#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AGBL3	340351	genome.wustl.edu	37	7	134672706	134672706	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr7:134672706G>A	ENST00000436302.2	+	2	275	c.22G>A	c.(22-24)Gaa>Aaa	p.E8K	AGBL3_ENST00000494702.2_3'UTR|AGBL3_ENST00000458078.1_5'UTR|AGBL3_ENST00000435976.2_Missense_Mutation_p.E8K|AGBL3_ENST00000359383.3_Missense_Mutation_p.E8K	NM_178563.3	NP_848658.3	Q8NEM8	CBPC3_HUMAN	ATP/GTP binding protein-like 3	8						cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|lung(2)|skin(3)	10						TTCAGAAAAGGAAGACTATTC	0.313																																						dbGAP											0													162.0	154.0	157.0					7																	134672706		692	1588	2280	-	-	-	SO:0001583	missense	0			BC030651	CCDS47718.1	7q33	2014-06-23			ENSG00000146856	ENSG00000146856			27981	protein-coding gene	gene with protein product							Standard	NM_178563		Approved	MGC32955, CCP3	uc011kpw.2	Q8NEM8	OTTHUMG00000155406	ENST00000436302.2:c.22G>A	7.37:g.134672706G>A	ENSP00000388275:p.Glu8Lys		B7Z827|Q9H965	Missense_Mutation	SNP	pfam_Peptidase_M14	p.E8K	ENST00000436302.2	37	c.22	CCDS47718.1	7	.	.	.	.	.	.	.	.	.	.	G	17.47	3.397856	0.62177	.	.	ENSG00000146856	ENST00000436302;ENST00000359383;ENST00000435976;ENST00000455283	T;T;T;T	0.35789	2.81;1.31;2.83;1.29	4.28	4.28	0.50868	.	0.800688	0.11073	N	0.602680	T	0.27663	0.0680	N	0.22421	0.69	0.80722	D	1	B	0.27732	0.187	B	0.24848	0.056	T	0.12785	-1.0534	10	0.87932	D	0	-18.849	12.4122	0.55473	0.0:0.0:1.0:0.0	.	8	Q8NEM8-4	.	K	8	ENSP00000388275:E8K;ENSP00000352343:E8K;ENSP00000401220:E8K;ENSP00000412700:E8K	ENSP00000275763:E8K	E	+	1	0	AGBL3	134323246	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	3.933000	0.56545	2.392000	0.81423	0.491000	0.48974	GAA	AGBL3	-	NULL	ENSG00000146856		0.313	AGBL3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	AGBL3	HGNC	protein_coding	OTTHUMT00000376655.1	524	0.00	0	G	NM_178563		134672706	134672706	+1	no_errors	ENST00000436302	ensembl	human	known	69_37n	missense	306	14.53	52	SNP	0.999	A
AP2A1	160	genome.wustl.edu	37	19	50302177	50302177	+	Silent	SNP	C	C	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr19:50302177C>T	ENST00000359032.5	+	8	933	c.933C>T	c.(931-933)ttC>ttT	p.F311F	AP2A1_ENST00000354293.5_Silent_p.F311F	NM_014203.2	NP_055018.2	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1 subunit	311					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	AP-2 adaptor complex (GO:0030122)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)	19		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		CCATCCTCTTCGAGACCATCA	0.612																																						dbGAP											0													29.0	32.0	31.0					19																	50302177		2026	4145	6171	-	-	-	SO:0001819	synonymous_variant	0			AA993745	CCDS46148.1, CCDS46149.1	19q13.3	2008-05-23				ENSG00000196961			561	protein-coding gene	gene with protein product		601026		CLAPA1, ADTAA		2564002	Standard	NM_014203		Approved		uc002ppn.3	O95782		ENST00000359032.5:c.933C>T	19.37:g.50302177C>T			Q96CI7|Q96PP6|Q96PP7|Q9H070	Silent	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Clathrin_a-adaptin_app_sub_C,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP2_complex_asu	p.F311	ENST00000359032.5	37	c.933	CCDS46148.1	19																																																																																			AP2A1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP2_complex_asu	ENSG00000196961		0.612	AP2A1-008	NOVEL	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	AP2A1	HGNC	protein_coding	OTTHUMT00000465809.1	145	0.00	0	C			50302177	50302177	+1	no_errors	ENST00000359032	ensembl	human	known	69_37n	silent	151	15.17	27	SNP	0.984	T
AQP5	362	genome.wustl.edu	37	12	50355892	50355892	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr12:50355892C>G	ENST00000293599.6	+	1	240	c.92C>G	c.(91-93)tCg>tGg	p.S31W	RP11-469H8.6_ENST00000550530.1_RNA|RP11-469H8.6_ENST00000552379.1_RNA|RP11-469H8.6_ENST00000550214.1_RNA	NM_001651.2	NP_001642.1	P55064	AQP5_HUMAN	aquaporin 5	31					camera-type eye morphogenesis (GO:0048593)|carbon dioxide transport (GO:0015670)|excretion (GO:0007588)|odontogenesis (GO:0042476)|pancreatic juice secretion (GO:0030157)|saliva secretion (GO:0046541)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	water channel activity (GO:0015250)			large_intestine(1)|lung(3)	4						GGCCTGGGCTCGGCCCTCAAG	0.657																																						dbGAP											0													60.0	44.0	49.0					12																	50355892		2203	4300	6503	-	-	-	SO:0001583	missense	0			U46569	CCDS8793.1	12q13	2013-09-10				ENSG00000161798		"""Ion channels / Aquaporins"""	638	protein-coding gene	gene with protein product		600442				8621489, 23830519	Standard	NM_001651		Approved		uc001rvo.3	P55064	OTTHUMG00000169710	ENST00000293599.6:c.92C>G	12.37:g.50355892C>G	ENSP00000293599:p.Ser31Trp		Q6FGW8	Missense_Mutation	SNP	pfam_MIP,superfamily_Aquaporin-like,prints_MIP,prints_Aquaporin_5,tigrfam_Aquaporin	p.S31W	ENST00000293599.6	37	c.92	CCDS8793.1	12	.	.	.	.	.	.	.	.	.	.	C	17.17	3.321946	0.60634	.	.	ENSG00000161798	ENST00000293599	D	0.86956	-2.19	3.76	2.87	0.33458	Aquaporin-like (2);	0.000000	0.49916	D	0.000138	D	0.95726	0.8610	H	0.99104	4.43	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94832	0.7997	10	0.87932	D	0	-7.9855	9.1904	0.37195	0.0:0.8894:0.0:0.1106	.	31	P55064	AQP5_HUMAN	W	31	ENSP00000293599:S31W	ENSP00000293599:S31W	S	+	2	0	AQP5	48642159	1.000000	0.71417	0.453000	0.27007	0.795000	0.44927	5.861000	0.69553	0.935000	0.37341	0.462000	0.41574	TCG	AQP5	-	pfam_MIP,superfamily_Aquaporin-like,prints_MIP,tigrfam_Aquaporin	ENSG00000161798		0.657	AQP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQP5	HGNC	protein_coding	OTTHUMT00000405542.2	56	0.00	0	C	NM_001651		50355892	50355892	+1	no_errors	ENST00000293599	ensembl	human	known	69_37n	missense	64	22.89	19	SNP	0.949	G
ATP7A	538	genome.wustl.edu	37	X	77289220	77289220	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chrX:77289220G>A	ENST00000341514.6	+	17	3567	c.3412G>A	c.(3412-3414)Gag>Aag	p.E1138K	ATP7A_ENST00000350425.4_Missense_Mutation_p.E141K|ATP7A_ENST00000343533.5_Missense_Mutation_p.E1060K	NM_000052.5	NP_000043.4	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	1138					blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cartilage development (GO:0051216)|catecholamine metabolic process (GO:0006584)|cellular copper ion homeostasis (GO:0006878)|central nervous system neuron development (GO:0021954)|cerebellar Purkinje cell differentiation (GO:0021702)|collagen fibril organization (GO:0030199)|copper ion export (GO:0060003)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|dendrite morphogenesis (GO:0048813)|detoxification of copper ion (GO:0010273)|dopamine metabolic process (GO:0042417)|elastic fiber assembly (GO:0048251)|elastin biosynthetic process (GO:0051542)|epinephrine metabolic process (GO:0042414)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|lung alveolus development (GO:0048286)|mitochondrion organization (GO:0007005)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of neuron apoptotic process (GO:0043524)|neuron projection morphogenesis (GO:0048812)|norepinephrine biosynthetic process (GO:0042421)|norepinephrine metabolic process (GO:0042415)|peptidyl-lysine modification (GO:0018205)|pigmentation (GO:0043473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of oxidoreductase activity (GO:0051353)|pyramidal neuron development (GO:0021860)|regulation of gene expression (GO:0010468)|regulation of oxidative phosphorylation (GO:0002082)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|response to iron(III) ion (GO:0010041)|response to zinc ion (GO:0010043)|serotonin metabolic process (GO:0042428)|skin development (GO:0043588)|T-helper cell differentiation (GO:0042093)|transmembrane transport (GO:0055085)|tryptophan metabolic process (GO:0006568)|tyrosine metabolic process (GO:0006570)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|copper-dependent protein binding (GO:0032767)|copper-exporting ATPase activity (GO:0004008)|superoxide dismutase copper chaperone activity (GO:0016532)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(26)|pancreas(1)|prostate(1)|urinary_tract(1)	53					Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	CTGGAATATAGAGGACAATAA	0.393																																						dbGAP											0													122.0	114.0	117.0					X																	77289220		2203	4296	6499	-	-	-	SO:0001583	missense	0			L06133	CCDS35339.1, CCDS75997.1	Xq21.1	2012-10-22	2008-07-31		ENSG00000165240	ENSG00000165240	3.6.3.4	"""ATPases / P-type"""	869	protein-coding gene	gene with protein product	"""copper pump 1"", ""copper-transporting ATPase 1"""	300011	"""Menkes syndrome"""	MNK		10079817	Standard	NM_000052		Approved		uc004ecx.4	Q04656	OTTHUMG00000021885	ENST00000341514.6:c.3412G>A	X.37:g.77289220G>A	ENSP00000345728:p.Glu1138Lys		B1AT72|O00227|O00745|Q9BYY8	Missense_Mutation	SNP	pfam_HeavyMe-assoc_HMA,pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,pfam_HAD-SF_hydro-like_3,superfamily_HAD-like_dom,superfamily_HeavyMe-assoc_HMA,pfscan_HeavyMe-assoc_HMA,prints_ATPase_P-typ_cat/Cu-transptr,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_H-transp,prints_HG_scavenger,tigrfam_ATPase_P-typ_heavy-metal,tigrfam_ATPase_P-typ_ion-transptr,tigrfam_HMA_Cu_ion-bd	p.E1138K	ENST00000341514.6	37	c.3412	CCDS35339.1	X	.	.	.	.	.	.	.	.	.	.	G	15.09	2.731432	0.48939	.	.	ENSG00000165240	ENST00000343533;ENST00000350425;ENST00000341514	D;D;D	0.97279	-3.93;-4.32;-3.95	5.27	4.41	0.53225	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);	0.362301	0.30227	N	0.010108	D	0.91439	0.7298	N	0.08118	0	0.50039	D	0.999844	P	0.39376	0.67	B	0.40101	0.319	D	0.89177	0.3541	10	0.14656	T	0.56	-0.1412	13.3288	0.60475	0.0787:0.0:0.9213:0.0	.	1138	Q04656	ATP7A_HUMAN	K	1060;141;1138	ENSP00000343026:E1060K;ENSP00000343678:E141K;ENSP00000345728:E1138K	ENSP00000345728:E1138K	E	+	1	0	ATP7A	77175876	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	7.092000	0.76930	1.105000	0.41606	-0.191000	0.12829	GAG	ATP7A	-	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_heavy-metal	ENSG00000165240		0.393	ATP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP7A	HGNC	protein_coding	OTTHUMT00000057306.1	468	0.00	0	G	NM_000052		77289220	77289220	+1	no_errors	ENST00000341514	ensembl	human	known	69_37n	missense	264	28.69	107	SNP	1.000	A
BOD1L1	259282	genome.wustl.edu	37	4	13579099	13579099	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr4:13579099C>G	ENST00000040738.5	-	24	8947	c.8812G>C	c.(8812-8814)Gaa>Caa	p.E2938Q		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	2938						nucleus (GO:0005634)	DNA binding (GO:0003677)										ACTATTTTTTCTTCACCATCA	0.343																																						dbGAP											0													89.0	81.0	84.0					4																	13579099		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.8812G>C	4.37:g.13579099C>G	ENSP00000040738:p.Glu2938Gln		Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	NULL	p.E2938Q	ENST00000040738.5	37	c.8812	CCDS3411.2	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.75|16.75	3.210521|3.210521	0.58343|0.58343	.|.	.|.	ENSG00000038219|ENSG00000038219	ENST00000040738|ENST00000507943	T|.	0.10099|.	2.91|.	5.44|5.44	4.6|4.6	0.57074|0.57074	.|.	0.102724|.	0.42964|.	D|.	0.000639|.	T|T	0.37210|0.37210	0.0995|0.0995	L|L	0.29908|0.29908	0.895|0.895	0.19300|0.19300	N|N	0.999976|0.999976	P|.	0.38250|.	0.624|.	B|.	0.39706|.	0.307|.	T|T	0.22521|0.22521	-1.0214|-1.0214	10|5	0.66056|.	D|.	0.02|.	-8.3221|-8.3221	12.4676|12.4676	0.55768|0.55768	0.0:0.9221:0.0:0.0779|0.0:0.9221:0.0:0.0779	.|.	2938|.	Q8NFC6|.	BOD1L_HUMAN|.	Q|N	2938|46	ENSP00000040738:E2938Q|.	ENSP00000040738:E2938Q|.	E|K	-|-	1|3	0|2	BOD1L|BOD1L	13188197|13188197	0.629000|0.629000	0.27146|0.27146	0.031000|0.031000	0.17742|0.17742	0.002000|0.002000	0.02628|0.02628	2.345000|2.345000	0.44018|0.44018	1.299000|1.299000	0.44798|0.44798	-0.251000|-0.251000	0.11542|0.11542	GAA|AAG	BOD1L1	-	NULL	ENSG00000038219		0.343	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	HGNC	protein_coding	OTTHUMT00000207321.1	541	0.00	0	C	NM_148894		13579099	13579099	-1	no_errors	ENST00000040738	ensembl	human	known	69_37n	missense	376	14.93	66	SNP	0.383	G
C16orf96	342346	genome.wustl.edu	37	16	4638311	4638311	+	Silent	SNP	C	C	G			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr16:4638311C>G	ENST00000444310.4	+	9	2571	c.2571C>G	c.(2569-2571)ctC>ctG	p.L857L		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						TGGAGGAGCTCAGCAAGGACG	0.468																																						dbGAP											0													160.0	140.0	146.0					16																	4638311		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.2571C>G	16.37:g.4638311C>G				Silent	SNP	NULL	p.L857	ENST00000444310.4	37	c.2571	CCDS53986.1	16																																																																																			C16orf96	-	NULL	ENSG00000205832		0.468	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C16orf96	HGNC	protein_coding	OTTHUMT00000432384.1	295	0.00	0	C	NM_001145011		4638311	4638311	+1	no_errors	ENST00000444310	ensembl	human	known	69_37n	silent	269	20.35	69	SNP	0.000	G
ADM5	199800	genome.wustl.edu	37	19	50193365	50193365	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr19:50193365G>A	ENST00000420022.3	+	2	1251	c.77G>A	c.(76-78)cGa>cAa	p.R26Q	CPT1C_ENST00000354199.5_5'Flank|CPT1C_ENST00000392518.4_5'Flank|CPT1C_ENST00000405931.2_5'Flank|CPT1C_ENST00000323446.5_5'Flank|CPT1C_ENST00000598293.1_5'Flank|CTB-33G10.6_ENST00000596472.1_RNA	NM_001101340.1	NP_001094810.1	C9JUS6	ADM5_HUMAN	adrenomedullin 5 (putative)	26						extracellular region (GO:0005576)		p.R26Q(1)									CTCTCCAGGCGAGGCCAGCAC	0.637											OREG0025628	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - Missense(1)	lung(1)											7.0	9.0	8.0					19																	50193365		2023	4113	6136	-	-	-	SO:0001583	missense	0			BC032764	CCDS46146.1	19q13.33	2012-12-07	2012-12-07	2012-10-29	ENSG00000224420	ENSG00000224420			27293	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 76"", ""adrenomedullin 5 homolog (pig)"""	C19orf76		18434369	Standard	NM_001101340		Approved	AM5	uc002pph.2	C9JUS6		ENST00000420022.3:c.77G>A	19.37:g.50193365G>A	ENSP00000393631:p.Arg26Gln	967		Missense_Mutation	SNP	NULL	p.R26Q	ENST00000420022.3	37	c.77	CCDS46146.1	19	.	.	.	.	.	.	.	.	.	.	G	12.41	1.930252	0.34096	.	.	ENSG00000224420	ENST00000420022	.	.	.	2.49	-4.63	0.03359	.	.	.	.	.	T	0.08492	0.0211	N	0.08118	0	0.09310	N	1	B	0.32893	0.389	B	0.16722	0.016	T	0.24584	-1.0156	8	0.21014	T	0.42	.	0.1983	0.00142	0.2429:0.1686:0.247:0.3415	.	26	C9JUS6	ADM5_HUMAN	Q	26	.	ENSP00000393631:R26Q	R	+	2	0	C19orf76	54885177	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.639000	0.05446	-0.988000	0.03489	-0.264000	0.10439	CGA	C19orf76	-	NULL	ENSG00000224420		0.637	ADM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf76	HGNC	protein_coding	OTTHUMT00000465777.1	17	0.00	0	G	NM_001101340		50193365	50193365	+1	no_errors	ENST00000420022	ensembl	human	known	69_37n	missense	19	38.71	12	SNP	0.000	A
C2orf83	56918	genome.wustl.edu	37	2	228476365	228476365	+	Silent	SNP	A	A	G			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr2:228476365A>G	ENST00000264387.4	-	3	284	c.198T>C	c.(196-198)agT>agC	p.S66S	C2orf83_ENST00000409066.1_3'UTR	NM_020161.3	NP_064546.3	Q53S99	CB083_HUMAN	chromosome 2 open reading frame 83	66					transport (GO:0006810)	membrane (GO:0016020)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|stomach(2)	11						TCTCAGATGGACTTAATACTG	0.423																																						dbGAP											0													59.0	64.0	62.0					2																	228476365		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS33388.1, CCDS54434.1	2q36.3	2008-09-16			ENSG00000042304	ENSG00000042304			25344	protein-coding gene	gene with protein product							Standard	NM_020161		Approved	DKFZp547H025	uc002vph.3	Q53S99	OTTHUMG00000153550	ENST00000264387.4:c.198T>C	2.37:g.228476365A>G			A2RRG6|B8ZZI8|Q9NPW4	Silent	SNP	pfam_Folate_carrier	p.S66	ENST00000264387.4	37	c.198	CCDS33388.1	2																																																																																			C2orf83	-	NULL	ENSG00000042304		0.423	C2orf83-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C2orf83	HGNC	protein_coding	OTTHUMT00000331607.1	207	0.00	0	A	NM_020161		228476365	228476365	-1	no_errors	ENST00000264387	ensembl	human	known	69_37n	silent	156	18.32	35	SNP	0.382	G
CA6	765	genome.wustl.edu	37	1	9022689	9022689	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr1:9022689C>T	ENST00000377443.2	+	5	549	c.545C>T	c.(544-546)tCt>tTt	p.S182F	CA6_ENST00000377442.2_Missense_Mutation_p.S122F|CA6_ENST00000476083.1_3'UTR|CA6_ENST00000377436.3_Missense_Mutation_p.S182F	NM_001215.3	NP_001206.2	P23280	CAH6_HUMAN	carbonic anhydrase VI	182					bicarbonate transport (GO:0015701)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|skin(5)	16	Ovarian(185;0.112)|all_lung(157;0.143)	all_epithelial(116;1.02e-19)|all_lung(118;3.6e-06)|Lung NSC(185;7.94e-06)|Renal(390;0.000147)|Breast(348;0.00123)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.9e-07)|COAD - Colon adenocarcinoma(227;8.28e-05)|Kidney(185;0.000268)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|STAD - Stomach adenocarcinoma(132;0.00184)|BRCA - Breast invasive adenocarcinoma(304;0.00192)|READ - Rectum adenocarcinoma(331;0.0649)	Mafenide(DB06795)|Zonisamide(DB00909)	AACTTCATTTCTCATCTGGCC	0.522																																						dbGAP											0													122.0	112.0	115.0					1																	9022689		2203	4300	6503	-	-	-	SO:0001583	missense	0			M57892	CCDS30578.1, CCDS57970.1, CCDS57971.1	1p36.2	2008-02-05			ENSG00000131686	ENSG00000131686	4.2.1.1	"""Carbonic anhydrases"""	1380	protein-coding gene	gene with protein product		114780				9691177	Standard	NM_001215		Approved		uc031plc.1	P23280	OTTHUMG00000001763	ENST00000377443.2:c.545C>T	1.37:g.9022689C>T	ENSP00000366662:p.Ser182Phe		E7EMQ1|Q5FBW3|Q5FC00|Q96QX8|Q9UF03	Missense_Mutation	SNP	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.S182F	ENST00000377443.2	37	c.545	CCDS30578.1	1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.044835	0.75732	.	.	ENSG00000131686	ENST00000549778;ENST00000377443;ENST00000377436;ENST00000377442	T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35	5.0	3.96	0.45880	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.654935	0.15985	N	0.235096	D	0.83571	0.5283	M	0.94101	3.495	0.19945	N	0.999946	D;D	0.71674	0.998;0.989	D;P	0.67382	0.951;0.889	T	0.74737	-0.3564	10	0.87932	D	0	.	9.3616	0.38199	0.2665:0.7335:0.0:0.0	.	122;182	E7EMQ1;P23280	.;CAH6_HUMAN	F	150;182;182;122	ENSP00000447108:S150F;ENSP00000366662:S182F;ENSP00000366654:S182F;ENSP00000366661:S122F	ENSP00000366654:S182F	S	+	2	0	CA6	8945276	0.346000	0.24844	0.251000	0.24312	0.913000	0.54294	2.262000	0.43285	2.453000	0.82957	0.650000	0.86243	TCT	CA6	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	ENSG00000131686		0.522	CA6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CA6	HGNC	protein_coding	OTTHUMT00000004911.1	389	0.26	1	C			9022689	9022689	+1	no_errors	ENST00000377443	ensembl	human	known	69_37n	missense	282	19.43	68	SNP	0.085	T
CCDC154	645811	genome.wustl.edu	37	16	1488633	1488633	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr16:1488633C>T	ENST00000389176.3	-	9	1205	c.1039G>A	c.(1039-1041)Gag>Aag	p.E347K	CCDC154_ENST00000409671.1_Missense_Mutation_p.E193K	NM_001143980.1	NP_001137452.1	A6NI56	CC154_HUMAN	coiled-coil domain containing 154	347						endosome (GO:0005768)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)	5						GCTTTCTCCTCGGCCAGTAGG	0.672																																						dbGAP											0													44.0	53.0	51.0					16																	1488633		692	1590	2282	-	-	-	SO:0001583	missense	0					16p13.3	2012-12-13			ENSG00000197599	ENSG00000197599			34454	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 29"""	C16orf29			Standard	NM_001143980		Approved	LOC645811	uc010uve.2	A6NI56	OTTHUMG00000154097	ENST00000389176.3:c.1039G>A	16.37:g.1488633C>T	ENSP00000373828:p.Glu347Lys		G9JV18	Missense_Mutation	SNP	NULL	p.E347K	ENST00000389176.3	37	c.1039		16	.	.	.	.	.	.	.	.	.	.	C	10.37	1.331863	0.24167	.	.	ENSG00000197599	ENST00000409671;ENST00000389176	.	.	.	4.17	3.21	0.36854	.	0.000000	0.38548	N	0.001644	T	0.19446	0.0467	L	0.29908	0.895	0.27083	N	0.963046	P	0.40638	0.725	B	0.27715	0.082	T	0.11251	-1.0595	9	0.48119	T	0.1	-7.5466	8.0438	0.30536	0.0:0.8829:0.0:0.1171	.	347	A6NI56	CC154_HUMAN	K	193;347	.	ENSP00000373828:E347K	E	-	1	0	CCDC154	1428634	0.018000	0.18449	0.277000	0.24703	0.015000	0.08874	0.260000	0.18424	0.751000	0.32900	0.491000	0.48974	GAG	CCDC154	-	NULL	ENSG00000197599		0.672	CCDC154-201	KNOWN	basic|appris_candidate_longest	protein_coding	CCDC154	HGNC	protein_coding		48	0.00	0	C	NM_001143980		1488633	1488633	-1	no_errors	ENST00000389176	ensembl	human	known	69_37n	missense	84	15.15	15	SNP	0.564	T
CCDC158	339965	genome.wustl.edu	37	4	77304840	77304840	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr4:77304840G>C	ENST00000388914.3	-	6	930	c.778C>G	c.(778-780)Cta>Gta	p.L260V	CCDC158_ENST00000434846.2_Missense_Mutation_p.L260V	NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	260										breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						TGCAGAAGTAGTTCTATTTTG	0.383																																						dbGAP											0													247.0	217.0	226.0					4																	77304840		1848	4098	5946	-	-	-	SO:0001583	missense	0			BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.778C>G	4.37:g.77304840G>C	ENSP00000373566:p.Leu260Val		Q8IYQ1|Q8N7D4|Q8N7E3	Missense_Mutation	SNP	superfamily_Prefoldin	p.L260V	ENST00000388914.3	37	c.778	CCDS43242.1	4	.	.	.	.	.	.	.	.	.	.	G	17.26	3.345128	0.61073	.	.	ENSG00000163749	ENST00000388914;ENST00000318586;ENST00000434846	T;T	0.35973	1.31;1.28	5.78	0.914	0.19360	.	0.000000	0.44902	D	0.000404	T	0.30916	0.0780	N	0.19112	0.55	0.26025	N	0.981816	D;D	0.60575	0.988;0.976	P;P	0.56612	0.802;0.741	T	0.21518	-1.0243	10	0.23891	T	0.37	.	8.5929	0.33699	0.4205:0.0:0.5795:0.0	.	260;260	Q5M9N0-3;Q5M9N0	.;CD158_HUMAN	V	260	ENSP00000373566:L260V;ENSP00000401742:L260V	ENSP00000316815:L260V	L	-	1	2	CCDC158	77523864	0.995000	0.38212	0.977000	0.42913	0.955000	0.61496	1.489000	0.35562	0.065000	0.16485	0.650000	0.86243	CTA	CCDC158	-	NULL	ENSG00000163749		0.383	CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC158	HGNC	protein_coding	OTTHUMT00000362694.2	1026	0.00	0	G	NM_001042784		77304840	77304840	-1	no_errors	ENST00000388914	ensembl	human	known	69_37n	missense	816	12.63	118	SNP	0.955	C
CCNT1	904	genome.wustl.edu	37	12	49086993	49086993	+	Silent	SNP	G	G	C			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr12:49086993G>C	ENST00000261900.3	-	9	2226	c.2004C>G	c.(2002-2004)ctC>ctG	p.L668L		NM_001240.3	NP_001231.2	O60563	CCNT1_HUMAN	cyclin T1	668					cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|snRNA binding (GO:0017069)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|skin(2)	27						CCTGGGCACTGAGCAGGGAGT	0.498																																						dbGAP											0													150.0	140.0	144.0					12																	49086993		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF048730	CCDS8766.1, CCDS61109.1	12q13.11	2010-11-15			ENSG00000129315	ENSG00000129315			1599	protein-coding gene	gene with protein product		143055	"""human immunodeficiency virus type 1 (HIV-1) expression (elevated) 1"""	HIVE1		9491887, 9499409	Standard	NM_001240		Approved	CCNT, CYCT1	uc001rsd.4	O60563	OTTHUMG00000170393	ENST00000261900.3:c.2004C>G	12.37:g.49086993G>C			A9XU13|E7EX76|O60581	Silent	SNP	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like	p.L668	ENST00000261900.3	37	c.2004	CCDS8766.1	12																																																																																			CCNT1	-	NULL	ENSG00000129315		0.498	CCNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNT1	HGNC	protein_coding	OTTHUMT00000408853.1	315	0.00	0	G	NM_001240		49086993	49086993	-1	no_errors	ENST00000261900	ensembl	human	known	69_37n	silent	307	15.15	55	SNP	0.999	C
CD55	1604	genome.wustl.edu	37	1	207498997	207498997	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr1:207498997G>A	ENST00000367064.3	+	4	767	c.509G>A	c.(508-510)cGa>cAa	p.R170Q	CD55_ENST00000465534.1_3'UTR|CD55_ENST00000367065.5_Missense_Mutation_p.R170Q|CD55_ENST00000314754.8_Missense_Mutation_p.R170Q|CD55_ENST00000391920.4_Missense_Mutation_p.R170Q|CD55_ENST00000367063.2_Missense_Mutation_p.R170Q|CD55_ENST00000391921.4_Missense_Mutation_p.R106Q|CD55_ENST00000367062.4_Missense_Mutation_p.R170Q|CD55_ENST00000367067.4_3'UTR	NM_000574.3	NP_000565.1	P08174	DAF_HUMAN	CD55 molecule, decay accelerating factor for complement (Cromer blood group)	170	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				CD4-positive, alpha-beta T cell cytokine production (GO:0035743)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|maternal process involved in parturition (GO:0060137)|negative regulation of complement activation (GO:0045916)|positive regulation of CD4-positive, alpha-beta T cell activation (GO:2000516)|positive regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000563)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of complement activation (GO:0030449)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|respiratory burst (GO:0045730)|response to peptide hormone (GO:0043434)|response to virus (GO:0009615)|spermatogenesis (GO:0007283)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	enzyme inhibitor activity (GO:0004857)|lipid binding (GO:0008289)|virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	16					Chloramphenicol(DB00446)	GGAGAAATACGAAATGGTCAG	0.353																																						dbGAP											0													170.0	164.0	166.0					1																	207498997		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC001288	CCDS31006.1, CCDS44307.1, CCDS73022.1	1q32	2014-09-17	2006-03-28	2006-02-23	ENSG00000196352	ENSG00000196352		"""CD molecules"", ""Blood group antigens"""	2665	protein-coding gene	gene with protein product		125240	"""decay accelerating factor for complement (CD55, Cromer blood group system)"""	DAF			Standard	XM_005273077		Approved	CR, TC, CROM	uc001hfr.4	P08174	OTTHUMG00000036255	ENST00000367064.3:c.509G>A	1.37:g.207498997G>A	ENSP00000356031:p.Arg170Gln		B1AP14|D3DT83|D3DT84|E7ER69|P09679|P78361|Q14UF2|Q14UF3|Q14UF4|Q14UF5|Q14UF6	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.R170Q	ENST00000367064.3	37	c.509	CCDS31006.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.026|3.026	-0.200699|-0.200699	0.06219|0.06219	.|.	.|.	ENSG00000196352|ENSG00000196352	ENST00000343420|ENST00000367064;ENST00000367063;ENST00000391921;ENST00000536840;ENST00000314754;ENST00000367065;ENST00000391920;ENST00000367062	.|T;T;T;T;T;T;T	.|0.63744	.|-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06	5.5|5.5	-11.0|-11.0	0.00169|0.00169	.|Complement control module (2);Sushi/SCR/CCP (3);	.|6.605220	.|0.00166	.|N	.|0.000001	T|T	0.26593|0.26593	0.0650|0.0650	N|N	0.02916|0.02916	-0.46|-0.46	0.19300|0.19300	N|N	0.999973|0.999973	.|B;B;B;B;B	.|0.15141	.|0.004;0.004;0.001;0.012;0.002	.|B;B;B;B;B	.|0.06405	.|0.001;0.001;0.002;0.001;0.002	T|T	0.31668|0.31668	-0.9935|-0.9935	5|10	.|0.15066	.|T	.|0.55	.|.	2.2589|2.2589	0.04062|0.04062	0.1842:0.4003:0.1715:0.244|0.1842:0.4003:0.1715:0.244	.|.	.|106;170;170;170;170	.|B1AP15;Q14UF4;P08174-2;P08174;B1AP13	.|.;.;.;DAF_HUMAN;.	K|Q	180|170;170;106;106;170;170;170;170	.|ENSP00000356031:R170Q;ENSP00000356030:R170Q;ENSP00000375788:R106Q;ENSP00000316333:R170Q;ENSP00000356032:R170Q;ENSP00000375787:R170Q;ENSP00000356029:R170Q	.|ENSP00000316333:R170Q	E|R	+|+	1|2	0|0	CD55|CD55	205565620|205565620	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-4.960000|-4.960000	0.00165|0.00165	-3.827000|-3.827000	0.00102|0.00102	-3.388000|-3.388000	0.00040|0.00040	GAA|CGA	CD55	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000196352		0.353	CD55-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD55	HGNC	protein_coding	OTTHUMT00000088208.2	570	0.00	0	G	NM_000574		207498997	207498997	+1	no_errors	ENST00000314754	ensembl	human	known	69_37n	missense	426	14.80	74	SNP	0.000	A
CDHR4	389118	genome.wustl.edu	37	3	49831147	49831147	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr3:49831147G>A	ENST00000412678.2	-	12	1500	c.1492C>T	c.(1492-1494)Cac>Tac	p.H498Y	CDHR4_ENST00000462108.1_5'Flank	NM_001007540.2	NP_001007541.2	A6H8M9	CDHR4_HUMAN	cadherin-related family member 4	498	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(3)	11						CCCAGGAGGTGAACTTCCCCT	0.587																																						dbGAP											0													139.0	135.0	136.0					3																	49831147		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS46829.1	3p21.31	2011-07-01	2010-01-25	2010-01-25	ENSG00000187492	ENSG00000187492		"""Cadherins / Cadherin-related"""	34527	protein-coding gene	gene with protein product			"""cadherin-like 29"""	CDH29			Standard	NM_001007540		Approved	VLLR9392	uc010hkz.3	A6H8M9	OTTHUMG00000158198	ENST00000412678.2:c.1492C>T	3.37:g.49831147G>A	ENSP00000391409:p.His498Tyr		Q6UXT0	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.H498Y	ENST00000412678.2	37	c.1492	CCDS46829.1	3	.	.	.	.	.	.	.	.	.	.	G	3.943	-0.013921	0.07681	.	.	ENSG00000187492	ENST00000412678	T	0.50548	0.74	5.26	1.42	0.22433	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.20292	0.0488	N	0.04787	-0.16	0.09310	N	1	B	0.02656	0.0	B	0.10450	0.005	T	0.27434	-1.0074	9	0.02654	T	1	1.5431	7.5699	0.27900	0.3464:0.0:0.6536:0.0	.	498	A6H8M9	CDHR4_HUMAN	Y	498	ENSP00000391409:H498Y	ENSP00000391409:H498Y	H	-	1	0	CDHR4	49806151	0.001000	0.12720	0.699000	0.30290	0.177000	0.22998	0.427000	0.21379	0.596000	0.29794	-0.205000	0.12727	CAC	CDHR4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	ENSG00000187492		0.587	CDHR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDHR4	HGNC	protein_coding	OTTHUMT00000350387.1	277	0.00	0	G	NM_001007540		49831147	49831147	-1	no_errors	ENST00000412678	ensembl	human	known	69_37n	missense	161	28.00	63	SNP	0.032	A
