#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA13	154664	genome.wustl.edu	37	7	48338055	48338055	+	Missense_Mutation	SNP	A	A	T	rs186758618		TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr7:48338055A>T	ENST00000435803.1	+	23	9316	c.9292A>T	c.(9292-9294)Att>Ttt	p.I3098F		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3098					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TATCCATAGCATTCTAGAAGC	0.423																																						dbGAP											0													148.0	139.0	142.0					7																	48338055		1917	4122	6039	-	-	-	SO:0001583	missense	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.9292A>T	7.37:g.48338055A>T	ENSP00000411096:p.Ile3098Phe		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.I3098F	ENST00000435803.1	37	c.9292	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	A	12.36	1.914253	0.33815	.	.	ENSG00000179869	ENST00000435803	D	0.89050	-2.46	5.47	-0.0978	0.13631	.	0.410116	0.20449	N	0.092127	D	0.84338	0.5450	L	0.34521	1.04	0.20764	N	0.999857	P;D	0.56521	0.919;0.976	P;P	0.52267	0.51;0.694	T	0.76173	-0.3056	10	0.87932	D	0	.	4.8224	0.13398	0.5312:0.3024:0.1665:0.0	.	800;3098	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	F	3098	ENSP00000411096:I3098F	ENSP00000411096:I3098F	I	+	1	0	ABCA13	48308601	0.004000	0.15560	0.001000	0.08648	0.008000	0.06430	-0.029000	0.12329	-0.241000	0.09681	0.533000	0.62120	ATT	ABCA13	-	NULL	ENSG00000179869		0.423	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	281	0.00	0	A	NM_152701		48338055	48338055	+1	no_errors	ENST00000435803	ensembl	human	known	69_37n	missense	343	39.54	225	SNP	0.006	T
ADRA2B	151	genome.wustl.edu	37	2	96780849	96780849	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr2:96780849C>T	ENST00000409345.3	-	1	1135	c.1040G>A	c.(1039-1041)gGt>gAt	p.G347D		NM_000682.5	NP_000673	P18089	ADA2B_HUMAN	adrenoceptor alpha 2B	347					activation of MAPK activity by adrenergic receptor signaling pathway (GO:0071883)|activation of protein kinase B activity (GO:0032148)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|MAPK cascade (GO:0000165)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of norepinephrine secretion (GO:0010700)|platelet activation (GO:0030168)|positive regulation of blood pressure (GO:0045777)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of vascular smooth muscle contraction (GO:0003056)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha2-adrenergic receptor activity (GO:0004938)|epinephrine binding (GO:0051379)			endometrium(2)|large_intestine(2)|lung(9)|ovary(3)	16					Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Apraclonidine(DB00964)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bethanidine(DB00217)|Brimonidine(DB00484)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Desipramine(DB01151)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Etomidate(DB00292)|Fenoldopam(DB00800)|Guanabenz(DB00629)|Guanfacine(DB01018)|Lisuride(DB00589)|Loxapine(DB00408)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Pramipexole(DB00413)|Prazosin(DB00457)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Tizanidine(DB00697)|Tolazoline(DB00797)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Yohimbine(DB01392)|Ziprasidone(DB00246)	ACCTATAGCACCCACGCCCCT	0.682																																						dbGAP											0													24.0	30.0	28.0					2																	96780849		2173	4258	6431	-	-	-	SO:0001583	missense	0			M34041	CCDS56129.1	2q11.1	2014-05-06	2012-05-09		ENSG00000222040	ENSG00000274286		"""GPCR / Class A : Adrenoceptors : alpha"""	282	protein-coding gene	gene with protein product		104260	"""adrenergic, alpha-2B-, receptor"""	ADRA2L1, ADRA2RL1		2164221	Standard	NM_000682		Approved	ADRARL1	uc021vlh.1	P18089	OTTHUMG00000188276	ENST00000409345.3:c.1040G>A	2.37:g.96780849C>T	ENSP00000387281:p.Gly347Asp		Q4TUH9|Q53RF2|Q9BZK0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Adren_rcpt_A2B,prints_7TM_GPCR_Rhodpsn,prints_Adrnrgc_rcpt	p.G347D	ENST00000409345.3	37	c.1040	CCDS56129.1	2	.	.	.	.	.	.	.	.	.	.	C	11.61	1.690544	0.29962	.	.	ENSG00000222040	ENST00000409345	T	0.61510	0.1	5.48	2.6	0.31112	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.49355	0.1552	L	0.50333	1.59	0.09310	N	1	B	0.15141	0.012	B	0.22152	0.038	T	0.42766	-0.9432	9	0.41790	T	0.15	.	7.3284	0.26567	0.0:0.4913:0.4119:0.0968	.	350	P18089	ADA2B_HUMAN	D	347	ENSP00000387281:G347D	ENSP00000387281:G347D	G	-	2	0	ADRA2B	96144576	0.478000	0.25917	0.012000	0.15200	0.921000	0.55340	1.018000	0.30002	0.687000	0.31509	0.449000	0.29647	GGT	ADRA2B	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Adren_rcpt_A2B	ENSG00000222040		0.682	ADRA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADRA2B	HGNC	protein_coding	OTTHUMT00000334990.1	33	0.00	0	C			96780849	96780849	-1	no_errors	ENST00000409345	ensembl	human	known	69_37n	missense	108	11.38	14	SNP	0.001	T
AP2M1	1173	genome.wustl.edu	37	3	183896904	183896904	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr3:183896904C>A	ENST00000292807.5	+	3	482	c.334C>A	c.(334-336)Ctg>Atg	p.L112M	AP2M1_ENST00000382456.3_Missense_Mutation_p.L112M|EIF2B5_ENST00000444495.1_Intron|AP2M1_ENST00000411763.2_Missense_Mutation_p.L137M|AP2M1_ENST00000439647.1_Missense_Mutation_p.L112M	NM_004068.3	NP_004059.2	Q96CW1	AP2M1_HUMAN	adaptor-related protein complex 2, mu 1 subunit	112					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of protein localization to plasma membrane (GO:1903077)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	18	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.92e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			ATATGAGCTGCTGGATGGTGA	0.547																																						dbGAP											0													86.0	89.0	88.0					3																	183896904		1991	4168	6159	-	-	-	SO:0001583	missense	0			U36188	CCDS43177.1, CCDS43178.1	3q28	2008-07-18			ENSG00000161203	ENSG00000161203			564	protein-coding gene	gene with protein product	"""clathrin-associated/assembly/adaptor protein, medium 1"", ""plasma membrane adaptor AP-2 50kDA protein"", ""clathrin coat adaptor protein AP50"", ""clathrin adaptor complex AP2, mu subunit"", ""HA2 50 kDA subunit"", ""clathrin assembly protein complex 2 medium chain"", ""AP-2 mu 2 chain"""	601024		CLAPM1		8595912	Standard	NM_004068		Approved	AP50, mu2	uc003fmw.3	Q96CW1	OTTHUMG00000156822	ENST00000292807.5:c.334C>A	3.37:g.183896904C>A	ENSP00000292807:p.Leu112Met		A6NE12|D3DNT1|P20172|P53679	Missense_Mutation	SNP	pfam_Clathrin_mu_C,pfam_AP_mu_sigma_su,superfamily_Clathrin_mu_C,superfamily_Longin-like_dom,pirsf_Clathrin_mu,pfscan_Clathrin_mu_C,prints_Clathrin_mu	p.L112M	ENST00000292807.5	37	c.334	CCDS43177.1	3	.	.	.	.	.	.	.	.	.	.	C	21.9	4.210373	0.79240	.	.	ENSG00000161203	ENST00000382456;ENST00000427072;ENST00000411763;ENST00000292807;ENST00000540821;ENST00000539646;ENST00000448139;ENST00000455925;ENST00000439647;ENST00000432591;ENST00000431779	T;T;T;T	0.80123	-1.29;-1.34;-1.24;-1.29	5.53	4.66	0.58398	Longin-like (1);AP complex, mu/sigma subunit (1);	0.000000	0.85682	D	0.000000	D	0.89832	0.6829	M	0.86740	2.835	0.80722	D	1	D;P;D	0.76494	0.999;0.949;0.998	D;P;P	0.66084	0.941;0.607;0.903	D	0.91002	0.4843	10	0.51188	T	0.08	.	14.7982	0.69894	0.0:0.931:0.0:0.069	.	112;137;112	Q96CW1;E9PFW3;Q96CW1-2	AP2M1_HUMAN;.;.	M	112;135;137;112;52;99;114;112;112;112;112	ENSP00000371894:L112M;ENSP00000403362:L137M;ENSP00000292807:L112M;ENSP00000409081:L112M	ENSP00000292807:L112M	L	+	1	2	AP2M1	185379598	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.627000	0.67784	1.575000	0.49775	0.655000	0.94253	CTG	AP2M1	-	pfam_AP_mu_sigma_su,superfamily_Longin-like_dom,pirsf_Clathrin_mu,prints_Clathrin_mu	ENSG00000161203		0.547	AP2M1-003	KNOWN	basic|CCDS	protein_coding	AP2M1	HGNC	protein_coding	OTTHUMT00000346013.1	113	0.00	0	C	NM_004068		183896904	183896904	+1	no_errors	ENST00000292807	ensembl	human	known	69_37n	missense	58	50.43	59	SNP	1.000	A
ARAP3	64411	genome.wustl.edu	37	5	141051178	141051178	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr5:141051178T>C	ENST00000239440.4	-	12	1878	c.1813A>G	c.(1813-1815)Aag>Gag	p.K605E	ARAP3_ENST00000508305.1_Missense_Mutation_p.K527E|ARAP3_ENST00000513878.1_Missense_Mutation_p.K267E	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	605	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						GGGTGGGGCTTCCGGAAGAGA	0.627																																						dbGAP											0													36.0	37.0	37.0					5																	141051178		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.1813A>G	5.37:g.141051178T>C	ENSP00000239440:p.Lys605Glu		B4DIT1|D3DQE3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ras-assoc,pfam_SAM_2,pfam_SAM_type1,superfamily_Rho_GTPase_activation_prot,superfamily_ArfGAP,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.K605E	ENST00000239440.4	37	c.1813	CCDS4266.1	5	.	.	.	.	.	.	.	.	.	.	T	16.41	3.115966	0.56505	.	.	ENSG00000120318	ENST00000508305;ENST00000239440;ENST00000513878	T;T;T	0.40756	1.02;2.72;2.72	3.44	2.26	0.28386	.	0.634047	0.14788	U	0.298367	T	0.36166	0.0957	L	0.47190	1.495	0.24101	N	0.99587	P;P;B	0.46220	0.776;0.874;0.425	P;B;B	0.45913	0.497;0.33;0.158	T	0.24333	-1.0163	10	0.62326	D	0.03	.	3.5509	0.07845	0.0:0.2196:0.2094:0.5709	.	267;527;605	B4DIT1;G5E9Y3;Q8WWN8	.;.;ARAP3_HUMAN	E	527;605;267	ENSP00000421826:K527E;ENSP00000239440:K605E;ENSP00000421468:K267E	ENSP00000239440:K605E	K	-	1	0	ARAP3	141031362	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.697000	0.47060	1.433000	0.47394	0.460000	0.39030	AAG	ARAP3	-	pfam_ArfGAP,superfamily_ArfGAP,smart_ArfGAP,pfscan_ArfGAP	ENSG00000120318		0.627	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP3	HGNC	protein_coding	OTTHUMT00000251805.1	28	0.00	0	T	NM_022481		141051178	141051178	-1	no_errors	ENST00000239440	ensembl	human	known	69_37n	missense	20	28.57	8	SNP	0.977	C
ASL	435	genome.wustl.edu	37	7	65547366	65547366	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr7:65547366G>C	ENST00000304874.9	+	4	321	c.219G>C	c.(217-219)gaG>gaC	p.E73D	ASL_ENST00000380839.4_Missense_Mutation_p.E73D|ASL_ENST00000395331.3_Missense_Mutation_p.E73D|ASL_ENST00000395332.3_Missense_Mutation_p.E73D	NM_000048.3	NP_000039.2	P04424	ARLY_HUMAN	argininosuccinate lyase	73					arginine biosynthetic process via ornithine (GO:0042450)|arginine catabolic process (GO:0006527)|cellular nitrogen compound metabolic process (GO:0034641)|internal protein amino acid acetylation (GO:0006475)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	argininosuccinate lyase activity (GO:0004056)			breast(3)|endometrium(3)|large_intestine(2)|lung(9)|upper_aerodigestive_tract(1)	18					L-Arginine(DB00125)	TGGCTGAGGAGTGGGCCCAGG	0.617																																						dbGAP											0													47.0	46.0	47.0					7																	65547366		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5531.1, CCDS47597.1, CCDS47598.1	7q11.21	2012-10-02			ENSG00000126522	ENSG00000126522	4.3.2.1		746	protein-coding gene	gene with protein product		608310					Standard	NM_001024943		Approved		uc003tuo.3	P04424	OTTHUMG00000022876	ENST00000304874.9:c.219G>C	7.37:g.65547366G>C	ENSP00000307188:p.Glu73Asp		E7EMI0|E9PE48|Q6LDS5|Q96HS2	Missense_Mutation	SNP	pfam_Lyase1_N,superfamily_L-Aspartase-like,prints_D_crystallin,prints_Fumarate_lyase,tigrfam_Argininosuccinate_lyase	p.E73D	ENST00000304874.9	37	c.219	CCDS5531.1	7	.	.	.	.	.	.	.	.	.	.	g	18.86	3.713927	0.68730	.	.	ENSG00000126522	ENST00000304874;ENST00000380839;ENST00000395332;ENST00000362000;ENST00000395331;ENST00000502022	D;D;D;D;D	0.99418	-5.87;-5.87;-5.87;-5.87;-5.87	4.76	1.79	0.24919	Lyase 1, N-terminal (1);L-Aspartase-like (1);	0.000000	0.85682	D	0.000000	D	0.98947	0.9642	L	0.55990	1.75	0.58432	D	0.999998	D;D;D;P;D	0.89917	0.999;1.0;1.0;0.606;0.999	D;D;D;B;D	0.97110	0.999;1.0;1.0;0.429;0.999	D	0.97704	1.0186	10	0.30854	T	0.27	.	7.0114	0.24865	0.4793:0.0:0.5207:0.0	.	73;53;73;73;73	B4DU69;Q6XYD2;E9PE48;E7EMI0;P04424	.;.;.;.;ARLY_HUMAN	D	73;73;73;8;73;53	ENSP00000307188:E73D;ENSP00000370219:E73D;ENSP00000378741:E73D;ENSP00000354710:E8D;ENSP00000378740:E73D	ENSP00000307188:E73D	E	+	3	2	ASL	65184801	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	1.718000	0.38001	0.559000	0.29153	-0.150000	0.13652	GAG	ASL	-	pfam_Lyase1_N,superfamily_L-Aspartase-like,tigrfam_Argininosuccinate_lyase	ENSG00000126522		0.617	ASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASL	HGNC	protein_coding	OTTHUMT00000251695.2	64	0.00	0	G	NM_000048		65547366	65547366	+1	no_errors	ENST00000304874	ensembl	human	known	69_37n	missense	104	18.46	24	SNP	1.000	C
ATP13A4	84239	genome.wustl.edu	37	3	193188758	193188758	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr3:193188758C>G	ENST00000342695.4	-	9	1155	c.833G>C	c.(832-834)cGc>cCc	p.R278P	ATP13A4_ENST00000295548.3_Missense_Mutation_p.R278P|ATP13A4_ENST00000392443.3_Missense_Mutation_p.R278P	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4	278						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		CACCAGGACGCGTGATTCCAG	0.448																																						dbGAP											0													148.0	146.0	146.0					3																	193188758		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.833G>C	3.37:g.193188758C>G	ENSP00000339182:p.Arg278Pro		B7WPC7|Q6UY23|Q8N1Q9|Q9H043	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_cation-exchng_asu,tigrfam_ATPase_P-typ_unknown-pump-sp,tigrfam_ATPase_P-typ_ion-transptr	p.R278P	ENST00000342695.4	37	c.833	CCDS3304.2	3	.	.	.	.	.	.	.	.	.	.	C	11.12	1.543910	0.27563	.	.	ENSG00000127249	ENST00000392443;ENST00000342695;ENST00000295548	D;D;D	0.91237	-2.81;-2.81;-2.81	5.44	1.66	0.24008	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.502926	0.20156	N	0.098060	D	0.92750	0.7695	M	0.63428	1.95	0.18873	N	0.999984	D;D	0.60575	0.988;0.983	D;D	0.69479	0.94;0.964	D	0.85488	0.1183	10	0.34782	T	0.22	-16.1724	10.9667	0.47416	0.0:0.6914:0.0:0.3086	.	278;278	Q4VNC1-2;Q4VNC1	.;AT134_HUMAN	P	278	ENSP00000376238:R278P;ENSP00000339182:R278P;ENSP00000295548:R278P	ENSP00000295548:R278P	R	-	2	0	ATP13A4	194671452	0.006000	0.16342	0.821000	0.32701	0.167000	0.22549	1.014000	0.29950	0.023000	0.15187	-0.961000	0.02630	CGC	ATP13A4	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_unknown-pump-sp,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000127249		0.448	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A4	HGNC	protein_coding	OTTHUMT00000157244.4	102	0.00	0	C	NM_032279		193188758	193188758	-1	no_errors	ENST00000342695	ensembl	human	known	69_37n	missense	96	17.95	21	SNP	0.294	G
AZGP1	563	genome.wustl.edu	37	7	99565858	99565858	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr7:99565858G>A	ENST00000292401.4	-	3	669	c.533C>T	c.(532-534)gCc>gTc	p.A178V	AZGP1_ENST00000411734.1_Missense_Mutation_p.A175V|AZGP1_ENST00000483612.1_5'Flank	NM_001185.3	NP_001176.1	P25311	ZA2G_HUMAN	alpha-2-glycoprotein 1, zinc-binding	178					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell adhesion (GO:0007155)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein transmembrane transport (GO:0071806)|retina homeostasis (GO:0001895)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|MHC class I protein complex (GO:0042612)|nucleus (GO:0005634)	glycoprotein binding (GO:0001948)|peptide antigen binding (GO:0042605)|protein transmembrane transporter activity (GO:0008320)|ribonuclease activity (GO:0004540)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|stomach(1)	16	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					GTAAGCCTTGGCCCGCTGCAC	0.542																																						dbGAP											0													107.0	103.0	104.0					7																	99565858		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC005306	CCDS5680.1	7q22.1	2013-01-11	2006-11-07		ENSG00000160862	ENSG00000160862		"""Immunoglobulin superfamily / C1-set domain containing"""	910	protein-coding gene	gene with protein product		194460	"""alpha-2-glycoprotein 1, zinc"""			2049092	Standard	NM_001185		Approved	ZA2G, ZAG	uc003ush.3	P25311	OTTHUMG00000023066	ENST00000292401.4:c.533C>T	7.37:g.99565858G>A	ENSP00000292401:p.Ala178Val		D6W5T8|O60386|Q5XKQ4|Q8N4N0	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like,prints_MHC_I_a_a1/a2	p.A178V	ENST00000292401.4	37	c.533	CCDS5680.1	7	.	.	.	.	.	.	.	.	.	.	G	7.671	0.686934	0.14973	.	.	ENSG00000160862	ENST00000292401;ENST00000411734	D;D	0.88586	-2.4;-2.4	2.76	0.426	0.16479	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.000000	0.31976	U	0.006773	D	0.86981	0.6064	L	0.31476	0.935	0.09310	N	1	D	0.89917	1.0	D	0.71870	0.975	T	0.77427	-0.2592	10	0.19147	T	0.46	.	7.5513	0.27798	0.0:0.0:0.3821:0.6179	.	178	P25311	ZA2G_HUMAN	V	178;175	ENSP00000292401:A178V;ENSP00000396093:A175V	ENSP00000292401:A178V	A	-	2	0	AZGP1	99403794	0.000000	0.05858	0.016000	0.15963	0.429000	0.31625	0.081000	0.14823	0.396000	0.25283	0.313000	0.20887	GCC	AZGP1	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	ENSG00000160862		0.542	AZGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AZGP1	HGNC	protein_coding	OTTHUMT00000059387.4	173	0.00	0	G	NM_001185		99565858	99565858	-1	no_errors	ENST00000292401	ensembl	human	known	69_37n	missense	175	46.85	156	SNP	0.000	A
BCORL1	63035	genome.wustl.edu	37	X	129147782	129147782	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chrX:129147782C>T	ENST00000218147.7	+	4	1231	c.1034C>T	c.(1033-1035)aCg>aTg	p.T345M	BCORL1_ENST00000540052.1_Missense_Mutation_p.T345M|BCORL1_ENST00000359304.2_Missense_Mutation_p.T345M|BCORL1_ENST00000303743.5_Missense_Mutation_p.T345M			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	345	Pro-rich.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						ccagcatccacgcctccagcg	0.672																																						dbGAP											0													32.0	30.0	30.0					X																	129147782		2088	4131	6219	-	-	-	SO:0001583	missense	0			AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.1034C>T	X.37:g.129147782C>T	ENSP00000218147:p.Thr345Met		B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.T345M	ENST00000218147.7	37	c.1034	CCDS14616.1	X	.	.	.	.	.	.	.	.	.	.	C	11.50	1.657837	0.29425	.	.	ENSG00000085185	ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052	T;T;T;T	0.45668	0.9;1.33;0.89;0.9	4.31	4.31	0.51392	.	0.000000	0.34484	N	0.003935	T	0.33352	0.0860	N	0.08118	0	0.24248	N	0.995334	D;D	0.76494	0.999;0.996	P;P	0.57324	0.818;0.512	T	0.09997	-1.0649	9	.	.	.	-9.1855	8.8317	0.35087	0.2236:0.7764:0.0:0.0	.	345;345	Q5H9F3-2;Q5H9F3	.;BCORL_HUMAN	M	345	ENSP00000218147:T345M;ENSP00000307541:T345M;ENSP00000352253:T345M;ENSP00000437775:T345M	.	T	+	2	0	BCORL1	128975463	0.508000	0.26154	0.994000	0.49952	0.648000	0.38561	2.444000	0.44890	2.140000	0.66376	0.523000	0.50628	ACG	BCORL1	-	NULL	ENSG00000085185		0.672	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCORL1	HGNC	protein_coding	OTTHUMT00000058223.1	113	0.00	0	C	NM_021946		129147782	129147782	+1	no_errors	ENST00000303743	ensembl	human	known	69_37n	missense	120	29.41	50	SNP	0.983	T
RP11-464F9.1	0	genome.wustl.edu	37	10	75482195	75482195	+	RNA	SNP	C	C	T			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr10:75482195C>T	ENST00000399449.3	-	0	647				RP11-574K11.28_ENST00000580790.1_RNA|BMS1P4_ENST00000584747.1_RNA																							TCTTTGTCTTCTTCAGTTGCT	0.358																																						dbGAP											0																																										-	-	-			0																															10.37:g.75482195C>T				RNA	SNP	-	NULL	ENST00000399449.3	37	NULL		10																																																																																			RP11-464F9.1	-	-	ENSG00000242288		0.358	RP11-464F9.1-001	KNOWN	basic|readthrough_transcript	processed_transcript	BMS1P4	Clone_based_vega_gene	processed_transcript	OTTHUMT00000048674.2	105	0.00	0	C			75482195	75482195	-1	no_errors	ENST00000399449	ensembl	human	known	69_37n	rna	104	57.83	144	SNP	0.998	T
BOD1L1	259282	genome.wustl.edu	37	4	13606196	13606196	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr4:13606196A>T	ENST00000040738.5	-	10	2463	c.2328T>A	c.(2326-2328)agT>agA	p.S776R		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	776	Lys-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)										TTGTTTGTTGACTTTGCTTTT	0.323																																						dbGAP											0													109.0	91.0	97.0					4																	13606196		2201	4298	6499	-	-	-	SO:0001583	missense	0			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.2328T>A	4.37:g.13606196A>T	ENSP00000040738:p.Ser776Arg		Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	NULL	p.S776R	ENST00000040738.5	37	c.2328	CCDS3411.2	4	.	.	.	.	.	.	.	.	.	.	A	15.80	2.939377	0.52972	.	.	ENSG00000038219	ENST00000040738	T	0.09073	3.02	5.54	3.12	0.35913	.	0.319429	0.24481	N	0.038156	T	0.07728	0.0194	L	0.29908	0.895	0.26349	N	0.977237	P	0.50272	0.933	P	0.44860	0.462	T	0.19128	-1.0315	10	0.37606	T	0.19	-1.2199	9.6117	0.39668	0.8579:0.0:0.1421:0.0	.	776	Q8NFC6	BOD1L_HUMAN	R	776	ENSP00000040738:S776R	ENSP00000040738:S776R	S	-	3	2	BOD1L	13215294	1.000000	0.71417	0.994000	0.49952	0.887000	0.51463	1.979000	0.40608	0.406000	0.25560	0.460000	0.39030	AGT	BOD1L1	-	NULL	ENSG00000038219		0.323	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	HGNC	protein_coding	OTTHUMT00000207321.1	412	0.00	0	A	NM_148894		13606196	13606196	-1	no_errors	ENST00000040738	ensembl	human	known	69_37n	missense	376	28.52	150	SNP	1.000	T
BRD9	65980	genome.wustl.edu	37	5	865540	865540	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr5:865540T>A	ENST00000467963.1	-	15	1848	c.1682A>T	c.(1681-1683)cAg>cTg	p.Q561L	BRD9_ENST00000483173.1_Missense_Mutation_p.Q508L|BRD9_ENST00000323510.4_Missense_Mutation_p.Q465L|BRD9_ENST00000388890.4_Missense_Mutation_p.Q445L	NM_023924.4	NP_076413.3	Q9H8M2	BRD9_HUMAN	bromodomain containing 9	561					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		lysine-acetylated histone binding (GO:0070577)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(3)	29			Epithelial(17;0.00202)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00815)|Lung(60;0.185)			CAGGTGGTGCTGGTCCCTCTC	0.652																																						dbGAP											0													77.0	74.0	75.0					5																	865540		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023503	CCDS34127.1, CCDS34128.1, CCDS34127.2, CCDS34128.2	5p15.33	2008-02-05			ENSG00000028310	ENSG00000028310			25818	protein-coding gene	gene with protein product						12477932	Standard	NM_023924		Approved	FLJ13441	uc003jbq.3	Q9H8M2	OTTHUMG00000159258	ENST00000467963.1:c.1682A>T	5.37:g.865540T>A	ENSP00000419765:p.Gln561Leu		A6NFY8|B4DMQ2|B4DR93|Q2XUS1|Q6UWU9|Q8IUS4|Q9H5Q5|Q9H7R9	Missense_Mutation	SNP	pfam_DUF3512,pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.Q561L	ENST00000467963.1	37	c.1682	CCDS34127.2	5	.	.	.	.	.	.	.	.	.	.	t	7.521	0.656611	0.14580	.	.	ENSG00000028310	ENST00000323510;ENST00000388890;ENST00000483173;ENST00000467963	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	5.24	-0.495	0.12030	.	0.393767	0.31601	N	0.007368	T	0.33381	0.0861	L	0.60455	1.87	0.80722	D	1	B;B;B;B	0.06786	0.001;0.0;0.0;0.0	B;B;B;B	0.09377	0.004;0.001;0.004;0.004	T	0.38286	-0.9668	10	0.02654	T	1	.	8.7909	0.34850	0.1195:0.0:0.4964:0.3841	.	508;561;465;445	B4DMQ2;Q9H8M2;Q9H8M2-1;Q9H8M2-3	.;BRD9_HUMAN;.;.	L	465;445;508;561	ENSP00000323557:Q465L;ENSP00000373542:Q445L;ENSP00000419845:Q508L;ENSP00000419765:Q561L	ENSP00000323557:Q465L	Q	-	2	0	BRD9	918540	0.986000	0.35501	0.014000	0.15608	0.961000	0.63080	1.842000	0.39250	-0.309000	0.08779	0.459000	0.35465	CAG	BRD9	-	NULL	ENSG00000028310		0.652	BRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRD9	HGNC	protein_coding	OTTHUMT00000354113.1	51	0.00	0	T	NM_023924		865540	865540	-1	no_errors	ENST00000467963	ensembl	human	known	69_37n	missense	69	26.60	25	SNP	0.993	A
TOPAZ1	375337	genome.wustl.edu	37	3	44283717	44283717	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr3:44283717C>A	ENST00000309765.4	+	1	340	c.172C>A	c.(172-174)Cct>Act	p.P58T		NM_001145030.1	NP_001138502.1	Q8N9V7	TOPZ1_HUMAN	testis and ovary specific PAZ domain containing 1	58						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)										CCGGGCCACCCCTGGGAGAGG	0.701																																						dbGAP											0													18.0	20.0	20.0					3																	44283717		692	1591	2283	-	-	-	SO:0001583	missense	0			AK093476	CCDS46809.1	3p21.33	2012-10-08	2012-10-08	2012-10-08	ENSG00000173769	ENSG00000173769			24746	protein-coding gene	gene with protein product		614412	"""chromosome 3 open reading frame 77"""	C3orf77		22069478	Standard	NM_001145030		Approved	FLJ36157	uc003cna.4	Q8N9V7	OTTHUMG00000156172	ENST00000309765.4:c.172C>A	3.37:g.44283717C>A	ENSP00000310303:p.Pro58Thr			Missense_Mutation	SNP	NULL	p.P58T	ENST00000309765.4	37	c.172	CCDS46809.1	3	.	.	.	.	.	.	.	.	.	.	C	8.891	0.953961	0.18431	.	.	ENSG00000173769	ENST00000309765	T	0.09445	2.98	3.58	1.22	0.21188	.	1.433080	0.05990	N	0.645894	T	0.07007	0.0178	N	0.19112	0.55	0.09310	N	1	B	0.28291	0.206	B	0.22601	0.04	T	0.39057	-0.9632	10	0.39692	T	0.17	.	4.9466	0.13993	0.0:0.2732:0.0:0.7268	.	58	Q8N9V7	CC077_HUMAN	T	58	ENSP00000310303:P58T	ENSP00000310303:P58T	P	+	1	0	C3orf77	44258721	0.000000	0.05858	0.003000	0.11579	0.015000	0.08874	-0.230000	0.09083	0.254000	0.21573	-0.469000	0.05056	CCT	C3orf77	-	NULL	ENSG00000173769		0.701	TOPAZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf77	HGNC	protein_coding	OTTHUMT00000343247.1	22	0.00	0	C	NM_001145030		44283717	44283717	+1	no_errors	ENST00000309765	ensembl	human	known	69_37n	missense	16	38.46	10	SNP	0.003	A
C7orf60	154743	genome.wustl.edu	37	7	112462311	112462311	+	Nonsense_Mutation	SNP	C	C	A			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr7:112462311C>A	ENST00000297145.4	-	5	871	c.706G>T	c.(706-708)Gag>Tag	p.E236*	C7orf60_ENST00000485446.1_5'Flank	NM_152556.2	NP_689769.2	Q1RMZ1	BMT2_HUMAN	chromosome 7 open reading frame 60	236							rRNA (adenine) methyltransferase activity (GO:0016433)			breast(1)|endometrium(2)|lung(7)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	17						TGGAAAAGCTCTCCAGGAAGA	0.423																																						dbGAP											0													43.0	44.0	44.0					7																	112462311		1833	4099	5932	-	-	-	SO:0001587	stop_gained	0				CCDS43634.1	7q31.1	2011-01-11	2008-06-19		ENSG00000164603	ENSG00000164603			26475	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31818"""						Standard	NM_152556		Approved	DKFZp762M126, FLJ31818	uc003vgo.1	Q1RMZ1	OTTHUMG00000155233	ENST00000297145.4:c.706G>T	7.37:g.112462311C>A	ENSP00000297145:p.Glu236*		Q8N3D0|Q96MV7	Nonsense_Mutation	SNP	pfam_DUF3321	p.E236*	ENST00000297145.4	37	c.706	CCDS43634.1	7	.	.	.	.	.	.	.	.	.	.	C	15.09	2.731394	0.48939	.	.	ENSG00000164603	ENST00000297145;ENST00000432572;ENST00000358032	.	.	.	5.78	5.78	0.91487	.	0.046733	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-13.64	20.0044	0.97430	0.0:1.0:0.0:0.0	.	.	.	.	X	236;218;183	.	ENSP00000297145:E236X	E	-	1	0	C7orf60	112249547	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.102000	0.64572	2.714000	0.92807	0.650000	0.86243	GAG	C7orf60	-	pfam_DUF3321	ENSG00000164603		0.423	C7orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf60	HGNC	protein_coding	OTTHUMT00000338923.1	72	0.00	0	C	NM_152556		112462311	112462311	-1	no_errors	ENST00000297145	ensembl	human	known	69_37n	nonsense	105	38.95	67	SNP	1.000	A
