#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA7	10347	genome.wustl.edu	37	19	1053382	1053382	+	Missense_Mutation	SNP	T	T	G	rs201213180		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr19:1053382T>G	ENST00000263094.6	+	24	3506	c.3275T>G	c.(3274-3276)gTg>gGg	p.V1092G	ABCA7_ENST00000435683.2_Missense_Mutation_p.V954G|ABCA7_ENST00000433129.1_Missense_Mutation_p.V1092G	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	1092					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCACGGCTGGTGGAGGAGCTG	0.682																																						dbGAP											0													16.0	14.0	15.0					19																	1053382		2177	4235	6412	-	-	-	SO:0001583	missense	0			AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.3275T>G	19.37:g.1053382T>G	ENSP00000263094:p.Val1092Gly		Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_GroES-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.V1092G	ENST00000263094.6	37	c.3275	CCDS12055.1	19	.	.	.	.	.	.	.	.	.	.	T	15.05	2.718371	0.48622	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	D;D	0.84516	-1.86;-1.86	4.57	3.54	0.40534	.	.	.	.	.	D	0.88254	0.6387	M	0.70842	2.15	0.48452	D	0.999655	P;P	0.49253	0.921;0.913	P;P	0.55508	0.777;0.638	D	0.88655	0.3185	9	0.87932	D	0	.	9.2199	0.37370	0.0:0.0905:0.0:0.9095	.	954;1092	Q8IZY2-2;Q8IZY2	.;ABCA7_HUMAN	G	1092	ENSP00000263094:V1092G;ENSP00000414062:V1092G	ENSP00000263094:V1092G	V	+	2	0	ABCA7	1004382	1.000000	0.71417	0.578000	0.28575	0.413000	0.31143	2.746000	0.47467	1.701000	0.51217	0.397000	0.26171	GTG	ABCA7	-	NULL	ENSG00000064687		0.682	ABCA7-001	KNOWN	basic|CCDS	protein_coding	ABCA7	HGNC	protein_coding	OTTHUMT00000394993.1	45	0.00	0	T	NM_019112		1053382	1053382	+1	no_errors	ENST00000263094	ensembl	human	known	69_37n	missense	8	57.89	11	SNP	0.997	G
AKAP3	10566	genome.wustl.edu	37	12	4736391	4736391	+	Silent	SNP	A	A	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr12:4736391A>G	ENST00000545990.2	-	5	2201	c.1677T>C	c.(1675-1677)ttT>ttC	p.F559F	AKAP3_ENST00000228850.1_Silent_p.F559F|RP11-500M8.7_ENST00000536588.1_Intron	NM_001278309.1	NP_001265238.1	O75969	AKAP3_HUMAN	A kinase (PRKA) anchor protein 3	559					acrosome reaction (GO:0007340)|cellular component movement (GO:0006928)|protein localization (GO:0008104)|single fertilization (GO:0007338)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	acrosomal vesicle (GO:0001669)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	protein kinase A binding (GO:0051018)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|liver(1)|lung(17)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	51						CATTGGCAGGAAAGTTGGTGG	0.517																																						dbGAP											0													44.0	45.0	44.0					12																	4736391		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U85715	CCDS8531.1	12p13.3	2009-03-12				ENSG00000111254		"""A-kinase anchor proteins"""	373	protein-coding gene	gene with protein product	"""Fibrous Sheath Protein of 95 kDa"", ""cancer/testis antigen 82"""	604689				10334916, 10319321	Standard	NM_001278309		Approved	FSP95, SOB1, AKAP110, CT82	uc001qnb.4	O75969		ENST00000545990.2:c.1677T>C	12.37:g.4736391A>G			O75945|Q86X01|Q9UM61	Silent	SNP	pfam_AKAP_110_C,pfam_RII_binding_1,smart_AKAP_110	p.F559	ENST00000545990.2	37	c.1677	CCDS8531.1	12																																																																																			AKAP3	-	pfam_AKAP_110_C,smart_AKAP_110	ENSG00000111254		0.517	AKAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP3	HGNC	protein_coding	OTTHUMT00000398911.2	98	0.00	0	A	NM_006422		4736391	4736391	-1	no_errors	ENST00000228850	ensembl	human	known	69_37n	silent	63	33.68	32	SNP	0.000	G
ANKRD27	84079	genome.wustl.edu	37	19	33098731	33098731	+	Missense_Mutation	SNP	G	G	C	rs201798259		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr19:33098731G>C	ENST00000306065.4	-	23	2341	c.2183C>G	c.(2182-2184)gCg>gGg	p.A728G	SNORA68_ENST00000364518.1_RNA	NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	728					early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					AGGAACCTTCGCCAGCCTCTG	0.627																																						dbGAP											0													14.0	15.0	14.0					19																	33098731		2201	4288	6489	-	-	-	SO:0001583	missense	0			AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.2183C>G	19.37:g.33098731G>C	ENSP00000304292:p.Ala728Gly		Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_VPS9,superfamily_Ankyrin_rpt-contain_dom,smart_VPS9_subgr,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_VPS9,prints_Ankyrin_rpt	p.A728G	ENST00000306065.4	37	c.2183	CCDS32986.1	19	.	.	.	.	.	.	.	.	.	.	G	7.285	0.609828	0.14066	.	.	ENSG00000105186	ENST00000306065	T	0.72051	-0.62	5.16	4.06	0.47325	Ankyrin repeat-containing domain (2);	0.556851	0.17161	N	0.184664	T	0.54967	0.1891	L	0.28054	0.825	0.20074	N	0.999936	P	0.40794	0.729	B	0.42214	0.38	T	0.42832	-0.9428	10	0.25751	T	0.34	-6.707	5.7055	0.17905	0.0791:0.1382:0.6404:0.1422	.	728	Q96NW4	ANR27_HUMAN	G	728	ENSP00000304292:A728G	ENSP00000304292:A728G	A	-	2	0	ANKRD27	37790571	0.094000	0.21725	0.966000	0.40874	0.035000	0.12851	1.053000	0.30442	2.578000	0.87016	0.655000	0.94253	GCG	ANKRD27	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000105186		0.627	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD27	HGNC	protein_coding	OTTHUMT00000450329.1	72	0.00	0	G	NM_032139		33098731	33098731	-1	no_errors	ENST00000306065	ensembl	human	known	69_37n	missense	18	55.00	22	SNP	0.167	C
ANKRD30A	91074	genome.wustl.edu	37	10	37486216	37486216	+	Silent	SNP	C	C	G	rs574286090	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	bf856604-4326-4145-bc3c-137098338f61	g.chr10:37486216C>G	ENST00000602533.1	+	28	2553	c.2454C>G	c.(2452-2454)ccC>ccG	p.P818P	ANKRD30A_ENST00000374660.1_Silent_p.P937P|ANKRD30A_ENST00000361713.1_Silent_p.P818P			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	874					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P818P(4)		NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						TAGAGCCTCCCGAGAAGCCAT	0.323													.|||	2	0.000399361	0.0015	0.0	5008	,	,		17579	0.0		0.0	False		,,,				2504	0.0					dbGAP											4	Substitution - coding silent(4)	lung(1)|ovary(1)|prostate(1)|kidney(1)											201.0	165.0	176.0					10																	37486216		1812	4087	5899	-	-	-	SO:0001819	synonymous_variant	0			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.2454C>G	10.37:g.37486216C>G			Q5W025	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.P818	ENST00000602533.1	37	c.2454		10																																																																																			ANKRD30A	-	NULL	ENSG00000148513		0.323	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ANKRD30A	HGNC	protein_coding	OTTHUMT00000047588.2	607	0.00	0	C	NM_052997		37486216	37486216	+1	no_errors	ENST00000361713	ensembl	human	known	69_37n	silent	378	47.73	347	SNP	0.011	G
ANKRD30A	91074	genome.wustl.edu	37	10	37486216	37486216	+	Silent	SNP	C	C	G	rs574286090	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr10:37486216C>G	ENST00000602533.1	+	28	2553	c.2454C>G	c.(2452-2454)ccC>ccG	p.P818P	ANKRD30A_ENST00000374660.1_Silent_p.P937P|ANKRD30A_ENST00000361713.1_Silent_p.P818P			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	874					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P818P(4)		NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						TAGAGCCTCCCGAGAAGCCAT	0.323													.|||	2	0.000399361	0.0015	0.0	5008	,	,		17579	0.0		0.0	False		,,,				2504	0.0					dbGAP											4	Substitution - coding silent(4)	lung(1)|ovary(1)|prostate(1)|kidney(1)											201.0	165.0	176.0					10																	37486216		1812	4087	5899	-	-	-	SO:0001819	synonymous_variant	0			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.2454C>G	10.37:g.37486216C>G			Q5W025	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.P818	ENST00000602533.1	37	c.2454		10																																																																																			ANKRD30A	-	NULL	ENSG00000148513		0.323	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ANKRD30A	HGNC	protein_coding	OTTHUMT00000047588.2	67	0.00	0	C	NM_052997		37486216	37486216	+1	no_errors	ENST00000361713	ensembl	human	known	69_37n	silent	378	47.73	347	SNP	0.011	G
APH1A	51107	genome.wustl.edu	37	1	150238892	150238892	+	Intron	SNP	T	T	G	rs201680381	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr1:150238892T>G	ENST00000369109.3	-	6	922				C1orf54_ENST00000369102.1_5'Flank|APH1A_ENST00000461320.1_5'UTR|APH1A_ENST00000414276.2_Intron|APH1A_ENST00000360244.4_3'UTR	NM_001077628.2	NP_001071096.1	Q96BI3	APH1A_HUMAN	APH1A gamma secretase subunit						amyloid precursor protein catabolic process (GO:0042987)|apoptotic signaling pathway (GO:0097190)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|metanephros development (GO:0001656)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|protein processing (GO:0016485)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase activity (GO:0004175)			breast(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(2)	9	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			GACAGGCAGGTGGGATCTGTC	0.607																																						dbGAP											0													26.0	29.0	28.0					1																	150238892		2075	4211	6286	-	-	-	SO:0001627	intron_variant	0			AF151835	CCDS41390.1, CCDS41391.1, CCDS58025.1	1q21.2	2013-05-01	2013-05-01		ENSG00000117362	ENSG00000117362			29509	protein-coding gene	gene with protein product		607629	"""anterior pharynx defective 1 homolog A (C. elegans)"""			10810093, 12110170	Standard	NM_001077628		Approved	APH-1A, CGI-78	uc001ety.2	Q96BI3	OTTHUMG00000012545	ENST00000369109.3:c.733+40A>C	1.37:g.150238892T>G			B4DQK0|Q5TB22|Q5TB23|Q969R6|Q9BVG0|Q9Y386	RNA	SNP	-	NULL	ENST00000369109.3	37	NULL	CCDS41390.1	1																																																																																			APH1A	-	-	ENSG00000117362		0.607	APH1A-002	KNOWN	basic|CCDS	protein_coding	APH1A	HGNC	protein_coding	OTTHUMT00000035048.1	68	0.00	0	T	NM_016022		150238892	150238892	-1	no_errors	ENST00000461320	ensembl	human	known	69_37n	rna	19	53.49	23	SNP	0.999	G
APOBEC3H	164668	genome.wustl.edu	37	22	39498014	39498014	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr22:39498014T>G	ENST00000401756.1	+	4	586	c.510T>G	c.(508-510)agT>agG	p.S170R	APOBEC3H_ENST00000421988.2_Intron|APOBEC3H_ENST00000348946.4_Missense_Mutation_p.S170R|APOBEC3H_ENST00000442487.3_Missense_Mutation_p.S170R	NM_001166003.1	NP_001159475.1	Q6NTF7	ABC3H_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3H	170					cytidine deamination (GO:0009972)|defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transposition (GO:0010529)|negative regulation of viral process (GO:0048525)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|nucleus (GO:0005634)	cytidine deaminase activity (GO:0004126)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(8)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	15	Melanoma(58;0.04)					ATAAAAACAGTCGAGCCATAA	0.547																																						dbGAP											0													49.0	44.0	46.0					22																	39498014		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC069023	CCDS13985.1, CCDS54530.1, CCDS54531.1, CCDS54532.1	22q13.1	2007-02-01			ENSG00000100298	ENSG00000100298		"""Apolipoprotein B mRNA editing enzymes"""	24100	protein-coding gene	gene with protein product		610976				16571802	Standard	NM_001166003		Approved	ARP10	uc021wpt.1	Q6NTF7	OTTHUMG00000151082	ENST00000401756.1:c.510T>G	22.37:g.39498014T>G	ENSP00000385741:p.Ser170Arg		B0QYP0|B0QYP1|B7TQM5|E9PF38|Q5JYL9|Q6IC87	Missense_Mutation	SNP	pfam_APOBEC_N,pfam_APOBEC_C,pfam_CMP_dCMP_Zn-bd,superfamily_Cytidine_deaminase-like	p.S170R	ENST00000401756.1	37	c.510	CCDS54530.1	22	.	.	.	.	.	.	.	.	.	.	.	12.37	1.918497	0.33908	.	.	ENSG00000100298	ENST00000348946;ENST00000442487;ENST00000401756	T;T;T	0.66099	-0.19;-0.19;-0.19	3.21	-1.67	0.08238	.	.	.	.	.	T	0.76983	0.4064	M	0.86268	2.805	0.09310	N	1	D	0.89917	1.0	D	0.79784	0.993	T	0.67356	-0.5691	9	0.87932	D	0	.	8.7141	0.34401	0.0:0.4888:0.0:0.5112	.	170	B7TQM3	.	R	170	ENSP00000216123:S170R;ENSP00000411754:S170R;ENSP00000385741:S170R	ENSP00000216123:S170R	S	+	3	2	APOBEC3H	37827960	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.342000	0.02645	-0.790000	0.04492	-1.843000	0.00578	AGT	APOBEC3H	-	pfam_APOBEC_C	ENSG00000100298		0.547	APOBEC3H-002	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	APOBEC3H	HGNC	protein_coding	OTTHUMT00000321230.1	129	0.00	0	T	NM_181773		39498014	39498014	+1	no_errors	ENST00000442487	ensembl	human	known	69_37n	missense	56	17.81	13	SNP	0.000	G
ASB10	136371	genome.wustl.edu	37	7	150884015	150884015	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr7:150884015C>G	ENST00000420175.2	-	1	227	c.203G>C	c.(202-204)gGc>gCc	p.G68A	ASB10_ENST00000275838.1_Missense_Mutation_p.G68A|ASB10_ENST00000377867.3_Intron|ASB10_ENST00000434669.1_Missense_Mutation_p.G113A|ASB10_ENST00000422024.1_Missense_Mutation_p.G113A			Q8WXI3	ASB10_HUMAN	ankyrin repeat and SOCS box containing 10	68					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(2)|lung(7)|skin(2)	12			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GGAGACACAGCCCACGTCCCC	0.632																																						dbGAP											0													33.0	36.0	35.0					7																	150884015		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK055536	CCDS5921.2, CCDS47749.1, CCDS47750.1, CCDS47749.2, CCDS47750.2	7q35	2014-02-04	2011-01-25		ENSG00000146926	ENSG00000146926		"""Ankyrin repeat domain containing"""	17185	protein-coding gene	gene with protein product		615054	"""ankyrin repeat and SOCS box-containing 10"", ""glaucoma 1, open angle, F (adult-onset)"""	GLC1F		22156576	Standard	NM_080871		Approved		uc003wjm.1	Q8WXI3	OTTHUMG00000157013	ENST00000420175.2:c.203G>C	7.37:g.150884015C>G	ENSP00000391137:p.Gly68Ala		A0AVH0|Q6ZUL6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C	p.G113A	ENST00000420175.2	37	c.338	CCDS47750.2	7	.	.	.	.	.	.	.	.	.	.	C	0.036	-1.306291	0.01353	.	.	ENSG00000146926	ENST00000275838;ENST00000422024;ENST00000434669;ENST00000420175	T;T;T;T	0.52526	0.66;0.66;0.66;0.66	4.37	3.42	0.39159	Ankyrin repeat-containing domain (1);	.	.	.	.	T	0.21921	0.0528	N	0.01473	-0.845	0.22779	N	0.998741	B;B	0.10296	0.001;0.003	B;B	0.14578	0.006;0.011	T	0.09930	-1.0652	9	0.28530	T	0.3	-5.8314	12.2904	0.54815	0.0:0.8302:0.1698:0.0	.	68;113	Q8WXI3;D5MNW9	ASB10_HUMAN;.	A	68;113;113;68	ENSP00000275838:G68A;ENSP00000401369:G113A;ENSP00000398247:G113A;ENSP00000391137:G68A	ENSP00000275838:G68A	G	-	2	0	ASB10	150514948	0.022000	0.18835	0.960000	0.40013	0.036000	0.12997	0.967000	0.29344	2.143000	0.66587	0.491000	0.48974	GGC	ASB10	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000146926		0.632	ASB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB10	HGNC	protein_coding	OTTHUMT00000347096.3	90	0.00	0	C	NM_080871		150884015	150884015	-1	no_errors	ENST00000422024	ensembl	human	known	69_37n	missense	26	44.68	21	SNP	0.922	G
ASB9	140462	genome.wustl.edu	37	X	15262576	15262576	+	3'UTR	SNP	C	C	A	rs201067436		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chrX:15262576C>A	ENST00000380488.4	-	0	1210				ASB9_ENST00000380485.3_3'UTR|ASB9_ENST00000473862.1_5'UTR|ASB9_ENST00000380483.3_3'UTR|ASB9_ENST00000546332.1_3'UTR	NM_001031739.2	NP_001026909.1	Q96DX5	ASB9_HUMAN	ankyrin repeat and SOCS box containing 9						intracellular signal transduction (GO:0035556)|positive regulation of protein catabolic process (GO:0045732)|protein ubiquitination (GO:0016567)	mitochondrion (GO:0005739)				breast(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(10)	15	Hepatocellular(33;0.183)					CTAGTGGCTACAACACTCAAT	0.328													C|||	328	0.0868874	0.0348	0.0778	3775	,	,		14294	0.126		0.0964	False		,,,				2504	0.0041					dbGAP											0													65.0	66.0	66.0					X																	15262576		876	1991	2867	-	-	-	SO:0001624	3_prime_UTR_variant	0			AK000643	CCDS14163.1, CCDS35208.1, CCDS55372.1	Xp22.2	2013-01-10	2011-01-25		ENSG00000102048	ENSG00000102048		"""Ankyrin repeat domain containing"""	17184	protein-coding gene	gene with protein product		300890	"""ankyrin repeat and SOCS box-containing 9"""			12076535	Standard	NM_001031739		Approved	DKFZP564L0862, MGC4954, FLJ20636	uc004cwl.3	Q96DX5	OTTHUMG00000021172	ENST00000380488.4:c.*52G>T	X.37:g.15262576C>A			A8K8A5|Q9BVF5|Q9NWS5|Q9Y4T3	RNA	SNP	-	NULL	ENST00000380488.4	37	NULL	CCDS35208.1	X																																																																																			ASB9	-	-	ENSG00000102048		0.328	ASB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB9	HGNC	protein_coding	OTTHUMT00000055844.1	70	0.00	0	C			15262576	15262576	-1	no_errors	ENST00000473862	ensembl	human	known	69_37n	rna	98	47.59	89	SNP	0.000	A
ATG9B	285973	genome.wustl.edu	37	7	150721193	150721193	+	Silent	SNP	T	T	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr7:150721193T>G	ENST00000377974.2	-	1	393	c.318A>C	c.(316-318)acA>acC	p.T106T	ATG9B_ENST00000605952.1_Silent_p.T106T|ATG9B_ENST00000605938.1_Silent_p.T106T|ATG9B_ENST00000494791.1_5'UTR|ATG9B_ENST00000444312.1_5'UTR			Q674R7	ATG9B_HUMAN	autophagy related 9B	106	Pro-rich.				autophagic vacuole assembly (GO:0000045)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(4)|prostate(1)	14	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CAGAGGCAGGTGTCATTGCAG	0.657																																						dbGAP											0													15.0	19.0	17.0					7																	150721193		2000	4143	6143	-	-	-	SO:0001819	synonymous_variant	0			AK027791		7q36	2014-02-12	2012-06-06	2005-09-11	ENSG00000181652	ENSG00000181652			21899	protein-coding gene	gene with protein product		612205	"""nitric oxide synthase 3 antisense"", ""ATG9 autophagy related 9 homolog B (S. cerevisiae)"""	NOS3AS		15234981, 15755735	Standard	NM_173681		Approved	FLJ14885, APG9L2, SONE	uc011kvc.2	Q674R7	OTTHUMG00000158634	ENST00000377974.2:c.318A>C	7.37:g.150721193T>G			A1A5D3|Q6JRW5|Q8N8I8	RNA	SNP	-	NULL	ENST00000377974.2	37	NULL		7																																																																																			ATG9B	-	-	ENSG00000181652		0.657	ATG9B-201	KNOWN	basic|appris_principal	protein_coding	ATG9B	HGNC	protein_coding		44	0.00	0	T	NM_173681		150721193	150721193	-1	no_errors	ENST00000377974	ensembl	human	known	69_37n	rna	25	45.65	21	SNP	0.000	G
ATP8B3	148229	genome.wustl.edu	37	19	1782989	1782989	+	3'UTR	SNP	T	T	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr19:1782989T>G	ENST00000310127.6	-	0	4179				ATP8B3_ENST00000539485.1_3'UTR	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3						binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGTGGCTGGTGCTTCTTCTT	0.522																																						dbGAP											0													30.0	31.0	31.0					19																	1782989		1973	4149	6122	-	-	-	SO:0001624	3_prime_UTR_variant	0			AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.*38A>C	19.37:g.1782989T>G			Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	RNA	SNP	-	NULL	ENST00000310127.6	37	NULL	CCDS45901.1	19																																																																																			ATP8B3	-	-	ENSG00000130270		0.522	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	ATP8B3	HGNC	protein_coding	OTTHUMT00000388279.1	44	0.00	0	T	NM_138813		1782989	1782989	-1	no_errors	ENST00000546207	ensembl	human	known	69_37n	rna	50	49.00	49	SNP	0.000	G
BARHL1	56751	genome.wustl.edu	37	9	135458334	135458334	+	Silent	SNP	G	G	C			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr9:135458334G>C	ENST00000263610.2	+	1	763	c.150G>C	c.(148-150)tcG>tcC	p.S50S	BARHL1_ENST00000542090.1_Silent_p.S50S	NM_020064.3	NP_064448.1	Q9BZE3	BARH1_HUMAN	BarH-like homeobox 1	50					midbrain development (GO:0030901)|negative regulation of neuron apoptotic process (GO:0043524)|neuron migration (GO:0001764)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			cervix(1)|large_intestine(2)|lung(2)|skin(3)	8				OV - Ovarian serous cystadenocarcinoma(145;1.79e-06)|Epithelial(140;3.12e-05)		ACTGCTCTTCGCCAGCCTCTC	0.701																																						dbGAP											0													38.0	45.0	43.0					9																	135458334		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0			AJ237816	CCDS6950.1	9q34.13	2011-06-20	2007-07-09		ENSG00000125492	ENSG00000125492		"""Homeoboxes / ANTP class : NKL subclass"""	953	protein-coding gene	gene with protein product		605211	"""BarH (Drosophila)-like 1"""				Standard	NM_020064		Approved		uc004cbp.1	Q9BZE3	OTTHUMG00000020839	ENST00000263610.2:c.150G>C	9.37:g.135458334G>C			Q5T6V2|Q9NY88	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.S50	ENST00000263610.2	37	c.150	CCDS6950.1	9																																																																																			BARHL1	-	NULL	ENSG00000125492		0.701	BARHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BARHL1	HGNC	protein_coding	OTTHUMT00000054789.2	51	0.00	0	G			135458334	135458334	+1	no_errors	ENST00000263610	ensembl	human	known	69_37n	silent	20	48.72	19	SNP	0.932	C
BCAT2	587	genome.wustl.edu	37	19	49303276	49303276	+	Missense_Mutation	SNP	T	T	G	rs200989265		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr19:49303276T>G	ENST00000316273.6	-	5	505	c.493A>C	c.(493-495)Acc>Ccc	p.T165P	BCAT2_ENST00000598162.1_Missense_Mutation_p.T165P|BCAT2_ENST00000545387.2_Missense_Mutation_p.T73P|BCAT2_ENST00000402551.1_Missense_Mutation_p.T125P|BCAT2_ENST00000597011.1_Missense_Mutation_p.T125P|BCAT2_ENST00000599246.1_Missense_Mutation_p.T73P	NM_001190.3	NP_001181.2	O15382	BCAT2_HUMAN	branched chain amino-acid transaminase 2, mitochondrial	165					branched-chain amino acid biosynthetic process (GO:0009082)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|isoleucine catabolic process (GO:0006550)|leucine metabolic process (GO:0006551)|regulation of hormone levels (GO:0010817)|small molecule metabolic process (GO:0044281)|valine metabolic process (GO:0006573)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	branched-chain-amino-acid transaminase activity (GO:0004084)|L-isoleucine transaminase activity (GO:0052656)|L-leucine transaminase activity (GO:0052654)|L-valine transaminase activity (GO:0052655)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	12		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.000366)|Epithelial(262;0.0195)|GBM - Glioblastoma multiforme(486;0.0224)	L-Isoleucine(DB00167)|L-Leucine(DB00149)	TAGAGGCTGGTGCCGGCGGCA	0.632																																						dbGAP											0													22.0	27.0	25.0					19																	49303276		2202	4299	6501	-	-	-	SO:0001583	missense	0			U68418	CCDS12735.1, CCDS54290.1, CCDS74416.1	19q13.33	2013-09-20	2010-05-07		ENSG00000105552	ENSG00000105552	2.6.1.42		977	protein-coding gene	gene with protein product		113530	"""branched chain aminotransferase 2, mitochondrial"""	BCT2		9165094	Standard	NM_001190		Approved	BCAM	uc002pkr.3	O15382	OTTHUMG00000183327	ENST00000316273.6:c.493A>C	19.37:g.49303276T>G	ENSP00000322991:p.Thr165Pro		B2RB87|O00269|Q96KG1|Q9BTB6|Q9BUU6	Missense_Mutation	SNP	pfam_Aminotrans_IV,superfamily_Aminotrans_IV,pirsf_B_amino_transII,tigrfam_B_amino_transII	p.T165P	ENST00000316273.6	37	c.493	CCDS12735.1	19	.	.	.	.	.	.	.	.	.	.	T	15.32	2.799625	0.50208	.	.	ENSG00000105552	ENST00000316273;ENST00000545387;ENST00000402551	T;T;T	0.20463	2.07;2.07;2.07	4.86	3.84	0.44239	.	0.169295	0.52532	D	0.000067	T	0.36166	0.0957	M	0.88704	2.975	0.36424	D	0.864504	P;P;B;P	0.35383	0.498;0.498;0.182;0.498	B;P;B;B	0.45119	0.431;0.47;0.241;0.354	T	0.37337	-0.9710	10	0.39692	T	0.17	-18.8562	6.7033	0.23236	0.0:0.1897:0.0:0.8103	.	125;165;73;165	B3KSI3;Q53EW7;O15382-2;O15382	.;.;.;BCAT2_HUMAN	P	165;73;125	ENSP00000322991:T165P;ENSP00000440973:T73P;ENSP00000385161:T125P	ENSP00000322991:T165P	T	-	1	0	BCAT2	53995088	0.996000	0.38824	0.928000	0.36995	0.299000	0.27559	2.092000	0.41700	0.796000	0.33947	0.459000	0.35465	ACC	BCAT2	-	pfam_Aminotrans_IV,superfamily_Aminotrans_IV,pirsf_B_amino_transII,tigrfam_B_amino_transII	ENSG00000105552		0.632	BCAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAT2	HGNC	protein_coding	OTTHUMT00000466202.1	126	0.79	1	T			49303276	49303276	-1	no_errors	ENST00000316273	ensembl	human	known	69_37n	missense	15	65.91	29	SNP	0.914	G
BTNL8	79908	genome.wustl.edu	37	5	180335598	180335598	+	Missense_Mutation	SNP	T	T	G	rs201214790	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr5:180335598T>G	ENST00000340184.4	+	2	268	c.62T>G	c.(61-63)gTg>gGg	p.V21G	Y_RNA_ENST00000410920.1_RNA|BTNL8_ENST00000231229.4_Missense_Mutation_p.V21G|BTNL8_ENST00000400707.3_Intron|BTNL8_ENST00000505126.1_5'Flank|BTNL8_ENST00000511704.1_Intron|BTNL8_ENST00000508408.1_Missense_Mutation_p.V21G|BTNL8_ENST00000533815.2_5'Flank	NM_001040462.2	NP_001035552.1	Q6UX41	BTNL8_HUMAN	butyrophilin-like 8	21	Ig-like V-type 1.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)		p.V21G(3)		breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	28	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CAGTGGCAGGTGTTTGGGCCA	0.547																																						dbGAP											3	Substitution - Missense(3)	large_intestine(3)											47.0	49.0	48.0					5																	180335598		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK025111	CCDS4459.1, CCDS43413.1, CCDS54956.1, CCDS54957.1, CCDS54958.1, CCDS54959.1	5q35.3	2014-01-14			ENSG00000113303	ENSG00000113303		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	26131	protein-coding gene	gene with protein product		615606				12975309	Standard	NM_024850		Approved	FLJ21458, BTN9.2	uc003mmp.3	Q6UX41	OTTHUMG00000130932	ENST00000340184.4:c.62T>G	5.37:g.180335598T>G	ENSP00000342197:p.Val21Gly		A4QMZ8|A6NEX6|B7Z409|B7Z5B1|E9PEF6|E9PG07|F2Z2B2|F8W712|Q9H730	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,superfamily_ConA-like_lec_gl,smart_Ig_sub,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Ig-like	p.V21G	ENST00000340184.4	37	c.62	CCDS43413.1	5	.	.	.	.	.	.	.	.	.	.	T	14.64	2.595570	0.46318	.	.	ENSG00000113303	ENST00000231229;ENST00000340184;ENST00000508408	T;T;T	0.72167	-0.63;-0.63;-0.63	2.58	2.58	0.30949	Immunoglobulin V-set (1);	.	.	.	.	D	0.84866	0.5567	M	0.92923	3.36	0.09310	P	0.999999999143561	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.87135	0.2199	8	0.87932	D	0	.	6.9269	0.24419	0.0:0.0:0.0:1.0	.	21;21;21	F2Z2B2;A6NEX6;Q6UX41	.;.;BTNL8_HUMAN	G	21	ENSP00000231229:V21G;ENSP00000342197:V21G;ENSP00000424585:V21G	ENSP00000231229:V21G	V	+	2	0	BTNL8	180268204	0.811000	0.29063	0.776000	0.31678	0.071000	0.16799	3.679000	0.54634	1.197000	0.43143	0.358000	0.22013	GTG	BTNL8	-	pfam_Ig_V-set	ENSG00000113303		0.547	BTNL8-002	KNOWN	basic|CCDS	protein_coding	BTNL8	HGNC	protein_coding	OTTHUMT00000368440.1	40	0.00	0	T	NM_024850		180335598	180335598	+1	no_errors	ENST00000340184	ensembl	human	known	69_37n	missense	50	56.80	71	SNP	0.867	G
MYRF	745	genome.wustl.edu	37	11	61544784	61544784	+	Missense_Mutation	SNP	C	C	G	rs199625782		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr11:61544784C>G	ENST00000278836.5	+	12	1735	c.1639C>G	c.(1639-1641)Cgg>Ggg	p.R547G	TMEM258_ENST00000535042.1_Intron|MYRF_ENST00000389602.4_5'Flank|MYRF_ENST00000327797.1_Missense_Mutation_p.R172G|MYRF_ENST00000265460.5_Missense_Mutation_p.R538G	NM_001127392.1	NP_001120864.1	Q9Y2G1	MRF_HUMAN	myelin regulatory factor	547					central nervous system myelin maintenance (GO:0032286)|central nervous system myelination (GO:0022010)|oligodendrocyte development (GO:0014003)|oligodendrocyte differentiation (GO:0048709)|positive regulation of myelination (GO:0031643)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GTTGTGGCAGCGGGCACAGGT	0.647																																						dbGAP											0													46.0	45.0	45.0					11																	61544784		2199	4293	6492	-	-	-	SO:0001583	missense	0				CCDS31579.1, CCDS44622.1	11q12-q13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000124920	ENSG00000124920			1181	protein-coding gene	gene with protein product	"""myelin gene regulatory factor"""	608329	"""chromosome 11 open reading frame 9"""	C11orf9		10828591, 12384578	Standard	NM_001127392		Approved	Ndt80, pqn-47, MRF	uc001nsc.1	Q9Y2G1	OTTHUMG00000168161	ENST00000278836.5:c.1639C>G	11.37:g.61544784C>G	ENSP00000278836:p.Arg547Gly		O43582|Q9P1Q6	Missense_Mutation	SNP	pfam_NDT80_DNA-bd_dom,superfamily_p53-like_TF_DNA-bd	p.R547G	ENST00000278836.5	37	c.1639	CCDS44622.1	11	.	.	.	.	.	.	.	.	.	.	C	17.33	3.361963	0.61403	.	.	ENSG00000124920	ENST00000278836;ENST00000265460;ENST00000327797	T;T;T	0.53857	1.06;1.04;0.6	3.83	1.84	0.25277	.	0.000000	0.85682	D	0.000000	T	0.68430	0.3000	M	0.80183	2.485	0.80722	D	1	D;D	0.71674	0.998;0.989	D;P	0.74674	0.984;0.809	T	0.68108	-0.5496	10	0.87932	D	0	-18.0937	8.332	0.32191	0.1546:0.7604:0.0:0.085	.	538;547	Q9Y2G1-2;Q9Y2G1	.;MRF_HUMAN	G	547;538;172	ENSP00000278836:R547G;ENSP00000265460:R538G;ENSP00000333261:R172G	ENSP00000265460:R538G	R	+	1	2	C11orf9	61301360	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	4.462000	0.60121	0.336000	0.23639	0.313000	0.20887	CGG	C11orf9	-	NULL	ENSG00000124920		0.647	MYRF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C11orf9	HGNC	protein_coding	OTTHUMT00000398519.2	78	0.00	0	C	NM_013279		61544784	61544784	+1	no_errors	ENST00000278836	ensembl	human	known	69_37n	missense	21	34.38	11	SNP	1.000	G
C15orf59	388135	genome.wustl.edu	37	15	74032293	74032293	+	Missense_Mutation	SNP	T	T	G	rs186014243		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr15:74032293T>G	ENST00000569673.1	-	3	2051	c.847A>C	c.(847-849)Aca>Cca	p.T283P	C15orf59_ENST00000379822.4_Missense_Mutation_p.T283P|C15orf59_ENST00000558834.1_5'UTR			Q2T9L4	CO059_HUMAN	chromosome 15 open reading frame 59	283										breast(1)|endometrium(2)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CTAGTGGCTGTGTAGGGCAGA	0.542																																						dbGAP											0													90.0	98.0	96.0					15																	74032293		2198	4297	6495	-	-	-	SO:0001583	missense	0				CCDS32289.1	15q24.1	2012-09-27			ENSG00000205363	ENSG00000205363			33753	protein-coding gene	gene with protein product							Standard	XM_005254369		Approved	MGC131524, LOC388135	uc002avy.3	Q2T9L4	OTTHUMG00000172556	ENST00000569673.1:c.847A>C	15.37:g.74032293T>G	ENSP00000457205:p.Thr283Pro			Missense_Mutation	SNP	superfamily_Polyketide_synth_docking	p.T283P	ENST00000569673.1	37	c.847	CCDS32289.1	15	654	0.29945054945054944	104	0.21138211382113822	111	0.30662983425414364	214	0.3741258741258741	225	0.29683377308707126	T	16.25	3.069457	0.55539	.	.	ENSG00000205363	ENST00000379822	.	.	.	5.1	3.75	0.43078	.	0.291126	0.32244	N	0.006376	T	0.00012	0.0000	L	0.36672	1.1	0.34691	P	0.274282	B	0.25105	0.118	B	0.31245	0.126	T	0.34477	-0.9827	8	0.59425	D	0.04	.	7.3865	0.26884	0.0:0.2349:0.0:0.7651	.	283	Q2T9L4	CO059_HUMAN	P	283	.	ENSP00000369150:T283P	T	-	1	0	C15orf59	71819346	1.000000	0.71417	0.984000	0.44739	0.952000	0.60782	2.118000	0.41949	1.906000	0.55180	0.459000	0.35465	ACA	C15orf59	-	NULL	ENSG00000205363		0.542	C15orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf59	HGNC	protein_coding	OTTHUMT00000419077.2	53	0.00	0	T	NM_001039614		74032293	74032293	-1	no_errors	ENST00000379822	ensembl	human	known	69_37n	missense	25	56.90	33	SNP	0.995	G
C1orf123	54987	genome.wustl.edu	37	1	53683750	53683750	+	Intron	SNP	T	T	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr1:53683750T>G	ENST00000294360.4	-	5	303				C1orf123_ENST00000470385.1_Intron|RP5-1024G6.7_ENST00000569869.1_RNA	NM_017887.1	NP_060357.1	Q9NWV4	CA123_HUMAN	chromosome 1 open reading frame 123							extracellular vesicular exosome (GO:0070062)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|pancreas(2)|skin(1)	6						CTATGGCAGGTCACTCTGATG	0.448																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC010908	CCDS576.1	1p32.3	2011-02-18			ENSG00000162384	ENSG00000162384			26059	protein-coding gene	gene with protein product						12477932	Standard	NM_017887		Approved	FLJ20580	uc001cvd.3	Q9NWV4	OTTHUMG00000008940	ENST00000294360.4:c.261+93A>C	1.37:g.53683750T>G				RNA	SNP	-	NULL	ENST00000294360.4	37	NULL	CCDS576.1	1																																																																																			C1orf123	-	-	ENSG00000162384		0.448	C1orf123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf123	HGNC	protein_coding	OTTHUMT00000024751.1	30	0.00	0	T	NM_017887		53683750	53683750	-1	no_errors	ENST00000478839	ensembl	human	known	69_37n	rna	20	63.16	36	SNP	0.000	G
GUCD1	83606	genome.wustl.edu	37	22	24939827	24939827	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr22:24939827T>G	ENST00000407471.3	-	5	801	c.611A>C	c.(610-612)aAc>aCc	p.N204T	GUCD1_ENST00000404664.3_Missense_Mutation_p.N260T|GUCD1_ENST00000435822.1_Missense_Mutation_p.N204T|GUCD1_ENST00000402766.1_Intron|GUCD1_ENST00000447813.2_Intron|GUCD1_ENST00000490922.1_Intron	NM_001284251.1	NP_001271180.1	Q96NT3	GUCD1_HUMAN	guanylyl cyclase domain containing 1	204																	ATAGGCTGGGTTGTTGTAGAA	0.607																																						dbGAP											0													53.0	45.0	48.0					22																	24939827		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK054681	CCDS33621.1, CCDS63426.1, CCDS63427.1, CCDS74831.1, CCDS74832.1, CCDS74833.1	22q11.2	2012-11-13	2012-11-13	2012-11-13	ENSG00000138867	ENSG00000138867			14237	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 13"""	C22orf13		12477932	Standard	XM_005261761		Approved	MGC1842, LLN4	uc003aah.2	Q96NT3	OTTHUMG00000150728	ENST00000407471.3:c.611A>C	22.37:g.24939827T>G	ENSP00000386076:p.Asn204Thr		B5MCB8|B5MCL7|Q96Q79|Q9BU32	Missense_Mutation	SNP	pfam_Guanylyl_cyclase	p.N204T	ENST00000407471.3	37	c.611	CCDS33621.1	22	.	.	.	.	.	.	.	.	.	.	T	16.57	3.159559	0.57368	.	.	ENSG00000138867	ENST00000407471;ENST00000435822;ENST00000404664	.	.	.	4.69	4.69	0.59074	.	0.000000	0.85682	D	0.000000	T	0.79015	0.4375	M	0.80422	2.495	0.80722	D	1	P;P;D;P	0.71674	0.659;0.889;0.998;0.889	P;P;D;P	0.78314	0.555;0.736;0.991;0.653	T	0.82476	-0.0438	9	0.87932	D	0	-51.1178	13.598	0.62002	0.0:0.0:0.0:1.0	.	260;268;161;204	B5MCL7;B4DH83;B4DL90;Q96NT3	.;.;.;CV013_HUMAN	T	204;204;260	.	ENSP00000381297:N204T	N	-	2	0	C22orf13	23269827	1.000000	0.71417	0.967000	0.41034	0.256000	0.26092	7.802000	0.85969	1.867000	0.54127	0.460000	0.39030	AAC	C22orf13	-	pfam_Guanylyl_cyclase	ENSG00000138867		0.607	GUCD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C22orf13	HGNC	protein_coding	OTTHUMT00000319819.1	50	0.00	0	T	NM_031444		24939827	24939827	-1	no_errors	ENST00000407471	ensembl	human	known	69_37n	missense	33	36.36	20	SNP	1.000	G
C3orf18	51161	genome.wustl.edu	37	3	50603097	50603097	+	Missense_Mutation	SNP	A	A	C	rs200546547		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr3:50603097A>C	ENST00000357203.3	-	3	573	c.34T>G	c.(34-36)Ttc>Gtc	p.F12V	C3orf18_ENST00000449241.1_Missense_Mutation_p.F12V|C3orf18_ENST00000441239.1_Missense_Mutation_p.F12V|C3orf18_ENST00000486175.1_Intron|C3orf18_ENST00000426034.1_Missense_Mutation_p.F12V	NM_016210.4	NP_057294.2	Q9UK00	CC018_HUMAN	chromosome 3 open reading frame 18	12						integral component of membrane (GO:0016021)				lung(1)|pancreas(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.0175)|Kidney(197;0.0207)		CGGCTGCTGAACCAGCCCCTA	0.627																																						dbGAP											0													50.0	43.0	46.0					3																	50603097		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF188706	CCDS2829.1, CCDS54589.1	3p21.3	2006-01-11			ENSG00000088543	ENSG00000088543			24837	protein-coding gene	gene with protein product						12477932	Standard	NM_016210		Approved	G20	uc010hlp.3	Q9UK00	OTTHUMG00000156854	ENST00000357203.3:c.34T>G	3.37:g.50603097A>C	ENSP00000349732:p.Phe12Val		C9JNP0	Missense_Mutation	SNP	NULL	p.F12V	ENST00000357203.3	37	c.34	CCDS2829.1	3	.	.	.	.	.	.	.	.	.	.	A	14.81	2.647449	0.47258	.	.	ENSG00000088543	ENST00000426034;ENST00000357203;ENST00000449241;ENST00000441239	T;T;T;T	0.39787	1.06;1.06;1.06;1.38	5.24	-3.52	0.04682	.	1.016040	0.07823	N	0.960138	T	0.24699	0.0599	N	0.19112	0.55	0.80722	D	1	B;B	0.12013	0.002;0.005	B;B	0.09377	0.002;0.004	T	0.02743	-1.1116	10	0.44086	T	0.13	-10.2508	7.4395	0.27174	0.3951:0.0:0.4762:0.1287	.	12;12	C9JNP0;Q9UK00	.;CC018_HUMAN	V	12	ENSP00000387606:F12V;ENSP00000349732:F12V;ENSP00000404913:F12V;ENSP00000414124:F12V	ENSP00000349732:F12V	F	-	1	0	C3orf18	50578101	0.860000	0.29831	0.954000	0.39281	0.955000	0.61496	0.196000	0.17176	-0.961000	0.03609	-0.464000	0.05259	TTC	C3orf18	-	NULL	ENSG00000088543		0.627	C3orf18-014	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf18	HGNC	protein_coding	OTTHUMT00000346260.2	73	0.00	0	A	NM_016210		50603097	50603097	-1	no_errors	ENST00000357203	ensembl	human	known	69_37n	missense	37	48.65	36	SNP	0.600	C
C9orf142	286257	genome.wustl.edu	37	9	139888352	139888352	+	3'UTR	SNP	A	A	C	rs14512		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr9:139888352A>C	ENST00000371620.3	+	0	736				CLIC3_ENST00000480181.1_5'Flank|C9orf142_ENST00000493968.1_3'UTR	NM_183241.1	NP_899064.1	Q9BUH6	CI142_HUMAN	chromosome 9 open reading frame 142							extracellular vesicular exosome (GO:0070062)						all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CACCACCTCCACCTGCCTGTC	0.622																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC002613	CCDS7020.1	9q34.3	2008-02-05			ENSG00000148362	ENSG00000148362			27849	protein-coding gene	gene with protein product							Standard	NM_183241		Approved		uc004cki.3	Q9BUH6	OTTHUMG00000020971	ENST00000371620.3:c.*95A>C	9.37:g.139888352A>C			Q8IY19	RNA	SNP	-	NULL	ENST00000371620.3	37	NULL	CCDS7020.1	9																																																																																			C9orf142	-	-	ENSG00000148362		0.622	C9orf142-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf142	HGNC	protein_coding	OTTHUMT00000055255.1	30	0.00	0	A	NM_183241		139888352	139888352	+1	no_errors	ENST00000463765	ensembl	human	known	69_37n	rna	26	50.85	30	SNP	0.015	C
CASZ1	54897	genome.wustl.edu	37	1	10705025	10705025	+	Missense_Mutation	SNP	C	C	G	rs202119857		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr1:10705025C>G	ENST00000377022.3	-	18	4134	c.3817G>C	c.(3817-3819)Gca>Cca	p.A1273P	RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	1273					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		CCATTGGCTGCCCGCCGCTCC	0.607																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.3817G>C	1.37:g.10705025C>G	ENSP00000366221:p.Ala1273Pro		Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A1273P	ENST00000377022.3	37	c.3817	CCDS41246.1	1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.843192	0.91197	.	.	ENSG00000130940	ENST00000377022	.	.	.	5.15	4.23	0.50019	.	0.000000	0.45361	U	0.000362	T	0.68869	0.3048	L	0.52573	1.65	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.69202	-0.5207	9	0.48119	T	0.1	-6.3643	13.3719	0.60717	0.0:0.9242:0.0:0.0758	.	1273	Q86V15	CASZ1_HUMAN	P	1273	.	ENSP00000366221:A1273P	A	-	1	0	CASZ1	10627612	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.818000	0.86416	1.170000	0.42753	0.561000	0.74099	GCA	CASZ1	-	NULL	ENSG00000130940		0.607	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CASZ1	HGNC	protein_coding	OTTHUMT00000005673.2	91	0.00	0	C	NM_017766		10705025	10705025	-1	no_errors	ENST00000377022	ensembl	human	known	69_37n	missense	107	20.00	27	SNP	1.000	G
CBX4	8535	genome.wustl.edu	37	17	77809500	77809500	+	Missense_Mutation	SNP	T	T	C	rs200196269		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr17:77809500T>C	ENST00000269397.4	-	4	368	c.191A>G	c.(190-192)gAg>gGg	p.E64G	CBX4_ENST00000448310.1_Intron	NM_003655.2	NP_003646.2	O00257	CBX4_HUMAN	chromobox homolog 4	64	Chromo. {ECO:0000255|PROSITE- ProRule:PRU00053}.|Interaction with BMI1.				chromatin modification (GO:0016568)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|single-stranded RNA binding (GO:0003727)|SUMO binding (GO:0032183)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			CATCAGCTGCTCCTGCCGTTC	0.637											OREG0024799	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													67.0	52.0	57.0					17																	77809500		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF013956	CCDS32758.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141582	ENSG00000141582			1554	protein-coding gene	gene with protein product	"""NS5ATP1-binding protein 16"", ""Pc class 2 homolog (Drosophila)"""	603079	"""chromobox homolog 4 (Drosophila Pc class)"""			9315667	Standard	NM_003655		Approved	hPC2, PC2, NBP16	uc002jxe.3	O00257	OTTHUMG00000150415	ENST00000269397.4:c.191A>G	17.37:g.77809500T>C	ENSP00000269397:p.Glu64Gly	1178	B1PJR7|Q6TPI8|Q96C04	Missense_Mutation	SNP	pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,prints_Chromo_dom_subgr,pfscan_Chromo_domain/shadow	p.E64G	ENST00000269397.4	37	c.191	CCDS32758.1	17	.	.	.	.	.	.	.	.	.	.	T	18.70	3.679707	0.68042	.	.	ENSG00000141582	ENST00000269397;ENST00000343048	T	0.54071	0.59	4.53	4.53	0.55603	Chromo domain-like (1);Chromo domain/shadow (1);	0.064284	0.64402	U	0.000011	T	0.68988	0.3061	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.71414	-0.4600	10	0.52906	T	0.07	-1.1232	13.5194	0.61559	0.0:0.0:0.0:1.0	.	64	O00257	CBX4_HUMAN	G	64	ENSP00000269397:E64G	ENSP00000269397:E64G	E	-	2	0	CBX4	75424095	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	4.546000	0.60705	1.684000	0.51022	0.334000	0.21626	GAG	CBX4	-	superfamily_Chromodomain-like,pfscan_Chromo_domain/shadow	ENSG00000141582		0.637	CBX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBX4	HGNC	protein_coding	OTTHUMT00000318007.1	148	0.67	1	T	NM_003655		77809500	77809500	-1	no_errors	ENST00000269397	ensembl	human	known	69_37n	missense	65	32.32	32	SNP	1.000	C
CCAR1	55749	genome.wustl.edu	37	10	70496773	70496773	+	Missense_Mutation	SNP	C	C	A	rs79020072	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr10:70496773C>A	ENST00000265872.6	+	3	333	c.214C>A	c.(214-216)Caa>Aaa	p.Q72K	CCAR1_ENST00000535016.1_Missense_Mutation_p.Q72K|Y_RNA_ENST00000352915.2_RNA|CCAR1_ENST00000543719.1_Missense_Mutation_p.Q72K	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	72					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						ATTGCAGCAACAAGCCGCAGC	0.408																																						dbGAP											0													38.0	37.0	38.0					10																	70496773		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.214C>A	10.37:g.70496773C>A	ENSP00000265872:p.Gln72Lys		A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Missense_Mutation	SNP	pfam_SAP_DNA-bd,superfamily_NA-bd_OB-fold-like,smart_SAP_DNA-bd,pfscan_SAP_DNA-bd	p.Q72K	ENST00000265872.6	37	c.214	CCDS7282.1	10	.	.	.	.	.	.	.	.	.	.	C	22.3	4.267188	0.80469	.	.	ENSG00000060339	ENST00000536391;ENST00000265872;ENST00000535016;ENST00000538031;ENST00000543719;ENST00000539539;ENST00000543225	T;T;T;T;T	0.27557	1.66;1.82;1.82;1.83;1.72	5.62	5.62	0.85841	.	0.125067	0.56097	D	0.000031	T	0.42471	0.1204	N	0.24115	0.695	0.58432	D	0.999998	P;P	0.49447	0.811;0.924	P;P	0.62298	0.828;0.9	T	0.13845	-1.0494	10	0.40728	T	0.16	-16.1153	20.0205	0.97499	0.0:1.0:0.0:0.0	.	72;72	Q8IX12-2;Q8IX12	.;CCAR1_HUMAN	K	72	ENSP00000265872:Q72K;ENSP00000441820:Q72K;ENSP00000445254:Q72K;ENSP00000439252:Q72K;ENSP00000438610:Q72K	ENSP00000265872:Q72K	Q	+	1	0	CCAR1	70166779	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	7.001000	0.76297	2.801000	0.96364	0.650000	0.86243	CAA	CCAR1	-	NULL	ENSG00000060339		0.408	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCAR1	HGNC	protein_coding	OTTHUMT00000048356.2	26	0.00	0	C	NM_018237		70496773	70496773	+1	no_errors	ENST00000265872	ensembl	human	known	69_37n	missense	54	67.47	112	SNP	1.000	A
CCDC112	153733	genome.wustl.edu	37	5	114611288	114611288	+	Silent	SNP	A	A	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-10A-01D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	bf856604-4326-4145-bc3c-137098338f61	g.chr5:114611288A>G	ENST00000512261.1	-	7	710	c.294T>C	c.(292-294)atT>atC	p.I98I	CCDC112_ENST00000379611.5_Silent_p.I181I|CCDC112_ENST00000395557.4_Silent_p.I98I|CCDC112_ENST00000506442.1_Silent_p.I98I|CCDC112_ENST00000503027.1_5'UTR			Q8NEF3	CC112_HUMAN	coiled-coil domain containing 112	98										endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|skin(1)	20		all_cancers(142;0.000523)|all_epithelial(76;6.44e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;4.09e-08)|Epithelial(69;5.28e-08)|all cancers(49;7.06e-06)		TCTCTTCTTTAATTAGCTCTT	0.299																																						dbGAP											0													50.0	52.0	51.0					5																	114611288		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0			BC031242	CCDS4117.1, CCDS34213.1	5q22.3	2009-04-17			ENSG00000164221	ENSG00000164221			28599	protein-coding gene	gene with protein product						12477932	Standard	NM_001040440		Approved	MGC39633	uc003kqz.2	Q8NEF3	OTTHUMG00000128894	ENST00000512261.1:c.294T>C	5.37:g.114611288A>G			Q6A334	Silent	SNP	superfamily_Homeodomain-like	p.I181	ENST00000512261.1	37	c.543	CCDS4117.1	5																																																																																			CCDC112	-	NULL	ENSG00000164221		0.299	CCDC112-003	PUTATIVE	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	CCDC112	HGNC	protein_coding	OTTHUMT00000370999.1	93	0.00	0	A	NM_152549		114611288	114611288	-1	no_errors	ENST00000379611	ensembl	human	known	69_37n	silent	60	33.33	30	SNP	1.000	G
CCDC112	153733	genome.wustl.edu	37	5	114611288	114611288	+	Silent	SNP	A	A	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr5:114611288A>G	ENST00000512261.1	-	7	710	c.294T>C	c.(292-294)atT>atC	p.I98I	CCDC112_ENST00000379611.5_Silent_p.I181I|CCDC112_ENST00000395557.4_Silent_p.I98I|CCDC112_ENST00000506442.1_Silent_p.I98I|CCDC112_ENST00000503027.1_5'UTR			Q8NEF3	CC112_HUMAN	coiled-coil domain containing 112	98										endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|skin(1)	20		all_cancers(142;0.000523)|all_epithelial(76;6.44e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;4.09e-08)|Epithelial(69;5.28e-08)|all cancers(49;7.06e-06)		TCTCTTCTTTAATTAGCTCTT	0.299																																						dbGAP											0													50.0	52.0	51.0					5																	114611288		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0			BC031242	CCDS4117.1, CCDS34213.1	5q22.3	2009-04-17			ENSG00000164221	ENSG00000164221			28599	protein-coding gene	gene with protein product						12477932	Standard	NM_001040440		Approved	MGC39633	uc003kqz.2	Q8NEF3	OTTHUMG00000128894	ENST00000512261.1:c.294T>C	5.37:g.114611288A>G			Q6A334	Silent	SNP	superfamily_Homeodomain-like	p.I181	ENST00000512261.1	37	c.543	CCDS4117.1	5																																																																																			CCDC112	-	NULL	ENSG00000164221		0.299	CCDC112-003	PUTATIVE	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	CCDC112	HGNC	protein_coding	OTTHUMT00000370999.1	27	0.00	0	A	NM_152549		114611288	114611288	-1	no_errors	ENST00000379611	ensembl	human	known	69_37n	silent	60	33.33	30	SNP	1.000	G