CDK19	23097	genome.wustl.edu	37	6	110944522	110944522	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr6:110944522C>A	ENST00000368911.3	-	9	1083	c.904G>T	c.(904-906)Gtc>Ttc	p.V302F	CDK19_ENST00000323817.3_Missense_Mutation_p.V242F|CDK19_ENST00000413605.2_Missense_Mutation_p.V178F	NM_015076.3	NP_055891.1	Q9BWU1	CDK19_HUMAN	cyclin-dependent kinase 19	302	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(2)|prostate(2)|skin(1)	22						TCAGGCTTGACCTTGTGTTTC	0.443																																						dbGAP											0													239.0	191.0	207.0					6																	110944522		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL122055	CCDS5085.1, CCDS75503.1	6q21	2011-10-25	2009-12-16	2009-12-16	ENSG00000155111	ENSG00000155111		"""Cyclin-dependent kinases"""	19338	protein-coding gene	gene with protein product		614720	"""cyclin-dependent kinase (CDC2-like) 11"", ""cell division cycle 2-like 6 (CDK8-like)"""	CDK11, CDC2L6		10470851, 19884882	Standard	XM_005266871		Approved	KIAA1028, bA346C16.3	uc003puh.1	Q9BWU1	OTTHUMG00000015365	ENST00000368911.3:c.904G>T	6.37:g.110944522C>A	ENSP00000357907:p.Val302Phe		Q5JQZ7|Q5JR00|Q8TC78|Q9UPX2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.V302F	ENST00000368911.3	37	c.904	CCDS5085.1	6	.	.	.	.	.	.	.	.	.	.	C	30	5.055891	0.93793	.	.	ENSG00000155111	ENST00000368911;ENST00000323817;ENST00000392576;ENST00000413605;ENST00000457688	T;T;T;T	0.64438	0.94;0.94;0.94;-0.1	5.9	5.9	0.94986	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.42086	0.1187	N	0.20445	0.575	0.80722	D	1	P;B	0.36086	0.536;0.234	B;B	0.44224	0.444;0.179	T	0.40572	-0.9556	10	0.09338	T	0.73	-11.8471	20.2821	0.98520	0.0:1.0:0.0:0.0	.	178;302	B4DUB1;Q9BWU1	.;CDK19_HUMAN	F	302;242;241;178;242	ENSP00000357907:V302F;ENSP00000317665:V242F;ENSP00000410604:V178F;ENSP00000415621:V242F	ENSP00000317665:V242F	V	-	1	0	CDK19	111051215	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.398000	0.79919	2.786000	0.95864	0.563000	0.77884	GTC	CDK19	-	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000155111		0.443	CDK19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK19	HGNC	protein_coding	OTTHUMT00000041804.1	366	0.00	0	C	NM_015076		110944522	110944522	-1	no_errors	ENST00000368911	ensembl	human	known	69_37n	missense	240	19.13	57	SNP	1.000	A
CHRNB1	1140	genome.wustl.edu	37	17	7359155	7359155	+	Silent	SNP	C	C	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr17:7359155C>A	ENST00000306071.2	+	10	1327	c.1260C>A	c.(1258-1260)atC>atA	p.I420I	CHRNB1_ENST00000576360.1_Silent_p.I299I|CHRNB1_ENST00000536404.2_Silent_p.I348I|CHRNB1_ENST00000575379.1_5'UTR	NM_000747.2	NP_000738.2	P11230	ACHB_HUMAN	cholinergic receptor, nicotinic, beta 1 (muscle)	420					behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|neurological system process (GO:0050877)|neuromuscular synaptic transmission (GO:0007274)|postsynaptic membrane organization (GO:0001941)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)|ligand-gated ion channel activity (GO:0015276)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|ovary(3)	23		Prostate(122;0.157)			Galantamine(DB00674)	GGCGATTTATCGATGGTCCAA	0.612																																						dbGAP											0													75.0	66.0	69.0					17																	7359155		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X14830	CCDS11106.1	17p13.1	2012-02-11	2006-02-01		ENSG00000170175	ENSG00000170175		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1961	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 1 (muscle)"""	100710	"""cholinergic receptor, nicotinic, beta polypeptide 1 (muscle)"""	CHRNB			Standard	NM_000747		Approved		uc002ghb.3	P11230	OTTHUMG00000108139	ENST00000306071.2:c.1260C>A	17.37:g.7359155C>A			B7Z5H1|Q8IZ46|Q96FB8	Nonsense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel	p.S308*	ENST00000306071.2	37	c.923	CCDS11106.1	17																																																																																			CHRNB1	-	superfamily_Neurotrans-gated_channel_TM	ENSG00000170175		0.612	CHRNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNB1	HGNC	protein_coding	OTTHUMT00000226942.3	115	0.00	0	C			7359155	7359155	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000570557	ensembl	human	novel	69_37n	nonsense	86	24.56	28	SNP	0.987	A
CHRNB4	1143	genome.wustl.edu	37	15	78921439	78921439	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr15:78921439G>A	ENST00000261751.3	-	5	1319	c.1208C>T	c.(1207-1209)tCt>tTt	p.S403F	RP11-335K5.2_ENST00000559120.1_RNA|CHRNB4_ENST00000412074.2_Intron|CHRNB4_ENST00000560511.1_5'Flank	NM_000750.3	NP_000741.1	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4 (neuronal)	403					action potential (GO:0001508)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|regulation of neurotransmitter secretion (GO:0046928)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			endometrium(7)|kidney(1)|lung(13)|prostate(1)	22					Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)	CACCGGGGTAGAGCCGGCTGG	0.612																																						dbGAP											0													48.0	51.0	50.0					15																	78921439		2196	4293	6489	-	-	-	SO:0001583	missense	0			U48861	CCDS10306.1, CCDS58392.1	15q24	2012-02-11	2012-02-07		ENSG00000117971	ENSG00000117971		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1964	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 4 (neuronal)"""	118509	"""cholinergic receptor, nicotinic, beta polypeptide 4"""			2004777	Standard	NM_000750		Approved		uc002bed.1	P30926	OTTHUMG00000143860	ENST00000261751.3:c.1208C>T	15.37:g.78921439G>A	ENSP00000261751:p.Ser403Phe		A4FTX5|E9PHE8|Q16607|Q4VBA5|Q8WXC8|Q9BQR4	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.S403F	ENST00000261751.3	37	c.1208	CCDS10306.1	15	.	.	.	.	.	.	.	.	.	.	G	0.160	-1.082243	0.01888	.	.	ENSG00000117971	ENST00000261751	D	0.86297	-2.1	5.32	4.41	0.53225	Neurotransmitter-gated ion-channel transmembrane domain (2);	33.597600	0.00166	N	0.000000	D	0.87485	0.6189	L	0.52266	1.64	0.22880	N	0.998619	B	0.32526	0.374	B	0.38921	0.285	T	0.72050	-0.4407	10	0.48119	T	0.1	.	8.7174	0.34419	0.2344:0.0:0.7656:0.0	.	403	P30926	ACHB4_HUMAN	F	403	ENSP00000261751:S403F	ENSP00000261751:S403F	S	-	2	0	CHRNB4	76708494	0.576000	0.26700	0.011000	0.14972	0.008000	0.06430	2.617000	0.46385	1.258000	0.44101	0.561000	0.74099	TCT	CHRNB4	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel	ENSG00000117971		0.612	CHRNB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNB4	HGNC	protein_coding	OTTHUMT00000290108.1	215	0.00	0	G			78921439	78921439	-1	no_errors	ENST00000261751	ensembl	human	known	69_37n	missense	253	25.07	85	SNP	0.003	A
COL12A1	1303	genome.wustl.edu	37	6	75814970	75814970	+	Silent	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr6:75814970G>A	ENST00000322507.8	-	54	8526	c.8217C>T	c.(8215-8217)tgC>tgT	p.C2739C	COL12A1_ENST00000345356.6_Silent_p.C1575C|COL12A1_ENST00000416123.2_Silent_p.C2663C|COL12A1_ENST00000483888.2_Silent_p.C2739C	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	2739	Nonhelical region (NC3).				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						GTGTACATGTGCAAGAATTTG	0.403																																						dbGAP											0													64.0	79.0	75.0					6																	75814970		1864	4115	5979	-	-	-	SO:0001819	synonymous_variant	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.8217C>T	6.37:g.75814970G>A			O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Silent	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.C2739	ENST00000322507.8	37	c.8217	CCDS43482.1	6																																																																																			COL12A1	-	NULL	ENSG00000111799		0.403	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	226	0.00	0	G	NM_004370		75814970	75814970	-1	no_errors	ENST00000322507	ensembl	human	known	69_37n	silent	151	16.57	30	SNP	0.997	A
COL12A1	1303	genome.wustl.edu	37	6	75892984	75892984	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr6:75892984C>G	ENST00000322507.8	-	10	1982	c.1673G>C	c.(1672-1674)aGa>aCa	p.R558T	COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000416123.2_Missense_Mutation_p.R558T|COL12A1_ENST00000483888.2_Missense_Mutation_p.R558T	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	558	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CGCAGGATCTCTGAAAGCATC	0.428																																						dbGAP											0													169.0	160.0	163.0					6																	75892984		1919	4136	6055	-	-	-	SO:0001583	missense	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.1673G>C	6.37:g.75892984C>G	ENSP00000325146:p.Arg558Thr		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.R558T	ENST00000322507.8	37	c.1673	CCDS43482.1	6	.	.	.	.	.	.	.	.	.	.	C	13.92	2.380019	0.42207	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	D;D;D	0.83419	-1.72;-1.72;-1.72	5.56	4.68	0.58851	von Willebrand factor, type A (3);	0.074841	0.56097	D	0.000024	T	0.49592	0.1566	N	0.17594	0.5	0.30254	N	0.79382	P;P	0.38677	0.642;0.642	B;B	0.31495	0.131;0.131	T	0.52866	-0.8518	10	0.49607	T	0.09	.	5.573	0.17208	0.0:0.7346:0.0:0.2654	.	558;558	D6RGG3;Q99715	.;COCA1_HUMAN	T	558	ENSP00000325146:R558T;ENSP00000412864:R558T;ENSP00000421216:R558T	ENSP00000325146:R558T	R	-	2	0	COL12A1	75949704	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.544000	0.45761	2.777000	0.95525	0.655000	0.94253	AGA	COL12A1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000111799		0.428	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	404	0.00	0	C	NM_004370		75892984	75892984	-1	no_errors	ENST00000322507	ensembl	human	known	69_37n	missense	251	16.33	49	SNP	1.000	G
CSMD1	64478	genome.wustl.edu	37	8	3057296	3057296	+	Silent	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr8:3057296G>A	ENST00000520002.1	-	34	5692	c.5137C>T	c.(5137-5139)Ctg>Ttg	p.L1713L	CSMD1_ENST00000523387.1_5'UTR|CSMD1_ENST00000539096.1_Silent_p.L1712L|CSMD1_ENST00000537824.1_Silent_p.L1712L|CSMD1_ENST00000602557.1_Silent_p.L1713L|CSMD1_ENST00000602723.1_Silent_p.L1713L|CSMD1_ENST00000542608.1_Silent_p.L1712L|CSMD1_ENST00000400186.3_Silent_p.L1713L			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1713	CUB 10. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AATCGGAGCAGAATTTGATTT	0.507																																						dbGAP											0													42.0	43.0	43.0					8																	3057296		1928	4161	6089	-	-	-	SO:0001819	synonymous_variant	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.5137C>T	8.37:g.3057296G>A			Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,smart_CUB,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.S1192F	ENST00000520002.1	37	c.3575		8	.	.	.	.	.	.	.	.	.	.	G	8.384	0.838206	0.16891	.	.	ENSG00000183117	ENST00000335551	.	.	.	5.61	3.79	0.43588	.	.	.	.	.	T	0.62792	0.2457	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61549	-0.7040	4	.	.	.	.	11.8727	0.52529	0.141:0.0:0.859:0.0	.	.	.	.	F	1192	.	.	S	-	2	0	CSMD1	3044703	1.000000	0.71417	0.999000	0.59377	0.758000	0.43043	1.394000	0.34509	1.494000	0.48533	0.655000	0.94253	TCT	CSMD1	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000183117		0.507	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	129	0.00	0	G	NM_033225		3057296	3057296	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000335551	ensembl	human	novel	69_37n	missense	77	27.36	29	SNP	1.000	A
DGKA	1606	genome.wustl.edu	37	12	56335341	56335341	+	Missense_Mutation	SNP	A	A	G	rs199795969	byFrequency	TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr12:56335341A>G	ENST00000331886.5	+	15	1677	c.1223A>G	c.(1222-1224)aAc>aGc	p.N408S	DGKA_ENST00000394147.1_Missense_Mutation_p.N408S|DGKA_ENST00000549079.2_3'UTR|DGKA_ENST00000551156.1_Missense_Mutation_p.N408S	NM_001345.4	NP_001336.2	P23743	DGKA_HUMAN	diacylglycerol kinase, alpha 80kDa	408	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(4)|pancreas(1)|skin(3)|urinary_tract(1)	25					Vitamin E(DB00163)	CAGGTGTTCAACCTCCTAAAG	0.493													A|||	10	0.00199681	0.0	0.0	5008	,	,		19872	0.0		0.0	False		,,,				2504	0.0102					dbGAP											0													127.0	130.0	129.0					12																	56335341		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF064767	CCDS8896.1	12q13.3	2013-01-10	2002-08-29			ENSG00000065357	2.7.1.107	"""EF-hand domain containing"""	2849	protein-coding gene	gene with protein product		125855	"""diacylglycerol kinase, alpha (80kD)"""	DAGK, DAGK1		8180475, 7959783	Standard	NM_001345		Approved	DGK-alpha	uc001sim.3	P23743		ENST00000331886.5:c.1223A>G	12.37:g.56335341A>G	ENSP00000328405:p.Asn408Ser		O75481|O75482|O75483|O95217|Q3ZE25|Q8IZ56|Q8N5Q2	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_EF_hand_Ca-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,pfscan_EF_HAND_2,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.N408S	ENST00000331886.5	37	c.1223	CCDS8896.1	12	.	.	.	.	.	.	.	.	.	.	A	16.12	3.031814	0.54790	.	.	ENSG00000065357	ENST00000331886;ENST00000555218;ENST00000394147;ENST00000551156	T;T;T;T	0.20881	2.04;2.04;2.04;2.04	5.31	5.31	0.75309	Diacylglycerol kinase, catalytic domain (3);	0.137507	0.64402	D	0.000006	T	0.20047	0.0482	L	0.31476	0.935	0.45580	D	0.998528	B;B	0.25235	0.096;0.121	B;B	0.34779	0.06;0.189	T	0.06789	-1.0807	10	0.27082	T	0.32	.	14.6932	0.69101	1.0:0.0:0.0:0.0	.	327;408	G3V4E1;P23743	.;DGKA_HUMAN	S	408;327;408;408	ENSP00000328405:N408S;ENSP00000451743:N327S;ENSP00000377703:N408S;ENSP00000450359:N408S	ENSP00000328405:N408S	N	+	2	0	DGKA	54621608	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.001000	0.88508	2.367000	0.80283	0.528000	0.53228	AAC	DGKA	-	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	ENSG00000065357		0.493	DGKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGKA	HGNC	protein_coding	OTTHUMT00000407291.1	463	0.22	1	A			56335341	56335341	+1	no_errors	ENST00000331886	ensembl	human	known	69_37n	missense	322	30.84	144	SNP	1.000	G
EIF4G3	8672	genome.wustl.edu	37	1	21175934	21175934	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr1:21175934C>T	ENST00000264211.8	-	23	3888	c.3694G>A	c.(3694-3696)Gaa>Aaa	p.E1232K	EIF4G3_ENST00000602326.1_Missense_Mutation_p.E1238K|EIF4G3_ENST00000374937.3_Missense_Mutation_p.E1238K|EIF4G3_ENST00000400422.1_Missense_Mutation_p.E1232K|EIF4G3_ENST00000374935.3_Missense_Mutation_p.E952K|EIF4G3_ENST00000536266.1_Missense_Mutation_p.E836K|EIF4G3_ENST00000537738.1_Missense_Mutation_p.E722K	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	1232	MI. {ECO:0000255|PROSITE- ProRule:PRU00698}.				cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		TGTAGAAATTCATCAATGATA	0.338																																						dbGAP											0													79.0	73.0	75.0					1																	21175934		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.3694G>A	1.37:g.21175934C>T	ENSP00000264211:p.Glu1232Lys		B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,pfam_Initiation_fac_eIF4g_MI,pfam_W2_domain,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3,smart_Initiation_fac_eIF4g_MI,smart_W2_domain	p.E1238K	ENST00000264211.8	37	c.3712	CCDS214.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.688766	0.96784	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374935;ENST00000537738;ENST00000374937;ENST00000536266	T;T;T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16;-0.16;-0.16	5.87	5.87	0.94306	Initiation factor eIF-4 gamma, MA3 (3);Armadillo-type fold (1);	0.049075	0.85682	D	0.000000	D	0.83243	0.5212	M	0.86953	2.85	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;1.0;0.997;1.0	D;D;D;D;D	0.91635	0.992;0.998;0.999;0.983;0.997	D	0.85036	0.0920	10	0.87932	D	0	-18.4013	20.206	0.98277	0.0:1.0:0.0:0.0	.	1427;952;836;1238;1232	Q59GJ0;Q504Z1;F5H564;B9EGQ7;O43432	.;.;.;.;IF4G3_HUMAN	K	1232;1428;1232;952;722;1238;836	ENSP00000264211:E1232K;ENSP00000383274:E1232K;ENSP00000364071:E952K;ENSP00000442010:E722K;ENSP00000364073:E1238K;ENSP00000444693:E836K	ENSP00000264211:E1232K	E	-	1	0	EIF4G3	21048521	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.208000	0.77907	2.785000	0.95823	0.655000	0.94253	GAA	EIF4G3	-	pfam_Initiation_fac_eIF4g_MI,superfamily_ARM-type_fold,smart_Initiation_fac_eIF4g_MI	ENSG00000075151		0.338	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	EIF4G3	HGNC	protein_coding	OTTHUMT00000007467.3	365	0.00	0	C	NM_003760		21175934	21175934	-1	no_errors	ENST00000374937	ensembl	human	known	69_37n	missense	237	23.05	71	SNP	1.000	T
EML5	161436	genome.wustl.edu	37	14	89091348	89091348	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr14:89091348C>T	ENST00000380664.5	-	34	4839	c.4840G>A	c.(4840-4842)Gat>Aat	p.D1614N	EML5_ENST00000554922.1_Missense_Mutation_p.D1622N|EML5_ENST00000553320.1_5'UTR|EML5_ENST00000352093.5_Missense_Mutation_p.D1576N			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	1614						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						ATAAGTCCATCTCGCAGGGTG	0.468																																						dbGAP											0													70.0	70.0	70.0					14																	89091348		1988	4166	6154	-	-	-	SO:0001583	missense	0			AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.4840G>A	14.37:g.89091348C>T	ENSP00000370039:p.Asp1614Asn		B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_HELP,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D1622N	ENST00000380664.5	37	c.4864	CCDS45148.1	14	.	.	.	.	.	.	.	.	.	.	C	34	5.354211	0.95830	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664;ENST00000555823	T;T;T;T	0.58210	2.03;2.03;2.03;0.35	5.01	5.01	0.66863	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (2);	0.104218	0.64402	D	0.000005	T	0.67353	0.2884	L	0.46819	1.47	0.58432	D	0.999996	P;D	0.89917	0.918;1.0	P;D	0.91635	0.749;0.999	T	0.65713	-0.6101	10	0.42905	T	0.14	-19.895	18.5013	0.90882	0.0:1.0:0.0:0.0	.	1622;1614	Q05BV3-5;Q05BV3	.;EMAL5_HUMAN	N	1622;1576;1614;63	ENSP00000451998:D1622N;ENSP00000298315:D1576N;ENSP00000370039:D1614N;ENSP00000452030:D63N	ENSP00000298315:D1576N	D	-	1	0	EML5	88161101	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.171000	0.77595	2.612000	0.88384	0.561000	0.74099	GAT	EML5	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000165521		0.468	EML5-010	KNOWN	basic|CCDS	protein_coding	EML5	HGNC	protein_coding	OTTHUMT00000410491.1	158	0.00	0	C			89091348	89091348	-1	no_errors	ENST00000554922	ensembl	human	known	69_37n	missense	136	20.47	35	SNP	1.000	T
EPOR	2057	genome.wustl.edu	37	19	11488778	11488778	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr19:11488778G>A	ENST00000222139.6	-	8	1513	c.1409C>T	c.(1408-1410)tCa>tTa	p.S470L	EPOR_ENST00000592375.2_3'UTR	NM_000121.3	NP_000112.1	P19235	EPOR_HUMAN	erythropoietin receptor	470					brain development (GO:0007420)|decidualization (GO:0046697)|erythropoietin-mediated signaling pathway (GO:0038162)|heart development (GO:0007507)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	erythropoietin receptor activity (GO:0004900)|identical protein binding (GO:0042802)			endometrium(1)|lung(2)|ovary(1)|urinary_tract(1)	5					Darbepoetin alfa(DB00012)|Epoetin alfa(DB00016)|Epoetin Zeta(DB08923)|Peginesatide(DB08894)	GGAGTCCCCTGAGCTGTAGTC	0.602											OREG0025254	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													80.0	87.0	84.0					19																	11488778		2203	4300	6503	-	-	-	SO:0001583	missense	0			M34986	CCDS12260.1	19p13.3-p13.2	2013-02-11				ENSG00000187266		"""Fibronectin type III domain containing"""	3416	protein-coding gene	gene with protein product		133171					Standard	NM_000121		Approved		uc002mrj.2	P19235		ENST00000222139.6:c.1409C>T	19.37:g.11488778G>A	ENSP00000222139:p.Ser470Leu	672	B2RCG4|Q15443|Q2M205	Missense_Mutation	SNP	pfam_Growth/epo_recpt_lig-bind,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pirsf_Erythropoietin_rcpt,pfscan_Fibronectin_type3	p.S470L	ENST00000222139.6	37	c.1409	CCDS12260.1	19	.	.	.	.	.	.	.	.	.	.	G	14.07	2.426421	0.43020	.	.	ENSG00000187266	ENST00000222139	T	0.47528	0.84	4.82	4.82	0.62117	.	0.000000	0.35838	N	0.002947	T	0.29061	0.0722	L	0.32530	0.975	0.28471	N	0.915432	P	0.43094	0.799	B	0.33799	0.17	T	0.16482	-1.0401	10	0.19147	T	0.46	-36.5793	9.1643	0.37041	0.1007:0.0:0.8993:0.0	.	470	P19235	EPOR_HUMAN	L	470	ENSP00000222139:S470L	ENSP00000222139:S470L	S	-	2	0	EPOR	11349778	1.000000	0.71417	0.929000	0.37066	0.918000	0.54935	3.491000	0.53252	2.210000	0.71456	0.555000	0.69702	TCA	EPOR	-	pirsf_Erythropoietin_rcpt	ENSG00000187266		0.602	EPOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPOR	HGNC	protein_coding	OTTHUMT00000458791.1	125	0.00	0	G			11488778	11488778	-1	no_errors	ENST00000222139	ensembl	human	known	69_37n	missense	59	50.42	60	SNP	0.971	A
EYS	346007	genome.wustl.edu	37	6	65531584	65531584	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr6:65531584G>A	ENST00000370621.3	-	21	3723	c.3197C>T	c.(3196-3198)tCa>tTa	p.S1066L	EYS_ENST00000370616.2_Missense_Mutation_p.S1066L|EYS_ENST00000503581.1_Missense_Mutation_p.S1066L			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	1066	EGF-like 17. {ECO:0000255|PROSITE- ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TGCATCACATGAACATGGATA	0.274																																						dbGAP											0													78.0	64.0	69.0					6																	65531584		692	1588	2280	-	-	-	SO:0001583	missense	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.3197C>T	6.37:g.65531584G>A	ENSP00000359655:p.Ser1066Leu		A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF-like_dom,superfamily_ConA-like_lec_gl,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.S1066L	ENST00000370621.3	37	c.3197		6	.	.	.	.	.	.	.	.	.	.	G	4.964	0.179037	0.09443	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.87571	-2.27;-2.27;-2.27	4.2	0.182	0.15077	.	1.005730	0.08025	N	0.992609	T	0.50531	0.1621	N	0.25286	0.73	0.09310	N	1	B	0.13594	0.008	B	0.11329	0.006	T	0.41034	-0.9531	10	0.07175	T	0.84	.	3.2403	0.06778	0.271:0.0:0.4173:0.3117	.	1066	Q5T1H1-1	.	L	1066	ENSP00000424243:S1066L;ENSP00000359655:S1066L;ENSP00000359650:S1066L	ENSP00000359650:S1066L	S	-	2	0	EYS	65588305	0.000000	0.05858	0.001000	0.08648	0.417000	0.31264	-0.169000	0.09911	-0.052000	0.13311	0.563000	0.77884	TCA	EYS	-	smart_EGF-like_Ca-bd,smart_EGF-like	ENSG00000188107		0.274	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	253	0.00	0	G	XM_294050		65531584	65531584	-1	no_errors	ENST00000370616	ensembl	human	known	69_37n	missense	103	32.24	49	SNP	0.030	A
FAM186A	121006	genome.wustl.edu	37	12	50747708	50747708	+	Silent	SNP	C	C	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr12:50747708C>T	ENST00000327337.5	-	4	2906	c.2907G>A	c.(2905-2907)caG>caA	p.Q969Q	FAM186A_ENST00000543111.1_Silent_p.Q969Q	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	969																	TCTCTGGCTTCTGCTTTTCCT	0.468																																					NSCLC(138;1796 1887 12511 19463 37884)	dbGAP											0													228.0	183.0	197.0					12																	50747708		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.2907G>A	12.37:g.50747708C>T				Silent	SNP	NULL	p.Q969	ENST00000327337.5	37	c.2907	CCDS44878.1	12																																																																																			FAM186A	-	NULL	ENSG00000185958		0.468	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM186A	HGNC	protein_coding	OTTHUMT00000396838.1	944	0.00	0	C	XM_001718353		50747708	50747708	-1	no_errors	ENST00000327337	ensembl	human	known	69_37n	silent	630	30.77	280	SNP	0.867	T
FAM35BP	414241	genome.wustl.edu	37	10	46927958	46927958	+	IGR	SNP	C	C	G			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr10:46927958C>G								FAM35BP (4270 upstream) : RP11-38L15.2 (9649 downstream)																							AGAACAGGATCTACAAACAAT	0.333																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															10.37:g.46927958C>G				RNA	SNP	-	NULL		37	NULL		10	.	.	.	.	.	.	.	.	.	.	C	14.80	2.642621	0.47153	.	.	ENSG00000165874	ENST00000301038;ENST00000539388	.	.	.	4.12	4.12	0.48240	.	0.000000	0.85682	D	0.000000	T	0.72269	0.3439	.	.	.	0.43971	D	0.996654	D	0.89917	1.0	D	0.85130	0.997	T	0.80520	-0.1346	7	0.87932	D	0	-14.9915	9.4785	0.38887	0.2113:0.7887:0.0:0.0	.	90	F5H2C6	.	M	159;90	.	ENSP00000301038:I159M	I	+	3	3	FAM35B	46347964	1.000000	0.71417	1.000000	0.80357	0.708000	0.40852	1.290000	0.33319	2.298000	0.77334	0.460000	0.39030	ATC	FAM35B	-	-	ENSG00000165874	0	0.333					FAM35B	HGNC			141	0.00	0	C			46927958	46927958	+1	no_errors	ENST00000497389	ensembl	human	known	69_37n	rna	64	31.18	29	SNP	1.000	G
FAM45A	404636	genome.wustl.edu	37	10	120863682	120863682	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr10:120863682C>G	ENST00000361432.2	+	1	54	c.28C>G	c.(28-30)Cag>Gag	p.Q10E	FAM45A_ENST00000535029.1_Missense_Mutation_p.Q10E|FAM45A_ENST00000544016.1_5'UTR	NM_207009.2	NP_996892.1	Q8TCE6	FA45A_HUMAN	family with sequence similarity 45, member A	10										breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	14		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0293)		GGCGGACACTCAGCTGATGCT	0.741																																						dbGAP											0													22.0	21.0	21.0					10																	120863682		2113	4136	6249	-	-	-	SO:0001583	missense	0			AF168713	CCDS7609.1	10q25	2008-09-04			ENSG00000119979	ENSG00000119979			31793	protein-coding gene	gene with protein product							Standard	NM_207009		Approved			Q8TCE6	OTTHUMG00000019143	ENST00000361432.2:c.28C>G	10.37:g.120863682C>G	ENSP00000354688:p.Gln10Glu		B1AMV6|B4DDC3|D3DRC8|Q9NXW4	Missense_Mutation	SNP	pfam_Secretory_pathway_prot_Avl9	p.Q10E	ENST00000361432.2	37	c.28	CCDS7609.1	10	.	.	.	.	.	.	.	.	.	.	c	11.72	1.722106	0.30503	.	.	ENSG00000119979	ENST00000535029;ENST00000546291;ENST00000361432	.	.	.	4.77	3.86	0.44501	.	0.126422	0.56097	D	0.000040	T	0.34687	0.0906	N	0.05383	-0.06	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.09185	-1.0686	9	0.23891	T	0.37	.	11.7104	0.51623	0.0:0.9146:0.0:0.0854	.	10	Q8TCE6	FA45A_HUMAN	E	10	.	ENSP00000354688:Q10E	Q	+	1	0	FAM45A	120853672	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	2.558000	0.45879	1.153000	0.42468	0.430000	0.28490	CAG	FAM45A	-	NULL	ENSG00000119979		0.741	FAM45A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM45A	HGNC	protein_coding	OTTHUMT00000050623.1	12	0.00	0	C	NM_207009		120863682	120863682	+1	no_errors	ENST00000361432	ensembl	human	known	69_37n	missense	22	24.14	7	SNP	1.000	G
FANK1	92565	genome.wustl.edu	37	10	127668745	127668745	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr10:127668745C>T	ENST00000368693.1	+	2	133	c.29C>T	c.(28-30)tCa>tTa	p.S10L	FANK1_ENST00000368695.1_Missense_Mutation_p.S4L|FANK1_ENST00000449042.2_Missense_Mutation_p.S4L|FANK1_ENST00000368689.1_Missense_Mutation_p.S4L			Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains 1	10	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(10)|ovary(1)|urinary_tract(1)	21		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				ATGCCACCCTCAAAGCCTCAT	0.468																																						dbGAP											0													92.0	84.0	87.0					10																	127668745		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC024189	CCDS31309.1	10q26.2	2013-02-11	2005-03-01		ENSG00000203780	ENSG00000203780		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	23527	protein-coding gene	gene with protein product		611640	"""fibronectin type 3 and ankyrin repeat domains 1"""			12477932	Standard	NM_145235		Approved		uc001ljh.4	Q8TC84	OTTHUMG00000019241	ENST00000368693.1:c.29C>T	10.37:g.127668745C>T	ENSP00000357682:p.Ser10Leu		Q6UXY9|Q6X7T6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Fibronectin_type3,prints_Ankyrin_rpt	p.S10L	ENST00000368693.1	37	c.29	CCDS31309.1	10	.	.	.	.	.	.	.	.	.	.	C	11.29	1.595494	0.28445	.	.	ENSG00000203780	ENST00000368695;ENST00000368693;ENST00000449042;ENST00000417114;ENST00000445510;ENST00000368691;ENST00000368689;ENST00000368692	T;T;T;T;T;T;T	0.34859	1.34;1.34;1.34;1.34;1.34;1.34;1.34	4.9	3.98	0.46160	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.632286	0.14289	N	0.329002	T	0.30759	0.0775	L	0.48362	1.52	0.24648	N	0.993532	B;B;B;B	0.12630	0.006;0.001;0.0;0.0	B;B;B;B	0.12837	0.008;0.008;0.003;0.001	T	0.20907	-1.0261	10	0.48119	T	0.1	-5.3561	8.0051	0.30321	0.0:0.8102:0.0:0.1898	.	4;10;10;10	B7Z939;Q8TC84-3;Q8TC84-2;Q8TC84	.;.;.;FANK1_HUMAN	L	4;10;4;4;4;4;4;10	ENSP00000357684:S4L;ENSP00000357682:S10L;ENSP00000411388:S4L;ENSP00000396356:S4L;ENSP00000415719:S4L;ENSP00000357680:S4L;ENSP00000357678:S4L	ENSP00000357678:S4L	S	+	2	0	FANK1	127658735	0.007000	0.16637	0.472000	0.27241	0.639000	0.38242	0.995000	0.29706	1.017000	0.39495	0.563000	0.77884	TCA	FANK1	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000203780		0.468	FANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FANK1	HGNC	protein_coding		314	0.00	0	C	NM_145235		127668745	127668745	+1	no_errors	ENST00000368693	ensembl	human	known	69_37n	missense	202	19.20	48	SNP	0.753	T
FBL	2091	genome.wustl.edu	37	19	40328380	40328380	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr19:40328380C>T	ENST00000221801.3	-	6	766	c.653G>A	c.(652-654)cGa>cAa	p.R218Q	FBL_ENST00000593503.1_5'UTR	NM_001436.3	NP_001427.2	P22087	FBRL_HUMAN	fibrillarin	218					histone glutamine methylation (GO:1990258)|osteoblast differentiation (GO:0001649)|rRNA processing (GO:0006364)|snoRNA metabolic process (GO:0016074)|tRNA processing (GO:0008033)	box C/D snoRNP complex (GO:0031428)|Cajal body (GO:0015030)|extracellular vesicular exosome (GO:0070062)|granular component (GO:0001652)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone-glutamine methyltransferase activity (GO:1990259)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)	9	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)	Renal(1328;0.000518)|Hepatocellular(1079;0.0893)	Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)	GBM - Glioblastoma multiforme(1328;0.000826)|STAD - Stomach adenocarcinoma(1328;0.138)		GTGTGGGTGTCGAGCATCCTC	0.582																																						dbGAP											0													163.0	127.0	139.0					19																	40328380		2203	4300	6503	-	-	-	SO:0001583	missense	0			AC005393	CCDS12545.1	19q13.1	2010-02-17			ENSG00000105202	ENSG00000105202			3599	protein-coding gene	gene with protein product		134795				1846968, 2026646	Standard	NM_001436		Approved	RNU3IP1, FLRN, FIB	uc002omn.3	P22087		ENST00000221801.3:c.653G>A	19.37:g.40328380C>T	ENSP00000221801:p.Arg218Gln		B5BUE8|O75259|Q6IAT5|Q9UPI6	Missense_Mutation	SNP	pfam_Fibrillarin,pirsf_Fibrillarin,prints_Fibrillarin	p.R218Q	ENST00000221801.3	37	c.653	CCDS12545.1	19	.	.	.	.	.	.	.	.	.	.	C	36	5.809489	0.96975	.	.	ENSG00000105202	ENST00000221801	.	.	.	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.80014	0.4546	M	0.89840	3.065	0.80722	D	1	D;D	0.76494	0.964;0.999	B;P	0.57101	0.357;0.813	D	0.84840	0.0807	9	0.87932	D	0	-5.2016	16.5575	0.84490	0.0:1.0:0.0:0.0	.	157;218	Q96BS4;P22087	.;FBRL_HUMAN	Q	218	.	ENSP00000221801:R218Q	R	-	2	0	FBL	45020220	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.963000	0.76055	2.501000	0.84356	0.561000	0.74099	CGA	FBL	-	pfam_Fibrillarin,pirsf_Fibrillarin,prints_Fibrillarin	ENSG00000105202		0.582	FBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBL	HGNC	protein_coding	OTTHUMT00000462509.4	273	0.00	0	C	NM_001436		40328380	40328380	-1	no_errors	ENST00000221801	ensembl	human	known	69_37n	missense	219	31.35	100	SNP	1.000	T