CCDC180	100499483	genome.wustl.edu	37	9	100092921	100092921	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr9:100092921C>G	ENST00000357054.1	+	32	3630	c.2695C>G	c.(2695-2697)Caa>Gaa	p.Q899E	RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000375202.2_Missense_Mutation_p.Q760E|CCDC180_ENST00000395220.1_3'UTR|CCDC180_ENST00000460482.2_3'UTR|CCDC180_ENST00000411667.2_Missense_Mutation_p.Q757E|CCDC180_ENST00000529487.1_Missense_Mutation_p.Q760E			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	899	Glu-rich.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											TGTGAAGGGTCAAGGAGAAAa	0.507																																						dbGAP											0													41.0	44.0	43.0					9																	100092921		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.2695C>G	9.37:g.100092921C>G	ENSP00000349562:p.Gln899Glu		Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	NULL	p.Q760E	ENST00000357054.1	37	c.2278		9	.	.	.	.	.	.	.	.	.	.	C	5.036	0.192387	0.09599	.	.	ENSG00000197816	ENST00000357054;ENST00000375202;ENST00000411667;ENST00000541524;ENST00000529487	T;T;T;T	0.08458	3.73;3.09;3.73;3.09	4.98	-0.911	0.10507	.	1.448820	0.03928	N	0.284832	T	0.07548	0.0190	L	0.36672	1.1	0.09310	N	1	B;B;B;B;B	0.06786	0.001;0.001;0.001;0.001;0.001	B;B;B;B;B	0.12156	0.007;0.007;0.004;0.007;0.004	T	0.42982	-0.9419	10	0.11485	T	0.65	2.8005	8.8211	0.35027	0.2683:0.3386:0.3931:0.0	.	783;757;899;760;899	Q86Y65;F5H149;B7ZMG3;Q9P1Z9-2;Q9P1Z9	.;.;.;.;CI174_HUMAN	E	899;760;757;783;760	ENSP00000349562:Q899E;ENSP00000364348:Q760E;ENSP00000414000:Q757E;ENSP00000434727:Q760E	ENSP00000349562:Q899E	Q	+	1	0	C9orf174	99132742	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.015000	0.13355	-0.245000	0.09625	0.555000	0.69702	CAA	C9orf174	-	NULL	ENSG00000197816		0.507	CCDC180-201	KNOWN	basic	protein_coding	C9orf174	HGNC	protein_coding		104	0.00	0	C	NM_020893		100092921	100092921	+1	no_errors	ENST00000375202	ensembl	human	known	69_37n	missense	77	33.04	38	SNP	0.000	G
CACNA1F	778	genome.wustl.edu	37	X	49076144	49076144	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chrX:49076144A>G	ENST00000376265.2	-	20	2586	c.2525T>C	c.(2524-2526)gTg>gCg	p.V842A	CACNA1F_ENST00000376251.1_Missense_Mutation_p.V777A|CACNA1F_ENST00000323022.5_Missense_Mutation_p.V831A|CACNA1F_ENST00000480889.1_5'Flank	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	842					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	GATGGGTACCACCTTCTCCTT	0.607																																						dbGAP											0													200.0	137.0	158.0					X																	49076144		2203	4300	6503	-	-	-	SO:0001583	missense	0			AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.2525T>C	X.37:g.49076144A>G	ENSP00000365441:p.Val842Ala		A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.V842A	ENST00000376265.2	37	c.2525	CCDS35253.1	X	.	.	.	.	.	.	.	.	.	.	.	6.048	0.377285	0.11466	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265	D;D;D	0.96200	-3.94;-3.87;-3.86	4.89	4.89	0.63831	.	0.377578	0.26816	N	0.022355	D	0.91456	0.7303	L	0.29908	0.895	0.41213	D	0.986452	P;P	0.44429	0.835;0.745	P;B	0.46339	0.513;0.315	D	0.89512	0.3772	10	0.02654	T	1	.	12.6021	0.56503	1.0:0.0:0.0:0.0	.	831;842	F5CIQ9;O60840	.;CAC1F_HUMAN	A	777;831;842	ENSP00000365427:V777A;ENSP00000321618:V831A;ENSP00000365441:V842A	ENSP00000321618:V831A	V	-	2	0	CACNA1F	48963088	0.082000	0.21442	1.000000	0.80357	0.843000	0.47879	3.132000	0.50523	1.612000	0.50221	0.407000	0.27541	GTG	CACNA1F	-	NULL	ENSG00000102001		0.607	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1F	HGNC	protein_coding	OTTHUMT00000358157.1	216	0.90	2	A	NM_005183		49076144	49076144	-1	no_errors	ENST00000376265	ensembl	human	known	69_37n	missense	318	22.38	92	SNP	1.000	G
CCNL2	81669	genome.wustl.edu	37	1	1328842	1328842	+	Splice_Site	SNP	T	T	C			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr1:1328842T>C	ENST00000400809.3	-	5	600		c.e5-2		CCNL2_ENST00000505849.1_5'Flank|CCNL2_ENST00000408952.5_Splice_Site|CCNL2_ENST00000408918.4_Splice_Site	NM_030937.4	NP_112199.2	Q96S94	CCNL2_HUMAN	cyclin L2						regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.03e-36)|OV - Ovarian serous cystadenocarcinoma(86;4.17e-22)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.0023)|BRCA - Breast invasive adenocarcinoma(365;0.00465)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.146)		AACGATTATCTGGAAGATACG	0.468																																						dbGAP											0													158.0	137.0	144.0					1																	1328842		2203	4296	6499	-	-	-	SO:0001630	splice_region_variant	0			AF251294	CCDS30557.1, CCDS30558.1	1p36.33	2014-07-03			ENSG00000221978	ENSG00000221978			20570	protein-coding gene	gene with protein product	"""cyclin S"""	613482	"""cyclin M"""	CCNM		14725631	Standard	NM_030937		Approved	ania-6b, PCEE, SB138, HLA-ISO, CCNS	uc001afi.2	Q96S94	OTTHUMG00000002917	ENST00000400809.3:c.595-2A>G	1.37:g.1328842T>C			A8K8A3|B1B152|Q5T2N5|Q5T2N6|Q6IQ12|Q7Z4Z8|Q8N3C9|Q8N3D5|Q8NHE3|Q8TEL0|Q96B00	Splice_Site	SNP	-	e5-2	ENST00000400809.3	37	c.595-2	CCDS30557.1	1	.	.	.	.	.	.	.	.	.	.	T	18.42	3.620895	0.66787	.	.	ENSG00000221978	ENST00000400809;ENST00000408918	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6621	0.68879	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	CCNL2	1318705	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.440000	0.80464	2.253000	0.74438	0.533000	0.62120	.	CCNL2	-	-	ENSG00000221978		0.468	CCNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNL2	HGNC	protein_coding	OTTHUMT00000008146.2	87	0.00	0	T	NM_030937	Intron	1328842	1328842	-1	no_errors	ENST00000400809	ensembl	human	known	69_37n	splice_site	32	75.76	100	SNP	1.000	C
CASQ2	845	genome.wustl.edu	37	1	116280870	116280870	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr1:116280870delG	ENST00000261448.5	-	4	746	c.507delC	c.(505-507)ggcfs	p.G169fs	CASQ2_ENST00000456138.2_Intron	NM_001232.3	NP_001223.2	O14958	CASQ2_HUMAN	calsequestrin 2 (cardiac muscle)	169					cardiac muscle contraction (GO:0060048)|cellular response to caffeine (GO:0071313)|detection of calcium ion (GO:0005513)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|protein polymerization (GO:0051258)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of heart rate (GO:0002027)|regulation of membrane repolarization (GO:0060306)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|sequestering of calcium ion (GO:0051208)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|junctional sarcoplasmic reticulum membrane (GO:0014701)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|skin(1)	18	Lung SC(450;0.211)	all_cancers(81;1.25e-06)|all_epithelial(167;1.02e-06)|all_lung(203;8.03e-06)|Lung NSC(69;5.01e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		TCTTGAAAAAGCCAATGAGTT	0.448																																						dbGAP											0													222.0	195.0	205.0					1																	116280870		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			BC022288	CCDS884.1	1p13.1	2014-09-17			ENSG00000118729	ENSG00000118729		"""Protein disulfide isomerases"""	1513	protein-coding gene	gene with protein product		114251				8406504	Standard	NM_001232		Approved	PDIB2	uc001efx.4	O14958	OTTHUMG00000011970	ENST00000261448.5:c.507delC	1.37:g.116280870delG	ENSP00000261448:p.Gly169fs		B2R7M6|B4DIB0|Q5T1D2|Q8TBW8	Frame_Shift_Del	DEL	pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Calsequestrin	p.F171fs	ENST00000261448.5	37	c.507	CCDS884.1	1																																																																																			CASQ2	-	pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Calsequestrin	ENSG00000118729		0.448	CASQ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASQ2	HGNC	protein_coding	OTTHUMT00000033091.1	206	0.00	0	G	NM_001232		116280870	116280870	-1	no_errors	ENST00000261448	ensembl	human	known	69_37n	frame_shift_del	246	32.31	126	DEL	1.000	-
CASQ1	844	genome.wustl.edu	37	1	160167383	160167383	+	Silent	SNP	G	G	A	rs375200941		TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr1:160167383G>A	ENST00000368078.3	+	7	1003	c.807G>A	c.(805-807)ccG>ccA	p.P269P	CASQ1_ENST00000467691.1_5'Flank|CASQ1_ENST00000368079.3_Silent_p.P263P			P31415	CASQ1_HUMAN	calsequestrin 1 (fast-twitch, skeletal muscle)	269					endoplasmic reticulum organization (GO:0007029)|ion transmembrane transport (GO:0034220)|protein polymerization (GO:0051258)|regulation of sequestering of calcium ion (GO:0051282)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to heat (GO:0009408)|response to organic substance (GO:0010033)|sarcomere organization (GO:0045214)|skeletal muscle tissue development (GO:0007519)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna lumen (GO:0014804)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(1)	21	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			AACTGAAGCCGGAGAGTATGT	0.547																																						dbGAP											0													113.0	111.0	111.0					1																	160167383		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			S73775	CCDS1198.1, CCDS1198.2	1q21	2011-10-19			ENSG00000143318	ENSG00000143318		"""Protein disulfide isomerases"""	1512	protein-coding gene	gene with protein product	"""calsequestrin 1, fast-twitch, skeletal muscle"", ""calmitine"""	114250		CASQ		8406504, 2321095	Standard	NM_001231		Approved	PDIB1	uc010pja.2	P31415	OTTHUMG00000031607	ENST00000368078.3:c.807G>A	1.37:g.160167383G>A			B1AKZ2|B2R863|Q8TBW7	Silent	SNP	pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Calsequestrin	p.P269	ENST00000368078.3	37	c.807	CCDS1198.2	1																																																																																			CASQ1	-	pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Calsequestrin	ENSG00000143318		0.547	CASQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASQ1	HGNC	protein_coding	OTTHUMT00000077412.1	123	0.00	0	G	NM_001231		160167383	160167383	+1	no_errors	ENST00000368078	ensembl	human	known	69_37n	silent	109	52.40	120	SNP	0.231	A
CD33	945	genome.wustl.edu	37	19	51728821	51728821	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr19:51728821T>C	ENST00000262262.4	+	2	406	c.385T>C	c.(385-387)Tac>Cac	p.Y129H	CD33_ENST00000436584.2_Intron|CD33_ENST00000391796.3_Missense_Mutation_p.Y129H|CD33_ENST00000421133.2_Intron	NM_001772.3	NP_001763.3	P20138	CD33_HUMAN	CD33 molecule	129	Ig-like V-type.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|negative regulation of cell proliferation (GO:0008285)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(15)|skin(1)|stomach(1)	24		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000224)|OV - Ovarian serous cystadenocarcinoma(262;0.00468)	Gemtuzumab ozogamicin(DB00056)	CAAATACAGTTACAAATCTCC	0.532																																						dbGAP											0													46.0	48.0	47.0					19																	51728821		2203	4299	6502	-	-	-	SO:0001583	missense	0			M23197	CCDS33084.1, CCDS46157.1, CCDS54299.1	19q13.3	2013-01-29	2006-03-28		ENSG00000105383	ENSG00000105383		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1659	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 3"""	159590	"""CD33 antigen (gp67)"""			3139766, 9465907	Standard	NM_001772		Approved	SIGLEC3, SIGLEC-3, p67, FLJ00391	uc002pwa.2	P20138		ENST00000262262.4:c.385T>C	19.37:g.51728821T>C	ENSP00000262262:p.Tyr129His		B4E3P8|C9JEN7|F8WAL2|Q8TD24	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,pfscan_Ig-like	p.Y129H	ENST00000262262.4	37	c.385	CCDS33084.1	19	.	.	.	.	.	.	.	.	.	.	.	14.16	2.451652	0.43531	.	.	ENSG00000105383	ENST00000262262;ENST00000391796	T;T	0.64438	-0.1;-0.1	2.85	2.85	0.33270	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.79776	0.4504	M	0.90082	3.085	0.21802	N	0.999539	D;D	0.76494	0.991;0.999	D;D	0.79784	0.979;0.993	T	0.66575	-0.5889	9	0.87932	D	0	.	7.4295	0.27120	0.0:0.0:0.0:1.0	.	129;129	F8WAL2;P20138	.;CD33_HUMAN	H	129	ENSP00000262262:Y129H;ENSP00000375673:Y129H	ENSP00000262262:Y129H	Y	+	1	0	CD33	56420633	0.005000	0.15991	0.002000	0.10522	0.002000	0.02628	1.400000	0.34577	1.316000	0.45131	0.533000	0.62120	TAC	CD33	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000105383		0.532	CD33-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD33	HGNC	protein_coding	OTTHUMT00000464199.2	38	0.00	0	T	NM_001772		51728821	51728821	+1	no_errors	ENST00000262262	ensembl	human	known	69_37n	missense	52	26.76	19	SNP	0.004	C
CDH11	1009	genome.wustl.edu	37	16	65025783	65025783	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr16:65025783G>C	ENST00000268603.4	-	6	1314	c.699C>G	c.(697-699)caC>caG	p.H233Q	CDH11_ENST00000566827.1_Missense_Mutation_p.H107Q|CDH11_ENST00000394156.3_Missense_Mutation_p.H233Q	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	233	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		GGATCACCACGTGGTACTCCT	0.512			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																												dbGAP		Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	0													272.0	179.0	211.0					16																	65025783		2203	4300	6503	-	-	-	SO:0001583	missense	0			D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.699C>G	16.37:g.65025783G>C	ENSP00000268603:p.His233Gln		A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.H233Q	ENST00000268603.4	37	c.699	CCDS10803.1	16	.	.	.	.	.	.	.	.	.	.	G	7.998	0.754841	0.15846	.	.	ENSG00000140937	ENST00000268603;ENST00000394156;ENST00000538390	T;T	0.51071	0.72;4.69	5.54	-5.36	0.02689	Cadherin (5);Cadherin-like (1);	0.097447	0.64402	D	0.000001	T	0.17238	0.0414	N	0.03071	-0.42	0.38556	D	0.949575	B;B	0.19200	0.034;0.001	B;B	0.12837	0.007;0.008	T	0.24512	-1.0158	10	0.09084	T	0.74	.	14.5072	0.67761	0.6201:0.0:0.3799:0.0	.	233;233	P55287-2;P55287	.;CAD11_HUMAN	Q	233;233;216	ENSP00000268603:H233Q;ENSP00000377711:H233Q	ENSP00000268603:H233Q	H	-	3	2	CDH11	63583284	0.000000	0.05858	0.933000	0.37362	0.995000	0.86356	-1.794000	0.01753	-0.863000	0.04084	-0.143000	0.13931	CAC	CDH11	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000140937		0.512	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH11	HGNC	protein_coding	OTTHUMT00000268755.1	257	0.00	0	G	NM_033664		65025783	65025783	-1	no_errors	ENST00000268603	ensembl	human	known	69_37n	missense	331	26.39	119	SNP	0.358	C
CHST9	83539	genome.wustl.edu	37	18	24496887	24496887	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr18:24496887C>G	ENST00000284224.8	-	6	945	c.668G>C	c.(667-669)gGc>gCc	p.G223A	AQP4-AS1_ENST00000568797.1_RNA|AQP4-AS1_ENST00000578701.1_RNA|AQP4-AS1_ENST00000582605.1_RNA|AQP4-AS1_ENST00000579964.1_RNA|CHST9_ENST00000580774.1_3'UTR|CHST9_ENST00000581714.1_Missense_Mutation_p.G223A	NM_031422.5	NP_113610.2	Q7L1S5	CHST9_HUMAN	carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9	223					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|hormone biosynthetic process (GO:0042446)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|skin(3)	28	all_lung(6;0.0145)|Ovarian(20;0.124)					ATTGGAACAGCCAGCCTTAGG	0.408																																						dbGAP											0													137.0	124.0	128.0					18																	24496887		1890	4116	6006	-	-	-	SO:0001583	missense	0			AF239821	CCDS42422.1, CCDS58618.1	18q11.2	2011-04-28			ENSG00000154080	ENSG00000154080		"""Sulfotransferases, membrane-bound"""	19898	protein-coding gene	gene with protein product		610191				11139592, 11445554	Standard	NM_031422		Approved	GALNAC4ST-2, GALNAC-4-ST2	uc002kwe.4	Q7L1S5		ENST00000284224.8:c.668G>C	18.37:g.24496887C>G	ENSP00000284224:p.Gly223Ala		Q6UX69|Q9BXH3|Q9BXH4|Q9BZW9	Missense_Mutation	SNP	pfam_Sulfotransferase	p.G223A	ENST00000284224.8	37	c.668	CCDS42422.1	18	.	.	.	.	.	.	.	.	.	.	C	6.377	0.437634	0.12104	.	.	ENSG00000154080	ENST00000284224	T	0.72835	-0.69	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.72851	0.3512	N	0.16708	0.43	0.80722	D	1	D	0.61080	0.989	D	0.67725	0.953	T	0.65471	-0.6160	10	0.12766	T	0.61	-14.4666	20.8598	0.99761	0.0:1.0:0.0:0.0	.	223	Q7L1S5	CHST9_HUMAN	A	223	ENSP00000284224:G223A	ENSP00000284224:G223A	G	-	2	0	CHST9	22750885	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	6.042000	0.70996	2.937000	0.99478	0.650000	0.86243	GGC	CHST9	-	pfam_Sulfotransferase	ENSG00000154080		0.408	CHST9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST9	HGNC	protein_coding	OTTHUMT00000446549.1	241	0.00	0	C	NM_031422		24496887	24496887	-1	no_errors	ENST00000284224	ensembl	human	known	69_37n	missense	88	82.62	423	SNP	1.000	G
COL18A1	80781	genome.wustl.edu	37	21	46897375	46897375	+	Missense_Mutation	SNP	C	C	T	rs551388856		TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr21:46897375C>T	ENST00000359759.4	+	6	2245	c.2224C>T	c.(2224-2226)Cgg>Tgg	p.R742W	COL18A1_ENST00000400337.2_Missense_Mutation_p.R327W|COL18A1_ENST00000355480.5_Missense_Mutation_p.R507W			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	742	Nonhelical region 1 (NC1).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CGGGAGTGTCCGGACCCCTGG	0.637																																						dbGAP											0													40.0	42.0	42.0					21																	46897375		1972	4147	6119	-	-	-	SO:0001583	missense	0				CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.2224C>T	21.37:g.46897375C>T	ENSP00000352798:p.Arg742Trp		A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Missense_Mutation	SNP	pfam_Collagenase_NC10/endostatin,pfam_DUF959_COL18_N,pfam_Collagen,pfam_Frizzled_dom,superfamily_C-type_lectin_fold,superfamily_ConA-like_lec_gl,superfamily_Frizzled_dom,smart_Frizzled_dom,smart_Laminin_G,pfscan_Frizzled_dom	p.R742W	ENST00000359759.4	37	c.2224		21	.	.	.	.	.	.	.	.	.	.	C	11.05	1.525137	0.27299	.	.	ENSG00000182871	ENST00000400337;ENST00000400347;ENST00000355480;ENST00000359759;ENST00000539645	D;D;D	0.90788	-2.71;-2.73;-2.62	3.06	-2.42	0.06542	.	4.291830	0.00654	N	0.000569	T	0.80752	0.4683	N	0.08118	0	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.04013	0.0;0.001;0.001	T	0.69533	-0.5120	10	0.48119	T	0.1	.	7.7104	0.28673	0.0:0.3862:0.0:0.6138	.	742;507;327	P39060;P39060-1;P39060-2	COIA1_HUMAN;.;.	W	327;327;507;742;742	ENSP00000383191:R327W;ENSP00000347665:R507W;ENSP00000352798:R742W	ENSP00000347665:R507W	R	+	1	2	COL18A1	45721803	0.000000	0.05858	0.000000	0.03702	0.098000	0.18820	-0.159000	0.10056	-0.569000	0.06030	-0.361000	0.07541	CGG	COL18A1	-	NULL	ENSG00000182871		0.637	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	COL18A1	HGNC	protein_coding	OTTHUMT00000206827.1	39	0.00	0	C			46897375	46897375	+1	no_errors	ENST00000359759	ensembl	human	known	69_37n	missense	97	17.65	21	SNP	0.000	T
CPA1	1357	genome.wustl.edu	37	7	130023284	130023284	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr7:130023284A>G	ENST00000011292.3	+	5	686	c.536A>G	c.(535-537)cAt>cGt	p.H179R	CPA1_ENST00000484324.1_Missense_Mutation_p.H91R	NM_001868.2	NP_001859.1	P15085	CBPA1_HUMAN	carboxypeptidase A1 (pancreatic)	179	Substrate binding.				proteolysis (GO:0006508)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(18;0.0435)					ACGGGCATCCATTCCCGGGAG	0.622																																						dbGAP											0													56.0	61.0	60.0					7																	130023284		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5820.1	7q32	2012-02-10			ENSG00000091704	ENSG00000091704	3.4.17.1		2296	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase A"""	114850		CPA			Standard	NM_001868		Approved		uc003vpx.3	P15085	OTTHUMG00000157826	ENST00000011292.3:c.536A>G	7.37:g.130023284A>G	ENSP00000011292:p.His179Arg		A4D1M1|Q53XU0|Q9BS67|Q9UCF2	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Prot_inh_M14A,superfamily_Prot_inh_propept,smart_Peptidase_M14,prints_Peptidase_M14	p.H179R	ENST00000011292.3	37	c.536	CCDS5820.1	7	.	.	.	.	.	.	.	.	.	.	A	16.14	3.038187	0.54896	.	.	ENSG00000091704	ENST00000481342;ENST00000011292;ENST00000476062;ENST00000484324	T;T;T;T	0.61510	0.1;0.1;0.1;0.1	5.58	4.4	0.53042	Peptidase M14, carboxypeptidase A (4);	0.000000	0.85682	D	0.000000	D	0.83792	0.5331	H	0.98466	4.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.981	D	0.87350	0.2337	10	0.87932	D	0	.	11.0634	0.47961	0.861:0.0:0.0:0.139	.	91;179	B4DDW9;P15085	.;CBPA1_HUMAN	R	91;179;91;91	ENSP00000420218:H91R;ENSP00000011292:H179R;ENSP00000419408:H91R;ENSP00000419497:H91R	ENSP00000011292:H179R	H	+	2	0	CPA1	129810520	1.000000	0.71417	0.989000	0.46669	0.108000	0.19459	8.962000	0.93254	0.902000	0.36520	0.528000	0.53228	CAT	CPA1	-	pfam_Peptidase_M14,smart_Peptidase_M14,prints_Peptidase_M14	ENSG00000091704		0.622	CPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPA1	HGNC	protein_coding	OTTHUMT00000349736.2	94	0.00	0	A	NM_001868		130023284	130023284	+1	no_errors	ENST00000011292	ensembl	human	known	69_37n	missense	132	40.54	90	SNP	1.000	G
CROCC	9696	genome.wustl.edu	37	1	17266458	17266458	+	Nonsense_Mutation	SNP	G	G	T	rs145642834	byFrequency	TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr1:17266458G>T	ENST00000375541.5	+	13	1747	c.1678G>T	c.(1678-1680)Gag>Tag	p.E560*	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		TAGCGACAGCGAGAGCGAGCG	0.697																																						dbGAP											0													44.0	42.0	42.0					1																	17266458		2199	4291	6490	-	-	-	SO:0001587	stop_gained	0			AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.1678G>T	1.37:g.17266458G>T	ENSP00000364691:p.Glu560*			Nonsense_Mutation	SNP	superfamily_Prefoldin,superfamily_t-SNARE	p.E560*	ENST00000375541.5	37	c.1678	CCDS30616.1	1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.428596	0.83667	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	.	.	.	4.89	4.89	0.63831	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	16.3533	0.83225	0.0:0.0:1.0:0.0	.	.	.	.	X	560;441	.	ENSP00000364691:E560X	E	+	1	0	CROCC	17139045	1.000000	0.71417	0.995000	0.50966	0.113000	0.19764	5.547000	0.67249	2.651000	0.90000	0.561000	0.74099	GAG	CROCC	-	NULL	ENSG00000058453		0.697	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CROCC	HGNC	protein_coding	OTTHUMT00000006249.2	14	0.00	0	G	NM_014675		17266458	17266458	+1	no_errors	ENST00000375541	ensembl	human	known	69_37n	nonsense	23	37.84	14	SNP	1.000	T
CYSLTR1	10800	genome.wustl.edu	37	X	77528833	77528833	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chrX:77528833C>A	ENST00000373304.3	-	3	703	c.411G>T	c.(409-411)caG>caT	p.Q137H		NM_001282187.1|NM_001282188.1|NM_006639.3	NP_001269116.1|NP_001269117.1|NP_006630.1	Q9Y271	CLTR1_HUMAN	cysteinyl leukotriene receptor 1	137					defense response (GO:0006952)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|respiratory gaseous exchange (GO:0007585)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	leukotriene receptor activity (GO:0004974)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	14					Cinalukast(DB00587)|Montelukast(DB00471)|Nedocromil(DB00716)|Pranlukast(DB01411)|Zafirlukast(DB00549)	TGGCTTTTTTCTGTGTAACCA	0.358																																						dbGAP											0													65.0	58.0	60.0					X																	77528833		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF119711	CCDS14439.1	Xq13-q21	2012-08-10			ENSG00000173198	ENSG00000173198		"""GPCR / Class A : Leukotriene receptors"""	17451	protein-coding gene	gene with protein product		300201				10391245, 10462554	Standard	NM_006639		Approved	CysLT1, CysLT(1), CYSLT1R	uc004edb.3	Q9Y271	OTTHUMG00000021889	ENST00000373304.3:c.411G>T	X.37:g.77528833C>A	ENSP00000362401:p.Gln137His		B2R954|D3DTE4|Q5JS94|Q8IV19	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfam_7TM_GPCR_serpentine_rcpt_Srv,prints_Cyst_leuk_rcpt,prints_CLT1_recept,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor,pfscan_GPCR_Rhodpsn_supfam	p.Q137H	ENST00000373304.3	37	c.411	CCDS14439.1	X	.	.	.	.	.	.	.	.	.	.	c	4.404	0.074657	0.08485	.	.	ENSG00000173198	ENST00000373304	T	0.72282	-0.64	4.45	3.58	0.41010	GPCR, rhodopsin-like superfamily (1);	0.393105	0.26582	N	0.023568	T	0.50292	0.1607	N	0.19112	0.55	0.31738	N	0.636128	B	0.02656	0.0	B	0.06405	0.002	T	0.49031	-0.8981	10	0.41790	T	0.15	.	4.952	0.14019	0.2082:0.6772:0.0:0.1146	.	137	Q9Y271	CLTR1_HUMAN	H	137	ENSP00000362401:Q137H	ENSP00000362401:Q137H	Q	-	3	2	CYSLTR1	77415489	0.999000	0.42202	1.000000	0.80357	0.967000	0.64934	0.787000	0.26858	0.678000	0.31325	0.452000	0.29995	CAG	CYSLTR1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfam_7TM_GPCR_serpentine_rcpt_Srv,prints_Cyst_leuk_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000173198		0.358	CYSLTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYSLTR1	HGNC	protein_coding	OTTHUMT00000057315.1	172	0.00	0	C			77528833	77528833	-1	no_errors	ENST00000373304	ensembl	human	known	69_37n	missense	248	47.23	222	SNP	0.997	A
DENND5B	160518	genome.wustl.edu	37	12	31551140	31551140	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr12:31551140C>G	ENST00000389082.5	-	17	3489	c.3225G>C	c.(3223-3225)ttG>ttC	p.L1075F	RNU6-618P_ENST00000363518.1_RNA|DENND5B_ENST00000306833.6_Missense_Mutation_p.L1110F|DENND5B_ENST00000536562.1_Missense_Mutation_p.L1110F	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	1075					positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						AAGTGATGCTCAATCTCCTAG	0.403																																						dbGAP											0													57.0	53.0	54.0					12																	31551140		1927	4136	6063	-	-	-	SO:0001583	missense	0			AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.3225G>C	12.37:g.31551140C>G	ENSP00000373734:p.Leu1075Phe		B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Missense_Mutation	SNP	pfam_DENN_dom,pfam_Run,pfam_uDENN_dom,pfam_dDENN_dom,pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,smart_Run,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,pfscan_LipOase_LH2,pfscan_Run	p.L1110F	ENST00000389082.5	37	c.3330	CCDS44857.1	12	.	.	.	.	.	.	.	.	.	.	C	5.682	0.310320	0.10733	.	.	ENSG00000170456	ENST00000389082;ENST00000306833;ENST00000536562	T;T;T	0.04119	3.7;3.8;3.8	4.16	-1.93	0.07594	.	0.107599	0.38837	N	0.001541	T	0.02807	0.0084	L	0.33485	1.01	0.41655	D	0.989154	B;B	0.11235	0.002;0.004	B;B	0.12156	0.003;0.007	T	0.49688	-0.8913	10	0.09590	T	0.72	-25.103	5.7642	0.18217	0.0:0.4857:0.2405:0.2738	.	1075;1110	Q6ZUT9;G3V1S3	DEN5B_HUMAN;.	F	1075;1110;1110	ENSP00000373734:L1075F;ENSP00000306482:L1110F;ENSP00000444889:L1110F	ENSP00000306482:L1110F	L	-	3	2	DENND5B	31442407	0.028000	0.19301	0.877000	0.34402	0.843000	0.47879	-0.737000	0.04877	-0.492000	0.06687	0.563000	0.77884	TTG	DENND5B	-	NULL	ENSG00000170456		0.403	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND5B	HGNC	protein_coding	OTTHUMT00000402040.1	159	0.00	0	C	NM_144973		31551140	31551140	-1	no_errors	ENST00000306833	ensembl	human	known	69_37n	missense	289	29.85	123	SNP	0.868	G
DHX30	22907	genome.wustl.edu	37	3	47889002	47889002	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr3:47889002G>T	ENST00000445061.1	+	13	2493	c.2086G>T	c.(2086-2088)Gag>Tag	p.E696*	MIR1226_ENST00000408658.1_RNA|DHX30_ENST00000348968.4_Nonsense_Mutation_p.E668*|DHX30_ENST00000446256.2_Nonsense_Mutation_p.E657*|DHX30_ENST00000457607.1_Nonsense_Mutation_p.E724*	NM_138615.2	NP_619520.1	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 30	696	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|large_intestine(11)|lung(13)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	37				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		GGGCATGCACGAGAGCAAGTA	0.637																																						dbGAP											0													26.0	27.0	27.0					3																	47889002		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0			AB020697	CCDS2759.1	3p24.3-p22.1	2013-07-16	2013-07-16	2003-06-13	ENSG00000132153	ENSG00000132153		"""DEAH-boxes"""	16716	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 30"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 30"""	DDX30		10048485, 18022663	Standard	NM_138615		Approved	KIAA0890, FLJ11214	uc003cru.3	Q7L2E3	OTTHUMG00000133522	ENST00000445061.1:c.2086G>T	3.37:g.47889002G>T	ENSP00000405620:p.Glu696*		A8K5F1|O94965|Q7Z753|Q96CH4|Q9NUQ0	Nonsense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_DUF1605,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E696*	ENST00000445061.1	37	c.2086	CCDS2759.1	3	.	.	.	.	.	.	.	.	.	.	G	42	9.185209	0.99092	.	.	ENSG00000132153	ENST00000446256;ENST00000445061;ENST00000348968;ENST00000457607	.	.	.	5.16	5.16	0.70880	.	0.291026	0.35124	N	0.003436	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	.	7.557	0.27829	0.1839:0.0:0.8161:0.0	.	.	.	.	X	657;696;668;724	.	ENSP00000343442:E668X	E	+	1	0	DHX30	47864006	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.816000	0.55658	2.378000	0.81104	0.563000	0.77884	GAG	DHX30	-	smart_Helicase_C,pfscan_Helicase_C	ENSG00000132153		0.637	DHX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DHX30	HGNC	protein_coding	OTTHUMT00000257495.2	43	0.00	0	G	NM_138615		47889002	47889002	+1	no_errors	ENST00000445061	ensembl	human	known	69_37n	nonsense	31	34.04	16	SNP	0.877	T