CCDC78	124093	genome.wustl.edu	37	16	772688	772688	+	3'UTR	SNP	C	C	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr16:772688C>G	ENST00000293889.6	-	0	1504					NM_001031737.2	NP_001026907.2	A2IDD5	CCD78_HUMAN	coiled-coil domain containing 78						cell projection organization (GO:0030030)|de novo centriole assembly (GO:0098535)|skeletal muscle contraction (GO:0003009)	centriole (GO:0005814)|deuterosome (GO:0098536)|perinuclear region of cytoplasm (GO:0048471)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|lung(2)|skin(3)	9		Hepatocellular(780;0.0218)				CTAGTGGCTGCCGGTCCTTGG	0.617																																						dbGAP											0													7.0	11.0	10.0					16																	772688		674	1518	2192	-	-	-	SO:0001624	3_prime_UTR_variant	0			BC042110	CCDS32353.1	16p13.3	2014-07-15		2006-02-20	ENSG00000162004	ENSG00000162004			14153	protein-coding gene	gene with protein product		614666		C16orf25		24075808	Standard	NM_001031737		Approved	FLJ34512	uc002cjg.3	A2IDD5	OTTHUMG00000121176	ENST00000293889.6:c.*82G>C	16.37:g.772688C>G			B4DNY4|B4E1U6|Q05BY7|Q05CA0|Q6T2V5|Q6ZR33|Q8IUR3|Q8NAY7|Q96S12	Missense_Mutation	SNP	NULL	p.A317P	ENST00000293889.6	37	c.949	CCDS32353.1	16	.	.	.	.	.	.	.	.	.	.	C	4.346	0.063752	0.08388	.	.	ENSG00000162004	ENST00000345165	.	.	.	3.56	-5.72	0.02406	.	.	.	.	.	T	0.16300	0.0392	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.27806	-1.0063	4	.	.	.	.	1.4909	0.02456	0.1748:0.1318:0.2205:0.4728	.	.	.	.	P	317	.	.	A	-	1	0	CCDC78	712689	0.000000	0.05858	0.000000	0.03702	0.054000	0.15201	-2.489000	0.00976	-0.700000	0.05070	0.561000	0.74099	GCA	CCDC78	-	NULL	ENSG00000162004		0.617	CCDC78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC78	HGNC	protein_coding	OTTHUMT00000241665.3	34	0.00	0	C	NM_173476		772688	772688	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000345165	ensembl	human	putative	69_37n	missense	46	29.23	19	SNP	0.000	G
CCNF	899	genome.wustl.edu	37	16	2495482	2495482	+	Missense_Mutation	SNP	T	T	G	rs201540325	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr16:2495482T>G	ENST00000397066.4	+	10	1041	c.953T>G	c.(952-954)gTg>gGg	p.V318G		NM_001761.2	NP_001752.2	P41002	CCNF_HUMAN	cyclin F	318	Cyclin N-terminal.				mitotic nuclear division (GO:0007067)|negative regulation of centrosome duplication (GO:0010826)|placenta development (GO:0001890)|protein ubiquitination (GO:0016567)|re-entry into mitotic cell cycle (GO:0000320)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	centriole (GO:0005814)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)		p.V318G(1)		breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(2)|lung(5)|prostate(4)|skin(1)	20		Ovarian(90;0.17)				GACTGGCTGGTGGAAGTTGCC	0.597																																						dbGAP											1	Substitution - Missense(1)	lung(1)											107.0	78.0	88.0					16																	2495482		2198	4300	6498	-	-	-	SO:0001583	missense	0			Z36714	CCDS10467.1	16p13.3	2008-02-05			ENSG00000162063	ENSG00000162063		"""F-boxes /  ""other"""""	1591	protein-coding gene	gene with protein product		600227				7896286	Standard	NM_001761		Approved	FBX1, FBXO1	uc002cqd.1	P41002	OTTHUMG00000128858	ENST00000397066.4:c.953T>G	16.37:g.2495482T>G	ENSP00000380256:p.Val318Gly		B2R8H3|Q96EG9	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C,pfam_F-box_dom_cyclin-like,superfamily_Cyclin-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_Cyclin-like,pfscan_F-box_dom_cyclin-like	p.V318G	ENST00000397066.4	37	c.953	CCDS10467.1	16	.	.	.	.	.	.	.	.	.	.	T	25.4	4.634110	0.87660	.	.	ENSG00000162063	ENST00000397066;ENST00000293968	T	0.13538	2.58	5.5	5.5	0.81552	Cyclin, N-terminal (2);Cyclin-like (3);	0.000000	0.85682	D	0.000000	T	0.47377	0.1442	M	0.92833	3.35	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.60078	-0.7333	10	0.87932	D	0	-21.644	14.4299	0.67243	0.0:0.0:0.0:1.0	.	318	P41002	CCNF_HUMAN	G	318;233	ENSP00000380256:V318G	ENSP00000293968:V233G	V	+	2	0	CCNF	2435483	1.000000	0.71417	0.986000	0.45419	0.992000	0.81027	4.884000	0.63135	2.090000	0.63153	0.455000	0.32223	GTG	CCNF	-	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like	ENSG00000162063		0.597	CCNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNF	HGNC	protein_coding	OTTHUMT00000250801.1	86	0.00	0	T	NM_001761		2495482	2495482	+1	no_errors	ENST00000397066	ensembl	human	known	69_37n	missense	38	54.76	46	SNP	1.000	G
CENPB	1059	genome.wustl.edu	37	20	3766022	3766022	+	Missense_Mutation	SNP	G	G	C	rs200811692		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr20:3766022G>C	ENST00000379751.4	-	1	1315	c.1109C>G	c.(1108-1110)gCc>gGc	p.A370G	CDC25B_ENST00000344256.6_5'Flank|CDC25B_ENST00000379598.5_5'Flank	NM_001810.5	NP_001801.1	P07199	CENPB_HUMAN	centromere protein B, 80kDa	370					regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)	centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|satellite DNA binding (GO:0003696)|sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(2)|lung(4)|skin(1)	8						CTGCCAGGCGGCAGCCACAAA	0.647																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			X05299	CCDS13064.1	20p13	2013-11-05	2002-08-29		ENSG00000125817	ENSG00000125817			1852	protein-coding gene	gene with protein product		117140	"""centromere protein B (80kD)"""			8406460, 11884609	Standard	NM_001810		Approved		uc002wjk.3	P07199	OTTHUMG00000031761	ENST00000379751.4:c.1109C>G	20.37:g.3766022G>C	ENSP00000369075:p.Ala370Gly		Q96EI4	Missense_Mutation	SNP	pfam_Centromere_CenpB_dimerisation,pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_Psq,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.A370G	ENST00000379751.4	37	c.1109	CCDS13064.1	20	.	.	.	.	.	.	.	.	.	.	g	11.50	1.657475	0.29425	.	.	ENSG00000125817	ENST00000379751	T	0.45276	0.9	4.47	4.47	0.54385	.	0.000000	0.38548	U	0.001648	T	0.36054	0.0953	L	0.46157	1.445	0.32794	N	0.500735	B	0.24823	0.112	B	0.28784	0.094	T	0.43861	-0.9365	10	0.20046	T	0.44	-5.9631	12.6346	0.56677	0.0:0.0:1.0:0.0	.	370	P07199	CENPB_HUMAN	G	370	ENSP00000369075:A370G	ENSP00000369075:A370G	A	-	2	0	CENPB	3714022	0.668000	0.27493	0.864000	0.33941	0.593000	0.36681	2.718000	0.47236	2.031000	0.59945	0.550000	0.68814	GCC	CENPB	-	pfam_DDE_SF_endonuclease_CENPB-like	ENSG00000125817		0.647	CENPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPB	HGNC	protein_coding	OTTHUMT00000077772.2	51	0.00	0	G	NM_001810		3766022	3766022	-1	no_errors	ENST00000379751	ensembl	human	known	69_37n	missense	24	29.41	10	SNP	0.949	C
CHD5	26038	genome.wustl.edu	37	1	6185196	6185196	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr1:6185196A>C	ENST00000262450.3	-	29	4457	c.4358T>G	c.(4357-4359)gTg>gGg	p.V1453G	CHD5_ENST00000378021.1_Missense_Mutation_p.V310G	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		AAGGTCCCGCACCAGCCAGTG	0.642																																						dbGAP											0													36.0	39.0	38.0					1																	6185196		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.4358T>G	1.37:g.6185196A>C	ENSP00000262450:p.Val1453Gly		A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.V1453G	ENST00000262450.3	37	c.4358	CCDS57.1	1	.	.	.	.	.	.	.	.	.	.	A	32	5.161078	0.94727	.	.	ENSG00000116254	ENST00000262450;ENST00000378006;ENST00000378021;ENST00000536802;ENST00000538279;ENST00000377999	D;T	0.92911	-3.13;1.87	4.5	4.5	0.54988	Domain of unknown function DUF1086 (1);	0.000000	0.64402	D	0.000006	D	0.95711	0.8605	M	0.80183	2.485	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.81914	0.995;0.985	D	0.96059	0.9037	10	0.62326	D	0.03	-26.4829	14.1146	0.65144	1.0:0.0:0.0:0.0	.	1453;310	Q8TDI0;Q5TG85	CHD5_HUMAN;.	G	1453;969;310;861;861;310	ENSP00000262450:V1453G;ENSP00000367260:V310G	ENSP00000262450:V1453G	V	-	2	0	CHD5	6107783	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.813000	0.91963	1.802000	0.52723	0.459000	0.35465	GTG	CHD5	-	pfam_DUF1086	ENSG00000116254		0.642	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD5	HGNC	protein_coding	OTTHUMT00000002823.2	173	0.57	1	A	NM_015557		6185196	6185196	-1	no_errors	ENST00000262450	ensembl	human	known	69_37n	missense	59	43.40	46	SNP	1.000	C
CHRND	1144	genome.wustl.edu	37	2	233393286	233393286	+	Silent	SNP	A	A	C			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr2:233393286A>C	ENST00000258385.3	+	5	461	c.429A>C	c.(427-429)ccA>ccC	p.P143P	CHRND_ENST00000543200.1_Silent_p.P128P|CHRND_ENST00000457943.2_Missense_Mutation_p.H53P|CHRND_ENST00000536614.1_Silent_p.P143P	NM_000751.2	NP_000742.1	Q07001	ACHD_HUMAN	cholinergic receptor, nicotinic, delta (muscle)	143					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|musculoskeletal movement (GO:0050881)|neuromuscular process (GO:0050905)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)	34		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	Galantamine(DB00674)	ACTGGCTGCCACCTGCCATCT	0.567																																						dbGAP											0													176.0	161.0	166.0					2																	233393286		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X55019	CCDS2494.1, CCDS58754.1	2q37.1	2012-02-11	2012-02-07		ENSG00000135902	ENSG00000135902		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1965	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, delta (muscle)"""	100720	"""cholinergic receptor, nicotinic, delta"""	ACHRD			Standard	NM_000751		Approved		uc002vsw.4	Q07001	OTTHUMG00000133261	ENST00000258385.3:c.429A>C	2.37:g.233393286A>C			A8K661|B4DT92|Q52LH4	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM	p.H53P	ENST00000258385.3	37	c.158	CCDS2494.1	2	.	.	.	.	.	.	.	.	.	.	A	11.79	1.744004	0.30865	.	.	ENSG00000135902	ENST00000457943	D	0.86956	-2.19	4.29	-8.59	0.00893	.	.	.	.	.	T	0.72748	0.3499	.	.	.	0.20196	N	0.999927	B	0.02656	0.0	B	0.01281	0.0	T	0.56105	-0.8034	7	.	.	.	.	9.9221	0.41470	0.5421:0.2258:0.2321:0.0	.	53	B4E3W4	.	P	53	ENSP00000391055:H53P	.	H	+	2	0	CHRND	233101530	0.000000	0.05858	0.408000	0.26446	0.959000	0.62525	-5.032000	0.00158	-2.108000	0.00839	-0.366000	0.07423	CAC	CHRND	-	NULL	ENSG00000135902		0.567	CHRND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRND	HGNC	protein_coding	OTTHUMT00000257038.2	64	0.00	0	A			233393286	233393286	+1	no_errors	ENST00000457943	ensembl	human	known	69_37n	missense	236	19.39	57	SNP	0.140	C
CHRND	1144	genome.wustl.edu	37	2	233399890	233399890	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	bf856604-4326-4145-bc3c-137098338f61	g.chr2:233399890delG	ENST00000258385.3	+	12	1454	c.1422delG	c.(1420-1422)ctgfs	p.L474fs	CHRND_ENST00000543200.1_Frame_Shift_Del_p.L459fs|CHRND_ENST00000457943.2_Frame_Shift_Del_p.L280fs	NM_000751.2	NP_000742.1	Q07001	ACHD_HUMAN	cholinergic receptor, nicotinic, delta (muscle)	474					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|musculoskeletal movement (GO:0050881)|neuromuscular process (GO:0050905)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)	34		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	Galantamine(DB00674)	GCCTCTGCCTGTTTGTGGTGA	0.617																																						dbGAP											0													109.0	109.0	109.0					2																	233399890		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			X55019	CCDS2494.1, CCDS58754.1	2q37.1	2012-02-11	2012-02-07		ENSG00000135902	ENSG00000135902		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1965	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, delta (muscle)"""	100720	"""cholinergic receptor, nicotinic, delta"""	ACHRD			Standard	NM_000751		Approved		uc002vsw.4	Q07001	OTTHUMG00000133261	ENST00000258385.3:c.1422delG	2.37:g.233399890delG	ENSP00000258385:p.Leu474fs		A8K661|B4DT92|Q52LH4	Frame_Shift_Del	DEL	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.F475fs	ENST00000258385.3	37	c.1422	CCDS2494.1	2																																																																																			CHRND	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel	ENSG00000135902		0.617	CHRND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRND	HGNC	protein_coding	OTTHUMT00000257038.2	193	0.00	0	G			233399890	233399890	+1	no_errors	ENST00000258385	ensembl	human	known	69_37n	frame_shift_del	133	29.44	58	DEL	0.991	-
CHRND	1144	genome.wustl.edu	37	2	233399890	233399890	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr2:233399890delG	ENST00000258385.3	+	12	1454	c.1422delG	c.(1420-1422)ctgfs	p.L474fs	CHRND_ENST00000543200.1_Frame_Shift_Del_p.L459fs|CHRND_ENST00000457943.2_Frame_Shift_Del_p.L280fs	NM_000751.2	NP_000742.1	Q07001	ACHD_HUMAN	cholinergic receptor, nicotinic, delta (muscle)	474					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|musculoskeletal movement (GO:0050881)|neuromuscular process (GO:0050905)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)	34		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	Galantamine(DB00674)	GCCTCTGCCTGTTTGTGGTGA	0.617																																						dbGAP											0													109.0	109.0	109.0					2																	233399890		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			X55019	CCDS2494.1, CCDS58754.1	2q37.1	2012-02-11	2012-02-07		ENSG00000135902	ENSG00000135902		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1965	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, delta (muscle)"""	100720	"""cholinergic receptor, nicotinic, delta"""	ACHRD			Standard	NM_000751		Approved		uc002vsw.4	Q07001	OTTHUMG00000133261	ENST00000258385.3:c.1422delG	2.37:g.233399890delG	ENSP00000258385:p.Leu474fs		A8K661|B4DT92|Q52LH4	Frame_Shift_Del	DEL	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.F475fs	ENST00000258385.3	37	c.1422	CCDS2494.1	2																																																																																			CHRND	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel	ENSG00000135902		0.617	CHRND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRND	HGNC	protein_coding	OTTHUMT00000257038.2	78	0.00	0	G			233399890	233399890	+1	no_errors	ENST00000258385	ensembl	human	known	69_37n	frame_shift_del	133	29.44	58	DEL	0.991	-
CLK2	1196	genome.wustl.edu	37	1	155238508	155238508	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr1:155238508G>T	ENST00000368361.4	-	4	793	c.478C>A	c.(478-480)Caa>Aaa	p.Q160K	CLK2_ENST00000361168.5_Missense_Mutation_p.Q159K|CLK2_ENST00000536801.1_Missense_Mutation_p.Q160K|CLK2_ENST00000497188.1_5'UTR|CLK2_ENST00000355560.4_Missense_Mutation_p.Q158K			P49760	CLK2_HUMAN	CDC-like kinase 2	160					negative regulation of gluconeogenesis (GO:0045721)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)|response to ionizing radiation (GO:0010212)|response to retinoic acid (GO:0032526)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			endometrium(4)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	22	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CATCGCTCTTGTAGCCAGTCC	0.582								Other conserved DNA damage response genes																														dbGAP											0													147.0	118.0	128.0					1																	155238508		2203	4300	6503	-	-	-	SO:0001583	missense	0			L29218	CCDS1107.1, CCDS72939.1	1q21	2008-05-02			ENSG00000176444	ENSG00000176444		"""CDC-like kinases"""	2069	protein-coding gene	gene with protein product		602989				7990150, 9856501	Standard	XM_005244876		Approved	clk2	uc001fjw.3	P49760	OTTHUMG00000035873	ENST00000368361.4:c.478C>A	1.37:g.155238508G>T	ENSP00000357345:p.Gln160Lys		B1AVS9|B5MBX6|Q96CQ0	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Q160K	ENST00000368361.4	37	c.478		1	.	.	.	.	.	.	.	.	.	.	.	15.13	2.742782	0.49151	.	.	ENSG00000176444	ENST00000361168;ENST00000368361;ENST00000355560;ENST00000536801	T;T;T;T	0.19669	2.13;2.13;2.13;2.13	4.86	4.86	0.63082	Protein kinase-like domain (1);	0.105891	0.64402	D	0.000003	T	0.15869	0.0382	M	0.68317	2.08	0.80722	D	1	B;B	0.09022	0.002;0.0	B;B	0.08055	0.003;0.001	T	0.01988	-1.1234	10	0.48119	T	0.1	.	17.1111	0.86675	0.0:0.0:1.0:0.0	.	160;159	P49760;P49760-3	CLK2_HUMAN;.	K	159;160;158;160	ENSP00000354856:Q159K;ENSP00000357345:Q160K;ENSP00000347759:Q158K;ENSP00000441023:Q160K	ENSP00000347759:Q158K	Q	-	1	0	CLK2	153505132	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.657000	0.98554	2.687000	0.91594	0.655000	0.94253	CAA	CLK2	-	superfamily_Kinase-like_dom	ENSG00000176444		0.582	CLK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	CLK2	HGNC	protein_coding	OTTHUMT00000087391.1	56	0.00	0	G	NM_003993		155238508	155238508	-1	no_errors	ENST00000368361	ensembl	human	known	69_37n	missense	124	17.88	27	SNP	1.000	T
COX10	1352	genome.wustl.edu	37	17	14110451	14110451	+	Missense_Mutation	SNP	A	A	C	rs200435051		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr17:14110451A>C	ENST00000261643.3	+	7	1330	c.1253A>C	c.(1252-1254)cAc>cCc	p.H418P	COX10_ENST00000537334.1_Missense_Mutation_p.H201P|COX10_ENST00000536205.1_Missense_Mutation_p.H226P	NM_001303.3	NP_001294.2	Q12887	COX10_HUMAN	cytochrome c oxidase assembly homolog 10 (yeast)	418					aerobic respiration (GO:0009060)|cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|heme O biosynthetic process (GO:0048034)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|mitochondrial fission (GO:0000266)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	farnesyltranstransferase activity (GO:0004311)|protoheme IX farnesyltransferase activity (GO:0008495)			cervix(1)|endometrium(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		all_lung(20;0.06)|Lung SC(565;0.168)		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)		AGCCTGTGGCACCTGCCGCTG	0.672																																						dbGAP											0													34.0	35.0	34.0					17																	14110451		2200	4293	6493	-	-	-	SO:0001583	missense	0			U09466	CCDS11166.1	17p12	2013-05-24	2012-10-15		ENSG00000006695	ENSG00000006695		"""Mitochondrial respiratory chain complex assembly factors"""	2260	protein-coding gene	gene with protein product	"""heme A: farnesyltransferase"", ""protoheme IX farnesyltransferase, mitochondrial"", ""heme O synthase"""	602125	"""COX10 (yeast) homolog, cytochrome c oxidase assembly protein (heme A: farnesyltransferase)"", ""COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)"""			9177788, 12928484	Standard	NM_001303		Approved		uc002gof.4	Q12887	OTTHUMG00000058814	ENST00000261643.3:c.1253A>C	17.37:g.14110451A>C	ENSP00000261643:p.His418Pro		B2R6U5|B4DJ50|O15334|Q969F7	Missense_Mutation	SNP	pfam_UbiA_prenyltransferase,pirsf_Protohaem_IX_farnesylTrfase_mt,tigrfam_Protohaem_IX_farnesylTrfase	p.H418P	ENST00000261643.3	37	c.1253	CCDS11166.1	17	.	.	.	.	.	.	.	.	.	.	A	25.3	4.623350	0.87460	.	.	ENSG00000006695	ENST00000261643;ENST00000536205;ENST00000537334	D;D;D	0.92397	-3.03;-3.03;-3.03	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	D	0.97133	0.9063	H	0.95437	3.67	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.79784	0.981;0.993	D	0.98325	1.0530	10	0.87932	D	0	.	14.6208	0.68582	1.0:0.0:0.0:0.0	.	226;418	B4DJ50;Q12887	.;COX10_HUMAN	P	418;226;201	ENSP00000261643:H418P;ENSP00000439494:H226P;ENSP00000443354:H201P	ENSP00000261643:H418P	H	+	2	0	COX10	14051176	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.822000	0.92013	1.932000	0.55993	0.459000	0.35465	CAC	COX10	-	pfam_UbiA_prenyltransferase,pirsf_Protohaem_IX_farnesylTrfase_mt,tigrfam_Protohaem_IX_farnesylTrfase	ENSG00000006695		0.672	COX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX10	HGNC	protein_coding	OTTHUMT00000130003.1	37	0.00	0	A	NM_001303		14110451	14110451	+1	no_errors	ENST00000261643	ensembl	human	known	69_37n	missense	5	73.68	14	SNP	1.000	C
CRBN	51185	genome.wustl.edu	37	3	3221322	3221322	+	Missense_Mutation	SNP	T	T	G	rs200222965		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr3:3221322T>G	ENST00000231948.4	-	1	72	c.50A>C	c.(49-51)cAc>cCc	p.H17P	CRBN_ENST00000432408.2_Missense_Mutation_p.H17P	NM_016302.3	NP_057386.2	Q96SW2	CRBN_HUMAN	cereblon	17					negative regulation of ion transmembrane transport (GO:0034766)|negative regulation of protein homooligomerization (GO:0032463)|positive regulation of protein homodimerization activity (GO:0090073)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP-dependent peptidase activity (GO:0004176)			endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	11				Epithelial(13;0.00244)|OV - Ovarian serous cystadenocarcinoma(96;0.00617)|all cancers(10;0.0079)	Lenalidomide(DB00480)|Pomalidomide(DB08910)|Thalidomide(DB01041)	GAGCGGCAGGTGGTTGCCCAT	0.672																																						dbGAP											0													39.0	36.0	37.0					3																	3221322		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC017419	CCDS2562.1, CCDS54547.1	3p26.3	2014-05-27			ENSG00000113851	ENSG00000113851			30185	protein-coding gene	gene with protein product		609262	"""mental retardation, non-syndromic, autosomal recessive, 2A"""	MRT2A		15557513	Standard	NM_016302		Approved	MRT2	uc003bpq.3	Q96SW2	OTTHUMG00000090261	ENST00000231948.4:c.50A>C	3.37:g.3221322T>G	ENSP00000231948:p.His17Pro		B2R6H4|C9IZA9|C9JAH6|Q6AI62|Q6NVZ0|Q9UHW4	Missense_Mutation	SNP	pfam_Pept_S16_N,superfamily_PUA-like_domain,smart_Pept_S16_N	p.H17P	ENST00000231948.4	37	c.50	CCDS2562.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.07|10.07	1.250591|1.250591	0.22880|0.22880	.|.	.|.	ENSG00000113851|ENSG00000113851	ENST00000231948;ENST00000432408|ENST00000424814;ENST00000450014	.|.	.|.	.|.	3.43|3.43	2.26|2.26	0.28386|0.28386	.|.	0.281705|.	0.35407|.	N|.	0.003233|.	T|T	0.18130|0.18130	0.0435|0.0435	N|N	0.08118|0.08118	0|0	0.33588|0.33588	D|D	0.600735|0.600735	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.01281|.	0.0;0.0|.	T|T	0.19031|0.19031	-1.0318|-1.0318	9|5	0.29301|.	T|.	0.29|.	-7.5851|-7.5851	1.6673|1.6673	0.02805|0.02805	0.1655:0.1016:0.1702:0.5628|0.1655:0.1016:0.1702:0.5628	.|.	17;17|.	Q96SW2-2;Q96SW2|.	.;CRBN_HUMAN|.	P|P	17|13	.|.	ENSP00000231948:H17P|.	H|T	-|-	2|1	0|0	CRBN|CRBN	3196322|3196322	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.462000|0.462000	0.32619|0.32619	3.009000|3.009000	0.49552|0.49552	0.493000|0.493000	0.27837|0.27837	0.455000|0.455000	0.32223|0.32223	CAC|ACC	CRBN	-	NULL	ENSG00000113851		0.672	CRBN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CRBN	HGNC	protein_coding	OTTHUMT00000206579.3	107	0.93	1	T	NM_016302		3221322	3221322	-1	no_errors	ENST00000231948	ensembl	human	known	69_37n	missense	18	57.78	26	SNP	1.000	G
CRYBA2	1412	genome.wustl.edu	37	2	219856873	219856873	+	Missense_Mutation	SNP	C	C	G	rs202133858		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr2:219856873C>G	ENST00000295728.2	-	2	490	c.254G>C	c.(253-255)aGc>aCc	p.S85T	CRYBA2_ENST00000487181.1_5'Flank|CRYBA2_ENST00000392096.2_Missense_Mutation_p.S85T	NM_057093.1	NP_476434.1	P53672	CRBA2_HUMAN	crystallin, beta A2	85	Beta/gamma crystallin 'Greek key' 2. {ECO:0000255|PROSITE-ProRule:PRU00028}.				lens development in camera-type eye (GO:0002088)		structural constituent of eye lens (GO:0005212)			endometrium(1)|lung(3)|prostate(1)	5		Renal(207;0.0474)		Epithelial(149;9.77e-07)|all cancers(144;0.000167)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GTTGTGGCTGCTGCTGCCACT	0.622																																						dbGAP											0													33.0	32.0	32.0					2																	219856873		2199	4292	6491	-	-	-	SO:0001583	missense	0				CCDS2429.1	2q35	2013-02-14			ENSG00000163499	ENSG00000163499			2395	protein-coding gene	gene with protein product		600836				7490092, 12907171	Standard	NM_057093		Approved		uc002vjj.1	P53672	OTTHUMG00000133084	ENST00000295728.2:c.254G>C	2.37:g.219856873C>G	ENSP00000295728:p.Ser85Thr		Q4ZFX0|Q9Y562	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.S85T	ENST00000295728.2	37	c.254	CCDS2429.1	2	.	.	.	.	.	.	.	.	.	.	C	15.09	2.729613	0.48833	.	.	ENSG00000163499	ENST00000392096;ENST00000295728;ENST00000453769	T;T;T	0.76709	-1.04;-1.04;-1.04	4.46	3.58	0.41010	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.478067	0.24336	N	0.039417	T	0.74680	0.3748	M	0.63843	1.955	0.47407	D	0.999412	B	0.18968	0.032	B	0.22880	0.042	T	0.71886	-0.4457	10	0.39692	T	0.17	.	13.7284	0.62771	0.0:0.844:0.156:0.0	.	85	P53672	CRBA2_HUMAN	T	85	ENSP00000375946:S85T;ENSP00000295728:S85T;ENSP00000395120:S85T	ENSP00000295728:S85T	S	-	2	0	CRYBA2	219565117	0.999000	0.42202	0.990000	0.47175	0.962000	0.63368	2.973000	0.49264	1.216000	0.43427	0.655000	0.94253	AGC	CRYBA2	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin	ENSG00000163499		0.622	CRYBA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CRYBA2	HGNC	protein_coding	OTTHUMT00000336424.1	43	0.00	0	C	NM_057093		219856873	219856873	-1	no_errors	ENST00000295728	ensembl	human	known	69_37n	missense	18	40.00	12	SNP	1.000	G
DCAF8	50717	genome.wustl.edu	37	1	160209535	160209535	+	Silent	SNP	C	C	G	rs199714661	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr1:160209535C>G	ENST00000368073.3	-	4	1109	c.675G>C	c.(673-675)cgG>cgC	p.R225R	DCAF8_ENST00000475733.1_Silent_p.R225R|DCAF8_ENST00000326837.2_Silent_p.R225R|DCAF8_ENST00000556710.1_Silent_p.R379R|DCAF8_ENST00000368074.1_Silent_p.R225R|DCAF8_ENST00000610139.1_Silent_p.R225R|DCAF8_ENST00000608310.1_Silent_p.R379R			Q5TAQ9	DCAF8_HUMAN	DDB1 and CUL4 associated factor 8	225					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(16)|skin(3)|upper_aerodigestive_tract(1)	33						GTACTGGCTGCCGCCGTACCC	0.532																																						dbGAP											0													59.0	68.0	65.0					1																	160209535		2144	4206	6350	-	-	-	SO:0001819	synonymous_variant	0			AK093176	CCDS1200.1	1q22-q23	2013-01-09	2009-07-17	2009-07-17	ENSG00000132716	ENSG00000132716		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	24891	protein-coding gene	gene with protein product		615820	"""WD repeat domain 42A"""	WDR42A		11401431	Standard	NM_015726		Approved	H326, FLJ35857	uc010pjb.1	Q5TAQ9	OTTHUMG00000031604	ENST00000368073.3:c.675G>C	1.37:g.160209535C>G			D3DVE6|Q12839|Q4QQI6|Q53F14|Q66K50|Q68CS7|Q96E00	Silent	SNP	pfam_Pex19,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R379	ENST00000368073.3	37	c.1137	CCDS1200.1	1																																																																																			DCAF8	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000132716		0.532	DCAF8-001	KNOWN	basic|CCDS	protein_coding	DCAF8	HGNC	protein_coding	OTTHUMT00000077402.2	72	0.00	0	C	NM_015726		160209535	160209535	-1	no_errors	ENST00000555195	ensembl	human	known	69_37n	silent	24	40.48	17	SNP	0.927	G
DNAH12	201625	genome.wustl.edu	37	3	57414077	57414077	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-10A-01D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	bf856604-4326-4145-bc3c-137098338f61	g.chr3:57414077T>C	ENST00000351747.2	-	35	5462	c.5282A>G	c.(5281-5283)cAa>cGa	p.Q1761R		NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	1761					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						AAATGTACATTGAGTTTTTAG	0.264																																						dbGAP											0													11.0	11.0	11.0					3																	57414077		691	1565	2256	-	-	-	SO:0001583	missense	0			U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.5282A>G	3.37:g.57414077T>C	ENSP00000295937:p.Gln1761Arg		A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.Q1761R	ENST00000351747.2	37	c.5282		3	.	.	.	.	.	.	.	.	.	.	T	1.607	-0.524919	0.04141	.	.	ENSG00000174844	ENST00000351747	T	0.19806	2.12	2.97	1.8	0.24995	.	.	.	.	.	T	0.09905	0.0243	N	0.16201	0.385	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.38156	-0.9674	9	0.16420	T	0.52	.	4.7238	0.12931	0.0:0.1503:0.0:0.8497	.	1761	Q6ZR08	DYH12_HUMAN	R	1761	ENSP00000295937:Q1761R	ENSP00000295937:Q1761R	Q	-	2	0	DNAH12	57389117	0.194000	0.23325	0.007000	0.13788	0.012000	0.07955	2.353000	0.44089	0.532000	0.28657	0.472000	0.43445	CAA	DNAH12	-	NULL	ENSG00000174844		0.264	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	DNAH12	HGNC	protein_coding		46	0.00	0	T	NM_178504		57414077	57414077	-1	no_errors	ENST00000351747	ensembl	human	known	69_37n	missense	23	25.81	8	SNP	0.012	C
DNAH12	201625	genome.wustl.edu	37	3	57414077	57414077	+	Missense_Mutation	SNP	T	T	C			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr3:57414077T>C	ENST00000351747.2	-	35	5462	c.5282A>G	c.(5281-5283)cAa>cGa	p.Q1761R		NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	1761					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						AAATGTACATTGAGTTTTTAG	0.264																																						dbGAP											0													11.0	11.0	11.0					3																	57414077		691	1565	2256	-	-	-	SO:0001583	missense	0			U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.5282A>G	3.37:g.57414077T>C	ENSP00000295937:p.Gln1761Arg		A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.Q1761R	ENST00000351747.2	37	c.5282		3	.	.	.	.	.	.	.	.	.	.	T	1.607	-0.524919	0.04141	.	.	ENSG00000174844	ENST00000351747	T	0.19806	2.12	2.97	1.8	0.24995	.	.	.	.	.	T	0.09905	0.0243	N	0.16201	0.385	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.38156	-0.9674	9	0.16420	T	0.52	.	4.7238	0.12931	0.0:0.1503:0.0:0.8497	.	1761	Q6ZR08	DYH12_HUMAN	R	1761	ENSP00000295937:Q1761R	ENSP00000295937:Q1761R	Q	-	2	0	DNAH12	57389117	0.194000	0.23325	0.007000	0.13788	0.012000	0.07955	2.353000	0.44089	0.532000	0.28657	0.472000	0.43445	CAA	DNAH12	-	NULL	ENSG00000174844		0.264	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	DNAH12	HGNC	protein_coding		50	0.00	0	T	NM_178504		57414077	57414077	-1	no_errors	ENST00000351747	ensembl	human	known	69_37n	missense	23	25.81	8	SNP	0.012	C
DNAH6	1768	genome.wustl.edu	37	2	84838960	84838960	+	Missense_Mutation	SNP	C	C	G	rs201711823	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr2:84838960C>G	ENST00000237449.6	+	21	3465	c.3457C>G	c.(3457-3459)Cga>Gga	p.R1153G	DNAH6_ENST00000389394.3_Missense_Mutation_p.R1153G|DNAH6_ENST00000398278.2_Missense_Mutation_p.R1153G			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	1153	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						TAATGCTCTTCGAGCCGCTAC	0.428																																						dbGAP											0													17.0	24.0	22.0					2																	84838960		692	1591	2283	-	-	-	SO:0001583	missense	0			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.3457C>G	2.37:g.84838960C>G	ENSP00000237449:p.Arg1153Gly		A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.R1153G	ENST00000237449.6	37	c.3457	CCDS46348.1	2	.	.	.	.	.	.	.	.	.	.	C	17.11	3.305422	0.60305	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.61742	0.08;0.08;0.08	5.6	4.73	0.59995	Dynein heavy chain, domain-2 (1);	.	.	.	.	T	0.71298	0.3323	M	0.72894	2.215	0.41089	D	0.985586	D	0.56746	0.977	D	0.64410	0.925	T	0.70641	-0.4816	9	0.30854	T	0.27	.	13.3909	0.60823	0.0:0.9233:0.0:0.0767	.	1153	Q9C0G6	DYH6_HUMAN	G	1153	ENSP00000374045:R1153G;ENSP00000381326:R1153G;ENSP00000237449:R1153G	ENSP00000237449:R1153G	R	+	1	2	DNAH6	84692471	0.998000	0.40836	0.998000	0.56505	0.984000	0.73092	2.997000	0.49457	1.369000	0.46134	0.655000	0.94253	CGA	DNAH6	-	pfam_Dynein_heavy_dom-2	ENSG00000115423		0.428	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH6	HGNC	protein_coding	OTTHUMT00000328537.2	25	0.00	0	C	NM_001370		84838960	84838960	+1	no_errors	ENST00000237449	ensembl	human	known	69_37n	missense	36	66.67	72	SNP	1.000	G
DNAJB2	3300	genome.wustl.edu	37	2	220144582	220144582	+	Silent	SNP	C	C	T			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	bf856604-4326-4145-bc3c-137098338f61	g.chr2:220144582C>T	ENST00000336576.5	+	2	315	c.27C>T	c.(25-27)gaC>gaT	p.D9D	DNAJB2_ENST00000392086.4_Silent_p.D9D	NM_006736.5	NP_006727.2	P25686	DNJB2_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 2	9	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				cell death (GO:0008219)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of inclusion body assembly (GO:0090084)|negative regulation of protein deubiquitination (GO:0090086)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein folding (GO:0006457)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|inclusion body (GO:0016234)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|polyubiquitin binding (GO:0031593)|proteasome binding (GO:0070628)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14		Renal(207;0.0474)		Epithelial(149;1.97e-06)|all cancers(144;0.00028)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGATCCTAGACGTGCCGCGAA	0.592																																						dbGAP											0													94.0	83.0	87.0					2																	220144582		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2439.1, CCDS46519.1	2q32-q34	2011-09-02			ENSG00000135924	ENSG00000135924		"""Heat shock proteins / DNAJ (HSP40)"""	5228	protein-coding gene	gene with protein product		604139		HSJ1		1599432, 10516435	Standard	NM_006736		Approved	HSPF3	uc002vkx.1	P25686	OTTHUMG00000133134	ENST00000336576.5:c.27C>T	2.37:g.220144582C>T			A8K9P6|Q8IUK1|Q8IUK2|Q96F52	Silent	SNP	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,smart_Ubiquitin-int_motif,pfscan_Ubiquitin-int_motif,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.D9	ENST00000336576.5	37	c.27	CCDS2439.1	2																																																																																			DNAJB2	-	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	ENSG00000135924		0.592	DNAJB2-001	KNOWN	basic|CCDS	protein_coding	DNAJB2	HGNC	protein_coding	OTTHUMT00000256823.2	136	0.00	0	C			220144582	220144582	+1	no_errors	ENST00000336576	ensembl	human	known	69_37n	silent	70	38.60	44	SNP	0.984	T
DNAJB2	3300	genome.wustl.edu	37	2	220144582	220144582	+	Silent	SNP	C	C	T			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr2:220144582C>T	ENST00000336576.5	+	2	315	c.27C>T	c.(25-27)gaC>gaT	p.D9D	DNAJB2_ENST00000392086.4_Silent_p.D9D	NM_006736.5	NP_006727.2	P25686	DNJB2_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 2	9	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				cell death (GO:0008219)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of inclusion body assembly (GO:0090084)|negative regulation of protein deubiquitination (GO:0090086)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein folding (GO:0006457)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|inclusion body (GO:0016234)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|polyubiquitin binding (GO:0031593)|proteasome binding (GO:0070628)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14		Renal(207;0.0474)		Epithelial(149;1.97e-06)|all cancers(144;0.00028)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGATCCTAGACGTGCCGCGAA	0.592																																						dbGAP											0													94.0	83.0	87.0					2																	220144582		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2439.1, CCDS46519.1	2q32-q34	2011-09-02			ENSG00000135924	ENSG00000135924		"""Heat shock proteins / DNAJ (HSP40)"""	5228	protein-coding gene	gene with protein product		604139		HSJ1		1599432, 10516435	Standard	NM_006736		Approved	HSPF3	uc002vkx.1	P25686	OTTHUMG00000133134	ENST00000336576.5:c.27C>T	2.37:g.220144582C>T			A8K9P6|Q8IUK1|Q8IUK2|Q96F52	Silent	SNP	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,smart_Ubiquitin-int_motif,pfscan_Ubiquitin-int_motif,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.D9	ENST00000336576.5	37	c.27	CCDS2439.1	2																																																																																			DNAJB2	-	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	ENSG00000135924		0.592	DNAJB2-001	KNOWN	basic|CCDS	protein_coding	DNAJB2	HGNC	protein_coding	OTTHUMT00000256823.2	46	0.00	0	C			220144582	220144582	+1	no_errors	ENST00000336576	ensembl	human	known	69_37n	silent	70	38.60	44	SNP	0.984	T
DNAJB4	11080	genome.wustl.edu	37	1	78478782	78478782	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr1:78478782C>T	ENST00000370763.5	+	2	516	c.259C>T	c.(259-261)Cgg>Tgg	p.R87W	DNAJB4_ENST00000487931.1_3'UTR|GIPC2_ENST00000476882.1_Intron	NM_007034.3	NP_008965.2	Q9UDY4	DNJB4_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 4	87					protein folding (GO:0006457)|response to heat (GO:0009408)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chaperone binding (GO:0051087)|unfolded protein binding (GO:0051082)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10						AGGTACCTTCCGGTACACCTT	0.438																																						dbGAP											0													89.0	92.0	91.0					1																	78478782		2203	4300	6503	-	-	-	SO:0001583	missense	0			U40992	CCDS684.1	1p31.1	2011-09-02			ENSG00000162616	ENSG00000162616		"""Heat shock proteins / DNAJ (HSP40)"""	14886	protein-coding gene	gene with protein product		611327				9546042, 11147971	Standard	NM_007034		Approved	HLJ1	uc001dij.3	Q9UDY4	OTTHUMG00000040905	ENST00000370763.5:c.259C>T	1.37:g.78478782C>T	ENSP00000359799:p.Arg87Trp		B2R824|Q13431	Missense_Mutation	SNP	pfam_DnaJ_C,pfam_DnaJ_N,superfamily_DnaJ_N,superfamily_HSP40/DnaJ_pept-bd,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.R87W	ENST00000370763.5	37	c.259	CCDS684.1	1	.	.	.	.	.	.	.	.	.	.	C	17.77	3.471780	0.63737	.	.	ENSG00000162616	ENST00000426517;ENST00000370763	T;T	0.73469	-0.75;-0.75	5.57	3.66	0.41972	Heat shock protein DnaJ, N-terminal (1);	0.218237	0.45126	D	0.000397	T	0.61236	0.2331	L	0.49126	1.545	0.80722	D	1	D	0.61697	0.99	P	0.48677	0.586	T	0.61058	-0.7139	10	0.39692	T	0.17	.	10.4212	0.44352	0.138:0.7921:0.0:0.0698	.	87	Q9UDY4	DNJB4_HUMAN	W	87	ENSP00000399494:R87W;ENSP00000359799:R87W	ENSP00000359799:R87W	R	+	1	2	DNAJB4	78251370	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.212000	0.58514	0.660000	0.30964	0.644000	0.83932	CGG	DNAJB4	-	NULL	ENSG00000162616		0.438	DNAJB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJB4	HGNC	protein_coding	OTTHUMT00000098248.3	65	0.00	0	C			78478782	78478782	+1	no_errors	ENST00000370763	ensembl	human	known	69_37n	missense	225	10.36	26	SNP	1.000	T
DNTTIP2	30836	genome.wustl.edu	37	1	94344542	94344542	+	Intron	SNP	T	T	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr1:94344542T>G	ENST00000436063.2	-	1	130				DNTTIP2_ENST00000460191.1_5'UTR	NM_014597.4	NP_055412.2	Q5QJE6	TDIF2_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 2						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	38		all_lung(203;0.0111)|Lung NSC(277;0.0347)		all cancers(265;0.00679)|GBM - Glioblastoma multiforme(16;0.0278)|Epithelial(280;0.128)		TGTCGGCAGGTCCTCACCCTT	0.632																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AY394925	CCDS44174.1	1p22.1	2008-02-05			ENSG00000067334	ENSG00000067334			24013	protein-coding gene	gene with protein product	"""acidic 82 kDa protein mRNA"""	611199				15047147	Standard	NM_014597		Approved	HSU15552, ERBP, TdIF2	uc001dqf.3	Q5QJE6	OTTHUMG00000010268	ENST00000436063.2:c.72+90A>C	1.37:g.94344542T>G			Q12987|Q53H59|Q5TFJ4|Q6TLI0|Q76MJ8|Q86WX9	RNA	SNP	-	NULL	ENST00000436063.2	37	NULL	CCDS44174.1	1																																																																																			DNTTIP2	-	-	ENSG00000067334		0.632	DNTTIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNTTIP2	HGNC	protein_coding	OTTHUMT00000028317.2	38	0.00	0	T	NM_014597		94344542	94344542	-1	no_errors	ENST00000460191	ensembl	human	known	69_37n	rna	16	44.83	13	SNP	0.000	G
DPAGT1	1798	genome.wustl.edu	37	11	118972221	118972221	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr11:118972221T>G	ENST00000409993.2	-	3	1696	c.145A>C	c.(145-147)Acc>Ccc	p.T49P	DPAGT1_ENST00000354202.4_Missense_Mutation_p.T49P|DPAGT1_ENST00000445653.1_5'UTR|DPAGT1_ENST00000432443.2_5'UTR			Q9H3H5	GPT_HUMAN	dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)	49					cellular protein metabolic process (GO:0044267)|dolichol biosynthetic process (GO:0019408)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|protein oligomerization (GO:0051259)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	phospho-N-acetylmuramoyl-pentapeptide-transferase activity (GO:0008963)|transferase activity, transferring glycosyl groups (GO:0016757)|UDP-N-acetylglucosamine-dolichyl-phosphate N-acetylglucosaminephosphotransferase activity (GO:0003975)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(2)	17	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.55e-05)		TGTCGGCTGGTTTTGTTGAGG	0.647											OREG0021396	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													96.0	108.0	104.0					11																	118972221		2200	4295	6495	-	-	-	SO:0001583	missense	0			Z82022	CCDS8411.1	11q23.3	2007-12-14			ENSG00000172269	ENSG00000172269	2.7.8.15		2995	protein-coding gene	gene with protein product		191350		DPAGT2, DPAGT		8244387	Standard	NM_001382		Approved	GPT, D11S366, DGPT, ALG7, CDG-Ij	uc001pvi.3	Q9H3H5	OTTHUMG00000153533	ENST00000409993.2:c.145A>C	11.37:g.118972221T>G	ENSP00000386597:p.Thr49Pro	1492	O15216|Q86WV9|Q9BWE6	Missense_Mutation	SNP	pfam_Glycosyl_transferase_4	p.T49P	ENST00000409993.2	37	c.145	CCDS8411.1	11	.	.	.	.	.	.	.	.	.	.	T	11.82	1.753986	0.31046	.	.	ENSG00000172269	ENST00000409993;ENST00000354202	D;D	0.91351	-2.83;-2.83	5.65	-11.3	0.00108	.	0.829483	0.11312	N	0.577044	T	0.74145	0.3678	N	0.20845	0.615	0.26120	N	0.980567	B	0.02656	0.0	B	0.01281	0.0	T	0.57602	-0.7783	10	0.14656	T	0.56	-17.8296	6.8892	0.24220	0.0906:0.0684:0.2604:0.5807	.	49	Q9H3H5	GPT_HUMAN	P	49	ENSP00000386597:T49P;ENSP00000346142:T49P	ENSP00000346142:T49P	T	-	1	0	DPAGT1	118477431	0.454000	0.25728	0.000000	0.03702	0.776000	0.43924	0.082000	0.14847	-2.650000	0.00424	-1.489000	0.00976	ACC	DPAGT1	-	NULL	ENSG00000172269		0.647	DPAGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DPAGT1	HGNC	protein_coding	OTTHUMT00000331527.2	64	0.00	0	T	NM_001382		118972221	118972221	-1	no_errors	ENST00000354202	ensembl	human	known	69_37n	missense	46	19.30	11	SNP	0.002	G
DSPP	1834	genome.wustl.edu	37	4	88536880	88536880	+	Silent	SNP	C	C	T			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr4:88536880C>T	ENST00000282478.7	+	4	3099	c.3066C>T	c.(3064-3066)agC>agT	p.S1022S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S1022S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1022	Asp/Ser-rich.			S -> G (in Ref. 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtgacagcagcaatagcagtg	0.517																																						dbGAP											0													43.0	36.0	39.0					4																	88536880		1598	2799	4397	-	-	-	SO:0001819	synonymous_variant	0			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3066C>T	4.37:g.88536880C>T			A8MUI0|O95815	Silent	SNP	NULL	p.S1022	ENST00000282478.7	37	c.3066	CCDS43248.1	4																																																																																			DSPP	-	NULL	ENSG00000152591		0.517	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DSPP	HGNC	protein_coding	OTTHUMT00000363616.3	46	0.00	0	C	NM_014208		88536880	88536880	+1	no_errors	ENST00000282478	ensembl	human	known	69_37n	silent	446	13.23	68	SNP	0.011	T
DSPP	1834	genome.wustl.edu	37	4	88536886	88536886	+	Silent	SNP	C	C	T	rs111205182		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr4:88536886C>T	ENST00000282478.7	+	4	3105	c.3072C>T	c.(3070-3072)agC>agT	p.S1024S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S1024S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1024	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gcagcaatagcagtgacagca	0.517																																						dbGAP											0													44.0	40.0	41.0					4																	88536886		1516	2409	3925	-	-	-	SO:0001819	synonymous_variant	0			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3072C>T	4.37:g.88536886C>T			A8MUI0|O95815	Silent	SNP	NULL	p.S1024	ENST00000282478.7	37	c.3072	CCDS43248.1	4																																																																																			DSPP	-	NULL	ENSG00000152591		0.517	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DSPP	HGNC	protein_coding	OTTHUMT00000363616.3	45	0.00	0	C	NM_014208		88536886	88536886	+1	no_errors	ENST00000282478	ensembl	human	known	69_37n	silent	378	22.70	111	SNP	0.076	T
EML2	24139	genome.wustl.edu	37	19	46137720	46137720	+	Nonsense_Mutation	SNP	G	G	T	rs146273538		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr19:46137720G>T	ENST00000245925.3	-	4	239	c.189C>A	c.(187-189)taC>taA	p.Y63*	EML2_ENST00000536630.1_Nonsense_Mutation_p.Y210*|EML2_ENST00000586902.1_5'Flank|EML2_ENST00000587152.1_Nonsense_Mutation_p.Y264*|EML2_ENST00000589876.1_Nonsense_Mutation_p.Y63*	NM_012155.2	NP_036287.1	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like 2	63	Tandem atypical propeller in EMLs. {ECO:0000250}.				negative regulation of microtubule polymerization (GO:0031115)|regulation of microtubule nucleation (GO:0010968)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|urinary_tract(1)	31		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		CTCGGCCACGGTAGCCATAGC	0.458																																						dbGAP											0													26.0	22.0	23.0					19																	46137720		2202	4296	6498	-	-	-	SO:0001587	stop_gained	0			AF103939	CCDS12670.1, CCDS54280.1, CCDS59399.1	19q13.32	2013-01-10				ENSG00000125746		"""WD repeat domain containing"""	18035	protein-coding gene	gene with protein product	"""echinoderm MT-associated protein (EMAP)-like protein 70"", ""microtubule-associated protein like echinoderm EMAP"""					11694528, 10521658	Standard	NM_012155		Approved	EMAP2, ELP70, EMAP-2	uc010xxm.2	O95834		ENST00000245925.3:c.189C>A	19.37:g.46137720G>T	ENSP00000245925:p.Tyr63*		B7Z3I2|B7Z3Q9|K7ERL7|Q59EN8|Q8N5A2|Q9UG50	Nonsense_Mutation	SNP	pfam_HELP,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,superfamily_Quinoprot_gluc/sorb_DH,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Y264*	ENST00000245925.3	37	c.792	CCDS12670.1	19	.	.	.	.	.	.	.	.	.	.	G	37	6.481785	0.97603	.	.	ENSG00000125746	ENST00000536630;ENST00000245925;ENST00000448055;ENST00000399594	.	.	.	4.74	3.7	0.42460	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-28.3381	6.5424	0.22387	0.2178:0.0:0.7822:0.0	.	.	.	.	X	210;63;264;221	.	ENSP00000245925:Y63X	Y	-	3	2	EML2	50829560	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	3.471000	0.53107	1.201000	0.43203	0.462000	0.41574	TAC	EML2	-	pfam_HELP,superfamily_Quinonprotein_ADH-like	ENSG00000125746		0.458	EML2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	EML2	HGNC	protein_coding	OTTHUMT00000459608.1	121	0.00	0	G	NM_012155		46137720	46137720	-1	no_errors	ENST00000587152	ensembl	human	known	69_37n	nonsense	46	45.88	39	SNP	1.000	T
BBS1	582	genome.wustl.edu	37	11	66288848	66288848	+	Splice_Site	SNP	G	G	T	rs200335137		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr11:66288848G>T	ENST00000318312.7	+	9	881		c.e9+1		BBS1_ENST00000455748.2_Splice_Site|BBS1_ENST00000529766.1_Splice_Site|BBS1_ENST00000393994.2_Intron|ZDHHC24_ENST00000526986.1_3'UTR|CTD-3074O7.11_ENST00000419755.3_Splice_Site|BBS1_ENST00000537537.1_Splice_Site	NM_024649.4	NP_078925.3	Q8NFJ9	BBS1_HUMAN	Bardet-Biedl syndrome 1						cilium assembly (GO:0042384)|Golgi to plasma membrane protein transport (GO:0043001)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	patched binding (GO:0005113)|RNA polymerase II repressing transcription factor binding (GO:0001103)|smoothened binding (GO:0005119)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	28						TTCTGAGAAGGTAGCCACATC	0.547									Bardet-Biedl syndrome																												GBM(152;173 2612 9770 10137)	dbGAP											0			GRCh37	CS033489	BBS1	S							44.0	44.0	44.0					11																	66288848		2200	4295	6495	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AF503941	CCDS8142.1	11q13	2013-01-08			ENSG00000174483	ENSG00000174483			966	protein-coding gene	gene with protein product		209901				9039982, 12567324	Standard	NM_024649		Approved	FLJ23590	uc001oij.1	Q8NFJ9	OTTHUMG00000167110	ENST00000318312.7:c.830+1G>T	11.37:g.66288848G>T			Q32MM9|Q32MN0|Q96SN4	Splice_Site	SNP	-	e9+1	ENST00000318312.7	37	c.941+1	CCDS8142.1	11	.	.	.	.	.	.	.	.	.	.	G	20.5	3.993853	0.74703	.	.	ENSG00000256349;ENSG00000174483;ENSG00000174483;ENSG00000174483;ENSG00000174483	ENST00000419755;ENST00000318312;ENST00000537537;ENST00000525809;ENST00000455748	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3713	0.87379	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BBS1;CTD-3074O7.11	66045424	1.000000	0.71417	1.000000	0.80357	0.656000	0.38851	8.663000	0.91134	2.703000	0.92315	0.650000	0.86243	.	CTD-3074O7.11	-	-	ENSG00000256349		0.547	BBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000256349	Clone_based_vega_gene	protein_coding	OTTHUMT00000393235.2	76	0.00	0	G		Intron	66288848	66288848	+1	no_errors	ENST00000419755	ensembl	human	known	69_37n	splice_site	133	21.30	36	SNP	1.000	T