FREM1	158326	genome.wustl.edu	37	9	14851512	14851512	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr9:14851512C>G	ENST00000380880.3	-	6	1705	c.922G>C	c.(922-924)Gat>Cat	p.D308H	FREM1_ENST00000380881.4_Missense_Mutation_p.D309H|FREM1_ENST00000422223.2_Missense_Mutation_p.D308H|RNU6-1260P_ENST00000362944.1_RNA			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	308					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		ATGAACTGATCCACTTCCAGA	0.473																																						dbGAP											0													121.0	120.0	120.0					9																	14851512		1956	4147	6103	-	-	-	SO:0001583	missense	0			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.922G>C	9.37:g.14851512C>G	ENSP00000370262:p.Asp308His		B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Calx_beta,superfamily_C-type_lectin_fold,superfamily_Cadherin-like,smart_C-type_lectin,pfscan_C-type_lectin	p.D309H	ENST00000380880.3	37	c.925	CCDS47952.1	9	.	.	.	.	.	.	.	.	.	.	C	33	5.261492	0.95368	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.18657	2.21;2.2;2.2	6.11	6.11	0.99139	.	0.000000	0.85682	D	0.000000	T	0.54046	0.1834	M	0.82517	2.595	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.53422	-0.8441	10	0.62326	D	0.03	-21.4549	20.7342	0.99715	0.0:1.0:0.0:0.0	.	308	Q5H8C1	FREM1_HUMAN	H	309;308;308	ENSP00000370263:D309H;ENSP00000412940:D308H;ENSP00000370262:D308H	ENSP00000370257:D311H	D	-	1	0	FREM1	14841512	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.784000	0.68990	2.906000	0.99361	0.655000	0.94253	GAT	FREM1	-	NULL	ENSG00000164946		0.473	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FREM1	HGNC	protein_coding	OTTHUMT00000339474.2	257	0.00	0	C	NM_144966		14851512	14851512	-1	no_errors	ENST00000380881	ensembl	human	known	69_37n	missense	161	18.69	37	SNP	1.000	G
GABRQ	55879	genome.wustl.edu	37	X	151808900	151808900	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chrX:151808900G>A	ENST00000370306.2	+	2	231	c.211G>A	c.(211-213)Gat>Aat	p.D71N		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	71					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GTCAAGATACGATGTCCGCCT	0.468																																						dbGAP											0													177.0	151.0	160.0					X																	151808900		2203	4300	6503	-	-	-	SO:0001583	missense	0			U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.211G>A	X.37:g.151808900G>A	ENSP00000359329:p.Asp71Asn		A6NFN1|Q32MB4|Q9NZK8	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAt_rcpt,prints_GABAA_rcpt,prints_Neur_channel,prints_GABAAb_rcpt,prints_GABAAa_rcpt,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.D71N	ENST00000370306.2	37	c.211	CCDS14707.1	X	.	.	.	.	.	.	.	.	.	.	G	20.8	4.046498	0.75846	.	.	ENSG00000147402	ENST00000370306;ENST00000333733	T	0.79033	-1.23	4.45	4.45	0.53987	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.40554	N	0.001070	D	0.84615	0.5511	M	0.64676	1.99	0.41103	D	0.985685	D	0.89917	1.0	D	0.97110	1.0	D	0.84776	0.0770	10	0.46703	T	0.11	.	11.3403	0.49529	0.0:0.0:1.0:0.0	.	71	Q9UN88	GBRT_HUMAN	N	71;66	ENSP00000359329:D71N	ENSP00000331410:D66N	D	+	1	0	GABRQ	151559556	1.000000	0.71417	0.848000	0.33437	0.842000	0.47809	5.871000	0.69628	2.051000	0.60960	0.529000	0.55759	GAT	GABRQ	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_GABBAg_rcpt,tigrfam_Neur_channel	ENSG00000147402		0.468	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRQ	HGNC	protein_coding	OTTHUMT00000058763.2	475	0.00	0	G	NM_018558		151808900	151808900	+1	no_errors	ENST00000370306	ensembl	human	known	69_37n	missense	507	18.49	115	SNP	0.999	A
GALNTL6	442117	genome.wustl.edu	37	4	173961139	173961141	+	In_Frame_Del	DEL	AGA	AGA	-	rs369616934		TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	AGA	AGA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr4:173961139_173961141delAGA	ENST00000506823.1	+	13	2351_2353	c.1694_1696delAGA	c.(1693-1698)gagaag>gag	p.K567del	GALNTL6_ENST00000508122.1_In_Frame_Del_p.K550del	NM_001034845.2	NP_001030017.2	Q49A17	GLTL6_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 6	567	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.K567delK(1)		breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(2)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	45						AACCCCGCAGAGAAGAAGATTTT	0.424																																						dbGAP											1	Deletion - In frame(1)	lung(1)																																								-	-	-	SO:0001651	inframe_deletion	0				CCDS34104.1	4q34.1	2014-03-13	2014-03-13		ENSG00000174473	ENSG00000174473		"""Glycosyltransferase family 2 domain containing"""	33844	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 6"""	615138	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6"""				Standard	NM_001034845		Approved	GALNT17, GalNAc-T6L	uc003isv.3	Q49A17	OTTHUMG00000160807	ENST00000506823.1:c.1694_1696delAGA	4.37:g.173961145_173961147delAGA	ENSP00000423313:p.Lys567del		Q2L4S6	In_Frame_Del	DEL	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.K567in_frame_del	ENST00000506823.1	37	c.1694_1696	CCDS34104.1	4																																																																																			GALNTL6	-	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	ENSG00000174473		0.424	GALNTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNTL6	HGNC	protein_coding	OTTHUMT00000362395.1	428	0.00	0	AGA	NM_001034845		173961139	173961141	+1	no_errors	ENST00000506823	ensembl	human	known	69_37n	in_frame_del	398	10.89	49	DEL	1.000:1.000:1.000	-
GOLGA8G	283768	genome.wustl.edu	37	15	28769180	28769180	+	Splice_Site	SNP	C	C	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr15:28769180C>T	ENST00000525590.2	-	15	1377	c.1316G>A	c.(1315-1317)gGa>gAa	p.G439E	RN7SL829P_ENST00000489494.2_RNA|AC138749.1_ENST00000458870.1_RNA|GOLGA8G_ENST00000329523.6_Intron			Q08AF8	GOG8F_HUMAN	golgin A8 family, member G	221						Golgi apparatus (GO:0005794)				lung(1)	1		all_lung(180;1.98e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;4.69e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0201)|GBM - Glioblastoma multiforme(186;0.0503)|Lung(196;0.171)		TCCTCCATCTCCTGGGGGTGG	0.617																																						dbGAP											0													15.0	9.0	12.0					15																	28769180		1851	2295	4146	-	-	-	SO:0001630	splice_region_variant	0					15q13.1	2013-01-17	2010-02-12		ENSG00000183629	ENSG00000183629			25328	other	unknown			"""golgi autoantigen, golgin subfamily a, 8G"""			12477932	Standard	NR_033353		Approved	DKFZp434K052		Q08AF8	OTTHUMG00000167134	ENST00000525590.2:c.1316-1G>A	15.37:g.28769180C>T			A4FTY1|Q1A5X9|Q8NDK0	Missense_Mutation	SNP	NULL	p.G439E	ENST00000525590.2	37	c.1316		15																																																																																			GOLGA8G	-	NULL	ENSG00000183629		0.617	GOLGA8G-001	NOVEL	basic|appris_candidate_longest	protein_coding	GOLGA8G	HGNC	protein_coding	OTTHUMT00000393332.2	153	0.00	0	C	NR_033353.1	Missense_Mutation	28769180	28769180	-1	no_errors	ENST00000416855	ensembl	human	known	69_37n	missense	97	24.62	32	SNP	1.000	T
GPSM2	29899	genome.wustl.edu	37	1	109445764	109445764	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr1:109445764G>A	ENST00000406462.2	+	10	1743	c.970G>A	c.(970-972)Gca>Aca	p.A324T	GPSM2_ENST00000264126.3_Missense_Mutation_p.A324T|AKNAD1_ENST00000357393.4_Intron			P81274	GPSM2_HUMAN	G-protein signaling modulator 2	324					establishment of mitotic spindle orientation (GO:0000132)|G-protein coupled receptor signaling pathway (GO:0007186)|lung epithelial cell differentiation (GO:0060487)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase regulator activity (GO:0030695)|identical protein binding (GO:0042802)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)	14		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0353)|Lung(183;0.0984)|COAD - Colon adenocarcinoma(174;0.129)|Epithelial(280;0.175)|all cancers(265;0.209)		TGAAGGAAGAGCATGTTGGAG	0.363																																						dbGAP											0													110.0	103.0	105.0					1																	109445764		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY136740	CCDS792.2	1p13.3	2013-10-11	2010-06-24		ENSG00000121957	ENSG00000121957		"""Tetratricopeptide (TTC) repeat domain containing"""	29501	protein-coding gene	gene with protein product		609245	"""G-protein signalling modulator 2 (AGS3-like, C. elegans)"", ""deafness, autosomal recessive 82"""	DFNB82		11832491, 8973305, 19888295, 20602914, 21348867	Standard	NM_013296		Approved	LGN, Pins	uc010ovc.2	P81274	OTTHUMG00000011730	ENST00000406462.2:c.970G>A	1.37:g.109445764G>A	ENSP00000385510:p.Ala324Thr		Q5T1N8|Q6IBL7|Q8N0Z5	Missense_Mutation	SNP	pfam_GoLoco_motif,pfam_TPR-1,pfam_TPR-4,smart_TPR_repeat,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.A324T	ENST00000406462.2	37	c.970	CCDS792.2	1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.567275	0.86439	.	.	ENSG00000121957	ENST00000406462;ENST00000264126	T;T	0.78595	-1.19;-1.19	5.59	5.59	0.84812	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.66167	0.2762	L	0.48218	1.51	0.80722	D	1	P	0.44946	0.846	B	0.39152	0.292	T	0.70081	-0.4970	10	0.44086	T	0.13	-6.1074	19.592	0.95518	0.0:0.0:1.0:0.0	.	324	P81274	GPSM2_HUMAN	T	324	ENSP00000385510:A324T;ENSP00000264126:A324T	ENSP00000264126:A324T	A	+	1	0	GPSM2	109247287	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	9.444000	0.97578	2.626000	0.88956	0.557000	0.71058	GCA	GPSM2	-	pfam_TPR-4,smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000121957		0.363	GPSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPSM2	HGNC	protein_coding	OTTHUMT00000032400.3	513	0.00	0	G	NM_013296		109445764	109445764	+1	no_errors	ENST00000264126	ensembl	human	known	69_37n	missense	237	37.47	142	SNP	1.000	A
GPATCH4	54865	genome.wustl.edu	37	1	156567909	156567909	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr1:156567909C>A	ENST00000438976.2	-	5	296	c.266G>T	c.(265-267)gGa>gTa	p.G89V	GPATCH4_ENST00000497287.1_5'UTR|GPATCH4_ENST00000368232.4_Missense_Mutation_p.G84V|GPATCH4_ENST00000334588.7_Missense_Mutation_p.G38V			Q5T3I0	GPTC4_HUMAN	G patch domain containing 4	84							poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(3)|stomach(1)	17	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TATCTGTACTCCATCCTGTAG	0.473																																						dbGAP											0													172.0	170.0	171.0					1																	156567909		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC056904	CCDS1146.1, CCDS44245.1	1q22	2013-01-28		2006-12-13	ENSG00000160818	ENSG00000160818		"""G patch domain containing"""	25982	protein-coding gene	gene with protein product				GPATC4		12477932	Standard	NM_015590		Approved	FLJ20249, DKFZP434F1735	uc001fpl.3	Q5T3I0	OTTHUMG00000033203	ENST00000438976.2:c.266G>T	1.37:g.156567909C>A	ENSP00000396441:p.Gly89Val		Q5T3I1|Q6ZUE7|Q8IWG8|Q9NXH4	Missense_Mutation	SNP	pfam_G_patch_dom,smart_G_patch_dom,pfscan_G_patch_dom	p.G89V	ENST00000438976.2	37	c.266	CCDS44245.1	1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.943433	0.73672	.	.	ENSG00000160818	ENST00000368232;ENST00000368229;ENST00000438976;ENST00000334588	.	.	.	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.71584	0.3357	M	0.86740	2.835	0.80722	D	1	D;D	0.61697	0.99;0.99	P;P	0.57911	0.829;0.829	T	0.77000	-0.2750	9	0.87932	D	0	-24.0457	10.1098	0.42555	0.0:0.9117:0.0:0.0882	.	89;84	E9PAV9;Q5T3I0	.;GPTC4_HUMAN	V	84;84;89;38	.	ENSP00000334793:G38V	G	-	2	0	GPATCH4	154834533	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.791000	0.38744	2.853000	0.98044	0.655000	0.94253	GGA	GPATCH4	-	NULL	ENSG00000160818		0.473	GPATCH4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPATCH4	HGNC	protein_coding	OTTHUMT00000386947.1	415	0.00	0	C	NM_017725		156567909	156567909	-1	no_errors	ENST00000438976	ensembl	human	known	69_37n	missense	284	30.49	125	SNP	1.000	A
GRIN3A	116443	genome.wustl.edu	37	9	104499593	104499593	+	Silent	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr9:104499593G>A	ENST00000361820.3	-	1	1269	c.669C>T	c.(667-669)atC>atT	p.I223I		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	223					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	CGTGGCGCACGATGCTGATCA	0.632																																						dbGAP											0													64.0	56.0	59.0					9																	104499593		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.669C>T	9.37:g.104499593G>A			B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Silent	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,prints_NMDA_rcpt	p.I223	ENST00000361820.3	37	c.669	CCDS6758.1	9																																																																																			GRIN3A	-	NULL	ENSG00000198785		0.632	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN3A	HGNC	protein_coding	OTTHUMT00000053453.1	70	0.00	0	G			104499593	104499593	-1	no_errors	ENST00000361820	ensembl	human	known	69_37n	silent	93	13.08	14	SNP	0.999	A
HIST1H2BC	8347	genome.wustl.edu	37	6	26123904	26123904	+	Nonsense_Mutation	SNP	C	C	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr6:26123904C>A	ENST00000314332.5	-	1	234	c.229G>T	c.(229-231)Gag>Tag	p.E77*	HIST1H2AC_ENST00000377791.2_5'Flank|HIST1H2AC_ENST00000602637.1_5'Flank|HIST1H2BC_ENST00000396984.1_Nonsense_Mutation_p.E77*			P62807	H2B1C_HUMAN	histone cluster 1, H2bc	77					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	16						CGGGAAGCCTCGCCCGCGATG	0.587																																						dbGAP											0													111.0	110.0	110.0					6																	26123904		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			Z80783	CCDS4584.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000180596	ENSG00000180596		"""Histones / Replication-dependent"""	4757	protein-coding gene	gene with protein product		602847	"""H2B histone family, member L"", ""histone 1, H2bc"""	H2BFL		9119399, 12408966	Standard	NM_003526		Approved	H2B/l, H2B.1	uc003ngl.3	P62807	OTTHUMG00000014425	ENST00000314332.5:c.229G>T	6.37:g.26123904C>A	ENSP00000321744:p.Glu77*		P02278|Q3B872|Q4VB69|Q93078|Q93080	Nonsense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.E77*	ENST00000314332.5	37	c.229	CCDS4584.1	6	.	.	.	.	.	.	.	.	.	.	.	23.8	4.454520	0.84209	.	.	ENSG00000180596	ENST00000314332;ENST00000396984	.	.	.	5.61	5.61	0.85477	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	18.9929	0.92801	0.0:1.0:0.0:0.0	.	.	.	.	X	77	.	ENSP00000321744:E77X	E	-	1	0	HIST1H2BC	26231883	1.000000	0.71417	1.000000	0.80357	0.414000	0.31173	5.951000	0.70273	2.799000	0.96334	0.650000	0.86243	GAG	HIST1H2BC	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	ENSG00000180596		0.587	HIST1H2BC-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BC	HGNC	protein_coding	OTTHUMT00000468022.1	139	0.00	0	C	NM_003526		26123904	26123904	-1	no_errors	ENST00000314332	ensembl	human	known	69_37n	nonsense	110	19.12	26	SNP	1.000	A
HIST1H2AD	3013	genome.wustl.edu	37	6	26199108	26199108	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr6:26199108C>G	ENST00000341023.1	-	1	363	c.364G>C	c.(364-366)Gag>Cag	p.E122Q	HIST1H2BF_ENST00000359985.1_5'Flank|HIST1H3D_ENST00000356476.2_5'Flank|HIST1H3D_ENST00000377831.5_5'UTR	NM_021065.2	NP_066409.1	P20671	H2A1D_HUMAN	histone cluster 1, H2ad	122						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	6		all_hematologic(11;0.196)				TGGTGACTCTCAGTCTTCTTG	0.488																																						dbGAP											0													120.0	105.0	110.0					6																	26199108		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z80776	CCDS4591.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196866	ENSG00000196866		"""Histones / Replication-dependent"""	4729	protein-coding gene	gene with protein product		602792	"""H2A histone family, member G"", ""histone 1, H2ad"""	H2AFG		9119399, 12408966	Standard	NM_021065		Approved	H2A/g, H2A.3	uc003ngw.4	P20671	OTTHUMG00000014437	ENST00000341023.1:c.364G>C	6.37:g.26199108C>G	ENSP00000341094:p.Glu122Gln		A0PK91|P57754|Q6FGY6	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.E122Q	ENST00000341023.1	37	c.364	CCDS4591.1	6	.	.	.	.	.	.	.	.	.	.	.	10.29	1.309280	0.23821	.	.	ENSG00000196866	ENST00000341023	T	0.42513	0.97	4.82	4.82	0.62117	Histone-fold (2);Histone H2A (1);	0.000000	0.43416	U	0.000575	T	0.18551	0.0445	N	0.21194	0.64	0.36589	D	0.873974	B	0.02656	0.0	B	0.04013	0.001	T	0.03249	-1.1056	10	0.38643	T	0.18	.	17.2301	0.86982	0.0:1.0:0.0:0.0	.	122	P20671	H2A1D_HUMAN	Q	122	ENSP00000341094:E122Q	ENSP00000341094:E122Q	E	-	1	0	HIST1H2AD	26307087	1.000000	0.71417	1.000000	0.80357	0.134000	0.20937	7.295000	0.78780	2.373000	0.80994	0.655000	0.94253	GAG	HIST1H2AD	-	superfamily_Histone-fold,smart_Histone_H2A	ENSG00000196866		0.488	HIST1H2AD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AD	HGNC	protein_coding	OTTHUMT00000040100.1	417	0.00	0	C	NM_021065		26199108	26199108	-1	no_errors	ENST00000341023	ensembl	human	known	69_37n	missense	304	15.08	54	SNP	1.000	G
HIST1H4I	8294	genome.wustl.edu	37	6	27107360	27107360	+	Silent	SNP	C	C	G	rs570548268		TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr6:27107360C>G	ENST00000354348.2	+	1	285	c.273C>G	c.(271-273)ctC>ctG	p.L91L	HIST1H2BK_ENST00000396891.4_Intron	NM_003495.2	NP_003486.1	P62805	H4_HUMAN	histone cluster 1, H4i	91					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			lung(1)	1						TCTACGCGCTCAAGCGCCAGG	0.577			T	BCL6	NHL																																	dbGAP		Dom	yes		6	6p21.3	8294	"""histone 1, H4i (H4FM)"""		L	0													64.0	61.0	62.0					6																	27107360		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB000905	CCDS4620.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198339	ENSG00000276180		"""Histones / Replication-dependent"""	4793	protein-coding gene	gene with protein product		602833	"""H4 histone family, member M"", ""histone 1, H4i"""	H4FM		8988030, 9439656, 12408966	Standard	NM_003495		Approved	H4/m	uc003niy.1	P62805	OTTHUMG00000014471	ENST00000354348.2:c.273C>G	6.37:g.27107360C>G			A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Silent	SNP	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	p.L91	ENST00000354348.2	37	c.273	CCDS4620.1	6																																																																																			HIST1H4I	-	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_TAF_TATA-bd,prints_Histone_H4	ENSG00000198339		0.577	HIST1H4I-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4I	HGNC	protein_coding	OTTHUMT00000040139.1	71	0.00	0	C	NM_003495		27107360	27107360	+1	no_errors	ENST00000354348	ensembl	human	known	69_37n	silent	61	20.78	16	SNP	0.999	G
HMGN5	79366	genome.wustl.edu	37	X	80371738	80371738	+	Nonsense_Mutation	SNP	C	C	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chrX:80371738C>A	ENST00000358130.2	-	6	560	c.232G>T	c.(232-234)Gaa>Taa	p.E78*	HMGN5_ENST00000491275.1_5'UTR	NM_030763.2	NP_110390.1	P82970	HMGN5_HUMAN	high mobility group nucleosome binding domain 5	78					chromatin modification (GO:0016568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	10						TTAGCATTTTCATTGTAGTCT	0.323																																						dbGAP											0													135.0	106.0	116.0					X																	80371738		2202	4297	6499	-	-	-	SO:0001587	stop_gained	0			AF250329	CCDS14448.1	Xq13.3	2011-07-01	2011-04-05	2009-09-15	ENSG00000198157	ENSG00000198157		"""High-mobility group / Canonical"""	8013	protein-coding gene	gene with protein product		300385	"""nucleosomal binding protein 1"", ""high-mobility group nucleosome binding domain 5"""	NSBP1		11161810, 19748358	Standard	NM_030763		Approved		uc004eee.1	P82970	OTTHUMG00000021911	ENST00000358130.2:c.232G>T	X.37:g.80371738C>A	ENSP00000350848:p.Glu78*		Q5JSL1	Nonsense_Mutation	SNP	pfam_HMGN_fam,smart_HMGN_fam,prints_HMGN_fam	p.E78*	ENST00000358130.2	37	c.232	CCDS14448.1	X	.	.	.	.	.	.	.	.	.	.	C	14.96	2.691046	0.48097	.	.	ENSG00000198157	ENST00000358130;ENST00000447319;ENST00000373250;ENST00000430960;ENST00000436386;ENST00000451455	.	.	.	3.44	2.57	0.30868	.	0.228741	0.22165	N	0.063737	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	5.8204	0.18524	0.0:0.8504:0.0:0.1496	.	.	.	.	X	78;58;68;78;78;78	.	ENSP00000350848:E78X	E	-	1	0	HMGN5	80258394	0.904000	0.30761	0.407000	0.26434	0.169000	0.22640	0.888000	0.28268	0.835000	0.34877	-0.268000	0.10319	GAA	HMGN5	-	pfam_HMGN_fam,smart_HMGN_fam	ENSG00000198157		0.323	HMGN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGN5	HGNC	protein_coding	OTTHUMT00000057354.1	823	0.12	1	C	NM_030763		80371738	80371738	-1	no_errors	ENST00000358130	ensembl	human	known	69_37n	nonsense	644	13.12	98	SNP	0.484	A
IGKV1D-12	28903	genome.wustl.edu	37	2	90199146	90199146	+	RNA	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr2:90199146G>A	ENST00000390276.2	+	0	488									immunoglobulin kappa variable 1D-12																		CCTGCAGCCTGAAGATTTTGC	0.498																																						dbGAP											0													79.0	104.0	98.0					2																	90199146		1407	3977	5384	-	-	-			0			X17263		2p11.2	2014-05-06			ENSG00000240834	ENSG00000278857		"""Immunoglobulins / IGK locus"""	5746	other	immunoglobulin gene							Standard	NG_000833		Approved				OTTHUMG00000188272		2.37:g.90199146G>A				Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.E103K	ENST00000390276.2	37	c.307		2																																																																																			IGKV1D-12	-	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000240834		0.498	IGKV1D-12-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGKV1D-12	HGNC	IG_V_gene	OTTHUMT00000323139.2	410	0.00	0	G	NG_000833		90199146	90199146	+1	no_stop_codon	ENST00000390276	ensembl	human	known	69_37n	missense	309	18.90	72	SNP	1.000	A
IL37	27178	genome.wustl.edu	37	2	113676141	113676141	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr2:113676141G>C	ENST00000263326.3	+	5	454	c.412G>C	c.(412-414)Gag>Cag	p.E138Q	IL37_ENST00000353225.3_Missense_Mutation_p.E98Q|IL37_ENST00000349806.3_Missense_Mutation_p.E77Q|IL37_ENST00000352179.3_Missense_Mutation_p.E117Q|IL37_ENST00000311328.2_Missense_Mutation_p.E112Q	NM_014439.3	NP_055254.2	Q9NZH6	IL37_HUMAN	interleukin 37	138					immune response (GO:0006955)|inflammatory response (GO:0006954)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleus (GO:0005634)	interleukin-1 receptor binding (GO:0005149)			NS(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(1)|lung(7)|ovary(2)|skin(3)	19						CTCACAGAAGGAGAAACTGAT	0.522																																						dbGAP											0													46.0	51.0	50.0					2																	113676141		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF201832	CCDS2103.1, CCDS2104.1, CCDS2105.1, CCDS2106.1, CCDS2107.1	2q12-q14.1	2011-06-06	2011-06-06	2011-06-06	ENSG00000125571	ENSG00000125571		"""Interleukins and interleukin receptors"""	15563	protein-coding gene	gene with protein product	"""interleukin 1, zeta"", ""interleukin-1 homolog 4"", ""interleukin-1-related protein"""	605510	"""interleukin 1 family, member 7 (zeta)"""	IL1F7		10625660, 10512743, 12496389	Standard	NM_014439		Approved	FIL1, FIL1Z, FIL1(ZETA), IL-1H4, IL-1RP1, IL-1F7	uc002tij.3	Q9NZH6	OTTHUMG00000131345	ENST00000263326.3:c.412G>C	2.37:g.113676141G>C	ENSP00000263326:p.Glu138Gln		B5BU97|Q56AP9|Q8TD04|Q8TD05|Q9HBF2|Q9HBF3|Q9UHA6	Missense_Mutation	SNP	pfam_Interleukin_1,superfamily_Cytokine_IL1-like,smart_Interleukin_1,prints_Interleukin_1,prints_IL_rcpt_IL1RA	p.E138Q	ENST00000263326.3	37	c.412	CCDS2103.1	2	.	.	.	.	.	.	.	.	.	.	g	7.854	0.724633	0.15439	.	.	ENSG00000125571	ENST00000263326;ENST00000352179;ENST00000349806;ENST00000353225;ENST00000311328	T;T;T;T;T	0.16743	2.32;2.32;2.98;2.98;2.32	3.49	2.31	0.28768	.	0.207467	0.24085	N	0.041693	T	0.05823	0.0152	N	0.04880	-0.145	0.09310	N	0.999996	P;B;B;B;B	0.38767	0.646;0.016;0.034;0.11;0.042	B;B;B;B;B	0.30401	0.115;0.001;0.017;0.027;0.028	T	0.29336	-1.0015	10	0.34782	T	0.22	-3.9222	5.7828	0.18316	0.8713:0.0:0.1287:0.0	.	112;77;98;117;138	Q9NZH6-2;Q9NZH6-5;Q9NZH6-3;Q9NZH6-4;Q9NZH6	.;.;.;.;IL37_HUMAN	Q	138;117;77;98;112	ENSP00000263326:E138Q;ENSP00000263327:E117Q;ENSP00000263328:E77Q;ENSP00000309208:E98Q;ENSP00000309883:E112Q	ENSP00000263326:E138Q	E	+	1	0	IL37	113392612	0.008000	0.16893	0.536000	0.28039	0.071000	0.16799	0.771000	0.26633	0.511000	0.28236	-0.430000	0.05897	GAG	IL37	-	pfam_Interleukin_1,superfamily_Cytokine_IL1-like,smart_Interleukin_1	ENSG00000125571		0.522	IL37-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL37	HGNC	protein_coding	OTTHUMT00000254126.1	144	0.00	0	G	NM_014439		113676141	113676141	+1	no_errors	ENST00000263326	ensembl	human	known	69_37n	missense	95	18.80	22	SNP	0.610	C
ITGA2	3673	genome.wustl.edu	37	5	52366060	52366060	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr5:52366060G>C	ENST00000296585.5	+	17	2348	c.2205G>C	c.(2203-2205)caG>caC	p.Q735H		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	735					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				ATCAAGCACAGAGTTGCCCCG	0.398																																						dbGAP											0													73.0	72.0	72.0					5																	52366060		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.2205G>C	5.37:g.52366060G>C	ENSP00000296585:p.Gln735His		Q14595	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,prints_Integrin_alpha,pfscan_VWF_A	p.Q735H	ENST00000296585.5	37	c.2205	CCDS3957.1	5	.	.	.	.	.	.	.	.	.	.	G	15.85	2.955404	0.53293	.	.	ENSG00000164171	ENST00000296585	T	0.58652	0.32	5.86	3.07	0.35406	Integrin alpha-2 (1);	1.038600	0.07534	N	0.912734	T	0.55226	0.1907	L	0.43152	1.355	0.09310	N	1	P;P	0.45715	0.865;0.836	P;P	0.47891	0.56;0.506	T	0.40515	-0.9559	10	0.38643	T	0.18	.	6.2165	0.20658	0.2098:0.1366:0.6536:0.0	.	735;735	E7ESP4;P17301	.;ITA2_HUMAN	H	735	ENSP00000296585:Q735H	ENSP00000296585:Q735H	Q	+	3	2	ITGA2	52401817	0.003000	0.15002	0.010000	0.14722	0.331000	0.28603	0.946000	0.29069	0.792000	0.33850	0.655000	0.94253	CAG	ITGA2	-	pfam_Integrin_alpha-2	ENSG00000164171		0.398	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA2	HGNC	protein_coding	OTTHUMT00000253857.2	164	0.00	0	G	NM_002203		52366060	52366060	+1	no_errors	ENST00000296585	ensembl	human	known	69_37n	missense	92	36.99	54	SNP	0.000	C
KIAA1109	84162	genome.wustl.edu	37	4	123230553	123230553	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr4:123230553G>T	ENST00000264501.4	+	59	10559	c.10186G>T	c.(10186-10188)Gat>Tat	p.D3396Y	KIAA1109_ENST00000455637.1_Missense_Mutation_p.D3396Y|KIAA1109_ENST00000388738.3_Missense_Mutation_p.D3396Y			Q2LD37	K1109_HUMAN	KIAA1109	3396					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)		p.D3396N(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						CCGTTTTGCTGATGGATTTGA	0.373																																						dbGAP											1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											174.0	161.0	165.0					4																	123230553		1846	4100	5946	-	-	-	SO:0001583	missense	0			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.10186G>T	4.37:g.123230553G>T	ENSP00000264501:p.Asp3396Tyr		Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	pfam_Fragile_site-assoc_C	p.D3396Y	ENST00000264501.4	37	c.10186	CCDS43267.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.80|19.80	3.895103|3.895103	0.72639|0.72639	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637;ENST00000438707;ENST00000421930|ENST00000419325	T;T;T;T|.	0.44881|.	0.91;0.91;0.91;0.91|.	5.71|5.71	4.86|4.86	0.63082|0.63082	.|.	0.068605|.	0.56097|.	D|.	0.000025|.	T|.	0.68677|.	0.3027|.	L|L	0.55990|0.55990	1.75|1.75	0.49915|0.49915	D|D	0.999835|0.999835	P;P|.	0.52842|.	0.763;0.956|.	P;P|.	0.48030|.	0.549;0.564|.	T|.	0.66044|.	-0.6021|.	10|.	0.87932|.	D|.	0|.	.|.	15.1087|15.1087	0.72338|0.72338	0.0691:0.0:0.9309:0.0|0.0691:0.0:0.9309:0.0	.|.	3396;3396|.	Q2LD37-6;Q2LD37|.	.;K1109_HUMAN|.	Y|L	3396;3396;3396;12;12|1353	ENSP00000264501:D3396Y;ENSP00000373390:D3396Y;ENSP00000389925:D3396Y;ENSP00000410874:D12Y|.	ENSP00000264501:D3396Y|.	D|X	+|+	1|2	0|2	KIAA1109|KIAA1109	123450003|123450003	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	9.740000|9.740000	0.98839|0.98839	2.688000|2.688000	0.91661|0.91661	0.557000|0.557000	0.71058|0.71058	GAT|TGA	KIAA1109	-	NULL	ENSG00000138688		0.373	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1109	HGNC	protein_coding	OTTHUMT00000316415.1	629	0.00	0	G	NM_020797		123230553	123230553	+1	no_errors	ENST00000264501	ensembl	human	known	69_37n	missense	391	18.20	87	SNP	1.000	T
KIAA2022	340533	genome.wustl.edu	37	X	73962903	73962903	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chrX:73962903C>G	ENST00000055682.6	-	3	2100	c.1489G>C	c.(1489-1491)Gac>Cac	p.D497H		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	497					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						TCTAGTGAGTCAACATCATAT	0.448																																						dbGAP											0													72.0	62.0	65.0					X																	73962903		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.1489G>C	X.37:g.73962903C>G	ENSP00000055682:p.Asp497His		A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	NULL	p.D497H	ENST00000055682.6	37	c.1489	CCDS35337.1	X	.	.	.	.	.	.	.	.	.	.	C	17.81	3.480078	0.63849	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.35605	1.3;1.3	6.03	6.03	0.97812	.	0.145674	0.64402	D	0.000012	T	0.56688	0.2002	L	0.47716	1.5	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.56505	-0.7968	10	0.87932	D	0	-13.3947	19.4774	0.94994	0.0:1.0:0.0:0.0	.	497	Q5QGS0	K2022_HUMAN	H	497	ENSP00000362567:D497H;ENSP00000055682:D497H	ENSP00000055682:D497H	D	-	1	0	KIAA2022	73879628	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.554000	0.86153	0.600000	0.82982	GAC	KIAA2022	-	NULL	ENSG00000050030		0.448	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA2022	HGNC	protein_coding	OTTHUMT00000057270.2	534	0.00	0	C	NM_001008537		73962903	73962903	-1	no_errors	ENST00000055682	ensembl	human	known	69_37n	missense	449	14.96	79	SNP	1.000	G