DKK3	27122	genome.wustl.edu	37	11	12023920	12023920	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr11:12023920C>T	ENST00000396505.2	-	3	516	c.278G>A	c.(277-279)aGc>aAc	p.S93N	DKK3_ENST00000525493.1_Missense_Mutation_p.S93N|DKK3_ENST00000527132.1_Intron|DKK3_ENST00000326932.4_Missense_Mutation_p.S93N|DKK3_ENST00000450094.2_Missense_Mutation_p.S93N	NM_015881.5	NP_056965.3	Q9UBP4	DKK3_HUMAN	dickkopf WNT signaling pathway inhibitor 3	93					adrenal gland development (GO:0030325)|anatomical structure morphogenesis (GO:0009653)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of transcription, DNA-templated (GO:0045892)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)				breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|pancreas(1)	8				Epithelial(150;0.000502)		ATTGTGATAGCTGGGAGGTAA	0.418																																						dbGAP											0													292.0	244.0	260.0					11																	12023920		2201	4294	6495	-	-	-	SO:0001583	missense	0			AF177396	CCDS7808.1	11p15.3	2013-05-15	2013-05-15		ENSG00000050165	ENSG00000050165			2893	protein-coding gene	gene with protein product	"""regulated in glioma"""	605416	"""dickkopf (Xenopus laevis) homolog 3"", ""dickkopf 3 homolog (Xenopus laevis)"""			10570958	Standard	XM_006718177		Approved	REIC, RIG	uc001mjv.3	Q9UBP4	OTTHUMG00000165709	ENST00000396505.2:c.278G>A	11.37:g.12023920C>T	ENSP00000379762:p.Ser93Asn		A8K1I2|D3DQW1|Q9ULB7	Missense_Mutation	SNP	pfam_Dickkopf_N	p.S93N	ENST00000396505.2	37	c.278	CCDS7808.1	11	.	.	.	.	.	.	.	.	.	.	C	5.215	0.225218	0.09916	.	.	ENSG00000050165	ENST00000396505;ENST00000326932;ENST00000366345;ENST00000525493;ENST00000450094;ENST00000533813;ENST00000534511;ENST00000529338	T;T;T;T;T;T;T	0.41400	2.5;2.5;2.51;1.59;2.19;1.0;1.1	5.55	-2.17	0.07059	.	0.519951	0.22278	N	0.062170	T	0.09992	0.0245	N	0.02403	-0.565	0.23893	N	0.996544	B;B;B;B	0.06786	0.001;0.001;0.001;0.0	B;B;B;B	0.06405	0.002;0.001;0.002;0.001	T	0.23261	-1.0193	10	0.02654	T	1	-8.5843	1.2082	0.01899	0.1408:0.1828:0.279:0.3974	.	93;93;93;93	F6SYF8;E7EUD0;B4DI69;Q9UBP4	.;.;.;DKK3_HUMAN	N	93;93;36;93;93;93;93;93	ENSP00000379762:S93N;ENSP00000314910:S93N;ENSP00000433112:S93N;ENSP00000398365:S93N;ENSP00000435269:S93N;ENSP00000436645:S93N;ENSP00000431604:S93N	ENSP00000314910:S93N	S	-	2	0	DKK3	11980496	0.485000	0.25972	0.986000	0.45419	0.983000	0.72400	-0.726000	0.04936	-0.200000	0.10300	0.655000	0.94253	AGC	DKK3	-	NULL	ENSG00000050165		0.418	DKK3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DKK3	HGNC	protein_coding	OTTHUMT00000385863.1	427	0.00	0	C	NM_013253		12023920	12023920	-1	no_errors	ENST00000326932	ensembl	human	known	69_37n	missense	378	36.04	213	SNP	0.978	T
DST	667	genome.wustl.edu	37	6	56473155	56473155	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr6:56473155A>C	ENST00000361203.3	-	36	5645	c.5638T>G	c.(5638-5640)Ttg>Gtg	p.L1880V	DST_ENST00000370788.2_Intron|DST_ENST00000370754.5_Missense_Mutation_p.L2058V|DST_ENST00000312431.6_Missense_Mutation_p.L1880V|DST_ENST00000244364.6_Intron|DST_ENST00000370769.4_Missense_Mutation_p.L1880V|DST_ENST00000421834.2_Intron|DST_ENST00000446842.2_Missense_Mutation_p.L1554V			Q03001	DYST_HUMAN	dystonin	1880					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TTTGTAATCAATTCTTGCTGC	0.428																																						dbGAP											0													120.0	114.0	116.0					6																	56473155		1847	4096	5943	-	-	-	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.5638T>G	6.37:g.56473155A>C	ENSP00000354508:p.Leu1880Val		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.L2058V	ENST00000361203.3	37	c.6172		6	.	.	.	.	.	.	.	.	.	.	A	12.93	2.085813	0.36758	.	.	ENSG00000151914	ENST00000370754;ENST00000370769;ENST00000446842;ENST00000312431;ENST00000361203;ENST00000439203	T;T;T;T;T;T	0.81163	-1.46;-1.46;-1.46;-1.46;-1.46;-1.46	5.52	0.429	0.16506	.	0.159880	0.28914	N	0.013733	T	0.61813	0.2377	.	.	.	0.27185	N	0.960568	B	0.31790	0.34	B	0.40901	0.343	T	0.55328	-0.8158	8	0.62326	D	0.03	.	4.3772	0.11275	0.4695:0.0:0.3117:0.2187	.	1554	Q03001-9	.	V	2058;1880;1554;1880;1880;1554	ENSP00000359790:L2058V;ENSP00000359805:L1880V;ENSP00000393645:L1554V;ENSP00000307959:L1880V;ENSP00000354508:L1880V;ENSP00000404924:L1554V	ENSP00000307959:L1880V	L	-	1	2	DST	56581114	0.191000	0.23288	0.084000	0.20598	0.979000	0.70002	0.766000	0.26560	-0.140000	0.11394	0.374000	0.22700	TTG	DST	-	pfam_Plectin_repeat,superfamily_ABC_transptrTM_dom_typ1,smart_Plectin_repeat	ENSG00000151914		0.428	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	222	0.00	0	A	NM_001723		56473155	56473155	-1	no_errors	ENST00000370754	ensembl	human	known	69_37n	missense	247	32.88	121	SNP	0.046	C
EIF3M	10480	genome.wustl.edu	37	11	32608625	32608625	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr11:32608625G>C	ENST00000531120.1	+	2	173	c.110G>C	c.(109-111)gGa>gCa	p.G37A	EIF3M_ENST00000532054.1_3'UTR|EIF3M_ENST00000524896.1_Intron	NM_006360.4	NP_006351.2			eukaryotic translation initiation factor 3, subunit M											breast(3)|endometrium(4)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	16	Breast(20;0.109)					TCGGAAGGTGGACTTCATGTT	0.358																																						dbGAP											0													133.0	139.0	137.0					11																	32608625		2202	4299	6501	-	-	-	SO:0001583	missense	0			AK131064	CCDS7880.1	11p13	2012-12-13	2007-07-27	2007-07-27	ENSG00000149100	ENSG00000149100			24460	protein-coding gene	gene with protein product	"""transport and golgi organization 7 homolog (Drosophila)"""	609641	"""PCI domain containing 1 (herpesvirus entry mediator)"""	PCID1		15919898, 15919899	Standard	NM_006360		Approved	hfl-B5, FLJ29030, GA17, eIF3m, TANGO7	uc001mtu.4	Q7L2H7	OTTHUMG00000166258	ENST00000531120.1:c.110G>C	11.37:g.32608625G>C	ENSP00000436049:p.Gly37Ala			Missense_Mutation	SNP	pfam_PCI_dom,superfamily_ARM-type_fold,smart_PCI_dom	p.G37A	ENST00000531120.1	37	c.110	CCDS7880.1	11	.	.	.	.	.	.	.	.	.	.	G	17.30	3.354762	0.61293	.	.	ENSG00000149100	ENST00000531120	T	0.31247	1.5	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.50103	0.1596	M	0.68593	2.085	0.80722	D	1	D	0.56968	0.978	P	0.55303	0.773	T	0.52328	-0.8590	10	0.72032	D	0.01	-23.7579	19.2741	0.94023	0.0:0.0:1.0:0.0	.	37	Q7L2H7	EIF3M_HUMAN	A	37	ENSP00000436049:G37A	ENSP00000432286:G37A	G	+	2	0	EIF3M	32565201	1.000000	0.71417	1.000000	0.80357	0.238000	0.25445	9.476000	0.97823	2.558000	0.86282	0.655000	0.94253	GGA	EIF3M	-	NULL	ENSG00000149100		0.358	EIF3M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3M	HGNC	protein_coding	OTTHUMT00000388762.2	271	0.00	0	G	NM_006360		32608625	32608625	+1	no_errors	ENST00000531120	ensembl	human	known	69_37n	missense	96	64.96	178	SNP	1.000	C
CCSER2	54462	genome.wustl.edu	37	10	86198279	86198279	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr10:86198279A>T	ENST00000224756.8	+	6	2065	c.1880A>T	c.(1879-1881)tAt>tTt	p.Y627F	CCSER2_ENST00000494144.1_Intron|CCSER2_ENST00000372088.2_Missense_Mutation_p.Y627F|CCSER2_ENST00000543283.1_Missense_Mutation_p.Y54F	NM_001284243.1|NM_018999.2	NP_001271172.1|NP_061872.2	Q9H7U1	CCSE2_HUMAN	coiled-coil serine-rich protein 2	627					microtubule bundle formation (GO:0001578)	microtubule cytoskeleton (GO:0015630)											GGCTCTCCCTATAGAGAATCT	0.388																																						dbGAP											0													95.0	91.0	93.0					10																	86198279		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31235.1, CCDS60582.1, CCDS60583.1, CCDS73159.1	10q23.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000107771	ENSG00000107771			29197	protein-coding gene	gene with protein product			"""KIAA1128"", ""family with sequence similarity 190, member B"""	KIAA1128, FAM190B		10574461	Standard	XM_005269905		Approved		uc001kdh.1	Q9H7U1	OTTHUMG00000018641	ENST00000224756.8:c.1880A>T	10.37:g.86198279A>T	ENSP00000224756:p.Tyr627Phe		B4DFY4|B4DQU9|B7WPE8|D3DWE2|Q8N6E9|Q9H2S0|Q9ULU1	Missense_Mutation	SNP	NULL	p.Y627F	ENST00000224756.8	37	c.1880	CCDS31235.1	10	.	.	.	.	.	.	.	.	.	.	A	22.1	4.242234	0.79912	.	.	ENSG00000107771	ENST00000224756;ENST00000372088;ENST00000543283	T;T;T	0.28069	2.13;2.06;1.63	5.83	5.83	0.93111	.	0.106277	0.42294	D	0.000724	T	0.46347	0.1388	L	0.60455	1.87	0.45403	D	0.998389	D;P	0.62365	0.991;0.899	P;P	0.58130	0.833;0.6	T	0.34329	-0.9833	10	0.41790	T	0.15	-23.3358	14.1488	0.65367	1.0:0.0:0.0:0.0	.	627;627	Q9H7U1-3;Q9H7U1	.;F190B_HUMAN	F	627;627;54	ENSP00000224756:Y627F;ENSP00000361160:Y627F;ENSP00000439944:Y54F	ENSP00000224756:Y627F	Y	+	2	0	FAM190B	86188259	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.509000	0.60448	2.225000	0.72522	0.533000	0.62120	TAT	FAM190B	-	NULL	ENSG00000107771		0.388	CCSER2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM190B	HGNC	protein_coding	OTTHUMT00000049132.2	212	0.00	0	A	NM_018999		86198279	86198279	+1	no_errors	ENST00000372088	ensembl	human	known	69_37n	missense	236	21.85	66	SNP	1.000	T
FAM46A	55603	genome.wustl.edu	37	6	82461445	82461445	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr6:82461445C>G	ENST00000320172.6	-	2	728	c.414G>C	c.(412-414)aaG>aaC	p.K138N	FAM46A_ENST00000369756.3_Missense_Mutation_p.K219N|FAM46A_ENST00000369754.3_Missense_Mutation_p.K157N	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	138					regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		GGTCCAGGTCCTTGTAGCCCA	0.662																																						dbGAP											0													63.0	62.0	62.0					6																	82461445		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.414G>C	6.37:g.82461445C>G	ENSP00000318298:p.Lys138Asn		A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	Missense_Mutation	SNP	pfam_DUF1693	p.K219N	ENST00000320172.6	37	c.657	CCDS34489.1	6	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	19.26|19.26|19.26	3.793389|3.793389|3.793389	0.70452|0.70452|0.70452	.|.|.	.|.|.	ENSG00000112773|ENSG00000112773|ENSG00000112773	ENST00000412306|ENST00000369754;ENST00000320172;ENST00000369756|ENST00000423467	.|T;T;T|.	.|0.24723|.	.|1.84;1.84;1.84|.	5.5|5.5|5.5	3.75|3.75|3.75	0.43078|0.43078|0.43078	.|Domain of unknown function DUF1693 (1);|.	.|0.125530|.	.|0.64402|.	.|D|.	.|0.000001|.	T|T|T	0.42562|0.42562|0.42562	0.1208|0.1208|0.1208	L|L|L	0.48362|0.48362|0.48362	1.52|1.52|1.52	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|D;D|.	.|0.67145|.	.|0.996;0.995|.	.|D;D|.	.|0.67382|.	.|0.951;0.919|.	T|T|T	0.34403|0.34403|0.34403	-0.9830|-0.9830|-0.9830	5|10|5	.|0.06625|.	.|T|.	.|0.88|.	-20.1766|-20.1766|-20.1766	9.1698|9.1698|9.1698	0.37074|0.37074|0.37074	0.0:0.7788:0.0:0.2212|0.0:0.7788:0.0:0.2212|0.0:0.7788:0.0:0.2212	.|.|.	.|138;157|.	.|Q96IP4;Q96IP4-2|.	.|FA46A_HUMAN;.|.	R|N|T	29|157;138;219|9	.|ENSP00000358769:K157N;ENSP00000318298:K138N;ENSP00000358771:K219N|.	.|ENSP00000318298:K138N|.	G|K|R	-|-|-	1|3|2	0|2|0	FAM46A|FAM46A|FAM46A	82518164|82518164|82518164	0.998000|0.998000|0.998000	0.40836|0.40836|0.40836	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.973000|0.973000|0.973000	0.67179|0.67179|0.67179	0.648000|0.648000|0.648000	0.24828|0.24828|0.24828	0.895000|0.895000|0.895000	0.36342|0.36342|0.36342	-0.136000|-0.136000|-0.136000	0.14681|0.14681|0.14681	GGA|AAG|AGG	FAM46A	-	pfam_DUF1693	ENSG00000112773		0.662	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM46A	HGNC	protein_coding	OTTHUMT00000041331.1	15	0.00	0	C			82461445	82461445	-1	no_errors	ENST00000369756	ensembl	human	known	69_37n	missense	16	51.52	17	SNP	1.000	G
FAM65C	140876	genome.wustl.edu	37	20	49208955	49208955	+	Missense_Mutation	SNP	C	C	G	rs77093450	byFrequency	TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr20:49208955C>G	ENST00000327979.2	-	19	2902	c.2491G>C	c.(2491-2493)Ggc>Cgc	p.G831R	FAM65C_ENST00000535356.1_Missense_Mutation_p.G835R|FAM65C_ENST00000462842.1_5'Flank|FAM65C_ENST00000045083.2_Missense_Mutation_p.G831R			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	831										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CTCGGAGTGCCGTCCAGCTGG	0.672																																						dbGAP											0													32.0	36.0	34.0					20																	49208955		1970	4144	6114	-	-	-	SO:0001583	missense	0			AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.2491G>C	20.37:g.49208955C>G	ENSP00000332663:p.Gly831Arg		Q5QPB6|Q9NQQ2	Missense_Mutation	SNP	superfamily_ARM-type_fold,superfamily_Chemokine_IL8-like_dom	p.G835R	ENST00000327979.2	37	c.2503	CCDS13431.2	20	.	.	.	.	.	.	.	.	.	.	C	20.2	3.948982	0.73787	.	.	ENSG00000042062	ENST00000327979;ENST00000045083;ENST00000535356	T;T;T	0.77750	-1.12;-1.12;-1.12	4.81	4.81	0.61882	.	0.941590	0.08689	U	0.908334	D	0.83631	0.5296	L	0.54323	1.7	0.38977	D	0.958862	P;D	0.60575	0.767;0.988	P;P	0.54460	0.457;0.753	T	0.80120	-0.1515	10	0.39692	T	0.17	-29.6403	17.893	0.88878	0.0:1.0:0.0:0.0	.	835;831	F5H0X2;Q96MK2	.;FA65C_HUMAN	R	831;831;835	ENSP00000332663:G831R;ENSP00000045083:G831R;ENSP00000439802:G835R	ENSP00000045083:G831R	G	-	1	0	FAM65C	48642362	0.928000	0.31464	0.978000	0.43139	0.640000	0.38277	3.910000	0.56371	2.216000	0.71823	0.462000	0.41574	GGC	FAM65C	-	superfamily_ARM-type_fold	ENSG00000042062		0.672	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM65C	HGNC	protein_coding	OTTHUMT00000257962.1	24	0.00	0	C			49208955	49208955	-1	no_errors	ENST00000535356	ensembl	human	known	69_37n	missense	11	62.07	18	SNP	0.984	G
FAM92A1P2	403315	genome.wustl.edu	37	4	183959891	183959891	+	RNA	SNP	A	A	T	rs1075694	byFrequency	TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr4:183959891A>T	ENST00000502308.1	+	0	1074					NR_003612.1				family with sequence similarity 92, member A1 pseudogene 2																		CAATGGATGCAACCCGAACAA	0.428													T|||	1800	0.359425	0.2421	0.4207	5008	,	,		18131	0.3403		0.3559	False		,,,				2504	0.498					dbGAP											0																																										-	-	-			0			BC022019		4q35.1	2012-04-19	2012-04-19	2012-04-19	ENSG00000230219	ENSG00000230219			32287	pseudogene	pseudogene			"""family with sequence similarity 92, member A3"""	FAM92A3		12477932	Standard	NR_003612		Approved	MGC71735, MGC102964	uc003ivi.4		OTTHUMG00000160675		4.37:g.183959891A>T				RNA	SNP	-	NULL	ENST00000502308.1	37	NULL		4																																																																																			FAM92A1P2	-	-	ENSG00000230219		0.428	FAM92A1P2-002	KNOWN	basic	processed_transcript	FAM92A1P2	HGNC	pseudogene	OTTHUMT00000361814.1	42	0.00	0	A			183959891	183959891	+1	no_errors	ENST00000502308	ensembl	human	known	69_37n	rna	32	15.79	6	SNP	0.950	T
FIG4	9896	genome.wustl.edu	37	6	110107520	110107520	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr6:110107520A>T	ENST00000230124.3	+	18	2088	c.1964A>T	c.(1963-1965)aAc>aTc	p.N655I	FIG4_ENST00000441478.2_Missense_Mutation_p.N378I	NM_014845.5	NP_055660.1	Q92562	FIG4_HUMAN	FIG4 phosphoinositide 5-phosphatase	655					cell death (GO:0008219)|locomotory behavior (GO:0007626)|myelin assembly (GO:0032288)|negative regulation of myelination (GO:0031642)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of neuron projection development (GO:0010976)|small molecule metabolic process (GO:0044281)|vacuole organization (GO:0007033)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)	phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)	32		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)		TGTGCTGTGAACTTAAAGAAG	0.348																																						dbGAP											0													98.0	98.0	98.0					6																	110107520		2203	4299	6502	-	-	-	SO:0001583	missense	0			D87464	CCDS5078.1	6q21	2014-09-17	2014-08-04	2007-07-30	ENSG00000112367	ENSG00000112367			16873	protein-coding gene	gene with protein product		609390	"""KIAA0274"", ""FIG4 homolog (S. cerevisiae)"", ""FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)"""	KIAA0274		9039502, 11274189, 17572665	Standard	NM_014845		Approved	SAC3, hSac3, dJ249I4.1, ALS11, CMT4J	uc003ptt.2	Q92562	OTTHUMG00000015352	ENST00000230124.3:c.1964A>T	6.37:g.110107520A>T	ENSP00000230124:p.Asn655Ile		Q53H49|Q5TCS6	Missense_Mutation	SNP	pfam_Syja_N,pfscan_Syja_N	p.N655I	ENST00000230124.3	37	c.1964	CCDS5078.1	6	.	.	.	.	.	.	.	.	.	.	A	14.23	2.474550	0.43942	.	.	ENSG00000112367	ENST00000441478;ENST00000230124	T;T	0.54071	1.86;0.59	5.71	3.28	0.37604	.	0.096172	0.64402	D	0.000001	T	0.17959	0.0431	N	0.24115	0.695	0.44711	D	0.997702	P;P	0.43885	0.634;0.82	B;B	0.36719	0.165;0.231	T	0.02852	-1.1102	10	0.41790	T	0.15	-32.1713	8.554	0.33469	0.8016:0.1311:0.0673:0.0	.	378;655	F5H8L9;Q92562	.;FIG4_HUMAN	I	378;655	ENSP00000399443:N378I;ENSP00000230124:N655I	ENSP00000230124:N655I	N	+	2	0	FIG4	110214213	1.000000	0.71417	0.954000	0.39281	0.931000	0.56810	4.455000	0.60075	0.504000	0.28082	0.528000	0.53228	AAC	FIG4	-	NULL	ENSG00000112367		0.348	FIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIG4	HGNC	protein_coding	OTTHUMT00000041768.1	179	0.00	0	A	NM_014845		110107520	110107520	+1	no_errors	ENST00000230124	ensembl	human	known	69_37n	missense	347	16.39	68	SNP	1.000	T
FOLH1	2346	genome.wustl.edu	37	11	49190796	49190796	+	Silent	SNP	G	G	A			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr11:49190796G>A	ENST00000256999.2	-	12	1583	c.1323C>T	c.(1321-1323)ctC>ctT	p.L441L	FOLH1_ENST00000343844.4_Silent_p.L133L|FOLH1_ENST00000340334.7_Silent_p.L426L|FOLH1_ENST00000356696.3_Silent_p.L441L|FOLH1_ENST00000533034.1_Silent_p.L426L|FOLH1_ENST00000525629.1_5'UTR	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	441	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GCTCTTGAAGGAGTCTTGAAT	0.363																																						dbGAP											0													80.0	79.0	79.0					11																	49190796		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.1323C>T	11.37:g.49190796G>A			A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Silent	SNP	pfam_TFR-like_dimer_dom,pfam_Protease-assoc_domain,pfam_Peptidase_M28,superfamily_TFR-like_dimer_dom	p.L441	ENST00000256999.2	37	c.1323	CCDS7946.1	11																																																																																			FOLH1	-	pfam_Peptidase_M28	ENSG00000086205		0.363	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	HGNC	protein_coding	OTTHUMT00000390896.1	278	0.00	0	G	NM_004476		49190796	49190796	-1	no_errors	ENST00000256999	ensembl	human	known	69_37n	silent	281	35.25	153	SNP	0.998	A
CMTR2	55783	genome.wustl.edu	37	16	71319781	71319781	+	Missense_Mutation	SNP	G	G	C	rs545597868		TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr16:71319781G>C	ENST00000338099.5	-	3	379	c.43C>G	c.(43-45)Ccc>Gcc	p.P15A	CMTR2_ENST00000434935.2_Missense_Mutation_p.P15A			Q8IYT2	CMTR2_HUMAN	cap methyltransferase 2	15					7-methylguanosine mRNA capping (GO:0006370)|cap2 mRNA methylation (GO:0097310)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	mRNA (nucleoside-2'-O-)-methyltransferase activity (GO:0004483)										AATGACGCGGGACTTGCTAGC	0.363																																						dbGAP											0													47.0	47.0	47.0					16																	71319781		2197	4297	6494	-	-	-	SO:0001583	missense	0			BC035005	CCDS10898.1	16q22.2	2013-07-23	2013-07-23	2013-07-23	ENSG00000180917	ENSG00000180917			25635	protein-coding gene	gene with protein product	"""adrift homolog (Drosophila)"""		"""FtsJ methyltransferase domain containing 1"""	FTSJD1		21310715	Standard	NM_018348		Approved	FLJ11171, AFT, MTr2	uc010cga.3	Q8IYT2	OTTHUMG00000137587	ENST00000338099.5:c.43C>G	16.37:g.71319781G>C	ENSP00000337512:p.Pro15Ala		B2RCD5|D3DWS1|Q8NE77|Q8NFR5|Q9H8Z4|Q9NUS3|Q9NXF5	Missense_Mutation	SNP	pfam_rRNA_MeTrfase_FtsJ_dom	p.P15A	ENST00000338099.5	37	c.43	CCDS10898.1	16	.	.	.	.	.	.	.	.	.	.	g	10.56	1.383852	0.25031	.	.	ENSG00000180917	ENST00000338099;ENST00000434935	T;T	0.12984	2.63;2.63	5.7	2.57	0.30868	.	1.000740	0.08064	N	0.998737	T	0.09905	0.0243	L	0.36672	1.1	0.09310	N	1	B	0.24483	0.104	B	0.15870	0.014	T	0.43458	-0.9390	10	0.12766	T	0.61	-32.1438	6.0372	0.19714	0.2269:0.1349:0.6382:0.0	.	15	Q8IYT2	FTSJ1_HUMAN	A	15	ENSP00000337512:P15A;ENSP00000411148:P15A	ENSP00000337512:P15A	P	-	1	0	FTSJD1	69877282	0.655000	0.27376	0.022000	0.16811	0.280000	0.26924	1.096000	0.30976	0.296000	0.22592	-0.121000	0.15023	CCC	FTSJD1	-	NULL	ENSG00000180917		0.363	CMTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FTSJD1	HGNC	protein_coding	OTTHUMT00000268984.2	76	0.00	0	G	NM_018348		71319781	71319781	-1	no_errors	ENST00000338099	ensembl	human	known	69_37n	missense	133	23.12	40	SNP	0.001	C
GALNT9	50614	genome.wustl.edu	37	12	132862937	132862937	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr12:132862937G>C	ENST00000328957.8	-	2	317	c.318C>G	c.(316-318)gaC>gaG	p.D106E		NM_001122636.1	NP_001116108.1	Q9HCQ5	GALT9_HUMAN	polypeptide N-acetylgalactosaminyltransferase 9	106					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(1)|endometrium(1)|large_intestine(2)|lung(5)	9	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.49e-08)|Epithelial(86;3.55e-07)|all cancers(50;2.09e-05)		CCTCCTGGCCGTCATCACGCA	0.667																																					Colon(186;2147 2752 13553 41466)	dbGAP											0													44.0	50.0	48.0					12																	132862937		692	1591	2283	-	-	-	SO:0001583	missense	0			AB040672	CCDS41866.1	12q24.33	2014-03-13	2014-03-13		ENSG00000182870	ENSG00000182870	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4131	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 9"""	606251	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9)"""			10978536, 12407114	Standard	NM_021808		Approved	GALNAC-T9	uc001ukc.4	Q9HCQ5	OTTHUMG00000168256	ENST00000328957.8:c.318C>G	12.37:g.132862937G>C	ENSP00000329846:p.Asp106Glu		Q52LR8|Q6NT54|Q8NFR1	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.D106E	ENST00000328957.8	37	c.318		12	.	.	.	.	.	.	.	.	.	.	G	5.424	0.263300	0.10294	.	.	ENSG00000182870	ENST00000328957	T	0.51574	0.7	4.76	2.92	0.33932	.	2.347330	0.02422	N	0.082649	T	0.37489	0.1005	N	0.25957	0.775	0.80722	D	1	P;B	0.34997	0.479;0.312	B;B	0.39771	0.309;0.055	T	0.48068	-0.9067	10	0.02654	T	1	.	7.8312	0.29344	0.0814:0.0:0.6335:0.2851	.	106;106	B2RXG6;Q9HCQ5	.;GALT9_HUMAN	E	106	ENSP00000329846:D106E	ENSP00000329846:D106E	D	-	3	2	GALNT9	131373010	1.000000	0.71417	0.051000	0.19133	0.014000	0.08584	1.331000	0.33793	0.429000	0.26202	-0.360000	0.07572	GAC	GALNT9	-	NULL	ENSG00000182870		0.667	GALNT9-009	KNOWN	basic|appris_principal	protein_coding	GALNT9	HGNC	protein_coding	OTTHUMT00000402967.1	21	0.00	0	G	NM_001122636		132862937	132862937	-1	no_errors	ENST00000328957	ensembl	human	known	69_37n	missense	26	31.58	12	SNP	1.000	C
GALNTL5	168391	genome.wustl.edu	37	7	151716746	151716746	+	Nonsense_Mutation	SNP	C	C	T	rs200861829		TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr7:151716746C>T	ENST00000392800.2	+	9	1446	c.1192C>T	c.(1192-1194)Cga>Tga	p.R398*	GALNTL5_ENST00000431418.2_Nonsense_Mutation_p.R398*	NM_145292.3	NP_660335.2	Q7Z4T8	GLTL5_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 5	398					spermatid development (GO:0007286)	endosome (GO:0005768)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(11)|ovary(2)|prostate(2)|skin(3)	32	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		GTTTTTTCTTCGAAAGCCTGG	0.378													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19157	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													89.0	90.0	89.0					7																	151716746		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF440400	CCDS5929.1	7q36.2	2014-03-13	2014-03-13	2004-07-28	ENSG00000106648	ENSG00000106648		"""Glycosyltransferase family 2 domain containing"""	21725	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 5"""	615133	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5"""	GALNT15			Standard	NM_145292		Approved	GalNAc-T5L	uc003wkp.3	Q7Z4T8	OTTHUMG00000157306	ENST00000392800.2:c.1192C>T	7.37:g.151716746C>T	ENSP00000376548:p.Arg398*		Q75KN2|Q75MD3|Q8NCV4|Q8WW05|Q9UDR9	Nonsense_Mutation	SNP	pfam_Glyco_trans_2	p.R398*	ENST00000392800.2	37	c.1192	CCDS5929.1	7	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	21.4	4.146353	0.77888	.	.	ENSG00000106648	ENST00000431418;ENST00000392800	.	.	.	4.91	2.12	0.27331	.	1.233600	0.05942	N	0.637161	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	.	4.3727	0.11255	0.1778:0.6348:0.0:0.1874	.	.	.	.	X	398	.	ENSP00000376548:R398X	R	+	1	2	GALNTL5	151347679	0.000000	0.05858	0.001000	0.08648	0.076000	0.17211	0.399000	0.20916	0.257000	0.21650	0.650000	0.86243	CGA	GALNTL5	-	NULL	ENSG00000106648		0.378	GALNTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNTL5	HGNC	protein_coding	OTTHUMT00000348395.1	178	0.00	0	C	NM_145292		151716746	151716746	+1	no_errors	ENST00000392800	ensembl	human	known	69_37n	nonsense	62	68.34	136	SNP	0.001	T
GBF1	8729	genome.wustl.edu	37	10	104128052	104128052	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr10:104128052G>T	ENST00000369983.3	+	22	2977	c.2717G>T	c.(2716-2718)cGa>cTa	p.R906L		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	906					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		CTGCTTCATCGAGGTGCCACC	0.537																																						dbGAP											0													202.0	171.0	182.0					10																	104128052		2203	4300	6503	-	-	-	SO:0001583	missense	0			D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.2717G>T	10.37:g.104128052G>T	ENSP00000359000:p.Arg906Leu		Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Missense_Mutation	SNP	pfam_Sec7,superfamily_Sec7,superfamily_ARM-type_fold,smart_Sec7,pfscan_Sec7	p.R906L	ENST00000369983.3	37	c.2717	CCDS7533.1	10	.	.	.	.	.	.	.	.	.	.	G	17.99	3.524096	0.64747	.	.	ENSG00000107862	ENST00000369983	T	0.12984	2.63	5.49	5.49	0.81192	.	0.052082	0.85682	D	0.000000	T	0.47600	0.1454	M	0.90252	3.1	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.993	D;D;D	0.74023	0.979;0.968;0.982	T	0.54636	-0.8264	10	0.72032	D	0.01	-6.7768	19.5755	0.95441	0.0:0.0:1.0:0.0	.	906;906;906	Q149P1;Q149P0;Q92538	.;.;GBF1_HUMAN	L	906	ENSP00000359000:R906L	ENSP00000359000:R906L	R	+	2	0	GBF1	104118042	1.000000	0.71417	1.000000	0.80357	0.157000	0.22087	9.657000	0.98554	2.865000	0.98341	0.655000	0.94253	CGA	GBF1	-	NULL	ENSG00000107862		0.537	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBF1	HGNC	protein_coding	OTTHUMT00000050051.1	205	0.00	0	G			104128052	104128052	+1	no_errors	ENST00000369983	ensembl	human	known	69_37n	missense	154	35.02	83	SNP	1.000	T