EPHA8	2046	genome.wustl.edu	37	1	22919888	22919888	+	Missense_Mutation	SNP	A	A	G	rs77608596		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr1:22919888A>G	ENST00000166244.3	+	6	1457	c.1385A>G	c.(1384-1386)gAg>gGg	p.E462G		NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	462	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CTGTGGCAGGAGCCCGAGCAG	0.667																																						dbGAP											0													15.0	15.0	15.0					1																	22919888		2191	4286	6477	-	-	-	SO:0001583	missense	0			BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.1385A>G	1.37:g.22919888A>G	ENSP00000166244:p.Glu462Gly		Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom	p.E462G	ENST00000166244.3	37	c.1385	CCDS225.1	1	.	.	.	.	.	.	.	.	.	.	A	18.21	3.572709	0.65765	.	.	ENSG00000070886	ENST00000166244	T	0.57595	0.39	4.27	4.27	0.50696	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.71929	0.3398	M	0.85041	2.73	0.80722	D	1	D	0.89917	1.0	D	0.69824	0.966	T	0.73575	-0.3939	10	0.34782	T	0.22	.	12.6422	0.56716	1.0:0.0:0.0:0.0	.	462	P29322	EPHA8_HUMAN	G	462	ENSP00000166244:E462G	ENSP00000166244:E462G	E	+	2	0	EPHA8	22792475	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.936000	0.70153	1.904000	0.55121	0.482000	0.46254	GAG	EPHA8	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000070886		0.667	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA8	HGNC	protein_coding	OTTHUMT00000008085.1	110	0.89	1	A	NM_020526		22919888	22919888	+1	no_errors	ENST00000166244	ensembl	human	known	69_37n	missense	15	42.31	11	SNP	1.000	G
EXOC3L1	283849	genome.wustl.edu	37	16	67218756	67218756	+	Intron	SNP	A	A	C	rs200200061	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr16:67218756A>C	ENST00000314586.6	-	13	2146				EXOC3L1_ENST00000562887.1_5'Flank|KIAA0895L_ENST00000563902.1_5'Flank|KIAA0895L_ENST00000290881.7_5'Flank|KIAA0895L_ENST00000561621.1_5'Flank|KIAA0895L_ENST00000563831.2_5'Flank	NM_178516.3	NP_848611.2	Q86VI1	EX3L1_HUMAN	exocyst complex component 3-like 1						exocytosis (GO:0006887)|peptide hormone secretion (GO:0030072)	exocyst (GO:0000145)|secretory granule (GO:0030141)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	21						CCTCTCTCCCACCCAGCCACT	0.672																																						dbGAP											0													19.0	23.0	22.0					16																	67218756		2196	4296	6492	-	-	-	SO:0001627	intron_variant	0			AK092858	CCDS10832.1	16q22.1	2011-01-31	2011-01-31	2011-01-31	ENSG00000179044	ENSG00000179044			27540	protein-coding gene	gene with protein product		614117	"""exocyst complex component 3-like"""	EXOC3L		12477932	Standard	NM_178516		Approved	FLJ35539, FLJ35587	uc002erx.1	Q86VI1	OTTHUMG00000137508	ENST00000314586.6:c.1906-43T>G	16.37:g.67218756A>C			A8K7I9|Q8NAD2|Q8TEN2	Missense_Mutation	SNP	pfam_Sec6	p.W554G	ENST00000314586.6	37	c.1660	CCDS10832.1	16	.	.	.	.	.	.	.	.	.	.	A	0.003	-2.474313	0.00167	.	.	ENSG00000179044	ENST00000545725;ENST00000314553	T	0.23147	1.92	4.46	0.871	0.19107	.	.	.	.	.	T	0.14527	0.0351	.	.	.	0.09310	N	0.999999	B;B	0.25772	0.11;0.134	B;B	0.25759	0.038;0.063	T	0.32534	-0.9903	7	.	.	.	.	6.1921	0.20530	0.6436:0.0:0.3564:0.0	.	549;549	F5H4W1;B7Z6U0	.;.	G	549;554	ENSP00000439910:W549G	.	W	-	1	0	EXOC3L1	65776257	0.000000	0.05858	0.001000	0.08648	0.061000	0.15899	0.035000	0.13797	0.033000	0.15463	0.379000	0.24179	TGG	EXOC3L1	-	pfam_Sec6	ENSG00000179044		0.672	EXOC3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC3L1	HGNC	protein_coding	OTTHUMT00000268827.2	31	0.00	0	A	NM_178516		67218756	67218756	-1	no_stop_codon	ENST00000563889	ensembl	human	novel	69_37n	missense	8	52.94	9	SNP	0.003	C
EXOSC2	23404	genome.wustl.edu	37	9	133569210	133569210	+	Missense_Mutation	SNP	G	G	C	rs202001690		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr9:133569210G>C	ENST00000372358.5	+	1	103	c.32G>C	c.(31-33)cGc>cCc	p.R11P	EXOSC2_ENST00000546165.1_Missense_Mutation_p.R11P|EXOSC2_ENST00000372351.3_Missense_Mutation_p.R11P|EXOSC2_ENST00000372352.3_Missense_Mutation_p.R11P			Q13868	EXOS2_HUMAN	exosome component 2	11					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of cell growth (GO:0030307)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|7S RNA binding (GO:0008312)			breast(1)|endometrium(1)|large_intestine(3)|ovary(1)	6		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(13;0.0588)		OV - Ovarian serous cystadenocarcinoma(145;0.000324)		CCAGTGGCTCGCAAGCCTCTT	0.587																																					Pancreas(134;1683 1824 10118 27928 31640)	dbGAP											0													33.0	33.0	33.0					9																	133569210		2201	4299	6500	-	-	-	SO:0001583	missense	0			AK001916	CCDS6935.1, CCDS65160.1, CCDS65161.1	9q34	2008-02-05			ENSG00000130713	ENSG00000130713			17097	protein-coding gene	gene with protein product	"""homolog of yeast RRP4 (ribosomal RNA processing 4), 3' 5' exoribonuclease (RRP4)"""	602238				8600032, 1538749	Standard	XM_005272176		Approved	hRrp4p, Rrp4p, RRP4, p7	uc004bzu.2	Q13868	OTTHUMG00000020811	ENST00000372358.5:c.32G>C	9.37:g.133569210G>C	ENSP00000361433:p.Arg11Pro		A3KFL3|B4DKK6|Q9NUY4	Missense_Mutation	SNP	superfamily_NA-bd_OB-fold-like	p.R11P	ENST00000372358.5	37	c.32	CCDS6935.1	9	.	.	.	.	.	.	.	.	.	.	G	20.2	3.950566	0.73787	.	.	ENSG00000130713	ENST00000372358;ENST00000546165;ENST00000372352;ENST00000372351;ENST00000372350;ENST00000495699	.	.	.	6.06	6.06	0.98353	.	0.199231	0.43579	D	0.000553	T	0.57740	0.2074	L	0.55481	1.735	0.43476	D	0.995695	B;D	0.53312	0.051;0.959	B;P	0.45881	0.012;0.496	T	0.61282	-0.7094	9	0.62326	D	0.03	-21.9848	12.8575	0.57894	0.0736:0.0:0.9264:0.0	.	11;11	B4DKK6;Q13868	.;EXOS2_HUMAN	P	11	.	ENSP00000361425:R11P	R	+	2	0	EXOSC2	132559031	0.994000	0.37717	0.924000	0.36721	0.379000	0.30106	3.806000	0.55583	2.882000	0.98803	0.655000	0.94253	CGC	EXOSC2	-	NULL	ENSG00000130713		0.587	EXOSC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOSC2	HGNC	protein_coding	OTTHUMT00000054673.1	50	0.00	0	G	NM_014285		133569210	133569210	+1	no_errors	ENST00000372358	ensembl	human	known	69_37n	missense	12	64.71	22	SNP	0.990	C
FAM110C	642273	genome.wustl.edu	37	2	45606	45606	+	Silent	SNP	G	G	A			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr2:45606G>A	ENST00000327669.4	-	1	779	c.780C>T	c.(778-780)ttC>ttT	p.F260F	FAM110C_ENST00000460464.1_5'Flank	NM_001077710.2	NP_001071178.2	Q1W6H9	F110C_HUMAN	family with sequence similarity 110, member C	260					positive regulation of cell migration (GO:0030335)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell projection assembly (GO:0060491)	cell cortex (GO:0005938)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|kidney(1)|lung(2)	4	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.00221)		all cancers(51;0.000815)|Epithelial(75;0.00379)|OV - Ovarian serous cystadenocarcinoma(76;0.0127)|GBM - Glioblastoma multiforme(21;0.232)		TGTGCCGGGAGAAGCCGCTGC	0.682																																						dbGAP											0													15.0	21.0	19.0					2																	45606		2050	4165	6215	-	-	-	SO:0001819	synonymous_variant	0			DQ431183	CCDS42645.1	2p25.3	2011-12-01			ENSG00000184731	ENSG00000184731			33340	protein-coding gene	gene with protein product		611395				17499476, 19698782	Standard	NM_001077710		Approved		uc010yim.2	Q1W6H9	OTTHUMG00000151321	ENST00000327669.4:c.780C>T	2.37:g.45606G>A				Silent	SNP	NULL	p.F260	ENST00000327669.4	37	c.780	CCDS42645.1	2																																																																																			FAM110C	-	NULL	ENSG00000184731		0.682	FAM110C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM110C	HGNC	protein_coding	OTTHUMT00000322220.1	89	0.00	0	G	NM_001077710		45606	45606	-1	no_errors	ENST00000327669	ensembl	human	known	69_37n	silent	16	46.67	14	SNP	1.000	A
FAM129B	64855	genome.wustl.edu	37	9	130287426	130287426	+	Missense_Mutation	SNP	A	A	C	rs201445763	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr9:130287426A>C	ENST00000373312.3	-	4	545	c.332T>G	c.(331-333)gTc>gGc	p.V111G	FAM129B_ENST00000468379.1_5'UTR|FAM129B_ENST00000373314.3_Missense_Mutation_p.V98G	NM_022833.2	NP_073744.2	Q96TA1	NIBL1_HUMAN	family with sequence similarity 129, member B	111	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				negative regulation of apoptotic process (GO:0043066)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.V111G(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						TCGTGGTGGGACCTGCCGCTC	0.577																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											82.0	75.0	78.0					9																	130287426		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF151783	CCDS35144.1, CCDS35145.1	9q34.13	2010-02-01	2006-11-23	2006-11-23	ENSG00000136830	ENSG00000136830			25282	protein-coding gene	gene with protein product		614045	"""chromosome 9 open reading frame 88"""	C9orf88		14702039, 19362540	Standard	XM_005252135		Approved	DKFZP434H0820, FLJ13518, FLJ22151, FLJ22298, bA356B19.6, MINERVA	uc004brh.3	Q96TA1	OTTHUMG00000020705	ENST00000373312.3:c.332T>G	9.37:g.130287426A>C	ENSP00000362409:p.Val111Gly		Q4LE55|Q5VVW6|Q5VVW7|Q9BUS2|Q9NT35	Missense_Mutation	SNP	pfscan_Pleckstrin_homology	p.V111G	ENST00000373312.3	37	c.332	CCDS35145.1	9	.	.	.	.	.	.	.	.	.	.	A	13.65	2.299966	0.40694	.	.	ENSG00000136830	ENST00000373314;ENST00000373312	T;T	0.22134	1.97;1.98	5.67	4.52	0.55395	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.696198	0.13927	N	0.353145	T	0.16342	0.0393	L	0.36672	1.1	0.31728	N	0.637387	B;B	0.27416	0.178;0.178	B;B	0.29353	0.101;0.101	T	0.10497	-1.0627	10	0.13853	T	0.58	-14.4527	10.1041	0.42521	0.9189:0.0:0.0811:0.0	.	98;111	Q96TA1-2;Q96TA1	.;NIBL1_HUMAN	G	98;111	ENSP00000362411:V98G;ENSP00000362409:V111G	ENSP00000362409:V111G	V	-	2	0	FAM129B	129327247	0.811000	0.29063	0.423000	0.26634	0.448000	0.32197	3.871000	0.56077	2.163000	0.67991	0.459000	0.35465	GTC	FAM129B	-	pfscan_Pleckstrin_homology	ENSG00000136830		0.577	FAM129B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM129B	HGNC	protein_coding	OTTHUMT00000054196.1	59	0.00	0	A	NM_022833		130287426	130287426	-1	no_errors	ENST00000373312	ensembl	human	known	69_37n	missense	68	55.69	93	SNP	0.324	C
FZD5	7855	genome.wustl.edu	37	2	208633326	208633326	+	Nonsense_Mutation	SNP	G	G	T	rs201344613		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr2:208633326G>T	ENST00000295417.3	-	2	691	c.138C>A	c.(136-138)taC>taA	p.Y46*		NM_003468.3	NP_003459.2	Q13467	FZD5_HUMAN	frizzled class receptor 5	46	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				angiogenesis (GO:0001525)|anterior/posterior axis specification, embryo (GO:0008595)|apoptotic process (GO:0006915)|apoptotic process involved in morphogenesis (GO:0060561)|axonogenesis (GO:0007409)|brain development (GO:0007420)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|canonical Wnt signaling pathway (GO:0060070)|cell maturation (GO:0048469)|cellular response to molecule of bacterial origin (GO:0071219)|chorionic trophoblast cell differentiation (GO:0060718)|embryonic axis specification (GO:0000578)|embryonic camera-type eye development (GO:0031076)|gonad development (GO:0008406)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|neuron differentiation (GO:0030182)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic camera-type eye development (GO:0031077)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of chorionic trophoblast cell proliferation (GO:1901382)|regulation of tight junction assembly (GO:2000810)|Spemann organizer formation (GO:0060061)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell differentiation in thymus (GO:0033077)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	cell projection (GO:0042995)|cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			NS(1)|kidney(1)|lung(1)|ovary(2)|prostate(1)|skin(1)	7				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.13)|Lung(261;0.134)		GCGTCAGGTTGTAGCCGATGC	0.677																																						dbGAP											0													71.0	56.0	61.0					2																	208633326		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U43318	CCDS33366.1	2q33.3	2014-01-29	2014-01-29		ENSG00000163251	ENSG00000163251		"""GPCR / Class F : Frizzled receptors"""	4043	protein-coding gene	gene with protein product		601723	"""frizzled (Drosophila) homolog 5"", ""chromosome 2 open reading frame 31"", ""frizzled homolog 5 (Drosophila)"", ""frizzled 5, seven transmembrane spanning receptor"", ""frizzled family receptor 5"""	C2orf31		8626800, 11408929	Standard	NM_003468		Approved	HFZ5, DKFZP434E2135	uc002vcj.3	Q13467	OTTHUMG00000154790	ENST00000295417.3:c.138C>A	2.37:g.208633326G>T	ENSP00000354607:p.Tyr46*		A8K2X1|B2RCZ1|Q53R22	Nonsense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.Y46*	ENST00000295417.3	37	c.138	CCDS33366.1	2	.	.	.	.	.	.	.	.	.	.	G	40	8.408773	0.98799	.	.	ENSG00000163251	ENST00000295417	.	.	.	4.37	2.53	0.30540	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.0782	0.30729	0.2611:0.0:0.7389:0.0	.	.	.	.	X	46	.	ENSP00000354607:Y46X	Y	-	3	2	FZD5	208341571	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.859000	0.62954	0.299000	0.22661	0.555000	0.69702	TAC	FZD5	-	pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom	ENSG00000163251		0.677	FZD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD5	HGNC	protein_coding	OTTHUMT00000337060.1	190	0.00	0	G	NM_003468		208633326	208633326	-1	no_errors	ENST00000295417	ensembl	human	known	69_37n	nonsense	110	16.67	22	SNP	1.000	T
GABRA6	2559	genome.wustl.edu	37	5	161116743	161116743	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-10A-01D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	bf856604-4326-4145-bc3c-137098338f61	g.chr5:161116743A>C	ENST00000274545.5	+	6	1064	c.631A>C	c.(631-633)Att>Ctt	p.I211L	GABRA6_ENST00000523217.1_Missense_Mutation_p.I201L|RP11-348M17.2_ENST00000521984.1_RNA			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	211					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	GTATGATCTGATTGGACAAAC	0.378										TCGA Ovarian(5;0.080)																												dbGAP											0													74.0	82.0	79.0					5																	161116743		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.631A>C	5.37:g.161116743A>C	ENSP00000274545:p.Ile211Leu		A8K096|Q4VAV2	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa6_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.I211L	ENST00000274545.5	37	c.631	CCDS4356.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	4.993|4.993	0.184412|0.184412	0.09495|0.09495	.|.	.|.	ENSG00000145863|ENSG00000145863	ENST00000274545;ENST00000523217;ENST00000517823;ENST00000523691|ENST00000520000	T;T;T;T|.	0.78707|.	-1.2;-1.2;-1.2;-1.2|.	5.41|5.41	2.93|2.93	0.34026|0.34026	Neurotransmitter-gated ion-channel ligand-binding (3);|.	0.053273|.	0.85682|.	D|.	0.000000|.	T|.	0.20292|.	0.0488|.	N|N	0.03050|0.03050	-0.425|-0.425	0.39742|0.39742	D|D	0.971764|0.971764	B|.	0.16603|.	0.018|.	B|.	0.25405|.	0.06|.	T|.	0.04811|.	-1.0925|.	10|.	0.10111|.	T|.	0.7|.	.|.	5.5056|5.5056	0.16852|0.16852	0.7057:0.1467:0.1476:0.0|0.7057:0.1467:0.1476:0.0	.|.	211|.	Q16445|.	GBRA6_HUMAN|.	L|C	211;201;158;131|150	ENSP00000274545:I211L;ENSP00000430527:I201L;ENSP00000430212:I158L;ENSP00000427989:I131L|.	ENSP00000274545:I211L|.	I|X	+|+	1|3	0|0	GABRA6|GABRA6	161049321|161049321	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.031000|2.031000	0.41117|0.41117	0.324000|0.324000	0.23333|0.23333	0.533000|0.533000	0.62120|0.62120	ATT|TGA	GABRA6	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_GABAAa_rcpt,tigrfam_Neur_channel	ENSG00000145863		0.378	GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA6	HGNC	protein_coding	OTTHUMT00000252707.2	206	0.00	0	A			161116743	161116743	+1	no_errors	ENST00000274545	ensembl	human	known	69_37n	missense	170	27.85	66	SNP	1.000	C
GABRA6	2559	genome.wustl.edu	37	5	161116743	161116743	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr5:161116743A>C	ENST00000274545.5	+	6	1064	c.631A>C	c.(631-633)Att>Ctt	p.I211L	GABRA6_ENST00000523217.1_Missense_Mutation_p.I201L|RP11-348M17.2_ENST00000521984.1_RNA			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	211					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	GTATGATCTGATTGGACAAAC	0.378										TCGA Ovarian(5;0.080)																												dbGAP											0													74.0	82.0	79.0					5																	161116743		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.631A>C	5.37:g.161116743A>C	ENSP00000274545:p.Ile211Leu		A8K096|Q4VAV2	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa6_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.I211L	ENST00000274545.5	37	c.631	CCDS4356.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	4.993|4.993	0.184412|0.184412	0.09495|0.09495	.|.	.|.	ENSG00000145863|ENSG00000145863	ENST00000274545;ENST00000523217;ENST00000517823;ENST00000523691|ENST00000520000	T;T;T;T|.	0.78707|.	-1.2;-1.2;-1.2;-1.2|.	5.41|5.41	2.93|2.93	0.34026|0.34026	Neurotransmitter-gated ion-channel ligand-binding (3);|.	0.053273|.	0.85682|.	D|.	0.000000|.	T|.	0.20292|.	0.0488|.	N|N	0.03050|0.03050	-0.425|-0.425	0.39742|0.39742	D|D	0.971764|0.971764	B|.	0.16603|.	0.018|.	B|.	0.25405|.	0.06|.	T|.	0.04811|.	-1.0925|.	10|.	0.10111|.	T|.	0.7|.	.|.	5.5056|5.5056	0.16852|0.16852	0.7057:0.1467:0.1476:0.0|0.7057:0.1467:0.1476:0.0	.|.	211|.	Q16445|.	GBRA6_HUMAN|.	L|C	211;201;158;131|150	ENSP00000274545:I211L;ENSP00000430527:I201L;ENSP00000430212:I158L;ENSP00000427989:I131L|.	ENSP00000274545:I211L|.	I|X	+|+	1|3	0|0	GABRA6|GABRA6	161049321|161049321	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.031000|2.031000	0.41117|0.41117	0.324000|0.324000	0.23333|0.23333	0.533000|0.533000	0.62120|0.62120	ATT|TGA	GABRA6	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_GABAAa_rcpt,tigrfam_Neur_channel	ENSG00000145863		0.378	GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA6	HGNC	protein_coding	OTTHUMT00000252707.2	40	0.00	0	A			161116743	161116743	+1	no_errors	ENST00000274545	ensembl	human	known	69_37n	missense	170	27.85	66	SNP	1.000	C
GCDH	2639	genome.wustl.edu	37	19	13002672	13002672	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr19:13002672A>G	ENST00000222214.5	+	4	366	c.155A>G	c.(154-156)gAc>gGc	p.D52G	GCDH_ENST00000591470.1_Missense_Mutation_p.D52G|GCDH_ENST00000457854.1_Missense_Mutation_p.D52G|GCDH_ENST00000422947.2_5'UTR			Q92947	GCDH_HUMAN	glutaryl-CoA dehydrogenase	52					cellular nitrogen compound metabolic process (GO:0034641)|fatty acid oxidation (GO:0019395)|fatty-acyl-CoA biosynthetic process (GO:0046949)|lysine catabolic process (GO:0006554)|small molecule metabolic process (GO:0044281)|tryptophan metabolic process (GO:0006568)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)|glutaryl-CoA dehydrogenase activity (GO:0004361)			autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)	19					Flavin adenine dinucleotide(DB03147)	GACTGGCAGGACCCGCTGGTG	0.617																																					GBM(123;875 1636 7726 16444 26754)	dbGAP											0													50.0	44.0	46.0					19																	13002672		2201	4300	6501	-	-	-	SO:0001583	missense	0			AF012342	CCDS12286.1	19p13.2	2010-04-30	2010-04-30			ENSG00000105607	1.3.99.7		4189	protein-coding gene	gene with protein product		608801	"""glutaryl-Coenzyme A dehydrogenase"""			1438360, 8088809	Standard	NM_000159		Approved	ACAD5	uc002mvq.4	Q92947		ENST00000222214.5:c.155A>G	19.37:g.13002672A>G	ENSP00000222214:p.Asp52Gly		A8K2Z2|O14719	Missense_Mutation	SNP	pfam_Acyl-CoA_Oxase/DH_1,pfam_Acyl-CoA_DH_N,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_Acyl-CoA_DH_2_C,superfamily_AcylCoA_DH/oxidase,superfamily_AcylCo_DH/oxidase_C	p.D52G	ENST00000222214.5	37	c.155	CCDS12286.1	19	.	.	.	.	.	.	.	.	.	.	A	19.84	3.902154	0.72754	.	.	ENSG00000105607	ENST00000457854;ENST00000222214;ENST00000421816	D;D	0.99070	-5.39;-5.39	5.17	5.17	0.71159	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA dehydrogenase/oxidase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98544	0.9514	L	0.32530	0.975	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99835	1.1057	10	0.87932	D	0	.	12.96	0.58453	1.0:0.0:0.0:0.0	.	40;52;52	B4DQF2;Q92947;Q92947-2	.;GCDH_HUMAN;.	G	52;52;40	ENSP00000394872:D52G;ENSP00000222214:D52G	ENSP00000222214:D52G	D	+	2	0	GCDH	12863672	1.000000	0.71417	0.761000	0.31378	0.189000	0.23516	8.711000	0.91396	1.958000	0.56883	0.379000	0.24179	GAC	GCDH	-	superfamily_AcylCoA_DH/oxidase	ENSG00000105607		0.617	GCDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCDH	HGNC	protein_coding	OTTHUMT00000451897.1	51	0.00	0	A			13002672	13002672	+1	no_errors	ENST00000222214	ensembl	human	known	69_37n	missense	26	44.90	22	SNP	1.000	G
GDAP1L1	78997	genome.wustl.edu	37	20	42893238	42893238	+	Intron	SNP	A	A	C			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr20:42893238A>C	ENST00000342560.5	+	5	848				GDAP1L1_ENST00000537864.1_Intron	NM_001256737.1|NM_024034.4	NP_001243666.1|NP_076939.3	Q96MZ0	GD1L1_HUMAN	ganglioside induced differentiation associated protein 1-like 1											endometrium(1)|large_intestine(5)|lung(10)|pancreas(1)|prostate(1)	18		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GCTGCAGCCCACCCAGCCTAC	0.607																																						dbGAP											0													18.0	20.0	19.0					20																	42893238		2202	4296	6498	-	-	-	SO:0001627	intron_variant	0				CCDS13328.1, CCDS74725.1, CCDS74726.1, CCDS74727.1	20q12	2012-02-09	2012-02-09		ENSG00000124194	ENSG00000124194			4213	protein-coding gene	gene with protein product							Standard	NM_024034		Approved		uc010zwl.3	Q96MZ0	OTTHUMG00000032530	ENST00000342560.5:c.760+39A>C	20.37:g.42893238A>C			B7Z621|Q5TE60|Q68CW7|Q9BQJ7|Q9BQV4|Q9BWJ4|Q9H3Y2|Q9H4G5	Missense_Mutation	SNP	superfamily_Thioredoxin-like_fold	p.H213P	ENST00000342560.5	37	c.638	CCDS13328.1	20	.	.	.	.	.	.	.	.	.	.	A	10.16	1.274523	0.23307	.	.	ENSG00000124194	ENST00000445952	.	.	.	3.5	1.21	0.21127	.	.	.	.	.	T	0.23965	0.0580	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.23154	-1.0196	4	.	.	.	.	3.6282	0.08121	0.6504:0.2281:0.1215:0.0	.	.	.	.	P	213	.	.	H	+	2	0	GDAP1L1	42326652	0.000000	0.05858	0.026000	0.17262	0.614000	0.37383	-0.056000	0.11787	0.228000	0.21019	0.402000	0.26972	CAC	GDAP1L1	-	NULL	ENSG00000124194		0.607	GDAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDAP1L1	HGNC	protein_coding	OTTHUMT00000079356.1	46	0.00	0	A	NM_024034		42893238	42893238	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000445952	ensembl	human	known	69_37n	missense	28	60.56	43	SNP	0.121	C
GLI2	2736	genome.wustl.edu	37	2	121747071	121747071	+	Missense_Mutation	SNP	G	G	A	rs200034506		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr2:121747071G>A	ENST00000452319.1	+	14	3641	c.3581G>A	c.(3580-3582)aGc>aAc	p.S1194N	GLI2_ENST00000361492.4_Missense_Mutation_p.S1194N|GLI2_ENST00000314490.11_Intron					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				CTACAGGCTAGCCCTGGGGGC	0.667																																						dbGAP											0													14.0	18.0	16.0					2																	121747071		2183	4246	6429	-	-	-	SO:0001583	missense	0				CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.3581G>A	2.37:g.121747071G>A	ENSP00000390436:p.Ser1194Asn			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S1194N	ENST00000452319.1	37	c.3581	CCDS33283.1	2	.	.	.	.	.	.	.	.	.	.	G	0.049	-1.257572	0.01457	.	.	ENSG00000074047	ENST00000452319;ENST00000361492	T;T	0.15372	2.43;2.43	4.72	3.84	0.44239	.	0.519881	0.22311	N	0.061726	T	0.16769	0.0403	L	0.57536	1.79	0.20074	N	0.999933	B;B	0.06786	0.001;0.001	B;B	0.06405	0.001;0.002	T	0.14615	-1.0466	9	.	.	.	.	9.59	0.39539	0.0818:0.1538:0.7644:0.0	.	1194;849	P10070;P10070-2	GLI2_HUMAN;.	N	1194	ENSP00000390436:S1194N;ENSP00000354586:S1194N	.	S	+	2	0	GLI2	121463541	0.028000	0.19301	0.177000	0.23020	0.031000	0.12232	0.082000	0.14847	1.224000	0.43551	0.449000	0.29647	AGC	GLI2	-	NULL	ENSG00000074047		0.667	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	GLI2	HGNC	protein_coding	OTTHUMT00000332293.3	24	0.00	0	G	NM_005270		121747071	121747071	+1	no_errors	ENST00000361492	ensembl	human	known	69_37n	missense	5	50.00	5	SNP	0.039	A
GIGYF2	26058	genome.wustl.edu	37	2	233712266	233712266	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr2:233712266G>C	ENST00000409547.1	+	29	3980	c.3669G>C	c.(3667-3669)caG>caC	p.Q1223H	GIGYF2_ENST00000373563.4_Missense_Mutation_p.Q1223H|GIGYF2_ENST00000373566.3_Missense_Mutation_p.Q1245H|GIGYF2_ENST00000409480.1_Missense_Mutation_p.Q1245H|GIGYF2_ENST00000409451.3_Missense_Mutation_p.Q1244H|GIGYF2_ENST00000409196.3_Missense_Mutation_p.Q1217H	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	1223	Gln-rich.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		agccgccacagcagccacaac	0.512																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.3669G>C	2.37:g.233712266G>C	ENSP00000386537:p.Gln1223His		A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Missense_Mutation	SNP	pfam_GYF,superfamily_GYF,smart_GYF,pfscan_GYF	p.Q1245H	ENST00000409547.1	37	c.3735	CCDS33401.1	2	.	.	.	.	.	.	.	.	.	.	G	0.137	-1.106594	0.01828	.	.	ENSG00000204120	ENST00000373566;ENST00000373563;ENST00000409480;ENST00000409547;ENST00000409196;ENST00000409451	T;T;T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1;-0.1;-0.1	2.09	-2.51	0.06365	.	2.229760	0.01609	N	0.022422	T	0.45196	0.1330	N	0.22421	0.69	0.09310	N	0.999998	B;B;B	0.28713	0.22;0.072;0.072	B;B;B	0.15052	0.012;0.012;0.012	T	0.32613	-0.9900	10	0.54805	T	0.06	1.1413	6.5154	0.22244	0.6043:0.0:0.3957:0.0	.	1244;1223;1217	A6H8W4;Q6Y7W6;E9PBB0	.;PERQ2_HUMAN;.	H	1245;1223;1245;1223;1217;1244	ENSP00000362667:Q1245H;ENSP00000362664:Q1223H;ENSP00000386765:Q1245H;ENSP00000386537:Q1223H;ENSP00000387070:Q1217H;ENSP00000387170:Q1244H	ENSP00000362664:Q1223H	Q	+	3	2	GIGYF2	233420510	0.885000	0.30320	0.004000	0.12327	0.004000	0.04260	1.408000	0.34668	-0.742000	0.04790	-0.218000	0.12543	CAG	GIGYF2	-	NULL	ENSG00000204120		0.512	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	GIGYF2	HGNC	protein_coding	OTTHUMT00000330316.2	61	0.00	0	G	NM_001103146		233712266	233712266	+1	no_errors	ENST00000373566	ensembl	human	known	69_37n	missense	12	66.67	24	SNP	0.053	C
GMIP	51291	genome.wustl.edu	37	19	19741085	19741085	+	Missense_Mutation	SNP	C	C	G	rs199807296		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr19:19741085C>G	ENST00000203556.4	-	21	2737	c.2600G>C	c.(2599-2601)cGc>cCc	p.R867P	LPAR2_ENST00000589311.1_5'Flank|LPAR2_ENST00000407877.3_5'Flank|LPAR2_ENST00000542587.1_5'Flank|GMIP_ENST00000445806.2_Missense_Mutation_p.R838P|LPAR2_ENST00000586703.1_5'Flank|GMIP_ENST00000587238.1_Missense_Mutation_p.R841P	NM_016573.2	NP_057657.2	Q9P107	GMIP_HUMAN	GEM interacting protein	867					intracellular signal transduction (GO:0035556)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|Rho GTPase activator activity (GO:0005100)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						CACTGGCTGGCGGCTGAAGTG	0.642																																						dbGAP											0													31.0	37.0	35.0					19																	19741085		2198	4295	6493	-	-	-	SO:0001583	missense	0			AF132541	CCDS12408.1, CCDS74318.1	19p13.11	2011-09-07				ENSG00000089639		"""Rho GTPase activating proteins"""	24852	protein-coding gene	gene with protein product		609694				12093360, 16086184	Standard	XM_005259927		Approved	ARHGAP46	uc002nnd.3	Q9P107		ENST00000203556.4:c.2600G>C	19.37:g.19741085C>G	ENSP00000203556:p.Arg867Pro		A0AVN9|B7ZLZ0	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom	p.R867P	ENST00000203556.4	37	c.2600	CCDS12408.1	19	.	.	.	.	.	.	.	.	.	.	C	13.13	2.144546	0.37825	.	.	ENSG00000089639	ENST00000203556;ENST00000445806	T;T	0.27720	1.72;1.65	5.29	4.25	0.50352	.	0.159702	0.29783	N	0.011218	T	0.42765	0.1217	L	0.34521	1.04	0.43719	D	0.996199	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	T	0.35847	-0.9772	10	0.87932	D	0	-21.4111	11.3019	0.49311	0.1821:0.8179:0.0:0.0	.	838;841;867	E7ERB7;B7ZLZ0;Q9P107	.;.;GMIP_HUMAN	P	867;838	ENSP00000203556:R867P;ENSP00000397075:R838P	ENSP00000203556:R867P	R	-	2	0	GMIP	19602085	1.000000	0.71417	0.998000	0.56505	0.002000	0.02628	5.637000	0.67854	1.213000	0.43380	-0.314000	0.08810	CGC	GMIP	-	NULL	ENSG00000089639		0.642	GMIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GMIP	HGNC	protein_coding	OTTHUMT00000460551.1	58	0.00	0	C	NM_016573		19741085	19741085	-1	no_errors	ENST00000203556	ensembl	human	known	69_37n	missense	34	50.72	35	SNP	1.000	G
GOLGA2P5	55592	genome.wustl.edu	37	12	100559710	100559710	+	RNA	SNP	T	T	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr12:100559710T>G	ENST00000397112.4	-	0	599					NR_036632.1		Q9HBQ8	GGA2B_HUMAN								Golgi apparatus (GO:0005794)				large_intestine(1)|lung(3)	4						CAGAGGCTGGTGCCCGCCTTC	0.602																																						dbGAP											0																																										-	-	-			0																															12.37:g.100559710T>G			Q9NSV2	RNA	SNP	-	NULL	ENST00000397112.4	37	NULL		12																																																																																			GOLGA2P5	-	-	ENSG00000238105		0.602	GOLGA2B-004	KNOWN	basic	processed_transcript	GOLGA2P5	HGNC	pseudogene	OTTHUMT00000396439.2	61	0.00	0	T			100559710	100559710	-1	no_errors	ENST00000421840	ensembl	human	known	69_37n	rna	25	39.53	17	SNP	0.001	G
GPRIN2	9721	genome.wustl.edu	37	10	46999178	46999178	+	Missense_Mutation	SNP	A	A	C	rs7090312	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-10A-01D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	bf856604-4326-4145-bc3c-137098338f61	g.chr10:46999178A>C	ENST00000374317.1	+	3	571	c.298A>C	c.(298-300)Acc>Ccc	p.T100P	GPRIN2_ENST00000374314.4_Missense_Mutation_p.T100P	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	100			T -> P (in dbSNP:rs7090312).							breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						CAATGTGTCCACCATGGGCGG	0.657																																						dbGAP											0													29.0	31.0	31.0					10																	46999178		2193	4285	6478	-	-	-	SO:0001583	missense	0			BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.298A>C	10.37:g.46999178A>C	ENSP00000363436:p.Thr100Pro		Q5SVF0	Missense_Mutation	SNP	NULL	p.T100P	ENST00000374317.1	37	c.298	CCDS31192.1	10	.	.	.	.	.	.	.	.	.	.	A	14.26	2.481989	0.44147	.	.	ENSG00000204175	ENST00000374317;ENST00000374314	T;T	0.03635	3.86;3.86	5.57	-1.01	0.10169	.	0.659438	0.13433	N	0.388285	T	0.03959	0.0111	M	0.65975	2.015	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.40478	-0.9561	10	0.42905	T	0.14	-4.1201	1.1261	0.01735	0.3231:0.1696:0.3426:0.1646	rs7090312	100	O60269	GRIN2_HUMAN	P	100	ENSP00000363436:T100P;ENSP00000363433:T100P	ENSP00000363433:T100P	T	+	1	0	GPRIN2	46419184	0.000000	0.05858	0.005000	0.12908	0.978000	0.69477	0.003000	0.13083	0.152000	0.19188	0.528000	0.53228	ACC	GPRIN2	-	NULL	ENSG00000204175		0.657	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRIN2	HGNC	protein_coding	OTTHUMT00000047836.1	11	0.00	0	A	NM_014696		46999178	46999178	+1	no_errors	ENST00000374314	ensembl	human	known	69_37n	missense	13	35.00	7	SNP	0.084	C
GPAM	57678	genome.wustl.edu	37	10	113932823	113932823	+	Splice_Site	SNP	G	G	T			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr10:113932823G>T	ENST00000348367.4	-	8	759	c.562C>A	c.(562-564)Ctg>Atg	p.L188M	GPAM_ENST00000423155.1_Splice_Site_p.L188M|GPAM_ENST00000369425.1_Splice_Site_p.L188M			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	188					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		CACCCAGTCAGTCTGAAACAA	0.358																																					Ovarian(161;1017 2606 18293 52943)	dbGAP											0													82.0	78.0	79.0					10																	113932823		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.561-1C>A	10.37:g.113932823G>T			Q5VW51|Q86TA3	Missense_Mutation	SNP	pfam_Acyltransferase,smart_Acyltransferase	p.L188M	ENST00000348367.4	37	c.562	CCDS7570.1	10	.	.	.	.	.	.	.	.	.	.	G	14.83	2.652029	0.47362	.	.	ENSG00000119927	ENST00000348367;ENST00000423155;ENST00000369425	D;D;D	0.94280	-3.39;-3.39;-3.39	5.79	0.872	0.19113	.	0.000000	0.64402	D	0.000002	D	0.94997	0.8381	M	0.73962	2.25	0.50467	D	0.999875	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	D	0.92003	0.5612	10	0.39692	T	0.17	-12.3809	7.8001	0.29170	0.5489:0.0:0.4511:0.0	.	188;188	Q5VW52;Q9HCL2	.;GPAT1_HUMAN	M	188	ENSP00000265276:L188M;ENSP00000409242:L188M;ENSP00000358433:L188M	ENSP00000265276:L188M	L	-	1	2	GPAM	113922813	1.000000	0.71417	0.998000	0.56505	0.963000	0.63663	2.323000	0.43823	0.102000	0.17638	-0.136000	0.14681	CTG	GPAM	-	NULL	ENSG00000119927		0.358	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPAM	HGNC	protein_coding	OTTHUMT00000050377.1	59	0.00	0	G	NM_020918	Missense_Mutation	113932823	113932823	-1	no_errors	ENST00000348367	ensembl	human	known	69_37n	missense	324	10.74	39	SNP	1.000	T
GPS2	2874	genome.wustl.edu	37	17	7217236	7217236	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	bf856604-4326-4145-bc3c-137098338f61	g.chr17:7217236delG	ENST00000380728.2	-	6	769	c.469delC	c.(469-471)caafs	p.Q157fs	RP11-542C16.2_ENST00000575474.1_3'UTR|GPS2_ENST00000391950.3_Frame_Shift_Del_p.Q157fs|GPS2_ENST00000389167.5_Frame_Shift_Del_p.Q157fs			Q13227	GPS2_HUMAN	G protein pathway suppressor 2	157					cell cycle (GO:0007049)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase inhibitor activity (GO:0005095)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(4)	24		Prostate(122;0.157)				GTAAGCACTTGGGGTCCAAAC	0.512																																						dbGAP											0													148.0	138.0	142.0					17																	7217236		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			U28963	CCDS11100.1	17p13.1	2006-04-29			ENSG00000132522	ENSG00000132522			4550	protein-coding gene	gene with protein product		601935				8943324	Standard	NM_004489		Approved		uc002gfx.1	Q13227	OTTHUMG00000102198	ENST00000380728.2:c.469delC	17.37:g.7217236delG	ENSP00000370104:p.Gln157fs		B4DXA1|Q6FHM8	Frame_Shift_Del	DEL	NULL	p.Q157fs	ENST00000380728.2	37	c.469	CCDS11100.1	17																																																																																			GPS2	-	NULL	ENSG00000132522		0.512	GPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPS2	HGNC	protein_coding	OTTHUMT00000220048.4	199	0.00	0	G	NM_004489		7217236	7217236	-1	no_errors	ENST00000380728	ensembl	human	known	69_37n	frame_shift_del	139	13.50	22	DEL	0.996	-
GRM3	2913	genome.wustl.edu	37	7	86493622	86493622	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	bf856604-4326-4145-bc3c-137098338f61	g.chr7:86493622C>T	ENST00000361669.2	+	6	3690	c.2591C>T	c.(2590-2592)aCg>aTg	p.T864M	GRM3_ENST00000546348.1_Missense_Mutation_p.T456M|GRM3_ENST00000439827.1_Silent_p.N508N|GRM3_ENST00000394720.2_Silent_p.N506N|GRM3_ENST00000536043.1_Missense_Mutation_p.T736M	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	864					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					TATGTGCCAACGGTGTGCAAT	0.453																																					GBM(52;969 1098 3139 52280)	dbGAP											0													264.0	218.0	234.0					7																	86493622		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.2591C>T	7.37:g.86493622C>T	ENSP00000355316:p.Thr864Met		Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_3,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_2,prints_GPCR_3_GABA_rcpt_B,pfscan_GPCR_3_C	p.T864M	ENST00000361669.2	37	c.2591	CCDS5600.1	7	.	.	.	.	.	.	.	.	.	.	C	24.4	4.532918	0.85812	.	.	ENSG00000198822	ENST00000361669;ENST00000546348;ENST00000536043	D;D;D	0.88818	-2.43;-2.38;-2.2	5.99	5.99	0.97316	.	0.091734	0.85682	D	0.000000	D	0.91496	0.7315	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.71184	0.964;0.972;0.939	D	0.91892	0.5524	10	0.66056	D	0.02	.	19.4659	0.94939	0.0:1.0:0.0:0.0	.	456;736;864	B7Z204;F5GYZ2;Q14832	.;.;GRM3_HUMAN	M	864;456;736	ENSP00000355316:T864M;ENSP00000444064:T456M;ENSP00000441407:T736M	ENSP00000355316:T864M	T	+	2	0	GRM3	86331558	1.000000	0.71417	0.986000	0.45419	0.992000	0.81027	6.741000	0.74837	2.840000	0.97914	0.655000	0.94253	ACG	GRM3	-	prints_GPCR_3_mtglu_rcpt_3,prints_GPCR_3_mtglu_rcpt_2	ENSG00000198822		0.453	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM3	HGNC	protein_coding	OTTHUMT00000253362.2	615	0.16	1	C			86493622	86493622	+1	no_errors	ENST00000361669	ensembl	human	known	69_37n	missense	730	24.27	234	SNP	1.000	T
GRM3	2913	genome.wustl.edu	37	7	86493622	86493622	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr7:86493622C>T	ENST00000361669.2	+	6	3690	c.2591C>T	c.(2590-2592)aCg>aTg	p.T864M	GRM3_ENST00000546348.1_Missense_Mutation_p.T456M|GRM3_ENST00000439827.1_Silent_p.N508N|GRM3_ENST00000394720.2_Silent_p.N506N|GRM3_ENST00000536043.1_Missense_Mutation_p.T736M	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	864					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					TATGTGCCAACGGTGTGCAAT	0.453																																					GBM(52;969 1098 3139 52280)	dbGAP											0													264.0	218.0	234.0					7																	86493622		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.2591C>T	7.37:g.86493622C>T	ENSP00000355316:p.Thr864Met		Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_3,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_2,prints_GPCR_3_GABA_rcpt_B,pfscan_GPCR_3_C	p.T864M	ENST00000361669.2	37	c.2591	CCDS5600.1	7	.	.	.	.	.	.	.	.	.	.	C	24.4	4.532918	0.85812	.	.	ENSG00000198822	ENST00000361669;ENST00000546348;ENST00000536043	D;D;D	0.88818	-2.43;-2.38;-2.2	5.99	5.99	0.97316	.	0.091734	0.85682	D	0.000000	D	0.91496	0.7315	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.71184	0.964;0.972;0.939	D	0.91892	0.5524	10	0.66056	D	0.02	.	19.4659	0.94939	0.0:1.0:0.0:0.0	.	456;736;864	B7Z204;F5GYZ2;Q14832	.;.;GRM3_HUMAN	M	864;456;736	ENSP00000355316:T864M;ENSP00000444064:T456M;ENSP00000441407:T736M	ENSP00000355316:T864M	T	+	2	0	GRM3	86331558	1.000000	0.71417	0.986000	0.45419	0.992000	0.81027	6.741000	0.74837	2.840000	0.97914	0.655000	0.94253	ACG	GRM3	-	prints_GPCR_3_mtglu_rcpt_3,prints_GPCR_3_mtglu_rcpt_2	ENSG00000198822		0.453	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM3	HGNC	protein_coding	OTTHUMT00000253362.2	68	0.00	0	C			86493622	86493622	+1	no_errors	ENST00000361669	ensembl	human	known	69_37n	missense	730	24.27	234	SNP	1.000	T
GUCY2F	2986	genome.wustl.edu	37	X	108696999	108696999	+	Silent	SNP	A	A	C			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chrX:108696999A>C	ENST00000218006.2	-	4	1413	c.1122T>G	c.(1120-1122)ggT>ggG	p.G374G		NM_001522.2	NP_001513.2	P51841	GUC2F_HUMAN	guanylate cyclase 2F, retinal	374					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(6)|large_intestine(14)|lung(33)|prostate(3)|skin(1)	67						GGCTGGCAGCACCAGCCTGTC	0.383																																						dbGAP											0													52.0	44.0	47.0					X																	108696999		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L37378	CCDS14545.1	Xq22	2008-08-01			ENSG00000101890	ENSG00000101890			4691	protein-coding gene	gene with protein product	"""guanylate cyclase 2D-like, membrane (retina-specific)"""	300041				8838319, 7777544	Standard	NM_001522		Approved	GUC2DL, GC-F, RetGC-2, ROS-GC2, CYGF	uc004eod.4	P51841	OTTHUMG00000022184	ENST00000218006.2:c.1122T>G	X.37:g.108696999A>C			Q9UJF1	Silent	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Haem_no_assoc-bd,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_A/G_cyclase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_A/G_cyclase	p.G374	ENST00000218006.2	37	c.1122	CCDS14545.1	X																																																																																			GUCY2F	-	pfam_ANF_lig-bd_rcpt	ENSG00000101890		0.383	GUCY2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCY2F	HGNC	protein_coding	OTTHUMT00000057884.1	61	0.00	0	A	NM_001522		108696999	108696999	-1	no_errors	ENST00000218006	ensembl	human	known	69_37n	silent	103	39.66	69	SNP	0.999	C
HADH	3033	genome.wustl.edu	37	4	108955557	108955557	+	3'UTR	SNP	T	T	C			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr4:108955557T>C	ENST00000309522.3	+	0	1138				HADH_ENST00000510728.1_3'UTR|HADH_ENST00000505878.1_3'UTR|HADH_ENST00000603302.1_3'UTR|HADH_ENST00000454409.2_3'UTR|HADH_ENST00000403312.1_3'UTR	NM_005327.4	NP_005318	P40939	ECHA_HUMAN	hydroxyacyl-CoA dehydrogenase						cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acetyltransferase activity (GO:0003985)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	15		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000168)		GAGAGCGCTTTCCAGCCAGTG	0.458																																						dbGAP											0													44.0	48.0	47.0					4																	108955557		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			X96752	CCDS3678.1, CCDS54790.1	4q22-q26	2012-10-02	2010-04-30		ENSG00000138796	ENSG00000138796	1.1.1.35		4799	protein-coding gene	gene with protein product		601609	"""L-3-hydroxyacyl-Coenzyme A dehydrogenase, short chain"", ""hydroxyacyl-Coenzyme A dehydrogenase"""	HADHSC		975867, 16176262	Standard	NM_001184705		Approved	HADH1, SCHAD	uc010ilx.3	Q16836	OTTHUMG00000131810	ENST00000309522.3:c.*44T>C	4.37:g.108955557T>C			B2R7L4|B4DYP2|Q16679|Q53T69|Q53TA2|Q96GT7|Q9UQC5	RNA	SNP	-	NULL	ENST00000309522.3	37	NULL	CCDS3678.1	4																																																																																			HADH	-	-	ENSG00000138796		0.458	HADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HADH	HGNC	protein_coding	OTTHUMT00000254750.2	43	0.00	0	T	NM_005327		108955557	108955557	+1	no_errors	ENST00000510728	ensembl	human	known	69_37n	rna	87	25.64	30	SNP	0.000	C
HARS	3035	genome.wustl.edu	37	5	140058630	140058630	+	Missense_Mutation	SNP	T	T	G	rs200294240		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr5:140058630T>G	ENST00000504156.1	-	5	1198	c.479A>C	c.(478-480)aAc>aCc	p.N160T	HARS_ENST00000438307.2_Missense_Mutation_p.N120T|HARS_ENST00000457527.2_Intron|HARS_ENST00000307633.3_Intron|HARS_ENST00000415192.2_Intron|HARS_ENST00000448240.1_5'UTR|HARS_ENST00000431330.2_Intron|HARS_ENST00000504366.1_Missense_Mutation_p.N91T	NM_002109.4	NP_002100.2	P12081	SYHC_HUMAN	histidyl-tRNA synthetase	160					gene expression (GO:0010467)|histidyl-tRNA aminoacylation (GO:0006427)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|histidine-tRNA ligase activity (GO:0004821)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		L-Histidine(DB00117)	CATGGCTGGGTTATCCCGCCG	0.493																																						dbGAP											0													128.0	118.0	121.0					5																	140058630		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000498	CCDS4237.1, CCDS58976.1, CCDS58977.1, CCDS58978.1, CCDS75323.1, CCDS75324.1	5q31.3	2012-10-02			ENSG00000170445	ENSG00000170445	6.1.1.21	"""Aminoacyl tRNA synthetases / Class II"""	4816	protein-coding gene	gene with protein product	"""histidine tRNA ligase 1, cytoplasmic"""	142810					Standard	XM_005268428		Approved		uc003lgv.4	P12081	OTTHUMG00000129502	ENST00000504156.1:c.479A>C	5.37:g.140058630T>G	ENSP00000425634:p.Asn160Thr		B4DHQ1|B4DY73|D6REN6|J3KNE5	Missense_Mutation	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_WHEP-TRS,superfamily_Anticodon-bd,superfamily_S15_NS1_RNA-bd,pirsf_His-tRNA_synth_IIA,pfscan_aa-tRNA-synth_II,pfscan_WHEP-TRS,tigrfam_His-tRNA-synth_IIa_subgr	p.N160T	ENST00000504156.1	37	c.479	CCDS4237.1	5	.	.	.	.	.	.	.	.	.	.	T	35	5.503198	0.96371	.	.	ENSG00000170445	ENST00000504156;ENST00000504366;ENST00000438307	T;T;T	0.63417	-0.04;-0.04;-0.04	5.65	5.65	0.86999	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.000000	0.85682	D	0.000000	T	0.81370	0.4808	M	0.89601	3.045	0.80722	D	1	P;P;P	0.45902	0.868;0.844;0.633	P;P;P	0.59012	0.85;0.783;0.507	D	0.84359	0.0537	10	0.56958	D	0.05	-5.9271	16.1778	0.81874	0.0:0.0:0.0:1.0	.	120;160;160	B4DY73;Q52NV4;P12081	.;.;SYHC_HUMAN	T	160;91;120	ENSP00000425634:N160T;ENSP00000430063:N91T;ENSP00000411511:N120T	ENSP00000411511:N120T	N	-	2	0	HARS	140038814	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.957000	0.70323	2.279000	0.76181	0.533000	0.62120	AAC	HARS	-	pfam_aa-tRNA-synt_IIb_cons-dom,pirsf_His-tRNA_synth_IIA,pfscan_aa-tRNA-synth_II,tigrfam_His-tRNA-synth_IIa_subgr	ENSG00000170445		0.493	HARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HARS	HGNC	protein_coding	OTTHUMT00000251673.2	107	0.00	0	T	NM_002109		140058630	140058630	-1	no_errors	ENST00000504156	ensembl	human	known	69_37n	missense	188	35.05	102	SNP	1.000	G
HAVCR1	26762	genome.wustl.edu	37	5	156482504	156482504	+	Silent	SNP	A	A	C	rs141472249		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr5:156482504A>C	ENST00000339252.3	-	2	619	c.87T>G	c.(85-87)ggT>ggG	p.G29G	HAVCR1_ENST00000523175.1_Silent_p.G29G|HAVCR1_ENST00000544197.1_Silent_p.G29G|HAVCR1_ENST00000425854.1_Silent_p.G29G|HAVCR1_ENST00000522693.1_Silent_p.G29G	NM_012206.2	NP_036338.2	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1	0	Ig-like V-type.				viral process (GO:0016032)	integral component of membrane (GO:0016021)	virus receptor activity (GO:0001618)	p.G29G(1)		endometrium(3)|large_intestine(2)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGACAGATGGACCTGCCTCTC	0.473																																						dbGAP											1	Substitution - coding silent(1)	skin(1)											52.0	55.0	54.0					5																	156482504		1955	4153	6108	-	-	-	SO:0001819	synonymous_variant	0			AF043724	CCDS43392.1	5q33.2	2014-01-14			ENSG00000113249	ENSG00000113249		"""Immunoglobulin superfamily / V-set domain containing"""	17866	protein-coding gene	gene with protein product	"""T-cell immunoglobulin mucin family member 1"""	606518				9658108, 11725301	Standard	NM_012206		Approved	HAVCR-1, TIM-1, TIM1, HAVCR, TIMD1	uc021ygj.1	Q96D42	OTTHUMG00000163466	ENST00000339252.3:c.87T>G	5.37:g.156482504A>C			O43656	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.G29	ENST00000339252.3	37	c.87	CCDS43392.1	5																																																																																			HAVCR1	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000113249		0.473	HAVCR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HAVCR1	HGNC	protein_coding	OTTHUMT00000373698.1	37	0.00	0	A			156482504	156482504	-1	no_errors	ENST00000425854	ensembl	human	known	69_37n	silent	27	73.15	79	SNP	0.186	C