KRTAP4-8	728224	genome.wustl.edu	37	17	39254032	39254032	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr17:39254032G>T	ENST00000333822.4	-	1	361	c.305C>A	c.(304-306)cCc>cAc	p.P102H		NM_031960.2	NP_114166.1	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4-8	102	25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)	11						acagcagctggggcggcagca	0.662																																						dbGAP											0													5.0	8.0	7.0					17																	39254032		667	1539	2206	-	-	-	SO:0001583	missense	0			AJ406940	CCDS45674.1	17q21.2	2013-06-25			ENSG00000204880	ENSG00000204880		"""Keratin associated proteins"""	17230	protein-coding gene	gene with protein product						11279113	Standard	NM_031960		Approved	KAP4.8	uc010wfo.2	Q9BYQ9	OTTHUMG00000133580	ENST00000333822.4:c.305C>A	17.37:g.39254032G>T	ENSP00000328444:p.Pro102His		A8MSH3	Missense_Mutation	SNP	pfam_Keratin-assoc	p.P102H	ENST00000333822.4	37	c.305	CCDS45674.1	17	.	.	.	.	.	.	.	.	.	.	.	14.41	2.528306	0.44969	.	.	ENSG00000204880	ENST00000333822;ENST00000332991	T	0.06068	3.35	2.99	1.98	0.26296	.	.	.	.	.	T	0.18551	0.0445	H	0.95917	3.74	0.23506	N	0.997532	P	0.35033	0.481	B	0.36335	0.222	T	0.09618	-1.0666	9	0.87932	D	0	.	9.8497	0.41048	0.0:0.2118:0.7882:0.0	.	102	Q9BYQ9	KRA48_HUMAN	H	102;87	ENSP00000328444:P102H	ENSP00000414561:P87H	P	-	2	0	KRTAP4-8	36507558	0.442000	0.25633	0.026000	0.17262	0.704000	0.40688	2.537000	0.45702	0.573000	0.29400	0.449000	0.29647	CCC	KRTAP4-8	-	NULL	ENSG00000204880		0.662	KRTAP4-8-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	KRTAP4-8	HGNC	protein_coding	OTTHUMT00000257684.1	23	0.00	0	G	NM_031960		39254032	39254032	-1	no_errors	ENST00000333822	ensembl	human	known	69_37n	missense	18	40.00	12	SNP	0.655	T
LIMK1	3984	genome.wustl.edu	37	7	73511431	73511431	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr7:73511431C>T	ENST00000336180.2	+	4	364	c.313C>T	c.(313-315)Cac>Tac	p.H105Y	LIMK1_ENST00000491052.1_3'UTR|LIMK1_ENST00000418310.1_Missense_Mutation_p.H135Y|LIMK1_ENST00000538333.3_Missense_Mutation_p.H71Y	NM_002314.3	NP_002305.1	P53667	LIMK1_HUMAN	LIM domain kinase 1	105	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|nervous system development (GO:0007399)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of axon extension (GO:0045773)|positive regulation of stress fiber assembly (GO:0051496)|protein phosphorylation (GO:0006468)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)	ATP binding (GO:0005524)|heat shock protein binding (GO:0031072)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21		Lung NSC(55;0.137)			Dabrafenib(DB08912)	GCTGAAGTACCACCCCGAGTG	0.612																																						dbGAP											0													96.0	63.0	75.0					7																	73511431		2203	4300	6503	-	-	-	SO:0001583	missense	0			D26309	CCDS5563.1, CCDS56491.1	7q11.23	2005-01-21			ENSG00000106683	ENSG00000106683			6613	protein-coding gene	gene with protein product		601329				8673124, 8812460	Standard	NM_002314		Approved	LIMK	uc003uaa.2	P53667	OTTHUMG00000023448	ENST00000336180.2:c.313C>T	7.37:g.73511431C>T	ENSP00000336740:p.His105Tyr		B7Z6I8|D3DXF4|D3DXF5|O15283|Q15820|Q15821|Q75MU3|Q9Y5Q1	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Znf_LIM,pfam_PDZ,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,superfamily_PDZ,smart_Znf_LIM,smart_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_LIM,pfscan_PDZ,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.H105Y	ENST00000336180.2	37	c.313	CCDS5563.1	7	.	.	.	.	.	.	.	.	.	.	C	28.5	4.928835	0.92389	.	.	ENSG00000106683	ENST00000418310;ENST00000419043;ENST00000336180;ENST00000423685;ENST00000538333	D;D;D;D	0.96365	-3.99;-3.99;-3.99;-3.99	5.2	5.2	0.72013	Zinc finger, LIM-type (5);	0.000000	0.85682	D	0.000000	D	0.99080	0.9684	H	0.99507	4.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98894	1.0774	10	0.87932	D	0	-40.8218	16.2928	0.82759	0.0:1.0:0.0:0.0	.	71;105	B7Z6I8;P53667	.;LIMK1_HUMAN	Y	135;105;105;71;71	ENSP00000409717:H135Y;ENSP00000336740:H105Y;ENSP00000396480:H71Y;ENSP00000444452:H71Y	ENSP00000336740:H105Y	H	+	1	0	LIMK1	73149367	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.384000	0.79751	2.444000	0.82710	0.650000	0.86243	CAC	LIMK1	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000106683		0.612	LIMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIMK1	HGNC	protein_coding	OTTHUMT00000252335.2	92	0.00	0	C	NM_002314		73511431	73511431	+1	no_errors	ENST00000336180	ensembl	human	known	69_37n	missense	95	18.10	21	SNP	1.000	T
PLPPR2	64748	genome.wustl.edu	37	19	11473233	11473233	+	Silent	SNP	C	C	G			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr19:11473233C>G	ENST00000251473.5	+	7	1084	c.708C>G	c.(706-708)gtC>gtG	p.V236V	DKFZP761J1410_ENST00000591608.1_Silent_p.V211V	NM_001170635.1|NM_022737.2	NP_001164106.1|NP_073574.2																					CCCGCCTGGTCAAACCCTCGC	0.667																																						dbGAP											0													102.0	85.0	91.0					19																	11473233		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000251473.5:c.708C>G	19.37:g.11473233C>G				Silent	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.V211	ENST00000251473.5	37	c.633	CCDS12258.1	19																																																																																			LPPR2	-	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	ENSG00000105520		0.667	DKFZP761J1410-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPPR2	Clone_based_vega_gene	protein_coding	OTTHUMT00000458779.1	65	0.00	0	C			11473233	11473233	+1	no_errors	ENST00000591608	ensembl	human	known	69_37n	silent	18	48.57	17	SNP	0.940	G
LRRC43	254050	genome.wustl.edu	37	12	122685099	122685099	+	Silent	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr12:122685099G>A	ENST00000339777.4	+	9	1540	c.1512G>A	c.(1510-1512)gtG>gtA	p.V504V	B3GNT4_ENST00000324189.4_5'Flank|LRRC43_ENST00000425921.1_Silent_p.V319V	NM_152759.4	NP_689972.3	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43	504										NS(1)|endometrium(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(2)	19	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		GGCCTGTGGTGCTACCTGCTG	0.577																																						dbGAP											0													121.0	133.0	129.0					12																	122685099		1944	4150	6094	-	-	-	SO:0001819	synonymous_variant	0			AK124107	CCDS45001.1	12q24.31	2014-09-11			ENSG00000158113	ENSG00000158113			28562	protein-coding gene	gene with protein product						12477932	Standard	NM_152759		Approved	MGC35140	uc009zxm.3	Q8N309	OTTHUMG00000168915	ENST00000339777.4:c.1512G>A	12.37:g.122685099G>A			Q6ZVT9	Silent	SNP	NULL	p.V504	ENST00000339777.4	37	c.1512	CCDS45001.1	12																																																																																			LRRC43	-	NULL	ENSG00000158113		0.577	LRRC43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC43	HGNC	protein_coding	OTTHUMT00000401589.1	188	0.00	0	G	NM_152759		122685099	122685099	+1	no_errors	ENST00000339777	ensembl	human	known	69_37n	silent	180	21.40	49	SNP	0.000	A
LTBP4	8425	genome.wustl.edu	37	19	41117097	41117097	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr19:41117097G>T	ENST00000308370.7	+	16	2051	c.2051G>T	c.(2050-2052)cGa>cTa	p.R684L	LTBP4_ENST00000243562.9_5'Flank|LTBP4_ENST00000204005.9_Missense_Mutation_p.R647L|LTBP4_ENST00000602240.1_3'UTR|LTBP4_ENST00000545697.1_Missense_Mutation_p.R137L|LTBP4_ENST00000396819.3_Missense_Mutation_p.R617L	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	684	Cys-rich.|EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CTGTGTGGCCGAGGGGCCTGC	0.647																																						dbGAP											0													42.0	50.0	48.0					19																	41117097		1980	4133	6113	-	-	-	SO:0001583	missense	0			Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.2051G>T	19.37:g.41117097G>T	ENSP00000311905:p.Arg684Leu		O00508|O75412|O75413	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_TB_dom,superfamily_TB_dom,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.R684L	ENST00000308370.7	37	c.2051		19	.	.	.	.	.	.	.	.	.	.	G	16.35	3.097593	0.56075	.	.	ENSG00000090006	ENST00000204005;ENST00000545697;ENST00000308370;ENST00000396819	D;D;D;D	0.92099	-2.97;-2.97;-2.97;-2.97	4.82	3.77	0.43336	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.221517	0.23142	N	0.051458	D	0.86243	0.5886	N	0.12637	0.245	0.80722	D	1	D;P;P	0.56035	0.974;0.713;0.843	P;B;P	0.49252	0.604;0.217;0.523	D	0.83545	0.0098	10	0.28530	T	0.3	.	11.6504	0.51286	0.0:0.0:0.8216:0.1784	.	617;684;647	E7EUU1;Q8N2S1;E7ENG9	.;LTBP4_HUMAN;.	L	647;137;684;617	ENSP00000204005:R647L;ENSP00000441054:R137L;ENSP00000311905:R684L;ENSP00000380031:R617L	ENSP00000204005:R647L	R	+	2	0	LTBP4	45808937	0.001000	0.12720	0.765000	0.31456	0.541000	0.35023	0.741000	0.26202	1.006000	0.39211	0.561000	0.74099	CGA	LTBP4	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000090006		0.647	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	LTBP4	HGNC	protein_coding		85	0.00	0	G	NM_003573		41117097	41117097	+1	no_errors	ENST00000308370	ensembl	human	known	69_37n	missense	118	18.06	26	SNP	0.963	T
MANBA	4126	genome.wustl.edu	37	4	103590198	103590198	+	Missense_Mutation	SNP	C	C	G	rs200735604	byFrequency	TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr4:103590198C>G	ENST00000226578.4	-	10	1338	c.1239G>C	c.(1237-1239)caG>caC	p.Q413H	MANBA_ENST00000505239.1_Missense_Mutation_p.Q356H	NM_005908.3	NP_005899.3	O00462	MANBA_HUMAN	mannosidase, beta A, lysosomal	413					cellular protein modification process (GO:0006464)|glycoprotein catabolic process (GO:0006516)|mannan catabolic process (GO:0046355)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)	beta-mannosidase activity (GO:0004567)|mannose binding (GO:0005537)			cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)		ACATAAAATCCTGCCATACCT	0.408																																						dbGAP											0													66.0	60.0	62.0					4																	103590198		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3658.1	4q24	2013-09-20			ENSG00000109323	ENSG00000109323	3.2.1.25		6831	protein-coding gene	gene with protein product		609489				7876128	Standard	NM_005908		Approved		uc003hwg.3	O00462	OTTHUMG00000131123	ENST00000226578.4:c.1239G>C	4.37:g.103590198C>G	ENSP00000226578:p.Gln413His		Q96BC3|Q9NYX9	Missense_Mutation	SNP	pfam_Glyco_hydro_2_N,pfam_Glyco_hydro_2_TIM,superfamily_Glycoside_hydrolase_SF,superfamily_Galactose-bd-like,superfamily_Glyco_hydro_2_Ig-like	p.Q413H	ENST00000226578.4	37	c.1239	CCDS3658.1	4	.	.	.	.	.	.	.	.	.	.	C	18.64	3.667177	0.67814	.	.	ENSG00000109323	ENST00000226578;ENST00000505239	T;T	0.63913	-0.07;-0.07	4.82	3.96	0.45880	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycoside hydrolase, family 2, TIM barrel (1);	0.000000	0.85682	D	0.000000	T	0.71350	0.3329	L	0.55481	1.735	0.58432	D	0.999999	D;D	0.60575	0.984;0.988	P;D	0.63877	0.851;0.919	T	0.73490	-0.3966	10	0.59425	D	0.04	-13.5495	12.7927	0.57543	0.0:0.9203:0.0:0.0797	.	356;413	E9PFW2;O00462	.;MANBA_HUMAN	H	413;356	ENSP00000226578:Q413H;ENSP00000427322:Q356H	ENSP00000226578:Q413H	Q	-	3	2	MANBA	103809246	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	2.708000	0.47152	2.377000	0.81083	0.460000	0.39030	CAG	MANBA	-	pfam_Glyco_hydro_2_TIM,superfamily_Glycoside_hydrolase_SF	ENSG00000109323		0.408	MANBA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MANBA	HGNC	protein_coding	OTTHUMT00000253803.2	322	0.00	0	C			103590198	103590198	-1	no_errors	ENST00000226578	ensembl	human	known	69_37n	missense	252	17.59	54	SNP	1.000	G
MAP4	4134	genome.wustl.edu	37	3	47951254	47951254	+	Intron	SNP	C	C	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr3:47951254C>A	ENST00000360240.6	-	8	2518				MAP4_ENST00000264724.11_Nonsense_Mutation_p.E160*|MAP4_ENST00000395734.3_Intron|MAP4_ENST00000426837.2_Nonsense_Mutation_p.E1570*|MAP4_ENST00000383737.4_Intron	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4						cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	TGCACTGACTCAGATTCTCCT	0.458																																						dbGAP											0													99.0	95.0	97.0					3																	47951254		2007	4180	6187	-	-	-	SO:0001627	intron_variant	0				CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.1999+5052G>T	3.37:g.47951254C>A			Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Nonsense_Mutation	SNP	pfam_Tau/MAP_tubulin-bd_rpt	p.E160*	ENST00000360240.6	37	c.478	CCDS33750.1	3	.	.	.	.	.	.	.	.	.	.	C	43	10.132993	0.99344	.	.	ENSG00000047849	ENST00000264724;ENST00000426837;ENST00000383736	.	.	.	4.7	3.82	0.43975	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.0643	0.42295	0.0:0.9058:0.0:0.0942	.	.	.	.	X	160;1570;160	.	.	E	-	1	0	MAP4	47926258	0.253000	0.23982	0.043000	0.18650	0.803000	0.45373	2.592000	0.46171	1.323000	0.45263	0.561000	0.74099	GAG	MAP4	-	NULL	ENSG00000047849		0.458	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP4	HGNC	protein_coding	OTTHUMT00000346085.1	219	0.00	0	C	NM_002375		47951254	47951254	-1	no_errors	ENST00000264724	ensembl	human	known	69_37n	nonsense	58	56.72	76	SNP	0.074	A
MAST1	22983	genome.wustl.edu	37	19	12976890	12976890	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr19:12976890C>T	ENST00000251472.4	+	17	2042	c.2003C>T	c.(2002-2004)tCg>tTg	p.S668L		NM_014975.2	NP_055790.1			microtubule associated serine/threonine kinase 1											NS(1)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(20)|ovary(5)|prostate(5)|skin(3)	56						CACCTAGAGTCGGAAGATGAC	0.592																																						dbGAP											0													61.0	52.0	55.0					19																	12976890		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023190	CCDS32921.1	19p13.2	2008-02-05				ENSG00000105613			19034	protein-coding gene	gene with protein product		612256					Standard	NM_014975		Approved	SAST, KIAA0973	uc002mvm.3	Q9Y2H9		ENST00000251472.4:c.2003C>T	19.37:g.12976890C>T	ENSP00000251472:p.Ser668Leu			Missense_Mutation	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_cat_dom	p.S668L	ENST00000251472.4	37	c.2003	CCDS32921.1	19	.	.	.	.	.	.	.	.	.	.	C	33	5.287762	0.95517	.	.	ENSG00000105613	ENST00000251472;ENST00000542153	T	0.25085	1.82	4.89	4.89	0.63831	AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.37517	0.1006	M	0.83603	2.65	0.54753	D	0.999988	P	0.45212	0.853	B	0.42030	0.373	T	0.49380	-0.8946	10	0.72032	D	0.01	-8.1291	15.91	0.79467	0.0:1.0:0.0:0.0	.	668	Q9Y2H9	MAST1_HUMAN	L	668	ENSP00000251472:S668L	ENSP00000251472:S668L	S	+	2	0	MAST1	12837890	1.000000	0.71417	0.980000	0.43619	0.998000	0.95712	7.787000	0.85759	2.423000	0.82170	0.563000	0.77884	TCG	MAST1	-	superfamily_Kinase-like_dom	ENSG00000105613		0.592	MAST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST1	HGNC	protein_coding	OTTHUMT00000451733.2	183	0.00	0	C	NM_014975		12976890	12976890	+1	no_errors	ENST00000251472	ensembl	human	known	69_37n	missense	100	26.81	37	SNP	1.000	T
MNDA	4332	genome.wustl.edu	37	1	158812198	158812198	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr1:158812198G>C	ENST00000368141.4	+	2	516	c.255G>C	c.(253-255)gaG>gaC	p.E85D	MNDA_ENST00000491210.1_3'UTR	NM_002432.1	NP_002423.1	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	85	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				B cell receptor signaling pathway (GO:0050853)|cellular defense response (GO:0006968)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of B cell proliferation (GO:0030889)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(2)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(26)|ovary(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	all_hematologic(112;0.0378)					TTCGAAAAGAGAAGTCAAAAG	0.418																																						dbGAP											0													89.0	96.0	93.0					1																	158812198		2193	4297	6490	-	-	-	SO:0001583	missense	0			BC032319	CCDS1177.1	1q22	2008-02-05			ENSG00000163563	ENSG00000163563			7183	protein-coding gene	gene with protein product		159553				1644857, 7512843	Standard	NM_002432		Approved	PYHIN3	uc001fsz.1	P41218	OTTHUMG00000022776	ENST00000368141.4:c.255G>C	1.37:g.158812198G>C	ENSP00000357123:p.Glu85Asp			Missense_Mutation	SNP	pfam_HIN200/IF120x,pfam_DAPIN,pfscan_DAPIN,pfscan_HIN200/IF120x	p.E85D	ENST00000368141.4	37	c.255	CCDS1177.1	1	.	.	.	.	.	.	.	.	.	.	G	14.60	2.583192	0.46006	.	.	ENSG00000163563	ENST00000368141	T	0.08546	3.08	3.51	-0.391	0.12446	Pyrin (1);	0.589495	0.12987	N	0.422751	T	0.09202	0.0227	M	0.69523	2.12	0.09310	N	1	D	0.76494	0.999	P	0.61070	0.883	T	0.08597	-1.0714	10	0.72032	D	0.01	-11.3714	6.1053	0.20069	0.4512:0.0:0.5488:0.0	.	85	P41218	MNDA_HUMAN	D	85	ENSP00000357123:E85D	ENSP00000357123:E85D	E	+	3	2	MNDA	157078822	0.009000	0.17119	0.001000	0.08648	0.042000	0.13812	0.041000	0.13927	-0.006000	0.14370	0.557000	0.71058	GAG	MNDA	-	pfscan_DAPIN	ENSG00000163563		0.418	MNDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MNDA	HGNC	protein_coding	OTTHUMT00000059069.1	206	0.00	0	G	NM_002432		158812198	158812198	+1	no_errors	ENST00000368141	ensembl	human	known	69_37n	missense	136	16.56	27	SNP	0.001	C
MUC17	140453	genome.wustl.edu	37	7	100681335	100681335	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr7:100681335C>T	ENST00000306151.4	+	3	6702	c.6638C>T	c.(6637-6639)tCa>tTa	p.S2213L		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2213	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					ATGCCAACCTCAACTCCTAGT	0.498																																						dbGAP											0													341.0	335.0	337.0					7																	100681335		2203	4298	6501	-	-	-	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.6638C>T	7.37:g.100681335C>T	ENSP00000302716:p.Ser2213Leu		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.S2213L	ENST00000306151.4	37	c.6638	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	C	4.441	0.081710	0.08533	.	.	ENSG00000169876	ENST00000306151	T	0.02606	4.23	1.11	1.11	0.20524	.	.	.	.	.	T	0.01592	0.0051	N	0.14661	0.345	0.09310	N	1	P	0.47604	0.898	B	0.33690	0.168	T	0.52495	-0.8568	9	0.36615	T	0.2	.	7.7662	0.28980	0.0:1.0:0.0:0.0	.	2213	Q685J3	MUC17_HUMAN	L	2213	ENSP00000302716:S2213L	ENSP00000302716:S2213L	S	+	2	0	MUC17	100468055	0.000000	0.05858	0.004000	0.12327	0.004000	0.04260	0.524000	0.22940	0.551000	0.29008	0.134000	0.15878	TCA	MUC17	-	NULL	ENSG00000169876		0.498	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	236	0.00	0	C	NM_001040105		100681335	100681335	+1	no_errors	ENST00000306151	ensembl	human	known	69_37n	missense	170	18.27	38	SNP	0.002	T
MUC17	140453	genome.wustl.edu	37	7	100683508	100683508	+	Silent	SNP	C	C	T	rs530486985		TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr7:100683508C>T	ENST00000306151.4	+	3	8875	c.8811C>T	c.(8809-8811)acC>acT	p.T2937T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2937	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TTGTCAGCACCGTGCCAGTGG	0.488																																						dbGAP											0													219.0	225.0	223.0					7																	100683508		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.8811C>T	7.37:g.100683508C>T			O14761|Q685J2|Q8TDH7	Silent	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.T2937	ENST00000306151.4	37	c.8811	CCDS34711.1	7																																																																																			MUC17	-	NULL	ENSG00000169876		0.488	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	114	0.00	0	C	NM_001040105		100683508	100683508	+1	no_errors	ENST00000306151	ensembl	human	known	69_37n	silent	88	19.27	21	SNP	0.002	T
MYLK	4638	genome.wustl.edu	37	3	123419644	123419644	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr3:123419644C>G	ENST00000475616.1	-	15	2670	c.2671G>C	c.(2671-2673)Gag>Cag	p.E891Q	MYLK_ENST00000360772.3_Missense_Mutation_p.E891Q|MYLK_ENST00000360304.3_Missense_Mutation_p.E891Q|MYLK_ENST00000346322.5_Missense_Mutation_p.E822Q|MYLK_ENST00000359169.1_Missense_Mutation_p.E891Q|MYLK_ENST00000510775.1_5'Flank			Q15746	MYLK_HUMAN	myosin light chain kinase	891	5 X 28 AA approximate tandem repeats.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		TGCTCCACCTCCTGCTGGCGG	0.622																																						dbGAP											0													80.0	75.0	77.0					3																	123419644		2203	4300	6503	-	-	-	SO:0001583	missense	0			X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.2671G>C	3.37:g.123419644C>G	ENSP00000418335:p.Glu891Gln		B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Prot_kinase_cat_dom,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E891Q	ENST00000475616.1	37	c.2671	CCDS46896.1	3	.	.	.	.	.	.	.	.	.	.	C	13.99	2.402865	0.42613	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000475616	T;T;T;T;T	0.69561	-0.41;-0.32;-0.41;-0.35;-0.32	4.99	4.1	0.47936	.	.	.	.	.	T	0.62575	0.2439	M	0.66939	2.045	0.80722	D	1	B;B;B;B;B	0.29341	0.242;0.034;0.128;0.035;0.156	B;B;B;B;B	0.25405	0.06;0.023;0.043;0.024;0.027	T	0.58929	-0.7549	9	0.19147	T	0.46	.	15.2535	0.73568	0.0:0.8587:0.1413:0.0	.	891;822;891;822;891	Q15746-6;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;MYLK_HUMAN	Q	891;891;891;822;891	ENSP00000354004:E891Q;ENSP00000353452:E891Q;ENSP00000352088:E891Q;ENSP00000320622:E822Q;ENSP00000418335:E891Q	ENSP00000320622:E822Q	E	-	1	0	MYLK	124902334	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.338000	0.43957	1.074000	0.40909	0.561000	0.74099	GAG	MYLK	-	NULL	ENSG00000065534		0.622	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYLK	HGNC	protein_coding	OTTHUMT00000356464.1	101	0.00	0	C	NM_053025		123419644	123419644	-1	no_errors	ENST00000360304	ensembl	human	known	69_37n	missense	104	22.22	30	SNP	1.000	G
NFATC4	4776	genome.wustl.edu	37	14	24836334	24836334	+	5'Flank	SNP	C	C	G			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr14:24836334C>G	ENST00000250373.4	+	0	0				NFATC4_ENST00000554966.1_5'Flank|NFATC4_ENST00000424781.2_5'Flank|NFATC4_ENST00000555453.1_5'Flank|NFATC4_ENST00000557451.1_5'Flank|NFATC4_ENST00000554344.1_5'Flank|NFATC4_ENST00000554050.1_5'Flank|NFATC4_ENST00000553879.1_5'Flank|NFATC4_ENST00000555590.1_5'Flank|NFATC4_ENST00000422617.3_5'Flank|NFATC4_ENST00000554661.1_5'Flank|NFATC4_ENST00000553708.1_5'Flank|NFATC4_ENST00000554591.1_Missense_Mutation_p.S25C|NFATC4_ENST00000556169.1_5'Flank|NFATC4_ENST00000440487.2_3'UTR|NFATC4_ENST00000413692.2_Missense_Mutation_p.S25C|NFATC4_ENST00000553469.1_5'Flank|NFATC4_ENST00000556279.1_5'Flank|NFATC4_ENST00000539237.2_5'Flank	NM_004554.4	NP_004545.2	Q14934	NFAC4_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4						cellular respiration (GO:0045333)|cellular response to lithium ion (GO:0071285)|cellular response to UV (GO:0034644)|heart development (GO:0007507)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of synaptic plasticity (GO:0048167)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription coactivator activity (GO:0003713)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(7)|liver(4)|lung(12)|ovary(1)|skin(2)	34				GBM - Glioblastoma multiforme(265;0.018)		AATCTCCCATCTAACTCCCTC	0.562																																						dbGAP											0													146.0	147.0	147.0					14																	24836334		1568	3582	5150	-	-	-	SO:0001631	upstream_gene_variant	0			BC053855	CCDS9629.1, CCDS45089.1, CCDS55909.1, CCDS55910.1, CCDS55911.1, CCDS73625.1	14q11.2	2009-11-24			ENSG00000100968	ENSG00000100968		"""Nuclear factor of activated T-cells"""	7778	protein-coding gene	gene with protein product		602699				7749981	Standard	NM_004554		Approved	NFAT3	uc010tok.2	Q14934	OTTHUMG00000029351		14.37:g.24836334C>G	Exception_encountered		B4DDG5|B4DY55|B5B2U7|B5B2U8|B5B2U9|B5B2V0|B5B2V1|B5B2V2|B5B2V3|B5B2V4|B5B2V5|B5B2V7|B5B2V8|B5B2V9|B5B2W0|B5B2W1|B5B2W2|B5B2W3|B5B2W4|B5B2W5|B5B2W6|B5B2W7|B5B2W8|B5B2W9|B5B2X0|Q7Z598|Q96H68	Missense_Mutation	SNP	pfam_RHD,pfam_IPT_TIG_rcpt,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT_TIG_rcpt,pfscan_RHD,prints_NFAT	p.S25C	ENST00000250373.4	37	c.74	CCDS9629.1	14	.	.	.	.	.	.	.	.	.	.	C	11.96	1.795957	0.31777	.	.	ENSG00000100968	ENST00000413692;ENST00000554591	T;T	0.08282	3.11;3.12	4.31	0.0892	0.14458	.	.	.	.	.	T	0.04003	0.0112	N	0.08118	0	0.09310	N	0.999994	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.39941	-0.9589	9	0.72032	D	0.01	.	4.4377	0.11559	0.0:0.5344:0.1659:0.2997	.	25;25;25	Q14934-2;Q14934-3;Q14934-11	.;.;.	C	25	ENSP00000388910:S25C;ENSP00000452039:S25C	ENSP00000388910:S25C	S	+	2	0	NFATC4	23906174	0.000000	0.05858	0.000000	0.03702	0.148000	0.21650	0.020000	0.13466	0.082000	0.17018	0.585000	0.79938	TCT	NFATC4	-	NULL	ENSG00000100968		0.562	NFATC4-001	KNOWN	basic|CCDS	protein_coding	NFATC4	HGNC	protein_coding	OTTHUMT00000073206.6	391	0.00	0	C	NM_004554		24836334	24836334	+1	no_errors	ENST00000413692	ensembl	human	known	69_37n	missense	470	15.59	87	SNP	0.000	G
NLRP2	55655	genome.wustl.edu	37	19	55493529	55493529	+	Splice_Site	SNP	G	G	C			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr19:55493529G>C	ENST00000543010.1	+	6	606		c.e6-1		NLRP2_ENST00000538819.1_Splice_Site|NLRP2_ENST00000339757.7_Splice_Site|NLRP2_ENST00000427260.2_Splice_Site|NLRP2_ENST00000537859.1_Splice_Site|NLRP2_ENST00000391721.4_Splice_Site|NLRP2_ENST00000263437.6_Splice_Site|NLRP2_ENST00000448584.2_Splice_Site	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2						positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		CAATGATAAAGACAAAGACAA	0.478																																						dbGAP											0													199.0	222.0	215.0					19																	55493529		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.464-1G>C	19.37:g.55493529G>C			B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Splice_Site	SNP	-	e5-1	ENST00000543010.1	37	c.464-1	CCDS12913.1	19	.	.	.	.	.	.	.	.	.	.	g	2.498	-0.315921	0.05422	.	.	ENSG00000022556	ENST00000543010;ENST00000391721;ENST00000339757;ENST00000448584;ENST00000537859;ENST00000427260;ENST00000538819;ENST00000263437	.	.	.	2.23	-0.296	0.12824	.	.	.	.	.	.	.	.	.	.	.	0.19945	N	0.999947	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.2978	0.21095	0.0:0.0:0.4682:0.5318	.	.	.	.	.	-1	.	.	.	+	.	.	NLRP2	60185341	0.265000	0.24102	0.000000	0.03702	0.004000	0.04260	0.136000	0.15974	0.014000	0.14944	0.511000	0.50034	.	NLRP2	-	-	ENSG00000022556		0.478	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP2	HGNC	protein_coding	OTTHUMT00000396152.1	131	0.00	0	G	NM_017852	Intron	55493529	55493529	+1	no_errors	ENST00000448584	ensembl	human	known	69_37n	splice_site	101	14.41	17	SNP	0.000	C
NSUN3	63899	genome.wustl.edu	37	3	93783283	93783283	+	Silent	SNP	G	G	C			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr3:93783283G>C	ENST00000314622.4	+	2	226	c.15G>C	c.(13-15)ctG>ctC	p.L5L	DHFRL1_ENST00000314636.2_5'Flank|DHFRL1_ENST00000481631.1_5'Flank|NSUN3_ENST00000485793.1_3'UTR|DHFRL1_ENST00000394221.2_5'Flank	NM_022072.3	NP_071355.1	Q9H649	NSUN3_HUMAN	NOP2/Sun domain family, member 3	5							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|skin(1)	18						CGTCATAGCTGAAAGCAAAAT	0.353																																						dbGAP											0													73.0	75.0	75.0					3																	93783283		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC020602	CCDS2927.1	3q11.2	2009-11-23	2009-11-23		ENSG00000178694	ENSG00000178694		"""NOP2/Sun domain containing"""	26208	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family 3"", ""NOL1/NOP2/Sun domain family, member 3"""			12477932	Standard	NM_022072		Approved	FLJ22609	uc003drl.1	Q9H649	OTTHUMG00000159025	ENST00000314622.4:c.15G>C	3.37:g.93783283G>C			Q6PG41|Q8IXG9|Q9H6M2	Silent	SNP	pfam_Fmu/NOL1/Nop2p,prints_RCMT	p.L5	ENST00000314622.4	37	c.15	CCDS2927.1	3																																																																																			NSUN3	-	NULL	ENSG00000178694		0.353	NSUN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSUN3	HGNC	protein_coding	OTTHUMT00000352934.1	370	0.00	0	G	NM_022072		93783283	93783283	+1	no_errors	ENST00000314622	ensembl	human	known	69_37n	silent	252	12.76	37	SNP	1.000	C
NUP205	23165	genome.wustl.edu	37	7	135272700	135272700	+	Missense_Mutation	SNP	C	C	G	rs547020231		TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr7:135272700C>G	ENST00000285968.6	+	10	1459	c.1433C>G	c.(1432-1434)tCt>tGt	p.S478C	NUP205_ENST00000440390.2_Intron	NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	478					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						ATCATGGGCTCTTATCTAGGG	0.468													C|||	1	0.000199681	0.0	0.0014	5008	,	,		14029	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													69.0	68.0	69.0					7																	135272700		2203	4300	6503	-	-	-	SO:0001583	missense	0			D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.1433C>G	7.37:g.135272700C>G	ENSP00000285968:p.Ser478Cys		A6H8X3|Q86YC1	Missense_Mutation	SNP	pfam_DUF3414	p.S478C	ENST00000285968.6	37	c.1433	CCDS34759.1	7	.	.	.	.	.	.	.	.	.	.	C	34	5.351129	0.95830	.	.	ENSG00000155561	ENST00000285968	T	0.36699	1.24	5.85	5.85	0.93711	.	0.049778	0.85682	D	0.000000	T	0.53626	0.1808	L	0.51422	1.61	0.80722	D	1	D	0.65815	0.995	P	0.59171	0.853	T	0.51810	-0.8658	10	0.72032	D	0.01	-14.8671	20.1649	0.98147	0.0:1.0:0.0:0.0	.	478	Q92621	NU205_HUMAN	C	478	ENSP00000285968:S478C	ENSP00000285968:S478C	S	+	2	0	NUP205	134923240	1.000000	0.71417	0.992000	0.48379	0.977000	0.68977	7.701000	0.84566	2.753000	0.94483	0.655000	0.94253	TCT	NUP205	-	pfam_DUF3414	ENSG00000155561		0.468	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP205	HGNC	protein_coding	OTTHUMT00000340358.1	334	0.00	0	C			135272700	135272700	+1	no_errors	ENST00000285968	ensembl	human	known	69_37n	missense	271	16.05	52	SNP	1.000	G
OR2AG1	144125	genome.wustl.edu	37	11	6807135	6807135	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr11:6807135C>G	ENST00000307401.4	+	1	888	c.867C>G	c.(865-867)atC>atG	p.I289M		NM_001004489.2	NP_001004489.1	Q9H205	O2AG1_HUMAN	olfactory receptor, family 2, subfamily AG, member 1	289						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(13)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.19e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		ATCCACTCATCTACAGCCTGA	0.502																																						dbGAP											0													111.0	101.0	104.0					11																	6807135		2201	4293	6494	-	-	-	SO:0001583	missense	0			AB065823	CCDS31414.1	11p15.4	2012-08-09			ENSG00000170803	ENSG00000170803		"""GPCR / Class A : Olfactory receptors"""	15142	protein-coding gene	gene with protein product				OR2AG3			Standard	NM_001004489		Approved		uc001mer.2	Q9H205	OTTHUMG00000165735	ENST00000307401.4:c.867C>G	11.37:g.6807135C>G	ENSP00000307447:p.Ile289Met		B9EKV7|Q6IFG7|Q96R26	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.I289M	ENST00000307401.4	37	c.867	CCDS31414.1	11	.	.	.	.	.	.	.	.	.	.	C	10.13	1.265867	0.23136	.	.	ENSG00000170803	ENST00000307401	T	0.57273	0.41	4.39	1.44	0.22558	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000088	T	0.65770	0.2723	M	0.80508	2.5	0.32173	N	0.581385	D	0.89917	1.0	D	0.72338	0.977	T	0.67565	-0.5638	10	0.87932	D	0	.	3.6621	0.08242	0.1717:0.5429:0.0:0.2855	.	289	Q9H205	O2AG1_HUMAN	M	289	ENSP00000307447:I289M	ENSP00000307447:I289M	I	+	3	3	OR2AG1	6763711	0.048000	0.20356	1.000000	0.80357	0.250000	0.25880	-0.755000	0.04782	0.218000	0.20820	-0.136000	0.14681	ATC	OR2AG1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000170803		0.502	OR2AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2AG1	HGNC	protein_coding	OTTHUMT00000385980.1	509	0.00	0	C	NM_001004489		6807135	6807135	+1	no_errors	ENST00000307401	ensembl	human	known	69_37n	missense	249	26.11	88	SNP	1.000	G