GGTLC1	92086	genome.wustl.edu	37	20	23966412	23966412	+	Silent	SNP	G	G	T			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr20:23966412G>T	ENST00000335694.4	-	5	627	c.423C>A	c.(421-423)atC>atA	p.I141I	GGTLC1_ENST00000286890.4_Silent_p.I141I|GGTLC1_ENST00000278765.4_Silent_p.I141I	NM_178311.2	NP_842563.1	Q9BX51	GGTL1_HUMAN	gamma-glutamyltransferase light chain 1	141					glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)	gamma-glutamyltransferase activity (GO:0003840)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	15						GGTTGTAGATGATGGCCTGGG	0.602																																						dbGAP											0													64.0	68.0	66.0					20																	23966412		2203	4296	6499	-	-	-	SO:0001819	synonymous_variant	0			AL133466	CCDS13163.1	20p11.21	2010-07-14	2008-03-10	2008-03-10	ENSG00000149435	ENSG00000149435		"""Gamma-glutamyltransferases"""	16437	protein-coding gene	gene with protein product		612338	"""gamma-glutamyltransferase-like activity 4"", ""gamma-glutamyltransferase-like activity 3"""	GGTLA4, GGTLA3		10843999, 18357469	Standard	NM_178311		Approved	dJ831C21.2, dJ831C21.1	uc002wtu.3	Q9BX51	OTTHUMG00000032095	ENST00000335694.4:c.423C>A	20.37:g.23966412G>T			D3DW43|Q08246	Silent	SNP	pfam_GGT_peptidase,prints_GGT_peptidase	p.I141	ENST00000335694.4	37	c.423	CCDS13163.1	20																																																																																			GGTLC1	-	pfam_GGT_peptidase,prints_GGT_peptidase	ENSG00000149435		0.602	GGTLC1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	GGTLC1	HGNC	protein_coding	OTTHUMT00000078366.2	166	0.60	1	G	NM_178311.2		23966412	23966412	-1	no_errors	ENST00000278765	ensembl	human	known	69_37n	silent	260	20.54	68	SNP	1.000	T
GK5	256356	genome.wustl.edu	37	3	141890304	141890304	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr3:141890304C>G	ENST00000392993.2	-	14	1415	c.1264G>C	c.(1264-1266)Gag>Cag	p.E422Q		NM_001039547.2	NP_001034636.1	Q6ZS86	GLPK5_HUMAN	glycerol kinase 5 (putative)	422					glycerol catabolic process (GO:0019563)		ATP binding (GO:0005524)|glycerol kinase activity (GO:0004370)			kidney(1)|large_intestine(1)|lung(7)|urinary_tract(1)	10						TTCATCATCTCATATAACTGT	0.249																																						dbGAP											0													34.0	32.0	33.0					3																	141890304		2097	4103	6200	-	-	-	SO:0001583	missense	0			BX648681	CCDS33871.1	3q23	2014-02-12	2006-09-21		ENSG00000175066	ENSG00000175066		"""Glycerol kinases"""	28635	protein-coding gene	gene with protein product						12477932	Standard	NM_001039547		Approved	MGC40579	uc003euq.2	Q6ZS86	OTTHUMG00000133572	ENST00000392993.2:c.1264G>C	3.37:g.141890304C>G	ENSP00000418001:p.Glu422Gln		B2R9I2|D3DNG2|Q8N2A7|Q8N5E6	Missense_Mutation	SNP	pfam_Carb_kinase_FGGY_N,pfam_Carb_kinase_FGGY_C	p.E422Q	ENST00000392993.2	37	c.1264	CCDS33871.1	3	.	.	.	.	.	.	.	.	.	.	C	13.90	2.375865	0.42105	.	.	ENSG00000175066	ENST00000392993;ENST00000486459	D;D	0.91631	-2.88;-2.88	5.28	5.28	0.74379	Carbohydrate kinase, FGGY, C-terminal (1);	0.263697	0.44483	D	0.000460	D	0.91446	0.7300	L	0.52364	1.645	0.80722	D	1	B	0.33549	0.417	B	0.39935	0.314	D	0.90715	0.4630	10	0.49607	T	0.09	-13.3118	18.0424	0.89322	0.0:1.0:0.0:0.0	.	422	Q6ZS86	GLPK5_HUMAN	Q	422;76	ENSP00000418001:E422Q;ENSP00000420593:E76Q	ENSP00000418001:E422Q	E	-	1	0	GK5	143372994	1.000000	0.71417	0.181000	0.23098	0.535000	0.34838	3.525000	0.53502	2.626000	0.88956	0.455000	0.32223	GAG	GK5	-	pfam_Carb_kinase_FGGY_C	ENSG00000175066		0.249	GK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GK5	HGNC	protein_coding	OTTHUMT00000353999.1	233	0.43	1	C	NM_001039547		141890304	141890304	-1	no_errors	ENST00000392993	ensembl	human	known	69_37n	missense	683	17.31	143	SNP	1.000	G
GPR137B	7107	genome.wustl.edu	37	1	236341802	236341802	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr1:236341802T>C	ENST00000366592.3	+	3	644	c.553T>C	c.(553-555)Tgg>Cgg	p.W185R	GPR137B_ENST00000366591.4_Intron	NM_003272.3	NP_003263.1	O60478	G137B_HUMAN	G protein-coupled receptor 137B	185						integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|membrane (GO:0016020)				endometrium(2)|large_intestine(1)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.197)|Prostate(94;0.219)|Acute lymphoblastic leukemia(190;0.226)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)			GACGGGAAATTGGGAGAGGAA	0.502																																						dbGAP											0													220.0	191.0	201.0					1																	236341802		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF027826	CCDS1609.1	1q42-q43	2012-08-10	2006-01-26	2006-01-26	ENSG00000077585	ENSG00000077585			11862	protein-coding gene	gene with protein product		604658	"""transmembrane 7 superfamily member 1 (upregulated in kidney)"""	TM7SF1		9521871	Standard	NM_003272		Approved		uc001hxq.3	O60478	OTTHUMG00000037994	ENST00000366592.3:c.553T>C	1.37:g.236341802T>C	ENSP00000355551:p.Trp185Arg		Q53EK7|Q5TAE6|Q6FHI3	Missense_Mutation	SNP	NULL	p.W185R	ENST00000366592.3	37	c.553	CCDS1609.1	1	.	.	.	.	.	.	.	.	.	.	T	7.362	0.624955	0.14257	.	.	ENSG00000077585	ENST00000366592;ENST00000391852	T	0.40476	1.03	5.59	3.19	0.36642	.	0.316047	0.33419	N	0.004925	T	0.24236	0.0587	N	0.25647	0.755	0.80722	D	1	B	0.30973	0.302	B	0.27076	0.076	T	0.04481	-1.0948	10	0.15066	T	0.55	-3.9049	7.8231	0.29298	0.1303:0.0:0.2722:0.5975	.	185	O60478	G137B_HUMAN	R	185;184	ENSP00000355551:W185R	ENSP00000355551:W185R	W	+	1	0	GPR137B	234408425	0.948000	0.32251	0.477000	0.27303	0.947000	0.59692	1.509000	0.35780	0.365000	0.24400	-0.466000	0.05196	TGG	GPR137B	-	NULL	ENSG00000077585		0.502	GPR137B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR137B	HGNC	protein_coding	OTTHUMT00000092761.1	278	0.00	0	T	NM_003272		236341802	236341802	+1	no_errors	ENST00000366592	ensembl	human	known	69_37n	missense	421	31.54	194	SNP	0.449	C
GREB1L	80000	genome.wustl.edu	37	18	19020262	19020262	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr18:19020262C>T	ENST00000580732.2	+	9	1363	c.982C>T	c.(982-984)Cga>Tga	p.R328*	GREB1L_ENST00000431264.1_Nonsense_Mutation_p.R328*|GREB1L_ENST00000424526.1_Nonsense_Mutation_p.R328*|GREB1L_ENST00000400483.4_Nonsense_Mutation_p.R328*|RP11-296E23.1_ENST00000584611.1_RNA|GREB1L_ENST00000269218.6_Nonsense_Mutation_p.R328*|GREB1L_ENST00000578368.1_3'UTR			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	328						integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						ACCAAAGAAACGACACCGGGG	0.453																																						dbGAP											0													90.0	85.0	87.0					18																	19020262		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.982C>T	18.37:g.19020262C>T	ENSP00000464162:p.Arg328*		A4QN17|Q9H8F1	Nonsense_Mutation	SNP	NULL	p.R328*	ENST00000580732.2	37	c.982	CCDS45836.1	18	.	.	.	.	.	.	.	.	.	.	C	37	6.187361	0.97357	.	.	ENSG00000141449	ENST00000424526;ENST00000269218;ENST00000400483;ENST00000431264	.	.	.	5.48	4.52	0.55395	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	-11.6051	15.0908	0.72192	0.234:0.766:0.0:0.0	.	.	.	.	X	328	.	ENSP00000269218:R328X	R	+	1	2	GREB1L	17274260	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.840000	0.48215	2.580000	0.87095	0.650000	0.86243	CGA	GREB1L	-	NULL	ENSG00000141449		0.453	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	GREB1L	HGNC	protein_coding	OTTHUMT00000443782.2	137	0.00	0	C	NM_024935		19020262	19020262	+1	no_errors	ENST00000424526	ensembl	human	known	69_37n	nonsense	53	73.40	149	SNP	1.000	T
GRIA3	2892	genome.wustl.edu	37	X	122538638	122538638	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chrX:122538638T>C	ENST00000371251.1	+	10	1425	c.1373T>C	c.(1372-1374)cTa>cCa	p.L458P	GRIA3_ENST00000264357.5_Missense_Mutation_p.L458P|GRIA3_ENST00000371256.5_Missense_Mutation_p.L458P|GRIA3_ENST00000541091.1_Missense_Mutation_p.L442P|GRIA3_ENST00000542149.1_Missense_Mutation_p.L458P			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3	458					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)			breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	TGTGTAGACCTAGCCTATGAA	0.403																																						dbGAP											0													177.0	140.0	152.0					X																	122538638		2203	4300	6503	-	-	-	SO:0001583	missense	0			U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.1373T>C	X.37:g.122538638T>C	ENSP00000360297:p.Leu458Pro		D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.L458P	ENST00000371251.1	37	c.1373	CCDS14604.1	X	.	.	.	.	.	.	.	.	.	.	T	23.0	4.367906	0.82463	.	.	ENSG00000125675	ENST00000264357;ENST00000542149;ENST00000371256;ENST00000371251;ENST00000541091	D;D;D;D;D	0.85861	-2.04;-2.04;-2.04;-2.04;-2.04	5.7	5.7	0.88788	Glutamate receptor, L-glutamate/glycine-binding (2);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	D	0.95287	0.8471	H	0.98111	4.15	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.91635	0.999;0.998;0.996	D	0.96787	0.9579	10	0.87932	D	0	.	14.002	0.64439	0.0:0.0:0.0:1.0	.	442;458;458	B7Z4C0;P42263;P42263-2	.;GRIA3_HUMAN;.	P	458;458;458;458;442	ENSP00000264357:L458P;ENSP00000446146:L458P;ENSP00000360302:L458P;ENSP00000360297:L458P;ENSP00000446440:L442P	ENSP00000264357:L458P	L	+	2	0	GRIA3	122366319	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.040000	0.89188	1.904000	0.55121	0.412000	0.27726	CTA	GRIA3	-	pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd	ENSG00000125675		0.403	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA3	HGNC	protein_coding	OTTHUMT00000058854.1	242	0.00	0	T	NM_000828		122538638	122538638	+1	no_errors	ENST00000264357	ensembl	human	known	69_37n	missense	321	24.29	103	SNP	1.000	C
HLA-DMB	3109	genome.wustl.edu	37	6	32905029	32905029	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr6:32905029G>T	ENST00000418107.2	-	3	804	c.542C>A	c.(541-543)gCc>gAc	p.A181D	HLA-DMB_ENST00000416244.2_Missense_Mutation_p.A181D|AL645941.1_ENST00000390777.1_RNA	NM_002118.4	NP_002109.2	P28068	DMB_HUMAN	major histocompatibility complex, class II, DM beta	181	Beta-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|immune response (GO:0006955)|MHC class II protein complex assembly (GO:0002399)|peptide antigen assembly with MHC class II protein complex (GO:0002503)|positive regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001190)|positive regulation of T cell proliferation (GO:0042102)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)	MHC class II protein complex binding (GO:0023026)			breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13						GGGGGTTAAGGCTAAATGGGA	0.562																																						dbGAP											0													137.0	107.0	117.0					6																	32905029		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4760.1	6p21.3	2014-05-16			ENSG00000242574	ENSG00000242574		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4935	protein-coding gene	gene with protein product		142856				1922365	Standard	NM_002118		Approved	D6S221E, RING7	uc003ocl.2	P28068	OTTHUMG00000031176	ENST00000418107.2:c.542C>A	6.37:g.32905029G>T	ENSP00000398890:p.Ala181Asp		O77936|Q13012|Q29751|Q58ZE2|Q5SNZ8|Q5STC4|Q9XRX2	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_MHC_II_b_N,pfam_CD80_C2-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like	p.A181D	ENST00000418107.2	37	c.542	CCDS4760.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.929|9.929	1.214283|1.214283	0.22289|0.22289	.|.	.|.	ENSG00000242574|ENSG00000242574	ENST00000438510;ENST00000446948;ENST00000418107;ENST00000416244|ENST00000414017	T;T;T|.	0.02837|.	4.14;4.14;4.14|.	4.56|4.56	4.56|4.56	0.56223|0.56223	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);|.	0.112905|.	0.39834|.	N|.	0.001259|.	T|T	0.39145|0.39145	0.1067|0.1067	N|N	0.26042|0.26042	0.785|0.785	0.40230|0.40230	D|D	0.977838|0.977838	B;D;B;B;D|.	0.89917|.	0.285;1.0;0.263;0.156;1.0|.	B;D;B;B;D|.	0.91635|.	0.03;0.999;0.189;0.06;0.999|.	T|T	0.23691|0.23691	-1.0181|-1.0181	10|5	0.87932|.	D|.	0|.	.|.	13.0126|13.0126	0.58739|0.58739	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	181;181;63;70;181|.	E9PD01;A2AAT3;B0V061;B0V062;P28068|.	.;.;.;.;DMB_HUMAN|.	D|R	63;181;181;181|70	ENSP00000390848:A63D;ENSP00000398890:A181D;ENSP00000391010:A181D|.	ENSP00000391010:A181D|.	A|S	-|-	2|3	0|2	HLA-DMB|HLA-DMB	33013007|33013007	0.996000|0.996000	0.38824|0.38824	0.768000|0.768000	0.31515|0.31515	0.105000|0.105000	0.19272|0.19272	3.464000|3.464000	0.53057|0.53057	2.524000|2.524000	0.85096|0.85096	0.494000|0.494000	0.49563|0.49563	GCC|AGC	HLA-DMB	-	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	ENSG00000242574		0.562	HLA-DMB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DMB	HGNC	protein_coding	OTTHUMT00000076340.2	86	0.00	0	G	NM_002118		32905029	32905029	-1	no_errors	ENST00000418107	ensembl	human	known	69_37n	missense	119	25.93	42	SNP	0.826	T
HNRNPF	3185	genome.wustl.edu	37	10	43883017	43883017	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr10:43883017C>T	ENST00000544000.1	-	4	723	c.316G>A	c.(316-318)Gac>Aac	p.D106N	HNRNPF_ENST00000337970.3_Missense_Mutation_p.D106N|HNRNPF_ENST00000356053.3_Missense_Mutation_p.D106N|HNRNPF_ENST00000357065.4_Missense_Mutation_p.D106N|HNRNPF_ENST00000498176.1_5'Flank|HNRNPF_ENST00000443950.2_Missense_Mutation_p.D106N	NM_001098207.1	NP_001091677.1	P52597	HNRPF_HUMAN	heterogeneous nuclear ribonucleoprotein F	106					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA splicing (GO:0043484)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|urinary_tract(1)	19						TTGGCGCTGTCGGCACTGTTG	0.507																																						dbGAP											0													168.0	133.0	145.0					10																	43883017		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7204.1	10q11.21	2013-02-12		2008-04-18	ENSG00000169813	ENSG00000169813		"""RNA binding motif (RRM) containing"""	5039	protein-coding gene	gene with protein product		601037		HNRPF		7499401	Standard	NM_001098208		Approved		uc001jas.2	P52597	OTTHUMG00000018029	ENST00000544000.1:c.316G>A	10.37:g.43883017C>T	ENSP00000438061:p.Asp106Asn		B3KM84|Q5T0N2|Q96AU2	Missense_Mutation	SNP	pfam_RRM_dom,pfam_Znf_CHHC,smart_RRM_dom,pfscan_RRM_dom	p.D106N	ENST00000544000.1	37	c.316	CCDS7204.1	10	.	.	.	.	.	.	.	.	.	.	C	11.78	1.740821	0.30865	.	.	ENSG00000169813	ENST00000544000;ENST00000443950;ENST00000356053;ENST00000357065;ENST00000337970;ENST00000540544	T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55	4.04	2.19	0.27852	.	0.151902	0.56097	N	0.000023	T	0.19725	0.0474	L	0.45137	1.4	0.38837	D	0.955986	B	0.31227	0.314	B	0.21917	0.037	T	0.08186	-1.0734	10	0.17832	T	0.49	-29.076	8.5719	0.33574	0.0:0.8047:0.0:0.1953	.	106	P52597	HNRPF_HUMAN	N	106;106;106;106;106;29	ENSP00000438061:D106N;ENSP00000400433:D106N;ENSP00000348345:D106N;ENSP00000349573:D106N;ENSP00000338477:D106N	ENSP00000338477:D106N	D	-	1	0	HNRNPF	43203023	1.000000	0.71417	0.802000	0.32245	0.946000	0.59487	6.668000	0.74457	0.668000	0.31126	-0.136000	0.14681	GAC	HNRNPF	-	NULL	ENSG00000169813		0.507	HNRNPF-202	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPF	HGNC	protein_coding	OTTHUMT00000047705.2	153	0.65	1	C			43883017	43883017	-1	no_errors	ENST00000337970	ensembl	human	known	69_37n	missense	300	20.84	79	SNP	0.978	T
HOMER2	9455	genome.wustl.edu	37	15	83523466	83523466	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr15:83523466G>T	ENST00000304231.8	-	6	806	c.614C>A	c.(613-615)gCa>gAa	p.A205E	HOMER2_ENST00000450735.2_Missense_Mutation_p.A194E|HOMER2_ENST00000426485.1_Intron|HOMER2_ENST00000399166.2_Intron	NM_199330.2	NP_955362.1	Q9NSB8	HOME2_HUMAN	homer homolog 2 (Drosophila)	205					behavioral response to cocaine (GO:0048148)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|chemical homeostasis within a tissue (GO:0048875)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				cervix(1)|endometrium(2)|lung(6)	9						CACACTGGCTGCCGACTCCTG	0.612																																						dbGAP											0													45.0	50.0	48.0					15																	83523466		2174	4278	6452	-	-	-	SO:0001583	missense	0			AF093264	CCDS45334.1, CCDS45336.1	15q24.3	2008-02-05				ENSG00000103942			17513	protein-coding gene	gene with protein product		604799				9808459, 9808458	Standard	NM_199330		Approved	CPD, Cupidin, Vesl-2, HOMER-2B, HOMER-2, HOMER-2A	uc002bjg.3	Q9NSB8		ENST00000304231.8:c.614C>A	15.37:g.83523466G>T	ENSP00000305632:p.Ala205Glu		O95269|O95349|Q9NSB6|Q9NSB7|Q9UNT7	Missense_Mutation	SNP	pfam_EVH1,smart_EVH1,pfscan_EVH1	p.A205E	ENST00000304231.8	37	c.614	CCDS45334.1	15	.	.	.	.	.	.	.	.	.	.	G	14.89	2.669385	0.47677	.	.	ENSG00000103942	ENST00000304231;ENST00000450735	T;T	0.70749	2.32;-0.51	5.47	5.47	0.80525	.	0.179147	0.50627	D	0.000107	T	0.55657	0.1934	N	0.25144	0.715	0.58432	D	0.999993	B;B	0.10296	0.003;0.001	B;B	0.12156	0.007;0.002	T	0.50915	-0.8771	10	0.28530	T	0.3	.	11.7323	0.51744	0.0803:0.0:0.9197:0.0	.	194;205	Q9NSB8-2;Q9NSB8	.;HOME2_HUMAN	E	205;194	ENSP00000305632:A205E;ENSP00000407634:A194E	ENSP00000305632:A205E	A	-	2	0	HOMER2	81320520	1.000000	0.71417	0.333000	0.25482	0.923000	0.55619	5.036000	0.64164	2.583000	0.87209	0.655000	0.94253	GCA	HOMER2	-	NULL	ENSG00000103942		0.612	HOMER2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HOMER2	HGNC	protein_coding	OTTHUMT00000418689.1	37	0.00	0	G			83523466	83523466	-1	no_errors	ENST00000304231	ensembl	human	known	69_37n	missense	24	59.32	35	SNP	0.164	T
ITGB2	3689	genome.wustl.edu	37	21	46309979	46309979	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr21:46309979A>T	ENST00000397850.2	-	13	2023	c.1571T>A	c.(1570-1572)gTc>gAc	p.V524D	ITGB2_ENST00000355153.4_Missense_Mutation_p.V524D|ITGB2_ENST00000302347.5_Missense_Mutation_p.V524D|ITGB2_ENST00000397857.1_Missense_Mutation_p.V524D|ITGB2_ENST00000397854.3_Missense_Mutation_p.V467D|ITGB2_ENST00000397852.1_Missense_Mutation_p.V524D			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	524	Cysteine-rich tandem repeats.				apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	CTTGCCGGGGACGTCGCTGGT	0.637																																						dbGAP											0													105.0	80.0	88.0					21																	46309979		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.1571T>A	21.37:g.46309979A>T	ENSP00000380948:p.Val524Asp		B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Missense_Mutation	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_tail,pfam_Integrin_bsu_cyt,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like,smart_Integrin_bsu_N,prints_Integrin_bsu	p.V524D	ENST00000397850.2	37	c.1571	CCDS13716.1	21	.	.	.	.	.	.	.	.	.	.	A	0.386	-0.925879	0.02377	.	.	ENSG00000160255	ENST00000397852;ENST00000397857;ENST00000397854;ENST00000355153;ENST00000397850;ENST00000302347	D;D;D;D;D;D	0.92752	-3.1;-3.1;-3.1;-3.1;-3.1;-3.1	5.21	-5.04	0.02964	.	.	.	.	.	T	0.78084	0.4228	N	0.11427	0.14	0.09310	N	0.999996	B;B	0.13594	0.008;0.003	B;B	0.04013	0.001;0.001	T	0.64170	-0.6470	9	0.35671	T	0.21	.	3.4014	0.07324	0.2478:0.0989:0.0807:0.5727	.	467;524	A8MYE6;P05107	.;ITB2_HUMAN	D	524;524;467;524;524;524	ENSP00000380950:V524D;ENSP00000380955:V524D;ENSP00000380952:V467D;ENSP00000347279:V524D;ENSP00000380948:V524D;ENSP00000303242:V524D	ENSP00000303242:V524D	V	-	2	0	ITGB2	45134407	0.000000	0.05858	0.002000	0.10522	0.019000	0.09904	0.462000	0.21956	-0.327000	0.08551	0.533000	0.62120	GTC	ITGB2	-	pirsf_Integrin_bsu,pfam_EGF_extracell	ENSG00000160255		0.637	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB2	HGNC	protein_coding	OTTHUMT00000206566.2	47	0.00	0	A	NM_000211		46309979	46309979	-1	no_errors	ENST00000302347	ensembl	human	known	69_37n	missense	75	21.05	20	SNP	0.004	T
ITIH6	347365	genome.wustl.edu	37	X	54780124	54780124	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chrX:54780124G>T	ENST00000218436.6	-	11	3341	c.3312C>A	c.(3310-3312)caC>caA	p.H1104Q		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	1104					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										AGTCCCCAGGGTGCCCATTCA	0.502																																						dbGAP											0													111.0	92.0	99.0					X																	54780124		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.3312C>A	X.37:g.54780124G>T	ENSP00000218436:p.His1104Gln		A6NN03	Missense_Mutation	SNP	pfam_VIT,pfam_ITI_HC_C,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.H1104Q	ENST00000218436.6	37	c.3312	CCDS14361.1	X	.	.	.	.	.	.	.	.	.	.	G	0.014	-1.573208	0.00887	.	.	ENSG00000102313	ENST00000218436	T	0.01998	4.51	3.25	-3.67	0.04476	.	5.154220	0.01236	U	0.008484	T	0.01029	0.0034	N	0.02539	-0.55	0.09310	N	1	B	0.19935	0.04	B	0.12156	0.007	T	0.44952	-0.9294	10	0.32370	T	0.25	.	1.1782	0.01840	0.2921:0.1144:0.3762:0.2174	.	1104	Q6UXX5	ITH5L_HUMAN	Q	1104	ENSP00000218436:H1104Q	ENSP00000218436:H1104Q	H	-	3	2	ITIH5L	54796849	0.016000	0.18221	0.168000	0.22838	0.132000	0.20833	-0.007000	0.12810	-0.535000	0.06307	-0.453000	0.05500	CAC	ITIH6	-	NULL	ENSG00000102313		0.502	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITIH6	HGNC	protein_coding	OTTHUMT00000056814.2	271	0.00	0	G	NM_198510		54780124	54780124	-1	no_errors	ENST00000218436	ensembl	human	known	69_37n	missense	218	33.23	109	SNP	0.001	T
KCND3	3752	genome.wustl.edu	37	1	112524764	112524764	+	Silent	SNP	G	G	A			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr1:112524764G>A	ENST00000315987.2	-	2	1064	c.585C>T	c.(583-585)gtC>gtT	p.V195V	KCND3_ENST00000302127.4_Silent_p.V195V|KCND3_ENST00000369697.1_Silent_p.V195V	NM_004980.4	NP_004971.2	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 3	195					cell death (GO:0008219)|membrane repolarization (GO:0086009)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	49		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	TGATGACCGAGACAGCGATGA	0.657																																						dbGAP											0													39.0	38.0	38.0					1																	112524764		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF048713	CCDS843.1, CCDS844.1	1p13.2	2014-09-17			ENSG00000171385	ENSG00000171385		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6239	protein-coding gene	gene with protein product		605411	"""spinocerebellar ataxia 22"", ""spinocerebellar ataxia 19"""	SCA22, SCA19		10942109, 16382104, 23280837	Standard	NM_172198		Approved	Kv4.3, KSHIVB	uc001ebu.1	Q9UK17	OTTHUMG00000011989	ENST00000315987.2:c.585C>T	1.37:g.112524764G>A			O60576|O60577|Q14D71|Q5T0M0|Q9UH85|Q9UH86|Q9UK16	Silent	SNP	pfam_K_chnl_volt-dep_Kv4_C,pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Shal-type,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv4,prints_K_chnl_volt-dep_Kv4.3,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv3	p.V195	ENST00000315987.2	37	c.585	CCDS843.1	1																																																																																			KCND3	-	prints_K_chnl	ENSG00000171385		0.657	KCND3-001	KNOWN	basic|CCDS	protein_coding	KCND3	HGNC	protein_coding	OTTHUMT00000033144.1	27	0.00	0	G	NM_172198		112524764	112524764	-1	no_errors	ENST00000315987	ensembl	human	known	69_37n	silent	26	43.48	20	SNP	0.991	A
KGFLP2	654466	genome.wustl.edu	37	9	41962410	41962410	+	lincRNA	SNP	T	T	A	rs28474905	byFrequency	TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr9:41962410T>A	ENST00000454645.1	-	0	1094					NR_003670.1																						AATGCGCAAGTCCAGCTTGAT	0.299																																						dbGAP											0																																										-	-	-			0																															9.37:g.41962410T>A				RNA	SNP	-	NULL	ENST00000454645.1	37	NULL		9																																																																																			RP11-204M4.2	-	-	ENSG00000204837		0.299	RP11-204M4.2-001	KNOWN	basic	lincRNA	KGFLP2	Clone_based_vega_gene	lincRNA	OTTHUMT00000143738.1	15	0.00	0	T			41962410	41962410	-1	no_errors	ENST00000454645	ensembl	human	known	69_37n	rna	16	30.43	7	SNP	1.000	A
KHDC1	80759	genome.wustl.edu	37	6	73951884	73951884	+	Silent	SNP	A	A	G			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr6:73951884A>G	ENST00000370384.3	-	4	908	c.408T>C	c.(406-408)gcT>gcC	p.A136A	RP11-257K9.8_ENST00000423730.3_Silent_p.A63A|KHDC1_ENST00000257765.5_Silent_p.A63A	NM_001251874.1	NP_001238803.1	Q4VXA5	KHDC1_HUMAN	KH homology domain containing 1	136	KH; atypical.					integral component of membrane (GO:0016021)	RNA binding (GO:0003723)			large_intestine(1)|lung(4)|skin(1)	6						TCTGGCCTGTAGCTGTGAACC	0.542																																						dbGAP											0													88.0	89.0	89.0					6																	73951884		2067	4218	6285	-	-	-	SO:0001819	synonymous_variant	0				CCDS43480.1, CCDS59027.1	6q13	2014-05-15	2007-11-13	2007-11-13	ENSG00000135314	ENSG00000135314			21366	protein-coding gene	gene with protein product		611688	"""chromosome 6 open reading frame 148"""	C6orf148		17913455	Standard	NM_030568		Approved	MGC10818, bA257K9.4, NDG1	uc003pgn.4	Q4VXA5	OTTHUMG00000015030	ENST00000370384.3:c.408T>C	6.37:g.73951884A>G			Q5JSQ7|Q8WTV2|Q96NQ5	Silent	SNP	NULL	p.A63	ENST00000370384.3	37	c.189	CCDS59027.1	6																																																																																			KHDC1L	-	NULL	ENSG00000243501		0.542	KHDC1-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	KHDC1L	HGNC	protein_coding	OTTHUMT00000148103.2	153	0.00	0	A	NM_030568		73951884	73951884	-1	no_errors	ENST00000423730	ensembl	human	known	69_37n	silent	113	57.99	156	SNP	0.007	G
KRTAP5-4	387267	genome.wustl.edu	37	11	1643059	1643059	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr11:1643059C>A	ENST00000399682.1	-	1	309	c.265G>T	c.(265-267)Ggg>Tgg	p.G89W		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0	9 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ACACAGCCCCCCTTGGAACCC	0.672																																						dbGAP											0													8.0	14.0	13.0					11																	1643059		681	1576	2257	-	-	-	SO:0001583	missense	0			AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.265G>T	11.37:g.1643059C>A	ENSP00000382590:p.Gly89Trp			Missense_Mutation	SNP	NULL	p.G89W	ENST00000399682.1	37	c.265		11	.	.	.	.	.	.	.	.	.	.	C	6.328	0.428643	0.11987	.	.	ENSG00000241598	ENST00000399682;ENST00000328953	T	0.00856	5.61	2.26	2.26	0.28386	.	.	.	.	.	T	0.05593	0.0147	M	0.84433	2.695	0.26194	N	0.979542	D	0.89917	1.0	D	0.91635	0.999	T	0.06844	-1.0804	9	0.62326	D	0.03	.	10.6498	0.45642	0.0:1.0:0.0:0.0	.	149	Q6L8H1	KRA54_HUMAN	W	89	ENSP00000382590:G89W	ENSP00000331603:G89W	G	-	1	0	KRTAP5-4	1599635	0.000000	0.05858	0.436000	0.26797	0.184000	0.23303	-0.007000	0.12810	1.575000	0.49775	0.518000	0.50308	GGG	KRTAP5-4	-	NULL	ENSG00000241598		0.672	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	KRTAP5-4	HGNC	protein_coding	OTTHUMT00000127918.1	103	0.00	0	C	NM_001012709		1643059	1643059	-1	no_errors	ENST00000399682	ensembl	human	known	69_37n	missense	130	21.21	35	SNP	0.633	A
LAT	27040	genome.wustl.edu	37	16	28997485	28997485	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr16:28997485C>A	ENST00000360872.5	+	4	271	c.193C>A	c.(193-195)Cca>Aca	p.P65T	LAT_ENST00000395461.3_Missense_Mutation_p.P101T|RP11-264B17.3_ENST00000569969.1_RNA|LAT_ENST00000454369.2_Missense_Mutation_p.P65T|LAT_ENST00000354453.4_Missense_Mutation_p.P65T|LAT_ENST00000566177.1_Missense_Mutation_p.P65T|RP11-264B17.5_ENST00000561471.1_RNA|LAT_ENST00000395456.2_Missense_Mutation_p.P65T|LAT_ENST00000564277.1_Missense_Mutation_p.P65T|LAT_ENST00000563964.1_Intron			O43561	LAT_HUMAN	linker for activation of T cells	65					blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|gene expression (GO:0010467)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lymphocyte homeostasis (GO:0002260)|mast cell degranulation (GO:0043303)|platelet activation (GO:0030168)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)|regulation of T cell activation (GO:0050863)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH3/SH2 adaptor activity (GO:0005070)			large_intestine(2)|lung(3)|urinary_tract(1)	6		Hepatocellular(780;0.244)				ACCTGCCTACCCACCTGTCAC	0.622																																						dbGAP											0													100.0	96.0	98.0					16																	28997485		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF036905	CCDS10647.1, CCDS32425.1, CCDS45455.1, CCDS53999.1	16q13	2011-11-01			ENSG00000213658	ENSG00000213658			18874	protein-coding gene	gene with protein product	"""linker for activation of T cells, transmembrane adaptor"""	602354				9489702	Standard	NM_014387		Approved	LAT1	uc010vdj.2	O43561	OTTHUMG00000131761	ENST00000360872.5:c.193C>A	16.37:g.28997485C>A	ENSP00000354119:p.Pro65Thr		B7WPI0|C7C5T6|G5E9K3|O43919	Missense_Mutation	SNP	prints_Linker_for_activat_Tcells_prot	p.P101T	ENST00000360872.5	37	c.301	CCDS10647.1	16	.	.	.	.	.	.	.	.	.	.	C	13.36	2.212475	0.39102	.	.	ENSG00000213658	ENST00000395461;ENST00000395456;ENST00000454369;ENST00000360872;ENST00000354453	.	.	.	3.74	2.77	0.32553	.	.	.	.	.	T	0.40743	0.1129	L	0.27053	0.805	0.09310	N	1	P;D;D;P;D	0.61080	0.884;0.989;0.989;0.884;0.989	P;P;P;P;P	0.61132	0.586;0.884;0.884;0.586;0.884	T	0.16217	-1.0410	8	0.72032	D	0.01	-5.1507	9.285	0.37751	0.0:0.7792:0.2208:0.0	.	65;65;101;65;65	C7C5T6;O43561-2;B7WPI0;O43561;G5E9K3	.;.;.;LAT_HUMAN;.	T	101;65;65;65;65	.	ENSP00000346441:P65T	P	+	1	0	LAT	28904986	0.001000	0.12720	0.090000	0.20809	0.311000	0.27955	1.009000	0.29886	0.904000	0.36572	0.462000	0.41574	CCA	LAT	-	prints_Linker_for_activat_Tcells_prot	ENSG00000213658		0.622	LAT-001	KNOWN	basic|CCDS	protein_coding	LAT	HGNC	protein_coding	OTTHUMT00000254688.2	35	0.00	0	C			28997485	28997485	+1	no_errors	ENST00000395461	ensembl	human	known	69_37n	missense	50	16.67	10	SNP	0.027	A