HCFC1	3054	genome.wustl.edu	37	X	153220423	153220423	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chrX:153220423T>G	ENST00000310441.7	-	17	4393	c.3427A>C	c.(3427-3429)Acc>Ccc	p.T1143P	HCFC1_ENST00000354233.3_Missense_Mutation_p.T1074P|HCFC1_ENST00000369984.4_Missense_Mutation_p.T1143P	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	1143					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ACGGCAGGGGTGCCAGCTGCA	0.682																																						dbGAP											0													14.0	19.0	17.0					X																	153220423		2147	4220	6367	-	-	-	SO:0001583	missense	0				CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.3427A>C	X.37:g.153220423T>G	ENSP00000309555:p.Thr1143Pro		Q6P4G5	Missense_Mutation	SNP	pfam_Kelch_2,pfam_Kelch_1,superfamily_Fibronectin_type3,smart_Fibronectin_type3	p.T1143P	ENST00000310441.7	37	c.3427	CCDS44020.1	X	.	.	.	.	.	.	.	.	.	.	t	2.555	-0.303225	0.05495	.	.	ENSG00000172534	ENST00000310441;ENST00000369984;ENST00000354233	T;T;T	0.03580	3.91;3.93;3.88	4.91	1.02	0.19986	.	0.990899	0.08196	N	0.983035	T	0.02888	0.0086	N	0.19112	0.55	0.09310	N	1	B	0.14438	0.01	B	0.14023	0.01	T	0.46938	-0.9155	10	0.62326	D	0.03	.	4.242	0.10652	0.0:0.1915:0.1705:0.6381	.	1143	P51610	HCFC1_HUMAN	P	1143;1143;1074	ENSP00000309555:T1143P;ENSP00000359001:T1143P;ENSP00000346174:T1074P	ENSP00000309555:T1143P	T	-	1	0	HCFC1	152873617	0.981000	0.34729	0.000000	0.03702	0.028000	0.11728	1.044000	0.30329	-0.165000	0.10908	0.427000	0.28365	ACC	HCFC1	-	NULL	ENSG00000172534		0.682	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCFC1	HGNC	protein_coding	OTTHUMT00000061099.4	110	0.89	1	T	NM_005334		153220423	153220423	-1	no_errors	ENST00000310441	ensembl	human	known	69_37n	missense	57	44.04	48	SNP	0.004	G
HCFC1	3054	genome.wustl.edu	37	X	153220495	153220495	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chrX:153220495T>G	ENST00000310441.7	-	17	4321	c.3355A>C	c.(3355-3357)Act>Cct	p.T1119P	HCFC1_ENST00000354233.3_Missense_Mutation_p.T1050P|HCFC1_ENST00000369984.4_Missense_Mutation_p.T1119P	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	1119					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GTAGTGGCAGTGTTGGTGGTG	0.677																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.3355A>C	X.37:g.153220495T>G	ENSP00000309555:p.Thr1119Pro		Q6P4G5	Missense_Mutation	SNP	pfam_Kelch_2,pfam_Kelch_1,superfamily_Fibronectin_type3,smart_Fibronectin_type3	p.T1119P	ENST00000310441.7	37	c.3355	CCDS44020.1	X	.	.	.	.	.	.	.	.	.	.	t	22.8	4.333716	0.81801	.	.	ENSG00000172534	ENST00000310441;ENST00000369984;ENST00000354233	T;T;T	0.07114	3.28;3.29;3.22	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.24392	0.0591	L	0.58810	1.83	0.51012	D	0.999903	D	0.71674	0.998	D	0.76071	0.987	T	0.00559	-1.1671	10	0.72032	D	0.01	.	12.9259	0.58260	0.0:0.0:0.0:1.0	.	1119	P51610	HCFC1_HUMAN	P	1119;1119;1050	ENSP00000309555:T1119P;ENSP00000359001:T1119P;ENSP00000346174:T1050P	ENSP00000309555:T1119P	T	-	1	0	HCFC1	152873689	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	5.404000	0.66344	1.690000	0.51089	0.427000	0.28365	ACT	HCFC1	-	NULL	ENSG00000172534		0.677	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCFC1	HGNC	protein_coding	OTTHUMT00000061099.4	175	0.00	0	T	NM_005334		153220495	153220495	-1	no_errors	ENST00000310441	ensembl	human	known	69_37n	missense	108	31.48	51	SNP	1.000	G
HDDC2	51020	genome.wustl.edu	37	6	125598352	125598352	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-10A-01D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	bf856604-4326-4145-bc3c-137098338f61	g.chr6:125598352A>T	ENST00000398153.2	-	5	455	c.413T>A	c.(412-414)tTt>tAt	p.F138Y	HDDC2_ENST00000608456.1_5'Flank|HDDC2_ENST00000608295.1_3'UTR|HDDC2_ENST00000368377.4_Missense_Mutation_p.F104Y	NM_016063.2	NP_057147.2	Q7Z4H3	HDDC2_HUMAN	HD domain containing 2	138	HD.					extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)				endometrium(1)|large_intestine(1)|lung(4)	6			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0186)		CTGCTTCACAAATTTGGCTTC	0.413																																						dbGAP											0													156.0	137.0	143.0					6																	125598352		1877	4117	5994	-	-	-	SO:0001583	missense	0			AF151888	CCDS43503.1	6q13-q24.3	2008-02-05	2005-08-22	2005-08-22	ENSG00000111906	ENSG00000111906			21078	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 74"""	C6orf74		10810093	Standard	NM_016063		Approved	CGI-130, dJ167O5.2	uc003qaa.1	Q7Z4H3	OTTHUMG00000015506	ENST00000398153.2:c.413T>A	6.37:g.125598352A>T	ENSP00000381220:p.Phe138Tyr		Q5TDQ4|Q6NZ49|Q9BTT2|Q9BV31|Q9Y3D1	Missense_Mutation	SNP	pfam_HD_domain,smart_HD/PDEase_dom	p.F138Y	ENST00000398153.2	37	c.413	CCDS43503.1	6	.	.	.	.	.	.	.	.	.	.	A	16.31	3.086878	0.55861	.	.	ENSG00000111906	ENST00000318787;ENST00000398153;ENST00000368377	T;T;T	0.49720	0.77;0.77;0.77	5.97	4.8	0.61643	Metal-dependent phosphohydrolase, HD domain (1);Metal-dependent phosphohydrolase, HD subdomain (1);HD domain (1);	0.099263	0.64402	N	0.000001	T	0.21387	0.0515	L	0.48642	1.525	0.51482	D	0.99992	B	0.06786	0.001	B	0.15052	0.012	T	0.07252	-1.0782	10	0.18276	T	0.48	.	11.0563	0.47920	0.8472:0.0:0.0:0.1528	.	138	Q7Z4H3	HDDC2_HUMAN	Y	104;138;104	ENSP00000316242:F104Y;ENSP00000381220:F138Y;ENSP00000357361:F104Y	ENSP00000316242:F104Y	F	-	2	0	HDDC2	125640051	1.000000	0.71417	0.396000	0.26296	0.987000	0.75469	4.706000	0.61845	1.055000	0.40461	0.533000	0.62120	TTT	HDDC2	-	pfam_HD_domain,smart_HD/PDEase_dom	ENSG00000111906		0.413	HDDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HDDC2	HGNC	protein_coding	OTTHUMT00000472493.1	454	0.00	0	A	NM_016063		125598352	125598352	-1	no_errors	ENST00000398153	ensembl	human	known	69_37n	missense	423	25.40	144	SNP	0.997	T
HDDC2	51020	genome.wustl.edu	37	6	125598352	125598352	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr6:125598352A>T	ENST00000398153.2	-	5	455	c.413T>A	c.(412-414)tTt>tAt	p.F138Y	HDDC2_ENST00000608456.1_5'Flank|HDDC2_ENST00000608295.1_3'UTR|HDDC2_ENST00000368377.4_Missense_Mutation_p.F104Y	NM_016063.2	NP_057147.2	Q7Z4H3	HDDC2_HUMAN	HD domain containing 2	138	HD.					extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)				endometrium(1)|large_intestine(1)|lung(4)	6			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0186)		CTGCTTCACAAATTTGGCTTC	0.413																																						dbGAP											0													156.0	137.0	143.0					6																	125598352		1877	4117	5994	-	-	-	SO:0001583	missense	0			AF151888	CCDS43503.1	6q13-q24.3	2008-02-05	2005-08-22	2005-08-22	ENSG00000111906	ENSG00000111906			21078	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 74"""	C6orf74		10810093	Standard	NM_016063		Approved	CGI-130, dJ167O5.2	uc003qaa.1	Q7Z4H3	OTTHUMG00000015506	ENST00000398153.2:c.413T>A	6.37:g.125598352A>T	ENSP00000381220:p.Phe138Tyr		Q5TDQ4|Q6NZ49|Q9BTT2|Q9BV31|Q9Y3D1	Missense_Mutation	SNP	pfam_HD_domain,smart_HD/PDEase_dom	p.F138Y	ENST00000398153.2	37	c.413	CCDS43503.1	6	.	.	.	.	.	.	.	.	.	.	A	16.31	3.086878	0.55861	.	.	ENSG00000111906	ENST00000318787;ENST00000398153;ENST00000368377	T;T;T	0.49720	0.77;0.77;0.77	5.97	4.8	0.61643	Metal-dependent phosphohydrolase, HD domain (1);Metal-dependent phosphohydrolase, HD subdomain (1);HD domain (1);	0.099263	0.64402	N	0.000001	T	0.21387	0.0515	L	0.48642	1.525	0.51482	D	0.99992	B	0.06786	0.001	B	0.15052	0.012	T	0.07252	-1.0782	10	0.18276	T	0.48	.	11.0563	0.47920	0.8472:0.0:0.0:0.1528	.	138	Q7Z4H3	HDDC2_HUMAN	Y	104;138;104	ENSP00000316242:F104Y;ENSP00000381220:F138Y;ENSP00000357361:F104Y	ENSP00000316242:F104Y	F	-	2	0	HDDC2	125640051	1.000000	0.71417	0.396000	0.26296	0.987000	0.75469	4.706000	0.61845	1.055000	0.40461	0.533000	0.62120	TTT	HDDC2	-	pfam_HD_domain,smart_HD/PDEase_dom	ENSG00000111906		0.413	HDDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HDDC2	HGNC	protein_coding	OTTHUMT00000472493.1	80	0.00	0	A	NM_016063		125598352	125598352	-1	no_errors	ENST00000398153	ensembl	human	known	69_37n	missense	423	25.40	144	SNP	0.997	T
HK2	3099	genome.wustl.edu	37	2	75105930	75105930	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr2:75105930G>C	ENST00000290573.2	+	9	1747	c.1147G>C	c.(1147-1149)Gcc>Ccc	p.A383P	HK2_ENST00000409174.1_Missense_Mutation_p.A355P	NM_000189.4	NP_000180.2	P52789	HXK2_HUMAN	hexokinase 2	383	Hexokinase type-2 1.|Regulatory.				apoptotic mitochondrial changes (GO:0008637)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|lactation (GO:0007595)|regulation of glucose import (GO:0046324)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	43						CACACGCTCCGCCAGCCTGTG	0.667																																						dbGAP											0													17.0	14.0	15.0					2																	75105930		2171	4248	6419	-	-	-	SO:0001583	missense	0				CCDS1956.1	2p13	2010-03-19			ENSG00000159399	ENSG00000159399	2.7.1.1		4923	protein-coding gene	gene with protein product		601125					Standard	NM_000189		Approved		uc002snd.3	P52789	OTTHUMG00000129972	ENST00000290573.2:c.1147G>C	2.37:g.75105930G>C	ENSP00000290573:p.Ala383Pro		D6W5J2|Q8WU87|Q9UN82	Missense_Mutation	SNP	pfam_Hexokinase_C,pfam_Hexokinase_N,prints_Hexokinase	p.A383P	ENST00000290573.2	37	c.1147	CCDS1956.1	2	.	.	.	.	.	.	.	.	.	.	G	21.5	4.154558	0.78114	.	.	ENSG00000159399	ENST00000290573;ENST00000535740;ENST00000409174	T;T	0.28454	1.61;1.61	4.65	3.77	0.43336	Hexokinase, C-terminal (1);	0.094573	0.64402	D	0.000001	T	0.64560	0.2609	H	0.95679	3.705	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73594	-0.3933	10	0.87932	D	0	-19.7395	10.7884	0.46419	0.0929:0.0:0.9071:0.0	.	383	P52789	HXK2_HUMAN	P	383;383;355	ENSP00000290573:A383P;ENSP00000387140:A355P	ENSP00000290573:A383P	A	+	1	0	HK2	74959438	1.000000	0.71417	0.912000	0.35992	0.560000	0.35617	7.638000	0.83328	1.316000	0.45131	0.655000	0.94253	GCC	HK2	-	pfam_Hexokinase_C	ENSG00000159399		0.667	HK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HK2	HGNC	protein_coding	OTTHUMT00000252238.2	45	0.00	0	G	NM_000189		75105930	75105930	+1	no_errors	ENST00000290573	ensembl	human	known	69_37n	missense	10	54.55	12	SNP	0.997	C
IGFL3	388555	genome.wustl.edu	37	19	46627331	46627331	+	Silent	SNP	G	G	A			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	bf856604-4326-4145-bc3c-137098338f61	g.chr19:46627331G>A	ENST00000341415.2	-	3	186	c.162C>T	c.(160-162)tgC>tgT	p.C54C	AC007193.6_ENST00000597989.1_lincRNA	NM_207393.1	NP_997276.1	Q6UXB1	IGFL3_HUMAN	IGF-like family member 3	54						extracellular region (GO:0005576)				endometrium(1)|large_intestine(1)|lung(5)	7		Ovarian(192;0.0175)|all_neural(266;0.0476)		OV - Ovarian serous cystadenocarcinoma(262;0.00473)|GBM - Glioblastoma multiforme(486;0.0149)|Epithelial(262;0.239)		CATCATAACAGCACTGCTCTG	0.562																																						dbGAP											0													78.0	89.0	85.0					19																	46627331		2186	4300	6486	-	-	-	SO:0001819	synonymous_variant	0			AY358434	CCDS33058.1	19q13.32	2006-07-14				ENSG00000188624			32930	protein-coding gene	gene with protein product		610546				14702039	Standard	NM_207393		Approved	UNQ483	uc002pea.1	Q6UXB1		ENST00000341415.2:c.162C>T	19.37:g.46627331G>A				Silent	SNP	NULL	p.C54	ENST00000341415.2	37	c.162	CCDS33058.1	19																																																																																			IGFL3	-	NULL	ENSG00000188624		0.562	IGFL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFL3	HGNC	protein_coding	OTTHUMT00000421323.1	100	0.00	0	G	NM_207393		46627331	46627331	-1	no_errors	ENST00000341415	ensembl	human	known	69_37n	silent	86	22.52	25	SNP	0.022	A
IGFL3	388555	genome.wustl.edu	37	19	46627331	46627331	+	Silent	SNP	G	G	A			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr19:46627331G>A	ENST00000341415.2	-	3	186	c.162C>T	c.(160-162)tgC>tgT	p.C54C	AC007193.6_ENST00000597989.1_lincRNA	NM_207393.1	NP_997276.1	Q6UXB1	IGFL3_HUMAN	IGF-like family member 3	54						extracellular region (GO:0005576)				endometrium(1)|large_intestine(1)|lung(5)	7		Ovarian(192;0.0175)|all_neural(266;0.0476)		OV - Ovarian serous cystadenocarcinoma(262;0.00473)|GBM - Glioblastoma multiforme(486;0.0149)|Epithelial(262;0.239)		CATCATAACAGCACTGCTCTG	0.562																																						dbGAP											0													78.0	89.0	85.0					19																	46627331		2186	4300	6486	-	-	-	SO:0001819	synonymous_variant	0			AY358434	CCDS33058.1	19q13.32	2006-07-14				ENSG00000188624			32930	protein-coding gene	gene with protein product		610546				14702039	Standard	NM_207393		Approved	UNQ483	uc002pea.1	Q6UXB1		ENST00000341415.2:c.162C>T	19.37:g.46627331G>A				Silent	SNP	NULL	p.C54	ENST00000341415.2	37	c.162	CCDS33058.1	19																																																																																			IGFL3	-	NULL	ENSG00000188624		0.562	IGFL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFL3	HGNC	protein_coding	OTTHUMT00000421323.1	31	0.00	0	G	NM_207393		46627331	46627331	-1	no_errors	ENST00000341415	ensembl	human	known	69_37n	silent	86	22.52	25	SNP	0.022	A
IGHE	3497	genome.wustl.edu	37	14	106067816	106067816	+	lincRNA	SNP	T	T	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr14:106067816T>G	ENST00000390540.2	-	0	569				AL928742.12_ENST00000412518.1_lincRNA|IGHE_ENST00000576077.1_RNA|IGHE_ENST00000577108.1_RNA																							ACACGGCAGGTGAACATCTGC	0.577																																						dbGAP											0													186.0	197.0	194.0					14																	106067816		2147	4265	6412	-	-	-			0																															14.37:g.106067816T>G				Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	p.T84P	ENST00000390540.2	37	c.250		14																																																																																			IGHE	-	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like	ENSG00000211891		0.577	RP11-731F5.1-001	KNOWN	basic	lincRNA	IGHE	HGNC	lincRNA	OTTHUMT00000380286.1	102	0.00	0	T			106067816	106067816	-1	no_start_codon	ENST00000390541	ensembl	human	known	69_37n	missense	162	30.64	72	SNP	0.992	G
IRF3	3661	genome.wustl.edu	37	19	50165501	50165501	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr19:50165501A>C	ENST00000597198.1	-	6	1067	c.686T>G	c.(685-687)gTg>gGg	p.V229G	IRF3_ENST00000599680.1_5'Flank|IRF3_ENST00000377139.3_Missense_Mutation_p.V229G|IRF3_ENST00000599144.1_Missense_Mutation_p.V83G|IRF3_ENST00000598808.1_Missense_Mutation_p.V83G|IRF3_ENST00000600022.1_Intron|IRF3_ENST00000596822.1_Intron|IRF3_ENST00000309877.7_Missense_Mutation_p.V229G|IRF3_ENST00000601291.1_Missense_Mutation_p.V229G|IRF3_ENST00000599223.1_Intron|IRF3_ENST00000600911.1_Missense_Mutation_p.V229G|IRF3_ENST00000596765.1_Intron|IRF3_ENST00000593922.1_Missense_Mutation_p.V83G|IRF3_ENST00000377135.4_Intron			Q14653	IRF3_HUMAN	interferon regulatory factor 3	229	Involved in HERC5 binding.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dsRNA (GO:0071359)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage apoptotic process (GO:0071888)|MDA-5 signaling pathway (GO:0039530)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of defense response to virus by host (GO:0050689)|negative regulation of interferon-beta biosynthetic process (GO:0045358)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type I interferon production (GO:0032480)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|programmed necrotic cell death (GO:0097300)|response to exogenous dsRNA (GO:0043330)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(2)|lung(4)|ovary(2)|stomach(1)	10		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.02)		TTCGGACCCCACCAGCCGCAG	0.647																																						dbGAP											0													36.0	41.0	39.0					19																	50165501		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12775.1, CCDS56099.1, CCDS59407.1, CCDS59408.1, CCDS59409.1	19q13.3-q13.4	2008-07-16				ENSG00000126456			6118	protein-coding gene	gene with protein product		603734				8524823	Standard	NM_001571		Approved		uc002pow.3	Q14653		ENST00000597198.1:c.686T>G	19.37:g.50165501A>C	ENSP00000469113:p.Val229Gly		A8K7L2|B2RAZ3|Q5FBY1|Q5FBY2|Q5FBY4|Q7Z5G6	Missense_Mutation	SNP	pfam_Interferon_reg_factor-3,pfam_Interferon_reg_fact_DNA-bd_dom,superfamily_SMAD_FHA_domain,smart_Interferon_reg_fact_DNA-bd_dom,prints_Interferon_reg_fact_DNA-bd_dom	p.V229G	ENST00000597198.1	37	c.686	CCDS12775.1	19	.	.	.	.	.	.	.	.	.	.	a	20.1	3.936918	0.73557	.	.	ENSG00000126456	ENST00000377139;ENST00000309877	D;D	0.95412	-3.7;-3.7	4.65	4.65	0.58169	SMAD domain-like (1);SMAD/FHA domain (1);Interferon regulatory factor-3 (1);	0.673681	0.13471	N	0.385400	D	0.97167	0.9074	M	0.76002	2.32	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.95737	0.8780	10	0.41790	T	0.15	-27.6892	11.6916	0.51519	1.0:0.0:0.0:0.0	.	229;229;229;229	B2RAZ3;Q96GL3;Q7Z5G6;Q14653	.;.;.;IRF3_HUMAN	G	229	ENSP00000366344:V229G;ENSP00000310127:V229G	ENSP00000310127:V229G	V	-	2	0	IRF3	54857313	0.998000	0.40836	1.000000	0.80357	0.858000	0.48976	2.965000	0.49200	1.966000	0.57179	0.529000	0.55759	GTG	IRF3	-	pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain	ENSG00000126456		0.647	IRF3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IRF3	HGNC	protein_coding	OTTHUMT00000465962.1	75	0.00	0	A	NM_001571		50165501	50165501	-1	no_errors	ENST00000309877	ensembl	human	known	69_37n	missense	26	33.33	13	SNP	1.000	C
KCNJ2	3759	genome.wustl.edu	37	17	68171472	68171472	+	Missense_Mutation	SNP	T	T	G	rs79650811		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr17:68171472T>G	ENST00000243457.3	+	2	675	c.292T>G	c.(292-294)Ttt>Gtt	p.F98V	KCNJ2_ENST00000535240.1_Missense_Mutation_p.F98V	NM_000891.2	NP_000882.1	P63252	KCNJ2_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 2	98			Missing (in LQT7). {ECO:0000269|PubMed:11371347}.		cardiac muscle cell action potential involved in contraction (GO:0086002)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|magnesium ion transport (GO:0015693)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion import (GO:0010107)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of resting membrane potential (GO:0060075)|regulation of skeletal muscle contraction via regulation of action potential (GO:0014861)|relaxation of cardiac muscle (GO:0055119)|relaxation of skeletal muscle (GO:0090076)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of membrane (GO:0031224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(13)|skin(1)|urinary_tract(1)	25	Breast(10;1.64e-08)					GTCATGGCTGTTTTTTGGCTG	0.547																																						dbGAP											0													180.0	155.0	164.0					17																	68171472		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF011904	CCDS11688.1	17q24.3	2014-09-17				ENSG00000123700		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6263	protein-coding gene	gene with protein product		600681				7696590, 11240146, 16382105	Standard	NM_000891		Approved	Kir2.1, IRK1, LQT7	uc002jir.3	P63252		ENST00000243457.3:c.292T>G	17.37:g.68171472T>G	ENSP00000243457:p.Phe98Val		O15110|P48049	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir_Cr2,pfam_K_chnl_inward-rec_Kir_N,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir_Cr2,prints_K_chnl_inward-rec_Kir2.1	p.F98V	ENST00000243457.3	37	c.292	CCDS11688.1	17	.	.	.	.	.	.	.	.	.	.	T	10.93	1.490179	0.26686	.	.	ENSG00000123700	ENST00000535240;ENST00000243457	D;D	0.94092	-3.35;-3.35	5.66	5.66	0.87406	Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);	0.000000	0.85682	D	0.000000	D	0.90765	0.7101	L	0.49126	1.545	0.58432	D	0.999996	B	0.06786	0.001	B	0.10450	0.005	D	0.86968	0.2096	9	.	.	.	.	15.8929	0.79315	0.0:0.0:0.0:1.0	.	98	P63252	IRK2_HUMAN	V	98	ENSP00000441848:F98V;ENSP00000243457:F98V	.	F	+	1	0	KCNJ2	65683067	1.000000	0.71417	0.977000	0.42913	0.947000	0.59692	6.139000	0.71728	2.151000	0.67156	0.454000	0.30748	TTT	KCNJ2	-	pfam_K_chnl_inward-rec_Kir_Cr2,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir_Cr2	ENSG00000123700		0.547	KCNJ2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCNJ2	HGNC	protein_coding	OTTHUMT00000450889.1	199	0.00	0	T	NM_000891		68171472	68171472	+1	no_errors	ENST00000243457	ensembl	human	known	69_37n	missense	130	12.75	19	SNP	1.000	G
KCNQ4	9132	genome.wustl.edu	37	1	41296813	41296813	+	Silent	SNP	T	T	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr1:41296813T>G	ENST00000347132.5	+	10	1432	c.1350T>G	c.(1348-1350)ggT>ggG	p.G450G	KCNQ4_ENST00000506017.1_3'UTR|KCNQ4_ENST00000509682.2_Silent_p.G396G	NM_004700.3|NM_172163.2	NP_004691.2|NP_751895.1	P56696	KCNQ4_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 4	450					inner ear morphogenesis (GO:0042472)|potassium ion transport (GO:0006813)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(13)|skin(1)	26	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)		Ezogabine(DB04953)	GGCGGACGGGTCCTTCCAAGC	0.642																																						dbGAP											0													37.0	30.0	32.0					1																	41296813		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AF105202	CCDS456.1	1p34	2012-07-05			ENSG00000117013	ENSG00000117013		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6298	protein-coding gene	gene with protein product		603537		DFNA2		10025409, 16382104	Standard	NM_004700		Approved	Kv7.4	uc001cgh.2	P56696	OTTHUMG00000007730	ENST00000347132.5:c.1350T>G	1.37:g.41296813T>G			O96025	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ion_trans_dom,pfam_Ion_trans_2,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.S311A	ENST00000347132.5	37	c.931	CCDS456.1	1	.	.	.	.	.	.	.	.	.	.	T	10.52	1.373661	0.24857	.	.	ENSG00000117013	ENST00000443478	.	.	.	5.02	-1.5	0.08691	.	.	.	.	.	T	0.39572	0.1083	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.28202	-1.0051	4	.	.	.	-11.6296	1.3625	0.02194	0.2283:0.4008:0.1274:0.2436	.	.	.	.	A	311	.	.	S	+	1	0	KCNQ4	41069400	0.695000	0.27747	0.979000	0.43373	0.994000	0.84299	-0.216000	0.09266	-0.110000	0.12022	0.444000	0.29173	TCC	KCNQ4	-	NULL	ENSG00000117013		0.642	KCNQ4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KCNQ4	HGNC	protein_coding	OTTHUMT00000020812.1	59	0.00	0	T	NM_004700		41296813	41296813	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000443478	ensembl	human	novel	69_37n	missense	20	43.24	16	SNP	0.676	G
KDM2A	22992	genome.wustl.edu	37	11	66985085	66985085	+	Intron	SNP	A	A	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr11:66985085A>G	ENST00000529006.2	+	9	1133				KDM2A_ENST00000398645.2_Intron|KDM2A_ENST00000526258.1_Intron	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A						histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						ATAGGCTGGGAAAATTGCTTG	0.423																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.688-117A>G	11.37:g.66985085A>G			D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	RNA	SNP	-	NULL	ENST00000529006.2	37	NULL	CCDS44657.1	11																																																																																			KDM2A	-	-	ENSG00000173120		0.423	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM2A	HGNC	protein_coding	OTTHUMT00000393140.2	29	0.00	0	A	NM_012308		66985085	66985085	+1	no_errors	ENST00000525379	ensembl	human	putative	69_37n	rna	35	45.59	31	SNP	0.082	G
KLHL1	57626	genome.wustl.edu	37	13	70281929	70281929	+	Splice_Site	SNP	C	C	T			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	bf856604-4326-4145-bc3c-137098338f61	g.chr13:70281929C>T	ENST00000377844.4	-	10	2775		c.e10-1		KLHL1_ENST00000545028.1_Splice_Site	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1						actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		GGGATCATATCTAAAATTCAA	0.353																																						dbGAP											0													81.0	71.0	75.0					13																	70281929		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.2016-1G>A	13.37:g.70281929C>T			A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Splice_Site	SNP	-	e10-1	ENST00000377844.4	37	c.2016-1	CCDS9445.1	13	.	.	.	.	.	.	.	.	.	.	C	22.4	4.283923	0.80803	.	.	ENSG00000150361	ENST00000377844;ENST00000545028	.	.	.	5.43	4.59	0.56863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6903	0.69080	0.0:0.9298:0.0:0.0702	.	.	.	.	.	-1	.	.	.	-	.	.	KLHL1	69179930	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.587000	0.82613	1.429000	0.47314	0.650000	0.86243	.	KLHL1	-	-	ENSG00000150361		0.353	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL1	HGNC	protein_coding	OTTHUMT00000045231.3	239	0.00	0	C	NM_020866	Intron	70281929	70281929	-1	no_errors	ENST00000377844	ensembl	human	known	69_37n	splice_site	297	17.27	62	SNP	1.000	T
KLHL1	57626	genome.wustl.edu	37	13	70281929	70281929	+	Splice_Site	SNP	C	C	T			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr13:70281929C>T	ENST00000377844.4	-	10	2775		c.e10-1		KLHL1_ENST00000545028.1_Splice_Site	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1						actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		GGGATCATATCTAAAATTCAA	0.353																																						dbGAP											0													81.0	71.0	75.0					13																	70281929		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.2016-1G>A	13.37:g.70281929C>T			A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Splice_Site	SNP	-	e10-1	ENST00000377844.4	37	c.2016-1	CCDS9445.1	13	.	.	.	.	.	.	.	.	.	.	C	22.4	4.283923	0.80803	.	.	ENSG00000150361	ENST00000377844;ENST00000545028	.	.	.	5.43	4.59	0.56863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6903	0.69080	0.0:0.9298:0.0:0.0702	.	.	.	.	.	-1	.	.	.	-	.	.	KLHL1	69179930	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.587000	0.82613	1.429000	0.47314	0.650000	0.86243	.	KLHL1	-	-	ENSG00000150361		0.353	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL1	HGNC	protein_coding	OTTHUMT00000045231.3	36	0.00	0	C	NM_020866	Intron	70281929	70281929	-1	no_errors	ENST00000377844	ensembl	human	known	69_37n	splice_site	297	17.27	62	SNP	1.000	T
LCN12	286256	genome.wustl.edu	37	9	139847492	139847492	+	Intron	SNP	T	T	G	rs557881307	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr9:139847492T>G	ENST00000371633.3	+	2	251					NM_178536.3	NP_848631.2	Q6JVE5	LCN12_HUMAN	lipocalin 12						lipid metabolic process (GO:0006629)	extracellular region (GO:0005576)	retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			endometrium(1)|kidney(1)|lung(1)|prostate(2)	5	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.8e-06)|Epithelial(140;0.000106)		TGAGTGGCTGTCCCTGCCGTT	0.632																																						dbGAP											0													50.0	61.0	57.0					9																	139847492		2137	4222	6359	-	-	-	SO:0001627	intron_variant	0			BC041168	CCDS7018.2	9q34	2011-10-24	2007-12-18		ENSG00000184925	ENSG00000184925		"""Lipocalins"""	28733	protein-coding gene	gene with protein product		612905				15363845	Standard	XM_005266068		Approved	MGC48935	uc004ckb.3	Q6JVE5	OTTHUMG00000020968	ENST00000371633.3:c.251+12T>G	9.37:g.139847492T>G			A2AMJ7	RNA	SNP	-	NULL	ENST00000371633.3	37	NULL	CCDS7018.2	9																																																																																			LCN12	-	-	ENSG00000184925		0.632	LCN12-015	KNOWN	basic|appris_principal|CCDS	protein_coding	LCN12	HGNC	protein_coding	OTTHUMT00000257990.1	117	0.80	1	T	NM_178536		139847492	139847492	+1	no_errors	ENST00000484304	ensembl	human	known	69_37n	rna	24	48.11	51	SNP	0.013	G
LEFTY2	7044	genome.wustl.edu	37	1	226125151	226125151	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr1:226125151A>G	ENST00000366820.5	-	4	1439	c.1091T>C	c.(1090-1092)cTc>cCc	p.L364P	LEFTY2_ENST00000420304.2_Missense_Mutation_p.L330P|RP4-559A3.6_ENST00000513672.1_RNA|LEFTY2_ENST00000474493.1_5'Flank	NM_003240.3	NP_003231.2	O00292	LFTY2_HUMAN	left-right determination factor 2	364					blood coagulation (GO:0007596)|cell growth (GO:0016049)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|platelet alpha granule lumen (GO:0031093)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16	Breast(184;0.197)					CTATGGCTGGAGCCTCCTTGG	0.557																																					Colon(172;116 2643 9098 43333)	dbGAP											0																																										-	-	-	SO:0001583	missense	0			U81523	CCDS1549.1, CCDS53479.1	1q42.1	2008-07-18	2004-11-17	2004-11-17	ENSG00000143768	ENSG00000143768			3122	protein-coding gene	gene with protein product	"""transforming growth factor, beta-4 (endometrial bleeding-associated factor; LEFTY A)"""	601877	"""endometrial bleeding associated factor (left-right determination, factor A; transforming growth factor beta superfamily)"""	TGFB4, EBAF		9153275	Standard	NM_001172425		Approved	LEFTA, LEFTYA	uc001hpt.2	O00292	OTTHUMG00000037441	ENST00000366820.5:c.1091T>C	1.37:g.226125151A>G	ENSP00000355785:p.Leu364Pro		B3KNH4|B4E332|E9PDM4|O75611|Q5TE89|Q8NBQ9	Missense_Mutation	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C,pirsf_LRDF,prints_LRDF	p.L364P	ENST00000366820.5	37	c.1091	CCDS1549.1	1	.	.	.	.	.	.	.	.	.	.	a	16.66	3.183978	0.57800	.	.	ENSG00000143768	ENST00000420304;ENST00000366820	T;T	0.72615	-0.38;-0.67	5.21	4.0	0.46444	.	0.576296	0.16195	N	0.225208	T	0.78892	0.4355	L	0.60455	1.87	0.09310	N	0.999998	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.67051	-0.5768	10	0.87932	D	0	.	7.8812	0.29623	0.8162:0.0:0.0:0.1838	.	330;364	E9PDM4;O00292	.;LFTY2_HUMAN	P	330;364	ENSP00000388009:L330P;ENSP00000355785:L364P	ENSP00000355785:L364P	L	-	2	0	LEFTY2	224191774	0.003000	0.15002	0.054000	0.19295	0.162000	0.22319	1.331000	0.33793	2.093000	0.63338	0.459000	0.35465	CTC	LEFTY2	-	NULL	ENSG00000143768		0.557	LEFTY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEFTY2	HGNC	protein_coding	OTTHUMT00000091152.1	40	0.00	0	A	NM_003240		226125151	226125151	-1	no_errors	ENST00000366820	ensembl	human	known	69_37n	missense	16	44.83	13	SNP	0.004	G
LPO	4025	genome.wustl.edu	37	17	56332273	56332273	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	bf856604-4326-4145-bc3c-137098338f61	g.chr17:56332273C>T	ENST00000262290.4	+	9	1523	c.1207C>T	c.(1207-1209)Cag>Tag	p.Q403*	LPO_ENST00000582328.1_Nonsense_Mutation_p.Q320*|LPO_ENST00000421678.2_Nonsense_Mutation_p.Q320*|LPO_ENST00000543544.1_Nonsense_Mutation_p.Q344*	NM_006151.2	NP_006142.1	P22079	PERL_HUMAN	lactoperoxidase	403					defense response to bacterium (GO:0042742)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|hydrogen peroxide catabolic process (GO:0042744)|response to oxidative stress (GO:0006979)|thiocyanate metabolic process (GO:0018969)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|thiocyanate peroxidase activity (GO:0036393)			breast(5)|cervix(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30						ACTCAACCCTCAGTGGGATGG	0.577																																						dbGAP											0													101.0	101.0	101.0					17																	56332273		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M58151	CCDS32689.1, CCDS54149.1	17q23.1	2008-02-05				ENSG00000167419	1.11.1.7		6678	protein-coding gene	gene with protein product		150205				2222811, 8964511	Standard	NM_006151		Approved	SPO	uc002ivt.3	P22079		ENST00000262290.4:c.1207C>T	17.37:g.56332273C>T	ENSP00000262290:p.Gln403*		A5JUY4|E7EMJ3|Q13408|Q3KNQ2	Nonsense_Mutation	SNP	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.Q403*	ENST00000262290.4	37	c.1207	CCDS32689.1	17	.	.	.	.	.	.	.	.	.	.	C	39	7.857754	0.98528	.	.	ENSG00000167419	ENST00000262290;ENST00000421678;ENST00000543544;ENST00000389576	.	.	.	5.65	4.68	0.58851	.	0.735831	0.13828	N	0.359909	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-0.1773	8.5978	0.33725	0.1515:0.7732:0.0:0.0753	.	.	.	.	X	403;320;344;148	.	ENSP00000262290:Q403X	Q	+	1	0	LPO	53687272	0.190000	0.23276	0.489000	0.27452	0.998000	0.95712	1.423000	0.34837	1.630000	0.50440	0.655000	0.94253	CAG	LPO	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	ENSG00000167419		0.577	LPO-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LPO	HGNC	protein_coding	OTTHUMT00000443961.1	165	0.00	0	C			56332273	56332273	+1	no_errors	ENST00000262290	ensembl	human	known	69_37n	nonsense	137	11.61	18	SNP	0.377	T
LPO	4025	genome.wustl.edu	37	17	56332273	56332273	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr17:56332273C>T	ENST00000262290.4	+	9	1523	c.1207C>T	c.(1207-1209)Cag>Tag	p.Q403*	LPO_ENST00000582328.1_Nonsense_Mutation_p.Q320*|LPO_ENST00000421678.2_Nonsense_Mutation_p.Q320*|LPO_ENST00000543544.1_Nonsense_Mutation_p.Q344*	NM_006151.2	NP_006142.1	P22079	PERL_HUMAN	lactoperoxidase	403					defense response to bacterium (GO:0042742)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|hydrogen peroxide catabolic process (GO:0042744)|response to oxidative stress (GO:0006979)|thiocyanate metabolic process (GO:0018969)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|thiocyanate peroxidase activity (GO:0036393)			breast(5)|cervix(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30						ACTCAACCCTCAGTGGGATGG	0.577																																						dbGAP											0													101.0	101.0	101.0					17																	56332273		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M58151	CCDS32689.1, CCDS54149.1	17q23.1	2008-02-05				ENSG00000167419	1.11.1.7		6678	protein-coding gene	gene with protein product		150205				2222811, 8964511	Standard	NM_006151		Approved	SPO	uc002ivt.3	P22079		ENST00000262290.4:c.1207C>T	17.37:g.56332273C>T	ENSP00000262290:p.Gln403*		A5JUY4|E7EMJ3|Q13408|Q3KNQ2	Nonsense_Mutation	SNP	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.Q403*	ENST00000262290.4	37	c.1207	CCDS32689.1	17	.	.	.	.	.	.	.	.	.	.	C	39	7.857754	0.98528	.	.	ENSG00000167419	ENST00000262290;ENST00000421678;ENST00000543544;ENST00000389576	.	.	.	5.65	4.68	0.58851	.	0.735831	0.13828	N	0.359909	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-0.1773	8.5978	0.33725	0.1515:0.7732:0.0:0.0753	.	.	.	.	X	403;320;344;148	.	ENSP00000262290:Q403X	Q	+	1	0	LPO	53687272	0.190000	0.23276	0.489000	0.27452	0.998000	0.95712	1.423000	0.34837	1.630000	0.50440	0.655000	0.94253	CAG	LPO	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	ENSG00000167419		0.577	LPO-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LPO	HGNC	protein_coding	OTTHUMT00000443961.1	62	0.00	0	C			56332273	56332273	+1	no_errors	ENST00000262290	ensembl	human	known	69_37n	nonsense	137	11.61	18	SNP	0.377	T
LRRC25	126364	genome.wustl.edu	37	19	18507105	18507105	+	Missense_Mutation	SNP	G	G	C	rs201834596		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr19:18507105G>C	ENST00000339007.3	-	1	1322	c.669C>G	c.(667-669)agC>agG	p.S223R	LRRC25_ENST00000595840.1_Missense_Mutation_p.S223R	NM_145256.2	NP_660299.2	Q8N386	LRC25_HUMAN	leucine rich repeat containing 25	223						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(3)|lung(3)|skin(1)	8						GGGCGCTCCGGCTGCCGTACC	0.662																																						dbGAP											0													25.0	31.0	29.0					19																	18507105		2202	4297	6499	-	-	-	SO:0001583	missense	0			AK095435	CCDS12377.1	19p13.11	2013-09-20			ENSG00000175489	ENSG00000175489			29806	protein-coding gene	gene with protein product		607518				12384430	Standard	NM_145256		Approved	MAPA, FLJ38116	uc002niw.3	Q8N386	OTTHUMG00000183361	ENST00000339007.3:c.669C>G	19.37:g.18507105G>C	ENSP00000340983:p.Ser223Arg		Q6IQ00|Q8N9A5	Missense_Mutation	SNP	NULL	p.S223R	ENST00000339007.3	37	c.669	CCDS12377.1	19	.	.	.	.	.	.	.	.	.	.	G	14.95	2.688923	0.48097	.	.	ENSG00000175489	ENST00000339007	T	0.55413	0.52	3.76	-1.33	0.09172	.	0.000000	0.52532	D	0.000078	T	0.40791	0.1131	L	0.59436	1.845	0.32531	N	0.534917	B	0.15930	0.015	B	0.17433	0.018	T	0.30327	-0.9982	10	0.72032	D	0.01	-33.3235	4.0144	0.09637	0.3527:0.1785:0.4687:0.0	.	223	Q8N386	LRC25_HUMAN	R	223	ENSP00000340983:S223R	ENSP00000340983:S223R	S	-	3	2	LRRC25	18368105	0.876000	0.30132	0.561000	0.28357	0.003000	0.03518	0.417000	0.21214	-0.213000	0.10094	-1.149000	0.01842	AGC	LRRC25	-	NULL	ENSG00000175489		0.662	LRRC25-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRC25	HGNC	protein_coding	OTTHUMT00000466342.1	79	0.00	0	G	NM_145256		18507105	18507105	-1	no_errors	ENST00000339007	ensembl	human	known	69_37n	missense	20	60.38	32	SNP	0.897	C
LTBP3	4054	genome.wustl.edu	37	11	65315445	65315445	+	Missense_Mutation	SNP	A	A	G	rs200950246		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr11:65315445A>G	ENST00000301873.5	-	12	2060	c.1792T>C	c.(1792-1794)Tcc>Ccc	p.S598P	LTBP3_ENST00000532932.1_Missense_Mutation_p.S28P|LTBP3_ENST00000322147.4_Missense_Mutation_p.S598P|LTBP3_ENST00000529189.1_5'Flank|LTBP3_ENST00000536982.1_Missense_Mutation_p.S224P	NM_001130144.2	NP_001123616.1	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding protein 3	598	Cys-rich.|EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|extracellular matrix organization (GO:0030198)|lung saccule development (GO:0060430)|negative regulation of bone mineralization (GO:0030502)|negative regulation of chondrocyte differentiation (GO:0032331)|positive regulation of bone resorption (GO:0045780)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of mesenchymal stem cell proliferation (GO:1902462)|transforming growth factor beta activation (GO:0036363)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(3)	23						CAGTGGCAGGAGTAGTCAGGG	0.682																																						dbGAP											0													40.0	43.0	42.0					11																	65315445		2200	4294	6494	-	-	-	SO:0001583	missense	0			AF135960	CCDS8103.1, CCDS44647.1	11q12	2011-10-20			ENSG00000168056	ENSG00000168056		"""Latent transforming growth factor, beta binding proteins"""	6716	protein-coding gene	gene with protein product		602090		LTBP2		7719025	Standard	NM_001164266		Approved		uc001oej.3	Q9NS15	OTTHUMG00000166575	ENST00000301873.5:c.1792T>C	11.37:g.65315445A>G	ENSP00000301873:p.Ser598Pro		O15107|Q96HB9|Q9H7K2|Q9UFN4	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_TB_dom,superfamily_TB_dom,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.S598P	ENST00000301873.5	37	c.1792	CCDS44647.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.61|14.61	2.587219|2.587219	0.46110|0.46110	.|.	.|.	ENSG00000168056|ENSG00000168056	ENST00000526927|ENST00000322147;ENST00000301873;ENST00000532932;ENST00000536982;ENST00000530866	.|D;D;D;D;D	.|0.87491	.|-2.26;-2.26;-2.26;-2.26;-2.26	4.7|4.7	4.7|4.7	0.59300|0.59300	.|Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	.|0.426295	.|0.25866	.|N	.|0.027790	D|D	0.91526|0.91526	0.7324|0.7324	M|M	0.88105|0.88105	2.93|2.93	0.24266|0.24266	N|N	0.99526|0.99526	.|D;D;P;D;D;D	.|0.62365	.|0.976;0.961;0.934;0.991;0.986;0.979	.|P;P;B;P;P;P	.|0.54140	.|0.454;0.622;0.418;0.454;0.743;0.701	D|D	0.85401|0.85401	0.1131|0.1131	5|10	.|0.32370	.|T	.|0.25	.|.	12.0932|12.0932	0.53739|0.53739	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|509;224;481;598;598;28	.|E9PKW1;F5GWC4;B9EG76;Q9NS15;Q9NS15-2;E9PJR2	.|.;.;.;LTBP3_HUMAN;.;.	P|P	248|598;598;28;224;509	.|ENSP00000326647:S598P;ENSP00000301873:S598P;ENSP00000435530:S28P;ENSP00000441912:S224P;ENSP00000435276:S509P	.|ENSP00000301873:S598P	L|S	-|-	2|1	0|0	LTBP3|LTBP3	65072021|65072021	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.211000|0.211000	0.24417|0.24417	1.241000|1.241000	0.32743|0.32743	1.756000|1.756000	0.51951|0.51951	0.172000|0.172000	0.16884|0.16884	CTC|TCC	LTBP3	-	smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000168056		0.682	LTBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LTBP3	HGNC	protein_coding	OTTHUMT00000390538.1	93	0.00	0	A	NM_021070		65315445	65315445	-1	no_errors	ENST00000301873	ensembl	human	known	69_37n	missense	25	43.18	19	SNP	1.000	G
LYNX1	66004	genome.wustl.edu	37	8	143846046	143846046	+	Missense_Mutation	SNP	T	T	G	rs200203920		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr8:143846046T>G	ENST00000335822.5	-	5	1000	c.373A>C	c.(373-375)Acc>Ccc	p.T125P	LYNX1_ENST00000317543.7_Missense_Mutation_p.T91P|LYNX1_ENST00000523332.1_Intron|RP11-706C16.7_ENST00000523657.1_RNA	NM_023946.2	NP_076435.1	Q9BZG9	LYNX1_HUMAN	Ly6/neurotoxin 1	125	UPAR/Ly6.					anchored component of membrane (GO:0031225)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				endometrium(1)|lung(2)|skin(1)	4	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					CAGAGGCTGGTCTGGCAGCAA	0.672																																						dbGAP											0													46.0	47.0	47.0					8																	143846046		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF321824	CCDS6389.1, CCDS34951.1, CCDS34952.1	8q24.3	2008-03-12			ENSG00000180155	ENSG00000180155			29604	protein-coding gene	gene with protein product		606110				12573258, 10402197	Standard	NM_023946		Approved	SLURP2	uc003yxd.1	Q9BZG9	OTTHUMG00000164694	ENST00000335822.5:c.373A>C	8.37:g.143846046T>G	ENSP00000337950:p.Thr125Pro		D3DWI7|G3XAC2|Q86SR0	Missense_Mutation	SNP	pfam_LY6_UPAR	p.T125P	ENST00000335822.5	37	c.373	CCDS34951.1	8	.	.	.	.	.	.	.	.	.	.	T	10.43	1.346833	0.24426	.	.	ENSG00000180155	ENST00000317543;ENST00000335822	T;T	0.70399	-0.48;-0.48	3.18	-0.512	0.11966	CD59 antigen (1);	2.170590	0.01712	N	0.027766	T	0.58380	0.2118	L	0.39898	1.24	0.80722	D	1	B;P	0.34412	0.399;0.453	B;B	0.29663	0.093;0.105	T	0.47837	-0.9086	10	0.46703	T	0.11	-14.1875	3.6123	0.08065	0.5186:0.226:0.0:0.2553	.	125;91	G3XAC2;Q86SR0	.;SLUR2_HUMAN	P	91;125	ENSP00000319846:T91P;ENSP00000337950:T125P	ENSP00000319846:T91P	T	-	1	0	LYNX1	143843048	0.019000	0.18553	0.982000	0.44146	0.089000	0.18198	-0.127000	0.10547	-0.114000	0.11936	-0.534000	0.04291	ACC	LYNX1	-	pfam_LY6_UPAR	ENSG00000180155		0.672	LYNX1-001	KNOWN	basic|CCDS	protein_coding	LYNX1	HGNC	protein_coding	OTTHUMT00000379786.3	115	0.00	0	T	NM_177476		143846046	143846046	-1	no_errors	ENST00000335822	ensembl	human	known	69_37n	missense	29	60.81	45	SNP	0.981	G
MUC6	4588	genome.wustl.edu	37	11	1024858	1024858	+	Missense_Mutation	SNP	T	T	G	rs201059141		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr11:1024858T>G	ENST00000421673.2	-	24	3261	c.3211A>C	c.(3211-3213)Acc>Ccc	p.T1071P		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1071	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CTGTGGCAGGTGGCAAAGGTC	0.687																																						dbGAP											0													19.0	23.0	21.0					11																	1024858		2012	4161	6173	-	-	-	SO:0001583	missense	0			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.3211A>C	11.37:g.1024858T>G	ENSP00000406861:p.Thr1071Pro		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.T1071P	ENST00000421673.2	37	c.3211	CCDS44513.1	11	.	.	.	.	.	.	.	.	.	.	C	5.483	0.274125	0.10403	.	.	ENSG00000184956	ENST00000421673	T	0.76448	-1.02	3.9	1.94	0.25998	von Willebrand factor, type D domain (1);Uncharacterised domain, cysteine-rich (2);	0.000000	0.30732	U	0.008986	T	0.53094	0.1775	N	0.04705	-0.18	0.09310	N	0.999999	B	0.12013	0.005	B	0.08055	0.003	T	0.46428	-0.9192	10	0.62326	D	0.03	.	5.673	0.17733	0.1433:0.6403:0.1383:0.0781	.	1071	Q6W4X9	MUC6_HUMAN	P	1071	ENSP00000406861:T1071P	ENSP00000406861:T1071P	T	-	1	0	MUC6	1014858	0.442000	0.25633	0.146000	0.22360	0.043000	0.13939	0.979000	0.29500	0.091000	0.17302	-1.147000	0.01851	ACC	MUC6	-	pfam_Unchr_dom_Cys-rich,smart_Unchr_dom_Cys-rich	ENSG00000184956		0.687	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC6	HGNC	protein_coding	OTTHUMT00000382120.2	32	0.00	0	T	XM_290540		1024858	1024858	-1	no_errors	ENST00000421673	ensembl	human	known	69_37n	missense	4	68.75	11	SNP	0.168	G
MRGPRX2	117194	genome.wustl.edu	37	11	19077074	19077074	+	Missense_Mutation	SNP	C	C	G	rs201365816		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr11:19077074C>G	ENST00000329773.2	-	2	963	c.876G>C	c.(874-876)caG>caC	p.Q292H		NM_054030.2	NP_473371.1	Q96LB1	MRGX2_HUMAN	MAS-related GPR, member X2	292					positive regulation of cytokinesis (GO:0032467)|sensory perception of pain (GO:0019233)|sleep (GO:0030431)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide binding (GO:0042923)			NS(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	15						GGATCGGCTGCTGCAGCCGCC	0.537																																					GBM(198;1966 2199 4849 37227 49954)	dbGAP											0													34.0	40.0	38.0					11																	19077074		2199	4293	6492	-	-	-	SO:0001583	missense	0				CCDS7847.1	11p15.1	2013-10-10			ENSG00000183695	ENSG00000183695		"""GPCR / Class A : Orphans"""	17983	protein-coding gene	gene with protein product		607228				11551509	Standard	NM_054030		Approved	MRGX2	uc001mph.3	Q96LB1	OTTHUMG00000166098	ENST00000329773.2:c.876G>C	11.37:g.19077074C>G	ENSP00000333800:p.Gln292His		B5B0C7|Q4QXW4|Q4QXW7|Q4QXX0|Q4QXX2|Q4QXX3|Q4QXX4|Q4QXX6|Q4QXX7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.Q292H	ENST00000329773.2	37	c.876	CCDS7847.1	11	.	.	.	.	.	.	.	.	.	.	.	10.65	1.409195	0.25378	.	.	ENSG00000183695	ENST00000329773	T	0.06142	3.34	5.04	0.79	0.18613	.	4.184940	0.00357	N	0.000031	T	0.07413	0.0187	L	0.43923	1.385	0.09310	N	1	B	0.16396	0.017	B	0.17979	0.02	T	0.36089	-0.9762	10	0.44086	T	0.13	.	3.4378	0.07452	0.1753:0.5086:0.0:0.3162	.	292	Q96LB1	MRGX2_HUMAN	H	292	ENSP00000333800:Q292H	ENSP00000333800:Q292H	Q	-	3	2	MRGPRX2	19033650	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.268000	0.08607	0.056000	0.16144	0.650000	0.86243	CAG	MRGPRX2	-	NULL	ENSG00000183695		0.537	MRGPRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRX2	HGNC	protein_coding	OTTHUMT00000387819.1	33	0.00	0	C	NM_054030		19077074	19077074	-1	no_errors	ENST00000329773	ensembl	human	known	69_37n	missense	35	56.25	45	SNP	0.000	G
MYBPC2	4606	genome.wustl.edu	37	19	50957613	50957613	+	Silent	SNP	G	G	A			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr19:50957613G>A	ENST00000357701.5	+	18	2052	c.2001G>A	c.(1999-2001)ggG>ggA	p.G667G		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	667	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		ACGATGGGGGGAAGCCAGTCA	0.537																																						dbGAP											0													39.0	41.0	40.0					19																	50957613		2045	4189	6234	-	-	-	SO:0001819	synonymous_variant	0				CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.2001G>A	19.37:g.50957613G>A			A1L4G9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.G667	ENST00000357701.5	37	c.2001	CCDS46152.1	19																																																																																			MYBPC2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000086967		0.537	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPC2	HGNC	protein_coding	OTTHUMT00000464751.1	121	0.00	0	G	NM_004533		50957613	50957613	+1	no_errors	ENST00000357701	ensembl	human	known	69_37n	silent	31	21.43	9	SNP	0.993	A
MYBPH	4608	genome.wustl.edu	37	1	203144709	203144709	+	Missense_Mutation	SNP	T	T	G	rs200806121		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr1:203144709T>G	ENST00000255416.4	-	1	232	c.175A>C	c.(175-177)Aca>Cca	p.T59P		NM_004997.2	NP_004988.2	Q13203	MYBPH_HUMAN	myosin binding protein H	59					cell adhesion (GO:0007155)|regulation of striated muscle contraction (GO:0006942)	myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			endometrium(5)|large_intestine(6)|lung(7)|skin(1)|urinary_tract(1)	20			BRCA - Breast invasive adenocarcinoma(75;0.153)	Colorectal(1306;0.0306)		TTAGTGGCTGTGGAGGCTGTA	0.652																																					NSCLC(32;174 1025 14462 23899 42933)	dbGAP											0													65.0	80.0	75.0					1																	203144709		2197	4295	6492	-	-	-	SO:0001583	missense	0			BC044226	CCDS30975.1	1q32.1	2013-02-11	2001-11-28		ENSG00000133055	ENSG00000133055		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7552	protein-coding gene	gene with protein product		160795	"""myosin-binding protein H"""			8486381	Standard	NM_004997		Approved		uc001gzh.1	Q13203	OTTHUMG00000042121	ENST00000255416.4:c.175A>C	1.37:g.203144709T>G	ENSP00000255416:p.Thr59Pro		Q16886|Q86YC5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like	p.T59P	ENST00000255416.4	37	c.175	CCDS30975.1	1	.	.	.	.	.	.	.	.	.	.	T	9.106	1.005349	0.19199	.	.	ENSG00000133055	ENST00000255416	T	0.52057	0.68	5.11	1.91	0.25777	.	1.541090	0.04053	N	0.305108	T	0.28267	0.0698	N	0.08118	0	0.09310	N	1	B	0.31730	0.337	B	0.23419	0.046	T	0.25152	-1.0140	10	0.54805	T	0.06	.	7.4403	0.27179	0.0:0.6937:0.0:0.3063	.	59	Q13203	MYBPH_HUMAN	P	59	ENSP00000255416:T59P	ENSP00000255416:T59P	T	-	1	0	MYBPH	201411332	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.148000	0.03185	0.107000	0.17824	-0.696000	0.03686	ACA	MYBPH	-	NULL	ENSG00000133055		0.652	MYBPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPH	HGNC	protein_coding	OTTHUMT00000100264.1	118	0.83	1	T	NM_004997		203144709	203144709	-1	no_errors	ENST00000255416	ensembl	human	known	69_37n	missense	44	43.59	34	SNP	0.011	G