OTUD7B	56957	genome.wustl.edu	37	1	149937782	149937782	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr1:149937782C>T	ENST00000369135.4	-	5	818	c.524G>A	c.(523-525)aGt>aAt	p.S175N	OTUD7B_ENST00000479905.1_5'UTR	NM_020205.2	NP_064590.2	Q6GQQ9	OTU7B_HUMAN	OTU deubiquitinase 7B	175	Catalytic.|TRAF-binding.				mucosal immune response (GO:0002385)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|DNA binding (GO:0003677)|Lys48-specific deubiquitinase activity (GO:1990380)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			GGGATCCACACTCACCCACCA	0.507																																						dbGAP											0													48.0	51.0	50.0					1																	149937782		1975	4139	6114	-	-	-	SO:0001583	missense	0			AJ293573	CCDS72903.1	1q21.2	2014-02-24	2014-02-24	2006-07-07	ENSG00000163113	ENSG00000264522		"""OTU domain containing"""	16683	protein-coding gene	gene with protein product		611748	"""zinc finger, A20 domain containing 1"", ""OTU domain containing 7B"""	ZA20D1		11463333, 23827681	Standard	NM_020205		Approved	CEZANNE	uc001etn.3	Q6GQQ9	OTTHUMG00000012291	ENST00000369135.4:c.524G>A	1.37:g.149937782C>T	ENSP00000358131:p.Ser175Asn		B7Z643|D3DUZ8|Q5SZ60|Q8WWA7|Q9NQ53|Q9UFF4	Missense_Mutation	SNP	pfam_OTU,superfamily_UBA-like,smart_Znf_A20,pfscan_OTU,pfscan_Znf_A20	p.S175N	ENST00000369135.4	37	c.524	CCDS41389.1	1	.	.	.	.	.	.	.	.	.	.	C	11.84	1.758290	0.31137	.	.	ENSG00000163113	ENST00000369135;ENST00000543330;ENST00000417191	T;T	0.30448	1.54;1.53	4.99	4.99	0.66335	.	0.254500	0.43110	D	0.000617	T	0.05090	0.0136	N	0.11427	0.14	0.27787	N	0.942943	B;B	0.13145	0.007;0.001	B;B	0.12837	0.008;0.001	T	0.26395	-1.0104	9	.	.	.	-16.0125	5.3018	0.15781	0.0:0.6589:0.1778:0.1633	.	175;175	B7Z643;Q6GQQ9	.;OTU7B_HUMAN	N	175	ENSP00000358131:S175N;ENSP00000408231:S175N	.	S	-	2	0	OTUD7B	148204406	0.036000	0.19791	1.000000	0.80357	0.992000	0.81027	0.416000	0.21198	2.606000	0.88127	0.467000	0.42956	AGT	OTUD7B	-	NULL	ENSG00000163113		0.507	OTUD7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUD7B	HGNC	protein_coding	OTTHUMT00000034146.3	125	0.00	0	C	NM_020205		149937782	149937782	-1	no_errors	ENST00000369135	ensembl	human	known	69_37n	missense	137	14.37	23	SNP	0.986	T
OR2T34	127068	genome.wustl.edu	37	1	248737415	248737415	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr1:248737415G>T	ENST00000328782.2	-	1	665	c.644C>A	c.(643-645)cCc>cAc	p.P215H		NM_001001821.1	NP_001001821.1	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T, member 34	215						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(28)|ovary(2)|skin(2)|stomach(3)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GACCATGATGGGGGTGAGAAG	0.562																																						dbGAP											0													189.0	206.0	200.0					1																	248737415		2142	4300	6442	-	-	-	SO:0001583	missense	0			BK004477	CCDS31120.1	1q44	2012-08-09			ENSG00000183310	ENSG00000183310		"""GPCR / Class A : Olfactory receptors"""	31256	protein-coding gene	gene with protein product							Standard	NM_001001821		Approved		uc001iep.1	Q8NGX1	OTTHUMG00000040387	ENST00000328782.2:c.644C>A	1.37:g.248737415G>T	ENSP00000330904:p.Pro215His		B2RNJ8|Q6IEY5|Q96R31	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.P215H	ENST00000328782.2	37	c.644	CCDS31120.1	1	.	.	.	.	.	.	.	.	.	.	.	12.31	1.898486	0.33535	.	.	ENSG00000183310	ENST00000328782	T	0.57273	0.41	2.37	2.37	0.29283	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.80319	0.4601	H	0.98218	4.175	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.68303	-0.5444	9	0.87932	D	0	.	8.821	0.35025	0.0:0.2347:0.7653:0.0	.	215	Q8NGX1	O2T34_HUMAN	H	215	ENSP00000330904:P215H	ENSP00000330904:P215H	P	-	2	0	OR2T34	246804038	0.008000	0.16893	0.024000	0.17045	0.105000	0.19272	1.256000	0.32921	1.169000	0.42739	0.123000	0.15791	CCC	OR2T34	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000183310		0.562	OR2T34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T34	HGNC	protein_coding	OTTHUMT00000097138.1	419	0.00	0	G	NM_001001821		248737415	248737415	-1	no_errors	ENST00000328782	ensembl	human	known	69_37n	missense	473	16.28	92	SNP	0.001	T
P2RY4	5030	genome.wustl.edu	37	X	69478551	69478551	+	Silent	SNP	G	G	C			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chrX:69478551G>C	ENST00000374519.2	-	1	1103	c.924C>G	c.(922-924)ctC>ctG	p.L308L		NM_002565.3	NP_002556.1	P51582	P2RY4_HUMAN	pyrimidinergic receptor P2Y, G-protein coupled, 4	308					phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|transepithelial chloride transport (GO:0030321)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|uridine nucleotide receptor activity (GO:0015065)|UTP-activated nucleotide receptor activity (GO:0045030)			cervix(2)|endometrium(2)|large_intestine(8)|lung(6)	18						TGTCCCCAGTGAGCAAGTAGA	0.592																																						dbGAP											0													52.0	42.0	45.0					X																	69478551		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X91852	CCDS14398.1	Xq13	2012-08-08			ENSG00000186912	ENSG00000186912		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8542	protein-coding gene	gene with protein product		300038				8537336	Standard	NM_002565		Approved	NRU, P2Y4, UNR, P2P	uc004dxz.1	P51582	OTTHUMG00000021769	ENST00000374519.2:c.924C>G	X.37:g.69478551G>C			Q4VBB7|Q4VBB8|Q502W2|Q5JT22	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_P2Y4_purnocptor,prints_P2_purnocptor,prints_7TM_GPCR_Rhodpsn,prints_P2U_purnocptor,pfscan_GPCR_Rhodpsn_supfam	p.L308	ENST00000374519.2	37	c.924	CCDS14398.1	X																																																																																			P2RY4	-	prints_P2Y4_purnocptor,prints_7TM_GPCR_Rhodpsn	ENSG00000186912		0.592	P2RY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY4	HGNC	protein_coding	OTTHUMT00000057058.2	107	0.00	0	G	NM_002565		69478551	69478551	-1	no_errors	ENST00000374519	ensembl	human	known	69_37n	silent	100	31.97	47	SNP	1.000	C
PAPPA2	60676	genome.wustl.edu	37	1	176564678	176564678	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr1:176564678C>A	ENST00000367662.3	+	3	3102	c.1938C>A	c.(1936-1938)gaC>gaA	p.D646E	PAPPA2_ENST00000367661.3_Missense_Mutation_p.D646E	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	646	Metalloprotease.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						ACTGCTGCGACCCCCAGGTGG	0.572																																						dbGAP											0													57.0	62.0	60.0					1																	176564678		2164	4266	6430	-	-	-	SO:0001583	missense	0			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.1938C>A	1.37:g.176564678C>A	ENSP00000356634:p.Asp646Glu		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	pfam_Notch_dom,pfam_Sushi_SCR_CCP,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl,superfamily_Complement_control_module,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.D646E	ENST00000367662.3	37	c.1938	CCDS41438.1	1	.	.	.	.	.	.	.	.	.	.	C	16.46	3.129068	0.56721	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.33654	4.66;1.4	5.42	2.53	0.30540	.	0.294917	0.36972	N	0.002304	T	0.46328	0.1387	M	0.64997	1.995	0.36844	D	0.887547	P;D	0.69078	0.938;0.997	P;P	0.60541	0.74;0.876	T	0.50101	-0.8867	10	0.59425	D	0.04	-19.8752	4.948	0.14000	0.1478:0.6228:0.0:0.2294	.	646;646	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	E	646	ENSP00000356634:D646E;ENSP00000356633:D646E	ENSP00000356633:D646E	D	+	3	2	PAPPA2	174831301	1.000000	0.71417	0.979000	0.43373	0.421000	0.31385	1.823000	0.39062	0.262000	0.21774	0.650000	0.86243	GAC	PAPPA2	-	NULL	ENSG00000116183		0.572	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	HGNC	protein_coding	OTTHUMT00000084763.1	148	0.00	0	C			176564678	176564678	+1	no_errors	ENST00000367662	ensembl	human	known	69_37n	missense	162	18.41	37	SNP	1.000	A
PCDH18	54510	genome.wustl.edu	37	4	138451370	138451370	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr4:138451370C>T	ENST00000344876.4	-	1	2259	c.1873G>A	c.(1873-1875)Gag>Aag	p.E625K	PCDH18_ENST00000412923.2_Missense_Mutation_p.E625K|PCDH18_ENST00000507846.1_Missense_Mutation_p.E405K|PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000510305.1_Intron	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	625	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					ATATTCTCCTCATTACCTGCT	0.443																																						dbGAP											0													237.0	214.0	222.0					4																	138451370		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.1873G>A	4.37:g.138451370C>T	ENSP00000355082:p.Glu625Lys		A8K7K3|B7ZKT1|Q52LS2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.E625K	ENST00000344876.4	37	c.1873	CCDS34064.1	4	.	.	.	.	.	.	.	.	.	.	C	19.25	3.791492	0.70452	.	.	ENSG00000189184	ENST00000344876;ENST00000412923;ENST00000507846	T;T;T	0.53857	0.6;0.6;0.6	5.8	5.8	0.92144	Cadherin (4);Cadherin-like (1);	0.000000	0.43747	D	0.000529	T	0.71022	0.3291	M	0.77313	2.365	0.80722	D	1	P;B;P	0.52170	0.939;0.082;0.951	P;B;P	0.56216	0.735;0.061;0.794	T	0.73464	-0.3974	10	0.72032	D	0.01	.	20.064	0.97700	0.0:1.0:0.0:0.0	.	405;625;625	D6RIG4;Q9HCL0-2;Q9HCL0	.;.;PCD18_HUMAN	K	625;625;405	ENSP00000355082:E625K;ENSP00000390688:E625K;ENSP00000425903:E405K	ENSP00000355082:E625K	E	-	1	0	PCDH18	138670820	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.974000	0.70465	2.739000	0.93911	0.467000	0.42956	GAG	PCDH18	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000189184		0.443	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH18	HGNC	protein_coding	OTTHUMT00000364614.1	222	0.00	0	C	NM_019035		138451370	138451370	-1	no_errors	ENST00000344876	ensembl	human	known	69_37n	missense	179	16.74	36	SNP	1.000	T
PCDHGA3	56112	genome.wustl.edu	37	5	140724883	140724883	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr5:140724883G>T	ENST00000253812.6	+	1	1283	c.1283G>T	c.(1282-1284)gGa>gTa	p.G428V	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	428	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCAGATGGGGGAAGCCCGCCA	0.468																																						dbGAP											0													63.0	73.0	70.0					5																	140724883		2036	4206	6242	-	-	-	SO:0001583	missense	0			AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.1283G>T	5.37:g.140724883G>T	ENSP00000253812:p.Gly428Val		Q9Y5D4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G428V	ENST00000253812.6	37	c.1283	CCDS47290.1	5	.	.	.	.	.	.	.	.	.	.	.	15.38	2.816556	0.50633	.	.	ENSG00000254245	ENST00000253812	T	0.03441	3.93	5.59	5.59	0.84812	Cadherin (4);Cadherin-like (1);	0.000000	0.33075	U	0.005302	T	0.41073	0.1143	H	0.99777	4.77	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.69308	-0.5179	10	0.87932	D	0	.	19.5616	0.95374	0.0:0.0:1.0:0.0	.	428;428	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	V	428	ENSP00000253812:G428V	ENSP00000253812:G428V	G	+	2	0	PCDHGA3	140705067	1.000000	0.71417	0.904000	0.35570	0.119000	0.20118	9.669000	0.98622	2.790000	0.95986	0.655000	0.94253	GGA	PCDHGA3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000254245		0.468	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA3	HGNC	protein_coding	OTTHUMT00000377017.1	152	0.00	0	G	NM_018916		140724883	140724883	+1	no_errors	ENST00000253812	ensembl	human	known	69_37n	missense	131	17.50	28	SNP	1.000	T
PGBD5	79605	genome.wustl.edu	37	1	230503782	230503782	+	Intron	SNP	G	G	C			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr1:230503782G>C	ENST00000525115.1	-	1	148				PGBD5_ENST00000321327.2_Missense_Mutation_p.S78C|PGBD5_ENST00000391860.1_Intron			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5							integral component of membrane (GO:0016021)				biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		ACATAGGCAGGAATGAATACT	0.552																																						dbGAP											0													113.0	106.0	109.0					1																	230503782		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.124+9461C>G	1.37:g.230503782G>C			A0PJF3|B9EK58|Q5SR37|Q6PJN2	Missense_Mutation	SNP	NULL	p.S78C	ENST00000525115.1	37	c.233		1	.	.	.	.	.	.	.	.	.	.	G	12.20	1.867598	0.32977	.	.	ENSG00000177614	ENST00000321327	T	0.22945	1.93	2.71	0.665	0.17896	.	10.493700	0.00496	U	0.000151	T	0.29288	0.0729	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36311	-0.9753	7	0.62326	D	0.03	0.0187	8.4627	0.32938	0.0:0.4757:0.5243:0.0	.	.	.	.	C	78	ENSP00000322530:S78C	ENSP00000322530:S78C	S	-	2	0	PGBD5	228570405	0.002000	0.14202	0.000000	0.03702	0.004000	0.04260	0.810000	0.27183	0.171000	0.19730	0.655000	0.94253	TCC	PGBD5	-	NULL	ENSG00000177614		0.552	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	PGBD5	HGNC	protein_coding	OTTHUMT00000382617.1	498	0.00	0	G	NM_024554		230503782	230503782	-1	no_errors	ENST00000321327	ensembl	human	known	69_37n	missense	533	13.29	82	SNP	0.000	C
PIK3CA	5290	genome.wustl.edu	37	3	178941973	178941973	+	Silent	SNP	C	C	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr3:178941973C>T	ENST00000263967.3	+	15	2449	c.2292C>T	c.(2290-2292)ctC>ctT	p.L764L		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	764					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)			NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TAGGAAACCTCAGGTACTTTC	0.353		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	0													93.0	81.0	85.0					3																	178941973		1804	4064	5868	-	-	-	SO:0001819	synonymous_variant	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.2292C>T	3.37:g.178941973C>T			Q14CW1|Q99762	Silent	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.L764	ENST00000263967.3	37	c.2292	CCDS43171.1	3																																																																																			PIK3CA	-	superfamily_Kinase-like_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	439	0.00	0	C			178941973	178941973	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	silent	309	15.11	55	SNP	1.000	T
PIP	5304	genome.wustl.edu	37	7	142836690	142836690	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr7:142836690C>G	ENST00000291009.3	+	4	436	c.396C>G	c.(394-396)atC>atG	p.I132M		NM_002652.2	NP_002643.1	P12273	PIP_HUMAN	prolactin-induced protein	132					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of T cell apoptotic process (GO:0070233)|positive regulation of gene expression (GO:0010628)|proteolysis (GO:0006508)|regulation of immune system process (GO:0002682)|retina homeostasis (GO:0001895)	apical plasma membrane (GO:0016324)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	actin binding (GO:0003779)|aspartic-type endopeptidase activity (GO:0004190)|glycoprotein binding (GO:0001948)|IgG binding (GO:0019864)|protein dimerization activity (GO:0046983)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	18	Melanoma(164;0.059)	Ovarian(593;2.82e-05)|Breast(660;0.012)		BRCA - Breast invasive adenocarcinoma(188;0.0026)|LUSC - Lung squamous cell carcinoma(290;0.0733)|Lung(243;0.08)		TAATCCCCATCAAAAACAACC	0.443																																						dbGAP											0													158.0	158.0	158.0					7																	142836690		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS34768.1	7q34	2013-09-19			ENSG00000159763	ENSG00000159763			8993	protein-coding gene	gene with protein product	"""prolactin-inducible protein"""	176720				2727805, 1955075	Standard	NM_002652		Approved	GCDFP-15, GCDFP15, GPIP4	uc003wcf.1	P12273	OTTHUMG00000152635	ENST00000291009.3:c.396C>G	7.37:g.142836690C>G	ENSP00000291009:p.Ile132Met		A0A963|A0A9C3|A0A9F3|A4D2I1	Missense_Mutation	SNP	pfam_SV_autoAg,pirsf_SV_autoAg	p.I132M	ENST00000291009.3	37	c.396	CCDS34768.1	7	.	.	.	.	.	.	.	.	.	.	C	9.269	1.045221	0.19748	.	.	ENSG00000159763	ENST00000291009	T	0.15017	2.46	4.78	-6.95	0.01628	.	0.148255	0.31257	N	0.007969	T	0.07052	0.0179	L	0.40543	1.245	0.09310	N	1	P	0.39326	0.668	B	0.30572	0.117	T	0.08911	-1.0699	10	0.56958	D	0.05	.	2.3376	0.04252	0.1194:0.1561:0.237:0.4874	.	132	P12273	PIP_HUMAN	M	132	ENSP00000291009:I132M	ENSP00000291009:I132M	I	+	3	3	PIP	142546812	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-1.745000	0.01831	-1.132000	0.02907	-0.136000	0.14681	ATC	PIP	-	pirsf_SV_autoAg	ENSG00000159763		0.443	PIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIP	HGNC	protein_coding	OTTHUMT00000327089.1	277	0.00	0	C	NM_002652		142836690	142836690	+1	no_errors	ENST00000291009	ensembl	human	known	69_37n	missense	227	20.63	59	SNP	0.001	G
PLA1A	51365	genome.wustl.edu	37	3	119327722	119327722	+	Silent	SNP	A	A	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr3:119327722A>T	ENST00000273371.4	+	3	453	c.381A>T	c.(379-381)ggA>ggT	p.G127G	PLA1A_ENST00000495992.1_Silent_p.G127G|PLA1A_ENST00000494440.1_Silent_p.G111G|PLA1A_ENST00000488919.1_5'UTR	NM_015900.3	NP_056984.1	Q53H76	PLA1A_HUMAN	phospholipase A1 member A	127					lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|phosphatidylserine metabolic process (GO:0006658)	extracellular vesicular exosome (GO:0070062)	phosphatidylcholine 1-acylhydrolase activity (GO:0008970)			NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						GGTCTACAGGAGTCTACTTCT	0.443																																						dbGAP											0													164.0	160.0	161.0					3																	119327722		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF035268	CCDS2991.1, CCDS56268.1, CCDS56269.1	3q13.13-q13.2	2002-11-28			ENSG00000144837	ENSG00000144837			17661	protein-coding gene	gene with protein product		607460				10196188	Standard	NM_015900		Approved	ps-PLA1	uc003ecu.3	Q53H76	OTTHUMG00000159425	ENST00000273371.4:c.381A>T	3.37:g.119327722A>T			B2R8V2|B4DXA2|O95991|Q86WX6|Q9UPD2	Silent	SNP	pfam_Lipase_N,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase	p.G127	ENST00000273371.4	37	c.381	CCDS2991.1	3																																																																																			PLA1A	-	pfam_Lipase_N,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase	ENSG00000144837		0.443	PLA1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA1A	HGNC	protein_coding	OTTHUMT00000355252.2	550	0.00	0	A			119327722	119327722	+1	no_errors	ENST00000273371	ensembl	human	known	69_37n	silent	329	19.56	80	SNP	0.000	T
PLA2G6	8398	genome.wustl.edu	37	22	38541572	38541572	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr22:38541572G>C	ENST00000332509.3	-	3	481	c.298C>G	c.(298-300)Cag>Gag	p.Q100E	PLA2G6_ENST00000436218.1_Missense_Mutation_p.Q100E|PLA2G6_ENST00000335539.3_Missense_Mutation_p.Q100E|PLA2G6_ENST00000402064.1_Missense_Mutation_p.Q100E|PLA2G6_ENST00000447598.2_3'UTR	NM_003560.2	NP_003551.2	O60733	PLPL9_HUMAN	phospholipase A2, group VI (cytosolic, calcium-independent)	100					cardiolipin acyl-chain remodeling (GO:0035965)|cardiolipin biosynthetic process (GO:0032049)|cell death (GO:0008219)|chemotaxis (GO:0006935)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phospholipid metabolic process (GO:0006644)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of ceramide biosynthetic process (GO:2000304)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of exocytosis (GO:0045921)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of vasodilation (GO:0045909)|regulation of store-operated calcium channel activity (GO:1901339)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|urinary bladder smooth muscle contraction (GO:0014832)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipase A2 activity (GO:0004623)			breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|liver(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	24	Melanoma(58;0.045)				Quinacrine(DB01103)	TGCAGGACCTGAGGGGAGCTC	0.587																																						dbGAP											0													56.0	50.0	52.0					22																	38541572		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF064594	CCDS13967.1, CCDS33645.1	22q13.1	2013-01-10			ENSG00000184381	ENSG00000184381	3.1.1.4	"""Patatin-like phospholipase domain containing"", ""Parkinson disease"", ""Ankyrin repeat domain containing"""	9039	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 2"""	603604				9417066, 16799181, 19029121	Standard	NM_001199562		Approved	iPLA2, PNPLA9, PARK14, iPLA2beta, NBIA2	uc003aux.1	O60733	OTTHUMG00000151246	ENST00000332509.3:c.298C>G	22.37:g.38541572G>C	ENSP00000333142:p.Gln100Glu		A8K597|B0QYE8|O75645|Q8N452|Q9UG29|Q9UIT0|Q9Y671	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Patatin/PLipase_A2-rel,superfamily_Ankyrin_rpt-contain_dom,superfamily_Acyl_Trfase/lysoPLipase,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.Q100E	ENST00000332509.3	37	c.298	CCDS13967.1	22	.	.	.	.	.	.	.	.	.	.	G	0.034	-1.318524	0.01320	.	.	ENSG00000184381	ENST00000332509;ENST00000335539;ENST00000402064;ENST00000396860;ENST00000451461	T;T;T	0.60920	0.15;0.17;0.17	5.3	4.22	0.49857	.	0.521331	0.22584	N	0.058175	T	0.30541	0.0768	N	0.08118	0	0.19300	N	0.999977	B;B;B	0.26002	0.139;0.013;0.001	B;B;B	0.19946	0.027;0.022;0.001	T	0.11867	-1.0570	10	0.02654	T	1	-2.773	12.177	0.54190	0.0:0.0:0.8298:0.1702	.	100;100;100	B7Z6K3;O60733-2;O60733	.;.;PA2G6_HUMAN	E	100	ENSP00000333142:Q100E;ENSP00000335149:Q100E;ENSP00000386100:Q100E	ENSP00000333142:Q100E	Q	-	1	0	PLA2G6	36871518	1.000000	0.71417	0.135000	0.22099	0.006000	0.05464	6.301000	0.72782	2.490000	0.84030	0.655000	0.94253	CAG	PLA2G6	-	NULL	ENSG00000184381		0.587	PLA2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G6	HGNC	protein_coding	OTTHUMT00000321860.1	108	0.00	0	G	NM_001004426		38541572	38541572	-1	no_errors	ENST00000332509	ensembl	human	known	69_37n	missense	267	13.03	40	SNP	0.273	C
PLEKHA8	84725	genome.wustl.edu	37	7	30088947	30088947	+	Silent	SNP	C	C	G			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr7:30088947C>G	ENST00000449726.1	+	5	896	c.546C>G	c.(544-546)ctC>ctG	p.L182L	PLEKHA8_ENST00000396259.1_Silent_p.L182L|PLEKHA8_ENST00000258679.7_Silent_p.L182L|PLEKHA8_ENST00000396257.2_Silent_p.L182L	NM_001197027.1	NP_001183956.1	Q96JA3	PKHA8_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8	182					ER to Golgi ceramide transport (GO:0035621)|lipid transport (GO:0006869)|protein transport (GO:0015031)	membrane (GO:0016020)|trans-Golgi network (GO:0005802)	ceramide binding (GO:0097001)|glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)|phosphatidylinositol-4-phosphate binding (GO:0070273)			breast(4)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)	17						CTGAGCTGCTCTACCGCACTC	0.478																																						dbGAP											0													167.0	149.0	155.0					7																	30088947		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC053990	CCDS5424.1, CCDS56473.1, CCDS75574.1	7p21-p11.2	2013-01-10			ENSG00000106086	ENSG00000106086		"""Pleckstrin homology (PH) domain containing"""	30037	protein-coding gene	gene with protein product		608639				11001876	Standard	NM_001197027		Approved	FAPP2, MGC3358	uc003taq.3	Q96JA3	OTTHUMG00000097751	ENST00000449726.1:c.546C>G	7.37:g.30088947C>G			B4DH00|Q7Z5V8|Q9BU78|Q9H274|Q9H8Z7	Silent	SNP	pfam_Glycolipid_transfer_prot_dom,pfam_Pleckstrin_homology,superfamily_Glycolipid_transfer_prot_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.L182	ENST00000449726.1	37	c.546	CCDS56473.1	7																																																																																			PLEKHA8	-	NULL	ENSG00000106086		0.478	PLEKHA8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA8	HGNC	protein_coding		406	0.00	0	C	NM_032639		30088947	30088947	+1	no_errors	ENST00000449726	ensembl	human	known	69_37n	silent	387	21.02	103	SNP	0.003	G
POU6F2	11281	genome.wustl.edu	37	7	39125579	39125579	+	Silent	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr7:39125579G>A	ENST00000403058.1	+	3	292	c.138G>A	c.(136-138)ctG>ctA	p.L46L	POU6F2_ENST00000517348.1_3'UTR|POU6F2_ENST00000559001.1_Silent_p.L38L|POU6F2_ENST00000518318.2_Silent_p.L46L|POU6F2_ENST00000464276.2_Silent_p.L38L	NM_001166018.1|NM_007252.3	NP_001159490.1|NP_009183.3	P78424	PO6F2_HUMAN	POU class 6 homeobox 2	46					central nervous system development (GO:0007417)|ganglion mother cell fate determination (GO:0007402)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42						ATGAGCCCCTGCTTGCGCCTG	0.507																																						dbGAP											0													127.0	104.0	112.0					7																	39125579		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U91934	CCDS34620.2, CCDS55103.1	7p14.1	2011-06-20	2007-07-13		ENSG00000106536	ENSG00000106536		"""Homeoboxes / POU class"""	21694	protein-coding gene	gene with protein product	"""Retina-derived POU-domain factor-1"""	609062	"""POU domain, class 6, transcription factor 2"""			8601806	Standard	NM_007252		Approved	RPF-1	uc003thb.2	P78424	OTTHUMG00000150803	ENST00000403058.1:c.138G>A	7.37:g.39125579G>A			A4D1W2|C4AMB9|P78425|Q75ME8|Q86UM6|Q9UDS7	Silent	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Lambda_DNA-bd_dom,smart_POU_specific,smart_Homeodomain,pfscan_Homeodomain,pfscan_POU_specific,prints_POU	p.L46	ENST00000403058.1	37	c.138	CCDS34620.2	7																																																																																			POU6F2	-	NULL	ENSG00000106536		0.507	POU6F2-002	KNOWN	basic|CCDS	protein_coding	POU6F2	HGNC	protein_coding	OTTHUMT00000320146.3	423	0.00	0	G	NM_007252		39125579	39125579	+1	no_errors	ENST00000403058	ensembl	human	known	69_37n	silent	316	32.62	153	SNP	1.000	A
PPARGC1B	133522	genome.wustl.edu	37	5	149206414	149206414	+	Missense_Mutation	SNP	C	C	T	rs559196017		TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr5:149206414C>T	ENST00000309241.5	+	3	463	c.431C>T	c.(430-432)tCg>tTg	p.S144L	PPARGC1B_ENST00000403750.1_Missense_Mutation_p.S119L|PPARGC1B_ENST00000394320.3_Missense_Mutation_p.S144L|PPARGC1B_ENST00000360453.4_Missense_Mutation_p.S144L	NM_133263.3	NP_573570.3	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 beta	144					actin filament organization (GO:0007015)|bone trabecula formation (GO:0060346)|cellular lipid metabolic process (GO:0044255)|cellular response to reactive oxygen species (GO:0034614)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone resorption (GO:0045780)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of phosphorylation (GO:0042327)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transcription from mitochondrial promoter (GO:0006390)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-2 domain binding (GO:0050682)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|receptor activator activity (GO:0030546)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(2)|lung(15)|ovary(3)|prostate(2)|stomach(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			GAGAAGCCCTCGGCCCCAGCC	0.617													C|||	1	0.000199681	0.0	0.0	5008	,	,		16501	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													49.0	56.0	54.0					5																	149206414		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF468496	CCDS4298.1, CCDS54933.1, CCDS54934.1	5q33.1	2013-02-12	2006-10-17		ENSG00000155846	ENSG00000155846		"""RNA binding motif (RRM) containing"""	30022	protein-coding gene	gene with protein product		608886	"""peroxisome proliferative activated receptor, gamma, coactivator 1, beta"""			11793024, 11854298	Standard	NM_133263		Approved	PERC, PGC1B	uc003lrc.3	Q86YN6	OTTHUMG00000130055	ENST00000309241.5:c.431C>T	5.37:g.149206414C>T	ENSP00000312649:p.Ser144Leu		A2RUM8|A2RUN0|B3KVW0|Q86YN3|Q86YN4|Q86YN5|Q8N1N9|Q8TDE4|Q8TDE5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S144L	ENST00000309241.5	37	c.431	CCDS4298.1	5	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.638774	0.00799	.	.	ENSG00000155846	ENST00000360453;ENST00000394320;ENST00000309241;ENST00000403750	T;T;T;T	0.08546	3.08;3.18;3.18;3.08	4.98	-6.05	0.02172	.	1.025650	0.07692	N	0.938937	T	0.02533	0.0077	N	0.03608	-0.345	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.44174	-0.9345	10	0.27082	T	0.32	-0.1257	2.3565	0.04297	0.2367:0.1404:0.1015:0.5214	.	123;123;144;144;144	Q86YN6-2;Q86YN6-4;Q86YN6-5;Q86YN6;Q86YN6-3	.;.;.;PRGC2_HUMAN;.	L	144;144;144;119	ENSP00000353638:S144L;ENSP00000377855:S144L;ENSP00000312649:S144L;ENSP00000384403:S119L	ENSP00000312649:S144L	S	+	2	0	PPARGC1B	149186607	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.170000	0.03118	-0.711000	0.04995	-1.056000	0.02311	TCG	PPARGC1B	-	NULL	ENSG00000155846		0.617	PPARGC1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPARGC1B	HGNC	protein_coding	OTTHUMT00000252334.1	41	0.00	0	C	NM_133263		149206414	149206414	+1	no_errors	ENST00000309241	ensembl	human	known	69_37n	missense	66	12.00	9	SNP	0.000	T
PPM1E	22843	genome.wustl.edu	37	17	57043169	57043169	+	Nonsense_Mutation	SNP	C	C	G			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr17:57043169C>G	ENST00000308249.2	+	3	827	c.698C>G	c.(697-699)tCa>tGa	p.S233*	RP11-579O24.3_ENST00000582080.1_RNA	NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	0					protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)	p.S233L(2)		biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			TATGAGACATCAATCCATGCC	0.463																																						dbGAP											2	Substitution - Missense(2)	breast(2)											115.0	117.0	116.0					17																	57043169		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.698C>G	17.37:g.57043169C>G	ENSP00000312411:p.Ser233*		Q8N8J9|Q96DB8	Nonsense_Mutation	SNP	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	p.S233*	ENST00000308249.2	37	c.698	CCDS11613.1	17	.	.	.	.	.	.	.	.	.	.	C	38	6.655865	0.97739	.	.	ENSG00000175175	ENST00000308249;ENST00000443121	.	.	.	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-10.8991	19.6873	0.95984	0.0:1.0:0.0:0.0	.	.	.	.	X	233;85	.	ENSP00000312411:S233X	S	+	2	0	PPM1E	54397951	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.650000	0.89964	0.557000	0.71058	TCA	PPM1E	-	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	ENSG00000175175		0.463	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1E	HGNC	protein_coding	OTTHUMT00000445458.1	283	0.00	0	C	NM_014906		57043169	57043169	+1	no_errors	ENST00000308249	ensembl	human	known	69_37n	nonsense	171	26.61	62	SNP	1.000	G