LCE2B	26239	genome.wustl.edu	37	1	152659424	152659424	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr1:152659424G>T	ENST00000368780.3	+	2	159	c.105G>T	c.(103-105)caG>caT	p.Q35H	LCE2B_ENST00000417924.2_Missense_Mutation_p.Q35H	NM_014357.4	NP_055172.1	O14633	LCE2B_HUMAN	late cornified envelope 2B	35	Cys-rich.|Pro-rich.				epidermis development (GO:0008544)|keratinization (GO:0031424)					endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	11	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCTGCCCCAGTGCCCAGCTC	0.612																																						dbGAP											0													142.0	144.0	144.0					1																	152659424		2203	4300	6503	-	-	-	SO:0001583	missense	0			BI670514	CCDS1020.1	1q21	2008-02-05	2004-10-11	2004-10-15	ENSG00000159455	ENSG00000159455		"""Late cornified envelopes"""	16610	protein-coding gene	gene with protein product		612610	"""small proline rich-like (epidermal differentiation complex) 1B"""	SPRL1B		11698679, 9344646	Standard	NM_014357		Approved	LEP10, XP5	uc001fai.3	O14633	OTTHUMG00000012404	ENST00000368780.3:c.105G>T	1.37:g.152659424G>T	ENSP00000357769:p.Gln35His		Q5TA80	Missense_Mutation	SNP	NULL	p.Q35H	ENST00000368780.3	37	c.105	CCDS1020.1	1	.	.	.	.	.	.	.	.	.	.	G	0.580	-0.837555	0.02692	.	.	ENSG00000159455	ENST00000417924;ENST00000368780	T;T	0.04015	3.73;3.73	2.46	2.46	0.29980	.	.	.	.	.	T	0.02688	0.0081	L	0.27053	0.805	0.09310	N	1	P	0.47910	0.902	P	0.51229	0.663	T	0.45249	-0.9274	9	0.87932	D	0	.	8.4052	0.32610	0.0:0.0:1.0:0.0	.	35	O14633	LCE2B_HUMAN	H	35	ENSP00000414043:Q35H;ENSP00000357769:Q35H	ENSP00000357769:Q35H	Q	+	3	2	LCE2B	150926048	0.000000	0.05858	0.142000	0.22268	0.139000	0.21198	-0.252000	0.08806	1.360000	0.45960	0.313000	0.20887	CAG	LCE2B	-	NULL	ENSG00000159455		0.612	LCE2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE2B	HGNC	protein_coding	OTTHUMT00000034524.1	273	0.00	0	G	NM_014357		152659424	152659424	+1	no_errors	ENST00000368780	ensembl	human	known	69_37n	missense	670	18.77	155	SNP	0.360	T
LEMD2	221496	genome.wustl.edu	37	6	33752167	33752167	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr6:33752167A>G	ENST00000293760.5	-	3	834	c.815T>C	c.(814-816)cTg>cCg	p.L272P	LEMD2_ENST00000508327.1_5'UTR|LEMD2_ENST00000502643.1_5'Flank	NM_181336.3	NP_851853.1	Q8NC56	LEMD2_HUMAN	LEM domain containing 2	272					negative regulation of MAPK cascade (GO:0043409)|skeletal muscle cell differentiation (GO:0035914)	integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|nuclear membrane (GO:0031965)				central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(2)|pancreas(1)	9						TTCATGCAGCAGCTCCAGCAA	0.567																																						dbGAP											0													110.0	100.0	103.0					6																	33752167		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4785.1, CCDS47411.1	6p21.31	2009-11-06			ENSG00000161904	ENSG00000161904			21244	protein-coding gene	gene with protein product						12477932	Standard	NM_001143944		Approved	dJ482C21.1, NET25	uc011drm.2	Q8NC56	OTTHUMG00000014535	ENST00000293760.5:c.815T>C	6.37:g.33752167A>G	ENSP00000293760:p.Leu272Pro		B4DVH5|E7EVT2|Q5T972|Q5T974	Missense_Mutation	SNP	pfam_Inner-Nucl-membr_MAN1,pfam_LEM,superfamily_LEM-like_dom,smart_LEM,pfscan_LEM	p.L272P	ENST00000293760.5	37	c.815	CCDS4785.1	6	.	.	.	.	.	.	.	.	.	.	A	20.2	3.949945	0.73787	.	.	ENSG00000161904	ENST00000293760	.	.	.	5.61	4.42	0.53409	Inner nuclear membrane protein MAN1 (1);	0.747943	0.11779	N	0.530385	T	0.42359	0.1199	L	0.32530	0.975	0.80722	D	1	D	0.53885	0.963	P	0.54629	0.757	T	0.31558	-0.9939	9	0.62326	D	0.03	-2.4083	10.5702	0.45196	0.8561:0.0:0.0:0.1439	.	272	Q8NC56	LEMD2_HUMAN	P	272	.	ENSP00000293760:L272P	L	-	2	0	LEMD2	33860145	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.536000	0.45693	0.915000	0.36847	0.533000	0.62120	CTG	LEMD2	-	pfam_Inner-Nucl-membr_MAN1	ENSG00000161904		0.567	LEMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEMD2	HGNC	protein_coding	OTTHUMT00000040209.3	60	0.00	0	A	XM_166338		33752167	33752167	-1	no_errors	ENST00000293760	ensembl	human	known	69_37n	missense	49	34.67	26	SNP	0.999	G
MAGEB4	4115	genome.wustl.edu	37	X	30260876	30260876	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chrX:30260876C>G	ENST00000378982.2	+	1	820	c.624C>G	c.(622-624)atC>atG	p.I208M	MAGEB1_ENST00000378981.3_5'Flank|MAGEB1_ENST00000397550.1_5'Flank	NM_002367.3	NP_002358.1	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	208	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27						TGAGTGTGATCTTCTTAAATG	0.512																																						dbGAP											0													92.0	81.0	85.0					X																	30260876		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS14221.1	Xp21.3	2009-03-17			ENSG00000120289	ENSG00000120289			6811	protein-coding gene	gene with protein product	"""melanoma-associated antigen B4"", ""cancer/testis antigen family 3, member 6"""	300153				9441743	Standard	NM_002367		Approved	MGC33144, CT3.6	uc004dcb.3	O15481	OTTHUMG00000021321	ENST00000378982.2:c.624C>G	X.37:g.30260876C>G	ENSP00000368266:p.Ile208Met		B2R9G0|Q6FHH4|Q8IZ00	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.I208M	ENST00000378982.2	37	c.624	CCDS14221.1	X	.	.	.	.	.	.	.	.	.	.	C	12.65	2.001526	0.35320	.	.	ENSG00000120289	ENST00000378982	T	0.12672	2.66	3.2	-0.795	0.10915	.	0.072241	0.52532	U	0.000064	T	0.40570	0.1122	H	0.96015	3.755	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.26608	-1.0098	10	0.87932	D	0	.	3.5263	0.07760	0.0:0.4266:0.1965:0.3769	.	208	O15481	MAGB4_HUMAN	M	208	ENSP00000368266:I208M	ENSP00000368266:I208M	I	+	3	3	MAGEB4	30170797	0.486000	0.25980	0.004000	0.12327	0.165000	0.22458	-0.005000	0.12855	-0.328000	0.08539	0.600000	0.82982	ATC	MAGEB4	-	pfam_MAGE,pfscan_MAGE	ENSG00000120289		0.512	MAGEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB4	HGNC	protein_coding	OTTHUMT00000056159.1	128	0.00	0	C	NM_002367		30260876	30260876	+1	no_errors	ENST00000378982	ensembl	human	known	69_37n	missense	140	23.50	43	SNP	0.004	G
MBNL2	10150	genome.wustl.edu	37	13	97928584	97928584	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr13:97928584A>C	ENST00000376673.3	+	2	876	c.95A>C	c.(94-96)gAa>gCa	p.E32A	MBNL2_ENST00000343600.4_Missense_Mutation_p.E32A|MBNL2_ENST00000345429.6_Missense_Mutation_p.E32A|MBNL2_ENST00000397601.1_Missense_Mutation_p.E32A|MBNL2_ENST00000445661.2_Missense_Mutation_p.E32A			Q5VZF2	MBNL2_HUMAN	muscleblind-like splicing regulator 2	32					mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(4)|lung(7)|prostate(1)|skin(1)	17	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.218)			CGCTCTGATGAAGAATGCAAA	0.423																																						dbGAP											0													152.0	141.0	145.0					13																	97928584		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF061261	CCDS9483.1, CCDS9484.1	13q31.1	2013-01-18	2012-02-23		ENSG00000139793	ENSG00000139793		"""Zinc fingers, CCCH-type domain containing"""	16746	protein-coding gene	gene with protein product		607327	"""muscleblind-like 2 (Drosophila)"""			11929853	Standard	NM_207304		Approved	MBLL, MBLL39	uc001vmz.4	Q5VZF2	OTTHUMG00000017239	ENST00000376673.3:c.95A>C	13.37:g.97928584A>C	ENSP00000365861:p.Glu32Ala		Q3SXY5|Q58F19|Q8NEV3|Q8TD82	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.E32A	ENST00000376673.3	37	c.95		13	.	.	.	.	.	.	.	.	.	.	A	8.268	0.812677	0.16537	.	.	ENSG00000139793	ENST00000397601;ENST00000343600;ENST00000345429;ENST00000376673;ENST00000445661	T;T;T;T;T	0.27557	1.66;1.66;1.66;1.66;1.66	6.06	6.06	0.98353	Zinc finger, CCCH-type (2);	0.000000	0.85682	D	0.000000	T	0.17195	0.0413	N	0.05124	-0.11	0.44048	D	0.996781	B;B;B;B	0.22683	0.003;0.01;0.04;0.073	B;B;B;B	0.25405	0.01;0.007;0.014;0.06	T	0.13845	-1.0494	10	0.10377	T	0.69	.	16.6245	0.84952	1.0:0.0:0.0:0.0	.	32;32;32;32	B4E3F7;Q5VZF2;A2A3S3;Q5VZF2-2	.;MBNL2_HUMAN;.;.	A	32	ENSP00000380726:E32A;ENSP00000344214:E32A;ENSP00000267287:E32A;ENSP00000365861:E32A;ENSP00000406842:E32A	ENSP00000344214:E32A	E	+	2	0	MBNL2	96726585	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.006000	0.63978	2.323000	0.78572	0.528000	0.53228	GAA	MBNL2	-	smart_Znf_CCCH	ENSG00000139793		0.423	MBNL2-202	KNOWN	basic	protein_coding	MBNL2	HGNC	protein_coding		156	0.00	0	A	NM_144778		97928584	97928584	+1	no_errors	ENST00000376673	ensembl	human	known	69_37n	missense	210	26.57	76	SNP	1.000	C
MBOAT4	619373	genome.wustl.edu	37	8	29990295	29990295	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr8:29990295G>A	ENST00000320542.3	-	3	556	c.472C>T	c.(472-474)Cat>Tat	p.H158Y	LEPROTL1_ENST00000523116.1_Intron|LEPROTL1_ENST00000442880.2_Intron	NM_001100916.1	NP_001094386.1	Q96T53	MBOA4_HUMAN	membrane bound O-acyltransferase domain containing 4	158					cellular protein metabolic process (GO:0044267)|peptidyl-serine octanoylation (GO:0018191)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	serine O-acyltransferase activity (GO:0016412)			endometrium(1)	1						TTACACACATGCTCAGACAAA	0.542																																						dbGAP											0													38.0	38.0	38.0					8																	29990295		692	1591	2283	-	-	-	SO:0001583	missense	0			AF359269	CCDS47835.1	8p12	2008-08-04	2006-06-29	2006-06-29	ENSG00000177669	ENSG00000177669			32311	protein-coding gene	gene with protein product	"""ghrelin O-acyltransferase"""	611940	"""O-acyltransferase (membrane bound) domain containing 4"""	OACT4		18443287	Standard	NM_001100916		Approved	FKSG89, GOAT	uc010lvg.3	Q96T53	OTTHUMG00000163824	ENST00000320542.3:c.472C>T	8.37:g.29990295G>A	ENSP00000314196:p.His158Tyr		B1Q003	Missense_Mutation	SNP	pfam_MBOAT_fam	p.H158Y	ENST00000320542.3	37	c.472	CCDS47835.1	8	.	.	.	.	.	.	.	.	.	.	G	6.118	0.390072	0.11581	.	.	ENSG00000177669	ENST00000320542	T	0.72615	-0.67	4.54	2.7	0.31948	.	0.546700	0.16180	N	0.225862	T	0.61048	0.2316	L	0.57536	1.79	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.49153	-0.8969	9	.	.	.	.	5.314	0.15845	0.0959:0.0:0.5433:0.3608	.	158	Q96T53	MBOA4_HUMAN	Y	158	ENSP00000314196:H158Y	.	H	-	1	0	MBOAT4	30109837	0.000000	0.05858	0.388000	0.26195	0.398000	0.30690	0.445000	0.21677	0.638000	0.30545	0.563000	0.77884	CAT	MBOAT4	-	pfam_MBOAT_fam	ENSG00000177669		0.542	MBOAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBOAT4	HGNC	protein_coding	OTTHUMT00000375795.1	35	0.00	0	G			29990295	29990295	-1	no_errors	ENST00000320542	ensembl	human	known	69_37n	missense	55	18.84	13	SNP	0.035	A
MPLKIP	136647	genome.wustl.edu	37	7	40172716	40172716	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr7:40172716C>G	ENST00000306984.6	-	2	573	c.482G>C	c.(481-483)aGc>aCc	p.S161T	C7orf10_ENST00000309930.5_5'Flank|C7orf10_ENST00000540834.1_5'Flank|C7orf10_ENST00000335693.4_5'Flank|C7orf10_ENST00000401647.2_5'Flank	NM_138701.3	NP_619646.1	Q8TAP9	MPLKI_HUMAN	M-phase specific PLK1 interacting protein	161					mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)											GTATTGTTGGCTTATATCCAC	0.363																																						dbGAP											0													161.0	149.0	153.0					7																	40172716		2203	4300	6503	-	-	-	SO:0001583	missense	0			AX048113	CCDS5463.1	7p14	2014-09-17	2012-03-01	2012-03-01	ENSG00000168303	ENSG00000168303			16002	protein-coding gene	gene with protein product	tricothiodystrophy, non-photosensitive 1	609188	"""chromosome 7 open reading frame 11"""	C7orf11		11829489	Standard	NM_138701		Approved	ORF20, TTDN1	uc003thl.4	Q8TAP9	OTTHUMG00000128797	ENST00000306984.6:c.482G>C	7.37:g.40172716C>G	ENSP00000304553:p.Ser161Thr			Missense_Mutation	SNP	NULL	p.S161T	ENST00000306984.6	37	c.482	CCDS5463.1	7	.	.	.	.	.	.	.	.	.	.	C	14.27	2.484947	0.44147	.	.	ENSG00000168303	ENST00000306984	T	0.76709	-1.04	5.55	3.36	0.38483	.	0.255500	0.38111	N	0.001813	T	0.56615	0.1997	N	0.22421	0.69	0.29001	N	0.887488	B	0.13594	0.008	B	0.18561	0.022	T	0.39165	-0.9627	10	0.09084	T	0.74	-17.6805	4.8163	0.13369	0.0:0.5239:0.0:0.4761	.	161	Q8TAP9	TTDN1_HUMAN	T	161	ENSP00000304553:S161T	ENSP00000304553:S161T	S	-	2	0	C7orf11	40139241	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.233000	0.51311	1.318000	0.45170	0.591000	0.81541	AGC	MPLKIP	-	NULL	ENSG00000168303		0.363	MPLKIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPLKIP	HGNC	protein_coding	OTTHUMT00000250729.3	330	0.00	0	C	NM_138701		40172716	40172716	-1	no_errors	ENST00000306984	ensembl	human	known	69_37n	missense	607	15.91	115	SNP	1.000	G
MRPL49	740	genome.wustl.edu	37	11	64889852	64889852	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr11:64889852G>C	ENST00000279242.2	+	1	53	c.34G>C	c.(34-36)Gga>Cga	p.G12R	FAU_ENST00000529639.1_5'UTR|FAU_ENST00000527548.1_5'Flank|MRPL49_ENST00000534078.1_Missense_Mutation_p.G12R|FAU_ENST00000531743.1_5'Flank|FAU_ENST00000529259.1_5'Flank|MRPL49_ENST00000526171.1_Missense_Mutation_p.G12R|FAU_ENST00000434372.2_5'Flank|FAU_ENST00000279259.3_5'Flank|MRPL49_ENST00000524482.1_Intron|MRPL49_ENST00000531705.1_Missense_Mutation_p.G12R|FAU_ENST00000525297.1_5'Flank	NM_004927.3	NP_004918.1	Q13405	RM49_HUMAN	mitochondrial ribosomal protein L49	12					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	structural constituent of ribosome (GO:0003735)			endometrium(1)|ovary(1)	2						TACGCTGCGGGGATGGAGAAC	0.657																																						dbGAP											0													99.0	79.0	86.0					11																	64889852		2201	4297	6498	-	-	-	SO:0001583	missense	0				CCDS8096.1	11q13.1	2012-11-14	2001-10-16	2001-10-19	ENSG00000149792	ENSG00000149792		"""Mitochondrial ribosomal proteins / large subunits"""	1176	protein-coding gene	gene with protein product	"""neighbor of FAU"", ""next to FAU"""	606866	"""chromosome 11 open reading frame 4"""	C11orf4		8786148	Standard	NM_004927		Approved	NOF, NOF1, L49mt	uc001oda.2	Q13405	OTTHUMG00000165608	ENST00000279242.2:c.34G>C	11.37:g.64889852G>C	ENSP00000279242:p.Gly12Arg		B2R4G6	Missense_Mutation	SNP	pfam_Ribosomal_L49/IMG2	p.G12R	ENST00000279242.2	37	c.34	CCDS8096.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.76|10.76	1.441024|1.441024	0.25900|0.25900	.|.	.|.	ENSG00000149792|ENSG00000149792	ENST00000533943|ENST00000534078;ENST00000526171;ENST00000279242;ENST00000531705	.|T;T;T;T	.|0.72615	.|-0.67;0.94;1.0;0.98	4.69|4.69	-5.53|-5.53	0.02552|0.02552	.|.	1.216280|1.216280	0.05428|0.05428	N|N	0.545446|0.545446	T|T	0.44932|0.44932	0.1317|0.1317	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.04013	.|0.001	T|T	0.24512|0.24512	-1.0158|-1.0158	6|10	.|0.13470	.|T	.|0.59	-6.3564|-6.3564	0.176|0.176	0.00118|0.00118	0.3275:0.2397:0.1898:0.243|0.3275:0.2397:0.1898:0.243	.|.	.|12	.|Q13405	.|RM49_HUMAN	A|R	9|12	.|ENSP00000434222:G12R;ENSP00000437177:G12R;ENSP00000279242:G12R;ENSP00000436740:G12R	.|ENSP00000279242:G12R	G|G	+|+	2|1	0|0	MRPL49|MRPL49	64646428|64646428	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.004000|0.004000	0.04260|0.04260	-1.097000|-1.097000	0.03349|0.03349	-0.863000|-0.863000	0.04084|0.04084	-0.311000|-0.311000	0.09066|0.09066	GGG|GGA	MRPL49	-	NULL	ENSG00000149792		0.657	MRPL49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL49	HGNC	protein_coding	OTTHUMT00000385293.1	97	0.00	0	G	NM_004927		64889852	64889852	+1	no_errors	ENST00000279242	ensembl	human	known	69_37n	missense	99	49.75	98	SNP	0.000	C
MTMR12	54545	genome.wustl.edu	37	5	32233994	32233994	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr5:32233994G>C	ENST00000382142.3	-	15	1729	c.1559C>G	c.(1558-1560)aCc>aGc	p.T520S	MTMR12_ENST00000264934.5_Intron|RNU6-1079P_ENST00000362861.1_RNA|MTMR12_ENST00000280285.5_Intron|MTMR12_ENST00000510216.1_5'UTR	NM_001040446.1	NP_001035536.1	Q9C0I1	MTMRC_HUMAN	myotubularin related protein 12	520	Interaction with MTM1.|Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.					cytoplasm (GO:0005737)	phosphatase activity (GO:0016791)			breast(3)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						ATCCCACACGGTGAGCAGATT	0.498																																						dbGAP											0													128.0	120.0	123.0					5																	32233994		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051469	CCDS34138.1, CCDS75230.1	5p15.33	2011-06-09	2005-04-07	2005-04-07	ENSG00000150712	ENSG00000150712		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	18191	protein-coding gene	gene with protein product		606501	"""phosphatidylinositol-3-phosphate associated protein"""	PIP3AP		11504939, 12495846	Standard	XM_005248313		Approved	3-PAP, FLJ20476, KIAA1682, 3PAP	uc003jhq.3	Q9C0I1	OTTHUMG00000161978	ENST00000382142.3:c.1559C>G	5.37:g.32233994G>C	ENSP00000371577:p.Thr520Ser		Q69YJ4|Q6PFW3|Q96QU2|Q9NX27	Missense_Mutation	SNP	pfam_Myotubularin_assoc	p.T520S	ENST00000382142.3	37	c.1559	CCDS34138.1	5	.	.	.	.	.	.	.	.	.	.	G	9.532	1.111218	0.20714	.	.	ENSG00000150712	ENST00000382142	D	0.85411	-1.98	5.63	5.63	0.86233	Myotubularin phosphatase domain (1);	0.314021	0.32719	N	0.005724	T	0.71533	0.3351	N	0.11673	0.155	0.80722	D	1	B	0.21071	0.051	B	0.14023	0.01	T	0.68546	-0.5380	10	0.02654	T	1	.	19.7519	0.96271	0.0:0.0:1.0:0.0	.	520	Q9C0I1	MTMRC_HUMAN	S	520	ENSP00000371577:T520S	ENSP00000371577:T520S	T	-	2	0	MTMR12	32269751	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.890000	0.92477	2.662000	0.90505	0.650000	0.86243	ACC	MTMR12	-	NULL	ENSG00000150712		0.498	MTMR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR12	HGNC	protein_coding	OTTHUMT00000366579.1	152	0.00	0	G	NM_019061		32233994	32233994	-1	no_errors	ENST00000382142	ensembl	human	known	69_37n	missense	245	25.76	85	SNP	1.000	C
MUC2	4583	genome.wustl.edu	37	11	1101932	1101932	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr11:1101932C>A	ENST00000441003.2	+	43	7723	c.7696C>A	c.(7696-7698)Cac>Aac	p.H2566N		NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4928					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GGTGTGTGTTCACGGGAATGC	0.677																																						dbGAP											0													33.0	39.0	37.0					11																	1101932		2054	4185	6239	-	-	-	SO:0001583	missense	0			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.7696C>A	11.37:g.1101932C>A	ENSP00000415183:p.His2566Asn		Q14878	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.H2566N	ENST00000441003.2	37	c.7696		11	.	.	.	.	.	.	.	.	.	.	C	11.32	1.605376	0.28623	.	.	ENSG00000198788	ENST00000441003	T	0.66460	-0.21	3.89	1.94	0.25998	.	.	.	.	.	T	0.63640	0.2528	M	0.77820	2.39	0.09310	N	1	P	0.43477	0.808	B	0.39027	0.288	T	0.54886	-0.8226	9	0.45353	T	0.12	.	8.1099	0.30909	0.0:0.7481:0.1612:0.0907	.	2566	E7EUV1	.	N	2566	ENSP00000415183:H2566N	ENSP00000415183:H2566N	H	+	1	0	MUC2	1091932	0.000000	0.05858	0.024000	0.17045	0.548000	0.35241	-0.139000	0.10358	0.598000	0.29829	0.561000	0.74099	CAC	MUC2	-	smart_VWF_C,pfscan_VWF_C	ENSG00000198788		0.677	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	HGNC	protein_coding	OTTHUMT00000345894.2	92	0.00	0	C	NM_002457		1101932	1101932	+1	no_errors	ENST00000441003	ensembl	human	known	69_37n	missense	59	37.23	35	SNP	0.092	A
MUC20	200958	genome.wustl.edu	37	3	195452951	195452951	+	Missense_Mutation	SNP	G	G	C	rs2688542		TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr3:195452951G>C	ENST00000447234.2	+	2	1603	c.1477G>C	c.(1477-1479)Gat>Cat	p.D493H	MUC20_ENST00000436408.1_Missense_Mutation_p.D493H|MUC20_ENST00000445522.2_Missense_Mutation_p.D458H|MUC20_ENST00000320736.6_Missense_Mutation_p.D322H	NM_001282506.1	NP_001269435.1	Q8N307	MUC20_HUMAN	mucin 20, cell surface associated	493	Involved in oligomerization.		Missing. {ECO:0000269|PubMed:14702039}.	D -> H (in Ref. 1; BAD06718/BAD06720, 2; AAQ88814, 3; BAC11428 and 5; AAH44243). {ECO:0000305}.	activation of MAPK activity (GO:0000187)|cellular protein metabolic process (GO:0044267)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein homooligomerization (GO:0051260)	basal plasma membrane (GO:0009925)|cell projection (GO:0042995)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)				NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)	23	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		AGCTGCACCTGATGCCACGGT	0.602																																						dbGAP											0													53.0	48.0	49.0					3																	195452951		2178	4281	6459	-	-	-	SO:0001583	missense	0			AB037780	CCDS63877.1	3q29	2008-08-07	2006-03-14		ENSG00000176945	ENSG00000176945		"""Mucins"""	23282	protein-coding gene	gene with protein product		610360				14565953	Standard	NM_001282506		Approved	FLJ14408, KIAA1359	uc010hzo.3	Q8N307	OTTHUMG00000155823	ENST00000447234.2:c.1477G>C	3.37:g.195452951G>C	ENSP00000414350:p.Asp493His		Q6UX97|Q76I83|Q76I85|Q86ST8|Q8NBY6|Q96KA1|Q9P2I8	Missense_Mutation	SNP	NULL	p.D493H	ENST00000447234.2	37	c.1477		3	1354	0.61996336996337	233	0.4735772357723577	204	0.56353591160221	451	0.7884615384615384	466	0.6147757255936676	G	8.698	0.909135	0.17833	.	.	ENSG00000176945	ENST00000447234;ENST00000320736;ENST00000436408;ENST00000445522	T;T;T;T	0.20463	2.51;2.58;2.67;2.07	3.94	2.12	0.27331	.	1.625610	0.03967	N	0.290924	T	0.00012	0.0000	L	0.29908	0.895	0.80722	P	0.0	D	0.54964	0.969	P	0.50490	0.642	T	0.41179	-0.9523	9	0.36615	T	0.2	1.5642	5.8281	0.18564	0.2458:0.0:0.7542:0.0	rs2688542;rs3828412	322	E9PH32	.	H	493;322;493;458	ENSP00000414350:D493H;ENSP00000325431:D322H;ENSP00000396774:D493H;ENSP00000405629:D458H	ENSP00000325431:D322H	D	+	1	0	MUC20	196938622	0.001000	0.12720	0.002000	0.10522	0.052000	0.14988	0.431000	0.21444	0.428000	0.26173	0.514000	0.50259	GAT	MUC20	-	NULL	ENSG00000176945		0.602	MUC20-001	KNOWN	basic|appris_candidate	protein_coding	MUC20	HGNC	protein_coding	OTTHUMT00000341835.1	40	0.00	0	G	NM_152673		195452951	195452951	+1	no_errors	ENST00000447234	ensembl	human	known	69_37n	missense	29	14.71	5	SNP	0.004	C
MUC4	4585	genome.wustl.edu	37	3	195506037	195506037	+	Silent	SNP	G	G	T	rs2432527		TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr3:195506037G>T	ENST00000463781.3	-	2	12873	c.12414C>A	c.(12412-12414)tcC>tcA	p.S4138S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.S4138S|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGTCACCTGTGGATACTGAGG	0.577																																						dbGAP											0													18.0	12.0	13.0					3																	195506037		645	1545	2190	-	-	-	SO:0001819	synonymous_variant	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12414C>A	3.37:g.195506037G>T			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.S4138	ENST00000463781.3	37	c.12414	CCDS54700.1	3																																																																																			MUC4	-	NULL	ENSG00000145113		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	112	0.00	0	G	NM_018406		195506037	195506037	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	silent	73	23.16	22	SNP	0.012	T
MUC4	4585	genome.wustl.edu	37	3	195506775	195506775	+	Silent	SNP	G	G	A	rs79609066	byFrequency	TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr3:195506775G>A	ENST00000463781.3	-	2	12135	c.11676C>T	c.(11674-11676)acC>acT	p.T3892T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.T3892T|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T3892T(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGTGTCGGTGACAGGAA	0.592													.|||	23	0.00459265	0.0	0.0014	5008	,	,		8217	0.0		0.0	False		,,,				2504	0.0225					dbGAP											1	Substitution - coding silent(1)	kidney(1)											11.0	9.0	10.0					3																	195506775		565	1303	1868	-	-	-	SO:0001819	synonymous_variant	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11676C>T	3.37:g.195506775G>A			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.T3892	ENST00000463781.3	37	c.11676	CCDS54700.1	3																																																																																			MUC4	-	NULL	ENSG00000145113		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	76	0.00	0	G	NM_018406		195506775	195506775	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	silent	38	13.33	6	SNP	0.996	A
MUC4	4585	genome.wustl.edu	37	3	195508108	195508108	+	Missense_Mutation	SNP	G	G	A	rs374140595		TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr3:195508108G>A	ENST00000463781.3	-	2	10802	c.10343C>T	c.(10342-10344)tCa>tTa	p.S3448L	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S3448L|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGTAGATGCTGAGGAAGTGCT	0.597																																						dbGAP											0													24.0	21.0	22.0					3																	195508108		680	1577	2257	-	-	-	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10343C>T	3.37:g.195508108G>A	ENSP00000417498:p.Ser3448Leu		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.S3448L	ENST00000463781.3	37	c.10343	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	g	6.150	0.395913	0.11638	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35421	1.31;1.42	0.743	-1.49	0.08718	.	.	.	.	.	T	0.33089	0.0851	N	0.19112	0.55	0.09310	N	1	P	0.52170	0.951	D	0.65443	0.935	T	0.20240	-1.0281	8	.	.	.	.	2.1531	0.03805	0.0:0.3256:0.3506:0.3237	.	3320	E7ESK3	.	L	3448	ENSP00000417498:S3448L;ENSP00000420243:S3448L	.	S	-	2	0	MUC4	196992887	0.051000	0.20477	0.010000	0.14722	0.010000	0.07245	0.898000	0.28404	0.088000	0.17205	0.089000	0.15464	TCA	MUC4	-	NULL	ENSG00000145113		0.597	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	107	0.00	0	G	NM_018406		195508108	195508108	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	missense	94	11.32	12	SNP	0.000	A
MUC4	4585	genome.wustl.edu	37	3	195511465	195511465	+	Missense_Mutation	SNP	G	G	A	rs200967978	byFrequency	TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr3:195511465G>A	ENST00000463781.3	-	2	7445	c.6986C>T	c.(6985-6987)gCa>gTa	p.A2329V	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A2329V|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATGCTGAGGAAAG	0.592													.|||	186	0.0371406	0.0703	0.0173	5008	,	,		15743	0.003		0.0596	False		,,,				2504	0.0184					dbGAP											0													5.0	6.0	6.0					3																	195511465		606	1453	2059	-	-	-	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6986C>T	3.37:g.195511465G>A	ENSP00000417498:p.Ala2329Val		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.A2329V	ENST00000463781.3	37	c.6986	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	A	5.479	0.273362	0.10403	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34275	1.37;1.4	.	.	.	.	0.000000	0.24912	U	0.034619	T	0.14356	0.0347	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.13710	-1.0499	8	.	.	.	.	5.4001	0.16291	0.2688:0.0:0.7312:0.0	.	2329	E7ESK3	.	V	2329	ENSP00000417498:A2329V;ENSP00000420243:A2329V	.	A	-	2	0	MUC4	196995860	0.001000	0.12720	0.003000	0.11579	0.027000	0.11550	-0.209000	0.09358	-1.752000	0.01325	-2.092000	0.00371	GCA	MUC4	-	NULL	ENSG00000145113		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	107	0.00	0	G	NM_018406		195511465	195511465	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	missense	142	11.25	18	SNP	0.040	A