MYF5	4617	genome.wustl.edu	37	12	81111101	81111101	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr12:81111101G>C	ENST00000228644.3	+	1	411	c.259G>C	c.(259-261)Gca>Cca	p.A87P		NM_005593.2	NP_005584.2	P13349	MYF5_HUMAN	myogenic factor 5	87	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				camera-type eye development (GO:0043010)|cartilage condensation (GO:0001502)|embryonic skeletal system morphogenesis (GO:0048704)|extracellular matrix organization (GO:0030198)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|muscle tissue morphogenesis (GO:0060415)|ossification (GO:0001503)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)	protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(8)|lung(15)|ovary(2)|pancreas(1)	30						TCGGCGGAAGGCAGCCACTAT	0.627																																						dbGAP											0													41.0	38.0	39.0					12																	81111101		2203	4297	6500	-	-	-	SO:0001583	missense	0				CCDS9020.1	12q21	2013-05-21			ENSG00000111049	ENSG00000111049		"""Basic helix-loop-helix proteins"""	7565	protein-coding gene	gene with protein product		159990				8978788, 12105204	Standard	NM_005593		Approved	bHLHc2	uc001szg.2	P13349	OTTHUMG00000170166	ENST00000228644.3:c.259G>C	12.37:g.81111101G>C	ENSP00000228644:p.Ala87Pro		Q6ISR9	Missense_Mutation	SNP	pfam_Basic,pfam_Myf5,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_Basic,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.A87P	ENST00000228644.3	37	c.259	CCDS9020.1	12	.	.	.	.	.	.	.	.	.	.	G	34	5.294991	0.95574	.	.	ENSG00000111049	ENST00000228644	D	0.98362	-4.89	6.06	6.06	0.98353	Myogenic basic muscle-specific protein (1);Helix-loop-helix DNA-binding (4);	0.000000	0.85682	D	0.000000	D	0.99369	0.9778	H	0.95679	3.705	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98732	1.0713	10	0.87932	D	0	-16.6825	20.6208	0.99490	0.0:0.0:1.0:0.0	.	87	P13349	MYF5_HUMAN	P	87	ENSP00000228644:A87P	ENSP00000228644:A87P	A	+	1	0	MYF5	79635232	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.882000	0.98803	0.655000	0.94253	GCA	MYF5	-	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_Basic,pfscan_HLH_DNA-bd	ENSG00000111049		0.627	MYF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYF5	HGNC	protein_coding	OTTHUMT00000407757.1	79	0.00	0	G	NM_005593		81111101	81111101	+1	no_errors	ENST00000228644	ensembl	human	known	69_37n	missense	19	36.67	11	SNP	1.000	C
NCF4	4689	genome.wustl.edu	37	22	37260160	37260160	+	Missense_Mutation	SNP	A	A	C	rs200818199		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr22:37260160A>C	ENST00000248899.6	+	2	290	c.106A>C	c.(106-108)Acc>Ccc	p.T36P	CTA-833B7.2_ENST00000431290.1_RNA|NCF4_ENST00000397147.4_Missense_Mutation_p.T36P|CTA-833B7.2_ENST00000330602.2_RNA	NM_000631.4	NP_000622.2	Q15080	NCF4_HUMAN	neutrophil cytosolic factor 4, 40kDa	36	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|positive regulation of catalytic activity (GO:0043085)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|membrane (GO:0016020)|NADPH oxidase complex (GO:0043020)|phagolysosome (GO:0032010)	phosphatidylinositol-3-phosphate binding (GO:0032266)|protein dimerization activity (GO:0046983)|superoxide-generating NADPH oxidase activator activity (GO:0016176)			cervix(1)|endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16					Dextromethorphan(DB00514)	GAGAGGCTTCACCAGCCACTT	0.527																																						dbGAP											0													121.0	109.0	113.0					22																	37260160		2203	4300	6503	-	-	-	SO:0001583	missense	0			X77094	CCDS13934.1, CCDS13935.1	22q13.1	2014-09-17	2002-08-29		ENSG00000100365	ENSG00000100365			7662	protein-coding gene	gene with protein product	"""neutrophil NADPH oxidase factor 4"""	601488	"""neutrophil cytosolic factor 4 (40kD)"""			8839867	Standard	NM_013416		Approved	p40phox, SH3PXD4	uc003apy.4	Q15080	OTTHUMG00000150548	ENST00000248899.6:c.106A>C	22.37:g.37260160A>C	ENSP00000248899:p.Thr36Pro		A8K4F9|O60808|Q86U56|Q9BU98|Q9NP45	Missense_Mutation	SNP	pfam_Phox,pfam_SH3_domain,pfam_SH3_2,superfamily_Phox,superfamily_SH3_domain,smart_Phox,smart_SH3_domain,prints_NCF_P40,prints_p67phox,pfscan_Phox,pfscan_SH3_domain	p.T36P	ENST00000248899.6	37	c.106	CCDS13934.1	22	.	.	.	.	.	.	.	.	.	.	A	12.17	1.858738	0.32884	.	.	ENSG00000100365	ENST00000248899;ENST00000397147	T;T	0.29655	1.56;1.56	5.06	5.06	0.68205	Phox homologous domain (5);	0.164932	0.52532	D	0.000064	T	0.46600	0.1401	M	0.66939	2.045	0.37707	D	0.924444	D;P	0.57571	0.98;0.731	P;P	0.60473	0.875;0.592	T	0.55755	-0.8091	10	0.72032	D	0.01	-46.9624	8.1658	0.31226	0.7109:0.0:0.0:0.2891	.	36;36	A8K4F9;Q15080	.;NCF4_HUMAN	P	36	ENSP00000248899:T36P;ENSP00000380334:T36P	ENSP00000248899:T36P	T	+	1	0	NCF4	35590106	1.000000	0.71417	1.000000	0.80357	0.448000	0.32197	2.533000	0.45667	1.915000	0.55452	0.402000	0.26972	ACC	NCF4	-	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	ENSG00000100365		0.527	NCF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCF4	HGNC	protein_coding	OTTHUMT00000318863.1	58	0.00	0	A	NM_000631		37260160	37260160	+1	no_errors	ENST00000397147	ensembl	human	known	69_37n	missense	19	70.77	46	SNP	1.000	C
NDST1	3340	genome.wustl.edu	37	5	149915315	149915315	+	Silent	SNP	C	C	T	rs566674949		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr5:149915315C>T	ENST00000261797.6	+	6	1807	c.1305C>T	c.(1303-1305)ggC>ggT	p.G435G	NDST1_ENST00000523767.1_Silent_p.G435G	NM_001543.4	NP_001534.1	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1	435	Heparan sulfate N-deacetylase 1.				carbohydrate metabolic process (GO:0005975)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|midbrain development (GO:0030901)|polysaccharide biosynthetic process (GO:0000271)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	34		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACCACTCGGGCGTGTACCCCG	0.647													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21151	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													81.0	68.0	72.0					5																	149915315		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U18918	CCDS34277.1, CCDS75358.1	5q33.1	2008-02-05				ENSG00000070614		"""Sulfotransferases, membrane-bound"""	7680	protein-coding gene	gene with protein product		600853		HSST		7601448, 9230113	Standard	NM_001543		Approved	NST1	uc003lsk.4	P52848		ENST00000261797.6:c.1305C>T	5.37:g.149915315C>T			Q96E57	Silent	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom	p.G435	ENST00000261797.6	37	c.1305	CCDS34277.1	5																																																																																			NDST1	-	pfam_Heparan_SO4_deacetylase	ENSG00000070614		0.647	NDST1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST1	HGNC	protein_coding	OTTHUMT00000374314.2	50	0.00	0	C	NM_001543		149915315	149915315	+1	no_errors	ENST00000261797	ensembl	human	known	69_37n	silent	51	29.17	21	SNP	0.923	T
NFKBIE	4794	genome.wustl.edu	37	6	44232797	44232797	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr6:44232797C>G	ENST00000275015.5	-	1	703	c.704G>C	c.(703-705)cGc>cCc	p.R235P		NM_004556.2	NP_004547.2	O00221	IKBE_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon	235					cytoplasmic sequestering of transcription factor (GO:0042994)|D-serine transport (GO:0042942)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)		p.R235P(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|urinary_tract(1)	10	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GAGTGGCAGGCGTGGGGCCGG	0.672																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											13.0	18.0	16.0					6																	44232797		2186	4273	6459	-	-	-	SO:0001583	missense	0			U91616	CCDS34463.1	6p21.1	2013-01-10			ENSG00000146232	ENSG00000146232		"""Ankyrin repeat domain containing"""	7799	protein-coding gene	gene with protein product		604548				9135156	Standard	NM_004556		Approved	IKBE	uc003oxe.1	O00221	OTTHUMG00000014762	ENST00000275015.5:c.704G>C	6.37:g.44232797C>G	ENSP00000275015:p.Arg235Pro		Q5T9V9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.R235P	ENST00000275015.5	37	c.704	CCDS34463.1	6	.	.	.	.	.	.	.	.	.	.	C	7.490	0.650514	0.14516	.	.	ENSG00000146232	ENST00000275015	T	0.23348	1.91	4.48	3.61	0.41365	.	0.963138	0.08577	N	0.925198	T	0.06645	0.0170	L	0.36672	1.1	0.09310	N	1	P	0.35307	0.494	B	0.27170	0.077	T	0.30822	-0.9965	10	0.25751	T	0.34	-29.7315	8.2993	0.32004	0.0:0.8889:0.0:0.1111	.	235	O00221	IKBE_HUMAN	P	235	ENSP00000275015:R235P	ENSP00000275015:R235P	R	-	2	0	NFKBIE	44340775	0.000000	0.05858	0.030000	0.17652	0.135000	0.20990	0.134000	0.15932	0.895000	0.36342	0.561000	0.74099	CGC	NFKBIE	-	NULL	ENSG00000146232		0.672	NFKBIE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFKBIE	HGNC	protein_coding	OTTHUMT00000040733.2	102	0.00	0	C			44232797	44232797	-1	no_errors	ENST00000275015	ensembl	human	known	69_37n	missense	26	40.91	18	SNP	0.005	G
NHS	4810	genome.wustl.edu	37	X	17705940	17705940	+	Missense_Mutation	SNP	T	T	C	rs201401939		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chrX:17705940T>C	ENST00000380060.3	+	2	982	c.644T>C	c.(643-645)cTc>cCc	p.L215P	NHS_ENST00000398097.3_Missense_Mutation_p.L38P	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	215	WAVE homology domain (WHD).				cell differentiation (GO:0030154)|lens development in camera-type eye (GO:0002088)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.L215P(1)		breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)					AACATCTTCCTCCCAGCCACA	0.637																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)											79.0	68.0	71.0					X																	17705940		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158			7820	protein-coding gene	gene with protein product		300457					Standard	NM_001136024		Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.644T>C	X.37:g.17705940T>C	ENSP00000369400:p.Leu215Pro		B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	Missense_Mutation	SNP	NULL	p.L215P	ENST00000380060.3	37	c.644	CCDS14181.1	X	.	.	.	.	.	.	.	.	.	.	T	18.63	3.664386	0.67700	.	.	ENSG00000188158	ENST00000380060;ENST00000398097;ENST00000380057	T;T	0.55234	0.56;0.53	5.63	5.63	0.86233	.	0.472558	0.22547	N	0.058653	T	0.69504	0.3118	M	0.80183	2.485	0.80722	D	1	D;D;D;D	0.56968	0.978;0.978;0.978;0.978	P;P;P;P	0.56700	0.804;0.804;0.804;0.804	T	0.74556	-0.3626	10	0.72032	D	0.01	-6.5493	14.8143	0.70020	0.0:0.0:0.0:1.0	.	215;36;38;215	B7ZVX8;C9IYM8;Q6T4R5-2;Q6T4R5	.;.;.;NHS_HUMAN	P	215;38;36	ENSP00000369400:L215P;ENSP00000381170:L38P	ENSP00000369397:L36P	L	+	2	0	NHS	17615861	0.999000	0.42202	0.983000	0.44433	0.857000	0.48899	3.266000	0.51569	1.880000	0.54463	0.417000	0.27973	CTC	NHS	-	NULL	ENSG00000188158		0.637	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NHS	HGNC	protein_coding	OTTHUMT00000059120.1	249	0.79	2	T	NM_198270		17705940	17705940	+1	no_errors	ENST00000380060	ensembl	human	known	69_37n	missense	61	36.63	37	SNP	0.994	C
NID1	4811	genome.wustl.edu	37	1	236141220	236141220	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr1:236141220T>G	ENST00000264187.6	-	20	3773	c.3691A>C	c.(3691-3693)Acc>Ccc	p.T1231P	NID1_ENST00000366595.3_Missense_Mutation_p.T1098P	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	1231	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)			breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	CAACGGCAGGTCCTGCTCCCT	0.502																																						dbGAP											0													96.0	94.0	94.0					1																	236141220		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.3691A>C	1.37:g.236141220T>G	ENSP00000264187:p.Thr1231Pro		Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Missense_Mutation	SNP	pfam_G2_nidogen/fibulin_G2F,pfam_LDLR_classB_rpt,pfam_Nidogen_extracell_dom,pfam_Thyroglobulin_1,pfam_EGF-like_Ca-bd,superfamily_Green_fluorescent_prot-like,superfamily_Thyroglobulin_1,smart_Nidogen_extracell_dom,smart_EGF-like_Ca-bd,smart_EGF-like,smart_G2_nidogen/fibulin_G2F,smart_Thyroglobulin_1,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thyroglobulin_1	p.T1231P	ENST00000264187.6	37	c.3691	CCDS1608.1	1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.315251	0.81358	.	.	ENSG00000116962	ENST00000264187;ENST00000366595	D;D	0.96885	-4.16;-4.16	5.68	4.52	0.55395	Epidermal growth factor-like (1);	0.056824	0.64402	D	0.000001	D	0.96134	0.8740	M	0.81112	2.525	0.38821	D	0.955632	D;B	0.57571	0.98;0.136	P;B	0.48270	0.572;0.028	D	0.96457	0.9338	10	0.72032	D	0.01	.	9.991	0.41872	0.2901:0.0:0.0:0.7099	.	1098;1231	P14543-2;P14543	.;NID1_HUMAN	P	1231;1098	ENSP00000264187:T1231P;ENSP00000355554:T1098P	ENSP00000264187:T1231P	T	-	1	0	NID1	234207843	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.836000	0.39191	2.156000	0.67533	0.460000	0.39030	ACC	NID1	-	smart_EGF-like	ENSG00000116962		0.502	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NID1	HGNC	protein_coding	OTTHUMT00000096647.2	57	0.00	0	T	NM_002508		236141220	236141220	-1	no_errors	ENST00000264187	ensembl	human	known	69_37n	missense	50	58.20	71	SNP	1.000	G
NOTCH3	4854	genome.wustl.edu	37	19	15276624	15276624	+	Missense_Mutation	SNP	T	T	G	rs76166518		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr19:15276624T>G	ENST00000263388.2	-	30	5716	c.5641A>C	c.(5641-5643)Aca>Cca	p.T1881P		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1881					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GCATCGGCTGTGACAGCTGTG	0.607																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.5641A>C	19.37:g.15276624T>G	ENSP00000263388:p.Thr1881Pro		Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_Notch_dom,pfam_Notch_NODP_dom,pfam_Notch_NOD_dom,pfam_EGF_extracell,pfam_DUF3454_notch,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_3,prints_Notch_dom	p.T1881P	ENST00000263388.2	37	c.5641	CCDS12326.1	19	.	.	.	.	.	.	.	.	.	.	T	13.29	2.193235	0.38707	.	.	ENSG00000074181	ENST00000263388	T	0.64991	-0.13	5.36	5.36	0.76844	Ankyrin repeat-containing domain (4);	0.000000	0.33199	N	0.005163	T	0.65144	0.2663	L	0.38733	1.17	0.40726	D	0.982708	D	0.63046	0.992	P	0.60236	0.871	T	0.68907	-0.5285	10	0.72032	D	0.01	.	9.0052	0.36106	0.0:0.0828:0.0:0.9172	.	1881	Q9UM47	NOTC3_HUMAN	P	1881	ENSP00000263388:T1881P	ENSP00000263388:T1881P	T	-	1	0	NOTCH3	15137624	1.000000	0.71417	0.968000	0.41197	0.019000	0.09904	1.408000	0.34668	2.251000	0.74343	0.533000	0.62120	ACA	NOTCH3	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt-contain_dom	ENSG00000074181		0.607	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	HGNC	protein_coding	OTTHUMT00000465714.1	65	0.00	0	T	NM_000435		15276624	15276624	-1	no_errors	ENST00000263388	ensembl	human	known	69_37n	missense	15	55.88	19	SNP	1.000	G
NOTCH3	4854	genome.wustl.edu	37	19	15291055	15291055	+	Missense_Mutation	SNP	T	T	C	rs200822505	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr19:15291055T>C	ENST00000263388.2	-	20	3230	c.3155A>G	c.(3154-3156)gAg>gGg	p.E1052G		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1052	EGF-like 27. {ECO:0000255|PROSITE- ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			ACACAGCTGCTCCAGCCGCAC	0.587																																						dbGAP											0													42.0	32.0	35.0					19																	15291055		2202	4299	6501	-	-	-	SO:0001583	missense	0			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.3155A>G	19.37:g.15291055T>C	ENSP00000263388:p.Glu1052Gly		Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_Notch_dom,pfam_Notch_NODP_dom,pfam_Notch_NOD_dom,pfam_EGF_extracell,pfam_DUF3454_notch,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_3,prints_Notch_dom	p.E1052G	ENST00000263388.2	37	c.3155	CCDS12326.1	19	.	.	.	.	.	.	.	.	.	.	T	16.17	3.046029	0.55110	.	.	ENSG00000074181	ENST00000263388;ENST00000539383	T	0.67171	-0.25	4.84	4.84	0.62591	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.32753	N	0.005692	T	0.57080	0.2029	N	0.05050	-0.12	0.31753	N	0.634341	P;P	0.38110	0.493;0.618	B;P	0.49922	0.271;0.626	T	0.65240	-0.6216	10	0.33940	T	0.23	.	13.4243	0.61015	0.0:0.0:0.0:1.0	.	1003;1052	Q59FL3;Q9UM47	.;NOTC3_HUMAN	G	1052;1002	ENSP00000263388:E1052G	ENSP00000263388:E1052G	E	-	2	0	NOTCH3	15152055	0.894000	0.30519	0.895000	0.35142	0.596000	0.36781	1.535000	0.36061	1.823000	0.53134	0.533000	0.62120	GAG	NOTCH3	-	smart_EGF-like,smart_EGF-like_Ca-bd,pirsf_Notch,pfscan_EG-like_dom	ENSG00000074181		0.587	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	HGNC	protein_coding	OTTHUMT00000465714.1	162	0.00	0	T	NM_000435		15291055	15291055	-1	no_errors	ENST00000263388	ensembl	human	known	69_37n	missense	10	60.00	15	SNP	0.762	C
NR1D1	9572	genome.wustl.edu	37	17	38253621	38253621	+	Missense_Mutation	SNP	A	A	G	rs201066687		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr17:38253621A>G	ENST00000246672.3	-	2	697	c.67T>C	c.(67-69)Tcc>Ccc	p.S23P		NM_021724.3	NP_068370.1	P20393	NR1D1_HUMAN	nuclear receptor subfamily 1, group D, member 1	23	Modulating.				cell differentiation (GO:0030154)|cellular response to lipopolysaccharide (GO:0071222)|circadian regulation of gene expression (GO:0032922)|circadian temperature homeostasis (GO:0060086)|gene expression (GO:0010467)|glycogen biosynthetic process (GO:0005978)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of bile acid biosynthetic process (GO:0070859)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasomal protein catabolic process (GO:0010498)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|regulation of fat cell differentiation (GO:0045598)|regulation of gluconeogenesis by regulation of transcription from RNA polymerase II promoter (GO:0035947)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of lipid metabolic process (GO:0019216)|regulation of type B pancreatic cell proliferation (GO:0061469)|response to leptin (GO:0044321)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|heme binding (GO:0020037)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)|transcription corepressor binding (GO:0001222)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(5)|lung(2)|skin(1)|upper_aerodigestive_tract(2)	11	Colorectal(19;0.000442)					CGGCTTGGGGAGGAGCCACTG	0.592																																						dbGAP											0													43.0	48.0	47.0					17																	38253621		2203	4300	6503	-	-	-	SO:0001583	missense	0			X72631	CCDS11361.1	17q11.2	2013-01-16			ENSG00000126368	ENSG00000126368		"""Nuclear hormone receptors"""	7962	protein-coding gene	gene with protein product		602408		THRAL		1971514	Standard	NM_021724		Approved	ear-1, hRev, Rev-ErbAalpha, THRA1	uc002htz.3	P20393	OTTHUMG00000133327	ENST00000246672.3:c.67T>C	17.37:g.38253621A>G	ENSP00000246672:p.Ser23Pro		Q0P5Z4|Q15304	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt	p.S23P	ENST00000246672.3	37	c.67	CCDS11361.1	17	.	.	.	.	.	.	.	.	.	.	A	17.36	3.370292	0.61624	.	.	ENSG00000126368	ENST00000246672	D	0.91686	-2.89	4.72	3.65	0.41850	.	0.229124	0.36854	N	0.002372	D	0.87696	0.6242	L	0.46157	1.445	0.58432	D	0.999994	B	0.20780	0.048	B	0.16289	0.015	D	0.83608	0.0132	10	0.72032	D	0.01	.	9.0198	0.36193	0.9115:0.0:0.0885:0.0	.	23	P20393	NR1D1_HUMAN	P	23	ENSP00000246672:S23P	ENSP00000246672:S23P	S	-	1	0	NR1D1	35507147	1.000000	0.71417	0.974000	0.42286	0.934000	0.57294	2.649000	0.46656	0.867000	0.35654	0.379000	0.24179	TCC	NR1D1	-	NULL	ENSG00000126368		0.592	NR1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR1D1	HGNC	protein_coding	OTTHUMT00000257135.1	54	0.00	0	A			38253621	38253621	-1	no_errors	ENST00000246672	ensembl	human	known	69_37n	missense	144	43.36	111	SNP	0.999	G
NUMBL	9253	genome.wustl.edu	37	19	41173889	41173889	+	Silent	SNP	C	C	T			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr19:41173889C>T	ENST00000252891.4	-	10	1481	c.1314G>A	c.(1312-1314)caG>caA	p.Q438Q	NUMBL_ENST00000540131.1_Silent_p.Q397Q|NUMBL_ENST00000598779.1_Silent_p.Q397Q	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	438	Poly-Gln.				adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			gctgctgctgctgctgctgtt	0.662																																						dbGAP											0													8.0	8.0	8.0					19																	41173889		2113	4120	6233	-	-	-	SO:0001819	synonymous_variant	0			AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.1314G>A	19.37:g.41173889C>T			Q7Z4J9	Silent	SNP	pfam_Numb_domain,pfam_PTyr_interaction_dom,pfam_PTB,smart_PTyr_interaction_dom,pirsf_Numb/numb-like,pfscan_PTyr_interaction_dom	p.Q438	ENST00000252891.4	37	c.1314	CCDS12561.1	19																																																																																			NUMBL	-	pirsf_Numb/numb-like	ENSG00000105245		0.662	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUMBL	HGNC	protein_coding	OTTHUMT00000462749.2	25	0.00	0	C	NM_004756		41173889	41173889	-1	no_errors	ENST00000252891	ensembl	human	known	69_37n	silent	8	33.33	4	SNP	1.000	T
FFAR4	338557	genome.wustl.edu	37	10	95326590	95326590	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr10:95326590T>G	ENST00000371483.4	+	1	169	c.113T>G	c.(112-114)gTg>gGg	p.V38G	FFAR4_ENST00000604414.1_Missense_Mutation_p.V38G|FFAR4_ENST00000371481.4_Missense_Mutation_p.V38G	NM_181745.3	NP_859529.2	Q5NUL3	FFAR4_HUMAN	free fatty acid receptor 4	38					hormone secretion (GO:0046879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of inflammatory response (GO:0050728)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of glucose transport (GO:0010827)	endocytic vesicle (GO:0030139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fatty acid binding (GO:0005504)|taste receptor activity (GO:0008527)										CACCGGCTGGTGCTGGCCGCG	0.706																																						dbGAP											0													20.0	17.0	18.0					10																	95326590		2195	4293	6488	-	-	-	SO:0001583	missense	0				CCDS31248.1, CCDS55720.1	10q23.33	2012-11-16	2012-11-16	2012-11-16	ENSG00000186188	ENSG00000186188		"""GPCR / Class A : Fatty acid receptors"""	19061	protein-coding gene	gene with protein product		609044	"""G protein-coupled receptor 129"", ""G protein-coupled receptor 120"", ""omega-3 fatty acid receptor 1"""	GPR129, GPR120, O3FAR1		20471368, 19723586, 15619630, 20813258	Standard	NM_181745		Approved	PGR4	uc010qnt.2	Q5NUL3	OTTHUMG00000034409	ENST00000371483.4:c.113T>G	10.37:g.95326590T>G	ENSP00000360538:p.Val38Gly		Q495H1|Q5VY25|Q5VY26|Q7Z605|Q86SM7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.V38G	ENST00000371483.4	37	c.113	CCDS31248.1	10	.	.	.	.	.	.	.	.	.	.	T	3.291	-0.144901	0.06627	.	.	ENSG00000186188	ENST00000371481;ENST00000371483	T;T	0.37584	1.19;1.19	5.22	4.07	0.47477	.	0.447252	0.20429	N	0.092501	T	0.18882	0.0453	L	0.29908	0.895	0.46149	D	0.99889	P;P	0.35433	0.493;0.501	B;B	0.28011	0.085;0.039	T	0.05989	-1.0852	10	0.25751	T	0.34	-15.5285	3.6184	0.08086	0.0:0.2872:0.0:0.7128	.	38;38	Q5NUL3-2;Q5NUL3	.;O3FA1_HUMAN	G	38	ENSP00000360536:V38G;ENSP00000360538:V38G	ENSP00000360536:V38G	V	+	2	0	O3FAR1	95316580	0.997000	0.39634	0.996000	0.52242	0.038000	0.13279	1.710000	0.37920	2.192000	0.70111	0.459000	0.35465	GTG	O3FAR1	-	NULL	ENSG00000186188		0.706	FFAR4-002	KNOWN	basic|CCDS	protein_coding	O3FAR1	HGNC	protein_coding	OTTHUMT00000083179.1	214	0.00	0	T	NM_181745		95326590	95326590	+1	no_errors	ENST00000371483	ensembl	human	known	69_37n	missense	15	48.28	14	SNP	0.967	G
OAF	220323	genome.wustl.edu	37	11	120099649	120099649	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr11:120099649T>G	ENST00000328965.4	+	4	1133	c.620T>G	c.(619-621)gTg>gGg	p.V207G	OAF_ENST00000531220.1_Missense_Mutation_p.V91G	NM_178507.2	NP_848602.1	Q86UD1	OAF_HUMAN	OAF homolog (Drosophila)	207						extracellular vesicular exosome (GO:0070062)				kidney(1)|lung(5)	6		Breast(109;0.00663)|Medulloblastoma(222;0.0523)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)		TGCAGGCAGGTGGGGGACCAC	0.677																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			BC047726	CCDS8430.1	11q23.3	2010-11-23			ENSG00000184232	ENSG00000184232			28752	protein-coding gene	gene with protein product						12477932	Standard	NM_178507		Approved	MGC52117	uc001pxb.3	Q86UD1	OTTHUMG00000166139	ENST00000328965.4:c.620T>G	11.37:g.120099649T>G	ENSP00000332613:p.Val207Gly			Missense_Mutation	SNP	NULL	p.V207G	ENST00000328965.4	37	c.620	CCDS8430.1	11	.	.	.	.	.	.	.	.	.	.	T	9.566	1.119782	0.20877	.	.	ENSG00000184232	ENST00000328965;ENST00000531220	T;T	0.35605	1.3;1.3	4.73	2.35	0.29111	.	0.633028	0.15974	N	0.235620	T	0.33585	0.0868	M	0.61703	1.905	0.22305	N	0.999217	P	0.45827	0.867	B	0.41619	0.361	T	0.22417	-1.0217	10	0.87932	D	0	-8.8011	6.2248	0.20701	0.0:0.0816:0.3083:0.6101	.	207	Q86UD1	OAF_HUMAN	G	207;91	ENSP00000332613:V207G;ENSP00000431865:V91G	ENSP00000332613:V207G	V	+	2	0	OAF	119604859	0.003000	0.15002	0.078000	0.20375	0.001000	0.01503	-0.021000	0.12504	0.182000	0.20032	-0.316000	0.08728	GTG	OAF	-	NULL	ENSG00000184232		0.677	OAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OAF	HGNC	protein_coding	OTTHUMT00000388036.2	68	0.00	0	T	NM_178507		120099649	120099649	+1	no_errors	ENST00000328965	ensembl	human	known	69_37n	missense	13	31.58	6	SNP	0.003	G
OBSCN	84033	genome.wustl.edu	37	1	228402101	228402101	+	Silent	SNP	C	C	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr1:228402101C>G	ENST00000422127.1	+	4	1529	c.1485C>G	c.(1483-1485)ggC>ggG	p.G495G	OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000284548.11_Silent_p.G495G|OBSCN_ENST00000570156.2_Silent_p.G495G|OBSCN_ENST00000366709.4_5'UTR|C1orf145_ENST00000295012.5_5'Flank	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	495	Ig-like 5.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TTATGGCTGGCGACTGCCAGA	0.677																																						dbGAP											0													60.0	72.0	68.0					1																	228402101		2153	4236	6389	-	-	-	SO:0001819	synonymous_variant	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.1485C>G	1.37:g.228402101C>G			Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.G495	ENST00000422127.1	37	c.1485	CCDS58065.1	1																																																																																			OBSCN	-	superfamily_Fibronectin_type3,smart_Ig_sub	ENSG00000154358		0.677	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		147	0.00	0	C	NM_052843		228402101	228402101	+1	no_errors	ENST00000422127	ensembl	human	known	69_37n	silent	40	25.93	14	SNP	0.892	G
OR2D2	120776	genome.wustl.edu	37	11	6912828	6912828	+	Missense_Mutation	SNP	C	C	A	rs202199275		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr11:6912828C>A	ENST00000299459.2	-	1	1002	c.904G>T	c.(904-906)Gta>Tta	p.V302L		NM_003700.1	NP_003691.1	Q9H210	OR2D2_HUMAN	olfactory receptor, family 2, subfamily D, member 2	302					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(9)|ovary(1)|skin(2)	18		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CTTGTGGCTACTTTCCTCAGA	0.453																																						dbGAP											0													75.0	67.0	70.0					11																	6912828		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065824	CCDS31416.1	11p15.4	2012-08-09			ENSG00000166368	ENSG00000166368		"""GPCR / Class A : Olfactory receptors"""	8244	protein-coding gene	gene with protein product		608494		OR2D1		9787077	Standard	NM_003700		Approved	OR11-610, hg27	uc010rau.2	Q9H210	OTTHUMG00000165741	ENST00000299459.2:c.904G>T	11.37:g.6912828C>A	ENSP00000299459:p.Val302Leu		B9EIL5|O95224|Q6IF28|Q8NGH4|Q96R52	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt	p.V302L	ENST00000299459.2	37	c.904	CCDS31416.1	11	.	.	.	.	.	.	.	.	.	.	c	0.003	-2.560876	0.00136	.	.	ENSG00000166368	ENST00000299459	T	0.32272	1.46	5.12	2.16	0.27623	.	0.669257	0.12997	N	0.421987	T	0.11580	0.0282	N	0.05554	-0.025	0.21325	N	0.999725	B	0.26602	0.154	B	0.23852	0.049	T	0.34551	-0.9824	10	0.02654	T	1	-15.3431	5.9401	0.19187	0.1296:0.5482:0.2483:0.0738	.	302	Q9H210	OR2D2_HUMAN	L	302	ENSP00000299459:V302L	ENSP00000299459:V302L	V	-	1	0	OR2D2	6869404	0.000000	0.05858	0.800000	0.32199	0.024000	0.10985	-0.743000	0.04845	0.124000	0.18369	-2.763000	0.00121	GTA	OR2D2	-	NULL	ENSG00000166368		0.453	OR2D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2D2	HGNC	protein_coding	OTTHUMT00000385986.1	62	0.00	0	C	NM_003700		6912828	6912828	-1	no_errors	ENST00000299459	ensembl	human	known	69_37n	missense	125	34.72	67	SNP	0.592	A
PABPC3	5042	genome.wustl.edu	37	13	25671062	25671062	+	Silent	SNP	A	A	G	rs78534836	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr13:25671062A>G	ENST00000281589.3	+	1	763	c.726A>G	c.(724-726)gaA>gaG	p.E242E		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	242	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		AAAGGCATGAAGATGCACAGA	0.428																																						dbGAP											0													103.0	94.0	97.0					13																	25671062		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.726A>G	13.37:g.25671062A>G			Q8NHV0|Q9H086	Silent	SNP	pfam_RRM_dom,pfam_PABP_HYD,superfamily_PABP_HYD,smart_RRM_dom,smart_RRM_dom_euk,smart_PABP_HYD,pfscan_RRM_dom,tigrfam_PABP_1234	p.E242	ENST00000281589.3	37	c.726	CCDS9311.1	13																																																																																			PABPC3	-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom,tigrfam_PABP_1234	ENSG00000151846		0.428	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PABPC3	HGNC	protein_coding	OTTHUMT00000044220.2	40	0.00	0	A	NM_030979		25671062	25671062	+1	no_errors	ENST00000281589	ensembl	human	known	69_37n	silent	504	17.24	105	SNP	1.000	G
PABPC3	5042	genome.wustl.edu	37	13	25671089	25671089	+	Missense_Mutation	SNP	G	G	T	rs75281454	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr13:25671089G>T	ENST00000281589.3	+	1	790	c.753G>T	c.(751-753)atG>atT	p.M251I		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	251	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		TAGATGAGATGAATGGAAAGG	0.403																																						dbGAP											0													123.0	110.0	114.0					13																	25671089		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.753G>T	13.37:g.25671089G>T	ENSP00000281589:p.Met251Ile		Q8NHV0|Q9H086	Missense_Mutation	SNP	pfam_RRM_dom,pfam_PABP_HYD,superfamily_PABP_HYD,smart_RRM_dom,smart_RRM_dom_euk,smart_PABP_HYD,pfscan_RRM_dom,tigrfam_PABP_1234	p.M251I	ENST00000281589.3	37	c.753	CCDS9311.1	13	.	.	.	.	.	.	.	.	.	.	G	10.67	1.414895	0.25465	.	.	ENSG00000151846	ENST00000281589	T	0.17528	2.27	0.875	0.875	0.19130	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.56097	U	0.000023	T	0.26955	0.0660	M	0.75884	2.315	0.50171	D	0.999851	P	0.37276	0.589	P	0.48030	0.564	T	0.06320	-1.0833	10	0.66056	D	0.02	.	7.5489	0.27783	0.0:0.0:1.0:0.0	.	251	Q9H361	PABP3_HUMAN	I	251	ENSP00000281589:M251I	ENSP00000281589:M251I	M	+	3	0	PABPC3	24569089	1.000000	0.71417	0.961000	0.40146	0.281000	0.26958	6.590000	0.74085	0.759000	0.33084	0.313000	0.20887	ATG	PABPC3	-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom,tigrfam_PABP_1234	ENSG00000151846		0.403	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PABPC3	HGNC	protein_coding	OTTHUMT00000044220.2	46	0.00	0	G	NM_030979		25671089	25671089	+1	no_errors	ENST00000281589	ensembl	human	known	69_37n	missense	628	13.26	96	SNP	1.000	T
PANK4	55229	genome.wustl.edu	37	1	2453125	2453125	+	Intron	SNP	C	C	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr1:2453125C>G	ENST00000378466.3	-	2	220				PANK4_ENST00000435556.3_Intron|PANK4_ENST00000491212.1_Intron	NM_018216.1	NP_060686.1	Q9NVE7	PANK4_HUMAN	pantothenate kinase 4						coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	23	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;1.54e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.95e-23)|GBM - Glioblastoma multiforme(42;2.81e-08)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.00445)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		GAAGCGGCTGCCCTGCCCCGG	0.587																																						dbGAP											0													79.0	85.0	83.0					1																	2453125		2203	4299	6502	-	-	-	SO:0001627	intron_variant	0			AK001644	CCDS42.1	1p36.32	2008-02-05			ENSG00000157881	ENSG00000157881			19366	protein-coding gene	gene with protein product		606162				11479594	Standard	XR_241034		Approved	FLJ10782	uc001ajm.1	Q9NVE7	OTTHUMG00000000791	ENST00000378466.3:c.207+31G>C	1.37:g.2453125C>G			B9DI84|Q53EU3|Q5TA84|Q7RTX3|Q9H3X5	Missense_Mutation	SNP	NULL	p.G127A	ENST00000378466.3	37	c.380	CCDS42.1	1																																																																																			PANK4	-	NULL	ENSG00000157881		0.587	PANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PANK4	HGNC	protein_coding	OTTHUMT00000002082.1	92	0.00	0	C			2453125	2453125	-1	no_errors	ENST00000502770	ensembl	human	known	69_37n	missense	75	19.35	18	SNP	0.000	G
PARVG	64098	genome.wustl.edu	37	22	44585003	44585003	+	Missense_Mutation	SNP	C	C	G	rs200993379	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr22:44585003C>G	ENST00000444313.3	+	6	741	c.257C>G	c.(256-258)gCg>gGg	p.A86G	PARVG_ENST00000422871.1_Missense_Mutation_p.A86G|PARVG_ENST00000415224.1_Missense_Mutation_p.A86G	NM_022141.5	NP_071424.1	Q9HBI0	PARVG_HUMAN	parvin, gamma	86	CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton reorganization (GO:0031532)|cell-matrix adhesion (GO:0007160)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			endometrium(2)|kidney(1)|large_intestine(4)|lung(10)	17		Ovarian(80;0.024)|all_neural(38;0.0299)				GAGAGGCTGGCGGCGCTCAAG	0.657																																						dbGAP											0													52.0	55.0	54.0					22																	44585003		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF237772	CCDS14057.1	22q13.31	2013-01-24			ENSG00000138964	ENSG00000138964		"""Parvins"""	14654	protein-coding gene	gene with protein product		608122				11171322	Standard	NM_022141		Approved		uc003bep.4	Q9HBI0	OTTHUMG00000150473	ENST00000444313.3:c.257C>G	22.37:g.44585003C>G	ENSP00000391583:p.Ala86Gly		B4DDW5|E7EVM6|Q9BQX5|Q9NSG1	Missense_Mutation	SNP	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.A86G	ENST00000444313.3	37	c.257	CCDS14057.1	22	.	.	.	.	.	.	.	.	.	.	C	10.48	1.361742	0.24684	.	.	ENSG00000138964	ENST00000422871;ENST00000444313;ENST00000415224	D;D;D	0.95205	-3.64;-3.64;-3.64	4.86	2.59	0.31030	Calponin homology domain (4);	0.476104	0.20767	N	0.086056	D	0.91175	0.7220	L	0.40543	1.245	0.19775	N	0.999956	B	0.26602	0.154	B	0.33339	0.162	T	0.83293	-0.0032	10	0.35671	T	0.21	0.6589	12.4603	0.55729	0.0:0.6772:0.3228:0.0	.	86	Q9HBI0	PARVG_HUMAN	G	86	ENSP00000391453:A86G;ENSP00000391583:A86G;ENSP00000416761:A86G	ENSP00000349378:A86G	A	+	2	0	PARVG	42916336	0.875000	0.30112	0.075000	0.20258	0.690000	0.40134	1.733000	0.38156	1.025000	0.39708	0.555000	0.69702	GCG	PARVG	-	pfam_CH-domain,superfamily_CH-domain,pfscan_CH-domain	ENSG00000138964		0.657	PARVG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARVG	HGNC	protein_coding	OTTHUMT00000318238.4	65	0.00	0	C	NM_022141		44585003	44585003	+1	no_errors	ENST00000415224	ensembl	human	known	69_37n	missense	22	60.00	33	SNP	0.189	G
PCNT	5116	genome.wustl.edu	37	21	47817989	47817989	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr21:47817989A>G	ENST00000359568.5	+	23	4615	c.4508A>G	c.(4507-4509)gAg>gGg	p.E1503G	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	1503					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					CAGAGGCTGGAGGGGCAGCTC	0.682																																						dbGAP											0													20.0	21.0	21.0					21																	47817989		2194	4295	6489	-	-	-	SO:0001583	missense	0			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.4508A>G	21.37:g.47817989A>G	ENSP00000352572:p.Glu1503Gly		O43152|Q7Z7C9	Missense_Mutation	SNP	pfam_PACT_domain	p.E1503G	ENST00000359568.5	37	c.4508	CCDS33592.1	21	.	.	.	.	.	.	.	.	.	.	A	23.9	4.470553	0.84533	.	.	ENSG00000160299	ENST00000359568	T	0.72725	-0.68	4.95	4.95	0.65309	.	0.243446	0.21498	N	0.073566	D	0.83732	0.5318	M	0.82056	2.57	0.37807	D	0.92792	D;D	0.89917	0.998;1.0	D;D	0.83275	0.977;0.996	D	0.87226	0.2257	10	0.72032	D	0.01	.	12.6164	0.56580	1.0:0.0:0.0:0.0	.	1385;1503	O95613-2;O95613	.;PCNT_HUMAN	G	1503	ENSP00000352572:E1503G	ENSP00000352572:E1503G	E	+	2	0	PCNT	46642417	1.000000	0.71417	1.000000	0.80357	0.809000	0.45718	6.683000	0.74533	2.071000	0.62044	0.454000	0.30748	GAG	PCNT	-	NULL	ENSG00000160299		0.682	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNT	HGNC	protein_coding	OTTHUMT00000207336.1	62	0.00	0	A	NM_006031		47817989	47817989	+1	no_errors	ENST00000359568	ensembl	human	known	69_37n	missense	90	40.26	62	SNP	1.000	G
PDZD7	79955	genome.wustl.edu	37	10	102789826	102789826	+	Missense_Mutation	SNP	G	G	C	rs199892353		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr10:102789826G>C	ENST00000370215.3	-	2	376	c.151C>G	c.(151-153)Ctg>Gtg	p.L51V	PDZD7_ENST00000470414.1_Missense_Mutation_p.L51V|SFXN3_ENST00000393459.1_5'Flank|SFXN3_ENST00000224807.5_5'Flank	NM_024895.4	NP_079171.1	Q9H5P4	PDZD7_HUMAN	PDZ domain containing 7	51						cilium (GO:0005929)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		GGCCCGTTCAGCAGCCGTTGT	0.662																																						dbGAP											0													52.0	59.0	57.0					10																	102789826		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026862	CCDS31269.1, CCDS73182.1	10q24.32	2006-01-24		2006-01-24	ENSG00000186862	ENSG00000186862			26257	protein-coding gene	gene with protein product		612971		PDZK7		12477932	Standard	NM_024895		Approved	FLJ23209, bA108L7.8	uc021pxc.1	Q9H5P4	OTTHUMG00000018916	ENST00000370215.3:c.151C>G	10.37:g.102789826G>C	ENSP00000359234:p.Leu51Val		D5FJ77|Q8N321	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L51V	ENST00000370215.3	37	c.151	CCDS31269.1	10	.	.	.	.	.	.	.	.	.	.	G	12.82	2.051203	0.36181	.	.	ENSG00000186862	ENST00000393462;ENST00000370215	T	0.11712	2.75	5.28	1.93	0.25924	.	0.000000	0.36134	N	0.002774	T	0.04452	0.0122	N	0.19112	0.55	0.24205	N	0.995499	P;P	0.42908	0.689;0.793	B;B	0.37692	0.13;0.256	T	0.26710	-1.0095	10	0.10111	T	0.7	.	3.1934	0.06625	0.2389:0.1204:0.5179:0.1228	.	51;51	Q9H5P4;Q9H5P4-2	PDZD7_HUMAN;.	V	51	ENSP00000359234:L51V	ENSP00000359234:L51V	L	-	1	2	PDZD7	102779816	1.000000	0.71417	1.000000	0.80357	0.616000	0.37450	0.638000	0.24674	0.608000	0.30000	0.448000	0.29417	CTG	PDZD7	-	NULL	ENSG00000186862		0.662	PDZD7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD7	HGNC	protein_coding	OTTHUMT00000049883.1	157	0.00	0	G	NM_024895		102789826	102789826	-1	no_errors	ENST00000370215	ensembl	human	known	69_37n	missense	36	26.53	13	SNP	0.993	C
PFKM	5213	genome.wustl.edu	37	12	48526792	48526792	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr12:48526792A>C	ENST00000312352.7	+	5	418	c.379A>C	c.(379-381)Acc>Ccc	p.T127P	PFKM_ENST00000547587.1_Missense_Mutation_p.T127P|PFKM_ENST00000551804.1_Missense_Mutation_p.T127P|PFKM_ENST00000395233.2_Missense_Mutation_p.T127P|PFKM_ENST00000359794.5_Missense_Mutation_p.T127P|PFKM_ENST00000340802.6_Missense_Mutation_p.T198P	NM_001166687.1	NP_001160159.1	P08237	PFKAM_HUMAN	phosphofructokinase, muscle	127	N-terminal catalytic PFK domain 1.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|muscle cell cellular homeostasis (GO:0046716)|positive regulation of insulin secretion (GO:0032024)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	6-phosphofructokinase complex (GO:0005945)|apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|sperm principal piece (GO:0097228)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|fructose binding (GO:0070061)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			NS(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						TGGGGCTGACACCTTCCGTTC	0.532																																						dbGAP											0													110.0	105.0	107.0					12																	48526792		2203	4300	6503	-	-	-	SO:0001583	missense	0			M26066	CCDS8760.1, CCDS53786.1	12q13.11	2014-06-13					2.7.1.11		8877	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 122"""	610681	"""phosphofructokinase, polypeptide X"""	PFKX			Standard	NM_001166686		Approved	PFK-1, PPP1R122	uc001rrb.2	P08237		ENST00000312352.7:c.379A>C	12.37:g.48526792A>C	ENSP00000309438:p.Thr127Pro		J3KNX3|Q16814|Q16815|Q6ZTT1	Missense_Mutation	SNP	pfam_Phosphofructokinase_dom,superfamily_Phosphofructokinase_dom,pirsf_6-phosphofructokinase_euk,prints_Phosphofructokinase,tigrfam_6-phosphofructokinase_euk	p.T127P	ENST00000312352.7	37	c.379	CCDS8760.1	12	.	.	.	.	.	.	.	.	.	.	A	14.52	2.559581	0.45590	.	.	ENSG00000152556	ENST00000550345;ENST00000340802;ENST00000359794;ENST00000551339;ENST00000395233;ENST00000548345;ENST00000551804;ENST00000549022;ENST00000547587;ENST00000312352	T;T;T;T;T;T;T;T;T;T	0.80304	-1.36;-1.36;-1.36;-1.36;-1.36;-1.36;-1.36;-1.36;-1.36;-1.36	4.57	3.41	0.39046	Phosphofructokinase domain (2);	0.252568	0.39759	N	0.001277	T	0.78685	0.4322	L	0.54323	1.7	0.38832	D	0.955871	P;B;P	0.36712	0.566;0.148;0.496	B;B;B	0.42692	0.395;0.224;0.365	T	0.79885	-0.1614	10	0.62326	D	0.03	-23.7289	10.3276	0.43803	0.852:0.0:0.0:0.148	.	127;127;198	P08237-2;P08237;Q6ZTT1	.;K6PF_HUMAN;.	P	127;198;127;127;127;127;127;127;127;127	ENSP00000450369:T127P;ENSP00000345771:T198P;ENSP00000352842:T127P;ENSP00000448253:T127P;ENSP00000378656:T127P;ENSP00000449269:T127P;ENSP00000448177:T127P;ENSP00000446805:T127P;ENSP00000449426:T127P;ENSP00000309438:T127P	ENSP00000309438:T127P	T	+	1	0	PFKM	46813059	0.276000	0.24211	1.000000	0.80357	0.992000	0.81027	0.801000	0.27055	1.053000	0.40415	-0.341000	0.08007	ACC	PFKM	-	pfam_Phosphofructokinase_dom,superfamily_Phosphofructokinase_dom,pirsf_6-phosphofructokinase_euk,tigrfam_6-phosphofructokinase_euk	ENSG00000152556		0.532	PFKM-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PFKM	HGNC	protein_coding	OTTHUMT00000406490.1	60	0.00	0	A	NM_000289		48526792	48526792	+1	no_errors	ENST00000312352	ensembl	human	known	69_37n	missense	112	21.68	31	SNP	1.000	C
PICK1	9463	genome.wustl.edu	37	22	38465067	38465067	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr22:38465067T>G	ENST00000404072.3	+	6	724	c.377T>G	c.(376-378)gTg>gGg	p.V126G	PICK1_ENST00000468288.1_3'UTR|PICK1_ENST00000356976.3_Missense_Mutation_p.V126G|RP5-1039K5.13_ENST00000445483.1_RNA	NM_001039583.1|NM_001039584.1	NP_001034672.1|NP_001034673.1	Q9NRD5	PICK1_HUMAN	protein interacting with PRKCA 1	126					ATP catabolic process (GO:0006200)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|dendritic spine maintenance (GO:0097062)|dendritic spine organization (GO:0097061)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|glial cell development (GO:0021782)|long term synaptic depression (GO:0060292)|monoamine transport (GO:0015844)|negative regulation of Arp2/3 complex-mediated actin nucleation (GO:0034316)|neuronal ion channel clustering (GO:0045161)|positive regulation of receptor internalization (GO:0002092)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|protein targeting (GO:0006605)|receptor clustering (GO:0043113)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endocytic vesicle membrane (GO:0030666)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	actin filament binding (GO:0051015)|Arp2/3 complex binding (GO:0071933)|ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein kinase C binding (GO:0005080)|receptor binding (GO:0005102)			cervix(1)|endometrium(3)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13	Melanoma(58;0.045)					CACCGGCTGGTGGAGAACATG	0.637																																						dbGAP											0													54.0	46.0	49.0					22																	38465067		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL049654	CCDS13965.1	22q13.1	2006-02-14	2006-02-14	2006-02-14	ENSG00000100151	ENSG00000100151			9394	protein-coding gene	gene with protein product		605926	"""protein kinase C, alpha binding protein"", ""protein interacting with PRKCA"""	PRKCABP		10340301, 10591208	Standard	XM_006724377		Approved	dJ1039K5, MGC15204	uc003aus.3	Q9NRD5	OTTHUMG00000151159	ENST00000404072.3:c.377T>G	22.37:g.38465067T>G	ENSP00000385205:p.Val126Gly		B3KS52|O95906	Missense_Mutation	SNP	pfam_Arfaptin_homology_dom,pfam_PDZ,pfam_BAR_dom,superfamily_PDZ,smart_PDZ,pfscan_Arfaptin_homology_dom,pfscan_PDZ	p.V126G	ENST00000404072.3	37	c.377	CCDS13965.1	22	.	.	.	.	.	.	.	.	.	.	T	24.2	4.510127	0.85282	.	.	ENSG00000100151	ENST00000404072;ENST00000424694;ENST00000356976;ENST00000435166	T;T;T;T	0.79141	-1.24;-1.24;-1.24;0.95	4.86	4.86	0.63082	Arfaptin-like (1);	0.000000	0.85682	D	0.000000	D	0.84687	0.5527	M	0.84846	2.72	0.80722	D	1	P	0.40332	0.713	P	0.48063	0.565	D	0.87509	0.2438	10	0.87932	D	0	-24.1878	14.7647	0.69629	0.0:0.0:0.0:1.0	.	126	Q9NRD5	PICK1_HUMAN	G	126	ENSP00000385205:V126G;ENSP00000398141:V126G;ENSP00000349465:V126G;ENSP00000397588:V126G	ENSP00000349465:V126G	V	+	2	0	PICK1	36795013	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	7.821000	0.86641	1.948000	0.56530	0.459000	0.35465	GTG	PICK1	-	pfam_Arfaptin_homology_dom	ENSG00000100151		0.637	PICK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PICK1	HGNC	protein_coding	OTTHUMT00000321569.2	101	0.00	0	T	NM_012407		38465067	38465067	+1	no_errors	ENST00000356976	ensembl	human	known	69_37n	missense	30	45.45	25	SNP	1.000	G
PIGZ	80235	genome.wustl.edu	37	3	196674232	196674232	+	Silent	SNP	A	A	C	rs201995542	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr3:196674232A>C	ENST00000412723.1	-	3	1682	c.1536T>G	c.(1534-1536)ggT>ggG	p.G512G		NM_025163.2	NP_079439.2	Q86VD9	PIGZ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Z	512					GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	alpha-1,2-mannosyltransferase activity (GO:0000026)|mannosyltransferase activity (GO:0000030)			breast(1)|endometrium(1)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	14	all_cancers(143;1.05e-08)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.29e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00603)		GCCATGGCCCACCAGCCACTT	0.592																																						dbGAP											0													45.0	45.0	45.0					3																	196674232		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			BC018804	CCDS3324.1	3q29	2013-02-26	2006-06-28		ENSG00000119227	ENSG00000119227		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	30596	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 4"", ""dol-P-Man dependent GPI mannosyltransferase"""	611671	"""phosphatidylinositol glycan, class Z"""			15208306	Standard	NM_025163		Approved	FLJ12768, MGC52163, SMP3	uc003fxh.3	Q86VD9	OTTHUMG00000155522	ENST00000412723.1:c.1536T>G	3.37:g.196674232A>C			Q9H9G6	Silent	SNP	pfam_GPI_mannosylTrfase	p.G512	ENST00000412723.1	37	c.1536	CCDS3324.1	3																																																																																			PIGZ	-	NULL	ENSG00000119227		0.592	PIGZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGZ	HGNC	protein_coding	OTTHUMT00000340486.2	34	0.00	0	A	NM_025163		196674232	196674232	-1	no_errors	ENST00000412723	ensembl	human	known	69_37n	silent	49	40.70	35	SNP	0.000	C