PTPRU	10076	genome.wustl.edu	37	1	29587268	29587268	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr1:29587268G>A	ENST00000345512.3	+	7	1126	c.997G>A	c.(997-999)Gag>Aag	p.E333K	PTPRU_ENST00000428026.2_Missense_Mutation_p.E333K|PTPRU_ENST00000356870.3_Missense_Mutation_p.E333K|PTPRU_ENST00000460170.2_Missense_Mutation_p.E333K|PTPRU_ENST00000373779.3_Missense_Mutation_p.E333K|PTPRU_ENST00000323874.8_Missense_Mutation_p.E333K	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	333	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.E333K(3)		breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		GCCCTGGGCTGAGGTGCACGC	0.637																																						dbGAP											3	Substitution - Missense(3)	lung(3)											64.0	61.0	62.0					1																	29587268		2203	4300	6503	-	-	-	SO:0001583	missense	0			U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.997G>A	1.37:g.29587268G>A	ENSP00000334941:p.Glu333Lys		A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.E333K	ENST00000345512.3	37	c.997	CCDS334.1	1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.903083	0.92035	.	.	ENSG00000060656	ENST00000345512;ENST00000373779;ENST00000356870;ENST00000323874;ENST00000428026;ENST00000460170	T;T;T;T;T;T	0.59906	0.23;0.23;0.23;0.23;0.23;0.23	5.22	5.22	0.72569	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.70395	0.3219	M	0.61703	1.905	0.80722	D	1	D;D;D;D;D	0.61080	0.986;0.986;0.986;0.989;0.989	P;P;P;P;P	0.58928	0.764;0.764;0.764;0.848;0.848	T	0.70189	-0.4940	9	.	.	.	.	17.7715	0.88494	0.0:0.0:1.0:0.0	.	333;333;333;333;333	Q92729-3;Q92729-4;Q92729-2;E9PH42;Q92729	.;.;.;.;PTPRU_HUMAN	K	333	ENSP00000334941:E333K;ENSP00000362884:E333K;ENSP00000349333:E333K;ENSP00000314987:E333K;ENSP00000392332:E333K;ENSP00000432906:E333K	.	E	+	1	0	PTPRU	29459855	1.000000	0.71417	0.995000	0.50966	0.342000	0.28953	9.860000	0.99555	2.418000	0.82041	0.462000	0.41574	GAG	PTPRU	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000060656		0.637	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRU	HGNC	protein_coding	OTTHUMT00000010447.1	60	0.00	0	G			29587268	29587268	+1	no_errors	ENST00000345512	ensembl	human	known	69_37n	missense	77	19.79	19	SNP	1.000	A
RBM8A	9939	genome.wustl.edu	37	1	145508273	145508273	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr1:145508273G>T	ENST00000330165.8	+	3	263	c.194G>T	c.(193-195)gGa>gTa	p.G65V	RP11-315I20.1_ENST00000447686.2_RNA|RBM8A_ENST00000369307.3_Missense_Mutation_p.G64V|RP11-315I20.1_ENST00000599626.1_RNA|RP11-315I20.1_ENST00000601726.1_RNA|RP11-315I20.1_ENST00000598103.1_RNA|RP11-315I20.1_ENST00000600340.1_RNA|RP11-315I20.1_ENST00000599147.1_RNA|RP11-315I20.1_ENST00000596355.1_RNA|RP11-315I20.1_ENST00000595518.1_RNA|RP11-315I20.1_ENST00000597144.1_RNA|RP11-315I20.1_ENST00000421764.1_RNA|RP11-315I20.1_ENST00000448561.1_RNA|RP11-315I20.1_ENST00000599469.1_RNA|RP11-315I20.1_ENST00000437797.1_RNA|GNRHR2_ENST00000312753.5_RNA|RP11-315I20.1_ENST00000595494.1_RNA|RP11-315I20.1_ENST00000412239.1_RNA|RP11-315I20.1_ENST00000598354.1_RNA	NM_005105.3	NP_005096.1	Q9Y5S9	RBM8A_HUMAN	RNA binding motif protein 8A	65					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GATGAACCCGGACCACAACGC	0.488																																						dbGAP											0													108.0	110.0	109.0					1																	145508273		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF127761	CCDS72872.1	1q21.1	2013-02-12			ENSG00000131795			"""RNA binding motif (RRM) containing"""	9905	protein-coding gene	gene with protein product		605313		RBM8		11004516, 11013075	Standard	NM_005105		Approved	ZNRP, BOV-1A, BOV-1B, BOV-1C, RBM8B, Y14	uc001ent.2	Q9Y5S9	OTTHUMG00000013736	ENST00000330165.8:c.194G>T	1.37:g.145508273G>T	ENSP00000333001:p.Gly65Val		B3KQI9|Q6FHD1|Q6IQ40|Q9GZX8|Q9NZI4	Missense_Mutation	SNP	pfam_RRM_dom,pfam_RRM_3,smart_RRM_dom,pfscan_RRM_dom,prints_RNA-bd_8	p.G65V	ENST00000330165.8	37	c.194	CCDS916.1	1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.718568	0.89205	.	.	ENSG00000131795	ENST00000330165;ENST00000369307	T;T	0.73575	-0.76;-0.76	5.3	5.3	0.74995	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	T	0.79986	0.4541	M	0.88640	2.97	0.80722	D	1	P;B	0.35700	0.516;0.382	P;B	0.44518	0.452;0.206	D	0.83361	0.0002	10	0.87932	D	0	-10.5036	16.4914	0.84202	0.0:0.0:1.0:0.0	.	64;65	Q9Y5S9-2;Q9Y5S9	.;RBM8A_HUMAN	V	65;64	ENSP00000333001:G65V;ENSP00000358313:G64V	ENSP00000333001:G65V	G	+	2	0	RBM8A	144219630	1.000000	0.71417	0.998000	0.56505	0.967000	0.64934	8.030000	0.88816	2.764000	0.94973	0.555000	0.69702	GGA	RBM8A	-	prints_RNA-bd_8	ENSG00000131795		0.488	RBM8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM8A	HGNC	protein_coding	OTTHUMT00000038503.2	244	0.00	0	G	NM_005105		145508273	145508273	+1	no_errors	ENST00000330165	ensembl	human	known	69_37n	missense	178	33.58	90	SNP	1.000	T
RICTOR	253260	genome.wustl.edu	37	5	38944601	38944601	+	Silent	SNP	G	G	C			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr5:38944601G>C	ENST00000357387.3	-	36	4890	c.4860C>G	c.(4858-4860)gtC>gtG	p.V1620V	RICTOR_ENST00000296782.5_Silent_p.V1644V	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					TCAAATTAATGACTAATCTTA	0.323																																						dbGAP											0													111.0	109.0	110.0					5																	38944601		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0				CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.4860C>G	5.37:g.38944601G>C				Silent	SNP	superfamily_ARM-type_fold	p.V1644	ENST00000357387.3	37	c.4932	CCDS34148.1	5																																																																																			RICTOR	-	NULL	ENSG00000164327		0.323	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RICTOR	HGNC	protein_coding	OTTHUMT00000366985.1	427	0.00	0	G	NM_152756		38944601	38944601	-1	no_errors	ENST00000296782	ensembl	human	known	69_37n	silent	272	12.78	40	SNP	0.386	C
RIF1	55183	genome.wustl.edu	37	2	152322549	152322549	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr2:152322549C>T	ENST00000243326.5	+	29	6998	c.6515C>T	c.(6514-6516)tCt>tTt	p.S2172F	RIF1_ENST00000428287.2_Missense_Mutation_p.S2172F|RIF1_ENST00000444746.2_Missense_Mutation_p.S2172F|RIF1_ENST00000453091.2_Missense_Mutation_p.S2172F|RIF1_ENST00000430328.2_Missense_Mutation_p.S2172F			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		TGTGTCTGGTCTCCTTTGGCT	0.433																																						dbGAP											0													82.0	79.0	80.0					2																	152322549		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.6515C>T	2.37:g.152322549C>T	ENSP00000243326:p.Ser2172Phe		A0AVS0|Q9NS16	Missense_Mutation	SNP	pfam_Rif1_N,superfamily_ARM-type_fold	p.S2172F	ENST00000243326.5	37	c.6515	CCDS2194.1	2	.	.	.	.	.	.	.	.	.	.	C	31	5.090011	0.94149	.	.	ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000243326;ENST00000430328	T;T;T;T;T	0.33438	1.59;1.41;1.41;1.59;1.41	5.9	5.9	0.94986	.	0.098576	0.64402	D	0.000001	T	0.55561	0.1928	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.53802	-0.8387	10	0.87932	D	0	-14.2295	19.874	0.96863	0.0:1.0:0.0:0.0	.	2172;2172	Q5UIP0;Q5UIP0-2	RIF1_HUMAN;.	F	2172	ENSP00000390181:S2172F;ENSP00000414615:S2172F;ENSP00000415691:S2172F;ENSP00000243326:S2172F;ENSP00000416123:S2172F	ENSP00000243326:S2172F	S	+	2	0	RIF1	152030795	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.151000	0.77411	2.788000	0.95919	0.650000	0.86243	TCT	RIF1	-	NULL	ENSG00000080345		0.433	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RIF1	HGNC	protein_coding	OTTHUMT00000254836.3	132	0.00	0	C			152322549	152322549	+1	no_errors	ENST00000243326	ensembl	human	known	69_37n	missense	74	21.28	20	SNP	1.000	T
RIPK1	8737	genome.wustl.edu	37	6	3081330	3081330	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr6:3081330G>A	ENST00000259808.4	+	4	737	c.439G>A	c.(439-441)Gat>Aat	p.D147N	RIPK1_ENST00000479389.1_3'UTR|RIPK1_ENST00000380409.2_Missense_Mutation_p.D147N|RIPK1_ENST00000541791.1_Intron			Q13546	RIPK1_HUMAN	receptor (TNFRSF)-interacting serine-threonine kinase 1	147	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|amyloid fibril formation (GO:1990000)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular protein catabolic process (GO:0044257)|cellular response to growth factor stimulus (GO:0071363)|cellular response to tumor necrosis factor (GO:0071356)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|necroptotic signaling pathway (GO:0097527)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|peptidyl-serine autophosphorylation (GO:0036289)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of ATP:ADP antiporter activity (GO:0070926)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to tumor necrosis factor (GO:0034612)|ripoptosome assembly (GO:0097343)|ripoptosome assembly involved in necroptotic process (GO:1901026)|T cell apoptotic process (GO:0070231)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|death domain binding (GO:0070513)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	23	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				TATCCTTGTTGATAATGACTT	0.363																																						dbGAP											0													130.0	112.0	118.0					6																	3081330		2203	4300	6503	-	-	-	SO:0001583	missense	0			U25994	CCDS4482.1	6p25.2	2008-02-05			ENSG00000137275	ENSG00000137275			10019	protein-coding gene	gene with protein product		603453				7538908, 8612133	Standard	XM_005249458		Approved	RIP	uc003mux.3	Q13546	OTTHUMG00000014134	ENST00000259808.4:c.439G>A	6.37:g.3081330G>A	ENSP00000259808:p.Asp147Asn		A0AV89|B2RAG1|B4E3F9|Q13180|Q59H33	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Death,superfamily_Kinase-like_dom,superfamily_DEATH-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Death,pfscan_Death,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D147N	ENST00000259808.4	37	c.439	CCDS4482.1	6	.	.	.	.	.	.	.	.	.	.	G	26.0	4.698522	0.88830	.	.	ENSG00000137275	ENST00000259808;ENST00000380409	T;T	0.66638	-0.22;-0.22	5.83	5.83	0.93111	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.70298	0.3208	L	0.28776	0.89	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	T	0.71576	-0.4551	10	0.54805	T	0.06	-39.0603	20.1047	0.97888	0.0:0.0:1.0:0.0	.	147	Q13546	RIPK1_HUMAN	N	147	ENSP00000259808:D147N;ENSP00000369773:D147N	ENSP00000259808:D147N	D	+	1	0	RIPK1	3026329	1.000000	0.71417	0.100000	0.21137	0.803000	0.45373	7.465000	0.80898	2.762000	0.94881	0.655000	0.94253	GAT	RIPK1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000137275		0.363	RIPK1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	RIPK1	HGNC	protein_coding	OTTHUMT00000039659.2	295	0.00	0	G	NM_003804		3081330	3081330	+1	no_errors	ENST00000259808	ensembl	human	known	69_37n	missense	193	13.84	31	SNP	0.998	A
SARDH	1757	genome.wustl.edu	37	9	136595296	136595296	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr9:136595296C>T	ENST00000371872.4	-	5	961	c.704G>A	c.(703-705)tGc>tAc	p.C235Y	SARDH_ENST00000371867.1_Missense_Mutation_p.C146Y|SARDH_ENST00000298628.5_Missense_Mutation_p.C235Y|SARDH_ENST00000439388.1_Missense_Mutation_p.C235Y|SARDH_ENST00000422262.2_Missense_Mutation_p.C67Y	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	235					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		GGTCACTGGGCAGTTCTCAAT	0.602																																						dbGAP											0													85.0	81.0	82.0					9																	136595296		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.704G>A	9.37:g.136595296C>T	ENSP00000360938:p.Cys235Tyr		B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C	p.C235Y	ENST00000371872.4	37	c.704	CCDS6978.1	9	.	.	.	.	.	.	.	.	.	.	C	24.8	4.572676	0.86542	.	.	ENSG00000123453	ENST00000371872;ENST00000439388;ENST00000422262;ENST00000427237;ENST00000539227;ENST00000535281;ENST00000371867;ENST00000393050;ENST00000298628	D;D;D;D;D	0.82433	-1.61;-1.61;-1.61;-1.61;-1.61	5.29	5.29	0.74685	FAD dependent oxidoreductase (1);	0.000000	0.85682	D	0.000000	D	0.92770	0.7701	M	0.88570	2.965	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93935	0.7218	10	0.87932	D	0	-37.9468	18.929	0.92556	0.0:1.0:0.0:0.0	.	235	Q9UL12	SARDH_HUMAN	Y	235;235;67;235;235;235;146;213;235	ENSP00000360938:C235Y;ENSP00000403084:C235Y;ENSP00000415537:C67Y;ENSP00000360933:C146Y;ENSP00000298628:C235Y	ENSP00000298628:C235Y	C	-	2	0	SARDH	135585117	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.510000	0.81708	2.463000	0.83235	0.591000	0.81541	TGC	SARDH	-	pfam_FAD-dep_OxRdtase	ENSG00000123453		0.602	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SARDH	HGNC	protein_coding	OTTHUMT00000054931.1	133	0.00	0	C			136595296	136595296	-1	no_errors	ENST00000371872	ensembl	human	known	69_37n	missense	160	16.67	32	SNP	1.000	T
SF3B3	23450	genome.wustl.edu	37	16	70569223	70569223	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr16:70569223C>T	ENST00000302516.5	+	6	936	c.725C>T	c.(724-726)tCa>tTa	p.S242L	SNORD111_ENST00000408139.1_RNA	NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	242					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)			breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				CCAGGAGGGTCAGATGGTCCA	0.443																																						dbGAP											0													214.0	219.0	217.0					16																	70569223		2198	4300	6498	-	-	-	SO:0001583	missense	0			AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.725C>T	16.37:g.70569223C>T	ENSP00000305790:p.Ser242Leu		Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Missense_Mutation	SNP	pfam_Cleavage/polyA-sp_fac_asu_C,superfamily_WD40_repeat_dom	p.S242L	ENST00000302516.5	37	c.725	CCDS10894.1	16	.	.	.	.	.	.	.	.	.	.	C	20.8	4.049774	0.75846	.	.	ENSG00000189091	ENST00000302516;ENST00000310750	T	0.32023	1.47	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.32194	0.0821	L	0.42245	1.32	0.80722	D	1	B	0.19706	0.038	B	0.29524	0.103	T	0.08146	-1.0736	10	0.35671	T	0.21	.	17.9306	0.88996	0.0:1.0:0.0:0.0	.	242	Q15393	SF3B3_HUMAN	L	242	ENSP00000305790:S242L	ENSP00000305790:S242L	S	+	2	0	SF3B3	69126724	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.818000	0.86416	2.236000	0.73375	0.484000	0.47621	TCA	SF3B3	-	NULL	ENSG00000189091		0.443	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B3	HGNC	protein_coding	OTTHUMT00000268972.1	297	0.00	0	C	NM_012426		70569223	70569223	+1	no_errors	ENST00000302516	ensembl	human	known	69_37n	missense	180	13.46	28	SNP	1.000	T
SHROOM3	57619	genome.wustl.edu	37	4	77476816	77476816	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr4:77476816G>A	ENST00000296043.6	+	2	1176	c.223G>A	c.(223-225)Gag>Aag	p.E75K		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	75	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			GGCTGGGGATGAGGTTGTGCA	0.572																																						dbGAP											0													118.0	111.0	113.0					4																	77476816		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.223G>A	4.37:g.77476816G>A	ENSP00000296043:p.Glu75Lys		Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Missense_Mutation	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E75K	ENST00000296043.6	37	c.223	CCDS3579.2	4	.	.	.	.	.	.	.	.	.	.	G	17.59	3.427691	0.62733	.	.	ENSG00000138771	ENST00000296043	T	0.23950	1.88	4.69	4.69	0.59074	PDZ/DHR/GLGF (4);	0.701890	0.12516	N	0.462041	T	0.47911	0.1471	L	0.55834	1.745	0.42558	D	0.993138	D	0.76494	0.999	D	0.68765	0.96	T	0.44467	-0.9326	10	0.87932	D	0	-18.0268	16.6915	0.85323	0.0:0.0:1.0:0.0	.	75	Q8TF72	SHRM3_HUMAN	K	75	ENSP00000296043:E75K	ENSP00000296043:E75K	E	+	1	0	SHROOM3	77695840	1.000000	0.71417	0.975000	0.42487	0.489000	0.33432	7.448000	0.80631	2.532000	0.85374	0.467000	0.42956	GAG	SHROOM3	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000138771		0.572	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM3	HGNC	protein_coding	OTTHUMT00000252408.2	226	0.00	0	G	NM_020859		77476816	77476816	+1	no_errors	ENST00000296043	ensembl	human	known	69_37n	missense	156	35.39	86	SNP	1.000	A
SHROOM3	57619	genome.wustl.edu	37	4	77676338	77676338	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr4:77676338C>T	ENST00000296043.6	+	7	5655	c.4702C>T	c.(4702-4704)Cgc>Tgc	p.R1568C	RP11-359D14.2_ENST00000452412.1_RNA	NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	1568					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			CGAGGGGCCACGCCCCAGGTG	0.612																																						dbGAP											0													32.0	33.0	32.0					4																	77676338		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.4702C>T	4.37:g.77676338C>T	ENSP00000296043:p.Arg1568Cys		Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Missense_Mutation	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.R1568C	ENST00000296043.6	37	c.4702	CCDS3579.2	4	.	.	.	.	.	.	.	.	.	.	c	11.13	1.548573	0.27652	.	.	ENSG00000138771	ENST00000296043;ENST00000264907	T	0.20200	2.09	5.11	-4.99	0.03010	.	4.253390	0.00166	N	0.000006	T	0.15522	0.0374	L	0.44542	1.39	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.19745	-1.0296	10	0.52906	T	0.07	2.6384	1.2068	0.01896	0.2111:0.1261:0.3119:0.3509	.	1568	Q8TF72	SHRM3_HUMAN	C	1568;45	ENSP00000296043:R1568C	ENSP00000264907:R45C	R	+	1	0	SHROOM3	77895362	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.260000	0.02858	-1.040000	0.03271	-0.801000	0.03215	CGC	SHROOM3	-	NULL	ENSG00000138771		0.612	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM3	HGNC	protein_coding	OTTHUMT00000252408.2	78	0.00	0	C	NM_020859		77676338	77676338	+1	no_errors	ENST00000296043	ensembl	human	known	69_37n	missense	92	20.69	24	SNP	0.000	T
SLC17A6	57084	genome.wustl.edu	37	11	22391723	22391723	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr11:22391723G>A	ENST00000263160.3	+	8	1467	c.1030G>A	c.(1030-1032)Gaa>Aaa	p.E344K		NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	344					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						CTTTGGATTTGAAATTAGCAA	0.294																																						dbGAP											0													56.0	60.0	59.0					11																	22391723		2203	4296	6499	-	-	-	SO:0001583	missense	0			AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.1030G>A	11.37:g.22391723G>A	ENSP00000263160:p.Glu344Lys		A6NKS2	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.E344K	ENST00000263160.3	37	c.1030	CCDS7856.1	11	.	.	.	.	.	.	.	.	.	.	G	16.29	3.081844	0.55861	.	.	ENSG00000091664	ENST00000263160;ENST00000546171	T	0.58797	0.31	5.42	5.42	0.78866	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.52240	0.1722	L	0.38692	1.165	0.80722	D	1	B	0.16603	0.018	B	0.25405	0.06	T	0.41910	-0.9482	10	0.27785	T	0.31	.	19.5581	0.95361	0.0:0.0:1.0:0.0	.	344	Q9P2U8	VGLU2_HUMAN	K	344;232	ENSP00000263160:E344K	ENSP00000263160:E344K	E	+	1	0	SLC17A6	22348299	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.813000	0.99286	2.702000	0.92279	0.591000	0.81541	GAA	SLC17A6	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000091664		0.294	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A6	HGNC	protein_coding	OTTHUMT00000387671.1	178	0.00	0	G	NM_020346		22391723	22391723	+1	no_errors	ENST00000263160	ensembl	human	known	69_37n	missense	73	19.78	18	SNP	1.000	A
SMAD2	4087	genome.wustl.edu	37	18	45372102	45372102	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr18:45372102A>C	ENST00000402690.2	-	9	1461	c.1067T>G	c.(1066-1068)tTt>tGt	p.F356C	SMAD2_ENST00000262160.6_Missense_Mutation_p.F356C|SMAD2_ENST00000591214.1_Missense_Mutation_p.F326C|SMAD2_ENST00000356825.4_Missense_Mutation_p.F326C|SMAD2_ENST00000586040.1_Missense_Mutation_p.F326C	NM_001003652.3	NP_001003652.1	Q15796	SMAD2_HUMAN	SMAD family member 2	356	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.		Missing (in a colorectal carcinoma sample). {ECO:0000269|PubMed:8673135}.		activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|cell fate commitment (GO:0045165)|common-partner SMAD protein phosphorylation (GO:0007182)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|endoderm formation (GO:0001706)|gastrulation (GO:0007369)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|insulin secretion (GO:0030073)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|mesoderm formation (GO:0001707)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|nodal signaling pathway (GO:0038092)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900224)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primary miRNA processing (GO:0031053)|regulation of binding (GO:0051098)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to cholesterol (GO:0070723)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|zygotic specification of dorsal/ventral axis (GO:0007352)	activin responsive factor complex (GO:0032444)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|phosphatase binding (GO:0019902)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(21)|liver(1)|lung(8)|prostate(2)|urinary_tract(1)	43						GCTCTGCACAAAGATTGCACT	0.403																																						dbGAP											0													109.0	104.0	105.0					18																	45372102		2203	4300	6503	-	-	-	SO:0001583	missense	0			U65019	CCDS11934.1	18q21	2006-11-06	2006-11-06	2004-05-26	ENSG00000175387	ENSG00000175387		"""SMADs"""	6768	protein-coding gene	gene with protein product		601366	"""MAD, mothers against decapentaplegic homolog 2 (Drosophila)"", ""SMAD, mothers against DPP homolog 2 (Drosophila)"""	MADH2		8752209, 8673135	Standard	NM_001003652		Approved	MADR2, JV18-1	uc002lcz.4	Q15796	OTTHUMG00000132652	ENST00000402690.2:c.1067T>G	18.37:g.45372102A>C	ENSP00000384449:p.Phe356Cys			Missense_Mutation	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.F356C	ENST00000402690.2	37	c.1067	CCDS11934.1	18	.	.	.	.	.	.	.	.	.	.	A	25.6	4.650968	0.87958	.	.	ENSG00000175387	ENST00000262160;ENST00000356825;ENST00000402690	D;D;D	0.99245	-5.62;-5.62;-5.62	6.05	6.05	0.98169	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.043899	0.85682	D	0.000000	D	0.99632	0.9865	H	0.96239	3.79	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.91635	0.999;0.982;0.999	D	0.97688	1.0177	10	0.87932	D	0	.	16.5932	0.84781	1.0:0.0:0.0:0.0	.	326;326;356	B7Z5N5;Q15796-2;Q15796	.;.;SMAD2_HUMAN	C	356;326;356	ENSP00000262160:F356C;ENSP00000349282:F326C;ENSP00000384449:F356C	ENSP00000262160:F356C	F	-	2	0	SMAD2	43626100	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.320000	0.78422	0.528000	0.53228	TTT	SMAD2	-	pfam_SMAD_dom_Dwarfin-type,pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain,smart_SMAD_dom_Dwarfin-type,pfscan_SMAD_dom_Dwarfin-type	ENSG00000175387		0.403	SMAD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD2	HGNC	protein_coding	OTTHUMT00000450571.1	351	0.00	0	A	NM_005901		45372102	45372102	-1	no_errors	ENST00000262160	ensembl	human	known	69_37n	missense	100	52.38	110	SNP	1.000	C
SMAD3	4088	genome.wustl.edu	37	15	67457304	67457304	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr15:67457304G>A	ENST00000327367.4	+	2	588	c.278G>A	c.(277-279)cGa>cAa	p.R93Q	SMAD3_ENST00000540846.2_De_novo_Start_OutOfFrame|SMAD3_ENST00000439724.3_Missense_Mutation_p.R49Q|SMAD3_ENST00000537194.2_5'Flank|SMAD3_ENST00000559092.1_Missense_Mutation_p.D75N	NM_005902.3	NP_005893.1	P84022	SMAD3_HUMAN	SMAD family member 3	93	MH1. {ECO:0000255|PROSITE- ProRule:PRU00438}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell-cell junction organization (GO:0045216)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|embryonic pattern specification (GO:0009880)|endoderm development (GO:0007492)|evasion or tolerance of host defenses by virus (GO:0019049)|extrinsic apoptotic signaling pathway (GO:0097191)|gene expression (GO:0010467)|heart looping (GO:0001947)|immune response (GO:0006955)|immune system development (GO:0002520)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|lens fiber cell differentiation (GO:0070306)|liver development (GO:0001889)|mesoderm formation (GO:0001707)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)|nodal signaling pathway (GO:0038092)|osteoblast development (GO:0002076)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta3 production (GO:0032916)|primary miRNA processing (GO:0031053)|protein stabilization (GO:0050821)|regulation of binding (GO:0051098)|regulation of epithelial cell proliferation (GO:0050678)|regulation of immune response (GO:0050776)|regulation of striated muscle tissue development (GO:0016202)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|somitogenesis (GO:0001756)|T cell activation (GO:0042110)|thyroid gland development (GO:0030878)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transdifferentiation (GO:0060290)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transport (GO:0006810)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nuclear inner membrane (GO:0005637)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|bHLH transcription factor binding (GO:0043425)|chromatin DNA binding (GO:0031490)|co-SMAD binding (GO:0070410)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(11)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(7;0.125)		CGCCTGTGGCGATGGCCAGAC	0.612																																						dbGAP											0													102.0	109.0	107.0					15																	67457304		2201	4299	6500	-	-	-	SO:0001583	missense	0			BC050743	CCDS10222.1, CCDS45288.1, CCDS53950.1, CCDS53951.1	15q21-q22	2006-11-06	2006-11-06	2004-05-26	ENSG00000166949	ENSG00000166949		"""SMADs"""	6769	protein-coding gene	gene with protein product		603109	"""MAD, mothers against decapentaplegic homolog 3 (Drosophila)"", ""SMAD, mothers against DPP homolog 3 (Drosophila)"""	MADH3		8774881, 8673135	Standard	NM_001145102		Approved	JV15-2, HsT17436	uc002aqj.3	P84022	OTTHUMG00000133230	ENST00000327367.4:c.278G>A	15.37:g.67457304G>A	ENSP00000332973:p.Arg93Gln		A8K4B6|B7Z4Z5|B7Z6M9|B7Z9Q2|F5H383|O09064|O09144|O14510|O35273|Q92940|Q93002|Q9GKR4	Missense_Mutation	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.R93Q	ENST00000327367.4	37	c.278	CCDS10222.1	15	.	.	.	.	.	.	.	.	.	.	G	17.11	3.306488	0.60305	.	.	ENSG00000166949	ENST00000327367;ENST00000535241;ENST00000439724	T;T	0.80393	-1.37;-1.37	4.39	4.39	0.52855	MAD homology, MH1 (3);MAD homology 1, Dwarfin-type (2);	0.000000	0.85682	D	0.000000	D	0.93429	0.7904	H	0.97365	3.99	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95951	0.8954	10	0.87932	D	0	.	17.1514	0.86779	0.0:0.0:1.0:0.0	.	49;93	B7Z4Z5;P84022	.;SMAD3_HUMAN	Q	93;93;49	ENSP00000332973:R93Q;ENSP00000401133:R49Q	ENSP00000332973:R93Q	R	+	2	0	SMAD3	65244358	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.421000	0.97455	2.270000	0.75569	0.561000	0.74099	CGA	SMAD3	-	pfam_MAD_homology1_Dwarfin-type,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,pfscan_MAD_homology_MH1	ENSG00000166949		0.612	SMAD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD3	HGNC	protein_coding	OTTHUMT00000256967.2	61	0.00	0	G	NM_005902		67457304	67457304	+1	no_errors	ENST00000327367	ensembl	human	known	69_37n	missense	30	47.37	27	SNP	1.000	A
SNAI3	333929	genome.wustl.edu	37	16	88747605	88747605	+	Silent	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr16:88747605G>A	ENST00000332281.5	-	2	680	c.594C>T	c.(592-594)ctC>ctT	p.L198L	SNAI3-AS1_ENST00000563261.1_RNA	NM_178310.3	NP_840101.1	Q3KNW1	SNAI3_HUMAN	snail family zinc finger 3	198					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	copper ion binding (GO:0005507)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(1)|kidney(1)|lung(1)|ovary(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(80;0.048)		TGTGCATCTTGAGGGCACCCA	0.642																																					Colon(27;366 710 19748 23199 27567)	dbGAP											0													116.0	104.0	108.0					16																	88747605		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			BC041461	CCDS32505.1	16q24.3	2013-05-23	2013-05-23			ENSG00000185669		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	18411	protein-coding gene	gene with protein product		612741	"""zinc finger protein 293"", ""snail homolog 3 (Drosophila)"""	ZNF293		12579345	Standard	NM_178310		Approved	SMUC, Zfp293	uc002flj.3	Q3KNW1		ENST00000332281.5:c.594C>T	16.37:g.88747605G>A			Q86SU5	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L198	ENST00000332281.5	37	c.594	CCDS32505.1	16																																																																																			SNAI3	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000185669		0.642	SNAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAI3	HGNC	protein_coding	OTTHUMT00000422582.1	105	0.00	0	G			88747605	88747605	-1	no_errors	ENST00000332281	ensembl	human	known	69_37n	silent	76	36.13	43	SNP	1.000	A
SNX7	51375	genome.wustl.edu	37	1	99150448	99150448	+	Nonsense_Mutation	SNP	C	C	G	rs201226939		TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr1:99150448C>G	ENST00000306121.3	+	2	197	c.188C>G	c.(187-189)tCa>tGa	p.S63*	SNX7_ENST00000529992.1_Nonsense_Mutation_p.S63*|SNX7_ENST00000370189.5_5'UTR	NM_015976.4	NP_057060.2	Q9UNH6	SNX7_HUMAN	sorting nexin 7	201	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				apoptotic process (GO:0006915)|intracellular protein transport (GO:0006886)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	13		all_epithelial(167;7.64e-07)|all_lung(203;0.0006)|Lung NSC(277;0.00137)		Epithelial(280;0.0521)|all cancers(265;0.0687)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.207)|Colorectal(170;0.234)		TAGGATGCCTCATTGATGGAC	0.308																																						dbGAP											0													100.0	92.0	95.0					1																	99150448		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF121857	CCDS755.2, CCDS756.1, CCDS756.2	1p21	2008-05-22			ENSG00000162627	ENSG00000162627		"""Sorting nexins"""	14971	protein-coding gene	gene with protein product		614904					Standard	NM_015976		Approved		uc010ouc.2	Q9UNH6	OTTHUMG00000010723	ENST00000306121.3:c.188C>G	1.37:g.99150448C>G	ENSP00000304429:p.Ser63*		A8KAF3|D3DT50|Q53FQ3|Q5VT09|Q5VT10|Q86U82|Q8WVD4|Q96FW9|Q9Y3Z7	Nonsense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.S63*	ENST00000306121.3	37	c.188	CCDS755.2	1	.	.	.	.	.	.	.	.	.	.	C	31	5.083251	0.94050	.	.	ENSG00000162627	ENST00000529992;ENST00000306121	.	.	.	5.39	5.39	0.77823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	19.1723	0.93583	0.0:1.0:0.0:0.0	.	.	.	.	X	63	.	ENSP00000304429:S63X	S	+	2	0	SNX7	98923036	1.000000	0.71417	0.943000	0.38184	0.974000	0.67602	6.493000	0.73658	2.533000	0.85409	0.650000	0.86243	TCA	SNX7	-	NULL	ENSG00000162627		0.308	SNX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX7	HGNC	protein_coding	OTTHUMT00000029609.2	348	0.00	0	C			99150448	99150448	+1	no_errors	ENST00000306121	ensembl	human	known	69_37n	nonsense	181	18.47	41	SNP	0.996	G