MUC4	4585	genome.wustl.edu	37	3	195512343	195512343	+	Silent	SNP	G	G	A	rs113457754		TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr3:195512343G>A	ENST00000463781.3	-	2	6567	c.6108C>T	c.(6106-6108)acC>acT	p.T2036T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.T2036T|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T2036T(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGTATCGGTGACAGGAA	0.567																																						dbGAP											2	Substitution - coding silent(2)	stomach(2)											29.0	25.0	26.0					3																	195512343		688	1575	2263	-	-	-	SO:0001819	synonymous_variant	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6108C>T	3.37:g.195512343G>A			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.T2036	ENST00000463781.3	37	c.6108	CCDS54700.1	3																																																																																			MUC4	-	NULL	ENSG00000145113		0.567	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	70	0.00	0	G	NM_018406		195512343	195512343	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	silent	79	15.96	15	SNP	0.000	A
NBPF12	149013	genome.wustl.edu	37	1	146408106	146408107	+	Frame_Shift_Ins	INS	-	-	A			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr1:146408106_146408107insA	ENST00000442909.2	+	15	2576_2577	c.1740_1741insA	c.(1741-1743)aaafs	p.K581fs	NBPF12_ENST00000439206.2_Intron|NBPF12_ENST00000446760.2_Frame_Shift_Ins_p.K310fs|NBPF12_ENST00000309471.8_Frame_Shift_Ins_p.K235fs			Q5TAG4	NBPFC_HUMAN	neuroblastoma breakpoint family, member 12	0						cytoplasm (GO:0005737)				ovary(2)	2						TCAGAAGCCTCAAAGAGAAATG	0.465																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BG154169	CCDS72881.1	1q21.1	2013-01-17	2011-06-28	2011-06-28	ENSG00000186275	ENSG00000268043		"""neuroblastoma breakpoint family"""	24297	protein-coding gene	gene with protein product		608607	"""KIAA1245"""	KIAA1245		11948409	Standard	NM_001278141		Approved	COAS1		Q5TAG4	OTTHUMG00000043708	ENST00000442909.2:c.1743dupA	1.37:g.146408109_146408109dupA	ENSP00000391116:p.Lys581fs		O95877	Frame_Shift_Ins	INS	pfam_NBPF_dom	p.E310fs	ENST00000442909.2	37	c.927_928		1																																																																																			NBPF12	-	NULL	ENSG00000186275		0.465	NBPF12-001	NOVEL	basic|appris_principal	protein_coding	NBPF12	HGNC	protein_coding	OTTHUMT00000102086.3	131	0.00	0	-	XM_003119146		146408106	146408107	+1	no_errors	ENST00000446760	ensembl	human	known	69_37n	frame_shift_ins	261	48.62	247	INS	0.000:0.001	A
NDST4	64579	genome.wustl.edu	37	4	115791933	115791933	+	Silent	SNP	A	A	G			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr4:115791933A>G	ENST00000264363.2	-	7	2388	c.1710T>C	c.(1708-1710)ccT>ccC	p.P570P		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	570	Heparan sulfate N-deacetylase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		CCTGCCATAGAGGGTCTTTCT	0.448																																						dbGAP											0													73.0	77.0	76.0					4																	115791933		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.1710T>C	4.37:g.115791933A>G			Q2KHM8	Silent	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom	p.P570	ENST00000264363.2	37	c.1710	CCDS3706.1	4																																																																																			NDST4	-	NULL	ENSG00000138653		0.448	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST4	HGNC	protein_coding	OTTHUMT00000256427.1	146	0.00	0	A	NM_022569		115791933	115791933	-1	no_errors	ENST00000264363	ensembl	human	known	69_37n	silent	136	56.09	175	SNP	1.000	G
NEB	4703	genome.wustl.edu	37	2	152527544	152527544	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr2:152527544A>T	ENST00000172853.10	-	38	4646	c.4499T>A	c.(4498-4500)cTa>cAa	p.L1500Q	NEB_ENST00000604864.1_Missense_Mutation_p.L1500Q|NEB_ENST00000603639.1_Missense_Mutation_p.L1500Q|NEB_ENST00000409198.1_Missense_Mutation_p.L1500Q|NEB_ENST00000397345.3_Missense_Mutation_p.L1500Q|NEB_ENST00000427231.2_Missense_Mutation_p.L1500Q			P20929	NEBU_HUMAN	nebulin	1500					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		CACATCACTTAGCTGCTTTGT	0.463																																						dbGAP											0													135.0	130.0	131.0					2																	152527544		2095	4213	6308	-	-	-	SO:0001583	missense	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.4499T>A	2.37:g.152527544A>T	ENSP00000172853:p.Leu1500Gln		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom_bac,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,prints_Nebulin,pfscan_Nebulin_35r-motif,pfscan_SH3_domain	p.L1500Q	ENST00000172853.10	37	c.4499		2	.	.	.	.	.	.	.	.	.	.	A	16.63	3.176144	0.57692	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.06218	3.36;3.33;3.33;3.4	5.42	5.42	0.78866	.	0.256053	0.31134	N	0.008199	T	0.06371	0.0164	L	0.34521	1.04	0.80722	D	1	B	0.24920	0.114	B	0.25291	0.059	T	0.38067	-0.9678	10	0.32370	T	0.25	.	11.7324	0.51746	0.8528:0.1472:0.0:0.0	.	1500	P20929	NEBU_HUMAN	Q	1500	ENSP00000386259:L1500Q;ENSP00000380505:L1500Q;ENSP00000416578:L1500Q;ENSP00000172853:L1500Q	ENSP00000172853:L1500Q	L	-	2	0	NEB	152235790	0.971000	0.33674	0.992000	0.48379	0.962000	0.63368	3.260000	0.51523	2.174000	0.68829	0.533000	0.62120	CTA	NEB	-	smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif	ENSG00000183091		0.463	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		145	0.00	0	A	NM_004543		152527544	152527544	-1	no_errors	ENST00000397345	ensembl	human	known	69_37n	missense	127	33.51	64	SNP	1.000	T
NEBL	10529	genome.wustl.edu	37	10	21097581	21097581	+	Silent	SNP	C	C	A	rs140803920		TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr10:21097581C>A	ENST00000377122.4	-	26	3015	c.2619G>T	c.(2617-2619)gcG>gcT	p.A873A	NEBL_ENST00000377159.4_Intron|NEBL_ENST00000417816.2_Intron	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette	873	Linker.				cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TATAGTGACTCGCCTTTTCTA	0.403																																						dbGAP											0													117.0	111.0	113.0					10																	21097581		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.2619G>T	10.37:g.21097581C>A			B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Silent	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_SH3_domain	p.A873	ENST00000377122.4	37	c.2619	CCDS7134.1	10																																																																																			NEBL	-	NULL	ENSG00000078114		0.403	NEBL-004	KNOWN	basic|CCDS	protein_coding	NEBL	HGNC	protein_coding	OTTHUMT00000047113.1	57	0.00	0	C	NM_006393		21097581	21097581	-1	no_errors	ENST00000377122	ensembl	human	known	69_37n	silent	82	18.81	19	SNP	0.749	A
NES	10763	genome.wustl.edu	37	1	156640029	156640029	+	Silent	SNP	T	T	C			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr1:156640029T>C	ENST00000368223.3	-	4	4083	c.3951A>G	c.(3949-3951)ggA>ggG	p.G1317G		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	1317	Tail.			DPTGEQRPPPQG -> TPLESRGHPLK (in Ref. 1; CAA46780). {ECO:0000305}.	brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GCCTCTGCTCTCCAGTGGGGT	0.652																																						dbGAP											0													52.0	62.0	59.0					1																	156640029		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.3951A>G	1.37:g.156640029T>C			O00552|Q3LIF5|Q5SYZ6	Silent	SNP	pfam_F	p.G1317	ENST00000368223.3	37	c.3951	CCDS1151.1	1																																																																																			NES	-	NULL	ENSG00000132688		0.652	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NES	HGNC	protein_coding	OTTHUMT00000082844.2	31	0.00	0	T	NM_006617		156640029	156640029	-1	no_errors	ENST00000368223	ensembl	human	known	69_37n	silent	56	13.85	9	SNP	0.971	C
NME7	29922	genome.wustl.edu	37	1	169292459	169292459	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr1:169292459T>G	ENST00000367811.3	-	3	430	c.174A>C	c.(172-174)gaA>gaC	p.E58D	NME7_ENST00000472647.1_Missense_Mutation_p.E22D|NME7_ENST00000469474.1_5'UTR|RP4-800F24.1_ENST00000432081.1_RNA	NM_013330.3	NP_037462.1	Q9Y5B8	NDK7_HUMAN	NME/NM23 family member 7	58	DM10. {ECO:0000255|PROSITE- ProRule:PRU00665}.				brain development (GO:0007420)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|CTP biosynthetic process (GO:0006241)|determination of left/right symmetry (GO:0007368)|epithelial cilium movement (GO:0003351)|GTP biosynthetic process (GO:0006183)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|UTP biosynthetic process (GO:0006228)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(8)|skin(1)	16	all_hematologic(923;0.208)					TAAATAAATCTTCCAAGTGCA	0.373																																						dbGAP											0													157.0	166.0	163.0					1																	169292459		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF153191	CCDS1277.1, CCDS44274.1	1q24.2	2014-07-31	2012-05-18		ENSG00000143156	ENSG00000143156			20461	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 67"""	613465	"""non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase)"""			19852809	Standard	NM_197972		Approved	FLJ37194, NM23-H7, CFAP67	uc001gfu.3	Q9Y5B8	OTTHUMG00000034586	ENST00000367811.3:c.174A>C	1.37:g.169292459T>G	ENSP00000356785:p.Glu58Asp		A8K3T6|A8MY09|B3KSW9|Q5TGZ4	Missense_Mutation	SNP	pfam_Nucleoside_diP_kinase,superfamily_Nucleoside_diP_kinase,smart_Uncharacterised_DM10,smart_Nucleoside_diP_kinase,pirsf_NDK7,prints_Nucleoside_diP_kinase	p.E58D	ENST00000367811.3	37	c.174	CCDS1277.1	1	.	.	.	.	.	.	.	.	.	.	T	13.72	2.322083	0.41096	.	.	ENSG00000143156	ENST00000472647;ENST00000367811	T;T	0.55760	0.5;0.5	5.18	2.76	0.32466	Uncharacterised domain DM10 (2);	0.213482	0.47852	D	0.000204	T	0.13628	0.0330	N	0.20574	0.59	0.35561	D	0.804711	B;B	0.12013	0.005;0.003	B;B	0.15052	0.012;0.008	T	0.06954	-1.0798	9	0.22706	T	0.39	-33.6285	3.32	0.07047	0.137:0.0784:0.142:0.6427	.	62;58	Q59GR0;Q9Y5B8	.;NDK7_HUMAN	D	22;58	ENSP00000433341:E22D;ENSP00000356785:E58D	ENSP00000356785:E58D	E	-	3	2	NME7	167559083	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	0.765000	0.26546	2.084000	0.62774	0.533000	0.62120	GAA	NME7	-	smart_Uncharacterised_DM10,pirsf_NDK7	ENSG00000143156		0.373	NME7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NME7	HGNC	protein_coding	OTTHUMT00000083688.1	322	0.31	1	T	NM_013330		169292459	169292459	-1	no_errors	ENST00000367811	ensembl	human	known	69_37n	missense	496	26.37	178	SNP	0.999	G
NTRK3	4916	genome.wustl.edu	37	15	88678619	88678619	+	Missense_Mutation	SNP	C	C	G	rs148888023	byFrequency	TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr15:88678619C>G	ENST00000360948.2	-	9	1078	c.917G>C	c.(916-918)cGt>cCt	p.R306P	NTRK3_ENST00000357724.2_Missense_Mutation_p.R306P|NTRK3_ENST00000540489.2_Missense_Mutation_p.R306P|NTRK3_ENST00000394480.2_Missense_Mutation_p.R306P|NTRK3_ENST00000317501.3_Missense_Mutation_p.R306P|NTRK3_ENST00000558676.1_Missense_Mutation_p.R306P|NTRK3_ENST00000355254.2_Missense_Mutation_p.R306P|NTRK3_ENST00000542733.2_Missense_Mutation_p.R208P|NTRK3_ENST00000557856.1_Missense_Mutation_p.R306P	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	306			R -> C (in dbSNP:rs56386352). {ECO:0000269|PubMed:17344846}.		activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			GCTCACCACACGTGGGGGATC	0.592			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																												dbGAP		Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	0													26.0	29.0	28.0					15																	88678619		2201	4299	6500	-	-	-	SO:0001583	missense	0			U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.917G>C	15.37:g.88678619C>G	ENSP00000354207:p.Arg306Pro		B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_LRR-contain_N,superfamily_Kinase-like_dom,smart_LRR-contain_N,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Tyr_kinase_NGF_rcpt,prints_Tyr_kin_neurotrophic_rcpt_3,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R306P	ENST00000360948.2	37	c.917	CCDS32322.1	15	.	.	.	.	.	.	.	.	.	.	C	12.13	1.846910	0.32606	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000540489;ENST00000317501	T;T;T;T;T;T;T	0.72394	-0.65;-0.65;-0.65;-0.65;-0.65;-0.65;-0.65	5.28	5.28	0.74379	Immunoglobulin-like fold (1);	0.229312	0.45867	D	0.000331	T	0.67249	0.2873	L	0.52126	1.63	0.20563	N	0.999888	P;P;P;D;P;P	0.57571	0.731;0.811;0.657;0.98;0.904;0.657	B;B;B;B;B;B	0.41988	0.14;0.157;0.258;0.347;0.372;0.346	T	0.65294	-0.6203	10	0.44086	T	0.13	.	17.9266	0.88985	0.0:1.0:0.0:0.0	.	208;306;306;306;306;306	B7Z7U4;E9PG56;B7Z4C5;Q96CY4;Q16288-3;Q16288	.;.;.;.;.;NTRK3_HUMAN	P	306;306;306;306;208;306;306	ENSP00000377990:R306P;ENSP00000354207:R306P;ENSP00000350356:R306P;ENSP00000347397:R306P;ENSP00000437773:R208P;ENSP00000444673:R306P;ENSP00000318328:R306P	ENSP00000318328:R306P	R	-	2	0	NTRK3	86479623	0.914000	0.31030	0.142000	0.22268	0.408000	0.30992	2.090000	0.41682	2.454000	0.82982	0.563000	0.77884	CGT	NTRK3	-	prints_Tyr_kin_neurotrophic_rcpt_3	ENSG00000140538		0.592	NTRK3-204	KNOWN	basic|CCDS	protein_coding	NTRK3	HGNC	protein_coding		56	0.00	0	C			88678619	88678619	-1	no_errors	ENST00000360948	ensembl	human	known	69_37n	missense	63	27.59	24	SNP	0.210	G
OBSCN	84033	genome.wustl.edu	37	1	228506947	228506947	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr1:228506947G>A	ENST00000422127.1	+	54	14538	c.14494G>A	c.(14494-14496)Gcc>Acc	p.A4832T	OBSCN_ENST00000366709.4_Missense_Mutation_p.A1951T|OBSCN_ENST00000570156.2_Missense_Mutation_p.A5789T|OBSCN_ENST00000366707.4_Missense_Mutation_p.A2466T|OBSCN_ENST00000284548.11_Missense_Mutation_p.A4832T	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4832					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CTCACCACTGGCCAGCAAGGT	0.577																																						dbGAP											0													14.0	16.0	15.0					1																	228506947		2004	4153	6157	-	-	-	SO:0001583	missense	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.14494G>A	1.37:g.228506947G>A	ENSP00000409493:p.Ala4832Thr		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.A4832T	ENST00000422127.1	37	c.14494	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	g	8.430	0.848406	0.17034	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.61859	0.47;0.07;0.11;0.61	3.12	2.21	0.28008	.	0.546958	0.17412	N	0.175156	T	0.31104	0.0786	N	0.17082	0.46	0.09310	N	0.999998	B;B	0.12013	0.0;0.005	B;B	0.09377	0.001;0.004	T	0.19451	-1.0305	10	0.06625	T	0.88	.	5.3841	0.16208	0.2141:0.1694:0.6166:0.0	.	4832;4832	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	T	4832;4832;2466;1951	ENSP00000284548:A4832T;ENSP00000409493:A4832T;ENSP00000355668:A2466T;ENSP00000355670:A1951T	ENSP00000284548:A4832T	A	+	1	0	OBSCN	226573570	0.888000	0.30383	0.675000	0.29917	0.045000	0.14185	0.568000	0.23623	0.876000	0.35872	-1.249000	0.01516	GCC	OBSCN	-	NULL	ENSG00000154358		0.577	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		26	0.00	0	G	NM_052843		228506947	228506947	+1	no_errors	ENST00000422127	ensembl	human	known	69_37n	missense	53	11.67	7	SNP	0.375	A
OBSCN	84033	genome.wustl.edu	37	1	228509882	228509882	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr1:228509882G>A	ENST00000422127.1	+	55	15384	c.15340G>A	c.(15340-15342)Gag>Aag	p.E5114K	OBSCN_ENST00000366709.4_Missense_Mutation_p.E2233K|OBSCN_ENST00000570156.2_Missense_Mutation_p.E6071K|OBSCN_ENST00000366707.4_Missense_Mutation_p.E2748K|OBSCN_ENST00000284548.11_Missense_Mutation_p.E5114K	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5114					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGTGCCTCCAGAGCCATTGCC	0.617																																						dbGAP											0													38.0	44.0	42.0					1																	228509882		2072	4206	6278	-	-	-	SO:0001583	missense	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.15340G>A	1.37:g.228509882G>A	ENSP00000409493:p.Glu5114Lys		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.E5114K	ENST00000422127.1	37	c.15340	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	G	16.05	3.012938	0.54468	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.61980	0.45;0.06;0.12;0.61	5.3	2.31	0.28768	.	1.028430	0.07706	N	0.941172	T	0.44912	0.1316	N	0.24115	0.695	0.09310	N	1	B;B	0.14438	0.006;0.01	B;B	0.12156	0.003;0.007	T	0.28170	-1.0052	10	0.15952	T	0.53	.	7.0113	0.24863	0.1434:0.2697:0.587:0.0	.	5114;5114	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	K	5114;5114;2748;2233	ENSP00000284548:E5114K;ENSP00000409493:E5114K;ENSP00000355668:E2748K;ENSP00000355670:E2233K	ENSP00000284548:E5114K	E	+	1	0	OBSCN	226576505	0.004000	0.15560	0.001000	0.08648	0.004000	0.04260	1.068000	0.30629	0.201000	0.20466	-0.145000	0.13849	GAG	OBSCN	-	NULL	ENSG00000154358		0.617	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		35	0.00	0	G	NM_052843		228509882	228509882	+1	no_errors	ENST00000422127	ensembl	human	known	69_37n	missense	87	21.62	24	SNP	0.003	A
PFKP	5214	genome.wustl.edu	37	10	3178021	3178021	+	Missense_Mutation	SNP	C	C	T	rs199868194		TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr10:3178021C>T	ENST00000381125.4	+	21	2292	c.2216C>T	c.(2215-2217)aCg>aTg	p.T739M	PFKP_ENST00000381072.1_Missense_Mutation_p.T157M|PITRM1_ENST00000464395.1_5'Flank|PFKP_ENST00000381075.2_Missense_Mutation_p.T731M	NM_002627.4	NP_002618.1	Q01813	PFKAP_HUMAN	phosphofructokinase, platelet	739	C-terminal regulatory PFK domain 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein complex binding (GO:0032403)			breast(2)|central_nervous_system(4)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)		AAGAAGCAAACGGATTTTGAG	0.443																																						dbGAP											0													70.0	69.0	69.0					10																	3178021		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK092597	CCDS7059.1, CCDS55698.1	10p15.3-p15.2	2006-08-25			ENSG00000067057	ENSG00000067057	2.7.1.11		8878	protein-coding gene	gene with protein product	"""Phosphofructokinase, platelet type"""	171840					Standard	NM_002627		Approved	PFK-C, PFKF	uc001igp.3	Q01813	OTTHUMG00000017556	ENST00000381125.4:c.2216C>T	10.37:g.3178021C>T	ENSP00000370517:p.Thr739Met		B3KS15|Q5VSR7|Q5VSR8	Missense_Mutation	SNP	pfam_Phosphofructokinase_dom,superfamily_Phosphofructokinase_dom,pirsf_6-phosphofructokinase_euk,prints_Phosphofructokinase,tigrfam_6-phosphofructokinase_euk	p.T739M	ENST00000381125.4	37	c.2216	CCDS7059.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	21.8|21.8	4.198879|4.198879	0.79015|0.79015	.|.	.|.	ENSG00000067057|ENSG00000067057	ENST00000433193|ENST00000381125;ENST00000397834;ENST00000381075;ENST00000381072	.|T;T;T	.|0.80123	.|-1.34;-1.34;-1.34	4.92|4.92	4.92|4.92	0.64577|0.64577	.|Phosphofructokinase domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.91700|0.91700	0.7376|0.7376	M|M	0.89840|0.89840	3.065|3.065	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.87578	.|0.998;0.998;0.997	D|D	0.93554|0.93554	0.6889|0.6889	5|10	.|0.87932	.|D	.|0	.|.	18.1489|18.1489	0.89668|0.89668	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|731;731;739	.|B3KS15;Q5VSR7;Q01813	.|.;.;K6PP_HUMAN	W|M	92|739;728;731;157	.|ENSP00000370517:T739M;ENSP00000370465:T731M;ENSP00000370462:T157M	.|ENSP00000370462:T157M	R|T	+|+	1|2	2|0	PFKP|PFKP	3168021|3168021	1.000000|1.000000	0.71417|0.71417	0.298000|0.298000	0.25002|0.25002	0.779000|0.779000	0.44077|0.44077	4.644000|4.644000	0.61397|0.61397	2.276000|2.276000	0.75962|0.75962	0.462000|0.462000	0.41574|0.41574	CGG|ACG	PFKP	-	superfamily_Phosphofructokinase_dom,pirsf_6-phosphofructokinase_euk,tigrfam_6-phosphofructokinase_euk	ENSG00000067057		0.443	PFKP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PFKP	HGNC	protein_coding	OTTHUMT00000046454.1	167	0.00	0	C	NM_002627		3178021	3178021	+1	no_errors	ENST00000381125	ensembl	human	known	69_37n	missense	392	14.04	64	SNP	1.000	T
POTEM	641455	genome.wustl.edu	37	14	20020113	20020113	+	Silent	SNP	C	C	T	rs199622050		TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr14:20020113C>T	ENST00000551509.1	-	1	159	c.108G>A	c.(106-108)agG>agA	p.R36R		NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M	36										endometrium(4)|kidney(1)|lung(4)	9						TGCCGCTCCCCCTGCACCAGG	0.587																																						dbGAP											0													5.0	6.0	6.0					14																	20020113		197	578	775	-	-	-	SO:0001819	synonymous_variant	0				CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.108G>A	14.37:g.20020113C>T				Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.R36	ENST00000551509.1	37	c.108	CCDS45076.1	14																																																																																			POTEM	-	NULL	ENSG00000187537		0.587	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	POTEM	HGNC	protein_coding	OTTHUMT00000409490.3	17	0.00	0	C	NM_001145442		20020113	20020113	-1	no_errors	ENST00000547848	ensembl	human	known	69_37n	silent	41	19.61	10	SNP	0.101	T
PRKG2	5593	genome.wustl.edu	37	4	82061764	82061764	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr4:82061764T>C	ENST00000395578.1	-	12	1583	c.1467A>G	c.(1465-1467)atA>atG	p.I489M	PRKG2_ENST00000264399.1_Missense_Mutation_p.I489M|PRKG2_ENST00000509169.1_5'UTR|PRKG2_ENST00000545647.1_Missense_Mutation_p.I69M|PRKG2_ENST00000418486.2_Missense_Mutation_p.I460M			Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	489	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|circadian regulation of gene expression (GO:0032922)|nitric oxide metabolic process (GO:0046209)|protein phosphorylation (GO:0006468)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)|protein kinase activity (GO:0004672)			NS(1)|breast(4)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	37						TGGTGTCAACTATGTGCTTCT	0.383																																						dbGAP											0													171.0	151.0	158.0					4																	82061764		2203	4300	6503	-	-	-	SO:0001583	missense	0			X94612	CCDS3589.1, CCDS75150.1	4q13.1-q21.1	2009-07-10			ENSG00000138669	ENSG00000138669	2.7.11.1		9416	protein-coding gene	gene with protein product		601591				7498513	Standard	XM_005263126		Approved	cGKII, PRKGR2	uc003hmh.2	Q13237	OTTHUMG00000130296	ENST00000395578.1:c.1467A>G	4.37:g.82061764T>C	ENSP00000378945:p.Ile489Met		B4DMX3|E7EPE6|O00125|O60916	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_cNMP-bd_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_cGMP-dependent_protein_kinase,pfscan_cNMP-bd_dom,pfscan_Prot_kinase_cat_dom,prints_cGMP_dep_kinase,prints_cAMP/cGMP_kin	p.I489M	ENST00000395578.1	37	c.1467	CCDS3589.1	4	.	.	.	.	.	.	.	.	.	.	T	14.65	2.598422	0.46318	.	.	ENSG00000138669	ENST00000395578;ENST00000264399;ENST00000418486;ENST00000545647	T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17	5.98	-12.0	0.00017	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.149639	0.56097	D	0.000021	T	0.57740	0.2074	L	0.35593	1.075	0.31755	N	0.634049	D;P	0.89917	1.0;0.897	D;P	0.77004	0.989;0.859	T	0.82612	-0.0371	10	0.59425	D	0.04	-23.8938	11.1483	0.48442	0.401:0.0:0.4195:0.1796	.	460;489	E7EPE6;Q13237	.;KGP2_HUMAN	M	489;489;460;69	ENSP00000378945:I489M;ENSP00000264399:I489M;ENSP00000389038:I460M;ENSP00000439967:I69M	ENSP00000264399:I489M	I	-	3	3	PRKG2	82280788	0.019000	0.18553	0.240000	0.24138	0.543000	0.35085	-1.045000	0.03528	-3.088000	0.00248	-1.195000	0.01675	ATA	PRKG2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_cGMP-dependent_protein_kinase,pfscan_Prot_kinase_cat_dom	ENSG00000138669		0.383	PRKG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKG2	HGNC	protein_coding	OTTHUMT00000252639.1	228	0.00	0	T	NM_006259		82061764	82061764	-1	no_errors	ENST00000264399	ensembl	human	known	69_37n	missense	359	17.85	78	SNP	0.028	C
PRUNE	58497	genome.wustl.edu	37	1	151006389	151006389	+	Silent	SNP	T	T	C			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr1:151006389T>C	ENST00000271620.3	+	8	1197	c.1041T>C	c.(1039-1041)tcT>tcC	p.S347S	BNIPL_ENST00000368931.3_5'Flank|PRUNE_ENST00000368934.1_Silent_p.S112S|PRUNE_ENST00000368936.1_Silent_p.S165S|PRUNE_ENST00000368935.1_Silent_p.S62S|PRUNE_ENST00000368937.1_Silent_p.S112S|BNIPL_ENST00000295294.7_5'Flank|PRUNE_ENST00000271619.8_Silent_p.S135S	NM_021222.1	NP_067045.1	Q86TP1	PRUNE_HUMAN	prune exopolyphosphatase	347						cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	inorganic diphosphatase activity (GO:0004427)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	14	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CCCAGGTCTCTCGAAAGAAAC	0.552																																						dbGAP											0													130.0	125.0	127.0					1																	151006389		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U67085	CCDS977.1	1q21.2	2013-04-29	2013-04-29		ENSG00000143363	ENSG00000143363	3.6.1.11		13420	protein-coding gene	gene with protein product			"""prune homolog (Drosophila)"""			10602478, 11687967, 18700747	Standard	NM_021222		Approved	DRES-17, HTCD37	uc001ewh.1	Q86TP1	OTTHUMG00000035062	ENST00000271620.3:c.1041T>C	1.37:g.151006389T>C			B2RCH8|B4DFL7|Q5SZF9|Q659E5|Q6P4E0|Q8N654|Q96JU5|Q9C071|Q9C072|Q9UIV0	Silent	SNP	pfam_DHHA2,pfam_Pesterase_RecJ	p.S347	ENST00000271620.3	37	c.1041	CCDS977.1	1																																																																																			PRUNE	-	pfam_DHHA2	ENSG00000143363		0.552	PRUNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRUNE	HGNC	protein_coding	OTTHUMT00000084885.1	79	0.00	0	T	NM_021222		151006389	151006389	+1	no_errors	ENST00000271620	ensembl	human	known	69_37n	silent	101	59.77	153	SNP	0.998	C
PSMB11	122706	genome.wustl.edu	37	14	23511785	23511785	+	Silent	SNP	G	G	T	rs200575349		TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr14:23511785G>T	ENST00000408907.2	+	1	410	c.351G>T	c.(349-351)ctG>ctT	p.L117L		NM_001099780.1	NP_001093250.1	A5LHX3	PSB11_HUMAN	proteasome (prosome, macropain) subunit, beta type, 11	117					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)			endometrium(1)|kidney(2)|lung(4)	7	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00643)		TTCGGGAACTGAGGGAGGGTC	0.612																																						dbGAP											0													65.0	71.0	69.0					14																	23511785		2100	4224	6324	-	-	-	SO:0001819	synonymous_variant	0				CCDS41923.1	14q11.2	2008-01-31				ENSG00000222028			31963	protein-coding gene	gene with protein product		611137				17540904	Standard	NM_001099780		Approved	beta5t	uc010ake.1	A5LHX3		ENST00000408907.2:c.351G>T	14.37:g.23511785G>T				Silent	SNP	pfam_Proteasome_sua/b,prints_Pept_T1A_subB	p.L117	ENST00000408907.2	37	c.351	CCDS41923.1	14																																																																																			PSMB11	-	pfam_Proteasome_sua/b	ENSG00000222028		0.612	PSMB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMB11	HGNC	protein_coding	OTTHUMT00000408294.1	41	0.00	0	G	NM_001099780		23511785	23511785	+1	no_errors	ENST00000408907	ensembl	human	known	69_37n	silent	124	25.60	43	SNP	0.642	T