PKD1	5310	genome.wustl.edu	37	16	2152597	2152597	+	Missense_Mutation	SNP	A	A	G	rs201648917		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr16:2152597A>G	ENST00000262304.4	-	25	9194	c.8986T>C	c.(8986-8988)Tcc>Ccc	p.S2996P	PKD1_ENST00000423118.1_Missense_Mutation_p.S2996P|PKD1_ENST00000561991.1_5'Flank	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	2996					anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						AAGTGGCTGGAGAGGTTCAGA	0.647																																						dbGAP											0													24.0	33.0	30.0					16																	2152597		2183	4281	6464	-	-	-	SO:0001583	missense	0			L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.8986T>C	16.37:g.2152597A>G	ENSP00000262304:p.Ser2996Pro		Q15140|Q15141	Missense_Mutation	SNP	pfam_PKD_dom,pfam_PKD1_2_channel,pfam_PKD/REJ-like,pfam_LipOase_LH2,pfam_C-type_lectin,pfam_WSC_carb-bd,pfam_GPS_dom,superfamily_C-type_lectin_fold,superfamily_Lipase_LipOase,superfamily_PKD_dom,superfamily_Fe_hydrogenase,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_WSC_carb-bd_subgr,smart_PKD/Chitinase_dom,smart_C-type_lectin,smart_GPS_dom,smart_LipOase_LH2,pfscan_GPS_dom,pfscan_C-type_lectin,pfscan_PKD_dom,pfscan_LipOase_LH2,pfscan_REJ-like,pfscan_WSC_carb-bd,prints_PKD_1,tigrfam_Polycystin_cat	p.S2996P	ENST00000262304.4	37	c.8986	CCDS32369.1	16	.	.	.	.	.	.	.	.	.	.	A	14.41	2.527678	0.44969	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101	T;T	0.37915	1.17;1.17	4.55	2.21	0.28008	.	.	.	.	.	T	0.39572	0.1083	L	0.42245	1.32	0.21064	N	0.999797	P;D	0.56968	0.89;0.978	B;P	0.53146	0.351;0.719	T	0.17018	-1.0383	9	0.62326	D	0.03	.	7.5623	0.27857	0.1416:0.0:0.1462:0.7121	.	2996;2996	P98161-3;P98161	.;PKD1_HUMAN	P	2996;2996;2331	ENSP00000262304:S2996P;ENSP00000399501:S2996P	ENSP00000262304:S2996P	S	-	1	0	PKD1	2092598	1.000000	0.71417	0.999000	0.59377	0.325000	0.28411	5.136000	0.64783	0.237000	0.21200	-0.585000	0.04130	TCC	PKD1	-	NULL	ENSG00000008710		0.647	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKD1	HGNC	protein_coding	OTTHUMT00000341688.1	122	0.00	0	A			2152597	2152597	-1	no_errors	ENST00000262304	ensembl	human	known	69_37n	missense	50	31.51	23	SNP	1.000	G
PLCXD1	55344	genome.wustl.edu	37	X	208197	208197	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chrX:208197A>G	ENST00000381657.2	+	5	939	c.425A>G	c.(424-426)gAg>gGg	p.E142G	PLCXD1_ENST00000399012.1_Missense_Mutation_p.E142G|PLCXD1_ENST00000484611.2_3'UTR|PLCXD1_ENST00000381663.3_Missense_Mutation_p.E142G	NM_018390.3	NP_060860.1	Q9NUJ7	PLCX1_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 1	142	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				lipid metabolic process (GO:0006629)		phosphoric diester hydrolase activity (GO:0008081)			endometrium(3)|large_intestine(1)|lung(7)	11		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GAGTGGCTGGAGCGGCATCCA	0.632																																						dbGAP											0													116.0	110.0	112.0					X																	208197		2203	4296	6499	-	-	-	SO:0001583	missense	0			AK002185	CCDS14103.1	Xp22.33 and Yp11.32	2010-07-28			ENSG00000182378	ENSG00000182378		"""Pseudoautosomal regions / PAR1"""	23148	protein-coding gene	gene with protein product							Standard	NM_018390		Approved	FLJ11323	uc004cpc.3	Q9NUJ7	OTTHUMG00000022693	ENST00000381657.2:c.425A>G	X.37:g.208197A>G	ENSP00000371073:p.Glu142Gly		A2BH51|A2BH52	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom	p.E142G	ENST00000381657.2	37	c.425	CCDS14103.1	X	.	.	.	.	.	.	.	.	.	.	.	0.080	-1.185039	0.01620	.	.	ENSG00000182378	ENST00000399012;ENST00000430923;ENST00000381657;ENST00000381663;ENST00000415337;ENST00000447472	T;T;T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06;-0.06;-0.06	1.1	1.1	0.20463	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (2);	0.660669	0.14664	N	0.305758	T	0.41096	0.1144	.	.	.	0.09310	N	1	B	0.13145	0.007	B	0.15484	0.013	T	0.16424	-1.0403	9	0.30854	T	0.27	-14.5764	3.1858	0.06601	0.6192:0.0:0.0:0.3807	.	142	Q9NUJ7	PLCX1_HUMAN	G	142	ENSP00000381976:E142G;ENSP00000394848:E142G;ENSP00000371073:E142G;ENSP00000371079:E142G;ENSP00000399510:E142G;ENSP00000405307:E142G	ENSP00000371073:E142G	E	+	2	0	PLCXD1	148197	0.982000	0.34865	0.476000	0.27291	0.048000	0.14542	3.590000	0.53979	0.466000	0.27193	0.084000	0.15446	GAG	PLCXD1	-	pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom	ENSG00000182378		0.632	PLCXD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLCXD1	HGNC	protein_coding	OTTHUMT00000058879.2	102	0.97	1	A	NM_018390		208197	208197	+1	no_errors	ENST00000381657	ensembl	human	known	69_37n	missense	70	60.67	108	SNP	0.541	G
PNMT	5409	genome.wustl.edu	37	17	37826537	37826537	+	Nonsense_Mutation	SNP	C	C	A	rs201886594	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr17:37826537C>A	ENST00000269582.2	+	3	1062	c.744C>A	c.(742-744)taC>taA	p.Y248*	PNMT_ENST00000394246.1_Nonsense_Mutation_p.Y150*	NM_002686.3	NP_002677.1	P11086	PNMT_HUMAN	phenylethanolamine N-methyltransferase	248					catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|epinephrine biosynthetic process (GO:0042418)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phenylethanolamine N-methyltransferase activity (GO:0004603)			NS(1)|breast(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	8	all_cancers(6;6.59e-85)|all_epithelial(6;2.89e-103)|Breast(7;1.05e-86)|Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;3.87e-45)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			GTAGTGGCTACAAGGTCCGGG	0.637																																						dbGAP											0													51.0	30.0	37.0					17																	37826537		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0				CCDS11343.1	17q	2010-04-16			ENSG00000141744	ENSG00000141744	2.1.1.28		9160	protein-coding gene	gene with protein product		171190		PENT		3372503	Standard	NM_002686		Approved		uc002hsi.2	P11086	OTTHUMG00000133209	ENST00000269582.2:c.744C>A	17.37:g.37826537C>A	ENSP00000269582:p.Tyr248*			Nonsense_Mutation	SNP	pfam_NNMT_TEMT_trans,pirsf_NNMT_TEMT_trans	p.Y248*	ENST00000269582.2	37	c.744	CCDS11343.1	17	.	.	.	.	.	.	.	.	.	.	C	13.43	2.233667	0.39498	.	.	ENSG00000141744	ENST00000394246;ENST00000269582	.	.	.	5.1	-7.95	0.01148	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	-1.9272	15.9277	0.79632	0.0:0.27:0.0:0.73	.	.	.	.	X	150;248	.	ENSP00000269582:Y248X	Y	+	3	2	PNMT	35080063	0.000000	0.05858	0.287000	0.24848	0.675000	0.39556	-0.717000	0.04986	-1.658000	0.01490	-0.339000	0.08088	TAC	PNMT	-	pfam_NNMT_TEMT_trans,pirsf_NNMT_TEMT_trans	ENSG00000141744		0.637	PNMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNMT	HGNC	protein_coding	OTTHUMT00000256923.2	105	0.93	1	C	NM_002686		37826537	37826537	+1	no_errors	ENST00000269582	ensembl	human	known	69_37n	nonsense	15	31.82	7	SNP	0.069	A
POLG	5428	genome.wustl.edu	37	15	89873481	89873481	+	Missense_Mutation	SNP	A	A	C	rs202088074	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr15:89873481A>C	ENST00000268124.5	-	3	1019	c.686T>G	c.(685-687)gTg>gGg	p.V229G	POLG_ENST00000525806.1_5'Flank|POLG_ENST00000442287.2_Missense_Mutation_p.V229G	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	229					aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			ACGCTCTTCCACCAGCCGCTG	0.607								DNA polymerases (catalytic subunits)																													Colon(73;648 1203 11348 18386 27782)	dbGAP											0													27.0	27.0	27.0					15																	89873481		2200	4299	6499	-	-	-	SO:0001583	missense	0			X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.686T>G	15.37:g.89873481A>C	ENSP00000268124:p.Val229Gly		Q8NFM2|Q92515	Missense_Mutation	SNP	pirsf_DNA-dir_DNA_pol_A_mt_sub,pfam_DNA-dir_DNA_pol_A_palm_dom,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_A_palm_dom,prints_DNA-dir_DNA_pol_A_mt	p.V229G	ENST00000268124.5	37	c.686	CCDS10350.1	15	.	.	.	.	.	.	.	.	.	.	A	19.49	3.836792	0.71373	.	.	ENSG00000140521	ENST00000268124;ENST00000442287	D;D	0.91351	-2.83;-2.83	5.93	4.78	0.61160	Ribonuclease H-like (1);	0.330519	0.32068	N	0.006638	D	0.88865	0.6553	L	0.61218	1.895	0.80722	D	1	B	0.12630	0.006	B	0.13407	0.009	D	0.85055	0.0931	10	0.72032	D	0.01	-26.3295	12.8506	0.57855	0.8636:0.1364:0.0:0.0	.	229	P54098	DPOG1_HUMAN	G	229	ENSP00000268124:V229G;ENSP00000399851:V229G	ENSP00000268124:V229G	V	-	2	0	POLG	87674485	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.200000	0.95010	1.024000	0.39682	0.533000	0.62120	GTG	POLG	-	pirsf_DNA-dir_DNA_pol_A_mt_sub,superfamily_RNaseH-like_dom	ENSG00000140521		0.607	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLG	HGNC	protein_coding	OTTHUMT00000312854.2	63	0.00	0	A	NM_002693		89873481	89873481	-1	no_errors	ENST00000268124	ensembl	human	known	69_37n	missense	12	53.85	14	SNP	1.000	C
POU2F1	5451	genome.wustl.edu	37	1	167343435	167343435	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr1:167343435G>C	ENST00000541643.3	+	7	586	c.424G>C	c.(424-426)Gcc>Ccc	p.A142P	POU2F1_ENST00000420254.3_Missense_Mutation_p.A142P|POU2F1_ENST00000367865.1_3'UTR|POU2F1_ENST00000452019.1_Missense_Mutation_p.A142P|POU2F1_ENST00000367862.5_Missense_Mutation_p.A154P|POU2F1_ENST00000367866.2_Missense_Mutation_p.A165P|POU2F1_ENST00000429375.2_Intron			P14859	PO2F1_HUMAN	POU class 2 homeobox 1	142					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	30						GCAGCACTCCGCCAGCCAGCA	0.602																																						dbGAP											0													21.0	22.0	22.0					1																	167343435		2201	4300	6501	-	-	-	SO:0001583	missense	0			BC001664	CCDS1259.1, CCDS1259.2, CCDS55655.1, CCDS55656.1	1q24.2	2011-06-20	2007-07-13		ENSG00000143190	ENSG00000143190		"""Homeoboxes / POU class"""	9212	protein-coding gene	gene with protein product		164175	"""POU domain class 2, transcription factor 1"""	OTF1		1887216	Standard	NM_002697		Approved	OCT1	uc001gee.3	P14859	OTTHUMG00000034436	ENST00000541643.3:c.424G>C	1.37:g.167343435G>C	ENSP00000441285:p.Ala142Pro		B1AL91|B1AL93|B4E029|J3KP77|Q5TBT7|Q6PK46|Q8NEU9|Q9BPV1	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,pfscan_Homeodomain,pfscan_POU_specific,prints_POU,prints_TF_octamer	p.A165P	ENST00000541643.3	37	c.493		1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.231714	0.79688	.	.	ENSG00000143190	ENST00000367866;ENST00000452019;ENST00000492850;ENST00000367865;ENST00000420254;ENST00000541643;ENST00000367862;ENST00000443275	T;T;T;T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09;-1.09;-1.09;-1.09	5.8	5.8	0.92144	.	2.994580	0.01147	N	0.006336	D	0.86900	0.6044	L	0.55990	1.75	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.91635	0.998;0.998;0.999;0.995	T	0.73767	-0.3879	10	0.56958	D	0.05	.	20.0589	0.97667	0.0:0.0:1.0:0.0	.	142;154;140;142	P14859-4;P14859-2;P14859-3;P14859	.;.;.;PO2F1_HUMAN	P	165;142;19;140;142;142;154;50	ENSP00000356840:A165P;ENSP00000391523:A142P;ENSP00000356839:A140P;ENSP00000414660:A142P;ENSP00000441285:A142P;ENSP00000356836:A154P;ENSP00000415993:A50P	ENSP00000356836:A154P	A	+	1	0	POU2F1	165610059	1.000000	0.71417	0.981000	0.43875	0.797000	0.45037	9.434000	0.97515	2.732000	0.93576	0.650000	0.86243	GCC	POU2F1	-	NULL	ENSG00000143190		0.602	POU2F1-203	KNOWN	basic|appris_candidate	protein_coding	POU2F1	HGNC	protein_coding		29	0.00	0	G	NM_002697		167343435	167343435	+1	no_errors	ENST00000367866	ensembl	human	known	69_37n	missense	23	51.06	24	SNP	1.000	C
PPARGC1B	133522	genome.wustl.edu	37	5	149216613	149216613	+	Silent	SNP	A	A	C	rs202032543		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr5:149216613A>C	ENST00000309241.5	+	8	2627	c.2595A>C	c.(2593-2595)tcA>tcC	p.S865S	PPARGC1B_ENST00000394320.3_Silent_p.S865S|PPARGC1B_ENST00000360453.4_Silent_p.S826S|PPARGC1B_ENST00000403750.1_Silent_p.S801S	NM_133263.3	NP_573570.3	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 beta	865					actin filament organization (GO:0007015)|bone trabecula formation (GO:0060346)|cellular lipid metabolic process (GO:0044255)|cellular response to reactive oxygen species (GO:0034614)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone resorption (GO:0045780)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of phosphorylation (GO:0042327)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transcription from mitochondrial promoter (GO:0006390)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-2 domain binding (GO:0050682)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|receptor activator activity (GO:0030546)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(2)|lung(15)|ovary(3)|prostate(2)|stomach(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			ACTCCTGGTCACCAGCCACTC	0.652																																						dbGAP											0													60.0	70.0	66.0					5																	149216613		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF468496	CCDS4298.1, CCDS54933.1, CCDS54934.1	5q33.1	2013-02-12	2006-10-17		ENSG00000155846	ENSG00000155846		"""RNA binding motif (RRM) containing"""	30022	protein-coding gene	gene with protein product		608886	"""peroxisome proliferative activated receptor, gamma, coactivator 1, beta"""			11793024, 11854298	Standard	NM_133263		Approved	PERC, PGC1B	uc003lrc.3	Q86YN6	OTTHUMG00000130055	ENST00000309241.5:c.2595A>C	5.37:g.149216613A>C			A2RUM8|A2RUN0|B3KVW0|Q86YN3|Q86YN4|Q86YN5|Q8N1N9|Q8TDE4|Q8TDE5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.T552P	ENST00000309241.5	37	c.1654	CCDS4298.1	5	.	.	.	.	.	.	.	.	.	.	A	9.535	1.111749	0.20714	.	.	ENSG00000155846	ENST00000434684	.	.	.	5.8	-1.1	0.09872	.	.	.	.	.	T	0.39279	0.1072	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35748	-0.9776	4	.	.	.	-12.3442	0.6377	0.00805	0.4011:0.1881:0.2288:0.182	.	.	.	.	P	552	.	.	T	+	1	0	PPARGC1B	149196806	0.997000	0.39634	1.000000	0.80357	0.966000	0.64601	0.351000	0.20096	0.446000	0.26666	0.379000	0.24179	ACC	PPARGC1B	-	NULL	ENSG00000155846		0.652	PPARGC1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPARGC1B	HGNC	protein_coding	OTTHUMT00000252334.1	60	0.00	0	A	NM_133263		149216613	149216613	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000434684	ensembl	human	putative	69_37n	missense	25	45.65	21	SNP	0.956	C
PRRC2B	84726	genome.wustl.edu	37	9	134353170	134353170	+	Missense_Mutation	SNP	C	C	G	rs202133452		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr9:134353170C>G	ENST00000357304.4	+	16	4501	c.4446C>G	c.(4444-4446)tgC>tgG	p.C1482W	PRRC2B_ENST00000405995.1_Missense_Mutation_p.C788W|PRRC2B_ENST00000372249.1_5'UTR|PRRC2B_ENST00000458550.1_Missense_Mutation_p.C788W	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	1482							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						TTAGTGGCTGCAGCAGTGGGA	0.597																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.4446C>G	9.37:g.134353170C>G	ENSP00000349856:p.Cys1482Trp		O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	pfam_BAT2_N	p.C1482W	ENST00000357304.4	37	c.4446	CCDS48044.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.06|11.06	1.527921|1.527921	0.27299|0.27299	.|.	.|.	ENSG00000130723|ENSG00000130723	ENST00000405995;ENST00000357304;ENST00000458550;ENST00000418650|ENST00000451855	T;T;T|.	0.02472|.	4.28;4.61;4.28|.	4.47|4.47	-0.263|-0.263	0.12954|0.12954	.|.	0.612418|.	0.11976|.	U|.	0.511260|.	T|T	0.36963|0.36963	0.0986|0.0986	N|N	0.19112|0.19112	0.55|0.55	0.43480|0.43480	D|D	0.995705|0.995705	D;D|.	0.59357|.	0.961;0.985|.	P;P|.	0.49853|.	0.54;0.624|.	T|T	0.07121|0.07121	-1.0789|-1.0789	10|5	0.48119|.	T|.	0.1|.	-47.4096|-47.4096	8.2677|8.2677	0.31824|0.31824	0.0:0.5801:0.0:0.4199|0.0:0.5801:0.0:0.4199	.|.	215;1482|.	Q5JSZ8;Q5JSZ5|.	.;PRC2B_HUMAN|.	W|E	788;1482;788;778|216	ENSP00000384606:C788W;ENSP00000349856:C1482W;ENSP00000398853:C788W|.	ENSP00000349856:C1482W|.	C|Q	+|+	3|1	2|0	PRRC2B|PRRC2B	133342991|133342991	0.020000|0.020000	0.18652|0.18652	0.332000|0.332000	0.25469|0.25469	0.395000|0.395000	0.30598|0.30598	0.116000|0.116000	0.15561|0.15561	0.086000|0.086000	0.17137|0.17137	0.561000|0.561000	0.74099|0.74099	TGC|CAG	PRRC2B	-	NULL	ENSG00000130723		0.597	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2B	HGNC	protein_coding		51	0.00	0	C			134353170	134353170	+1	no_errors	ENST00000357304	ensembl	human	known	69_37n	missense	27	52.63	30	SNP	0.168	G
RABAC1	10567	genome.wustl.edu	37	19	42463050	42463050	+	Missense_Mutation	SNP	T	T	C	rs201138159		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr19:42463050T>C	ENST00000222008.6	-	2	204	c.107A>G	c.(106-108)gAg>gGg	p.E36G	RABAC1_ENST00000601891.1_Missense_Mutation_p.E36G|RABAC1_ENST00000601078.1_5'UTR	NM_006423.2	NP_006414.2	Q9UI14	PRAF1_HUMAN	Rab acceptor 1 (prenylated)	36	Required for interaction with prenylated RAB3A and VAMP2. {ECO:0000250}.					cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|synapse (GO:0045202)	identical protein binding (GO:0042802)			central_nervous_system(1)|kidney(1)|prostate(1)	3						GCGGCGCCGCTCCAGCCACTC	0.726																																						dbGAP											0													16.0	16.0	16.0					19																	42463050		2191	4293	6484	-	-	-	SO:0001583	missense	0			AJ133534	CCDS12593.1	19q13.2	2012-09-20			ENSG00000105404	ENSG00000105404			9794	protein-coding gene	gene with protein product	"""PRA1 domain family 1"", ""prenylated Rab acceptor 1"""	604925				10329441, 10751420	Standard	NM_006423		Approved	PRA1, PRAF1, YIP3	uc002osf.3	Q9UI14		ENST00000222008.6:c.107A>G	19.37:g.42463050T>C	ENSP00000222008:p.Glu36Gly		Q7Z4Y2|Q9Y3R1	Missense_Mutation	SNP	pfam_Prenylated_rab_accept_PRA1	p.E36G	ENST00000222008.6	37	c.107	CCDS12593.1	19	.	.	.	.	.	.	.	.	.	.	T	18.13	3.554365	0.65425	.	.	ENSG00000105404	ENST00000222008	T	0.44083	0.93	4.34	4.34	0.51931	.	0.248767	0.39146	N	0.001456	T	0.22859	0.0552	N	0.04880	-0.145	0.44110	D	0.996881	B	0.09022	0.002	B	0.13407	0.009	T	0.05683	-1.0870	10	0.41790	T	0.15	-9.1739	11.7869	0.52047	0.0:0.0:0.0:1.0	.	36	Q9UI14	PRAF1_HUMAN	G	36	ENSP00000222008:E36G	ENSP00000222008:E36G	E	-	2	0	RABAC1	47154890	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.325000	0.65869	1.953000	0.56701	0.459000	0.35465	GAG	RABAC1	-	pfam_Prenylated_rab_accept_PRA1	ENSG00000105404		0.726	RABAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABAC1	HGNC	protein_coding	OTTHUMT00000463388.1	67	0.00	0	T	NM_006423		42463050	42463050	-1	no_errors	ENST00000222008	ensembl	human	known	69_37n	missense	6	70.00	14	SNP	1.000	C
RPH3A	22895	genome.wustl.edu	37	12	113307580	113307580	+	Silent	SNP	G	G	A			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	bf856604-4326-4145-bc3c-137098338f61	g.chr12:113307580G>A	ENST00000389385.4	+	9	1124	c.627G>A	c.(625-627)agG>agA	p.R209R	RPH3A_ENST00000447659.2_Silent_p.R160R|RPH3A_ENST00000551052.1_Silent_p.R205R|RPH3A_ENST00000415485.3_Silent_p.R209R|RPH3A_ENST00000543106.2_Silent_p.R209R|RPH3A_ENST00000420983.2_Silent_p.R209R|RPH3A_ENST00000548866.1_Silent_p.R160R|RPH3A_ENST00000549913.2_3'UTR	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	209	Pro-rich.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		GTGAAGATAGGAGGGGCCCGG	0.458																																						dbGAP											0													114.0	121.0	119.0					12																	113307580		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.627G>A	12.37:g.113307580G>A			B7Z3C3|Q96AE0	Silent	SNP	pfam_C2_Ca-dep,pfam_Rabphilin3A_effector_Zn-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Znf_FYVE_PHD,smart_C2_Ca-dep,prints_Synaptotagmin,prints_C2_dom,pfscan_C2_membr_targeting,pfscan_Rab-bd_domain,pfscan_Znf_FYVE-rel	p.R209	ENST00000389385.4	37	c.627	CCDS44979.1	12																																																																																			RPH3A	-	NULL	ENSG00000089169		0.458	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPH3A	HGNC	protein_coding	OTTHUMT00000405561.1	304	0.33	1	G	NM_014954		113307580	113307580	+1	no_errors	ENST00000389385	ensembl	human	known	69_37n	silent	227	31.63	105	SNP	1.000	A
RPH3A	22895	genome.wustl.edu	37	12	113307580	113307580	+	Silent	SNP	G	G	A			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr12:113307580G>A	ENST00000389385.4	+	9	1124	c.627G>A	c.(625-627)agG>agA	p.R209R	RPH3A_ENST00000447659.2_Silent_p.R160R|RPH3A_ENST00000551052.1_Silent_p.R205R|RPH3A_ENST00000415485.3_Silent_p.R209R|RPH3A_ENST00000543106.2_Silent_p.R209R|RPH3A_ENST00000420983.2_Silent_p.R209R|RPH3A_ENST00000548866.1_Silent_p.R160R|RPH3A_ENST00000549913.2_3'UTR	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	209	Pro-rich.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		GTGAAGATAGGAGGGGCCCGG	0.458																																						dbGAP											0													114.0	121.0	119.0					12																	113307580		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.627G>A	12.37:g.113307580G>A			B7Z3C3|Q96AE0	Silent	SNP	pfam_C2_Ca-dep,pfam_Rabphilin3A_effector_Zn-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Znf_FYVE_PHD,smart_C2_Ca-dep,prints_Synaptotagmin,prints_C2_dom,pfscan_C2_membr_targeting,pfscan_Rab-bd_domain,pfscan_Znf_FYVE-rel	p.R209	ENST00000389385.4	37	c.627	CCDS44979.1	12																																																																																			RPH3A	-	NULL	ENSG00000089169		0.458	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPH3A	HGNC	protein_coding	OTTHUMT00000405561.1	40	0.00	0	G	NM_014954		113307580	113307580	+1	no_errors	ENST00000389385	ensembl	human	known	69_37n	silent	227	31.63	105	SNP	1.000	A
RPLP0	6175	genome.wustl.edu	37	12	120634697	120634697	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr12:120634697G>C	ENST00000551150.1	-	7	1148	c.833C>G	c.(832-834)gCt>gGt	p.A278G	RPLP0_ENST00000550296.1_5'Flank|RPLP0_ENST00000313104.5_Missense_Mutation_p.A216G|RPLP0_ENST00000228306.4_Missense_Mutation_p.A278G|RPLP0_ENST00000392514.4_Missense_Mutation_p.A278G|GCN1L1_ENST00000300648.6_5'Flank|RPLP0_ENST00000546989.1_Missense_Mutation_p.A242G|RPLP0_ENST00000552292.1_Missense_Mutation_p.A68G			P05388	RLA0_HUMAN	ribosomal protein, large, P0	278					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosome biogenesis (GO:0042254)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					cacaggggcagcagcCACAAA	0.582																																						dbGAP											0													31.0	32.0	32.0					12																	120634697		2038	4025	6063	-	-	-	SO:0001583	missense	0			AB007187	CCDS9193.1	12q24.2	2011-07-29			ENSG00000089157	ENSG00000089157		"""L ribosomal proteins"""	10371	protein-coding gene	gene with protein product	"""acidic ribosomal phosphoprotein P0"""	180510				9582194	Standard	NM_053275		Approved	PRLP0, P0, L10E, RPP0, LP0	uc001txq.3	P05388	OTTHUMG00000169317	ENST00000551150.1:c.833C>G	12.37:g.120634697G>C	ENSP00000449328:p.Ala278Gly		Q3B7A4|Q9BVK4	Missense_Mutation	SNP	pfam_Ribosomal_L10/acidic_P0,pfam_Ribosomal_60S	p.A278G	ENST00000551150.1	37	c.833	CCDS9193.1	12	.	.	.	.	.	.	.	.	.	.	G	19.54	3.846175	0.71603	.	.	ENSG00000089157	ENST00000392514;ENST00000551150;ENST00000552292;ENST00000313104;ENST00000546989;ENST00000228306;ENST00000546990	.	.	.	5.67	5.67	0.87782	.	0.193120	0.32273	U	0.006335	T	0.68943	0.3056	M	0.75615	2.305	0.80722	D	1	P;P	0.46064	0.872;0.697	B;B	0.43754	0.43;0.43	T	0.74147	-0.3759	9	0.72032	D	0.01	.	19.3832	0.94545	0.0:0.0:1.0:0.0	.	216;278	Q3B7A4;P05388	.;RLA0_HUMAN	G	278;278;68;216;242;278;229	.	ENSP00000339027:A278G	A	-	2	0	RPLP0	119119080	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.507000	0.97996	2.687000	0.91594	0.655000	0.94253	GCT	RPLP0	-	pfam_Ribosomal_60S	ENSG00000089157		0.582	RPLP0-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RPLP0	HGNC	protein_coding	OTTHUMT00000403448.3	76	0.00	0	G	NM_053275		120634697	120634697	-1	no_errors	ENST00000228306	ensembl	human	known	69_37n	missense	8	82.22	37	SNP	1.000	C
RPLP0P2	113157	genome.wustl.edu	37	11	61404984	61404984	+	RNA	SNP	C	C	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr11:61404984C>G	ENST00000496593.1	+	0	1588					NR_002775.2				ribosomal protein, large, P0 pseudogene 2																		TTTGTGGCTGCAGCCCCTGTG	0.572																																						dbGAP											0																																										-	-	-			0			BC010523		11q12.2	2014-08-07			ENSG00000243742	ENSG00000243742		"""L ribosomal proteins"""	17960	pseudogene	pseudogene						19123937, 25089627	Standard	NR_002775		Approved		uc001nrz.1		OTTHUMG00000158396		11.37:g.61404984C>G				RNA	SNP	-	NULL	ENST00000496593.1	37	NULL		11																																																																																			RPLP0P2	-	-	ENSG00000243742		0.572	RPLP0P2-002	KNOWN	basic	processed_transcript	RPLP0P2	HGNC	pseudogene	OTTHUMT00000350911.1	73	0.00	0	C	NR_002775		61404984	61404984	+1	no_errors	ENST00000496593	ensembl	human	known	69_37n	rna	33	37.74	20	SNP	0.907	G
RRBP1	6238	genome.wustl.edu	37	20	17640580	17640580	+	Silent	SNP	T	T	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr20:17640580T>G	ENST00000377813.1	-	3	876	c.573A>C	c.(571-573)acA>acC	p.T191T	RRBP1_ENST00000455029.2_Intron|RRBP1_ENST00000360807.4_Intron|RRBP1_ENST00000246043.4_Silent_p.T191T|RRBP1_ENST00000377807.2_Intron			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	191					osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						CAGTGGCTGGTGTGTTGCCCT	0.572																																						dbGAP											0													21.0	18.0	19.0					20																	17640580		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.573A>C	20.37:g.17640580T>G			A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Silent	SNP	pfam_Rib_rcpt_KP,superfamily_Ribosome_recyc_fac_dom	p.T191	ENST00000377813.1	37	c.573		20																																																																																			RRBP1	-	NULL	ENSG00000125844		0.572	RRBP1-002	NOVEL	basic	protein_coding	RRBP1	HGNC	protein_coding	OTTHUMT00000078125.1	72	0.00	0	T	NM_001042576		17640580	17640580	-1	no_errors	ENST00000246043	ensembl	human	known	69_37n	silent	25	74.00	74	SNP	0.000	G
RRP1	8568	genome.wustl.edu	37	21	45223490	45223490	+	Silent	SNP	T	T	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr21:45223490T>G	ENST00000497547.1	+	13	1338	c.1221T>G	c.(1219-1221)ggT>ggG	p.G407G	AP001053.11_ENST00000400385.2_RNA|AP001053.11_ENST00000448247.1_RNA|RRP1_ENST00000471909.1_3'UTR|AP001053.11_ENST00000437258.1_RNA	NM_003683.5	NP_003674.1	P05386	RLA1_HUMAN	ribosomal RNA processing 1	0					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|kidney(1)|lung(4)|stomach(2)	8				COAD - Colon adenocarcinoma(84;0.00753)|Colorectal(79;0.0157)|STAD - Stomach adenocarcinoma(101;0.171)		CAGAGGCTGGTGAGCAGCCAG	0.706																																						dbGAP											0													7.0	10.0	9.0					21																	45223490		1925	4015	5940	-	-	-	SO:0001819	synonymous_variant	0			U79775	CCDS42951.1	21q22.3	2013-07-02	2013-07-02		ENSG00000160214	ENSG00000160214			18785	protein-coding gene	gene with protein product	"""DNA segment on chromosome 21 (unique) 2056 expressed sequence"", ""Nnp1 homolog, nucleolar protein (Drosophila)"""	610653	"""ribosomal RNA processing 1 homolog (S. cerevisiae)"""			10830953, 10341208	Standard	NM_003683		Approved	NNP-1, Nop52, NOP52, RRP1A, D21S2056E	uc002zds.2	P56182	OTTHUMG00000086884	ENST00000497547.1:c.1221T>G	21.37:g.45223490T>G			A6NIB2	Silent	SNP	pfam_Nop52	p.G407	ENST00000497547.1	37	c.1221	CCDS42951.1	21																																																																																			RRP1	-	NULL	ENSG00000160214		0.706	RRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRP1	HGNC	protein_coding	OTTHUMT00000195680.1	60	0.00	0	T	NM_003683		45223490	45223490	+1	no_errors	ENST00000497547	ensembl	human	known	69_37n	silent	14	39.13	9	SNP	0.000	G
RUNX3	864	genome.wustl.edu	37	1	25228963	25228963	+	Missense_Mutation	SNP	T	T	G	rs202015637	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr1:25228963T>G	ENST00000308873.6	-	5	906	c.898A>C	c.(898-900)Acc>Ccc	p.T300P	RUNX3_ENST00000338888.3_Missense_Mutation_p.T314P|RUNX3_ENST00000496967.1_5'Flank|RUNX3_ENST00000540420.1_Missense_Mutation_p.T207P|RUNX3_ENST00000399916.1_Missense_Mutation_p.T314P	NM_004350.2	NP_004341.1	Q13761	RUNX3_HUMAN	runt-related transcription factor 3	300	Pro/Ser/Thr-rich.				axon guidance (GO:0007411)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|hair follicle morphogenesis (GO:0031069)|interferon-gamma production (GO:0032609)|negative regulation of cell cycle (GO:0045786)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peripheral nervous system neuron development (GO:0048935)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(3)	18		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00131)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.85e-26)|Colorectal(126;4.35e-08)|COAD - Colon adenocarcinoma(152;1.92e-06)|GBM - Glioblastoma multiforme(114;0.000102)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00148)|BRCA - Breast invasive adenocarcinoma(304;0.00173)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.136)		AAGCGGCTGGTGGCCGGCATG	0.692																																						dbGAP											0													23.0	32.0	29.0					1																	25228963		2190	4284	6474	-	-	-	SO:0001583	missense	0			BC013362	CCDS257.1, CCDS30633.1	1p36	2008-02-05			ENSG00000020633	ENSG00000020633			10473	protein-coding gene	gene with protein product		600210		CBFA3		7835892	Standard	NM_001031680		Approved	AML2, PEBP2A3	uc001bjq.3	Q13761	OTTHUMG00000003316	ENST00000308873.6:c.898A>C	1.37:g.25228963T>G	ENSP00000308051:p.Thr300Pro		B1AJV5|Q12969|Q13760	Missense_Mutation	SNP	pfam_AML1/Runt_N,pfam_RunxI,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,prints_AML1_Runt,pfscan_AML1/Runt_N	p.T314P	ENST00000308873.6	37	c.940	CCDS257.1	1	.	.	.	.	.	.	.	.	.	.	T	14.19	2.462043	0.43736	.	.	ENSG00000020633	ENST00000399916;ENST00000308873;ENST00000338888;ENST00000540420;ENST00000428150	D;D;D;D	0.97209	-4.29;-4.28;-4.29;-3.92	4.1	-2.23	0.06930	.	0.769944	0.11406	N	0.567256	D	0.93298	0.7864	L	0.32530	0.975	0.27329	N	0.956815	B;B;B	0.27559	0.078;0.09;0.181	B;B;B	0.32533	0.147;0.039;0.057	D	0.85470	0.1172	10	0.31617	T	0.26	-9.9339	11.178	0.48612	0.0:0.463:0.0:0.537	.	247;314;300	E9PH34;B1AJV5;Q13761	.;.;RUNX3_HUMAN	P	314;300;314;207;247	ENSP00000382800:T314P;ENSP00000308051:T300P;ENSP00000343477:T314P;ENSP00000444872:T207P	ENSP00000308051:T300P	T	-	1	0	RUNX3	25101550	0.995000	0.38212	0.985000	0.45067	0.991000	0.79684	0.284000	0.18864	-0.278000	0.09180	0.374000	0.22700	ACC	RUNX3	-	pirsf_TF_Runt-rel_RUNX	ENSG00000020633		0.692	RUNX3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RUNX3	HGNC	protein_coding	OTTHUMT00000009284.1	31	0.00	0	T	NM_004350		25228963	25228963	-1	no_errors	ENST00000338888	ensembl	human	known	69_37n	missense	9	60.87	14	SNP	0.988	G
RXFP3	51289	genome.wustl.edu	37	5	33937028	33937028	+	Silent	SNP	G	G	A			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr5:33937028G>A	ENST00000330120.3	+	1	538	c.183G>A	c.(181-183)ccG>ccA	p.P61P		NM_016568.3	NP_057652.1	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	61					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|G-protein coupled receptor activity (GO:0004930)			endometrium(4)|large_intestine(9)|lung(24)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)	42						ACGGCGCGCCGCCAGGACATC	0.701																																						dbGAP											0													47.0	61.0	56.0					5																	33937028		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			D88437	CCDS3900.1	5p15.1-p14	2012-08-08	2006-05-09	2006-03-15	ENSG00000182631	ENSG00000182631		"""GPCR / Class A : Relaxin family peptide receptors"""	24883	protein-coding gene	gene with protein product		609445	"""relaxin 3 receptor 1"", ""relaxin family peptide receptor 3"""	RLN3R1		15956688, 16507880	Standard	NM_016568		Approved	SALPR, GPCR135, RXFPR3	uc003jic.2	Q9NSD7	OTTHUMG00000090685	ENST00000330120.3:c.183G>A	5.37:g.33937028G>A			Q14DA5	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Frt_met_rcpt	p.P61	ENST00000330120.3	37	c.183	CCDS3900.1	5																																																																																			RXFP3	-	NULL	ENSG00000182631		0.701	RXFP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RXFP3	HGNC	protein_coding	OTTHUMT00000207369.1	37	0.00	0	G	NM_016568		33937028	33937028	+1	no_errors	ENST00000330120	ensembl	human	known	69_37n	silent	62	30.34	27	SNP	0.875	A
RYR3	6263	genome.wustl.edu	37	15	33923486	33923486	+	Silent	SNP	G	G	T			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	bf856604-4326-4145-bc3c-137098338f61	g.chr15:33923486G>T	ENST00000389232.4	+	23	2929	c.2859G>T	c.(2857-2859)ctG>ctT	p.L953L	RYR3_ENST00000415757.3_Silent_p.L953L	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	953	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AGGTCAAACTGCCCAAAAAGT	0.463																																						dbGAP											0													71.0	68.0	69.0					15																	33923486		1868	4106	5974	-	-	-	SO:0001819	synonymous_variant	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.2859G>T	15.37:g.33923486G>T			O15175|Q15412	Silent	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.L953	ENST00000389232.4	37	c.2859	CCDS45210.1	15																																																																																			RYR3	-	NULL	ENSG00000198838		0.463	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	373	0.00	0	G			33923486	33923486	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	silent	319	26.21	114	SNP	0.982	T
RYR3	6263	genome.wustl.edu	37	15	33923486	33923486	+	Silent	SNP	G	G	T			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr15:33923486G>T	ENST00000389232.4	+	23	2929	c.2859G>T	c.(2857-2859)ctG>ctT	p.L953L	RYR3_ENST00000415757.3_Silent_p.L953L	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	953	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AGGTCAAACTGCCCAAAAAGT	0.463																																						dbGAP											0													71.0	68.0	69.0					15																	33923486		1868	4106	5974	-	-	-	SO:0001819	synonymous_variant	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.2859G>T	15.37:g.33923486G>T			O15175|Q15412	Silent	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.L953	ENST00000389232.4	37	c.2859	CCDS45210.1	15																																																																																			RYR3	-	NULL	ENSG00000198838		0.463	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	35	0.00	0	G			33923486	33923486	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	silent	319	26.21	114	SNP	0.982	T
SEC14L1	6397	genome.wustl.edu	37	17	75210067	75210067	+	Missense_Mutation	SNP	T	T	C	rs200789514		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr17:75210067T>C	ENST00000413679.2	+	17	2413	c.2110T>C	c.(2110-2112)Tcc>Ccc	p.S704P	SEC14L1_ENST00000591437.1_Missense_Mutation_p.S670P|SEC14L1_ENST00000430767.4_Missense_Mutation_p.S704P|SEC14L1_ENST00000431431.2_Missense_Mutation_p.S670P|SEC14L1_ENST00000585618.1_Missense_Mutation_p.S704P|SEC14L1_ENST00000392476.2_Missense_Mutation_p.S704P|SEC14L1_ENST00000436233.4_Missense_Mutation_p.S704P|SEC14L1_ENST00000443798.4_Missense_Mutation_p.S704P	NM_001143998.1|NM_001143999.1|NM_003003.3	NP_001137470|NP_001137471|NP_002994	Q92503	S14L1_HUMAN	SEC14-like 1 (S. cerevisiae)	704					transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(2)	31						CACCACCTCCTCCAGCCAGTC	0.667																																						dbGAP											0													66.0	60.0	62.0					17																	75210067		2203	4299	6502	-	-	-	SO:0001583	missense	0			D67029	CCDS11752.1, CCDS42385.1, CCDS45789.1	17q25.2	2008-02-01	2001-11-28			ENSG00000129657			10698	protein-coding gene	gene with protein product		601504	"""SEC14 (S. cerevisiae)-like 1"""	SEC14L		8697811	Standard	NM_001143998		Approved	PRELID4A	uc002jto.3	Q92503		ENST00000413679.2:c.2110T>C	17.37:g.75210067T>C	ENSP00000394716:p.Ser704Pro		A8K4E8|B4DDI5|D5G3K1|Q99780	Missense_Mutation	SNP	pfam_PRELI/MSF1,pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,superfamily_GOLD,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_GOLD,pfscan_PRELI/MSF1	p.S704P	ENST00000413679.2	37	c.2110	CCDS11752.1	17	.	.	.	.	.	.	.	.	.	.	T	22.2	4.260986	0.80246	.	.	ENSG00000129657	ENST00000392476;ENST00000443798;ENST00000436233;ENST00000430767;ENST00000413679;ENST00000431431	T;T;T;T;T;T	0.75367	-0.81;-0.81;-0.8;-0.8;-0.8;-0.93	4.61	4.61	0.57282	.	0.061993	0.64402	D	0.000003	T	0.80894	0.4711	M	0.72479	2.2	0.48135	D	0.999592	D;D	0.64830	0.994;0.99	P;P	0.54759	0.76;0.58	D	0.83674	0.0168	10	0.72032	D	0.01	-35.0755	13.3232	0.60444	0.0:0.0:0.0:1.0	.	704;704	Q92503-2;Q92503	.;S14L1_HUMAN	P	704;704;704;704;704;670	ENSP00000376268:S704P;ENSP00000406030:S704P;ENSP00000390392:S704P;ENSP00000408169:S704P;ENSP00000394716:S704P;ENSP00000389838:S670P	ENSP00000376268:S704P	S	+	1	0	SEC14L1	72721662	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	7.390000	0.79816	1.906000	0.55180	0.379000	0.24179	TCC	SEC14L1	-	NULL	ENSG00000129657		0.667	SEC14L1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	SEC14L1	HGNC	protein_coding	OTTHUMT00000436240.1	142	0.70	1	T	NM_003003		75210067	75210067	+1	no_errors	ENST00000392476	ensembl	human	known	69_37n	missense	34	38.18	21	SNP	1.000	C
SELL	6402	genome.wustl.edu	37	1	169677594	169677594	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr1:169677594C>G	ENST00000236147.4	-	3	635	c.475G>C	c.(475-477)Gcc>Ccc	p.A159P	C1orf112_ENST00000498289.1_Intron|SELL_ENST00000463108.1_5'UTR	NM_000655.4	NP_000646.2	P14151	LYAM1_HUMAN	selectin L	146	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|regulation of immune response (GO:0050776)|response to ATP (GO:0033198)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|protease binding (GO:0002020)	p.A146S(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	15	all_hematologic(923;0.208)					TTGTGGCAGGCGTCATCGTTC	0.502																																						dbGAP											1	Substitution - Missense(1)	lung(1)											87.0	86.0	86.0					1																	169677594		1993	4166	6159	-	-	-	SO:0001583	missense	0			M25280	CCDS53427.1	1q23-q25	2008-07-31	2008-07-31		ENSG00000188404	ENSG00000188404		"""CD molecules"""	10720	protein-coding gene	gene with protein product		153240	"""lymphocyte adhesion molecule 1"""	LYAM1, LNHR		2664786, 1375831	Standard	NR_029467		Approved	LSEL, LAM1, LAM-1, hLHRc, Leu-8, Lyam-1, PLNHR, CD62L	uc001ggk.3	P14151	OTTHUMG00000034809	ENST00000236147.4:c.475G>C	1.37:g.169677594C>G	ENSP00000236147:p.Ala159Pro		B2R6Q8|P15023|Q9UJ43	Missense_Mutation	SNP	pirsf_L-selectin,pfam_C-type_lectin,pfam_Sushi_SCR_CCP,pfam_EGF-like_dom,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_C-type_lectin,smart_EGF-like,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Sushi_SCR_CCP,prints_Selectin_superfamily	p.A159P	ENST00000236147.4	37	c.475	CCDS53427.1	1	.	.	.	.	.	.	.	.	.	.	C	10.84	1.463308	0.26248	.	.	ENSG00000188404	ENST00000236147	T	0.17854	2.25	5.61	-2.88	0.05682	C-type lectin fold (1);C-type lectin, conserved site (1);C-type lectin-like (1);C-type lectin (3);	0.754969	0.11705	N	0.537496	T	0.05593	0.0147	N	0.01446	-0.86	0.09310	N	1	D;D	0.76494	0.998;0.999	D;D	0.83275	0.995;0.996	T	0.39375	-0.9617	10	0.31617	T	0.26	-7.434	11.6427	0.51242	0.6651:0.2654:0.0:0.0695	.	159;146	Q8WW79;P14151	.;LYAM1_HUMAN	P	159	ENSP00000236147:A159P	ENSP00000236147:A159P	A	-	1	0	SELL	167944218	0.000000	0.05858	0.024000	0.17045	0.612000	0.37316	-1.688000	0.01925	-0.282000	0.09128	0.650000	0.86243	GCC	SELL	-	pirsf_L-selectin,pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000188404		0.502	SELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SELL	HGNC	protein_coding	OTTHUMT00000084233.1	128	0.00	0	C	NM_000655		169677594	169677594	-1	no_errors	ENST00000236147	ensembl	human	known	69_37n	missense	100	38.27	62	SNP	0.000	G
SEMA3F	6405	genome.wustl.edu	37	3	50224126	50224126	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr3:50224126C>A	ENST00000002829.3	+	18	2378	c.1894C>A	c.(1894-1896)Caa>Aaa	p.Q632K	SEMA3F_ENST00000413852.1_Missense_Mutation_p.Q533K|SEMA3F_ENST00000434342.1_Missense_Mutation_p.Q601K	NM_004186.3	NP_004177.3	Q13275	SEM3F_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F	632	Ig-like C2-type.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|negative regulation of axon extension involved in axon guidance (GO:0048843)|nerve development (GO:0021675)|neural crest cell migration (GO:0001755)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	extracellular space (GO:0005615)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|receptor activity (GO:0004872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	17				BRCA - Breast invasive adenocarcinoma(193;0.00013)|KIRC - Kidney renal clear cell carcinoma(197;0.00599)|Kidney(197;0.00688)		CCGCTCGCCCCAAGCCACTGT	0.627																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			U33920	CCDS2811.1	3p21.3	2013-01-11			ENSG00000001617	ENSG00000001617		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10728	protein-coding gene	gene with protein product	"""sema IV"""	601124				8786119, 8649831	Standard	NM_004186		Approved	SEMAK, Sema4	uc003cyj.3	Q13275	OTTHUMG00000156806	ENST00000002829.3:c.1894C>A	3.37:g.50224126C>A	ENSP00000002829:p.Gln632Lys		C9JQ85|Q13274|Q13372|Q15704|Q6GTR4	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Ig_sub,smart_Ig_sub2,pfscan_Semaphorin/CD100_Ag,pfscan_Ig-like	p.Q632K	ENST00000002829.3	37	c.1894	CCDS2811.1	3	.	.	.	.	.	.	.	.	.	.	C	24.9	4.577267	0.86645	.	.	ENSG00000001617	ENST00000413852;ENST00000002829;ENST00000434342	T;T;T	0.01505	4.82;4.82;4.82	5.89	5.89	0.94794	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.101272	0.64402	D	0.000001	T	0.04770	0.0129	M	0.80847	2.515	0.51767	D	0.999931	P;B	0.37548	0.599;0.212	B;B	0.32465	0.146;0.114	T	0.15206	-1.0445	10	0.66056	D	0.02	.	19.8722	0.96854	0.0:1.0:0.0:0.0	.	601;632	C9JQ85;Q13275	.;SEM3F_HUMAN	K	533;632;601	ENSP00000388931:Q533K;ENSP00000002829:Q632K;ENSP00000409859:Q601K	ENSP00000002829:Q632K	Q	+	1	0	SEMA3F	50199130	1.000000	0.71417	0.994000	0.49952	0.825000	0.46686	7.665000	0.83852	2.793000	0.96121	0.655000	0.94253	CAA	SEMA3F	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000001617		0.627	SEMA3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3F	HGNC	protein_coding	OTTHUMT00000345929.1	74	0.00	0	C	NM_004186		50224126	50224126	+1	no_errors	ENST00000002829	ensembl	human	known	69_37n	missense	40	32.20	19	SNP	1.000	A
SEMA7A	8482	genome.wustl.edu	37	15	74703050	74703050	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr15:74703050T>G	ENST00000261918.4	-	14	2464	c.1916A>C	c.(1915-1917)cAc>cCc	p.H639P	SEMA7A_ENST00000542748.1_Missense_Mutation_p.H474P|SEMA7A_ENST00000543145.2_Missense_Mutation_p.H625P	NM_003612.3	NP_003603.1	O75326	SEM7A_HUMAN	semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group)	639					axon extension (GO:0048675)|axon guidance (GO:0007411)|immune response (GO:0006955)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|olfactory lobe development (GO:0021988)|osteoblast differentiation (GO:0001649)|positive regulation of axon extension (GO:0045773)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of protein phosphorylation (GO:0001934)|regulation of inflammatory response (GO:0050727)	anchored component of membrane (GO:0031225)|external side of plasma membrane (GO:0009897)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(3)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(3)|lung(12)|upper_aerodigestive_tract(1)	30						ACCCAGCAGGTGCTCGGCCAT	0.677																																						dbGAP											0													38.0	40.0	39.0					15																	74703050		2197	4296	6493	-	-	-	SO:0001583	missense	0			AF069493	CCDS10262.1, CCDS53958.1, CCDS53959.1	15q22.3-q23	2014-07-18	2006-02-23		ENSG00000138623	ENSG00000138623		"""Semaphorins"", ""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10741	protein-coding gene	gene with protein product	"""John Milton Hagen blood group"", ""H-Sema K1"""	607961	"""sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A"", ""sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A (JMH blood group)"""	SEMAL		9721204	Standard	NM_003612		Approved	H-Sema-L, CD108	uc002axv.3	O75326	OTTHUMG00000139000	ENST00000261918.4:c.1916A>C	15.37:g.74703050T>G	ENSP00000261918:p.His639Pro		B4DDP7|F5H1S0|Q1XE81|Q1XE82|Q1XE83|Q1XE84|Q3MIY5	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,pfscan_Semaphorin/CD100_Ag,pfscan_Ig-like	p.H639P	ENST00000261918.4	37	c.1916	CCDS10262.1	15	.	.	.	.	.	.	.	.	.	.	T	4.978	0.181634	0.09495	.	.	ENSG00000138623	ENST00000261918;ENST00000543145;ENST00000542748	T;T;T	0.20332	2.09;2.08;2.29	4.55	4.55	0.56014	.	1.114660	0.06858	N	0.798584	T	0.15262	0.0368	N	0.19112	0.55	0.09310	N	1	B;B	0.29955	0.263;0.171	B;B	0.28849	0.095;0.044	T	0.22417	-1.0217	10	0.27082	T	0.32	-15.4447	8.9433	0.35742	0.0:0.0:0.2517:0.7483	.	625;639	F5H1S0;O75326	.;SEM7A_HUMAN	P	639;625;474	ENSP00000261918:H639P;ENSP00000438966:H625P;ENSP00000441493:H474P	ENSP00000261918:H639P	H	-	2	0	SEMA7A	72490103	0.467000	0.25831	0.126000	0.21872	0.161000	0.22273	1.699000	0.37804	1.702000	0.51228	0.454000	0.30748	CAC	SEMA7A	-	NULL	ENSG00000138623		0.677	SEMA7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA7A	HGNC	protein_coding	OTTHUMT00000272904.3	116	0.84	1	T	NM_003612		74703050	74703050	-1	no_errors	ENST00000261918	ensembl	human	known	69_37n	missense	21	43.90	18	SNP	0.086	G
SHKBP1	92799	genome.wustl.edu	37	19	41092756	41092756	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	bf856604-4326-4145-bc3c-137098338f61	g.chr19:41092756G>T	ENST00000291842.5	+	13	1291	c.1242G>T	c.(1240-1242)gaG>gaT	p.E414D	SHKBP1_ENST00000597649.1_3'UTR|SHKBP1_ENST00000600733.1_Missense_Mutation_p.E389D	NM_138392.3	NP_612401.2	Q8TBC3	SHKB1_HUMAN	SH3KBP1 binding protein 1	414					protein homooligomerization (GO:0051260)					breast(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(3)|urinary_tract(1)	29			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGCACCCGGAGACTGTGGGCT	0.622																																						dbGAP											0													93.0	91.0	92.0					19																	41092756		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF258553	CCDS12560.1	19q13.2	2013-01-10				ENSG00000160410		"""WD repeat domain containing"""	19214	protein-coding gene	gene with protein product						11152963	Standard	NM_138392		Approved	PP203, Sb1	uc002oob.3	Q8TBC3		ENST00000291842.5:c.1242G>T	19.37:g.41092756G>T	ENSP00000291842:p.Glu414Asp		Q8N2I6|Q8WY93|Q96IB8	Missense_Mutation	SNP	pfam_T1-type_BTB,pfam_WD40_repeat,superfamily_BTB/POZ_fold,superfamily_WD40_repeat_dom,smart_BTB/POZ-like,smart_WD40_repeat,pfscan_BTB/POZ-like	p.E414D	ENST00000291842.5	37	c.1242	CCDS12560.1	19	.	.	.	.	.	.	.	.	.	.	G	23.9	4.469548	0.84533	.	.	ENSG00000160410	ENST00000291842	T	0.60040	0.22	4.83	2.57	0.30868	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.68081	0.2962	M	0.85859	2.78	0.58432	D	0.999998	P;P;P;B;P	0.51147	0.942;0.919;0.919;0.256;0.93	P;P;P;B;P	0.55824	0.785;0.633;0.633;0.086;0.584	T	0.69862	-0.5030	10	0.87932	D	0	-21.0734	5.0487	0.14497	0.3777:0.0:0.6223:0.0	.	292;337;251;414;414	B4DLI0;B4DUV2;B3KVX8;B2R6W9;Q8TBC3	.;.;.;.;SHKB1_HUMAN	D	414	ENSP00000291842:E414D	ENSP00000291842:E414D	E	+	3	2	SHKBP1	45784596	1.000000	0.71417	0.967000	0.41034	0.978000	0.69477	1.253000	0.32886	1.253000	0.44018	0.563000	0.77884	GAG	SHKBP1	-	superfamily_WD40_repeat_dom	ENSG00000160410		0.622	SHKBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHKBP1	HGNC	protein_coding	OTTHUMT00000462613.2	78	0.00	0	G	NM_138392		41092756	41092756	+1	no_errors	ENST00000291842	ensembl	human	known	69_37n	missense	54	33.33	27	SNP	1.000	T