SPARCL1	8404	genome.wustl.edu	37	4	88415072	88415072	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr4:88415072G>A	ENST00000282470.6	-	4	1350	c.880C>T	c.(880-882)Cag>Tag	p.Q294*	SPARCL1_ENST00000418378.1_Nonsense_Mutation_p.Q294*|SPARCL1_ENST00000503414.1_Nonsense_Mutation_p.Q169*	NM_004684.4	NP_004675.3	Q14515	SPRL1_HUMAN	SPARC-like 1 (hevin)	294					signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(2)|stomach(2)	21				OV - Ovarian serous cystadenocarcinoma(123;0.00118)		TCTTGACTCTGCCATTCAGTT	0.418																																						dbGAP											0													319.0	309.0	313.0					4																	88415072		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X86693	CCDS3622.1	4q22-q25	2013-01-10	2008-08-29		ENSG00000152583	ENSG00000152583		"""EF-hand domain containing"""	11220	protein-coding gene	gene with protein product		606041	"""SPARC-like 1 (mast9, hevin)"""			8488563, 7600298, 16844696	Standard	NM_001128310		Approved	MAST9	uc003hqs.4	Q14515	OTTHUMG00000130605	ENST00000282470.6:c.880C>T	4.37:g.88415072G>A	ENSP00000282470:p.Gln294*		B4E2Z0|E7ESU2|Q14800	Nonsense_Mutation	SNP	pfam_SPARC/Testican_Ca-bd-dom,pfam_Prot_inh_Kazal,pfam_Kazal-type_dom,pfam_Follistatin/Osteonectin_EGF,smart_Fol_N,smart_Prot_inh_Kazal,pirsf_SPARC-like_p1,pfscan_EF_HAND_2	p.Q294*	ENST00000282470.6	37	c.880	CCDS3622.1	4	.	.	.	.	.	.	.	.	.	.	G	32	5.153313	0.94645	.	.	ENSG00000152583	ENST00000282470;ENST00000418378;ENST00000438050;ENST00000503414	.	.	.	4.98	4.98	0.66077	.	0.858067	0.10560	N	0.660459	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-4.1037	14.4801	0.67576	0.0:0.0:1.0:0.0	.	.	.	.	X	294;294;169;169	.	ENSP00000282470:Q294X	Q	-	1	0	SPARCL1	88634096	1.000000	0.71417	0.317000	0.25265	0.002000	0.02628	5.127000	0.64727	2.689000	0.91719	0.655000	0.94253	CAG	SPARCL1	-	pirsf_SPARC-like_p1	ENSG00000152583		0.418	SPARCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPARCL1	HGNC	protein_coding	OTTHUMT00000253059.2	680	0.00	0	G			88415072	88415072	-1	no_errors	ENST00000282470	ensembl	human	known	69_37n	nonsense	530	18.81	123	SNP	0.514	A
SPINT3	10816	genome.wustl.edu	37	20	44141314	44141314	+	Nonsense_Mutation	SNP	C	C	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr20:44141314C>A	ENST00000217428.6	-	2	262	c.247G>T	c.(247-249)Gag>Tag	p.E83*		NM_006652.1	NP_006643.1	P49223	SPIT3_HUMAN	serine peptidase inhibitor, Kunitz type, 3	83	BPTI/Kunitz inhibitor. {ECO:0000255|PROSITE-ProRule:PRU00031}.					extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)	1						CAGAATTTCTCACATTTTTCT	0.448																																						dbGAP											0													110.0	95.0	100.0					20																	44141314		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			X77166	CCDS46608.1	20q12-q13.2	2012-08-20	2005-08-17		ENSG00000101446	ENSG00000101446			11248	protein-coding gene	gene with protein product		613941	"""serine protease inhibitor, Kunitz type, 3"""			21988899	Standard	NM_006652		Approved	HKIB9	uc010ghg.1	P49223	OTTHUMG00000032585	ENST00000217428.6:c.247G>T	20.37:g.44141314C>A	ENSP00000217428:p.Glu83*		A6NCQ6|Q6UDR8|Q96KK2	Nonsense_Mutation	SNP	pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	p.E83*	ENST00000217428.6	37	c.247	CCDS46608.1	20	.	.	.	.	.	.	.	.	.	.	C	5.652	0.304986	0.10678	.	.	ENSG00000101446	ENST00000217428	.	.	.	3.25	-4.63	0.03359	.	.	.	.	.	.	.	.	.	.	.	0.39656	D	0.970544	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.9517	0.19250	0.0:0.3107:0.4257:0.2635	.	.	.	.	X	83	.	ENSP00000217428:E83X	E	-	1	0	SPINT3	43574728	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.055000	0.11807	-0.633000	0.05545	0.467000	0.42956	GAG	SPINT3	-	pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	ENSG00000101446		0.448	SPINT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPINT3	HGNC	protein_coding	OTTHUMT00000079464.5	245	0.41	1	C	NM_006652		44141314	44141314	-1	no_errors	ENST00000217428	ensembl	human	known	69_37n	nonsense	189	18.53	43	SNP	0.001	A
SZRD1	26099	genome.wustl.edu	37	1	16719813	16719813	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr1:16719813G>C	ENST00000401088.4	+	3	367	c.192G>C	c.(190-192)aaG>aaC	p.K64N	SZRD1_ENST00000471507.1_Missense_Mutation_p.K63N|SPATA21_ENST00000466212.1_5'Flank|SZRD1_ENST00000375590.3_Missense_Mutation_p.K44N|SZRD1_ENST00000401089.3_Missense_Mutation_p.K45N|SZRD1_ENST00000492354.1_Missense_Mutation_p.K44N|SZRD1_ENST00000472461.1_3'UTR	NM_001114600.1|NM_001271869.1	NP_001108072.1|NP_001258798.1	Q7Z422	SZRD1_HUMAN	SUZ RNA binding domain containing 1	64	SUZ. {ECO:0000255|PROSITE- ProRule:PRU01009}.																GCATCCTCAAGAGGCCCACCA	0.607																																						dbGAP											0													53.0	60.0	58.0					1																	16719813		2048	4174	6222	-	-	-	SO:0001583	missense	0			BC010631	CCDS44065.1, CCDS60000.1	1p36.13	2012-07-23	2012-07-23	2012-07-23	ENSG00000055070	ENSG00000055070			30232	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 144"""	C1orf144		12761501	Standard	NM_001114600		Approved	DKFZp566C0424	uc001aym.5	Q7Z422	OTTHUMG00000002217	ENST00000401088.4:c.192G>C	1.37:g.16719813G>C	ENSP00000383866:p.Lys64Asn		A8MXJ2|C9K0U0|Q7Z424|Q8IVM2|Q8TBV3|Q9Y403	Missense_Mutation	SNP	NULL	p.K44N	ENST00000401088.4	37	c.132	CCDS44065.1	1	.	.	.	.	.	.	.	.	.	.	G	19.72	3.879404	0.72294	.	.	ENSG00000055070	ENST00000401088;ENST00000471507;ENST00000401089;ENST00000434120;ENST00000375590;ENST00000492354	T;T;T;T;T	0.56275	0.47;0.47;0.47;0.47;0.47	4.98	4.05	0.47172	SUZ domain (1);	0.000000	0.85682	D	0.000000	T	0.71230	0.3315	M	0.82323	2.585	0.80722	D	1	D;D;D;D	0.89917	0.999;0.997;1.0;1.0	D;D;D;D	0.87578	0.996;0.995;0.998;0.996	T	0.74737	-0.3564	10	0.87932	D	0	-26.7841	9.868	0.41157	0.1618:0.0:0.8382:0.0	.	44;64;44;45	F8WEE8;Q7Z422;Q7Z422-2;Q7Z422-4	.;CA144_HUMAN;.;.	N	64;63;45;64;44;44	ENSP00000383866:K64N;ENSP00000419589:K63N;ENSP00000383867:K45N;ENSP00000364740:K44N;ENSP00000418012:K44N	ENSP00000364740:K44N	K	+	3	2	C1orf144	16592400	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.761000	0.62243	2.455000	0.83008	0.561000	0.74099	AAG	SZRD1	-	NULL	ENSG00000055070		0.607	SZRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SZRD1	HGNC	protein_coding	OTTHUMT00000006283.2	95	0.00	0	G	NM_015609		16719813	16719813	+1	no_errors	ENST00000375590	ensembl	human	known	69_37n	missense	67	18.29	15	SNP	1.000	C
SPRR2F	6705	genome.wustl.edu	37	1	153085068	153085068	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr1:153085068G>A	ENST00000468739.1	-	2	202	c.142C>T	c.(142-144)Cag>Tag	p.Q48*	SPRR2B_ENST00000368752.4_Intron	NM_001014450.1	NP_001014450.1	Q96RM1	SPR2F_HUMAN	small proline-rich protein 2F	48					epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)				large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	4	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			TGGCACTGCTGAGGTGGGCAG	0.602																																						dbGAP											0													258.0	228.0	238.0					1																	153085068		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF333956	CCDS30867.1	1q21-q22	2008-02-05			ENSG00000244094	ENSG00000244094			11266	protein-coding gene	gene with protein product						8325635, 11279051	Standard	NM_001014450		Approved		uc001fbi.3	Q96RM1	OTTHUMG00000014398	ENST00000468739.1:c.142C>T	1.37:g.153085068G>A	ENSP00000418193:p.Gln48*		Q5T9T3	Nonsense_Mutation	SNP	NULL	p.Q48*	ENST00000468739.1	37	c.142	CCDS30867.1	1	.	.	.	.	.	.	.	.	.	.	G	14.03	2.412509	0.42817	.	.	ENSG00000244094	ENST00000468739	.	.	.	3.68	3.68	0.42216	.	3.855070	0.01056	N	0.004556	.	.	.	.	.	.	0.22412	N	0.999122	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	10.7908	0.46432	0.0:0.0:1.0:0.0	.	.	.	.	X	48	.	ENSP00000418193:Q48X	Q	-	1	0	SPRR2F	151351692	0.002000	0.14202	0.006000	0.13384	0.552000	0.35366	1.063000	0.30567	1.886000	0.54624	0.306000	0.20318	CAG	SPRR2F	-	NULL	ENSG00000244094		0.602	SPRR2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRR2F	HGNC	protein_coding	OTTHUMT00000040056.1	541	0.00	0	G			153085068	153085068	-1	no_errors	ENST00000468739	ensembl	human	known	69_37n	nonsense	498	34.69	265	SNP	0.007	A
TAF1B	9014	genome.wustl.edu	37	2	10050972	10050972	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr2:10050972G>A	ENST00000263663.5	+	10	1251	c.1063G>A	c.(1063-1065)Gat>Aat	p.D355N	TAF1B_ENST00000396242.3_Missense_Mutation_p.D100N	NM_005680.2	NP_005671	Q53T94	TAF1B_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	355	C-terminal cyclin fold.				gene expression (GO:0010467)|RNA polymerase I transcriptional preinitiation complex assembly at the promoter for the nuclear large rRNA transcript (GO:0001189)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I core factor complex (GO:0070860)	metal ion binding (GO:0046872)|RNA polymerase I CORE element sequence-specific DNA binding (GO:0001164)|RNA polymerase I CORE element sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001187)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TBP-class protein binding (GO:0017025)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TGTTAAGTACGATGTACAAGC	0.378																																						dbGAP											0													191.0	155.0	167.0					2																	10050972		2203	4300	6503	-	-	-	SO:0001583	missense	0			L39061	CCDS33143.1	2p25	2008-06-02	2002-08-29		ENSG00000115750	ENSG00000115750			11533	protein-coding gene	gene with protein product		604904	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kD"""			7801123	Standard	NM_005680		Approved	TAFI63, SL1, RAF1B, RAFI63	uc002qzz.3	Q53T94	OTTHUMG00000151673	ENST00000263663.5:c.1063G>A	2.37:g.10050972G>A	ENSP00000263663:p.Asp355Asn		B4DI42|F8WD72|Q15574|Q8WVC3	Missense_Mutation	SNP	pfam_TF_Rrn7	p.D355N	ENST00000263663.5	37	c.1063	CCDS33143.1	2	.	.	.	.	.	.	.	.	.	.	G	26.0	4.694736	0.88830	.	.	ENSG00000115750	ENST00000263663;ENST00000396242	T;T	0.03358	3.96;3.96	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.20861	0.0502	M	0.77616	2.38	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.00043	-1.2226	9	.	.	.	-29.9435	20.0566	0.97653	0.0:0.0:1.0:0.0	.	355;355	Q53T94;Q53T94-2	TAF1B_HUMAN;.	N	355;100	ENSP00000263663:D355N;ENSP00000379542:D100N	.	D	+	1	0	TAF1B	9968423	1.000000	0.71417	0.640000	0.29408	0.793000	0.44817	6.778000	0.75043	2.750000	0.94351	0.467000	0.42956	GAT	TAF1B	-	NULL	ENSG00000115750		0.378	TAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1B	HGNC	protein_coding	OTTHUMT00000323426.2	453	0.00	0	G	NM_005680		10050972	10050972	+1	no_errors	ENST00000263663	ensembl	human	known	69_37n	missense	265	17.19	55	SNP	1.000	A
TACR1	6869	genome.wustl.edu	37	2	75280858	75280858	+	Silent	SNP	C	C	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr2:75280858C>A	ENST00000305249.5	-	3	1374	c.609G>T	c.(607-609)ctG>ctT	p.L203L	TACR1_ENST00000409848.3_Silent_p.L203L	NM_001058.3	NP_001049.1	P25103	NK1R_HUMAN	tachykinin receptor 1	203					acute inflammatory response (GO:0002526)|aggressive behavior (GO:0002118)|angiotensin-mediated drinking behavior (GO:0003051)|associative learning (GO:0008306)|behavioral response to pain (GO:0048266)|detection of abiotic stimulus (GO:0009582)|eating behavior (GO:0042755)|inflammatory response (GO:0006954)|long-term memory (GO:0007616)|operant conditioning (GO:0035106)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of action potential (GO:0045760)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of hormone secretion (GO:0046887)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of ossification (GO:0045778)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of saliva secretion (GO:0046878)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of uterine smooth muscle contraction (GO:0070474)|positive regulation of vascular permeability (GO:0043117)|positive regulation of vasoconstriction (GO:0045907)|regulation of smooth muscle cell migration (GO:0014910)|regulation of smooth muscle cell proliferation (GO:0048660)|response to auditory stimulus (GO:0010996)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to heat (GO:0009408)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to ozone (GO:0010193)|response to progesterone (GO:0032570)|smooth muscle contraction involved in micturition (GO:0060083)|sperm ejaculation (GO:0042713)|tachykinin receptor signaling pathway (GO:0007217)	cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	substance P receptor activity (GO:0016496)|tachykinin receptor activity (GO:0004995)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(8)|ovary(1)|skin(1)	24					Aprepitant(DB00673)|Ketamine(DB01221)|Vapreotide(DB04894)	GGAAGTAGATCAGCACAGTCA	0.448											OREG0014726	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Pancreas(64;62 1268 3653 14826 43765)	dbGAP											0													101.0	88.0	92.0					2																	75280858		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M76675	CCDS1958.1, CCDS46345.1	2p13.1-p12	2012-08-08			ENSG00000115353	ENSG00000115353		"""GPCR / Class A : Tachykinin receptors"""	11526	protein-coding gene	gene with protein product		162323		TAC1R		1657150	Standard	NM_001058		Approved	SPR, NK1R, NKIR	uc002sng.2	P25103	OTTHUMG00000129973	ENST00000305249.5:c.609G>T	2.37:g.75280858C>A		1159	A8K150	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_NK1_rcpt,prints_Neurokn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt,prints_NK3_rcpt	p.L203	ENST00000305249.5	37	c.609	CCDS1958.1	2																																																																																			TACR1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Neurokn_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000115353		0.448	TACR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TACR1	HGNC	protein_coding	OTTHUMT00000252239.3	251	0.00	0	C	NM_001058		75280858	75280858	-1	no_errors	ENST00000305249	ensembl	human	known	69_37n	silent	156	20.41	40	SNP	1.000	A
TARS	6897	genome.wustl.edu	37	5	33459816	33459816	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr5:33459816G>A	ENST00000265112.3	+	11	1411	c.1100G>A	c.(1099-1101)aGa>aAa	p.R367K	TARS_ENST00000455217.2_Missense_Mutation_p.R400K|TARS_ENST00000414361.2_Missense_Mutation_p.R246K|TARS_ENST00000541634.1_Missense_Mutation_p.R263K|TARS_ENST00000502553.1_Missense_Mutation_p.R367K	NM_152295.4	NP_689508.3	P26639	SYTC_HUMAN	threonyl-tRNA synthetase	367					gene expression (GO:0010467)|threonyl-tRNA aminoacylation (GO:0006435)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|threonine-tRNA ligase activity (GO:0004829)			NS(1)|biliary_tract(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)	29					L-Threonine(DB00156)	TATAGGAAAAGAGGATTCCAG	0.423																																						dbGAP											0													72.0	76.0	74.0					5																	33459816		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095852	CCDS3899.1, CCDS58943.1	5p13.2	2012-10-02			ENSG00000113407	ENSG00000113407	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	11572	protein-coding gene	gene with protein product	"""threonine tRNA ligase 1, cytoplasmic"""	187790					Standard	NM_152295		Approved		uc011coc.3	P26639	OTTHUMG00000090683	ENST00000265112.3:c.1100G>A	5.37:g.33459816G>A	ENSP00000265112:p.Arg367Lys		A8K8I1|B4DEG8|Q96FP5|Q9BWA6	Missense_Mutation	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_TGS,pfam_tRNA_SAD,superfamily_Thr/Ala-tRNA-synth_IIc_edit,superfamily_Anticodon-bd,superfamily_TGS-like,smart_tRNA_SAD,prints_Thr-tRNA-synth_IIa,pfscan_aa-tRNA-synth_II,tigrfam_Thr-tRNA-synth_IIa	p.R367K	ENST00000265112.3	37	c.1100	CCDS3899.1	5	.	.	.	.	.	.	.	.	.	.	G	36	5.733823	0.96865	.	.	ENSG00000113407	ENST00000502553;ENST00000265112;ENST00000541634;ENST00000455217;ENST00000414361	T;T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26;-0.26	5.9	5.9	0.94986	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.000000	0.85682	D	0.000000	D	0.87748	0.6255	H	0.94183	3.505	0.80722	D	1	D;D;D;D	0.89917	0.985;1.0;0.994;1.0	P;D;D;D	0.81914	0.887;0.995;0.944;0.995	D	0.89978	0.4098	10	0.72032	D	0.01	-5.9832	20.2822	0.98520	0.0:0.0:1.0:0.0	.	246;400;263;367	E7ERI3;B4DEG8;G3XAN9;P26639	.;.;.;SYTC_HUMAN	K	367;367;263;400;246	ENSP00000424387:R367K;ENSP00000265112:R367K;ENSP00000438469:R263K;ENSP00000387710:R400K;ENSP00000394291:R246K	ENSP00000265112:R367K	R	+	2	0	TARS	33495573	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	8.031000	0.88826	2.806000	0.96561	0.655000	0.94253	AGA	TARS	-	pfam_aa-tRNA-synt_IIb_cons-dom,pfscan_aa-tRNA-synth_II,tigrfam_Thr-tRNA-synth_IIa	ENSG00000113407		0.423	TARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARS	HGNC	protein_coding	OTTHUMT00000207367.1	185	0.00	0	G	NM_152295		33459816	33459816	+1	no_errors	ENST00000265112	ensembl	human	known	69_37n	missense	123	25.45	42	SNP	1.000	A
TEAD1	7003	genome.wustl.edu	37	11	12785961	12785961	+	Nonsense_Mutation	SNP	C	C	G			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr11:12785961C>G	ENST00000527575.1	+	2	295	c.182C>G	c.(181-183)tCa>tGa	p.S61*	TEAD1_ENST00000334310.6_Nonsense_Mutation_p.S46*|TEAD1_ENST00000361905.4_Nonsense_Mutation_p.S46*|TEAD1_ENST00000361985.2_Nonsense_Mutation_p.S61*|TEAD1_ENST00000527636.1_Nonsense_Mutation_p.S61*			P28347	TEAD1_HUMAN	TEA domain family member 1 (SV40 transcriptional enhancer factor)	61					gene expression (GO:0010467)|hippo signaling (GO:0035329)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)	17				Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)		ATCATCTTATCAGACGAAGGC	0.493																																						dbGAP											0													95.0	93.0	94.0					11																	12785961		2200	4294	6494	-	-	-	SO:0001587	stop_gained	0			X84839	CCDS7810.1, CCDS7810.2	11p15.4	2008-11-12				ENSG00000187079			11714	protein-coding gene	gene with protein product		189967	"""atrophia areata, peripapillary chorioretinal degeneration"""	TCF13, AA		1851669, 9889009, 15016762	Standard	NM_021961		Approved	TEF-1	uc021qdx.1	P28347		ENST00000527575.1:c.182C>G	11.37:g.12785961C>G	ENSP00000435977:p.Ser61*		A4FUP2|E7EV65	Nonsense_Mutation	SNP	pfam_TEA/ATTS,smart_TEA/ATTS,pirsf_TEF,pfscan_TEA/ATTS,prints_TEA/ATTS	p.S46*	ENST00000527575.1	37	c.137		11	.	.	.	.	.	.	.	.	.	.	C	35	5.557235	0.96514	.	.	ENSG00000187079	ENST00000361905;ENST00000527636;ENST00000527376;ENST00000527575;ENST00000334310;ENST00000361985	.	.	.	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-5.4997	19.3895	0.94574	0.0:1.0:0.0:0.0	.	.	.	.	X	46;61;61;61;46;61	.	ENSP00000334754:S46X	S	+	2	0	TEAD1	12742537	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.746000	0.94184	0.591000	0.81541	TCA	TEAD1	-	pfam_TEA/ATTS,smart_TEA/ATTS,pirsf_TEF,pfscan_TEA/ATTS	ENSG00000187079		0.493	TEAD1-002	NOVEL	basic	protein_coding	TEAD1	HGNC	protein_coding	OTTHUMT00000386888.1	248	0.00	0	C	NM_021961		12785961	12785961	+1	no_errors	ENST00000361905	ensembl	human	known	69_37n	nonsense	118	15.71	22	SNP	1.000	G
THBS3	7059	genome.wustl.edu	37	1	155165801	155165801	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr1:155165801G>C	ENST00000368378.3	-	22	2809	c.2789C>G	c.(2788-2790)tCc>tGc	p.S930C	RP11-263K19.4_ENST00000436772.1_RNA|THBS3_ENST00000541990.1_Missense_Mutation_p.S459C|MIR92B_ENST00000607575.1_RNA|THBS3_ENST00000457183.2_Missense_Mutation_p.S810C|THBS3_ENST00000541576.1_Missense_Mutation_p.S327C|RP11-263K19.4_ENST00000447623.1_RNA|RP11-263K19.4_ENST00000453136.1_RNA|RP11-263K19.4_ENST00000454348.1_RNA	NM_001252607.1|NM_007112.4	NP_001239536.1|NP_009043.1	P49746	TSP3_HUMAN	thrombospondin 3	930	TSP C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00635}.				bone trabecula formation (GO:0060346)|cell-matrix adhesion (GO:0007160)|growth plate cartilage development (GO:0003417)|ossification involved in bone maturation (GO:0043931)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(6)|endometrium(4)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(3)	48	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CTGGAGATTGGACCAAATTAT	0.498																																						dbGAP											0													200.0	193.0	196.0					1																	155165801		2203	4300	6503	-	-	-	SO:0001583	missense	0			L38969	CCDS1099.1, CCDS58034.1, CCDS72937.1	1q21	2008-02-05			ENSG00000169231	ENSG00000169231			11787	protein-coding gene	gene with protein product		188062				1601886	Standard	NM_007112		Approved		uc001fix.3	P49746	OTTHUMG00000035710	ENST00000368378.3:c.2789C>G	1.37:g.155165801G>C	ENSP00000357362:p.Ser930Cys		B1AVR8|B4DQ20|Q8WV34	Missense_Mutation	SNP	pfam_Thrombospondin_C,pfam_Thbs/COMP_coiled-coil,pfam_Thrombospondin_3-like_rpt,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.S930C	ENST00000368378.3	37	c.2789	CCDS1099.1	1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.210951	0.79240	.	.	ENSG00000169231	ENST00000368378;ENST00000541576;ENST00000457183;ENST00000541990	D;D;D;D	0.93953	-3.32;-3.32;-3.32;-3.32	3.5	3.5	0.40072	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Thrombospondin, C-terminal (2);	0.000000	0.64402	D	0.000002	D	0.96482	0.8852	M	0.89478	3.035	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.996;0.998;0.998;0.998	D	0.96744	0.9549	10	0.87932	D	0	-17.7075	13.3099	0.60374	0.0:0.0:1.0:0.0	.	810;930;930;930	B4DQ20;Q53FK6;Q2HIZ0;P49746	.;.;.;TSP3_HUMAN	C	930;327;810;459	ENSP00000357362:S930C;ENSP00000444792:S327C;ENSP00000392207:S810C;ENSP00000437353:S459C	ENSP00000357362:S930C	S	-	2	0	THBS3	153432425	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.596000	0.98267	2.273000	0.75805	0.491000	0.48974	TCC	THBS3	-	pfam_Thrombospondin_C,superfamily_ConA-like_lec_gl	ENSG00000169231		0.498	THBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS3	HGNC	protein_coding	OTTHUMT00000086856.1	299	0.00	0	G	NM_007112		155165801	155165801	-1	no_errors	ENST00000368378	ensembl	human	known	69_37n	missense	277	15.29	50	SNP	1.000	C
THSD7B	80731	genome.wustl.edu	37	2	137814238	137814238	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr2:137814238G>C	ENST00000409968.1	+	3	566	c.388G>C	c.(388-390)Gag>Cag	p.E130Q	THSD7B_ENST00000543459.1_5'Flank|THSD7B_ENST00000272643.3_Missense_Mutation_p.E130Q|THSD7B_ENST00000413152.2_Missense_Mutation_p.E99Q			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	130	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		TCGGACTGCAGAGTGTGTGAC	0.537																																						dbGAP											0													76.0	82.0	80.0					2																	137814238		2065	4213	6278	-	-	-	SO:0001583	missense	0					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.388G>C	2.37:g.137814238G>C	ENSP00000387145:p.Glu130Gln			Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.E130Q	ENST00000409968.1	37	c.388		2	.	.	.	.	.	.	.	.	.	.	G	10.42	1.344510	0.24339	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.24723	2.37;2.24;1.84	6.07	3.23	0.37069	.	0.559368	0.20625	N	0.088697	T	0.22085	0.0532	L	0.52759	1.655	0.48696	D	0.999693	B	0.22800	0.075	B	0.17098	0.017	T	0.03706	-1.1011	9	.	.	.	.	10.5205	0.44916	0.0704:0.229:0.7006:0.0	.	99	C9JKN6	.	Q	130;130;99	ENSP00000387145:E130Q;ENSP00000272643:E130Q;ENSP00000413841:E99Q	.	E	+	1	0	THSD7B	137530708	1.000000	0.71417	0.481000	0.27354	0.208000	0.24298	4.937000	0.63513	0.857000	0.35407	0.585000	0.79938	GAG	THSD7B	-	superfamily_Thrombospondin_1_rpt	ENSG00000144229		0.537	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	THSD7B	HGNC	protein_coding	OTTHUMT00000331769.2	172	0.00	0	G	XM_046570.9		137814238	137814238	+1	no_errors	ENST00000272643	ensembl	human	known	69_37n	missense	115	25.32	39	SNP	0.547	C
UBE2V1	7335	genome.wustl.edu	37	20	48699337	48699337	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr20:48699337G>A	ENST00000371674.3	-	4	456	c.412C>T	c.(412-414)Cag>Tag	p.Q138*	UBE2V1_ENST00000415862.2_Nonsense_Mutation_p.Q94*|TMEM189-UBE2V1_ENST00000341698.2_Nonsense_Mutation_p.Q361*|UBE2V1_ENST00000371657.5_Nonsense_Mutation_p.Q96*|TMEM189_ENST00000557021.1_Nonsense_Mutation_p.Q361*|UBE2V1_ENST00000420027.2_Nonsense_Mutation_p.Q94*|UBE2V1_ENST00000371677.3_Nonsense_Mutation_p.Q161*|UBE2V1_ENST00000396059.3_5'UTR|UBE2V1_ENST00000340309.3_Nonsense_Mutation_p.Q161*	NM_001032288.2|NM_001257395.1	NP_001027459.1|NP_001244324.1	Q13404	UB2V1_HUMAN	ubiquitin-conjugating enzyme E2 variant 1	138					cell differentiation (GO:0030154)|error-free postreplication DNA repair (GO:0042275)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription, DNA-templated (GO:0045893)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|regulation of DNA repair (GO:0006282)|regulation of transcription, DNA-templated (GO:0006355)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein complex (GO:0043234)|UBC13-UEV1A complex (GO:0035370)|ubiquitin conjugating enzyme complex (GO:0031371)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(2)|large_intestine(3)|lung(4)	9			BRCA - Breast invasive adenocarcinoma(9;4.74e-06)			TCGGGCGGCTGAGGGAGTTTC	0.428																																						dbGAP											0													86.0	85.0	85.0					20																	48699337		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U39360	CCDS13426.1, CCDS13427.1, CCDS33483.1, CCDS58775.1, CCDS74740.1	20q13.2	2007-07-18			ENSG00000244687	ENSG00000244687		"""Ubiquitin-conjugating enzymes E2"""	12494	protein-coding gene	gene with protein product		602995		UBE2V		9418904, 9305758	Standard	NM_001032288		Approved	UEV-1, CROC-1, UEV1A, CROC1		Q13404	OTTHUMG00000152626	ENST00000371674.3:c.412C>T	20.37:g.48699337G>A	ENSP00000360739:p.Gln138*		E1P629|Q13403|Q13532|Q5TGE0|Q5TGE3|Q96H34|Q9GZT0|Q9GZW1|Q9H4J3|Q9H4J4|Q9UKL1|Q9UM48|Q9UM49|Q9UM50	Nonsense_Mutation	SNP	pfam_KuaUb-conj-enz_UEV1,pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.Q361*	ENST00000371674.3	37	c.1081	CCDS33483.1	20	.	.	.	.	.	.	.	.	.	.	G	29.8	5.035520	0.93630	.	.	ENSG00000124208;ENSG00000244687;ENSG00000244687;ENSG00000244687;ENSG00000244687;ENSG00000244687;ENSG00000244687;ENSG00000244687;ENSG00000240849	ENST00000341698;ENST00000371657;ENST00000371674;ENST00000340309;ENST00000415862;ENST00000371677;ENST00000420027;ENST00000354374;ENST00000557021	.	.	.	5.35	5.35	0.76521	.	0.000000	0.47455	U	0.000223	.	.	.	.	.	.	0.58432	D	0.999995	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-11.4307	19.0759	0.93161	0.0:0.0:1.0:0.0	.	.	.	.	X	361;96;138;161;94;161;94;94;361	.	ENSP00000344166:Q361X	Q	-	1	0	TMEM189-UBE2V1;UBE2V1;TMEM189	48132744	1.000000	0.71417	0.983000	0.44433	0.995000	0.86356	9.421000	0.97455	2.506000	0.84524	0.650000	0.86243	CAG	TMEM189-UBE2V1	-	superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	ENSG00000124208		0.428	UBE2V1-004	KNOWN	basic|CCDS	protein_coding	TMEM189-UBE2V1	HGNC	protein_coding	OTTHUMT00000080530.1	488	0.00	0	G	NM_021988		48699337	48699337	-1	no_errors	ENST00000341698	ensembl	human	known	69_37n	nonsense	438	13.78	70	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7578536	7578536	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr17:7578536T>C	ENST00000269305.4	-	5	583	c.394A>G	c.(394-396)Aag>Gag	p.K132E	TP53_ENST00000359597.4_Missense_Mutation_p.K132E|TP53_ENST00000455263.2_Missense_Mutation_p.K132E|TP53_ENST00000445888.2_Missense_Mutation_p.K132E|TP53_ENST00000420246.2_Missense_Mutation_p.K132E|TP53_ENST00000413465.2_Missense_Mutation_p.K132E|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	132	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		K -> E (in LFS; germline mutation and in sporadic cancers; somatic mutation).|K -> L (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|K -> M (in sporadic cancers; somatic mutation).|K -> N (in sporadic cancers; somatic mutation).|K -> Q (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1694291}.|K -> R (in sporadic cancers; somatic mutation).|K -> T (in sporadic cancers; somatic mutation).|K -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|KM -> NL (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.K132E(20)|p.K132Q(13)|p.0?(8)|p.Y126_K132delYSPALNK(6)|p.N131del(3)|p.K132*(3)|p.N131fs*27(2)|p.K132fs*38(2)|p.V73fs*9(1)|p.S127fs*36(1)|p.A129_K132delALNK(1)|p.Y126fs*11(1)|p.K132_A138delKMFCQLA(1)|p.S127_Q136del10(1)|p.L130_M133delLNKM(1)|p.L130fs*16(1)|p.K132W(1)|p.K39E(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAAAACATCTTGTTGAGGGCA	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	67	Substitution - Missense(35)|Deletion - In frame(13)|Whole gene deletion(8)|Deletion - Frameshift(8)|Substitution - Nonsense(3)	breast(11)|central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(7)|ovary(6)|large_intestine(5)|urinary_tract(5)|lung(5)|bone(4)|upper_aerodigestive_tract(3)|adrenal_gland(2)|stomach(2)|oesophagus(2)|prostate(2)|soft_tissue(1)|cervix(1)|kidney(1)|biliary_tract(1)|pancreas(1)|liver(1)	GRCh37	CM086989|CM973641	TP53	M							46.0	47.0	46.0					17																	7578536		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.394A>G	17.37:g.7578536T>C	ENSP00000269305:p.Lys132Glu		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.K132E	ENST00000269305.4	37	c.394	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	25.8	4.670498	0.88348	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793	D;D;D;D;D;D;D;D	0.99854	-7.19;-7.19;-7.19;-7.19;-7.19;-7.19;-7.19;-7.19	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99876	0.9941	M	0.91768	3.24	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.991;0.999;1.0;0.999;1.0	D;D;D;D;D;D;D	0.97110	0.992;0.992;0.953;0.98;0.995;0.989;1.0	D	0.96352	0.9259	10	0.87932	D	0	-14.0777	13.8301	0.63375	0.0:0.0:0.0:1.0	.	93;132;132;39;132;132;132	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	E	132;132;132;132;132;132;121;39;39;132	ENSP00000410739:K132E;ENSP00000352610:K132E;ENSP00000269305:K132E;ENSP00000398846:K132E;ENSP00000391127:K132E;ENSP00000391478:K132E;ENSP00000423862:K39E;ENSP00000424104:K132E	ENSP00000269305:K132E	K	-	1	0	TP53	7519261	1.000000	0.71417	1.000000	0.80357	0.777000	0.43975	7.993000	0.88291	2.206000	0.71126	0.533000	0.62120	AAG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	130	0.00	0	T	NM_000546		7578536	7578536	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	54	50.00	54	SNP	1.000	C