RASGRP2	10235	genome.wustl.edu	37	11	64503109	64503109	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr11:64503109G>A	ENST00000354024.3	-	11	1453	c.1201C>T	c.(1201-1203)Cca>Tca	p.P401S	RASGRP2_ENST00000377497.3_Missense_Mutation_p.P401S|RASGRP2_ENST00000377494.1_Missense_Mutation_p.P401S|RASGRP2_ENST00000394432.3_Missense_Mutation_p.P401S	NM_153819.1	NP_722541.1	Q7LDG7	GRP2_HUMAN	RAS guanyl releasing protein 2 (calcium and DAG-regulated)	401					blood coagulation (GO:0007596)|cellular response to calcium ion (GO:0071277)|platelet activation (GO:0030168)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GGCCGGGGTGGTGGGGTGCAA	0.657																																						dbGAP											0													29.0	30.0	30.0					11																	64503109		2201	4296	6497	-	-	-	SO:0001583	missense	0			U78170	CCDS31598.1	11q13	2014-09-17			ENSG00000068831	ENSG00000068831		"""EF-hand domain containing"""	9879	protein-coding gene	gene with protein product		605577				9789079	Standard	NM_001098670		Approved	CALDAG-GEFI	uc009ypv.3	Q7LDG7	OTTHUMG00000045420	ENST00000354024.3:c.1201C>T	11.37:g.64503109G>A	ENSP00000338864:p.Pro401Ser		A6NDC7|O00538|Q9UL65	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,smart_EF_hand_Ca-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_EF_HAND_2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.P401S	ENST00000354024.3	37	c.1201	CCDS31598.1	11	.	.	.	.	.	.	.	.	.	.	G	12.51	1.958293	0.34565	.	.	ENSG00000068831	ENST00000377494;ENST00000394432;ENST00000377497;ENST00000354024	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	4.72	4.72	0.59763	Ras guanine nucleotide exchange factor, domain (1);	0.172230	0.51477	D	0.000083	T	0.41604	0.1166	L	0.57536	1.79	0.80722	D	1	B;B	0.15930	0.015;0.015	B;B	0.10450	0.005;0.005	T	0.30650	-0.9971	10	0.40728	T	0.16	-36.7256	15.5566	0.76200	0.0:0.0:1.0:0.0	.	401;401	Q7LDG7;A6NDC7	GRP2_HUMAN;.	S	401	ENSP00000366714:P401S;ENSP00000377953:P401S;ENSP00000366717:P401S;ENSP00000338864:P401S	ENSP00000338864:P401S	P	-	1	0	RASGRP2	64259685	0.943000	0.32029	0.926000	0.36857	0.602000	0.36980	1.773000	0.38563	2.343000	0.79666	0.561000	0.74099	CCA	RASGRP2	-	superfamily_Ras_GEF_dom	ENSG00000068831		0.657	RASGRP2-002	NOVEL	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	RASGRP2	HGNC	protein_coding	OTTHUMT00000142062.1	73	0.00	0	G	NM_153819		64503109	64503109	-1	no_errors	ENST00000377494	ensembl	human	known	69_37n	missense	69	29.59	29	SNP	0.804	A
RBM14	10432	genome.wustl.edu	37	11	66391939	66391939	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr11:66391939T>C	ENST00000310137.4	+	2	731	c.592T>C	c.(592-594)Ttt>Ctt	p.F198L	RBM14-RBM4_ENST00000500635.2_Intron|RBM4_ENST00000514361.3_Intron|RBM14_ENST00000409738.4_Intron|RBM4_ENST00000503028.2_Intron|RBM14_ENST00000393979.3_Intron|RBM14_ENST00000461478.1_3'UTR|RBM14_ENST00000409372.1_3'UTR|RBM14-RBM4_ENST00000511114.1_Intron|RBM14-RBM4_ENST00000412278.2_Intron	NM_006328.3	NP_006319.1	Q96PK6	RBM14_HUMAN	RNA binding motif protein 14	198					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|glucocorticoid receptor signaling pathway (GO:0042921)|histone deacetylation (GO:0016575)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to hormone (GO:0009725)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)		RBM14/PACS1(2)	breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						CACTGGTGGCTTTGATGGGCA	0.617																																						dbGAP											0													53.0	54.0	53.0					11																	66391939		2200	4295	6495	-	-	-	SO:0001583	missense	0			AF080561	CCDS8147.1, CCDS55772.1, CCDS55773.1	11q13.2	2013-02-12			ENSG00000239306	ENSG00000239306		"""RNA binding motif (RRM) containing"""	14219	protein-coding gene	gene with protein product	"""coactivator activator"", ""SYT interacting protein"""	612409				9285794	Standard	NM_006328		Approved	SIP, SYTIP1, COAA, DKFZp779J0927	uc001oit.3	Q96PK6	OTTHUMG00000140380	ENST00000310137.4:c.592T>C	11.37:g.66391939T>C	ENSP00000311747:p.Phe198Leu		B0LM41|B3KMN4|D6RGD8|O75932|Q2PYN1|Q53GV1|Q68DQ9|Q96PK5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.F198L	ENST00000310137.4	37	c.592	CCDS8147.1	11	.	.	.	.	.	.	.	.	.	.	T	14.41	2.526792	0.44969	.	.	ENSG00000239306	ENST00000310137	T	0.81330	-1.48	5.61	4.49	0.54785	.	0.067361	0.64402	D	0.000008	T	0.62780	0.2456	N	0.14661	0.345	0.80722	D	1	B	0.18741	0.03	B	0.06405	0.002	T	0.61481	-0.7054	10	0.56958	D	0.05	-6.1378	6.2749	0.20975	0.0:0.1745:0.0:0.8255	.	198	Q96PK6	RBM14_HUMAN	L	198	ENSP00000311747:F198L	ENSP00000311747:F198L	F	+	1	0	RBM14	66148515	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.358000	0.52284	2.143000	0.66587	0.533000	0.62120	TTT	RBM14	-	NULL	ENSG00000239306		0.617	RBM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM14	HGNC	protein_coding	OTTHUMT00000277128.1	44	0.00	0	T	NM_006328		66391939	66391939	+1	no_errors	ENST00000310137	ensembl	human	known	69_37n	missense	41	19.61	10	SNP	1.000	C
RNU6-46P	100873760	genome.wustl.edu	37	11	67663113	67663113	+	RNA	SNP	G	G	A	rs2428819	byFrequency	TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr11:67663113G>A	ENST00000383860.1	+	0	12					NR_046497.1				RNA, U6 small nuclear 46, pseudogene																		tgcttgcttcggctgcacata	0.403													-|||	3748	0.748403	0.531	0.804	5008	,	,		20925	0.9464		0.7753	False		,,,				2504	0.771					dbGAP											0																																										-	-	-			0					11q13.2	2013-05-01	2013-05-01	2013-05-01	ENSG00000206587	ENSG00000206587			34290	pseudogene	RNA, pseudogene			"""RNA, U6 small nuclear 46"""	RNU6-46			Standard	NR_046497		Approved						11.37:g.67663113G>A				RNA	SNP	-	NULL	ENST00000383860.1	37	NULL		11																																																																																			RNU6-46	-	-	ENSG00000206587		0.403	RNU6-46P-201	KNOWN	basic	snRNA	RNU6-46	HGNC	snRNA		150	0.00	0	G	NR_046497		67663113	67663113	+1	no_errors	ENST00000383860	ensembl	human	known	69_37n	rna	105	12.40	15	SNP	0.000	A
SDK2	54549	genome.wustl.edu	37	17	71426721	71426721	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr17:71426721A>T	ENST00000392650.3	-	12	1512	c.1512T>A	c.(1510-1512)gaT>gaA	p.D504E	SDK2_ENST00000388726.3_Missense_Mutation_p.D504E	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	504	Ig-like C2-type 6.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						TGACACTCTGATCCTGGGGGG	0.607																																						dbGAP											0													46.0	40.0	42.0					17																	71426721		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.1512T>A	17.37:g.71426721A>T	ENSP00000376421:p.Asp504Glu		A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.D504E	ENST00000392650.3	37	c.1512	CCDS45769.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.6|22.6	4.304959|4.304959	0.81247|0.81247	.|.	.|.	ENSG00000069188|ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000316893|ENST00000416616	T;T|.	0.78707|.	-1.2;-1.2|.	4.49|4.49	3.51|3.51	0.40186|0.40186	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.76004|0.76004	0.3927|0.3927	M|M	0.84773|0.84773	2.715|2.715	0.48696|0.48696	D|D	0.999693|0.999693	D;D|.	0.63880|.	0.993;0.977|.	D;P|.	0.65233|.	0.933;0.855|.	T|T	0.78011|0.78011	-0.2371|-0.2371	10|5	0.56958|.	D|.	0.05|.	.|.	12.3187|12.3187	0.54973|0.54973	0.0852:0.0:0.9148:0.0|0.0852:0.0:0.9148:0.0	.|.	504;504|.	Q58EX2-2;Q58EX2|.	.;SDK2_HUMAN|.	E|T	128;504;504;504|409	ENSP00000376421:D504E;ENSP00000373378:D504E|.	ENSP00000324967:D504E|.	D|S	-|-	3|1	2|0	SDK2|SDK2	68938316|68938316	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.825000|0.825000	0.46686|0.46686	3.999000|3.999000	0.57031|0.57031	1.016000|1.016000	0.39470|0.39470	-0.230000|-0.230000	0.12252|0.12252	GAT|TCA	SDK2	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000069188		0.607	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK2	HGNC	protein_coding	OTTHUMT00000327598.2	85	0.00	0	A	NM_019064		71426721	71426721	-1	no_errors	ENST00000392650	ensembl	human	known	69_37n	missense	57	53.28	65	SNP	1.000	T
SEC16B	89866	genome.wustl.edu	37	1	177917055	177917055	+	Missense_Mutation	SNP	C	C	G	rs200132735	byFrequency	TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr1:177917055C>G	ENST00000308284.6	-	13	1657	c.1568G>C	c.(1567-1569)gGa>gCa	p.G523A	SEC16B_ENST00000464631.2_Missense_Mutation_p.G524A|RP4-798P15.3_ENST00000354921.3_RNA	NM_033127.2	NP_149118.2	Q96JE7	SC16B_HUMAN	SEC16 homolog B (S. cerevisiae)	523					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|positive regulation of gene expression (GO:0010628)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endoplasmic reticulum (GO:0070972)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)				central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)|stomach(1)	35						CCTCCAGTCTCCCCACTGCTT	0.468																																						dbGAP											0													45.0	48.0	47.0					1																	177917055		1938	4090	6028	-	-	-	SO:0001583	missense	0			AK090411	CCDS44281.1	1q25.2	2012-10-08	2007-06-20	2007-06-20	ENSG00000120341	ENSG00000120341			30301	protein-coding gene	gene with protein product	"""regucalcin gene promotor region related protein"""	612855	"""leucine zipper transcription regulator 2"""	LZTR2		11572484, 11605020	Standard	NM_033127		Approved	RGPR, PGPR-p117	uc001gli.1	Q96JE7	OTTHUMG00000167206	ENST00000308284.6:c.1568G>C	1.37:g.177917055C>G	ENSP00000308339:p.Gly523Ala		A3EYF1|Q5HYF6|Q8N7D6|Q96GX6	Missense_Mutation	SNP	NULL	p.G523A	ENST00000308284.6	37	c.1568	CCDS44281.1	1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.847385	0.91277	.	.	ENSG00000120341	ENST00000308284;ENST00000414025;ENST00000239472;ENST00000464631	T;T	0.52526	2.24;0.66	5.51	5.51	0.81932	.	0.000000	0.64402	D	0.000004	T	0.68522	0.3010	M	0.67953	2.075	0.80722	D	1	D;D;D;D;P	0.76494	0.999;0.997;0.998;0.997;0.915	D;D;D;D;P	0.73708	0.973;0.981;0.978;0.96;0.8	T	0.70630	-0.4819	10	0.72032	D	0.01	-14.2284	19.0314	0.92959	0.0:1.0:0.0:0.0	.	78;524;524;523;220	B1AM07;E9PK14;B1AM08;Q96JE7;Q96PW0	.;.;.;SC16B_HUMAN;.	A	523;207;238;524	ENSP00000308339:G523A;ENSP00000431727:G524A	ENSP00000239472:G238A	G	-	2	0	AL359075.1	176183678	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.022000	0.76431	2.582000	0.87167	0.557000	0.71058	GGA	SEC16B	-	NULL	ENSG00000120341		0.468	SEC16B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC16B	Clone_based_vega_gene	protein_coding	OTTHUMT00000084773.16	91	0.00	0	C	NM_033127		177917055	177917055	-1	no_errors	ENST00000308284	ensembl	human	known	69_37n	missense	76	20.19	21	SNP	1.000	G
SGPP1	81537	genome.wustl.edu	37	14	64153112	64153112	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr14:64153112G>C	ENST00000247225.6	-	3	1131	c.1037C>G	c.(1036-1038)tCt>tGt	p.S346C		NM_030791.2	NP_110418.1	Q9BX95	SGPP1_HUMAN	sphingosine-1-phosphate phosphatase 1	346					extrinsic apoptotic signaling pathway (GO:0097191)|intrinsic apoptotic signaling pathway (GO:0097193)|small molecule metabolic process (GO:0044281)|sphinganine-1-phosphate metabolic process (GO:0006668)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	sphingosine-1-phosphate phosphatase activity (GO:0042392)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(4)|skin(2)	10				OV - Ovarian serous cystadenocarcinoma(108;0.0056)|all cancers(60;0.0141)|BRCA - Breast invasive adenocarcinoma(234;0.103)		TGTATCTAGAGAAGGATCTAA	0.438																																						dbGAP											0													87.0	78.0	81.0					14																	64153112		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ293294	CCDS9760.1	14q23.1	2003-09-17			ENSG00000126821	ENSG00000126821			17720	protein-coding gene	gene with protein product		612826				10859351	Standard	NM_030791		Approved		uc001xgj.3	Q9BX95	OTTHUMG00000029080	ENST00000247225.6:c.1037C>G	14.37:g.64153112G>C	ENSP00000247225:p.Ser346Cys		B2RAH0|Q9H189	Missense_Mutation	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.S346C	ENST00000247225.6	37	c.1037	CCDS9760.1	14	.	.	.	.	.	.	.	.	.	.	G	13.12	2.142564	0.37825	.	.	ENSG00000126821	ENST00000247225	.	.	.	5.99	5.99	0.97316	.	0.724675	0.13426	N	0.388794	T	0.62392	0.2424	L	0.40543	1.245	0.35747	D	0.819125	D	0.57899	0.981	P	0.49047	0.599	T	0.68074	-0.5505	9	0.54805	T	0.06	-24.7657	20.4748	0.99174	0.0:0.0:1.0:0.0	.	346	Q9BX95	SGPP1_HUMAN	C	346	.	ENSP00000247225:S346C	S	-	2	0	SGPP1	63222865	1.000000	0.71417	0.592000	0.28758	0.100000	0.18952	7.278000	0.78587	2.843000	0.97960	0.655000	0.94253	TCT	SGPP1	-	NULL	ENSG00000126821		0.438	SGPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGPP1	HGNC	protein_coding	OTTHUMT00000072626.3	146	0.00	0	G	NM_030791		64153112	64153112	-1	no_errors	ENST00000247225	ensembl	human	known	69_37n	missense	43	71.90	110	SNP	0.665	C
SIGLEC9	27180	genome.wustl.edu	37	19	51631731	51631731	+	Silent	SNP	A	A	T			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr19:51631731A>T	ENST00000250360.3	+	6	1234	c.1167A>T	c.(1165-1167)atA>atT	p.I389I	SIGLEC9_ENST00000440804.3_Silent_p.I389I	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	389					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		ATACGGGCATAGAGGATGCAA	0.577																																						dbGAP											0													118.0	103.0	108.0					19																	51631731		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.1167A>T	19.37:g.51631731A>T			Q6GTU4|Q9BYI9	Silent	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like	p.I389	ENST00000250360.3	37	c.1167	CCDS12825.1	19																																																																																			SIGLEC9	-	NULL	ENSG00000129450		0.577	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIGLEC9	HGNC	protein_coding	OTTHUMT00000464224.1	187	0.53	1	A	NM_014441		51631731	51631731	+1	no_errors	ENST00000440804	ensembl	human	known	69_37n	silent	112	55.20	138	SNP	0.001	T
SLC6A1	6529	genome.wustl.edu	37	3	11070440	11070440	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr3:11070440delG	ENST00000287766.4	+	11	1519	c.1098delG	c.(1096-1098)ctgfs	p.L366fs	SLC6A1_ENST00000536032.1_Frame_Shift_Del_p.L188fs	NM_003042.3	NP_003033.3	P30531	SC6A1_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 1	366					gamma-aminobutyric acid import (GO:0051939)|learning (GO:0007612)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neurotransmitter secretion (GO:0007269)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|protein homooligomerization (GO:0051260)|response to calcium ion (GO:0051592)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to lead ion (GO:0010288)|response to purine-containing compound (GO:0014074)|response to sucrose (GO:0009744)|response to toxic substance (GO:0009636)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	26		Ovarian(110;0.0392)		OV - Ovarian serous cystadenocarcinoma(96;0.00099)	Clobazam(DB00349)|Tiagabine(DB00906)	TGGCGTTCCTGGCATACCCAG	0.537																																						dbGAP											0													49.0	47.0	48.0					3																	11070440		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS2603.1	3p25.3	2013-07-19	2013-07-19		ENSG00000157103	ENSG00000157103		"""Solute carriers"""	11042	protein-coding gene	gene with protein product	"""GABA transporter 1"""	137165	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 1"""			8530094	Standard	NM_003042		Approved	GAT1, GABATR, GABATHG	uc010hdq.3	P30531	OTTHUMG00000044208	ENST00000287766.4:c.1098delG	3.37:g.11070440delG	ENSP00000287766:p.Leu366fs		Q8N4K8	Frame_Shift_Del	DEL	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_GABA_GAT1	p.A367fs	ENST00000287766.4	37	c.1098	CCDS2603.1	3																																																																																			SLC6A1	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000157103		0.537	SLC6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A1	HGNC	protein_coding	OTTHUMT00000102767.2	66	0.00	0	G	NM_003042		11070440	11070440	+1	no_errors	ENST00000287766	ensembl	human	known	69_37n	frame_shift_del	94	45.40	79	DEL	1.000	-
SLCO5A1	81796	genome.wustl.edu	37	8	70588856	70588856	+	Silent	SNP	A	A	G			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr8:70588856A>G	ENST00000260126.4	-	9	2783	c.2077T>C	c.(2077-2079)Ttg>Ctg	p.L693L	SLCO5A1_ENST00000530307.1_Silent_p.L638L|SLCO5A1_ENST00000524945.1_Intron	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	693						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			AGTGTTCGCAACAAAACAAAC	0.423																																						dbGAP											0													153.0	130.0	138.0					8																	70588856		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.2077T>C	8.37:g.70588856A>G			A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Silent	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.L693	ENST00000260126.4	37	c.2077	CCDS6205.1	8																																																																																			SLCO5A1	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000137571		0.423	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO5A1	HGNC	protein_coding	OTTHUMT00000381990.3	131	0.00	0	A	NM_030958		70588856	70588856	-1	no_errors	ENST00000260126	ensembl	human	known	69_37n	silent	211	15.60	39	SNP	0.573	G
SNAP23	8773	genome.wustl.edu	37	15	42805156	42805156	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr15:42805156C>G	ENST00000249647.3	+	3	529	c.61C>G	c.(61-63)Ctg>Gtg	p.L21V	SNAP23_ENST00000349777.1_Missense_Mutation_p.L21V|SNAP23_ENST00000564153.1_Missense_Mutation_p.L21V|SNAP23_ENST00000397138.1_Missense_Mutation_p.L21V|SNAP23_ENST00000567094.1_Missense_Mutation_p.L21V	NM_003825.3	NP_003816.2	O00161	SNP23_HUMAN	synaptosomal-associated protein, 23kDa	21	t-SNARE coiled-coil homology 1. {ECO:0000255|PROSITE-ProRule:PRU00202}.				exocytosis (GO:0006887)|membrane fusion (GO:0061025)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|vesicle targeting (GO:0006903)	azurophil granule (GO:0042582)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|specific granule (GO:0042581)|synapse (GO:0045202)				large_intestine(1)|lung(1)	2		all_cancers(109;7.14e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;1.18e-08)|all_lung(180;4.2e-08)|Melanoma(134;0.0179)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;2.62e-06)		TTCCTAGTCTCTGGAAAGTAC	0.328																																						dbGAP											0													55.0	60.0	58.0					15																	42805156		2203	4299	6502	-	-	-	SO:0001583	missense	0			Y09567	CCDS10087.1, CCDS10088.1	15q14	2004-01-19	2002-08-29		ENSG00000092531	ENSG00000092531			11131	protein-coding gene	gene with protein product		602534	"""synaptosomal-associated protein, 23kD"""			9070898, 8663154	Standard	NM_003825		Approved	SNAP23A, SNAP23B, HsT17016	uc001zpz.2	O00161	OTTHUMG00000130625	ENST00000249647.3:c.61C>G	15.37:g.42805156C>G	ENSP00000249647:p.Leu21Val		O00162|Q13602|Q6IAE3	Missense_Mutation	SNP	pfam_T_SNARE_dom,pfam_SNAP-25,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.L21V	ENST00000249647.3	37	c.61	CCDS10087.1	15	.	.	.	.	.	.	.	.	.	.	C	16.41	3.114708	0.56505	.	.	ENSG00000092531	ENST00000249647;ENST00000349777;ENST00000397138	T;T;T	0.44482	0.92;0.92;0.92	5.32	5.32	0.75619	Target SNARE coiled-coil domain (2);	0.221838	0.38548	N	0.001649	T	0.60495	0.2273	M	0.79475	2.455	0.80722	D	1	D;D	0.60575	0.963;0.988	P;P	0.60789	0.778;0.879	T	0.63005	-0.6733	10	0.54805	T	0.06	-12.3689	12.2936	0.54833	0.0:0.917:0.0:0.083	.	21;21	O00161-2;O00161	.;SNP23_HUMAN	V	21	ENSP00000249647:L21V;ENSP00000207062:L21V;ENSP00000380327:L21V	ENSP00000249647:L21V	L	+	1	2	SNAP23	40592448	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.731000	0.55013	2.636000	0.89361	0.655000	0.94253	CTG	SNAP23	-	smart_T_SNARE_dom,pfscan_T_SNARE_dom	ENSG00000092531		0.328	SNAP23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAP23	HGNC	protein_coding	OTTHUMT00000253111.4	90	0.00	0	C	NM_003825		42805156	42805156	+1	no_errors	ENST00000249647	ensembl	human	known	69_37n	missense	32	72.17	83	SNP	1.000	G
SOGA1	140710	genome.wustl.edu	37	20	35406195	35406195	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr20:35406195C>A	ENST00000279034.6	-	15	3359	c.3033G>T	c.(3031-3033)caG>caT	p.Q1011H	SOGA1_ENST00000237536.4_3'UTR	NM_199181.2	NP_954650.2	O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	0					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						TTGGCGGGGGCTGGGGAGGGG	0.632																																						dbGAP											0													9.0	12.0	11.0					20																	35406195		1661	3657	5318	-	-	-	SO:0001583	missense	0			AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000279034.6:c.3033G>T	20.37:g.35406195C>A	ENSP00000279034:p.Gln1011His		A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Missense_Mutation	SNP	pfam_DUF3166	p.Q1011H	ENST00000279034.6	37	c.3033	CCDS46598.1	20	.	.	.	.	.	.	.	.	.	.	C	14.47	2.546492	0.45383	.	.	ENSG00000149639	ENST00000279034	T	0.17854	2.25	3.81	-0.0101	0.13998	.	.	.	.	.	T	0.13628	0.0330	.	.	.	0.09310	N	1	B	0.22541	0.071	B	0.27608	0.081	T	0.32508	-0.9904	8	0.87932	D	0	.	6.6239	0.22818	0.0:0.255:0.0:0.745	.	1011	O94964-4	.	H	1011	ENSP00000279034:Q1011H	ENSP00000279034:Q1011H	Q	-	3	2	KIAA0889	34839609	0.000000	0.05858	0.001000	0.08648	0.778000	0.44026	-2.079000	0.01369	-0.107000	0.12088	-0.145000	0.13849	CAG	SOGA1	-	NULL	ENSG00000149639		0.632	SOGA1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	SOGA1	HGNC	protein_coding	OTTHUMT00000276634.3	51	0.00	0	C	NM_199181		35406195	35406195	-1	no_errors	ENST00000279034	ensembl	human	known	69_37n	missense	74	39.37	50	SNP	0.002	A
SRCAP	10847	genome.wustl.edu	37	16	30733960	30733960	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr16:30733960G>C	ENST00000262518.4	+	23	4168	c.3783G>C	c.(3781-3783)caG>caC	p.Q1261H	SRCAP_ENST00000395059.2_Intron|SRCAP_ENST00000344771.4_Intron	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1261	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CCCTCATCCAGGCCGTGGCCC	0.647																																						dbGAP											0													102.0	110.0	107.0					16																	30733960		2114	4226	6340	-	-	-	SO:0001583	missense	0			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.3783G>C	16.37:g.30733960G>C	ENSP00000262518:p.Gln1261His		B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	pfam_SNF2_N,pfam_HSA,pfam_Helicase_C,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,smart_AT_hook_DNA-bd_motif,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_AT_hook-like	p.Q1261H	ENST00000262518.4	37	c.3783	CCDS10689.2	16	.	.	.	.	.	.	.	.	.	.	G	11.85	1.760657	0.31137	.	.	ENSG00000080603	ENST00000262518	D	0.92647	-3.08	5.17	5.17	0.71159	.	.	.	.	.	D	0.91637	0.7357	N	0.12182	0.205	0.80722	D	1	D	0.71674	0.998	D	0.69142	0.962	D	0.92725	0.6195	9	0.51188	T	0.08	-0.4459	17.5934	0.88004	0.0:0.0:1.0:0.0	.	1261	Q6ZRS2	SRCAP_HUMAN	H	1261	ENSP00000262518:Q1261H	ENSP00000262518:Q1261H	Q	+	3	2	SRCAP	30641461	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.924000	0.63418	2.700000	0.92200	0.561000	0.74099	CAG	SRCAP	-	NULL	ENSG00000080603		0.647	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCAP	HGNC	protein_coding	OTTHUMT00000255523.1	52	0.00	0	G	NM_006662		30733960	30733960	+1	no_errors	ENST00000262518	ensembl	human	known	69_37n	missense	67	19.28	16	SNP	1.000	C
STAT5A	6776	genome.wustl.edu	37	17	40460235	40460235	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr17:40460235G>A	ENST00000345506.4	+	17	2588	c.1946G>A	c.(1945-1947)cGg>cAg	p.R649Q	STAT5A_ENST00000452307.2_Missense_Mutation_p.R646Q|STAT5A_ENST00000590949.1_Missense_Mutation_p.R649Q|STAT5A_ENST00000588868.1_Missense_Mutation_p.R618Q|STAT5A_ENST00000587646.1_Missense_Mutation_p.R137Q|STAT5A_ENST00000546010.2_Missense_Mutation_p.R619Q	NM_003152.3	NP_003143.2	P42229	STA5A_HUMAN	signal transducer and activator of transcription 5A	649	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				2-oxoglutarate metabolic process (GO:0006103)|allantoin metabolic process (GO:0000255)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|luteinization (GO:0001553)|mammary gland epithelium development (GO:0061180)|natural killer cell differentiation (GO:0001779)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of mast cell apoptotic process (GO:0033026)|oxaloacetate metabolic process (GO:0006107)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mast cell differentiation (GO:0060376)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin signaling pathway (GO:0038161)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription, DNA-templated (GO:0006351)|valine metabolic process (GO:0006573)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	calcium ion binding (GO:0005509)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	14		all_cancers(22;1.56e-06)|all_epithelial(22;3.17e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.128)		TTCACCACGCGGGATTTCTCC	0.552																																						dbGAP											0													79.0	71.0	73.0					17																	40460235		2203	4300	6503	-	-	-	SO:0001583	missense	0			U43185	CCDS11424.1, CCDS74066.1, CCDS74067.1	17q11.2	2013-02-14			ENSG00000126561	ENSG00000126561		"""SH2 domain containing"""	11366	protein-coding gene	gene with protein product		601511		STAT5		7719937, 8631883	Standard	NM_003152		Approved	MGF	uc002hzj.2	P42229	OTTHUMG00000150725	ENST00000345506.4:c.1946G>A	17.37:g.40460235G>A	ENSP00000341208:p.Arg649Gln		Q1KLZ6	Missense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,smart_SH2,pfscan_SH2	p.R649Q	ENST00000345506.4	37	c.1946	CCDS11424.1	17	.	.	.	.	.	.	.	.	.	.	G	14.22	2.469186	0.43839	.	.	ENSG00000126561	ENST00000345506;ENST00000546010;ENST00000540577;ENST00000452307	D;D;D	0.88354	-2.37;-2.37;-2.37	5.06	3.87	0.44632	SH2 motif (4);	0.105903	0.64402	D	0.000011	D	0.85944	0.5815	L	0.50333	1.59	0.45076	D	0.998093	B;B;B;B;B	0.33637	0.42;0.42;0.42;0.11;0.243	B;B;B;B;B	0.35655	0.146;0.207;0.207;0.108;0.075	D	0.85324	0.1086	10	0.38643	T	0.18	-49.9723	14.3646	0.66799	0.0843:0.0:0.9156:0.0	.	649;646;619;620;649	A8K6I5;Q8WWS9;Q1KLZ6;Q59GY7;P42229	.;.;.;.;STA5A_HUMAN	Q	649;619;620;646	ENSP00000341208:R649Q;ENSP00000443107:R619Q;ENSP00000400320:R646Q	ENSP00000341208:R649Q	R	+	2	0	STAT5A	37713761	0.998000	0.40836	0.899000	0.35326	0.373000	0.29922	4.790000	0.62453	2.368000	0.80403	0.561000	0.74099	CGG	STAT5A	-	pfam_SH2,smart_SH2,pfscan_SH2	ENSG00000126561		0.552	STAT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAT5A	HGNC	protein_coding	OTTHUMT00000319804.1	127	0.00	0	G	NM_003152		40460235	40460235	+1	no_errors	ENST00000345506	ensembl	human	known	69_37n	missense	94	15.18	17	SNP	0.776	A
SUGT1	10910	genome.wustl.edu	37	13	53241054	53241054	+	Splice_Site	SNP	G	G	C			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr13:53241054G>C	ENST00000343788.6	+	11	805	c.723G>C	c.(721-723)aaG>aaC	p.K241N	SUGT1_ENST00000535397.1_Splice_Site_p.K153N|SUGT1_ENST00000310528.8_Splice_Site_p.K209N	NM_001130912.1	NP_001124384.1	Q9Y2Z0	SUGT1_HUMAN	SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)	241	CS. {ECO:0000255|PROSITE- ProRule:PRU00547}.				innate immune response (GO:0045087)|mitotic nuclear division (GO:0007067)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				kidney(3)|large_intestine(3)|lung(2)	8		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.25e-08)		TTTCAACAAAGGTAAGACCAT	0.318																																						dbGAP											0													68.0	67.0	67.0					13																	53241054		2203	4296	6499	-	-	-	SO:0001630	splice_region_variant	0			AF068289	CCDS9436.1, CCDS45050.1	13q14.3	2014-03-20			ENSG00000165416	ENSG00000165416			16987	protein-coding gene	gene with protein product		604098				10445024	Standard	NM_006704		Approved	SGT1	uc001vhc.2	Q9Y2Z0	OTTHUMG00000016977	ENST00000343788.6:c.723+1G>C	13.37:g.53241054G>C			A2A303|Q5JAK5|Q5TAM6|Q6VXY6	Missense_Mutation	SNP	pfam_SGS,pfam_CS_domain,superfamily_HSP20-like_chaperone,smart_TPR_repeat,pfscan_CS-like_domain,pfscan_SGS,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.K241N	ENST00000343788.6	37	c.723	CCDS45050.1	13	.	.	.	.	.	.	.	.	.	.	G	25.1	4.605026	0.87157	.	.	ENSG00000165416	ENST00000343788;ENST00000535397;ENST00000310528	T;T;T	0.17370	2.28;2.28;2.28	6.07	6.07	0.98685	CS-like domain (1);CS domain (1);HSP20-like chaperone (1);	0.000000	0.85682	D	0.000000	T	0.56992	0.2023	H	0.94345	3.525	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.999;0.995	T	0.67417	-0.5676	10	0.87932	D	0	-18.7322	19.4154	0.94694	0.0:0.0:1.0:0.0	.	153;153;241;209	F5H5A9;B4DYC6;Q9Y2Z0;Q9Y2Z0-2	.;.;SUGT1_HUMAN;.	N	241;153;209	ENSP00000367208:K241N;ENSP00000443521:K153N;ENSP00000308067:K209N	ENSP00000308067:K209N	K	+	3	2	SUGT1	52139055	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.874000	0.87199	2.884000	0.98904	0.655000	0.94253	AAG	SUGT1	-	pfam_CS_domain,superfamily_HSP20-like_chaperone,pfscan_CS-like_domain	ENSG00000165416		0.318	SUGT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SUGT1	HGNC	protein_coding	OTTHUMT00000045104.2	173	0.00	0	G		Missense_Mutation	53241054	53241054	+1	no_errors	ENST00000343788	ensembl	human	known	69_37n	missense	354	18.24	79	SNP	1.000	C