SHKBP1	92799	genome.wustl.edu	37	19	41092756	41092756	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr19:41092756G>T	ENST00000291842.5	+	13	1291	c.1242G>T	c.(1240-1242)gaG>gaT	p.E414D	SHKBP1_ENST00000597649.1_3'UTR|SHKBP1_ENST00000600733.1_Missense_Mutation_p.E389D	NM_138392.3	NP_612401.2	Q8TBC3	SHKB1_HUMAN	SH3KBP1 binding protein 1	414					protein homooligomerization (GO:0051260)					breast(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(3)|urinary_tract(1)	29			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGCACCCGGAGACTGTGGGCT	0.622																																						dbGAP											0													93.0	91.0	92.0					19																	41092756		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF258553	CCDS12560.1	19q13.2	2013-01-10				ENSG00000160410		"""WD repeat domain containing"""	19214	protein-coding gene	gene with protein product						11152963	Standard	NM_138392		Approved	PP203, Sb1	uc002oob.3	Q8TBC3		ENST00000291842.5:c.1242G>T	19.37:g.41092756G>T	ENSP00000291842:p.Glu414Asp		Q8N2I6|Q8WY93|Q96IB8	Missense_Mutation	SNP	pfam_T1-type_BTB,pfam_WD40_repeat,superfamily_BTB/POZ_fold,superfamily_WD40_repeat_dom,smart_BTB/POZ-like,smart_WD40_repeat,pfscan_BTB/POZ-like	p.E414D	ENST00000291842.5	37	c.1242	CCDS12560.1	19	.	.	.	.	.	.	.	.	.	.	G	23.9	4.469548	0.84533	.	.	ENSG00000160410	ENST00000291842	T	0.60040	0.22	4.83	2.57	0.30868	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.68081	0.2962	M	0.85859	2.78	0.58432	D	0.999998	P;P;P;B;P	0.51147	0.942;0.919;0.919;0.256;0.93	P;P;P;B;P	0.55824	0.785;0.633;0.633;0.086;0.584	T	0.69862	-0.5030	10	0.87932	D	0	-21.0734	5.0487	0.14497	0.3777:0.0:0.6223:0.0	.	292;337;251;414;414	B4DLI0;B4DUV2;B3KVX8;B2R6W9;Q8TBC3	.;.;.;.;SHKB1_HUMAN	D	414	ENSP00000291842:E414D	ENSP00000291842:E414D	E	+	3	2	SHKBP1	45784596	1.000000	0.71417	0.967000	0.41034	0.978000	0.69477	1.253000	0.32886	1.253000	0.44018	0.563000	0.77884	GAG	SHKBP1	-	superfamily_WD40_repeat_dom	ENSG00000160410		0.622	SHKBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHKBP1	HGNC	protein_coding	OTTHUMT00000462613.2	38	0.00	0	G	NM_138392		41092756	41092756	+1	no_errors	ENST00000291842	ensembl	human	known	69_37n	missense	54	33.33	27	SNP	1.000	T
SIGLEC6	946	genome.wustl.edu	37	19	52023268	52023268	+	3'UTR	SNP	C	C	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr19:52023268C>G	ENST00000425629.3	-	0	1584				SIGLEC6_ENST00000346477.3_3'UTR|SIGLEC6_ENST00000436458.1_3'UTR|SIGLEC6_ENST00000391797.3_3'UTR|CTD-3073N11.9_ENST00000598220.1_RNA|SIGLEC6_ENST00000343300.4_3'UTR|SIGLEC6_ENST00000359982.4_3'UTR|SIGLEC6_ENST00000474054.1_5'UTR	NM_001245.5	NP_001236.4	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6						cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(15)|ovary(1)|stomach(1)	28		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		gctgtggcagccctagtaacc	0.413																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			D86358	CCDS12834.3, CCDS12835.3, CCDS12836.3, CCDS54307.1, CCDS54308.1, CCDS59417.1	19q13.3	2013-01-29			ENSG00000105492	ENSG00000105492		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10875	protein-coding gene	gene with protein product		604405		CD33L, CD33L1		9465907	Standard	NM_001245		Approved	OB-BP1, SIGLEC-6, CD327	uc002pwy.3	O43699	OTTHUMG00000133571	ENST00000425629.3:c.*68G>C	19.37:g.52023268C>G			A8MV71|B2RTS8|C9JBE5|F8WA78|O15388|O43700	RNA	SNP	-	NULL	ENST00000425629.3	37	NULL	CCDS12834.3	19																																																																																			SIGLEC6	-	-	ENSG00000105492		0.413	SIGLEC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIGLEC6	HGNC	protein_coding	OTTHUMT00000257670.3	106	0.00	0	C	NM_001245		52023268	52023268	-1	no_errors	ENST00000474054	ensembl	human	known	69_37n	rna	63	19.23	15	SNP	0.037	G
SIGLEC5	8778	genome.wustl.edu	37	19	52131147	52131147	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr19:52131147T>G	ENST00000534261.2	-	6	1336	c.937A>C	c.(937-939)Acc>Ccc	p.T313P	SIGLEC5_ENST00000570106.2_Missense_Mutation_p.T313P|SIGLEC5_ENST00000599649.1_Missense_Mutation_p.T313P|SIGLEC5_ENST00000222107.4_Missense_Mutation_p.T313P|SIGLEC5_ENST00000429354.3_Missense_Mutation_p.T313P			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	313	Ig-like C2-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		GCGCGGCAGGTGAAGCCTCCT	0.572																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.937A>C	19.37:g.52131147T>G	ENSP00000473238:p.Thr313Pro			Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.T313P	ENST00000534261.2	37	c.937	CCDS33088.1	19	.	.	.	.	.	.	.	.	.	.	T	15.38	2.815322	0.50527	.	.	ENSG00000105501	ENST00000222107;ENST00000429354	T;T	0.16743	2.32;2.32	3.76	2.7	0.31948	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.149132	0.31051	N	0.008357	T	0.46112	0.1376	M	0.93854	3.465	0.24421	N	0.994616	D	0.89917	1.0	D	0.83275	0.996	T	0.39375	-0.9617	10	0.87932	D	0	.	6.2748	0.20975	0.2218:0.0:0.0:0.7782	.	313	O15389	SIGL5_HUMAN	P	313	ENSP00000222107:T313P;ENSP00000415200:T313P	ENSP00000222107:T313P	T	-	1	0	SIGLEC5	56822959	0.892000	0.30473	0.750000	0.31169	0.035000	0.12851	0.068000	0.14531	0.571000	0.29365	0.460000	0.39030	ACC	SIGLEC5	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000105501		0.572	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	SIGLEC5	HGNC	protein_coding	OTTHUMT00000466897.2	77	0.00	0	T	NM_003830		52131147	52131147	-1	no_errors	ENST00000222107	ensembl	human	known	69_37n	missense	66	30.21	29	SNP	0.885	G
SHISA7	729956	genome.wustl.edu	37	19	55953908	55953908	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr19:55953908C>G	ENST00000376325.4	-	1	322	c.323G>C	c.(322-324)gGc>gCc	p.G108A		NM_001145176.1	NP_001138648.1	A6NL88	SHSA7_HUMAN	shisa family member 7	108						integral component of membrane (GO:0016021)				skin(1)	1						GTGGCAGGTGCCACAGCAGAA	0.682																																						dbGAP											0													14.0	25.0	21.0					19																	55953908		678	1563	2241	-	-	-	SO:0001583	missense	0				CCDS46193.1	19q13.42	2013-07-31	2013-07-31					"""Shisa homologs"""	35409	protein-coding gene	gene with protein product			"""shisa homolog 7 (Xenopus laevis)"""				Standard	NM_001145176		Approved		uc002qkz.3	A6NL88		ENST00000376325.4:c.323G>C	19.37:g.55953908C>G	ENSP00000365503:p.Gly108Ala			Missense_Mutation	SNP	NULL	p.G108A	ENST00000376325.4	37	c.323	CCDS46193.1	19	.	.	.	.	.	.	.	.	.	.	C	19.41	3.821364	0.71028	.	.	ENSG00000187902	ENST00000376325	T	0.64618	-0.11	3.49	2.32	0.28847	.	.	.	.	.	T	0.77061	0.4075	M	0.85945	2.785	0.48452	D	0.999659	D	0.76494	0.999	D	0.70016	0.967	T	0.78674	-0.2112	8	.	.	.	.	9.3795	0.38304	0.2138:0.7861:0.0:0.0	.	108	A6NL88	SHSA7_HUMAN	A	108	ENSP00000365503:G108A	.	G	-	2	0	SHISA7	60645720	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	4.708000	0.61859	1.694000	0.51137	0.298000	0.19748	GGC	SHISA7	-	NULL	ENSG00000187902		0.682	SHISA7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SHISA7	HGNC	protein_coding	OTTHUMT00000334533.2	58	0.00	0	C	NM_001145176		55953908	55953908	-1	no_errors	ENST00000376325	ensembl	human	known	69_37n	missense	4	80.00	16	SNP	1.000	G
SLC12A3	6559	genome.wustl.edu	37	16	56913108	56913108	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr16:56913108G>C	ENST00000563236.1	+	10	1329	c.1304G>C	c.(1303-1305)aGc>aCc	p.S435T	SLC12A3_ENST00000262502.5_Missense_Mutation_p.S434T|SLC12A3_ENST00000438926.2_Missense_Mutation_p.S435T|SLC12A3_ENST00000566786.1_Missense_Mutation_p.S434T			P55017	S12A3_HUMAN	solute carrier family 12 (sodium/chloride transporter), member 3	435					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:chloride symporter activity (GO:0015378)|transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(28)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	CAGCAGCACAGCTGCCACTAC	0.637																																						dbGAP											0													29.0	31.0	30.0					16																	56913108		2198	4299	6497	-	-	-	SO:0001583	missense	0				CCDS10770.1, CCDS45491.1, CCDS58464.1	16q13	2013-07-18	2013-07-18		ENSG00000070915	ENSG00000070915		"""Solute carriers"""	10912	protein-coding gene	gene with protein product		600968				8812482	Standard	NM_000339		Approved	NCCT	uc002ekd.4	P55017	OTTHUMG00000133284	ENST00000563236.1:c.1304G>C	16.37:g.56913108G>C	ENSP00000456149:p.Ser435Thr		A8MSJ2|C9JNN9	Missense_Mutation	SNP	pfam_AA-permease_dom,pfam_AA_permease_N,prints_NaCl_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.S435T	ENST00000563236.1	37	c.1304	CCDS58464.1	16	.	.	.	.	.	.	.	.	.	.	G	2.399	-0.338051	0.05278	.	.	ENSG00000070915	ENST00000438926;ENST00000262502	.	.	.	4.91	1.43	0.22495	Amino acid permease domain (1);	0.324690	0.36444	N	0.002585	T	0.14184	0.0343	N	0.04768	-0.165	0.28059	N	0.933067	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.17722	0.001;0.019;0.011	T	0.30238	-0.9985	9	0.08179	T	0.78	.	8.3588	0.32346	0.3972:0.0:0.6028:0.0	.	434;435;435	P55017-3;P55017;P55017-2	.;S12A3_HUMAN;.	T	434;435	.	ENSP00000262502:S435T	S	+	2	0	SLC12A3	55470609	0.999000	0.42202	0.927000	0.36925	0.619000	0.37552	1.176000	0.31957	0.471000	0.27319	0.462000	0.41574	AGC	SLC12A3	-	pfam_AA-permease_dom,tigrfam_Na/K/Cl_cotransptS	ENSG00000070915		0.637	SLC12A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC12A3	HGNC	protein_coding	OTTHUMT00000432337.1	75	0.00	0	G			56913108	56913108	+1	no_errors	ENST00000438926	ensembl	human	known	69_37n	missense	9	60.87	14	SNP	0.243	C
SLC35A2	7355	genome.wustl.edu	37	X	48762371	48762371	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	bf856604-4326-4145-bc3c-137098338f61	g.chrX:48762371C>A	ENST00000247138.5	-	4	818	c.815G>T	c.(814-816)tGg>tTg	p.W272L	SLC35A2_ENST00000413561.2_Missense_Mutation_p.W211L|SLC35A2_ENST00000376521.1_Missense_Mutation_p.W272L|SLC35A2_ENST00000452555.2_Missense_Mutation_p.W300L|SLC35A2_ENST00000376529.3_Intron|SLC35A2_ENST00000445167.2_Intron|SLC35A2_ENST00000376515.3_Intron	NM_005660.1	NP_005651.1	P78381	S35A2_HUMAN	solute carrier family 35 (UDP-galactose transporter), member A2	272					galactose metabolic process (GO:0006012)|transmembrane transport (GO:0055085)|UDP-galactose transport (GO:0015785)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	sugar:proton symporter activity (GO:0005351)|UDP-galactose transmembrane transporter activity (GO:0005459)			breast(1)|endometrium(4)|kidney(2)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(2)	15						CACCACGCCCCAGACAGCAGG	0.617																																						dbGAP											0													41.0	31.0	34.0					X																	48762371		2202	4299	6501	-	-	-	SO:0001583	missense	0			D88146	CCDS14311.1, CCDS35247.1, CCDS43937.1, CCDS65253.1, CCDS65254.1, CCDS75973.1, CCDS75974.1, CCDS75975.1	Xp11.23-p11.22	2013-05-22			ENSG00000102100	ENSG00000102100		"""Solute carriers"""	11022	protein-coding gene	gene with protein product		314375	"""solute carrier family 35 (UDP-galactose transporter), member 2"""	UGALT		8128316	Standard	NM_001042498		Approved	UGAT, UGT, UGT1, UGT2, UGTL	uc004dlo.1	P78381	OTTHUMG00000024129	ENST00000247138.5:c.815G>T	X.37:g.48762371C>A	ENSP00000247138:p.Trp272Leu		A8K2L9|A8K9V1|B4DE11|B4DPT2|E7EW45|Q8IV21|Q92553	Missense_Mutation	SNP	pfam_Nuc_sug_transpt,pfam_UAA,pfam_DMT,pirsf_UDP/CMP-sugar_transptr,tigrfam_UDPgal_transpt	p.W300L	ENST00000247138.5	37	c.899	CCDS14311.1	X	.	.	.	.	.	.	.	.	.	.	C	19.41	3.823046	0.71028	.	.	ENSG00000102100	ENST00000247138;ENST00000376521;ENST00000413561;ENST00000452555	T;T;T;T	0.48836	0.8;0.8;0.8;0.8	5.86	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.48804	0.1520	M	0.72118	2.19	0.80722	D	1	B;B;P;B;B	0.34724	0.043;0.106;0.465;0.087;0.193	B;B;B;B;B	0.36464	0.147;0.225;0.115;0.144;0.225	T	0.53830	-0.8383	10	0.54805	T	0.06	-5.339	11.845	0.52378	0.1745:0.8255:0.0:0.0	.	211;300;285;272;272	B4DE11;E7EW45;B4DE15;P78381-2;P78381	.;.;.;.;S35A2_HUMAN	L	272;272;211;300	ENSP00000247138:W272L;ENSP00000365704:W272L;ENSP00000393233:W211L;ENSP00000416002:W300L	ENSP00000247138:W272L	W	-	2	0	SLC35A2	48647315	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.352000	0.52239	2.447000	0.82792	0.600000	0.82982	TGG	SLC35A2	-	pfam_Nuc_sug_transpt,pfam_UAA,pirsf_UDP/CMP-sugar_transptr,tigrfam_UDPgal_transpt	ENSG00000102100		0.617	SLC35A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC35A2	HGNC	protein_coding	OTTHUMT00000060790.1	63	0.00	0	C	NM_005660		48762371	48762371	-1	no_errors	ENST00000452555	ensembl	human	known	69_37n	missense	53	37.65	32	SNP	1.000	A
SLC35A2	7355	genome.wustl.edu	37	X	48762371	48762371	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chrX:48762371C>A	ENST00000247138.5	-	4	818	c.815G>T	c.(814-816)tGg>tTg	p.W272L	SLC35A2_ENST00000413561.2_Missense_Mutation_p.W211L|SLC35A2_ENST00000376521.1_Missense_Mutation_p.W272L|SLC35A2_ENST00000452555.2_Missense_Mutation_p.W300L|SLC35A2_ENST00000376529.3_Intron|SLC35A2_ENST00000445167.2_Intron|SLC35A2_ENST00000376515.3_Intron	NM_005660.1	NP_005651.1	P78381	S35A2_HUMAN	solute carrier family 35 (UDP-galactose transporter), member A2	272					galactose metabolic process (GO:0006012)|transmembrane transport (GO:0055085)|UDP-galactose transport (GO:0015785)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	sugar:proton symporter activity (GO:0005351)|UDP-galactose transmembrane transporter activity (GO:0005459)			breast(1)|endometrium(4)|kidney(2)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(2)	15						CACCACGCCCCAGACAGCAGG	0.617																																						dbGAP											0													41.0	31.0	34.0					X																	48762371		2202	4299	6501	-	-	-	SO:0001583	missense	0			D88146	CCDS14311.1, CCDS35247.1, CCDS43937.1, CCDS65253.1, CCDS65254.1, CCDS75973.1, CCDS75974.1, CCDS75975.1	Xp11.23-p11.22	2013-05-22			ENSG00000102100	ENSG00000102100		"""Solute carriers"""	11022	protein-coding gene	gene with protein product		314375	"""solute carrier family 35 (UDP-galactose transporter), member 2"""	UGALT		8128316	Standard	NM_001042498		Approved	UGAT, UGT, UGT1, UGT2, UGTL	uc004dlo.1	P78381	OTTHUMG00000024129	ENST00000247138.5:c.815G>T	X.37:g.48762371C>A	ENSP00000247138:p.Trp272Leu		A8K2L9|A8K9V1|B4DE11|B4DPT2|E7EW45|Q8IV21|Q92553	Missense_Mutation	SNP	pfam_Nuc_sug_transpt,pfam_UAA,pfam_DMT,pirsf_UDP/CMP-sugar_transptr,tigrfam_UDPgal_transpt	p.W300L	ENST00000247138.5	37	c.899	CCDS14311.1	X	.	.	.	.	.	.	.	.	.	.	C	19.41	3.823046	0.71028	.	.	ENSG00000102100	ENST00000247138;ENST00000376521;ENST00000413561;ENST00000452555	T;T;T;T	0.48836	0.8;0.8;0.8;0.8	5.86	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.48804	0.1520	M	0.72118	2.19	0.80722	D	1	B;B;P;B;B	0.34724	0.043;0.106;0.465;0.087;0.193	B;B;B;B;B	0.36464	0.147;0.225;0.115;0.144;0.225	T	0.53830	-0.8383	10	0.54805	T	0.06	-5.339	11.845	0.52378	0.1745:0.8255:0.0:0.0	.	211;300;285;272;272	B4DE11;E7EW45;B4DE15;P78381-2;P78381	.;.;.;.;S35A2_HUMAN	L	272;272;211;300	ENSP00000247138:W272L;ENSP00000365704:W272L;ENSP00000393233:W211L;ENSP00000416002:W300L	ENSP00000247138:W272L	W	-	2	0	SLC35A2	48647315	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.352000	0.52239	2.447000	0.82792	0.600000	0.82982	TGG	SLC35A2	-	pfam_Nuc_sug_transpt,pfam_UAA,pirsf_UDP/CMP-sugar_transptr,tigrfam_UDPgal_transpt	ENSG00000102100		0.617	SLC35A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC35A2	HGNC	protein_coding	OTTHUMT00000060790.1	49	0.00	0	C	NM_005660		48762371	48762371	-1	no_errors	ENST00000452555	ensembl	human	known	69_37n	missense	53	37.65	32	SNP	1.000	A
SLC38A10	124565	genome.wustl.edu	37	17	79220018	79220018	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr17:79220018C>G	ENST00000374759.3	-	16	3081	c.2698G>C	c.(2698-2700)Gca>Cca	p.A900P		NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10	900					amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CCAGTGGCTGCCACCTCCTTC	0.627																																						dbGAP											0													63.0	74.0	70.0					17																	79220018		1994	4141	6135	-	-	-	SO:0001583	missense	0			BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.2698G>C	17.37:g.79220018C>G	ENSP00000363891:p.Ala900Pro		Q6ZRC5|Q8NA99|Q96C66	Missense_Mutation	SNP	pfam_AA_transpt_TM	p.A900P	ENST00000374759.3	37	c.2698	CCDS42397.1	17	.	.	.	.	.	.	.	.	.	.	C	19.13	3.767426	0.69878	.	.	ENSG00000157637	ENST00000374759;ENST00000540966	T;T	0.48836	3.0;0.8	3.99	2.99	0.34606	.	1.741500	0.04445	N	0.371548	T	0.42177	0.1191	L	0.38175	1.15	0.22656	N	0.998889	B	0.15473	0.013	B	0.12156	0.007	T	0.30297	-0.9983	10	0.32370	T	0.25	-0.0875	11.1448	0.48424	0.0:0.9073:0.0:0.0927	.	900	Q9HBR0	S38AA_HUMAN	P	900;286	ENSP00000363891:A900P;ENSP00000437601:A286P	ENSP00000363891:A900P	A	-	1	0	SLC38A10	76834613	0.000000	0.05858	0.003000	0.11579	0.739000	0.42172	-0.468000	0.06656	0.866000	0.35629	0.467000	0.42956	GCA	SLC38A10	-	NULL	ENSG00000157637		0.627	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC38A10	HGNC	protein_coding	OTTHUMT00000397747.1	276	0.00	0	C	NM_138570		79220018	79220018	-1	no_errors	ENST00000374759	ensembl	human	known	69_37n	missense	19	44.12	15	SNP	0.003	G
SLIT3	6586	genome.wustl.edu	37	5	168199899	168199899	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr5:168199899G>C	ENST00000519560.1	-	14	1765	c.1346C>G	c.(1345-1347)gCc>gGc	p.A449G	SLIT3_ENST00000404867.3_Missense_Mutation_p.A449G|SLIT3_ENST00000332966.8_Missense_Mutation_p.A449G	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	449	LRRCT 2.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GAGGTAGTCGGCCAGCCACTT	0.612																																					Ovarian(29;311 847 10864 17279 24903)	dbGAP											0													33.0	38.0	36.0					5																	168199899		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.1346C>G	5.37:g.168199899G>C	ENSP00000430333:p.Ala449Gly		A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_Leu-rich_rpt,pfam_Laminin_G,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.A449G	ENST00000519560.1	37	c.1346	CCDS4369.1	5	.	.	.	.	.	.	.	.	.	.	G	32	5.145973	0.94603	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	T;T;T	0.25085	1.82;1.82;1.82	5.62	5.62	0.85841	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.43523	0.1251	L	0.39397	1.21	0.80722	D	1	D;D;P	0.69078	0.997;0.986;0.824	D;D;P	0.65010	0.931;0.923;0.668	T	0.18713	-1.0328	10	0.56958	D	0.05	.	19.6717	0.95914	0.0:0.0:1.0:0.0	.	449;449;449	O75094-2;O75094-3;O75094	.;.;SLIT3_HUMAN	G	449	ENSP00000430333:A449G;ENSP00000332164:A449G;ENSP00000384890:A449G	ENSP00000332164:A449G	A	-	2	0	SLIT3	168132477	1.000000	0.71417	0.968000	0.41197	0.957000	0.61999	9.869000	0.99810	2.649000	0.89929	0.555000	0.69702	GCC	SLIT3	-	smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Cys-rich_flank_reg_C	ENSG00000184347		0.612	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT3	HGNC	protein_coding	OTTHUMT00000252792.4	161	0.00	0	G	NM_003062		168199899	168199899	-1	no_errors	ENST00000519560	ensembl	human	known	69_37n	missense	29	38.78	19	SNP	1.000	C
NPR2	4882	genome.wustl.edu	37	9	35809551	35809551	+	3'UTR	SNP	A	A	C	rs138010251		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr9:35809551A>C	ENST00000342694.2	+	0	3508				SPAG8_ENST00000479751.1_5'Flank|SPAG8_ENST00000340291.2_Intron|AL133410.1_ENST00000582432.1_RNA	NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2						bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	GCAATGGAAAACAGCCACAAA	0.488																																						dbGAP											0													107.0	116.0	113.0					9																	35809551		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.*109A>C	9.37:g.35809551A>C			B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	RNA	SNP	-	NULL	ENST00000342694.2	37	NULL	CCDS6590.1	9																																																																																			SPAG8	-	-	ENSG00000137098		0.488	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG8	HGNC	protein_coding	OTTHUMT00000052345.1	71	0.00	0	A			35809551	35809551	-1	no_errors	ENST00000489063	ensembl	human	known	69_37n	rna	65	50.00	65	SNP	0.000	C
SPATA21	374955	genome.wustl.edu	37	1	16748588	16748588	+	Intron	SNP	C	C	T			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr1:16748588C>T	ENST00000335496.1	-	4	517				SPATA21_ENST00000540400.1_Intron|SPATA21_ENST00000466212.1_5'UTR	NM_198546.1	NP_940948.1	Q7Z572	SPT21_HUMAN	spermatogenesis associated 21								calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|lung(8)|ovary(2)|pancreas(3)|stomach(1)|urinary_tract(2)	19		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.15e-05)|BRCA - Breast invasive adenocarcinoma(304;4.2e-05)|Kidney(64;0.000183)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.0122)|READ - Rectum adenocarcinoma(331;0.0651)		CCTTGGGGTGCTTGCCTCCCA	0.657																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS172.1	1p36.13	2013-01-10			ENSG00000187144	ENSG00000187144		"""EF-hand domain containing"""	28026	protein-coding gene	gene with protein product							Standard	NM_198546		Approved	spergen-2, spergen2	uc001ayn.3	Q7Z572	OTTHUMG00000002312	ENST00000335496.1:c.35-122G>A	1.37:g.16748588C>T			B9EK40|F5GXP5	RNA	SNP	-	NULL	ENST00000335496.1	37	NULL	CCDS172.1	1																																																																																			SPATA21	-	-	ENSG00000187144		0.657	SPATA21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPATA21	HGNC	protein_coding	OTTHUMT00000006677.2	31	0.00	0	C	NM_198546		16748588	16748588	-1	no_errors	ENST00000466212	ensembl	human	known	69_37n	rna	55	32.10	26	SNP	0.000	T
SPATC1	375686	genome.wustl.edu	37	8	145096163	145096163	+	Missense_Mutation	SNP	T	T	G	rs202191550	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr8:145096163T>G	ENST00000377470.3	+	4	1439	c.1337T>G	c.(1336-1338)gTg>gGg	p.V446G	SPATC1_ENST00000447830.2_Intron	NM_198572.2	NP_940974.2	Q76KD6	SPERI_HUMAN	spermatogenesis and centriole associated 1	446						centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.67e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GAGAGGCTGGTGGGTGAGATT	0.632																																						dbGAP											0													68.0	52.0	57.0					8																	145096163		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC053547	CCDS6413.2, CCDS47937.1	8q24.3	2005-01-11			ENSG00000186583	ENSG00000186583			30510	protein-coding gene	gene with protein product		610874				15280373	Standard	NM_198572		Approved	MGC61633, SPATA15, SPERIOLIN	uc011lkw.2	Q76KD6	OTTHUMG00000156976	ENST00000377470.3:c.1337T>G	8.37:g.145096163T>G	ENSP00000366690:p.Val446Gly		B4DWW9|Q5U5I8|Q7Z6L7	Missense_Mutation	SNP	NULL	p.V446G	ENST00000377470.3	37	c.1337	CCDS6413.2	8	.	.	.	.	.	.	.	.	.	.	T	19.27	3.794592	0.70452	.	.	ENSG00000186583	ENST00000377470	T	0.56103	0.48	4.27	4.27	0.50696	.	0.190664	0.34959	N	0.003541	T	0.69033	0.3066	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.72462	-0.4286	10	0.87932	D	0	-21.2014	10.0451	0.42182	0.0:0.0:0.0:1.0	.	446	Q76KD6	SPERI_HUMAN	G	446	ENSP00000366690:V446G	ENSP00000366690:V446G	V	+	2	0	SPATC1	145168151	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.277000	0.51654	1.689000	0.51079	0.379000	0.24179	GTG	SPATC1	-	NULL	ENSG00000186583		0.632	SPATC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPATC1	HGNC	protein_coding	OTTHUMT00000346926.1	55	0.00	0	T	NM_198572		145096163	145096163	+1	no_errors	ENST00000377470	ensembl	human	known	69_37n	missense	32	50.75	34	SNP	1.000	G
SPTBN5	51332	genome.wustl.edu	37	15	42172431	42172431	+	Missense_Mutation	SNP	T	T	C	rs202241448		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr15:42172431T>C	ENST00000320955.6	-	14	2965	c.2738A>G	c.(2737-2739)gAg>gGg	p.E913G		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	913					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		TGTCTGCTTCTCCAGCCACAA	0.632																																						dbGAP											0													19.0	28.0	25.0					15																	42172431		1969	4152	6121	-	-	-	SO:0001583	missense	0			AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.2738A>G	15.37:g.42172431T>C	ENSP00000317790:p.Glu913Gly			Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.E913G	ENST00000320955.6	37	c.2738		15	.	.	.	.	.	.	.	.	.	.	.	8.481	0.859704	0.17178	.	.	ENSG00000137877	ENST00000320955	T	0.53206	0.63	4.23	1.62	0.23740	.	0.995108	0.08148	N	0.990516	T	0.39009	0.1062	L	0.56769	1.78	0.09310	N	0.999996	B	0.25850	0.136	B	0.27608	0.081	T	0.33317	-0.9873	10	0.20046	T	0.44	.	2.776	0.05347	0.1403:0.0858:0.161:0.6129	.	913	Q9NRC6	SPTN5_HUMAN	G	913	ENSP00000317790:E913G	ENSP00000317790:E913G	E	-	2	0	SPTBN5	39959723	0.916000	0.31088	0.429000	0.26710	0.087000	0.18053	1.146000	0.31589	0.579000	0.29504	0.402000	0.26972	GAG	SPTBN5	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000137877		0.632	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	SPTBN5	HGNC	protein_coding	OTTHUMT00000420237.1	48	0.00	0	T	NM_016642		42172431	42172431	-1	no_errors	ENST00000320955	ensembl	human	known	69_37n	missense	24	58.62	34	SNP	0.648	C
SRC	6714	genome.wustl.edu	37	20	36022255	36022255	+	Intron	SNP	A	A	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr20:36022255A>G	ENST00000373578.2	+	6	699				SRC_ENST00000373558.2_Intron|SRC_ENST00000373567.2_Intron|SRC_ENST00000360723.4_Intron|SRC_ENST00000445403.1_Intron|SRC_ENST00000358208.4_Intron	NM_198291.1	NP_938033.1	P12931	SRC_HUMAN	SRC proto-oncogene, non-receptor tyrosine kinase						axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cellular response to progesterone stimulus (GO:0071393)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|membrane organization (GO:0061024)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of mitochondrial depolarization (GO:0051902)|negative regulation of protein homooligomerization (GO:0032463)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oogenesis (GO:0048477)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of integrin activation (GO:0033625)|positive regulation of podosome assembly (GO:0071803)|positive regulation of protein kinase B signaling (GO:0051897)|progesterone receptor signaling pathway (GO:0050847)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of bone resorption (GO:0045124)|regulation of caveolin-mediated endocytosis (GO:2001286)|regulation of cell-cell adhesion (GO:0022407)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of epithelial cell migration (GO:0010632)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of protein binding (GO:0043393)|regulation of vascular permeability (GO:0043114)|response to interleukin-1 (GO:0070555)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|T cell costimulation (GO:0031295)|transforming growth factor beta receptor signaling pathway (GO:0007179)|uterus development (GO:0060065)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|growth factor receptor binding (GO:0070851)|heme binding (GO:0020037)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphoprotein binding (GO:0051219)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(16)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)			Bosutinib(DB06616)|Dasatinib(DB01254)|Ponatinib(DB08901)	CTTGTGGCTGACGGCTCCCTT	0.657																																						dbGAP											0													20.0	20.0	20.0					20																	36022255		2197	4297	6494	-	-	-	SO:0001627	intron_variant	0			AF077754	CCDS13294.1	20q12-q13	2014-06-25	2014-06-25		ENSG00000197122	ENSG00000197122		"""SH2 domain containing"""	11283	protein-coding gene	gene with protein product		190090	"""v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog"""	SRC1		2582238	Standard	NM_005417		Approved	ASV, c-src	uc002xgy.3	P12931	OTTHUMG00000032417	ENST00000373578.2:c.351-43A>G	20.37:g.36022255A>G			E1P5V4|Q76P87|Q86VB9|Q9H5A8	RNA	SNP	-	NULL	ENST00000373578.2	37	NULL	CCDS13294.1	20																																																																																			SRC	-	-	ENSG00000197122		0.657	SRC-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	SRC	HGNC	protein_coding	OTTHUMT00000268142.1	99	0.00	0	A	NM_005417		36022255	36022255	+1	no_errors	ENST00000489153	ensembl	human	putative	69_37n	rna	21	48.84	21	SNP	0.004	G
SRCAP	10847	genome.wustl.edu	37	16	30731617	30731617	+	Silent	SNP	A	A	C	rs145842115		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr16:30731617A>C	ENST00000262518.4	+	19	3337	c.2952A>C	c.(2950-2952)ccA>ccC	p.P984P	SRCAP_ENST00000395059.2_Silent_p.P984P|SRCAP_ENST00000344771.4_Silent_p.P984P	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	984	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)	p.P984P(3)		NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CTGACCCCCCACCCCGGCCCA	0.572																																						dbGAP											3	Substitution - coding silent(3)	prostate(3)											91.0	101.0	98.0					16																	30731617		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.2952A>C	16.37:g.30731617A>C			B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	pfam_SNF2_N,pfam_HSA,pfam_Helicase_C,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,smart_AT_hook_DNA-bd_motif,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_AT_hook-like	p.P984	ENST00000262518.4	37	c.2952	CCDS10689.2	16																																																																																			SRCAP	-	NULL	ENSG00000080603		0.572	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCAP	HGNC	protein_coding	OTTHUMT00000255523.1	48	0.00	0	A	NM_006662		30731617	30731617	+1	no_errors	ENST00000262518	ensembl	human	known	69_37n	silent	69	28.57	28	SNP	0.995	C
SREBF2	6721	genome.wustl.edu	37	22	42276902	42276902	+	Silent	SNP	G	G	C	rs201061816	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr22:42276902G>C	ENST00000361204.4	+	10	2110	c.1944G>C	c.(1942-1944)acG>acC	p.T648T		NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	648					cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						GGCGGGCCACGCCAGCCACTG	0.637													G|||	776	0.154952	0.0688	0.1916	5008	,	,		15516	0.2917		0.2356	False		,,,				2504	0.0215					dbGAP											0													20.0	22.0	21.0					22																	42276902		2172	4247	6419	-	-	-	SO:0001819	synonymous_variant	0			U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.1944G>C	22.37:g.42276902G>C			Q05BD5|Q6GTH7|Q86V36|Q9UH04	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.A682P	ENST00000361204.4	37	c.2044	CCDS14023.1	22	.	.	.	.	.	.	.	.	.	.	G	7.512	0.654823	0.14580	.	.	ENSG00000198911	ENST00000444813	.	.	.	4.4	-2.81	0.05805	.	.	.	.	.	T	0.34279	0.0892	.	.	.	0.19575	N	0.999965	.	.	.	.	.	.	T	0.43180	-0.9407	5	0.87932	D	0	-8.432	3.8526	0.08962	0.3877:0.2295:0.3084:0.0744	.	.	.	.	P	682	.	ENSP00000395728:A682P	A	+	1	0	SREBF2	40606848	0.006000	0.16342	0.462000	0.27118	0.462000	0.32619	-0.177000	0.09796	-0.294000	0.08973	-0.707000	0.03653	GCC	SREBF2	-	NULL	ENSG00000198911		0.637	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SREBF2	HGNC	protein_coding	OTTHUMT00000321956.1	82	0.00	0	G	NM_004599		42276902	42276902	+1	no_errors	ENST00000424354	ensembl	human	known	69_37n	missense	1	85.71	6	SNP	0.003	C
SUSD3	203328	genome.wustl.edu	37	9	95847083	95847083	+	3'UTR	SNP	A	A	C			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr9:95847083A>C	ENST00000375472.3	+	0	858				SUSD3_ENST00000375469.1_3'UTR	NM_145006.2	NP_659443.1	Q96L08	SUSD3_HUMAN	sushi domain containing 3							integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(2)	13						GGCTGACCCCACCAGCCAGTC	0.617																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK128289	CCDS6701.1, CCDS69620.1, CCDS75857.1	9q22.32	2004-01-29			ENSG00000157303	ENSG00000157303			28391	protein-coding gene	gene with protein product						12975309	Standard	NM_001287007		Approved	MGC26847	uc004atb.3	Q96L08	OTTHUMG00000020241	ENST00000375472.3:c.*54A>C	9.37:g.95847083A>C			Q49AA6|Q6UXV7	RNA	SNP	-	NULL	ENST00000375472.3	37	NULL	CCDS6701.1	9																																																																																			SUSD3	-	-	ENSG00000157303		0.617	SUSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD3	HGNC	protein_coding	OTTHUMT00000053120.1	39	0.00	0	A	NM_145006		95847083	95847083	+1	no_errors	ENST00000471462	ensembl	human	known	69_37n	rna	9	64.29	18	SNP	0.000	C
SYP	6855	genome.wustl.edu	37	X	49050648	49050648	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-10A-01D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	bf856604-4326-4145-bc3c-137098338f61	g.chrX:49050648C>T	ENST00000263233.4	-	4	470	c.398G>A	c.(397-399)cGa>cAa	p.R133Q	SYP_ENST00000479808.1_Missense_Mutation_p.R133Q|SYP_ENST00000538567.1_Missense_Mutation_p.R15Q	NM_003179.2	NP_003170.1	P08247	SYPH_HUMAN	synaptophysin	133	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cellular response to organic substance (GO:0071310)|endocytosis (GO:0006897)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of opioid receptor signaling pathway (GO:2000474)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|synaptic vesicle maturation (GO:0016188)|synaptic vesicle membrane organization (GO:0048499)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|integral component of synaptic vesicle membrane (GO:0030285)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	cholesterol binding (GO:0015485)|protein self-association (GO:0043621)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)	15		all_lung(315;0.00016)				GTTATTCTCTCGGTACTTGTT	0.567																																						dbGAP											0													102.0	91.0	95.0					X																	49050648		2203	4300	6503	-	-	-	SO:0001583	missense	0			X06389	CCDS14321.1	Xp11.23-p11.22	2014-02-19			ENSG00000102003	ENSG00000102003			11506	protein-coding gene	gene with protein product		313475				3120152, 19377476	Standard	NM_003179		Approved	MRX96	uc004dmz.1	P08247	OTTHUMG00000034557	ENST00000263233.4:c.398G>A	X.37:g.49050648C>T	ENSP00000263233:p.Arg133Gln		B2R7L6|B7Z359|Q6P2F7	Missense_Mutation	SNP	pfam_MARVEL-like_dom,prints_Synaptophysin/porin	p.R133Q	ENST00000263233.4	37	c.398	CCDS14321.1	X	.	.	.	.	.	.	.	.	.	.	C	26.9	4.777506	0.90195	.	.	ENSG00000102003	ENST00000263233;ENST00000538567;ENST00000479808	T;T;T	0.26810	1.71;1.71;1.71	4.55	4.55	0.56014	Marvel (1);MARVEL-like domain (1);	0.142693	0.39341	N	0.001384	T	0.44414	0.1292	M	0.66560	2.04	0.54753	D	0.999986	D	0.63046	0.992	P	0.58391	0.838	T	0.43196	-0.9406	10	0.52906	T	0.07	-16.4177	15.2313	0.73390	0.0:1.0:0.0:0.0	.	133	P08247	SYPH_HUMAN	Q	133;15;133	ENSP00000263233:R133Q;ENSP00000437456:R15Q;ENSP00000418169:R133Q	ENSP00000263233:R133Q	R	-	2	0	SYP	48937592	0.999000	0.42202	1.000000	0.80357	0.990000	0.78478	3.851000	0.55926	2.099000	0.63709	0.600000	0.82982	CGA	SYP	-	pfam_MARVEL-like_dom	ENSG00000102003		0.567	SYP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYP	HGNC	protein_coding	OTTHUMT00000083625.2	379	0.26	1	C	NM_003179		49050648	49050648	-1	no_errors	ENST00000263233	ensembl	human	known	69_37n	missense	239	29.62	101	SNP	1.000	T
SYP	6855	genome.wustl.edu	37	X	49050648	49050648	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chrX:49050648C>T	ENST00000263233.4	-	4	470	c.398G>A	c.(397-399)cGa>cAa	p.R133Q	SYP_ENST00000479808.1_Missense_Mutation_p.R133Q|SYP_ENST00000538567.1_Missense_Mutation_p.R15Q	NM_003179.2	NP_003170.1	P08247	SYPH_HUMAN	synaptophysin	133	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cellular response to organic substance (GO:0071310)|endocytosis (GO:0006897)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of opioid receptor signaling pathway (GO:2000474)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|synaptic vesicle maturation (GO:0016188)|synaptic vesicle membrane organization (GO:0048499)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|integral component of synaptic vesicle membrane (GO:0030285)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	cholesterol binding (GO:0015485)|protein self-association (GO:0043621)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)	15		all_lung(315;0.00016)				GTTATTCTCTCGGTACTTGTT	0.567																																						dbGAP											0													102.0	91.0	95.0					X																	49050648		2203	4300	6503	-	-	-	SO:0001583	missense	0			X06389	CCDS14321.1	Xp11.23-p11.22	2014-02-19			ENSG00000102003	ENSG00000102003			11506	protein-coding gene	gene with protein product		313475				3120152, 19377476	Standard	NM_003179		Approved	MRX96	uc004dmz.1	P08247	OTTHUMG00000034557	ENST00000263233.4:c.398G>A	X.37:g.49050648C>T	ENSP00000263233:p.Arg133Gln		B2R7L6|B7Z359|Q6P2F7	Missense_Mutation	SNP	pfam_MARVEL-like_dom,prints_Synaptophysin/porin	p.R133Q	ENST00000263233.4	37	c.398	CCDS14321.1	X	.	.	.	.	.	.	.	.	.	.	C	26.9	4.777506	0.90195	.	.	ENSG00000102003	ENST00000263233;ENST00000538567;ENST00000479808	T;T;T	0.26810	1.71;1.71;1.71	4.55	4.55	0.56014	Marvel (1);MARVEL-like domain (1);	0.142693	0.39341	N	0.001384	T	0.44414	0.1292	M	0.66560	2.04	0.54753	D	0.999986	D	0.63046	0.992	P	0.58391	0.838	T	0.43196	-0.9406	10	0.52906	T	0.07	-16.4177	15.2313	0.73390	0.0:1.0:0.0:0.0	.	133	P08247	SYPH_HUMAN	Q	133;15;133	ENSP00000263233:R133Q;ENSP00000437456:R15Q;ENSP00000418169:R133Q	ENSP00000263233:R133Q	R	-	2	0	SYP	48937592	0.999000	0.42202	1.000000	0.80357	0.990000	0.78478	3.851000	0.55926	2.099000	0.63709	0.600000	0.82982	CGA	SYP	-	pfam_MARVEL-like_dom	ENSG00000102003		0.567	SYP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYP	HGNC	protein_coding	OTTHUMT00000083625.2	68	0.00	0	C	NM_003179		49050648	49050648	-1	no_errors	ENST00000263233	ensembl	human	known	69_37n	missense	239	29.62	101	SNP	1.000	T
TCIRG1	10312	genome.wustl.edu	37	11	67817893	67817893	+	Intron	SNP	T	T	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr11:67817893T>G	ENST00000265686.3	+	19	2344				RP11-802E16.3_ENST00000529934.1_RNA|TCIRG1_ENST00000532635.1_Intron|RP11-802E16.3_ENST00000534517.1_RNA|TCIRG1_ENST00000530802.1_Splice_Site|RP11-802E16.3_ENST00000526897.1_RNA	NM_006019.3	NP_006010.2	Q13488	VPP3_HUMAN	T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3						ATP hydrolysis coupled proton transport (GO:0015991)|cellular defense response (GO:0006968)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of cell proliferation (GO:0008284)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(3)|prostate(1)	16						CTGCGGCAGGTAGGTAGGGGG	0.637																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF025374	CCDS8177.1, CCDS53670.1	11q13.2	2014-09-17	2006-01-20		ENSG00000110719	ENSG00000110719		"""ATPases / V-type"""	11647	protein-coding gene	gene with protein product	"""T-cell immune response cDNA 7"""	604592	"""T-cell, immune regulator 1"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein a isoform 3"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3"""			8579597, 9806637	Standard	NM_006019		Approved	TIRC7, OC-116, OC116, ATP6N1C, Atp6i, a3, ATP6V0A3	uc001one.3	Q13488	OTTHUMG00000167358	ENST00000265686.3:c.2237-61T>G	11.37:g.67817893T>G			O75877|Q8WVC5	Splice_Site	SNP	-	NULL	ENST00000265686.3	37	c.NULL	CCDS8177.1	11																																																																																			TCIRG1	-	-	ENSG00000110719		0.637	TCIRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCIRG1	HGNC	protein_coding	OTTHUMT00000394305.1	85	0.00	0	T	NM_006019		67817893	67817893	+1	no_errors	ENST00000530802	ensembl	human	known	69_37n	splice_site	36	41.94	26	SNP	0.001	G
TECTA	7007	genome.wustl.edu	37	11	121000388	121000388	+	Silent	SNP	G	G	A			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-10A-01D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	bf856604-4326-4145-bc3c-137098338f61	g.chr11:121000388G>A	ENST00000392793.1	+	10	2680	c.2409G>A	c.(2407-2409)tcG>tcA	p.S803S	TECTA_ENST00000264037.2_Silent_p.S803S			O75443	TECTA_HUMAN	tectorin alpha	803	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		TCCATCCTTCGGGGAAGCTGG	0.438																																						dbGAP											0													153.0	154.0	154.0					11																	121000388		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.2409G>A	11.37:g.121000388G>A				Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_Zona_pellucida_Endoglin/CD105,pfam_Nidogen_extracell_dom,pfam_TIL_dom,superfamily_TIL_dom,smart_Nidogen_extracell_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105	p.S803	ENST00000392793.1	37	c.2409	CCDS8434.1	11																																																																																			TECTA	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000109927		0.438	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TECTA	HGNC	protein_coding	OTTHUMT00000313850.1	408	0.49	2	G	NM_005422		121000388	121000388	+1	no_errors	ENST00000264037	ensembl	human	known	69_37n	silent	316	33.54	160	SNP	0.975	A
TECTA	7007	genome.wustl.edu	37	11	121000388	121000388	+	Silent	SNP	G	G	A			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr11:121000388G>A	ENST00000392793.1	+	10	2680	c.2409G>A	c.(2407-2409)tcG>tcA	p.S803S	TECTA_ENST00000264037.2_Silent_p.S803S			O75443	TECTA_HUMAN	tectorin alpha	803	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		TCCATCCTTCGGGGAAGCTGG	0.438																																						dbGAP											0													153.0	154.0	154.0					11																	121000388		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.2409G>A	11.37:g.121000388G>A				Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_Zona_pellucida_Endoglin/CD105,pfam_Nidogen_extracell_dom,pfam_TIL_dom,superfamily_TIL_dom,smart_Nidogen_extracell_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105	p.S803	ENST00000392793.1	37	c.2409	CCDS8434.1	11																																																																																			TECTA	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000109927		0.438	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TECTA	HGNC	protein_coding	OTTHUMT00000313850.1	66	0.00	0	G	NM_005422		121000388	121000388	+1	no_errors	ENST00000264037	ensembl	human	known	69_37n	silent	316	33.54	160	SNP	0.975	A
TEN1	100134934	genome.wustl.edu	37	17	73996333	73996333	+	Missense_Mutation	SNP	G	G	C	rs76149185		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr17:73996333G>C	ENST00000397640.1	+	4	660	c.362G>C	c.(361-363)gGc>gCc	p.G121A	CDK3_ENST00000448471.1_5'Flank|TEN1_ENST00000588202.1_3'UTR|CDK3_ENST00000425876.2_5'Flank|TEN1_ENST00000416485.1_Missense_Mutation_p.G120A|TEN1-CDK3_ENST00000567351.1_RNA	NM_001113324.2	NP_001106795.2	Q86WV5	TEN1L_HUMAN	TEN1 CST complex subunit	121						nuclear chromosome, telomeric region (GO:0000784)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)			breast(1)	1						GAGCGGGGCGGCAGCCAGTAG	0.637																																						dbGAP											0													24.0	34.0	31.0					17																	73996333		691	1591	2282	-	-	-	SO:0001583	missense	0				CCDS45780.1, CCDS45780.2	17q25.1	2013-05-23	2013-05-23	2011-06-14	ENSG00000257949	ENSG00000257949			37242	protein-coding gene	gene with protein product		613130	"""chromosome 17 open reading frame 106"", ""TEN1 telomerase capping complex subunit homolog (S. cerevisiae)"""	C17orf106		19854130	Standard	NM_001113324		Approved	FLJ39785		Q86WV5	OTTHUMG00000132686	ENST00000397640.1:c.362G>C	17.37:g.73996333G>C	ENSP00000380762:p.Gly121Ala		I3L0C7	Missense_Mutation	SNP	NULL	p.G121A	ENST00000397640.1	37	c.362	CCDS45780.2	17	.	.	.	.	.	.	.	.	.	.	G	11.49	1.653223	0.29425	.	.	ENSG00000257949	ENST00000397640;ENST00000416485	.	.	.	5.07	0.507	0.16967	.	0.554914	0.13638	U	0.373194	T	0.26810	0.0656	L	0.34521	1.04	0.09310	N	1	B	0.15930	0.015	B	0.16289	0.015	T	0.18777	-1.0326	9	0.49607	T	0.09	2.0E-4	3.9758	0.09473	0.1489:0.1281:0.591:0.132	.	120	Q86WV5	TEN1L_HUMAN	A	121;120	.	ENSP00000380762:G121A	G	+	2	0	AC040980.1	71507928	0.113000	0.22115	0.002000	0.10522	0.002000	0.02628	2.625000	0.46452	0.516000	0.28340	-0.310000	0.09108	GGC	TEN1	-	NULL	ENSG00000257949		0.637	TEN1-001	KNOWN	basic|CCDS	protein_coding	TEN1	HGNC	protein_coding	OTTHUMT00000255983.1	59	0.00	0	G	NM_001113324		73996333	73996333	+1	no_errors	ENST00000397640	ensembl	human	known	69_37n	missense	38	38.71	24	SNP	0.000	C
TEX264	51368	genome.wustl.edu	37	3	51708440	51708440	+	Silent	SNP	A	A	C			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr3:51708440A>C	ENST00000415259.1	+	2	1201	c.120A>C	c.(118-120)tcA>tcC	p.S40S	TEX264_ENST00000457573.1_Silent_p.S40S|TEX264_ENST00000395057.1_Silent_p.S40S|TEX264_ENST00000416589.1_Silent_p.S40S|TEX264_ENST00000341333.5_Silent_p.S40S			Q9Y6I9	TX264_HUMAN	testis expressed 264	40						extracellular vesicular exosome (GO:0070062)		p.S40S(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(193;8.53e-05)|Kidney(197;0.000594)|KIRC - Kidney renal clear cell carcinoma(197;0.000759)		GTGCTGGGTCACCCCCCATCC	0.607																																						dbGAP											1	Substitution - coding silent(1)	endometrium(1)											80.0	72.0	75.0					3																	51708440		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF072733	CCDS2833.1, CCDS74945.1	3p21	2007-03-13	2007-03-13		ENSG00000164081	ENSG00000164081			30247	protein-coding gene	gene with protein product			"""testis expressed gene 264"", ""testis expressed sequence 264"""			12975309	Standard	NM_001243725		Approved	ZSIG11, FLJ13935	uc003dbm.4	Q9Y6I9	OTTHUMG00000156901	ENST00000415259.1:c.120A>C	3.37:g.51708440A>C			B3KN87|Q9UKD7	Silent	SNP	superfamily_Reg_factor_effector_bac	p.S40	ENST00000415259.1	37	c.120	CCDS2833.1	3																																																																																			TEX264	-	NULL	ENSG00000164081		0.607	TEX264-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TEX264	HGNC	protein_coding	OTTHUMT00000346530.1	72	0.00	0	A	NM_015926		51708440	51708440	+1	no_errors	ENST00000341333	ensembl	human	known	69_37n	silent	80	28.45	33	SNP	0.969	C
THTPA	79178	genome.wustl.edu	37	14	24028236	24028236	+	3'UTR	SNP	C	C	T			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr14:24028236C>T	ENST00000288014.6	+	0	1616				RP11-66N24.4_ENST00000556354.1_RNA|RP11-66N24.4_ENST00000553985.1_RNA|THTPA_ENST00000554789.1_3'UTR|RP11-66N24.4_ENST00000555446.1_RNA|THTPA_ENST00000404535.3_3'UTR|RP11-66N24.3_ENST00000555968.1_RNA			Q9BU02	THTPA_HUMAN	thiamine triphosphatase						dephosphorylation (GO:0016311)|generation of precursor metabolites and energy (GO:0006091)|small molecule metabolic process (GO:0044281)|thiamine diphosphate metabolic process (GO:0042357)|thiamine metabolic process (GO:0006772)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	hydrolase activity (GO:0016787)|magnesium ion binding (GO:0000287)|thiamin-triphosphatase activity (GO:0050333)			large_intestine(1)|prostate(2)	3	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00643)		CTCGCTCATCCGTCAGATGCA	0.562											OREG0022604	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF432862	CCDS32053.1, CCDS58306.1, CCDS58307.1	14q11.2	2011-04-28					3.6.1.28		18987	protein-coding gene	gene with protein product		611612				11827967	Standard	NR_046051		Approved	THTPASE	uc001wkh.5	Q9BU02		ENST00000288014.6:c.*187C>T	14.37:g.24028236C>T		768	D3DS50|G3V4J3	RNA	SNP	-	NULL	ENST00000288014.6	37	NULL	CCDS32053.1	14																																																																																			RP11-66N24.4	-	-	ENSG00000157306		0.562	THTPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THTPA	Clone_based_vega_gene	protein_coding	OTTHUMT00000413800.2	37	0.00	0	C			24028236	24028236	+1	no_errors	ENST00000553985	ensembl	human	known	69_37n	rna	4	50.00	4	SNP	1.000	T