TPPP	11076	genome.wustl.edu	37	5	666230	666230	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr5:666230G>A	ENST00000360578.5	-	3	441	c.320C>T	c.(319-321)tCt>tTt	p.S107F	CEP72_ENST00000514507.1_Intron|AC026740.1_ENST00000594226.1_5'Flank	NM_007030.2	NP_008961.1	O94811	TPPP_HUMAN	tubulin polymerization promoting protein	107	Mediates interaction with LIMK1.				microtubule bundle formation (GO:0001578)|microtubule polymerization (GO:0046785)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein polymerization (GO:0032273)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5		Ovarian(839;0.0563)	Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)	GBM - Glioblastoma multiforme(108;0.0191)		GGTCCGGCAAGACTTCCCTCT	0.657																																						dbGAP											0													67.0	62.0	64.0					5																	666230		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB017016	CCDS3856.1	5p15.33	2008-02-05			ENSG00000171368	ENSG00000171368			24164	protein-coding gene	gene with protein product	"""brain specific protein p25 alpha"""	608773				10083737, 12093283, 15590652, 17105200	Standard	NM_007030		Approved	p25alpha, TPPP1, p25, TPPP/p25	uc003jbh.4	O94811	OTTHUMG00000131011	ENST00000360578.5:c.320C>T	5.37:g.666230G>A	ENSP00000353785:p.Ser107Phe			Missense_Mutation	SNP	pfam_P25-alpha	p.S107F	ENST00000360578.5	37	c.320	CCDS3856.1	5	.	.	.	.	.	.	.	.	.	.	g	18.71	3.682008	0.68042	.	.	ENSG00000171368	ENST00000360578	T	0.48201	0.82	4.54	4.54	0.55810	EF-hand-like domain (1);	0.322498	0.34777	N	0.003697	T	0.70343	0.3213	M	0.83692	2.655	0.80722	D	1	D	0.64830	0.994	D	0.67725	0.953	T	0.75703	-0.3225	10	0.56958	D	0.05	-20.5186	17.2627	0.87075	0.0:0.0:1.0:0.0	.	107	O94811	TPPP_HUMAN	F	107	ENSP00000353785:S107F	ENSP00000353785:S107F	S	-	2	0	TPPP	719230	0.948000	0.32251	0.994000	0.49952	0.218000	0.24690	3.745000	0.55119	2.238000	0.73509	0.555000	0.69702	TCT	TPPP	-	pfam_P25-alpha	ENSG00000171368		0.657	TPPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPPP	HGNC	protein_coding	OTTHUMT00000253645.3	71	0.00	0	G	NM_007030		666230	666230	-1	no_errors	ENST00000360578	ensembl	human	known	69_37n	missense	109	14.84	19	SNP	1.000	A
TSC22D2	9819	genome.wustl.edu	37	3	150127372	150127372	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr3:150127372G>C	ENST00000361875.3	+	1	1251	c.235G>C	c.(235-237)Gag>Cag	p.E79Q	TSC22D2_ENST00000361136.2_Missense_Mutation_p.E79Q	NM_014779.2	NP_055594.1	O75157	T22D2_HUMAN	TSC22 domain family, member 2	79					response to osmotic stress (GO:0006970)		sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			TGGGGATGCGGAGACTCCCGG	0.637																																						dbGAP											0													33.0	35.0	34.0					3																	150127372		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014569	CCDS3149.1	3q25.1	2005-03-01			ENSG00000196428	ENSG00000196428			29095	protein-coding gene	gene with protein product						9734811	Standard	NM_014779		Approved	KIAA0669, TILZ4a, TILZ4b, TILZ4c	uc003exv.3	O75157	OTTHUMG00000159744	ENST00000361875.3:c.235G>C	3.37:g.150127372G>C	ENSP00000354543:p.Glu79Gln		D3DNI5|Q6PI50|Q9H2Z6|Q9H2Z7|Q9H2Z8	Missense_Mutation	SNP	pfam_TSC-22_Dip_Bun	p.E79Q	ENST00000361875.3	37	c.235	CCDS3149.1	3	.	.	.	.	.	.	.	.	.	.	g	19.90	3.912091	0.72983	.	.	ENSG00000196428	ENST00000361875;ENST00000361136	T;T	0.25414	1.8;1.8	4.44	4.44	0.53790	.	0.000000	0.53938	D	0.000041	T	0.49864	0.1582	M	0.66939	2.045	0.44871	D	0.997888	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.984	T	0.55042	-0.8202	10	0.66056	D	0.02	.	16.725	0.85419	0.0:0.0:1.0:0.0	.	79;79	O75157-2;O75157	.;T22D2_HUMAN	Q	79	ENSP00000354543:E79Q;ENSP00000354893:E79Q	ENSP00000354893:E79Q	E	+	1	0	TSC22D2	151610062	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	5.990000	0.70595	2.032000	0.59987	0.645000	0.84053	GAG	TSC22D2	-	NULL	ENSG00000196428		0.637	TSC22D2-001	KNOWN	basic|CCDS	protein_coding	TSC22D2	HGNC	protein_coding	OTTHUMT00000357123.2	30	0.00	0	G	NM_014779		150127372	150127372	+1	no_errors	ENST00000361875	ensembl	human	known	69_37n	missense	28	31.71	13	SNP	1.000	C
TSGA13	114960	genome.wustl.edu	37	7	130364154	130364154	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr7:130364154G>C	ENST00000456951.1	-	6	1077	c.226C>G	c.(226-228)Caa>Gaa	p.Q76E	TSGA13_ENST00000356588.3_Missense_Mutation_p.Q76E			Q96PP4	TSG13_HUMAN	testis specific, 13	76										endometrium(1)|kidney(3)|large_intestine(3)|lung(6)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	18	Melanoma(18;0.0435)					TTCCTGTTTTGAGCCAGGAAT	0.448																																						dbGAP											0													158.0	138.0	145.0					7																	130364154		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK093329	CCDS5824.1	7q32	2008-02-04			ENSG00000213265	ENSG00000213265			12369	protein-coding gene	gene with protein product							Standard	NM_052933		Approved		uc003vqi.3	Q96PP4	OTTHUMG00000154999	ENST00000456951.1:c.226C>G	7.37:g.130364154G>C	ENSP00000406047:p.Gln76Glu		B3KSC9	Missense_Mutation	SNP	NULL	p.Q76E	ENST00000456951.1	37	c.226	CCDS5824.1	7	.	.	.	.	.	.	.	.	.	.	G	11.81	1.749962	0.30955	.	.	ENSG00000213265	ENST00000456951;ENST00000418126;ENST00000356588;ENST00000443954	.	.	.	4.98	3.04	0.35103	.	0.998527	0.08102	N	0.997606	T	0.28134	0.0694	N	0.14661	0.345	0.09310	N	1	B	0.14012	0.009	B	0.15484	0.013	T	0.17319	-1.0373	9	0.32370	T	0.25	-0.2227	10.9143	0.47126	0.0:0.3991:0.6009:0.0	.	76	Q96PP4	TSG13_HUMAN	E	76	.	ENSP00000348996:Q76E	Q	-	1	0	TSGA13	130014694	0.004000	0.15560	0.260000	0.24451	0.931000	0.56810	1.306000	0.33505	1.282000	0.44496	0.467000	0.42956	CAA	TSGA13	-	NULL	ENSG00000213265		0.448	TSGA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSGA13	HGNC	protein_coding	OTTHUMT00000337997.1	664	0.00	0	G	NM_052933		130364154	130364154	-1	no_errors	ENST00000356588	ensembl	human	known	69_37n	missense	609	15.88	115	SNP	0.015	C
CFAP70	118491	genome.wustl.edu	37	10	75034278	75034278	+	Nonsense_Mutation	SNP	A	A	C			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr10:75034278A>C	ENST00000310715.3	-	24	3078	c.2958T>G	c.(2956-2958)taT>taG	p.Y986*	DNAJC9-AS1_ENST00000440197.2_RNA|TTC18_ENST00000401621.2_Nonsense_Mutation_p.Y986*|TTC18_ENST00000394865.1_Nonsense_Mutation_p.Y986*|TTC18_ENST00000493787.1_5'UTR|TTC18_ENST00000355577.3_Nonsense_Mutation_p.Y455*|TTC18_ENST00000340329.3_Nonsense_Mutation_p.Y226*	NM_145170.3	NP_660153.3	Q5T0N1	TTC18_HUMAN		986						extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	Prostate(51;0.0119)					TGGTTCGTTCATAGCATGCCT	0.473																																						dbGAP											0													137.0	131.0	133.0					10																	75034278		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0																														ENST00000310715.3:c.2958T>G	10.37:g.75034278A>C	ENSP00000310829:p.Tyr986*		C9JIZ9|Q5T0M4|Q5T0M9|Q5T0N0|Q69YH9|Q8IYZ8|Q8N7D5|Q8NI30|Q8NI31	Nonsense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.Y986*	ENST00000310715.3	37	c.2958	CCDS7324.3	10	.	.	.	.	.	.	.	.	.	.	A	39	7.738656	0.98462	.	.	ENSG00000156042	ENST00000310715;ENST00000401621;ENST00000355577;ENST00000340329;ENST00000433268;ENST00000394865	.	.	.	5.97	-0.501	0.12008	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.3809	10.0637	0.42290	0.6447:0.0:0.3553:0.0	.	.	.	.	X	986;986;986;226;393;986	.	ENSP00000310829:Y986X	Y	-	3	2	TTC18	74704284	0.995000	0.38212	0.998000	0.56505	0.992000	0.81027	0.388000	0.20735	-0.063000	0.13065	0.528000	0.53228	TAT	TTC18	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000156042		0.473	TTC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC18	HGNC	protein_coding		372	0.00	0	A			75034278	75034278	-1	no_errors	ENST00000310715	ensembl	human	known	69_37n	nonsense	248	18.69	57	SNP	0.999	C
UBTD2	92181	genome.wustl.edu	37	5	171639034	171639034	+	Missense_Mutation	SNP	G	G	A	rs574348285		TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr5:171639034G>A	ENST00000393792.2	-	3	910	c.505C>T	c.(505-507)Cgc>Tgc	p.R169C		NM_152277.2	NP_689490.2	Q8WUN7	UBTD2_HUMAN	ubiquitin domain containing 2	169	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.					cytoplasm (GO:0005737)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|prostate(1)|skin(1)	10	Renal(175;0.000159)|Lung NSC(126;0.00976)|all_lung(126;0.0156)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TCTGTGCTGCGAACCACAAGC	0.507													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20761	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													168.0	144.0	152.0					5																	171639034		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF251700	CCDS4379.2	5q35.1	2008-10-30			ENSG00000168246	ENSG00000168246			24463	protein-coding gene	gene with protein product	"""dendritic cell derived ubiquitin like protein"""	610174				12507522	Standard	NM_152277		Approved	DC-UbP, MGC30022	uc003mbp.1	Q8WUN7	OTTHUMG00000130519	ENST00000393792.2:c.505C>T	5.37:g.171639034G>A	ENSP00000377381:p.Arg169Cys		Q8TDQ3	Missense_Mutation	SNP	pfam_Ubiquitin,pfam_SUMO,pfscan_Ubiquitin_supergroup	p.R169C	ENST00000393792.2	37	c.505	CCDS4379.2	5	.	.	.	.	.	.	.	.	.	.	G	22.0	4.224445	0.79576	.	.	ENSG00000168246	ENST00000393792	T	0.73469	-0.75	5.83	5.83	0.93111	Ubiquitin supergroup (1);Ubiquitin (2);	0.000000	0.85682	D	0.000000	D	0.83571	0.5283	L	0.55481	1.735	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.81484	-0.0912	10	0.38643	T	0.18	.	17.6156	0.88066	0.0:0.0:1.0:0.0	.	169	Q8WUN7	UBTD2_HUMAN	C	169	ENSP00000377381:R169C	ENSP00000377381:R169C	R	-	1	0	UBTD2	171571639	1.000000	0.71417	0.995000	0.50966	0.907000	0.53573	5.576000	0.67437	2.763000	0.94921	0.561000	0.74099	CGC	UBTD2	-	pfam_Ubiquitin,pfam_SUMO,pfscan_Ubiquitin_supergroup	ENSG00000168246		0.507	UBTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBTD2	HGNC	protein_coding	OTTHUMT00000252936.1	303	0.00	0	G	NM_152277		171639034	171639034	-1	no_errors	ENST00000393792	ensembl	human	known	69_37n	missense	243	19.00	57	SNP	1.000	A
UGT2B10	7365	genome.wustl.edu	37	4	69681927	69681927	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr4:69681927G>C	ENST00000265403.7	+	1	217	c.190G>C	c.(190-192)Gat>Cat	p.D64H	UGT2B10_ENST00000458688.2_Missense_Mutation_p.D64H	NM_001075.4	NP_001066.1	P36537	UDB10_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B10	64					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			endometrium(3)|kidney(4)|large_intestine(1)|lung(13)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	29						CATTCTTTTTGATCCCAACGA	0.368																																					Melanoma(133;755 1763 25578 26334 46021)	dbGAP											0													90.0	96.0	94.0					4																	69681927		2203	4297	6500	-	-	-	SO:0001583	missense	0			X63359	CCDS75135.1, CCDS75136.1	4q13.3	2008-02-05	2005-07-20			ENSG00000109181		"""UDP glucuronosyltransferases"""	12544	protein-coding gene	gene with protein product		600070	"""UDP glycosyltransferase 2 family, polypeptide B10"""			8333863	Standard	NM_001075		Approved		uc003hee.3	P36537		ENST00000265403.7:c.190G>C	4.37:g.69681927G>C	ENSP00000265403:p.Asp64His		A8K9M3|B4DPP1|Q14CR8	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.D64H	ENST00000265403.7	37	c.190		4	.	.	.	.	.	.	.	.	.	.	g	7.560	0.664448	0.14710	.	.	ENSG00000109181	ENST00000265403;ENST00000458688	T;T	0.61040	0.14;3.29	2.63	2.63	0.31362	.	0.265381	0.30483	U	0.009525	T	0.55369	0.1916	M	0.64260	1.97	0.09310	N	1	B;P	0.41159	0.062;0.74	B;B	0.42361	0.151;0.385	T	0.53563	-0.8421	10	0.59425	D	0.04	.	10.7026	0.45937	0.0:0.0:1.0:0.0	.	64;64	B4DPP1;P36537	.;UDB10_HUMAN	H	64	ENSP00000265403:D64H;ENSP00000413420:D64H	ENSP00000265403:D64H	D	+	1	0	UGT2B10	69716516	0.000000	0.05858	0.007000	0.13788	0.023000	0.10783	0.247000	0.18179	1.309000	0.44985	0.184000	0.17185	GAT	UGT2B10	-	pfam_UDP_glucos_trans	ENSG00000109181		0.368	UGT2B10-001	KNOWN	non_canonical_polymorphism|basic|appris_principal	protein_coding	UGT2B10	HGNC	protein_coding	OTTHUMT00000365169.1	155	0.00	0	G	NM_001075		69681927	69681927	+1	no_errors	ENST00000265403	ensembl	human	known	69_37n	missense	110	17.29	23	SNP	0.011	C
UNC13C	440279	genome.wustl.edu	37	15	54793090	54793090	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr15:54793090C>T	ENST00000260323.11	+	21	5215	c.5215C>T	c.(5215-5217)Cag>Tag	p.Q1739*	UNC13C_ENST00000545554.1_Nonsense_Mutation_p.Q1739*|UNC13C_ENST00000537900.1_Nonsense_Mutation_p.Q1737*	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1739	MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TGTCTTTGCTCAGCTGAATCA	0.408																																						dbGAP											0													105.0	105.0	105.0					15																	54793090		2039	4221	6260	-	-	-	SO:0001587	stop_gained	0			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.5215C>T	15.37:g.54793090C>T	ENSP00000260323:p.Gln1739*		Q0P613|Q8ND48|Q96NP3	Nonsense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_Ca-dep,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.Q1739*	ENST00000260323.11	37	c.5215	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	C	47	13.546570	0.99748	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	.	.	.	5.11	5.11	0.69529	.	0.121987	0.56097	D	0.000029	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	17.8694	0.88807	0.0:1.0:0.0:0.0	.	.	.	.	X	1739;1739;1737	.	ENSP00000260323:Q1739X	Q	+	1	0	UNC13C	52580382	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.741000	0.84997	2.523000	0.85059	0.591000	0.81541	CAG	UNC13C	-	NULL	ENSG00000137766		0.408	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3	367	0.00	0	C	NM_173166		54793090	54793090	+1	no_errors	ENST00000260323	ensembl	human	known	69_37n	nonsense	201	27.70	77	SNP	1.000	T
VSIG1	340547	genome.wustl.edu	37	X	107301404	107301404	+	Silent	SNP	C	C	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chrX:107301404C>T	ENST00000217957.5	+	2	303	c.186C>T	c.(184-186)ttC>ttT	p.F62F	VSIG1_ENST00000415430.3_Silent_p.F62F	NM_182607.4	NP_872413.1	Q86XK7	VSIG1_HUMAN	V-set and immunoglobulin domain containing 1	62	Ig-like V-type 1.					integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	17						GGTCTTTCTTCCATAAGAAGG	0.443																																						dbGAP											0													155.0	120.0	132.0					X																	107301404		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BX648658	CCDS14535.1, CCDS55474.1	Xq22.3	2013-01-29			ENSG00000101842	ENSG00000101842		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28675	protein-coding gene	gene with protein product		300620				12477932	Standard	NM_182607		Approved	MGC44287	uc011msk.2	Q86XK7	OTTHUMG00000022175	ENST00000217957.5:c.186C>T	X.37:g.107301404C>T			C9J4P2|Q6MZS4	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.F62	ENST00000217957.5	37	c.186	CCDS14535.1	X																																																																																			VSIG1	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000101842		0.443	VSIG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	VSIG1	HGNC	protein_coding	OTTHUMT00000057858.1	543	0.00	0	C	NM_182607		107301404	107301404	+1	no_errors	ENST00000415430	ensembl	human	known	69_37n	silent	441	17.26	92	SNP	0.002	T
CFAP43	80217	genome.wustl.edu	37	10	105965792	105965792	+	Splice_Site	SNP	C	C	G			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr10:105965792C>G	ENST00000278064.2	-	7	1011		c.e7-1		WDR96_ENST00000428666.1_Splice_Site|WDR96_ENST00000369720.1_Splice_Site|WDR96_ENST00000357060.3_Intron|WDR96_ENST00000369719.1_Splice_Site																NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CTTCTGTCTTCTGGAAAAGAA	0.313																																						dbGAP											0													47.0	46.0	47.0					10																	105965792		2203	4297	6500	-	-	-	SO:0001630	splice_region_variant	0																														ENST00000278064.2:c.686-1G>C	10.37:g.105965792C>G				Splice_Site	SNP	-	e7-1	ENST00000278064.2	37	c.896-1		10	.	.	.	.	.	.	.	.	.	.	C	0.464	-0.887514	0.02511	.	.	ENSG00000197748	ENST00000428666;ENST00000278064;ENST00000369720;ENST00000369719	.	.	.	4.43	-0.902	0.10537	.	.	.	.	.	.	.	.	.	.	.	0.20403	N	0.99991	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.7936	0.29135	0.0:0.4901:0.0:0.5099	.	.	.	.	.	-1	.	.	.	-	.	.	WDR96	105955782	0.002000	0.14202	0.010000	0.14722	0.112000	0.19704	-0.264000	0.08658	-0.143000	0.11334	-0.247000	0.11927	.	WDR96	-	-	ENSG00000197748		0.313	WDR96-003	KNOWN	basic	protein_coding	WDR96	HGNC	protein_coding	OTTHUMT00000050200.1	224	0.00	0	C		Intron	105965792	105965792	-1	no_errors	ENST00000428666	ensembl	human	known	69_37n	splice_site	113	32.34	54	SNP	0.017	G
ZBTB46	140685	genome.wustl.edu	37	20	62421337	62421337	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr20:62421337C>G	ENST00000245663.4	-	2	924	c.774G>C	c.(772-774)caG>caC	p.Q258H	ZBTB46_ENST00000395104.1_Missense_Mutation_p.Q258H|ZBTB46_ENST00000302995.2_Missense_Mutation_p.Q258H|ZBTB46_ENST00000480766.1_5'Flank	NM_025224.3	NP_079500.2	Q86UZ6	ZBT46_HUMAN	zinc finger and BTB domain containing 46	258					negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of monocyte differentiation (GO:0045656)|positive regulation of dendritic cell differentiation (GO:2001200)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)					CACCAGCACTCTGCTCTGAGA	0.577																																						dbGAP											0													81.0	76.0	78.0					20																	62421337		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK131482	CCDS13538.1	20q13.33	2013-01-08	2006-09-19	2006-09-19	ENSG00000130584	ENSG00000130584		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16094	protein-coding gene	gene with protein product	"""BTB-ZF protein expressed in effector lymphocytes"""	614639	"""BTB (POZ) domain containing 4"""	ZNF340, BTBD4			Standard	NM_025224		Approved	FLJ13502, RINZF, BZEL	uc002ygv.2	Q86UZ6	OTTHUMG00000033001	ENST00000245663.4:c.774G>C	20.37:g.62421337C>G	ENSP00000245663:p.Gln258His		E1P5K9|Q5JWJ3|Q6GMV4|Q9BQK3|Q9H3Z8|Q9H3Z9	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_DUF3342,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.Q258H	ENST00000245663.4	37	c.774	CCDS13538.1	20	.	.	.	.	.	.	.	.	.	.	C	11.72	1.724188	0.30593	.	.	ENSG00000130584	ENST00000245663;ENST00000302995;ENST00000395104	T;T;T	0.13307	2.6;2.6;2.6	5.5	4.46	0.54185	.	0.264874	0.39146	N	0.001456	T	0.23846	0.0577	M	0.61703	1.905	0.39685	D	0.970966	D	0.61697	0.99	P	0.56563	0.801	T	0.00768	-1.1574	10	0.46703	T	0.11	.	7.3926	0.26919	0.0:0.8245:0.0:0.1755	.	258	Q86UZ6	ZBT46_HUMAN	H	258	ENSP00000245663:Q258H;ENSP00000303102:Q258H;ENSP00000378536:Q258H	ENSP00000245663:Q258H	Q	-	3	2	ZBTB46	61891781	0.946000	0.32159	0.763000	0.31416	0.022000	0.10575	1.383000	0.34385	2.581000	0.87130	0.655000	0.94253	CAG	ZBTB46	-	NULL	ENSG00000130584		0.577	ZBTB46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB46	HGNC	protein_coding	OTTHUMT00000080232.2	109	0.00	0	C	NM_025224		62421337	62421337	-1	no_errors	ENST00000245663	ensembl	human	known	69_37n	missense	127	17.95	28	SNP	0.969	G
ZNF462	58499	genome.wustl.edu	37	9	109689136	109689136	+	Silent	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr9:109689136G>A	ENST00000277225.5	+	3	3232	c.2943G>A	c.(2941-2943)ctG>ctA	p.L981L	ZNF462_ENST00000441147.2_5'Flank|ZNF462_ENST00000457913.1_Silent_p.L981L			Q96JM2	ZN462_HUMAN	zinc finger protein 462	981					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						GGGAGATTCTGAATTCGGCTC	0.502																																						dbGAP											0													76.0	80.0	79.0					9																	109689136		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.2943G>A	9.37:g.109689136G>A			Q5T0T4|Q8N408	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L981	ENST00000277225.5	37	c.2943	CCDS35096.1	9																																																																																			ZNF462	-	NULL	ENSG00000148143		0.502	ZNF462-001	KNOWN	basic|CCDS	protein_coding	ZNF462	HGNC	protein_coding	OTTHUMT00000053532.2	215	0.00	0	G	NM_021224		109689136	109689136	+1	no_errors	ENST00000457913	ensembl	human	known	69_37n	silent	181	20.26	46	SNP	1.000	A
ZNF48	197407	genome.wustl.edu	37	16	30409375	30409375	+	Silent	SNP	G	G	A			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr16:30409375G>A	ENST00000320159.2	+	2	1180	c.804G>A	c.(802-804)ccG>ccA	p.P268P	SEPT1_ENST00000570039.1_5'Flank	NM_001214906.1|NM_001214907.1|NM_001214909.1|NM_152652.2	NP_001201835.1|NP_001201836.1|NP_001201838.1|NP_689865.2	Q96MX3	ZNF48_HUMAN	zinc finger protein 48	268					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)|pancreas(1)|skin(1)	21						CCCAGGGACCGAAGGCCCAGG	0.652																																						dbGAP											0													56.0	63.0	61.0					16																	30409375		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			M88358, AK056313	CCDS10679.1, CCDS73868.1	16p11.2	2013-01-08			ENSG00000180035	ENSG00000180035		"""Zinc fingers, C2H2-type"""	13114	protein-coding gene	gene with protein product			"""zinc finger protein 553"""	ZNF553		1505991	Standard	NM_152652		Approved	DKFZp762K013, FLJ31751, MGC43952	uc021tgi.1	Q96MX3	OTTHUMG00000048195	ENST00000320159.2:c.804G>A	16.37:g.30409375G>A			Q15920|Q4G0R3|Q69YP3|Q96IL9	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P268	ENST00000320159.2	37	c.804	CCDS10679.1	16																																																																																			ZNF48	-	NULL	ENSG00000180035		0.652	ZNF48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF48	HGNC	protein_coding	OTTHUMT00000255549.2	84	0.00	0	G	NM_152652		30409375	30409375	+1	no_errors	ENST00000320159	ensembl	human	known	69_37n	silent	76	17.39	16	SNP	0.289	A
ZNF469	84627	genome.wustl.edu	37	16	88504833	88504833	+	Nonsense_Mutation	SNP	C	C	G			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr16:88504833C>G	ENST00000437464.1	+	2	10871	c.10871C>G	c.(10870-10872)tCa>tGa	p.S3624*	ZNF469_ENST00000565624.1_Nonsense_Mutation_p.S3652*	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	3624					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						GAGGTGTCCTCAAGCCACATG	0.632																																						dbGAP											0													8.0	12.0	11.0					16																	88504833		687	1576	2263	-	-	-	SO:0001587	stop_gained	0			AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.10871C>G	16.37:g.88504833C>G	ENSP00000402343:p.Ser3624*			Nonsense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S3624*	ENST00000437464.1	37	c.10871	CCDS45544.1	16	.	.	.	.	.	.	.	.	.	.	C	51	17.609040	0.99890	.	.	ENSG00000225614	ENST00000437464	.	.	.	4.65	-0.00955	0.14000	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	0.2419	3.6823	0.08314	0.1595:0.4401:0.3102:0.0902	.	.	.	.	X	3624	.	ENSP00000402343:S3624X	S	+	2	0	ZNF469	87032334	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	0.014000	0.13333	-0.243000	0.09653	0.561000	0.74099	TCA	ZNF469	-	NULL	ENSG00000225614		0.632	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF469	HGNC	protein_coding		15	0.00	0	C	NG_012236		88504833	88504833	+1	no_errors	ENST00000437464	ensembl	human	known	69_37n	nonsense	22	24.14	7	SNP	0.000	G
ZNF480	147657	genome.wustl.edu	37	19	52825581	52825581	+	Nonsense_Mutation	SNP	C	C	T	rs538245309		TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr19:52825581C>T	ENST00000595962.1	+	5	1144	c.1078C>T	c.(1078-1080)Cga>Tga	p.R360*	ZNF480_ENST00000335090.6_Nonsense_Mutation_p.R283*|ZNF480_ENST00000490272.1_3'UTR|CTD-2525I3.6_ENST00000594379.1_RNA|ZNF480_ENST00000334564.7_Nonsense_Mutation_p.R317*	NM_144684.2	NP_653285.2	Q8WV37	ZN480_HUMAN	zinc finger protein 480	360					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	12				GBM - Glioblastoma multiforme(134;0.00212)|OV - Ovarian serous cystadenocarcinoma(262;0.00369)		GCTCCTTGTACGACATCAGAA	0.378													C|||	1	0.000199681	0.0	0.0	5008	,	,		19811	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													56.0	61.0	60.0					19																	52825581		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY512662	CCDS12850.2, CCDS74437.1	19q13.41	2013-01-08			ENSG00000198464	ENSG00000198464		"""Zinc fingers, C2H2-type"", ""-"""	23305	protein-coding gene	gene with protein product		613910				15219843	Standard	XM_005258525		Approved	MGC32104	uc010ydl.2	Q8WV37	OTTHUMG00000157507	ENST00000595962.1:c.1078C>T	19.37:g.52825581C>T	ENSP00000471754:p.Arg360*		Q5JPG9|Q6P0Q4|Q8N1M5	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R360*	ENST00000595962.1	37	c.1078	CCDS12850.2	19	.	.	.	.	.	.	.	.	.	.	C	13.06	2.125781	0.37533	.	.	ENSG00000198464	ENST00000468240;ENST00000334564;ENST00000335090	.	.	.	2.25	-1.97	0.07503	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	.	1.3731	0.02215	0.3463:0.3684:0.1205:0.1648	.	.	.	.	X	360;317;283	.	ENSP00000334164:R317X	R	+	1	2	ZNF480	57517393	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-2.383000	0.01063	-0.802000	0.04421	-0.499000	0.04595	CGA	ZNF480	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198464		0.378	ZNF480-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF480	HGNC	protein_coding	OTTHUMT00000349001.3	117	0.00	0	C	NM_144684		52825581	52825581	+1	no_errors	ENST00000468240	ensembl	human	known	69_37n	nonsense	69	10.39	8	SNP	0.000	T
ZNF609	23060	genome.wustl.edu	37	15	64792007	64792007	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr15:64792007A>G	ENST00000326648.3	+	1	517	c.389A>G	c.(388-390)aAt>aGt	p.N130S	ZNF609_ENST00000416172.1_Missense_Mutation_p.N130S	NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	130						nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GATGGTGCCAATGCTGGAGGC	0.572																																						dbGAP											0													47.0	50.0	49.0					15																	64792007		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.389A>G	15.37:g.64792007A>G	ENSP00000316527:p.Asn130Ser		Q0D2I2	Missense_Mutation	SNP	pfscan_Znf_C2H2	p.N130S	ENST00000326648.3	37	c.389	CCDS32270.1	15	.	.	.	.	.	.	.	.	.	.	.	4.476	0.088291	0.08583	.	.	ENSG00000180357	ENST00000416172;ENST00000326648	T	0.42513	0.97	5.5	1.83	0.25207	.	0.424946	0.27816	N	0.017733	T	0.15825	0.0381	N	0.11064	0.09	0.25388	N	0.988556	B;B	0.06786	0.0;0.001	B;B	0.06405	0.002;0.002	T	0.30001	-0.9993	10	0.02654	T	1	-15.3499	4.4121	0.11438	0.6466:0.0:0.2198:0.1336	.	130;130	E7ERY8;O15014	.;ZN609_HUMAN	S	130	ENSP00000316527:N130S	ENSP00000316527:N130S	N	+	2	0	ZNF609	62579060	0.870000	0.30015	0.997000	0.53966	0.983000	0.72400	0.622000	0.24433	0.106000	0.17784	-0.279000	0.10071	AAT	ZNF609	-	NULL	ENSG00000180357		0.572	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF609	HGNC	protein_coding	OTTHUMT00000418130.1	186	0.53	1	A	XM_042833		64792007	64792007	+1	no_errors	ENST00000326648	ensembl	human	known	69_37n	missense	78	46.94	69	SNP	0.993	G
ZNF786	136051	genome.wustl.edu	37	7	148767652	148767652	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr7:148767652C>T	ENST00000491431.1	-	4	2276	c.2212G>A	c.(2212-2214)Ggg>Agg	p.G738R	ZNF786_ENST00000451334.3_Missense_Mutation_p.G701R|ZNF786_ENST00000316286.9_Missense_Mutation_p.G652R	NM_152411.3	NP_689624.2	Q8N393	ZN786_HUMAN	zinc finger protein 786	738					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(2)	26	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			AAGCCCTTCCCACAATCGCCA	0.527																																						dbGAP											0													151.0	153.0	152.0					7																	148767652		2029	4207	6236	-	-	-	SO:0001583	missense	0			AK095701, AL834510	CCDS47738.1	7q36.1	2013-01-08			ENSG00000197362	ENSG00000197362		"""Zinc fingers, C2H2-type"", ""-"""	21806	protein-coding gene	gene with protein product							Standard	NM_152411		Approved	DKFZp762I137	uc003wfh.2	Q8N393	OTTHUMG00000158975	ENST00000491431.1:c.2212G>A	7.37:g.148767652C>T	ENSP00000417470:p.Gly738Arg		A1A568|B4DMI1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G738R	ENST00000491431.1	37	c.2212	CCDS47738.1	7	.	.	.	.	.	.	.	.	.	.	C	21.0	4.088690	0.76756	.	.	ENSG00000197362	ENST00000316286;ENST00000491431;ENST00000451334	T;T;T	0.65732	-0.17;-0.17;-0.17	4.45	4.45	0.53987	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.37483	N	0.002074	T	0.77738	0.4175	M	0.77486	2.375	0.49299	D	0.999773	D	0.89917	1.0	D	0.91635	0.999	T	0.80061	-0.1540	10	0.62326	D	0.03	-32.1534	12.492	0.55905	0.0:1.0:0.0:0.0	.	738	Q8N393	ZN786_HUMAN	R	652;738;701	ENSP00000313516:G652R;ENSP00000417470:G738R;ENSP00000404984:G701R	ENSP00000313516:G652R	G	-	1	0	ZNF786	148398585	0.986000	0.35501	0.743000	0.31040	0.685000	0.39939	3.463000	0.53050	2.325000	0.78763	0.467000	0.42956	GGG	ZNF786	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197362		0.527	ZNF786-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF786	HGNC	protein_coding	OTTHUMT00000352751.1	317	0.00	0	C	NM_152411		148767652	148767652	-1	no_errors	ENST00000491431	ensembl	human	known	69_37n	missense	203	36.65	118	SNP	1.000	T
ZSCAN5A	79149	genome.wustl.edu	37	19	56735124	56735124	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A152-01A-11D-A12B-09	TCGA-E2-A152-10A-01D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b266b370-425c-4146-8b72-59248436618e	61e9e215-f15b-4968-9afc-4931ad991c80	g.chr19:56735124C>G	ENST00000587340.1	-	5	1159	c.464G>C	c.(463-465)aGa>aCa	p.R155T	ZSCAN5A_ENST00000391713.1_Missense_Mutation_p.R155T|ZSCAN5A_ENST00000254165.3_Missense_Mutation_p.R38T|ZSCAN5A_ENST00000592355.1_Missense_Mutation_p.R155T|ZSCAN5A_ENST00000587492.1_Missense_Mutation_p.R9T			Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A	155				R -> G (in Ref. 2; BAD97205). {ECO:0000305}.	regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(12)|ovary(1)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						CAGATCATCTCTGACACTGGA	0.552																																						dbGAP											0													78.0	72.0	74.0					19																	56735124		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK098700	CCDS12941.1	19q13.43	2013-01-08	2008-06-10	2008-06-10	ENSG00000131848	ENSG00000131848		"""-"", ""Zinc fingers, C2H2-type"""	23710	protein-coding gene	gene with protein product			"""zinc finger protein 495"", ""zinc finger and SCAN domain containing 5"""	ZNF495, ZSCAN5			Standard	NM_024303		Approved	MGC4161	uc002qmq.3	Q9BUG6		ENST00000587340.1:c.464G>C	19.37:g.56735124C>G	ENSP00000467631:p.Arg155Thr		B4DX98|Q49A73|Q53F04|Q8N7B3	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.R155T	ENST00000587340.1	37	c.464	CCDS12941.1	19	.	.	.	.	.	.	.	.	.	.	C	4.989	0.183668	0.09495	.	.	ENSG00000131848	ENST00000391713;ENST00000254165	T;T	0.05996	3.36;3.45	2.81	-5.62	0.02481	.	.	.	.	.	T	0.05502	0.0145	L	0.59912	1.85	0.09310	N	1	P;P	0.47106	0.89;0.89	B;B	0.43413	0.419;0.328	T	0.14504	-1.0470	9	0.13470	T	0.59	.	2.7885	0.05380	0.282:0.1945:0.4188:0.1046	.	38;155	B4DX98;Q9BUG6	.;ZSA5A_HUMAN	T	155;38	ENSP00000375593:R155T;ENSP00000254165:R38T	ENSP00000254165:R38T	R	-	2	0	ZSCAN5A	61426936	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.330000	0.01110	-1.429000	0.01987	-0.175000	0.13238	AGA	ZSCAN5A	-	NULL	ENSG00000131848		0.552	ZSCAN5A-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZSCAN5A	HGNC	protein_coding	OTTHUMT00000458110.1	113	0.00	0	C	NM_024303		56735124	56735124	-1	no_errors	ENST00000391713	ensembl	human	known	69_37n	missense	160	11.11	20	SNP	0.000	G