SYMPK	8189	genome.wustl.edu	37	19	46321248	46321248	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr19:46321248A>T	ENST00000245934.7	-	23	3294	c.3050T>A	c.(3049-3051)aTg>aAg	p.M1017K	RSPH6A_ENST00000597055.1_5'Flank|SYMPK_ENST00000598155.1_5'UTR|RSPH6A_ENST00000221538.3_5'Flank	NM_004819.2	NP_004810.2	Q92797	SYMPK_HUMAN	symplekin	1017					cell adhesion (GO:0007155)|mRNA polyadenylation (GO:0006378)|positive regulation of protein dephosphorylation (GO:0035307)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(25)|ovary(1)|urinary_tract(1)	45		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		CAGGATGTTCATGACGAAGCC	0.632																																						dbGAP											0													35.0	30.0	32.0					19																	46321248		2195	4292	6487	-	-	-	SO:0001583	missense	0			U49240	CCDS12676.2	19q13.3	2008-02-05			ENSG00000125755	ENSG00000125755			22935	protein-coding gene	gene with protein product		602388				9330635	Standard	NM_004819		Approved	SYM, SPK	uc002pdn.3	Q92797	OTTHUMG00000150151	ENST00000245934.7:c.3050T>A	19.37:g.46321248A>T	ENSP00000245934:p.Met1017Lys		O00521|O00689|O00733|Q59GT5|Q8N2U5	Missense_Mutation	SNP	pfam_DUF3453,pfam_Symplekin_C,superfamily_ARM-type_fold	p.M1017K	ENST00000245934.7	37	c.3050	CCDS12676.2	19	.	.	.	.	.	.	.	.	.	.	A	27.9	4.871586	0.91587	.	.	ENSG00000125755	ENST00000245934	T	0.64803	-0.12	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.75466	0.3853	M	0.82630	2.6	0.80722	D	1	P	0.51933	0.949	P	0.55615	0.78	T	0.79897	-0.1609	10	0.72032	D	0.01	.	12.778	0.57459	1.0:0.0:0.0:0.0	.	1017	Q92797	SYMPK_HUMAN	K	1017	ENSP00000245934:M1017K	ENSP00000245934:M1017K	M	-	2	0	SYMPK	51013088	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.682000	0.74528	1.920000	0.55613	0.454000	0.30748	ATG	SYMPK	-	pfam_Symplekin_C	ENSG00000125755		0.632	SYMPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYMPK	HGNC	protein_coding	OTTHUMT00000316581.1	52	0.00	0	A	NM_004819		46321248	46321248	-1	no_errors	ENST00000245934	ensembl	human	known	69_37n	missense	37	27.45	14	SNP	1.000	T
TBP	6908	genome.wustl.edu	37	6	170871052	170871052	+	Silent	SNP	G	G	A	rs112083427|rs369312237	byFrequency	TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr6:170871052G>A	ENST00000392092.2	+	3	507	c.228G>A	c.(226-228)caG>caA	p.Q76Q	TBP_ENST00000230354.6_Silent_p.Q76Q|TBP_ENST00000540980.1_Silent_p.Q56Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	76	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q76Q(4)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacagcagcagcagcagc	0.572																																						dbGAP											4	Substitution - coding silent(4)	lung(3)|prostate(1)											14.0	19.0	17.0					6																	170871052		1952	3842	5794	-	-	-	SO:0001819	synonymous_variant	0			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.228G>A	6.37:g.170871052G>A			B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	pfam_TBP,prints_TBP	p.Q76	ENST00000392092.2	37	c.228	CCDS5315.1	6																																																																																			TBP	-	NULL	ENSG00000112592		0.572	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	HGNC	protein_coding	OTTHUMT00000043271.2	26	0.00	0	G	NM_003194		170871052	170871052	+1	no_errors	ENST00000230354	ensembl	human	known	69_37n	silent	53	17.19	11	SNP	0.994	A
TDRD1	56165	genome.wustl.edu	37	10	115986919	115986919	+	Silent	SNP	G	G	C			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr10:115986919G>C	ENST00000251864.2	+	23	3417	c.3264G>C	c.(3262-3264)gtG>gtC	p.V1088V	TDRD1_ENST00000369282.1_Intron|TDRD1_ENST00000369280.1_Intron|TDRD1_ENST00000369281.2_Silent_p.V974V|TDRD1_ENST00000422662.1_Intron	NM_198795.1	NP_942090.1	Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	1088					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		TGCTTTCTGTGAAAGGAATTA	0.333																																						dbGAP											0													81.0	74.0	76.0					10																	115986919		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000251864.2:c.3264G>C	10.37:g.115986919G>C			A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Silent	SNP	pfam_Tudor,pfam_Znf_MYND,smart_Tudor,pfscan_Tudor,pfscan_Znf_MYND	p.V1088	ENST00000251864.2	37	c.3264	CCDS7588.1	10																																																																																			TDRD1	-	NULL	ENSG00000095627		0.333	TDRD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TDRD1	HGNC	protein_coding		91	0.00	0	G			115986919	115986919	+1	no_errors	ENST00000251864	ensembl	human	known	69_37n	silent	76	33.91	39	SNP	1.000	C
TEX11	56159	genome.wustl.edu	37	X	70073144	70073144	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chrX:70073144G>A	ENST00000395889.2	-	7	559	c.404C>T	c.(403-405)gCt>gTt	p.A135V	TEX11_ENST00000374333.2_Missense_Mutation_p.A120V|TEX11_ENST00000344304.3_Missense_Mutation_p.A135V	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	135					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					AAAATTTCCAGCATCCAACCA	0.353																																						dbGAP											0													76.0	66.0	70.0					X																	70073144		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.404C>T	X.37:g.70073144G>A	ENSP00000379226:p.Ala135Val		A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Missense_Mutation	SNP	pfam_Meiosis_specific_SPO22,smart_TPR_repeat	p.A135V	ENST00000395889.2	37	c.404	CCDS35323.1	X	.	.	.	.	.	.	.	.	.	.	N	0.006	-2.098705	0.00360	.	.	ENSG00000120498	ENST00000374333;ENST00000395889;ENST00000344304	T;T;T	0.28454	1.62;1.61;1.61	4.67	-1.43	0.08884	Tetratricopeptide-like helical (1);	1.016460	0.07837	N	0.962330	T	0.06872	0.0175	N	0.00729	-1.24	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.28004	-1.0057	9	.	.	.	0.5685	0.8502	0.01171	0.4577:0.1569:0.23:0.1553	.	120;135	Q8IYF3-3;Q8IYF3	.;TEX11_HUMAN	V	120;135;135	ENSP00000363453:A120V;ENSP00000379226:A135V;ENSP00000340995:A135V	.	A	-	2	0	TEX11	69989869	0.686000	0.27661	0.014000	0.15608	0.001000	0.01503	0.081000	0.14823	-0.435000	0.07264	-0.296000	0.09543	GCT	TEX11	-	NULL	ENSG00000120498		0.353	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TEX11	HGNC	protein_coding	OTTHUMT00000359072.1	207	0.00	0	G			70073144	70073144	-1	no_errors	ENST00000344304	ensembl	human	known	69_37n	missense	214	23.30	65	SNP	0.311	A
TMEM108	66000	genome.wustl.edu	37	3	133109180	133109180	+	Splice_Site	SNP	T	T	A			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr3:133109180T>A	ENST00000321871.6	+	5	1815		c.e5+2		TMEM108_ENST00000508711.1_Splice_Site|TMEM108_ENST00000393130.3_Splice_Site	NM_001136469.1|NM_023943.2	NP_001129941.1|NP_076432.1	Q6UXF1	TM108_HUMAN	transmembrane protein 108							integral component of membrane (GO:0016021)				endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						ACCTCTGAGGTAATGAGCTTG	0.527																																						dbGAP											0													195.0	190.0	192.0					3																	133109180		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AL136578	CCDS33858.1, CCDS75012.1	3q22.1	2014-04-07			ENSG00000144868	ENSG00000144868			28451	protein-coding gene	gene with protein product	"""cancer/testis antigen 124"""					11214970	Standard	XM_005247726		Approved	MGC3040, CT124	uc003epi.3	Q6UXF1	OTTHUMG00000159685	ENST00000321871.6:c.1605+2T>A	3.37:g.133109180T>A			D3DNC9|Q9BQH1|Q9BW81|Q9C0H3	Splice_Site	SNP	-	e3+2	ENST00000321871.6	37	c.1605+2	CCDS33858.1	3	.	.	.	.	.	.	.	.	.	.	T	17.17	3.320717	0.60634	.	.	ENSG00000144868	ENST00000321871;ENST00000393130;ENST00000508711	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9734	0.71251	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	TMEM108	134591870	1.000000	0.71417	0.984000	0.44739	0.608000	0.37181	7.341000	0.79300	1.937000	0.56155	0.533000	0.62120	.	TMEM108	-	-	ENSG00000144868		0.527	TMEM108-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM108	HGNC	protein_coding	OTTHUMT00000356907.2	94	0.00	0	T	NM_023943	Intron	133109180	133109180	+1	no_errors	ENST00000321871	ensembl	human	known	69_37n	splice_site	161	30.00	69	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7578265	7578265	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr17:7578265A>G	ENST00000269305.4	-	6	773	c.584T>C	c.(583-585)aTc>aCc	p.I195T	TP53_ENST00000420246.2_Missense_Mutation_p.I195T|TP53_ENST00000413465.2_Missense_Mutation_p.I195T|TP53_ENST00000455263.2_Missense_Mutation_p.I195T|TP53_ENST00000445888.2_Missense_Mutation_p.I195T|TP53_ENST00000359597.4_Missense_Mutation_p.I195T|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	195	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		I -> F (in sporadic cancers; somatic mutation).|I -> L (in a sporadic cancer; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:9450901}.|I -> V (in a sporadic cancer; somatic mutation).|I -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.I195T(69)|p.I195N(12)|p.I195S(10)|p.0?(8)|p.I195fs*14(5)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.I102S(2)|p.I102T(2)|p.I63T(2)|p.I63S(2)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.I102fs*14(1)|p.I195fs*12(1)|p.I195fs*50(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I63fs*14(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCCACTCGGATAAGATGCTG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	134	Substitution - Missense(99)|Whole gene deletion(8)|Insertion - Frameshift(7)|Deletion - In frame(6)|Complex - deletion inframe(6)|Unknown(5)|Deletion - Frameshift(2)|Complex - frameshift(1)	ovary(37)|breast(21)|large_intestine(18)|lung(10)|central_nervous_system(8)|biliary_tract(6)|haematopoietic_and_lymphoid_tissue(5)|skin(5)|stomach(4)|oesophagus(4)|bone(4)|endometrium(3)|urinary_tract(3)|upper_aerodigestive_tract(2)|liver(2)|pancreas(2)											100.0	89.0	93.0					17																	7578265		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.584T>C	17.37:g.7578265A>G	ENSP00000269305:p.Ile195Thr		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.I195T	ENST00000269305.4	37	c.584	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	13.73	2.324656	0.41197	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99823	-6.95;-6.95;-6.95;-6.95;-6.95;-6.95;-6.95;-6.95	5.41	3.21	0.36854	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.103171	0.64402	N	0.000004	D	0.99785	0.9910	M	0.90019	3.08	0.52099	D	0.999943	D;D;D;D;D;D;D	0.89917	1.0;0.999;0.991;0.989;0.998;0.997;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.995;0.953;0.979;0.995;0.993;0.996	D	0.98429	1.0581	10	0.87932	D	0	-18.4587	8.2743	0.31864	0.8356:0.0:0.1644:0.0	.	156;195;195;102;195;195;195	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	T	195;195;195;195;195;195;184;102;63;102;63	ENSP00000410739:I195T;ENSP00000352610:I195T;ENSP00000269305:I195T;ENSP00000398846:I195T;ENSP00000391127:I195T;ENSP00000391478:I195T;ENSP00000425104:I63T;ENSP00000423862:I102T	ENSP00000269305:I195T	I	-	2	0	TP53	7518990	1.000000	0.71417	0.946000	0.38457	0.026000	0.11368	9.287000	0.95975	0.456000	0.26937	-0.256000	0.11100	ATC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	190	0.00	0	A	NM_000546		7578265	7578265	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	80	69.23	180	SNP	1.000	G
TP53BP1	7158	genome.wustl.edu	37	15	43767790	43767790	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr15:43767790C>T	ENST00000263801.3	-	9	1295	c.1043G>A	c.(1042-1044)aGg>aAg	p.R348K	TP53BP1_ENST00000382044.4_Missense_Mutation_p.R353K|TP53BP1_ENST00000450115.2_Missense_Mutation_p.R353K|TP53BP1_ENST00000382039.3_Missense_Mutation_p.R353K	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	348					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		AACAAGGGACCTCTGACCAGA	0.507								Other conserved DNA damage response genes																														dbGAP											0													99.0	105.0	103.0					15																	43767790		2201	4298	6499	-	-	-	SO:0001583	missense	0			U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.1043G>A	15.37:g.43767790C>T	ENSP00000263801:p.Arg348Lys		F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Missense_Mutation	SNP	pfam_53-BP1_Tudor,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.R353K	ENST00000263801.3	37	c.1058	CCDS10096.1	15	.	.	.	.	.	.	.	.	.	.	C	7.415	0.635538	0.14322	.	.	ENSG00000067369	ENST00000263801;ENST00000382044;ENST00000382039;ENST00000450115;ENST00000413546	T;T;T;T;T	0.09073	3.83;3.83;3.84;3.83;3.02	5.94	3.04	0.35103	.	0.126074	0.51477	N	0.000090	T	0.05044	0.0135	L	0.33485	1.01	0.19945	N	0.999949	B;B;B;B	0.10296	0.003;0.001;0.002;0.002	B;B;B;B	0.09377	0.004;0.001;0.003;0.003	T	0.44544	-0.9321	10	0.05959	T	0.93	-3.7801	6.8406	0.23961	0.0:0.7209:0.0:0.2791	.	353;348;353;353	B7Z3E7;Q12888;Q12888-2;F8VY86	.;TP53B_HUMAN;.;.	K	348;353;353;353;353	ENSP00000263801:R348K;ENSP00000371475:R353K;ENSP00000371470:R353K;ENSP00000393497:R353K;ENSP00000388028:R353K	ENSP00000263801:R348K	R	-	2	0	TP53BP1	41555082	0.726000	0.28059	0.993000	0.49108	0.981000	0.71138	0.776000	0.26704	0.839000	0.34971	0.650000	0.86243	AGG	TP53BP1	-	NULL	ENSG00000067369		0.507	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TP53BP1	HGNC	protein_coding	OTTHUMT00000132897.3	88	0.00	0	C			43767790	43767790	-1	no_errors	ENST00000382044	ensembl	human	known	69_37n	missense	23	78.30	83	SNP	0.903	T
UPB1	51733	genome.wustl.edu	37	22	24909455	24909455	+	Splice_Site	SNP	T	T	A			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr22:24909455T>A	ENST00000326010.5	+	5	965		c.e5+2		UPB1_ENST00000413389.2_Splice_Site	NM_016327.2	NP_057411.1	Q9UBR1	BUP1_HUMAN	ureidopropionase, beta						beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	beta-ureidopropionase activity (GO:0003837)|metal ion binding (GO:0046872)			endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	22	Colorectal(2;0.0339)					TTCAACGAGGTGAGCCACCCA	0.502																																						dbGAP											0													48.0	40.0	43.0					22																	24909455		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB013885	CCDS13827.1	22q11.2	2008-04-11			ENSG00000100024	ENSG00000100024			16297	protein-coding gene	gene with protein product		606673				10542323	Standard	XR_244378		Approved	BUP1	uc003aaf.3	Q9UBR1	OTTHUMG00000150749	ENST00000326010.5:c.621+2T>A	22.37:g.24909455T>A			A3KMF8|Q9UIR3	Splice_Site	SNP	-	e5+2	ENST00000326010.5	37	c.621+2	CCDS13827.1	22	.	.	.	.	.	.	.	.	.	.	T	16.38	3.107296	0.56291	.	.	ENSG00000100024	ENST00000413389;ENST00000326010	.	.	.	5.5	4.46	0.54185	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.8403	0.46710	0.0:0.0757:0.0:0.9243	.	.	.	.	.	-1	.	.	.	+	.	.	UPB1	23239455	1.000000	0.71417	0.996000	0.52242	0.586000	0.36452	6.047000	0.71038	2.098000	0.63641	0.455000	0.32223	.	UPB1	-	-	ENSG00000100024		0.502	UPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UPB1	HGNC	protein_coding	OTTHUMT00000319869.1	61	0.00	0	T		Intron	24909455	24909455	+1	no_errors	ENST00000326010	ensembl	human	known	69_37n	splice_site	32	46.67	28	SNP	1.000	A
USP34	9736	genome.wustl.edu	37	2	61505421	61505421	+	Splice_Site	SNP	C	C	A			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr2:61505421C>A	ENST00000398571.2	-	41	5389		c.e41-1			NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34						positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			GATCTCCCTACTACAAAAAAG	0.338																																						dbGAP											0													76.0	65.0	68.0					2																	61505421		1841	4085	5926	-	-	-	SO:0001630	splice_region_variant	0			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.5313-1G>T	2.37:g.61505421C>A			A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Splice_Site	SNP	-	e41-1	ENST00000398571.2	37	c.5313-1	CCDS42686.1	2	.	.	.	.	.	.	.	.	.	.	C	23.8	4.453392	0.84209	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571;ENST00000453734	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.6497	0.88159	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	USP34	61358925	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.767000	0.62286	2.607000	0.88179	0.563000	0.77884	.	USP34	-	-	ENSG00000115464		0.338	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP34	HGNC	protein_coding	OTTHUMT00000325650.4	223	0.00	0	C		Intron	61505421	61505421	-1	no_errors	ENST00000398571	ensembl	human	known	69_37n	splice_site	310	51.26	326	SNP	1.000	A
UTP20	27340	genome.wustl.edu	37	12	101723085	101723085	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr12:101723085G>T	ENST00000261637.4	+	27	3449	c.3275G>T	c.(3274-3276)gGt>gTt	p.G1092V		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	1092					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						CTTCCTTTAGGTCGTCAGCAC	0.423																																						dbGAP											0													163.0	143.0	149.0					12																	101723085		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.3275G>T	12.37:g.101723085G>T	ENSP00000261637:p.Gly1092Val		Q9H3H4	Missense_Mutation	SNP	pfam_DRIM,superfamily_ARM-type_fold	p.G1092V	ENST00000261637.4	37	c.3275	CCDS9081.1	12	.	.	.	.	.	.	.	.	.	.	G	27.5	4.837206	0.91117	.	.	ENSG00000120800	ENST00000261637	T	0.18016	2.24	5.6	5.6	0.85130	Armadillo-type fold (1);	0.048068	0.85682	D	0.000000	T	0.28566	0.0707	L	0.57536	1.79	0.80722	D	1	D	0.59767	0.986	P	0.47470	0.548	T	0.01492	-1.1341	10	0.72032	D	0.01	-9.7808	19.9737	0.97296	0.0:0.0:1.0:0.0	.	1092	O75691	UTP20_HUMAN	V	1092	ENSP00000261637:G1092V	ENSP00000261637:G1092V	G	+	2	0	UTP20	100247216	1.000000	0.71417	0.946000	0.38457	0.858000	0.48976	9.532000	0.98057	2.793000	0.96121	0.591000	0.81541	GGT	UTP20	-	superfamily_ARM-type_fold	ENSG00000120800		0.423	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP20	HGNC	protein_coding	OTTHUMT00000408242.1	145	0.00	0	G	NM_014503		101723085	101723085	+1	no_errors	ENST00000261637	ensembl	human	known	69_37n	missense	234	12.36	33	SNP	1.000	T
VSX1	30813	genome.wustl.edu	37	20	25060118	25060118	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr20:25060118G>C	ENST00000376709.4	-	2	720	c.457C>G	c.(457-459)Cta>Gta	p.L153V	VSX1_ENST00000429762.3_Missense_Mutation_p.L153V|VSX1_ENST00000444511.2_Missense_Mutation_p.L153V|VSX1_ENST00000424574.1_Missense_Mutation_p.L153V|VSX1_ENST00000451258.1_Missense_Mutation_p.L153V|VSX1_ENST00000376707.3_Missense_Mutation_p.L153V	NM_014588.5	NP_055403.2	Q9NZR4	VSX1_HUMAN	visual system homeobox 1	153					neuron maturation (GO:0042551)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(3)|lung(2)	6						GATGCCTTTAGGTCATTCCTG	0.532																																						dbGAP											0													66.0	51.0	56.0					20																	25060118		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF176797	CCDS13168.1, CCDS13169.1, CCDS58766.1, CCDS58767.1	20p11.21	2014-02-14	2007-07-12		ENSG00000100987	ENSG00000100987		"""Homeoboxes / PRD class"""	12723	protein-coding gene	gene with protein product		605020	"""posterior polymorphous corneal dystrophy"", ""visual system homeobox 1 homolog, CHX10-like (zebrafish)"""	PPCD		10673340	Standard	NM_001256272		Approved	PPD, PPCD1	uc002wuf.4	Q9NZR4	OTTHUMG00000032111	ENST00000376709.4:c.457C>G	20.37:g.25060118G>C	ENSP00000365899:p.Leu153Val		B9EGJ4|D1MF28|Q0GM60|Q0GM61|Q0GM62|Q0GM63|Q0GM64|Q0GM65|Q5TF40|Q5TF41|Q9HCU3|Q9NU27	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.L153V	ENST00000376709.4	37	c.457	CCDS13168.1	20	.	.	.	.	.	.	.	.	.	.	G	5.245	0.230644	0.09969	.	.	ENSG00000100987	ENST00000429762;ENST00000444511;ENST00000424574;ENST00000451258;ENST00000376709;ENST00000376707	D;D;D;D;D;D	0.95724	-3.79;-3.79;-3.79;-3.79;-3.79;-3.79	5.01	4.05	0.47172	.	0.694941	0.14086	N	0.342357	D	0.91583	0.7341	L	0.42245	1.32	0.49483	D	0.999792	P;P;B;B	0.42039	0.769;0.769;0.43;0.272	B;B;B;B	0.38500	0.275;0.204;0.164;0.031	D	0.87832	0.2645	10	0.29301	T	0.29	.	8.9964	0.36055	0.172:0.0:0.828:0.0	.	153;153;153;153	Q9NZR4-7;Q9NZR4-8;Q9NZR4-2;Q9NZR4	.;.;.;VSX1_HUMAN	V	153	ENSP00000401690:L153V;ENSP00000387720:L153V;ENSP00000399496:L153V;ENSP00000389654:L153V;ENSP00000365899:L153V;ENSP00000365897:L153V	ENSP00000365897:L153V	L	-	1	2	VSX1	25008118	0.935000	0.31712	0.561000	0.28357	0.367000	0.29736	0.637000	0.24659	1.310000	0.45006	0.462000	0.41574	CTA	VSX1	-	NULL	ENSG00000100987		0.532	VSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSX1	HGNC	protein_coding	OTTHUMT00000078384.3	89	0.00	0	G			25060118	25060118	-1	no_errors	ENST00000376709	ensembl	human	known	69_37n	missense	160	17.10	33	SNP	0.761	C
VWA3A	146177	genome.wustl.edu	37	16	22161158	22161158	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr16:22161158T>G	ENST00000389398.5	+	29	3131	c.3035T>G	c.(3034-3036)cTg>cGg	p.L1012R	VWA3A_ENST00000563755.1_Missense_Mutation_p.L114R|VWA3A_ENST00000389397.4_Missense_Mutation_p.L114R	NM_173615.3	NP_775886.3	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	1012	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.					extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				GBM - Glioblastoma multiforme(48;0.0439)		CAGGACACGCTGGTGGAGACC	0.552																																						dbGAP											0													30.0	31.0	31.0					16																	22161158		1972	4141	6113	-	-	-	SO:0001583	missense	0			AK128606, AK098260	CCDS45441.1	16p12.1	2008-02-05				ENSG00000175267			27088	protein-coding gene	gene with protein product						12477932	Standard	XM_006721021		Approved	FLJ46765, FLJ40941	uc010vbq.2	A6NCI4		ENST00000389398.5:c.3035T>G	16.37:g.22161158T>G	ENSP00000374049:p.Leu1012Arg		A4QMU8|A6NNC0|Q6UTX4|Q6ZQZ9|Q8IUY6|Q8N9W1	Missense_Mutation	SNP	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.L1012R	ENST00000389398.5	37	c.3035	CCDS45441.1	16	.	.	.	.	.	.	.	.	.	.	T	15.69	2.909164	0.52439	.	.	ENSG00000175267	ENST00000389398;ENST00000389397;ENST00000299840	T;T	0.32023	1.47;1.47	5.57	5.57	0.84162	von Willebrand factor, type A (3);	0.000000	0.64402	D	0.000009	T	0.64136	0.2571	M	0.92169	3.28	0.50813	D	0.999896	D;D	0.89917	0.999;1.0	D;D	0.80764	0.989;0.994	T	0.73445	-0.3980	10	0.72032	D	0.01	.	13.6858	0.62515	0.0:0.0:0.0:1.0	.	1012;114	A6NCI4;A6NCI4-4	VWA3A_HUMAN;.	R	1012;114;635	ENSP00000374049:L1012R;ENSP00000374048:L114R	ENSP00000299840:L635R	L	+	2	0	VWA3A	22068659	1.000000	0.71417	0.994000	0.49952	0.231000	0.25187	4.143000	0.58051	2.107000	0.64212	0.533000	0.62120	CTG	VWA3A	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000175267		0.552	VWA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA3A	HGNC	protein_coding	OTTHUMT00000430052.1	43	0.00	0	T			22161158	22161158	+1	no_errors	ENST00000389398	ensembl	human	known	69_37n	missense	49	39.29	33	SNP	0.998	G
ZFP69	339559	genome.wustl.edu	37	1	40945155	40945155	+	Missense_Mutation	SNP	G	G	C	rs568390195		TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr1:40945155G>C	ENST00000372706.1	+	2	1128	c.122G>C	c.(121-123)gGa>gCa	p.G41A	ZFP69_ENST00000372705.3_Missense_Mutation_p.G41A			Q49AA0	ZFP69_HUMAN	ZFP69 zinc finger protein	41					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										ATGTTTGAAGGAGAAGGTGAG	0.532																																						dbGAP											0													38.0	39.0	39.0					1																	40945155		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK122618	CCDS30686.1	1p34.2	2013-01-09	2012-11-27	2012-11-27	ENSG00000187815	ENSG00000187815		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	24708	protein-coding gene	gene with protein product	"""ZFP69 zinc finger protein A"""		"""zinc finger protein 642"""	ZNF642			Standard	XM_005270808		Approved	ZKSCAN23A, FLJ16030, ZFP69A, ZSCAN54A	uc001cfo.3	Q49AA0	OTTHUMG00000007303	ENST00000372706.1:c.122G>C	1.37:g.40945155G>C	ENSP00000361791:p.Gly41Ala		Q5SWM5|Q6ZWK8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,superfamily_Retrov_capsid_C,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G41A	ENST00000372706.1	37	c.122	CCDS30686.1	1	.	.	.	.	.	.	.	.	.	.	.	6.044	0.376401	0.11466	.	.	ENSG00000187815	ENST00000372706;ENST00000372705	T;T	0.04317	3.65;3.65	4.44	2.55	0.30701	.	0.210233	0.24010	N	0.042397	T	0.04634	0.0126	L	0.59436	1.845	0.25848	N	0.983973	B	0.30793	0.295	B	0.29176	0.099	T	0.34329	-0.9833	10	0.10636	T	0.68	-5.5722	6.0254	0.19652	0.2267:0.0:0.7733:0.0	.	41	Q49AA0	ZN642_HUMAN	A	41	ENSP00000361791:G41A;ENSP00000361790:G41A	ENSP00000361790:G41A	G	+	2	0	ZNF642	40717742	1.000000	0.71417	1.000000	0.80357	0.140000	0.21249	1.196000	0.32198	1.179000	0.42884	0.655000	0.94253	GGA	ZNF642	-	superfamily_Retrov_capsid_C	ENSG00000187815		0.532	ZFP69-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF642	HGNC	protein_coding	OTTHUMT00000019082.1	137	0.00	0	G	NM_198494		40945155	40945155	+1	no_errors	ENST00000372705	ensembl	human	known	69_37n	missense	223	15.79	42	SNP	1.000	C
ZNF665	79788	genome.wustl.edu	37	19	53668116	53668116	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A14R-01A-11D-A10Y-09	TCGA-E2-A14R-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	c7212115-1007-40cf-b9b5-7b25e2f5f2a4	7b38de28-3b9d-4a67-bf94-5fd17317d1a9	g.chr19:53668116T>G	ENST00000600412.1	-	2	1547	c.1432A>C	c.(1432-1434)Aaa>Caa	p.K478Q	ZNF665_ENST00000396424.3_Missense_Mutation_p.K543Q|CTD-2245F17.2_ENST00000600257.1_RNA			Q9H7R5	ZN665_HUMAN	zinc finger protein 665	478					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	35				GBM - Glioblastoma multiforme(134;0.0196)		TCATTACATTTGTATGGTTTT	0.388																																						dbGAP											0													148.0	159.0	155.0					19																	53668116		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS46169.1	19q13.42	2013-01-08				ENSG00000197497		"""Zinc fingers, C2H2-type"", ""-"""	25885	protein-coding gene	gene with protein product							Standard	NM_024733		Approved	FLJ14345	uc010eqm.1	Q9H7R5		ENST00000600412.1:c.1432A>C	19.37:g.53668116T>G	ENSP00000469154:p.Lys478Gln		A8K5T8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K543Q	ENST00000600412.1	37	c.1627		19	.	.	.	.	.	.	.	.	.	.	T	9.646	1.140186	0.21205	.	.	ENSG00000197497	ENST00000396424	T	0.35973	1.28	1.73	-0.77	0.11005	.	.	.	.	.	T	0.20780	0.0500	L	0.31926	0.97	0.09310	N	1	P	0.46220	0.874	B	0.40256	0.324	T	0.12604	-1.0541	9	0.44086	T	0.13	.	0.9895	0.01454	0.1934:0.1544:0.3918:0.2604	.	543	Q9H7R5-2	.	Q	543	ENSP00000379702:K543Q	ENSP00000379702:K543Q	K	-	1	0	ZNF665	58359928	0.000000	0.05858	0.004000	0.12327	0.009000	0.06853	-3.462000	0.00463	-0.080000	0.12685	0.338000	0.21704	AAA	ZNF665	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197497		0.388	ZNF665-002	PUTATIVE	not_organism_supported|basic	protein_coding	ZNF665	HGNC	protein_coding	OTTHUMT00000464179.1	217	0.91	2	T	NM_024733		53668116	53668116	-1	no_errors	ENST00000396424	ensembl	human	known	69_37n	missense	298	23.33	91	SNP	0.000	G