TMEM161B	153396	genome.wustl.edu	37	5	87516503	87516503	+	Missense_Mutation	SNP	A	A	C	rs201311722	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr5:87516503A>C	ENST00000296595.6	-	5	447	c.323T>G	c.(322-324)gTg>gGg	p.V108G	TMEM161B_ENST00000511218.1_5'Flank|TMEM161B_ENST00000514135.1_Missense_Mutation_p.V108G|TMEM161B_ENST00000509387.1_5'UTR|TMEM161B_ENST00000506536.1_5'UTR|TMEM161B_ENST00000512429.1_Missense_Mutation_p.V97G	NM_153354.3	NP_699185.1	Q8NDZ6	T161B_HUMAN	transmembrane protein 161B	108						integral component of membrane (GO:0016021)				endometrium(4)|large_intestine(3)|lung(9)|skin(3)|upper_aerodigestive_tract(1)	20		all_cancers(142;0.000275)|Lung NSC(167;0.00901)|all_lung(232;0.0111)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;6.24e-36)|Epithelial(54;6.8e-31)|all cancers(79;1.07e-26)		TGTGAAATCCACCAGCCACTG	0.338																																						dbGAP											0													49.0	56.0	54.0					5																	87516503		2196	4296	6492	-	-	-	SO:0001583	missense	0			BC037287	CCDS4065.1, CCDS75269.1, CCDS75270.1	5q14.3	2008-02-05			ENSG00000164180	ENSG00000164180			28483	protein-coding gene	gene with protein product						12477932	Standard	NM_001289008		Approved	MGC33214	uc003kjc.3	Q8NDZ6	OTTHUMG00000131323	ENST00000296595.6:c.323T>G	5.37:g.87516503A>C	ENSP00000296595:p.Val108Gly		Q5CZH7|Q6UWQ6	Missense_Mutation	SNP	pfam_Transmembrane_161A/B	p.V108G	ENST00000296595.6	37	c.323	CCDS4065.1	5	.	.	.	.	.	.	.	.	.	.	A	25.8	4.675438	0.88445	.	.	ENSG00000164180	ENST00000514135;ENST00000296595;ENST00000512429;ENST00000443393	.	.	.	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.76863	0.4047	M	0.64997	1.995	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.79478	-0.1787	9	0.87932	D	0	-2.7987	15.7836	0.78286	1.0:0.0:0.0:0.0	.	108	Q8NDZ6	T161B_HUMAN	G	108;108;97;108	.	ENSP00000296595:V108G	V	-	2	0	TMEM161B	87552259	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	2.190000	0.69967	0.477000	0.44152	GTG	TMEM161B	-	pfam_Transmembrane_161A/B	ENSG00000164180		0.338	TMEM161B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM161B	HGNC	protein_coding	OTTHUMT00000254094.1	33	0.00	0	A	NM_153354		87516503	87516503	-1	no_errors	ENST00000296595	ensembl	human	known	69_37n	missense	46	69.03	107	SNP	1.000	C
TMPRSS9	360200	genome.wustl.edu	37	19	2396400	2396400	+	Intron	SNP	C	C	T			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr19:2396400C>T	ENST00000332578.3	+	2	142				TMPRSS9_ENST00000592650.1_3'UTR	NM_182973.1	NP_892018.1	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9						plasminogen activation (GO:0031639)	integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATCACGGGGGCGTCGACCACC	0.617																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AJ488946	CCDS12088.1	19p13.3	2010-04-13						"""Serine peptidases / Transmembrane"""	30079	protein-coding gene	gene with protein product	"""polyserase 1"""	610477				12886014	Standard	NM_182973		Approved		uc010xgx.2	Q7Z410		ENST00000332578.3:c.143-137C>T	19.37:g.2396400C>T			Q6ZND6|Q7Z411	RNA	SNP	-	NULL	ENST00000332578.3	37	NULL	CCDS12088.1	19																																																																																			TMPRSS9	-	-	ENSG00000178297		0.617	TMPRSS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS9	HGNC	protein_coding	OTTHUMT00000451330.3	11	0.00	0	C	NM_182973		2396400	2396400	+1	no_errors	ENST00000592650	ensembl	human	known	69_37n	rna	10	37.50	6	SNP	0.001	T
TMTC2	160335	genome.wustl.edu	37	12	83251119	83251119	+	Silent	SNP	A	A	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr12:83251119A>G	ENST00000321196.3	+	2	1121	c.414A>G	c.(412-414)ggA>ggG	p.G138G	TMTC2_ENST00000548305.1_Silent_p.G138G|TMTC2_ENST00000549919.1_Silent_p.G132G	NM_152588.1	NP_689801.1	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat containing 2	138					calcium ion homeostasis (GO:0055074)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|urinary_tract(1)	39						GAATCGTGGGACGAGCCGATG	0.532																																						dbGAP											0													89.0	77.0	81.0					12																	83251119		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK074634	CCDS9025.1	12q21.31	2014-06-09			ENSG00000179104	ENSG00000179104		"""Tetratricopeptide (TTC) repeat domain containing"""	25440	protein-coding gene	gene with protein product		615856				24764305	Standard	NM_152588		Approved	DKFZp762A217	uc001szt.3	Q8N394	OTTHUMG00000169736	ENST00000321196.3:c.414A>G	12.37:g.83251119A>G			B2RCU7|Q8N2K8	Silent	SNP	pfam_TPR-1,pfam_TPR_2,pfam_DUF1736,pfam_TPR-4,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.G138	ENST00000321196.3	37	c.414	CCDS9025.1	12																																																																																			TMTC2	-	NULL	ENSG00000179104		0.532	TMTC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMTC2	HGNC	protein_coding	OTTHUMT00000405663.1	88	0.00	0	A	NM_152588		83251119	83251119	+1	no_errors	ENST00000321196	ensembl	human	known	69_37n	silent	75	30.58	37	SNP	0.615	G
TNRC6C	57690	genome.wustl.edu	37	17	76071307	76071307	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr17:76071307G>C	ENST00000588061.1	+	10	3735	c.3008G>C	c.(3007-3009)cGc>cCc	p.R1003P	TNRC6C_ENST00000541771.1_Missense_Mutation_p.R1003P|TNRC6C_ENST00000335749.4_Missense_Mutation_p.R1000P|TNRC6C_ENST00000588847.1_Missense_Mutation_p.R1000P|TNRC6C_ENST00000544502.1_Missense_Mutation_p.R1000P|TNRC6C_ENST00000301624.4_Missense_Mutation_p.R1003P			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	1003					embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			CTCGGCTGCCGCCCGCCAATC	0.542																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.3008G>C	17.37:g.76071307G>C	ENSP00000468647:p.Arg1003Pro		G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Missense_Mutation	SNP	pfam_Argonaute_hook_dom,pfam_UBA/transl_elong_EF1B_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.R1000P	ENST00000588061.1	37	c.2999	CCDS45798.1	17	.	.	.	.	.	.	.	.	.	.	G	28.1	4.888077	0.91814	.	.	ENSG00000078687	ENST00000455761;ENST00000395801;ENST00000335749;ENST00000301624;ENST00000541771;ENST00000544502	T;T;T;T	0.27890	1.69;1.64;1.64;1.69	5.86	4.9	0.64082	.	0.222058	0.39544	N	0.001340	T	0.56062	0.1960	M	0.75777	2.31	0.58432	D	0.999998	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.997;0.999;1.0	T	0.60905	-0.7170	10	0.62326	D	0.03	-13.8866	14.942	0.71000	0.0686:0.0:0.9314:0.0	.	1000;1003;1003	G3XAB8;Q9HCJ0-2;Q9HCJ0	.;.;TNR6C_HUMAN	P	1003;1000;1000;1003;1003;1000	ENSP00000336783:R1000P;ENSP00000301624:R1003P;ENSP00000440310:R1003P;ENSP00000442421:R1000P	ENSP00000301624:R1003P	R	+	2	0	TNRC6C	73582902	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.420000	0.97426	1.490000	0.48466	0.655000	0.94253	CGC	TNRC6C	-	NULL	ENSG00000078687		0.542	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TNRC6C	HGNC	protein_coding	OTTHUMT00000395947.1	38	0.00	0	G	NM_018996		76071307	76071307	+1	no_errors	ENST00000335749	ensembl	human	known	69_37n	missense	45	38.16	29	SNP	1.000	C
TNS3	64759	genome.wustl.edu	37	7	47342642	47342642	+	Silent	SNP	G	G	A			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr7:47342642G>A	ENST00000398879.1	-	22	3729	c.3363C>T	c.(3361-3363)ttC>ttT	p.F1121F	TNS3_ENST00000355730.3_Silent_p.F881F|TNS3_ENST00000311160.9_Silent_p.F1121F			Q68CZ2	TENS3_HUMAN	tensin 3	1121					cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						GCGGGCTGGAGAAGCCACTGG	0.627																																						dbGAP											0													43.0	52.0	49.0					7																	47342642		1968	4135	6103	-	-	-	SO:0001819	synonymous_variant	0			AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.3363C>T	7.37:g.47342642G>A			B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Silent	SNP	pfam_PTB,pfam_Tensin_phosphatase_C2-dom,pfam_SH2,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Tyr_Pase_cat,smart_SH2,smart_PTyr_interaction_dom,pfscan_SH2,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.F1121	ENST00000398879.1	37	c.3363	CCDS5506.2	7																																																																																			TNS3	-	NULL	ENSG00000136205		0.627	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TNS3	HGNC	protein_coding	OTTHUMT00000157253.1	71	0.00	0	G	NM_022748		47342642	47342642	-1	no_errors	ENST00000311160	ensembl	human	known	69_37n	silent	39	39.06	25	SNP	1.000	A
TOMM22	56993	genome.wustl.edu	37	22	39077991	39077991	+	Missense_Mutation	SNP	C	C	G	rs202201801		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr22:39077991C>G	ENST00000216034.4	+	1	39	c.8C>G	c.(7-9)gCc>gGc	p.A3G	RP3-508I15.9_ENST00000431924.2_RNA|RP3-508I15.9_ENST00000412067.1_RNA|RP3-508I15.9_ENST00000444381.1_RNA	NM_020243.4	NP_064628.1	Q9NS69	TOM22_HUMAN	translocase of outer mitochondrial membrane 22 homolog (yeast)	3					cellular protein metabolic process (GO:0044267)|protein import into mitochondrial outer membrane (GO:0045040)|protein targeting to mitochondrion (GO:0006626)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane translocase complex (GO:0005742)|mitochondrion (GO:0005739)	protein transmembrane transporter activity (GO:0008320)			large_intestine(1)|lung(2)	3	Melanoma(58;0.04)					GTCATGGCTGCCGCCGTCGCT	0.687																																						dbGAP											0													10.0	11.0	11.0					22																	39077991		2084	4144	6228	-	-	-	SO:0001583	missense	0			AB040119	CCDS13975.1	22q12-q13	2010-07-29			ENSG00000100216	ENSG00000100216			18002	protein-coding gene	gene with protein product		607046				10982837, 10900208	Standard	NM_020243		Approved	TOM22	uc003awe.3	Q9NS69	OTTHUMG00000150991	ENST00000216034.4:c.8C>G	22.37:g.39077991C>G	ENSP00000216034:p.Ala3Gly			Missense_Mutation	SNP	pfam_Tom22	p.A3G	ENST00000216034.4	37	c.8	CCDS13975.1	22	.	.	.	.	.	.	.	.	.	.	C	18.67	3.672939	0.67928	.	.	ENSG00000100216	ENST00000216034	.	.	.	5.45	5.45	0.79879	.	0.442965	0.23041	N	0.052601	T	0.74764	0.3759	L	0.53249	1.67	0.41960	D	0.990701	D	0.58970	0.984	D	0.65443	0.935	T	0.75051	-0.3454	9	0.51188	T	0.08	-3.4227	17.0498	0.86515	0.0:1.0:0.0:0.0	.	3	Q9NS69	TOM22_HUMAN	G	3	.	ENSP00000216034:A3G	A	+	2	0	TOMM22	37407937	0.987000	0.35691	0.985000	0.45067	0.560000	0.35617	1.717000	0.37991	2.547000	0.85894	0.655000	0.94253	GCC	TOMM22	-	NULL	ENSG00000100216		0.687	TOMM22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOMM22	HGNC	protein_coding	OTTHUMT00000320842.1	39	0.00	0	C			39077991	39077991	+1	no_errors	ENST00000216034	ensembl	human	known	69_37n	missense	3	80.00	12	SNP	1.000	G
TPP2	7174	genome.wustl.edu	37	13	103301465	103301465	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr13:103301465A>C	ENST00000376065.4	+	22	2873	c.2837A>C	c.(2836-2838)aAc>aCc	p.N946T	TPP2_ENST00000376052.3_Missense_Mutation_p.N946T	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	946					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)			breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CCCAAATATAACCAGCCATTC	0.343																																						dbGAP											0													137.0	133.0	134.0					13																	103301465		2203	4300	6503	-	-	-	SO:0001583	missense	0			M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.2837A>C	13.37:g.103301465A>C	ENSP00000365233:p.Asn946Thr		Q5VZU8	Missense_Mutation	SNP	pfam_Peptidase_S8/S53,pfam_Peptidase_S8A_TPPII,superfamily_Peptidase_S8/S53,prints_Peptidase_S8_subtilisin-rel	p.N946T	ENST00000376065.4	37	c.2837	CCDS9502.1	13	.	.	.	.	.	.	.	.	.	.	A	3.871	-0.027904	0.07589	.	.	ENSG00000134900	ENST00000376065;ENST00000376052	.	.	.	5.76	4.63	0.57726	Peptidase S8A, tripeptidyl peptidase II (1);	0.191997	0.53938	D	0.000049	T	0.09774	0.0240	N	0.00661	-1.28	0.38063	D	0.936136	B	0.02656	0.0	B	0.01281	0.0	T	0.34054	-0.9844	9	0.02654	T	1	.	3.3318	0.07087	0.6684:0.0:0.3316:0.0	.	946	P29144	TPP2_HUMAN	T	946	.	ENSP00000365220:N946T	N	+	2	0	TPP2	102099466	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	4.181000	0.58303	2.197000	0.70478	0.482000	0.46254	AAC	TPP2	-	pfam_Peptidase_S8A_TPPII	ENSG00000134900		0.343	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPP2	HGNC	protein_coding	OTTHUMT00000045683.2	66	0.00	0	A			103301465	103301465	+1	no_errors	ENST00000376065	ensembl	human	known	69_37n	missense	138	29.44	58	SNP	0.998	C
TRPC4AP	26133	genome.wustl.edu	37	20	33591353	33591353	+	Missense_Mutation	SNP	G	G	C	rs200035230	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr20:33591353G>C	ENST00000252015.2	-	18	2205	c.2116C>G	c.(2116-2118)Ccc>Gcc	p.P706A	TRPC4AP_ENST00000451813.2_Missense_Mutation_p.P698A|TRPC4AP_ENST00000539834.1_Missense_Mutation_p.P308A|TRPC4AP_ENST00000432634.2_Missense_Mutation_p.P667A			Q8TEL6	TP4AP_HUMAN	transient receptor potential cation channel, subfamily C, member 4 associated protein	706					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|protein ubiquitination (GO:0016567)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process (GO:0006511)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|skin(1)|stomach(1)|urinary_tract(1)	32			BRCA - Breast invasive adenocarcinoma(18;0.00936)			AGGTACAGGGGCAGCCGCTCT	0.632																																						dbGAP											0													34.0	33.0	33.0					20																	33591353		2200	4298	6498	-	-	-	SO:0001583	missense	0			AF055022	CCDS13246.1, CCDS46591.1	20q11.23	2014-06-13	2003-10-06	2003-10-08	ENSG00000100991	ENSG00000100991			16181	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 158"""	608430	"""chromosome 20 open reading frame 188"""	C20orf188			Standard	NM_015638		Approved	DKFZP727M231, DKFZp586C1223, dJ756N5.2, TRRP4AP, PPP1R158	uc002xbk.3	Q8TEL6	OTTHUMG00000032319	ENST00000252015.2:c.2116C>G	20.37:g.33591353G>C	ENSP00000252015:p.Pro706Ala		E1P5Q0|E1P5Q1|Q96H82|Q9BVB8|Q9H429|Q9UFS6	Missense_Mutation	SNP	pfam_DUF3689	p.P706A	ENST00000252015.2	37	c.2116	CCDS13246.1	20	.	.	.	.	.	.	.	.	.	.	G	11.28	1.591501	0.28357	.	.	ENSG00000100991	ENST00000252015;ENST00000451813;ENST00000539834;ENST00000432634;ENST00000541994	.	.	.	4.62	3.65	0.41850	.	0.000000	0.85682	D	0.000000	T	0.59797	0.2220	L	0.46157	1.445	0.80722	D	1	D;P;P	0.55800	0.973;0.953;0.953	P;P;P	0.54499	0.754;0.621;0.672	T	0.54899	-0.8224	9	0.16420	T	0.52	.	14.0147	0.64517	0.0:0.0:0.8475:0.1525	.	667;698;706	B4E0Q1;E1P5Q0;Q8TEL6	.;.;TP4AP_HUMAN	A	706;698;308;667;691	.	ENSP00000252015:P706A	P	-	1	0	TRPC4AP	33055014	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	9.616000	0.98359	1.121000	0.41925	0.462000	0.41574	CCC	TRPC4AP	-	pfam_DUF3689	ENSG00000100991		0.632	TRPC4AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC4AP	HGNC	protein_coding	OTTHUMT00000078832.2	176	0.00	0	G	NM_015638		33591353	33591353	-1	no_errors	ENST00000252015	ensembl	human	known	69_37n	missense	52	22.39	15	SNP	1.000	C
TSPAN11	441631	genome.wustl.edu	37	12	31116820	31116820	+	Nonsense_Mutation	SNP	C	C	A	rs200673533	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr12:31116820C>A	ENST00000261177.9	+	3	203	c.144C>A	c.(142-144)taC>taA	p.Y48*	TSPAN11_ENST00000535215.1_5'UTR|TSPAN11_ENST00000544427.1_Nonsense_Mutation_p.Y38*|TSPAN11_ENST00000546076.1_Nonsense_Mutation_p.Y48*	NM_001080509.2	NP_001073978.1	A1L157	TSN11_HUMAN	tetraspanin 11	48						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)	11	all_lung(12;3.11e-10)|Lung NSC(12;5.24e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					AGAGTGGCTACCTCAGCGTCC	0.662																																						dbGAP											0													102.0	89.0	93.0					12																	31116820		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS31765.1	12p11.21	2013-02-14				ENSG00000110900		"""Tetraspanins"""	30795	protein-coding gene	gene with protein product							Standard	NM_001080509		Approved		uc001rjp.3	A1L157		ENST00000261177.9:c.144C>A	12.37:g.31116820C>A	ENSP00000261177:p.Tyr48*		A1L158|B2RUX6	Nonsense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.Y48*	ENST00000261177.9	37	c.144	CCDS31765.1	12	.	.	.	.	.	.	.	.	.	.	C	33	5.197821	0.94997	.	.	ENSG00000110900	ENST00000546076;ENST00000544427;ENST00000261177	.	.	.	3.5	3.5	0.40072	.	0.000000	0.64402	U	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.8516	0.57860	0.0:1.0:0.0:0.0	.	.	.	.	X	48;38;48	.	ENSP00000261177:Y48X	Y	+	3	2	TSPAN11	31008087	1.000000	0.71417	0.995000	0.50966	0.992000	0.81027	1.464000	0.35288	1.652000	0.50683	0.457000	0.33378	TAC	TSPAN11	-	pfam_Tetraspanin/Peripherin	ENSG00000110900		0.662	TSPAN11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TSPAN11	HGNC	protein_coding	OTTHUMT00000399888.1	132	0.00	0	C	XM_497334		31116820	31116820	+1	no_errors	ENST00000261177	ensembl	human	known	69_37n	nonsense	33	47.62	30	SNP	1.000	A
TTC38	55020	genome.wustl.edu	37	22	46669905	46669905	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr22:46669905A>C	ENST00000381031.3	+	4	380	c.304A>C	c.(304-306)Acc>Ccc	p.T102P	TTC38_ENST00000445282.2_Missense_Mutation_p.T102P	NM_017931.2	NP_060401	Q5R3I4	TTC38_HUMAN	tetratricopeptide repeat domain 38	102						extracellular vesicular exosome (GO:0070062)				endometrium(4)|large_intestine(3)|lung(4)|ovary(1)	12						GATTTCAAGAACCCAGCCGCT	0.597																																						dbGAP											0													51.0	58.0	56.0					22																	46669905		2082	4224	6306	-	-	-	SO:0001583	missense	0				CCDS43030.1	22q13	2013-01-11			ENSG00000075234	ENSG00000075234		"""Tetratricopeptide (TTC) repeat domain containing"""	26082	protein-coding gene	gene with protein product							Standard	NM_017931		Approved	FLJ20699	uc003bhi.3	Q5R3I4	OTTHUMG00000150494	ENST00000381031.3:c.304A>C	22.37:g.46669905A>C	ENSP00000370419:p.Thr102Pro		Q8WV27|Q9NWP8	Missense_Mutation	SNP	NULL	p.T102P	ENST00000381031.3	37	c.304	CCDS43030.1	22	.	.	.	.	.	.	.	.	.	.	A	7.567	0.665825	0.14710	.	.	ENSG00000075234	ENST00000381031;ENST00000445282;ENST00000421359	T;D;D	0.83163	0.97;-1.69;-1.69	5.56	-1.37	0.09056	.	0.702115	0.14261	N	0.330817	T	0.72645	0.3486	L	0.60455	1.87	0.09310	N	1	B;B	0.34264	0.446;0.351	B;B	0.31337	0.128;0.128	T	0.59059	-0.7525	10	0.30854	T	0.27	-11.5953	4.5495	0.12105	0.3251:0.0:0.3451:0.3298	.	102;102	E7ES35;Q5R3I4	.;TTC38_HUMAN	P	102	ENSP00000370419:T102P;ENSP00000393960:T102P;ENSP00000410095:T102P	ENSP00000370419:T102P	T	+	1	0	TTC38	45048569	0.000000	0.05858	0.004000	0.12327	0.145000	0.21501	-0.575000	0.05861	-0.236000	0.09753	0.533000	0.62120	ACC	TTC38	-	NULL	ENSG00000075234		0.597	TTC38-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	TTC38	HGNC	protein_coding	OTTHUMT00000318469.1	42	0.00	0	A	NM_017931		46669905	46669905	+1	no_errors	ENST00000445282	ensembl	human	known	69_37n	missense	26	42.22	19	SNP	0.000	C
TTN	7273	genome.wustl.edu	37	2	179633421	179633421	+	Missense_Mutation	SNP	T	T	G	rs74773630		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr2:179633421T>G	ENST00000591111.1	-	38	9366	c.9142A>C	c.(9142-9144)Aca>Cca	p.T3048P	TTN_ENST00000359218.5_Missense_Mutation_p.T3002P|TTN_ENST00000589042.1_Missense_Mutation_p.T3048P|TTN_ENST00000460472.2_Missense_Mutation_p.T3002P|TTN_ENST00000342175.6_Missense_Mutation_p.T3002P|TTN_ENST00000360870.5_Missense_Mutation_p.T3048P|TTN_ENST00000342992.6_Missense_Mutation_p.T3048P|TTN-AS1_ENST00000610005.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13380	Ig-like 17.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGTGTGGCTGTTGATGTTGCT	0.373																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.9142A>C	2.37:g.179633421T>G	ENSP00000465570:p.Thr3048Pro		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.T3048P	ENST00000591111.1	37	c.9142		2	.	.	.	.	.	.	.	.	.	.	T	10.50	1.367901	0.24771	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.68903	-0.36;-0.36;-0.36;-0.36;-0.36	5.81	5.81	0.92471	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.78253	0.4254	M	0.79258	2.445	0.23519	N	0.997509	D;D;D;D;D	0.63880	0.966;0.966;0.966;0.966;0.993	P;P;P;P;P	0.57776	0.69;0.69;0.69;0.575;0.827	T	0.72663	-0.4225	9	0.87932	D	0	.	11.3174	0.49401	0.1671:0.0:0.0:0.8329	.	3002;3002;3002;3048;3048	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	P	3048;3002;3002;3002;3002;3048	ENSP00000343764:T3048P;ENSP00000434586:T3002P;ENSP00000340554:T3002P;ENSP00000352154:T3002P;ENSP00000354117:T3048P	ENSP00000340554:T3002P	T	-	1	0	TTN	179341666	0.651000	0.27340	0.949000	0.38748	0.750000	0.42670	1.039000	0.30266	2.343000	0.79666	0.533000	0.62120	ACA	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub	ENSG00000155657		0.373	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	128	0.00	0	T	NM_133378		179633421	179633421	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	227	20.28	58	SNP	0.805	G
UACA	55075	genome.wustl.edu	37	15	70949398	70949398	+	Silent	SNP	G	G	A	rs145929072	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr15:70949398G>A	ENST00000322954.6	-	19	4433	c.4248C>T	c.(4246-4248)tgC>tgT	p.C1416C	UACA_ENST00000560441.1_Silent_p.C1401C|UACA_ENST00000379983.2_Silent_p.C1403C|UACA_ENST00000539319.1_Silent_p.C1307C	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	1416					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						CTAACGGCTAGCACACAAGCC	0.473																																						dbGAP											0													61.0	59.0	60.0					15																	70949398		2199	4298	6497	-	-	-	SO:0001819	synonymous_variant	0			AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.4248C>T	15.37:g.70949398G>A			G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Prefoldin,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_T_SNARE_dom,prints_Ankyrin_rpt	p.C1416	ENST00000322954.6	37	c.4248	CCDS10235.1	15																																																																																			UACA	-	NULL	ENSG00000137831		0.473	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UACA	HGNC	protein_coding	OTTHUMT00000257199.2	59	0.00	0	G			70949398	70949398	-1	no_errors	ENST00000322954	ensembl	human	known	69_37n	silent	52	50.94	54	SNP	1.000	A
UBL4B	164153	genome.wustl.edu	37	1	110655404	110655404	+	Missense_Mutation	SNP	A	A	C	rs201442584	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr1:110655404A>C	ENST00000334179.3	+	1	343	c.248A>C	c.(247-249)cAc>cCc	p.H83P		NM_203412.1	NP_981957.1	Q8N7F7	UBL4B_HUMAN	ubiquitin-like 4B	83						cytoplasm (GO:0005737)				endometrium(1)|kidney(1)|large_intestine(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	7		all_cancers(81;1.14e-05)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0236)|all cancers(265;0.0823)|Epithelial(280;0.0917)|Colorectal(144;0.109)|LUSC - Lung squamous cell carcinoma(189;0.134)		AAGGAGGCCCACCAGCCGCAG	0.577																																						dbGAP											0													67.0	72.0	70.0					1																	110655404		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS820.1	1p13.3	2013-09-24			ENSG00000186150	ENSG00000186150			32309	protein-coding gene	gene with protein product		611127				16872915	Standard	NM_203412		Approved	FLJ25690	uc001dzc.3	Q8N7F7	OTTHUMG00000166989	ENST00000334179.3:c.248A>C	1.37:g.110655404A>C	ENSP00000334044:p.His83Pro			Missense_Mutation	SNP	pfam_Ubiquitin,pfam_SUMO,smart_Ubiquitin,pfscan_Ubiquitin_supergroup	p.H83P	ENST00000334179.3	37	c.248	CCDS820.1	1	.	.	.	.	.	.	.	.	.	.	A	0.643	-0.812424	0.02798	.	.	ENSG00000186150	ENST00000334179	.	.	.	4.08	-8.16	0.01061	.	1.226840	0.06022	N	0.651404	T	0.04634	0.0126	L	0.33485	1.01	0.09310	N	1	P	0.36438	0.553	B	0.32465	0.146	T	0.13442	-1.0509	9	0.33141	T	0.24	.	0.4956	0.00571	0.3033:0.1201:0.2528:0.3239	.	83	Q8N7F7	UBL4B_HUMAN	P	83	.	ENSP00000334044:H83P	H	+	2	0	UBL4B	110456927	0.000000	0.05858	0.001000	0.08648	0.090000	0.18270	-4.070000	0.00301	-1.471000	0.01886	-0.379000	0.06801	CAC	UBL4B	-	NULL	ENSG00000186150		0.577	UBL4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBL4B	HGNC	protein_coding	OTTHUMT00000392303.1	58	0.00	0	A	NM_203412		110655404	110655404	+1	no_errors	ENST00000334179	ensembl	human	known	69_37n	missense	34	41.94	26	SNP	0.000	C
UROS	7390	genome.wustl.edu	37	10	127477546	127477546	+	Missense_Mutation	SNP	C	C	G	rs201616690		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr10:127477546C>G	ENST00000368797.4	-	10	913	c.689G>C	c.(688-690)cGc>cCc	p.R230P	UROS_ENST00000368786.1_Missense_Mutation_p.R230P	NM_000375.2	NP_000366.1	P10746	HEM4_HUMAN	uroporphyrinogen III synthase	230					cellular response to amine stimulus (GO:0071418)|cellular response to arsenic-containing substance (GO:0071243)|heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to antibiotic (GO:0046677)|small molecule metabolic process (GO:0044281)|uroporphyrinogen III biosynthetic process (GO:0006780)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|uroporphyrinogen-III synthase activity (GO:0004852)			endometrium(2)|large_intestine(2)|lung(2)|skin(1)	7		all_lung(145;0.00756)|Lung NSC(174;0.0116)|Colorectal(57;0.0855)|all_neural(114;0.0937)|Breast(234;0.203)				GGCCAGCGCGCGAGCCGTAGT	0.637																																						dbGAP											0													18.0	24.0	22.0					10																	127477546		2163	4252	6415	-	-	-	SO:0001583	missense	0			J03824	CCDS7648.1	10q25.2-q26.3	2008-07-31	2008-07-31		ENSG00000188690	ENSG00000188690	4.2.1.75		12592	protein-coding gene	gene with protein product	"""congenital erythropoietic porphyria"""	606938				2037278	Standard	NM_000375		Approved		uc001lix.4	P10746	OTTHUMG00000019236	ENST00000368797.4:c.689G>C	10.37:g.127477546C>G	ENSP00000357787:p.Arg230Pro		B2RC13|D3DRF7|Q9H2T1	Missense_Mutation	SNP	pfam_4pyrrol_synth_uPrphyn_synth,superfamily_4pyrrol_synth_uPrphyn_synth	p.R230P	ENST00000368797.4	37	c.689	CCDS7648.1	10	.	.	.	.	.	.	.	.	.	.	C	14.56	2.571012	0.45798	.	.	ENSG00000188690	ENST00000368797;ENST00000368786	D;D	0.92805	-3.11;-3.11	4.93	-0.191	0.13252	Tetrapyrrole biosynthesis, uroporphyrinogen III synthase (2);	0.506728	0.21106	N	0.080072	D	0.88779	0.6529	L	0.58101	1.795	0.09310	N	0.999998	D;P	0.57571	0.98;0.78	P;B	0.47346	0.544;0.432	T	0.81291	-0.0999	10	0.51188	T	0.08	-3.4581	4.7703	0.13153	0.0:0.3728:0.1604:0.4668	.	230;202	P10746;E9PG85	HEM4_HUMAN;.	P	230	ENSP00000357787:R230P;ENSP00000357775:R230P	ENSP00000357775:R230P	R	-	2	0	UROS	127467536	0.004000	0.15560	0.000000	0.03702	0.869000	0.49853	0.111000	0.15458	-0.211000	0.10124	-0.176000	0.13171	CGC	UROS	-	pfam_4pyrrol_synth_uPrphyn_synth,superfamily_4pyrrol_synth_uPrphyn_synth	ENSG00000188690		0.637	UROS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UROS	HGNC	protein_coding	OTTHUMT00000050929.1	32	0.00	0	C	NM_000375		127477546	127477546	-1	no_errors	ENST00000368786	ensembl	human	known	69_37n	missense	12	40.00	8	SNP	0.000	G
USE1	55850	genome.wustl.edu	37	19	17330035	17330035	+	Missense_Mutation	SNP	T	T	G	rs201210102	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr19:17330035T>G	ENST00000263897.5	+	7	483	c.436T>G	c.(436-438)Tcc>Gcc	p.S146A	USE1_ENST00000596136.1_Intron|USE1_ENST00000379776.4_Intron|USE1_ENST00000445667.2_Missense_Mutation_p.S146A	NM_018467.3	NP_060937	Q9NZ43	USE1_HUMAN	unconventional SNARE in the ER 1 homolog (S. cerevisiae)	146					endoplasmic reticulum tubular network organization (GO:0071786)|lysosomal transport (GO:0007041)|protein catabolic process (GO:0030163)|protein transport (GO:0015031)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|secretion by cell (GO:0032940)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|lung(3)	6						AGTGGCAGGGTCCCAGCCAGT	0.517																																						dbGAP											0													34.0	40.0	38.0					19																	17330035		2011	4194	6205	-	-	-	SO:0001583	missense	0			AF220052	CCDS46011.1	19p13.11	2007-08-20				ENSG00000053501			30882	protein-coding gene	gene with protein product	"""Q-SNARE"", ""SNARE-like tail-anchored protein 1 homolog (S. cerevisiae)"""	610675				16354670, 15029241	Standard	NM_018467		Approved	p31, SLT1, MDS032	uc002nfo.2	Q9NZ43		ENST00000263897.5:c.436T>G	19.37:g.17330035T>G	ENSP00000263897:p.Ser146Ala		Q8NCK1|Q9BRT4	Missense_Mutation	SNP	pfam_Vesicle_transport_protein_Use1	p.S146A	ENST00000263897.5	37	c.436	CCDS46011.1	19	.	.	.	.	.	.	.	.	.	.	T	3.631	-0.075492	0.07184	.	.	ENSG00000053501	ENST00000263897;ENST00000445667	T;T	0.40756	1.02;1.02	4.43	-2.55	0.06288	.	0.812302	0.11216	N	0.587183	T	0.20007	0.0481	N	0.19112	0.55	0.49130	D	0.999757	B	0.09022	0.002	B	0.12156	0.007	T	0.31943	-0.9925	10	0.07813	T	0.8	-10.2664	6.5631	0.22497	0.0:0.4171:0.2073:0.3757	.	146	Q9NZ43	USE1_HUMAN	A	146	ENSP00000263897:S146A;ENSP00000390287:S146A	ENSP00000263897:S146A	S	+	1	0	USE1	17191035	0.870000	0.30015	0.005000	0.12908	0.026000	0.11368	0.046000	0.14035	-0.162000	0.10964	-0.415000	0.06103	TCC	USE1	-	pfam_Vesicle_transport_protein_Use1	ENSG00000053501		0.517	USE1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	USE1	HGNC	protein_coding	OTTHUMT00000463295.1	71	0.00	0	T	NM_018467		17330035	17330035	+1	no_errors	ENST00000263897	ensembl	human	known	69_37n	missense	35	51.43	54	SNP	0.386	G
USP10	9100	genome.wustl.edu	37	16	84779261	84779261	+	Missense_Mutation	SNP	G	G	T	rs200790580		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr16:84779261G>T	ENST00000219473.7	+	4	1287	c.1174G>T	c.(1174-1176)Gta>Tta	p.V392L	USP10_ENST00000570191.1_Missense_Mutation_p.V396L	NM_001272075.1|NM_005153.2	NP_001259004.1|NP_005144.2	Q14694	UBP10_HUMAN	ubiquitin specific peptidase 10	392					autophagy (GO:0006914)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA repair (GO:0006281)|protein deubiquitination (GO:0016579)|regulation of autophagy (GO:0010506)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(3)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|stomach(1)|urinary_tract(1)	17						AGAGGATCCTGTAGCCATAAA	0.448																																						dbGAP											0													12.0	13.0	13.0					16																	84779261		1857	4066	5923	-	-	-	SO:0001583	missense	0			D80012	CCDS45537.1, CCDS62004.1	16q	2008-03-25	2005-08-08			ENSG00000103194		"""Ubiquitin-specific peptidases"""	12608	protein-coding gene	gene with protein product		609818	"""ubiquitin specific protease 10"""			12838346	Standard	NM_005153		Approved	UBPO, KIAA0190	uc002fii.3	Q14694		ENST00000219473.7:c.1174G>T	16.37:g.84779261G>T	ENSP00000219473:p.Val392Leu		B2RDJ8|B4DS84|Q9BWG7|Q9NSL7	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Ataxin-2_C,pfscan_Peptidase_C19	p.V396L	ENST00000219473.7	37	c.1186	CCDS45537.1	16	.	.	.	.	.	.	.	.	.	.	G	12.04	1.818759	0.32145	.	.	ENSG00000103194	ENST00000219473	T	0.06449	3.3	5.56	5.56	0.83823	.	0.556530	0.18085	N	0.152178	T	0.08088	0.0202	L	0.55481	1.735	0.43308	D	0.995313	P;B	0.35401	0.499;0.015	B;B	0.29716	0.106;0.008	T	0.34204	-0.9838	10	0.10377	T	0.69	-9.1809	18.5079	0.90904	0.0:0.0:1.0:0.0	.	396;392	Q14694-3;Q14694	.;UBP10_HUMAN	L	392	ENSP00000219473:V392L	ENSP00000219473:V392L	V	+	1	0	USP10	83336762	1.000000	0.71417	0.985000	0.45067	0.979000	0.70002	3.661000	0.54503	2.608000	0.88229	0.561000	0.74099	GTA	USP10	-	NULL	ENSG00000103194		0.448	USP10-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	USP10	HGNC	protein_coding	OTTHUMT00000433660.1	43	0.00	0	G			84779261	84779261	+1	no_errors	ENST00000570191	ensembl	human	known	69_37n	missense	27	41.30	19	SNP	0.989	T
VANGL2	57216	genome.wustl.edu	37	1	160393856	160393856	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr1:160393856T>G	ENST00000368061.2	+	7	1562	c.1088T>G	c.(1087-1089)gTg>gGg	p.V363G	VANGL2_ENST00000483408.1_3'UTR	NM_020335.2	NP_065068.1	Q9ULK5	VANG2_HUMAN	VANGL planar cell polarity protein 2	363					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|cell migration involved in kidney development (GO:0035787)|cochlea morphogenesis (GO:0090103)|convergent extension involved in axis elongation (GO:0060028)|convergent extension involved in neural plate elongation (GO:0022007)|digestive tract morphogenesis (GO:0048546)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity involved in neural tube closure (GO:0090177)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|glomerulus development (GO:0032835)|hair follicle development (GO:0001942)|heart looping (GO:0001947)|inner ear receptor stereocilium organization (GO:0060122)|kidney morphogenesis (GO:0060993)|lateral sprouting involved in lung morphogenesis (GO:0060490)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in axis elongation (GO:0003402)|planar cell polarity pathway involved in heart morphogenesis (GO:0061346)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|positive regulation of JUN kinase activity (GO:0043507)|post-anal tail morphogenesis (GO:0036342)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Wnt signaling pathway (GO:0030111)|Rho protein signal transduction (GO:0007266)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell pole (GO:0060187)|cell-cell junction (GO:0005911)|ER to Golgi transport vesicle (GO:0030134)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)				biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	37	all_cancers(52;1.08e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GTAGTGGCGGTGGAGGAGGCC	0.627																																						dbGAP											0													51.0	57.0	55.0					1																	160393856		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB033041	CCDS30915.1	1q22-q23	2013-03-05	2013-03-05		ENSG00000162738	ENSG00000162738			15511	protein-coding gene	gene with protein product	"""vang, van gogh-like 2"", ""loop-tail-associated protein"", ""strabismus"""	600533	"""vang (van gogh, Drosophila)-like 2, vang, van gogh-like 2 (Drosophila)"", ""vang-like 2 (van gogh, Drosophila)"""			11431695	Standard	NM_020335		Approved	KIAA1215, LTAP, LPP1, STBM, STB1, STBM1, MGC119403, MGC119404	uc001fwc.2	Q9ULK5	OTTHUMG00000033122	ENST00000368061.2:c.1088T>G	1.37:g.160393856T>G	ENSP00000357040:p.Val363Gly		D3DVE9|Q5T212	Missense_Mutation	SNP	pfam_Strabismus,pirsf_Strabismus	p.V363G	ENST00000368061.2	37	c.1088	CCDS30915.1	1	.	.	.	.	.	.	.	.	.	.	T	13.97	2.396398	0.42512	.	.	ENSG00000162738	ENST00000368061	D	0.83250	-1.7	4.03	4.03	0.46877	.	0.136031	0.48767	N	0.000166	T	0.72843	0.3511	M	0.72118	2.19	0.80722	D	1	B	0.06786	0.001	B	0.10450	0.005	T	0.74256	-0.3724	10	0.41790	T	0.15	-15.405	12.4987	0.55944	0.0:0.0:0.0:1.0	.	363	Q9ULK5	VANG2_HUMAN	G	363	ENSP00000357040:V363G	ENSP00000357040:V363G	V	+	2	0	VANGL2	158660480	1.000000	0.71417	0.990000	0.47175	0.560000	0.35617	6.119000	0.71590	1.780000	0.52325	0.448000	0.29417	GTG	VANGL2	-	pfam_Strabismus,pirsf_Strabismus	ENSG00000162738		0.627	VANGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VANGL2	HGNC	protein_coding	OTTHUMT00000080677.1	58	0.00	0	T	NM_020335		160393856	160393856	+1	no_errors	ENST00000368061	ensembl	human	known	69_37n	missense	23	64.06	41	SNP	1.000	G
WDR4	10785	genome.wustl.edu	37	21	44299550	44299550	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr21:44299550C>G	ENST00000398208.2	-	1	115	c.56G>C	c.(55-57)gGc>gCc	p.G19A	WDR4_ENST00000330317.2_Missense_Mutation_p.G19A|WDR4_ENST00000492742.1_5'Flank	NM_001260474.1|NM_001260475.1|NM_001260476.1|NM_018669.5	NP_001247403.1|NP_001247404.1|NP_001247405.1|NP_061139.2			WD repeat domain 4											haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|ovary(2)	11				Colorectal(79;0.0165)|Lung(125;0.0484)|STAD - Stomach adenocarcinoma(101;0.0624)|COAD - Colon adenocarcinoma(84;0.128)|LUSC - Lung squamous cell carcinoma(216;0.244)		GAATCGGCTGCCGCCCCGCAC	0.697																																						dbGAP											0													66.0	73.0	71.0					21																	44299550		2203	4299	6502	-	-	-	SO:0001583	missense	0			AJ243912	CCDS13691.1	21q22.3	2013-01-09			ENSG00000160193	ENSG00000160193		"""WD repeat domain containing"""	12756	protein-coding gene	gene with protein product	"""TRM82 tRNA methyltransferase 82 homolog (S. cerevisiae)"""	605924				12403464	Standard	NM_018669		Approved	TRM82, TRMT82	uc002zci.4	P57081	OTTHUMG00000086826	ENST00000398208.2:c.56G>C	21.37:g.44299550C>G	ENSP00000381266:p.Gly19Ala			Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G19A	ENST00000398208.2	37	c.56	CCDS13691.1	21	.	.	.	.	.	.	.	.	.	.	C	22.0	4.234011	0.79688	.	.	ENSG00000160193	ENST00000330317;ENST00000398208	T;T	0.60040	0.22;0.22	4.4	4.4	0.53042	.	0.071683	0.56097	D	0.000040	T	0.60392	0.2265	M	0.62723	1.935	0.37472	D	0.915647	P;P	0.51351	0.944;0.908	P;B	0.48270	0.572;0.368	T	0.68481	-0.5397	10	0.51188	T	0.08	-33.0495	12.343	0.55105	0.0:1.0:0.0:0.0	.	19;19	P57081-2;P57081	.;WDR4_HUMAN	A	19	ENSP00000328671:G19A;ENSP00000381266:G19A	ENSP00000328671:G19A	G	-	2	0	WDR4	43172619	0.994000	0.37717	1.000000	0.80357	0.976000	0.68499	2.698000	0.47068	2.269000	0.75478	0.555000	0.69702	GGC	WDR4	-	NULL	ENSG00000160193		0.697	WDR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR4	HGNC	protein_coding	OTTHUMT00000195479.1	109	0.00	0	C			44299550	44299550	-1	no_errors	ENST00000330317	ensembl	human	known	69_37n	missense	50	30.56	22	SNP	1.000	G
XIRP2	129446	genome.wustl.edu	37	2	168115717	168115717	+	Silent	SNP	A	A	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-10A-01D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	bf856604-4326-4145-bc3c-137098338f61	g.chr2:168115717A>G	ENST00000409728.1	+	11	2849	c.2760A>G	c.(2758-2760)acA>acG	p.T920T	XIRP2_ENST00000295237.9_3'UTR|XIRP2_ENST00000409195.1_3'UTR|XIRP2_ENST00000409273.1_3'UTR|XIRP2_ENST00000409605.1_Silent_p.T665T|XIRP2_ENST00000409756.2_Silent_p.T887T|XIRP2_ENST00000420519.1_Silent_p.T920T|XIRP2_ENST00000409043.1_Silent_p.T887T	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	0					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						ATGTTGAAACAACAGAAGCTG	0.388																																						dbGAP											0													94.0	86.0	89.0					2																	168115717		1874	4112	5986	-	-	-	SO:0001819	synonymous_variant	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.2760A>G	2.37:g.168115717A>G			A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.T920	ENST00000409728.1	37	c.2760	CCDS56143.1	2																																																																																			XIRP2	-	NULL	ENSG00000163092		0.388	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333552.1	127	0.00	0	A	NM_152381		168115717	168115717	+1	no_errors	ENST00000420519	ensembl	human	known	69_37n	silent	75	39.52	49	SNP	0.000	G
XIRP2	129446	genome.wustl.edu	37	2	168115717	168115717	+	Silent	SNP	A	A	G			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr2:168115717A>G	ENST00000409728.1	+	11	2849	c.2760A>G	c.(2758-2760)acA>acG	p.T920T	XIRP2_ENST00000295237.9_3'UTR|XIRP2_ENST00000409195.1_3'UTR|XIRP2_ENST00000409273.1_3'UTR|XIRP2_ENST00000409605.1_Silent_p.T665T|XIRP2_ENST00000409756.2_Silent_p.T887T|XIRP2_ENST00000420519.1_Silent_p.T920T|XIRP2_ENST00000409043.1_Silent_p.T887T	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	0					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						ATGTTGAAACAACAGAAGCTG	0.388																																						dbGAP											0													94.0	86.0	89.0					2																	168115717		1874	4112	5986	-	-	-	SO:0001819	synonymous_variant	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.2760A>G	2.37:g.168115717A>G			A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.T920	ENST00000409728.1	37	c.2760	CCDS56143.1	2																																																																																			XIRP2	-	NULL	ENSG00000163092		0.388	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333552.1	54	0.00	0	A	NM_152381		168115717	168115717	+1	no_errors	ENST00000420519	ensembl	human	known	69_37n	silent	75	39.52	49	SNP	0.000	G
ZNF142	7701	genome.wustl.edu	37	2	219507438	219507438	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr2:219507438G>T	ENST00000449707.1	-	8	4222	c.3801C>A	c.(3799-3801)taC>taA	p.Y1267*	ZNF142_ENST00000411696.2_Nonsense_Mutation_p.Y1267*	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	1267					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		CATGGCGAAGGTAGCCACTAT	0.537																																					Colon(170;867 1942 8995 15834 18053)	dbGAP											0													64.0	71.0	69.0					2																	219507438		2128	4234	6362	-	-	-	SO:0001587	stop_gained	0			U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.3801C>A	2.37:g.219507438G>T	ENSP00000408643:p.Tyr1267*		Q92510	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Y1267*	ENST00000449707.1	37	c.3801	CCDS42817.1	2	.	.	.	.	.	.	.	.	.	.	G	47	13.004119	0.99712	.	.	ENSG00000115568	ENST00000449707;ENST00000411696	.	.	.	5.3	-0.452	0.12205	.	0.111696	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-46.6382	14.3705	0.66836	0.1546:0.0:0.8454:0.0	.	.	.	.	X	1267	.	ENSP00000398798:Y1267X	Y	-	3	2	ZNF142	219215682	1.000000	0.71417	0.990000	0.47175	0.987000	0.75469	2.732000	0.47352	-0.265000	0.09352	-0.320000	0.08662	TAC	ZNF142	-	smart_Znf_C2H2-like	ENSG00000115568		0.537	ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF142	HGNC	protein_coding	OTTHUMT00000336833.1	81	0.00	0	G	NM_005081		219507438	219507438	-1	no_errors	ENST00000411696	ensembl	human	known	69_37n	nonsense	32	38.89	21	SNP	0.959	T
ZNF425	155054	genome.wustl.edu	37	7	148800715	148800715	+	Missense_Mutation	SNP	A	A	G	rs199691259	byFrequency	TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr7:148800715A>G	ENST00000378061.2	-	4	2380	c.2248T>C	c.(2248-2250)Tcc>Ccc	p.S750P		NM_001001661.2	NP_001001661.1	Q6IV72	ZN425_HUMAN	zinc finger protein 425	750					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(6)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	50	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			TAGAGGCTGGAGGGCTTCTCT	0.567																																						dbGAP											0													44.0	41.0	42.0					7																	148800715		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056498	CCDS34773.1	7q36.1	2013-01-08			ENSG00000204947	ENSG00000204947		"""Zinc fingers, C2H2-type"", ""-"""	20690	protein-coding gene	gene with protein product							Standard	NM_001001661		Approved		uc003wfj.3	Q6IV72	OTTHUMG00000158971	ENST00000378061.2:c.2248T>C	7.37:g.148800715A>G	ENSP00000367300:p.Ser750Pro		B3KPM1|Q08AG3	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.S750P	ENST00000378061.2	37	c.2248	CCDS34773.1	7	.	.	.	.	.	.	.	.	.	.	A	10.33	1.320895	0.23994	.	.	ENSG00000204947	ENST00000378061	T	0.07908	3.15	2.45	-3.31	0.04988	.	.	.	.	.	T	0.06280	0.0162	L	0.39898	1.24	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39522	-0.9610	9	0.87932	D	0	.	3.9714	0.09455	0.3898:0.0:0.4317:0.1785	.	750	Q6IV72	ZN425_HUMAN	P	750	ENSP00000367300:S750P	ENSP00000367300:S750P	S	-	1	0	ZNF425	148431648	0.002000	0.14202	0.000000	0.03702	0.014000	0.08584	0.537000	0.23144	-0.656000	0.05380	0.533000	0.62120	TCC	ZNF425	-	NULL	ENSG00000204947		0.567	ZNF425-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF425	HGNC	protein_coding	OTTHUMT00000352726.1	59	0.00	0	A	XM_088140		148800715	148800715	-1	no_errors	ENST00000378061	ensembl	human	known	69_37n	missense	38	37.70	23	SNP	0.011	G
ZNF451	26036	genome.wustl.edu	37	6	56965972	56965972	+	Intron	SNP	C	C	T			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr6:56965972C>T	ENST00000370706.4	+	3	430				ZNF451_ENST00000370708.4_Missense_Mutation_p.P253L|ZNF451_ENST00000357489.3_Intron|ZNF451_ENST00000370702.1_Intron|ZNF451_ENST00000491832.2_Intron	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			CCATCTGACCCCAGCCAATCT	0.418																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.186+2033C>T	6.37:g.56965972C>T			Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Missense_Mutation	SNP	pfam_LAP2alpha	p.P253L	ENST00000370706.4	37	c.758	CCDS43477.1	6	.	.	.	.	.	.	.	.	.	.	C	13.82	2.350899	0.41599	.	.	ENSG00000112200	ENST00000370708	T	0.77358	-1.09	4.42	1.54	0.23209	.	.	.	.	.	T	0.33818	0.0876	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.18366	-1.0339	9	0.44086	T	0.13	.	2.8166	0.05457	0.2004:0.528:0.1716:0.0999	.	253	Q9Y4E5-4	.	L	253	ENSP00000359742:P253L	ENSP00000359742:P253L	P	+	2	0	ZNF451	57073931	0.674000	0.27549	0.991000	0.47740	0.924000	0.55760	0.328000	0.19681	0.324000	0.23333	0.591000	0.81541	CCC	ZNF451	-	NULL	ENSG00000112200		0.418	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF451	HGNC	protein_coding	OTTHUMT00000041035.2	26	0.00	0	C	NM_015555		56965972	56965972	+1	no_errors	ENST00000370708	ensembl	human	known	69_37n	missense	0	100.00	2	SNP	0.993	T
ZNF595	152687	genome.wustl.edu	37	4	53277	53277	+	5'UTR	SNP	G	G	C			TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr4:53277G>C	ENST00000509152.2	+	0	80				ZNF595_ENST00000339368.6_3'UTR|ZNF595_ENST00000526473.2_5'UTR			Q8IYB9	ZN595_HUMAN	zinc finger protein 595						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)	20		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		TCTCGGCTCCGGGAGGCCTCG	0.602																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			BX537887	CCDS75075.1, CCDS75076.1, CCDS75077.1	4p16.3	2013-01-08				ENSG00000272602		"""Zinc fingers, C2H2-type"", ""-"""	27196	protein-coding gene	gene with protein product						12477932	Standard	NM_182524		Approved	FLJ31740		Q8IYB9		ENST00000509152.2:c.-106G>C	4.37:g.53277G>C				RNA	SNP	-	NULL	ENST00000509152.2	37	NULL		4																																																																																			ZNF595	-	-	ENSG00000197701		0.602	ZNF595-004	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	ZNF595	HGNC	protein_coding	OTTHUMT00000357817.2	203	0.00	0	G	NM_182524		53277	53277	+1	no_errors	ENST00000339368	ensembl	human	known	69_37n	rna	247	37.50	150	SNP	0.004	C
ZZZ3	26009	genome.wustl.edu	37	1	78099032	78099032	+	Missense_Mutation	SNP	G	G	C	rs77366957		TCGA-E2-A15I-01A-21D-A135-09	TCGA-E2-A15I-11A-32D-A135-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9bec02b4-7cf0-4797-b1ac-253ef78a34af	cc8284b1-f404-4283-b41b-006f9402d472	g.chr1:78099032G>C	ENST00000370801.3	-	5	483	c.8C>G	c.(7-9)gCt>gGt	p.A3G	ZZZ3_ENST00000476275.1_5'Flank|ZZZ3_ENST00000370798.1_Intron	NM_015534.4	NP_056349.1	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3	3					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(2)	39						AGATCGGGAAGCAGCCATACT	0.398																																						dbGAP											0													41.0	42.0	42.0					1																	78099032		2194	4272	6466	-	-	-	SO:0001583	missense	0			AL080063	CCDS677.1	1p31.1	2012-08-13			ENSG00000036549	ENSG00000036549		"""Zinc fingers, ZZ-type"""	24523	protein-coding gene	gene with protein product	"""ATAC component 1 homolog (Drosophila)"""					16428443, 21304275	Standard	NM_015534		Approved	DKFZP564I052, ATAC1	uc001dhq.3	Q8IYH5	OTTHUMG00000009652	ENST00000370801.3:c.8C>G	1.37:g.78099032G>C	ENSP00000359837:p.Ala3Gly		B7WPC6|Q6N004|Q6N070|Q8IYP0|Q8IYR1|Q8TEK4|Q9Y4U0	Missense_Mutation	SNP	pfam_SANT/Myb,pfam_Znf_ZZ,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Znf_ZZ,pfscan_Myb-like_dom	p.A3G	ENST00000370801.3	37	c.8	CCDS677.1	1	.	.	.	.	.	.	.	.	.	.	G	17.80	3.478927	0.63849	.	.	ENSG00000036549	ENST00000370801;ENST00000433749;ENST00000414381	.	.	.	5.57	5.57	0.84162	.	0.057061	0.64402	D	0.000001	T	0.66645	0.2810	L	0.56769	1.78	0.80722	D	1	P;P;P	0.48503	0.911;0.856;0.911	P;B;P	0.52823	0.71;0.322;0.521	T	0.68443	-0.5407	9	0.66056	D	0.02	.	19.9467	0.97184	0.0:0.0:1.0:0.0	.	3;3;3	Q8IYH5-4;Q8IYH5;Q8IYH5-2	.;ZZZ3_HUMAN;.	G	3	.	ENSP00000359837:A3G	A	-	2	0	ZZZ3	77871620	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.476000	0.97823	2.788000	0.95919	0.650000	0.86243	GCT	ZZZ3	-	NULL	ENSG00000036549		0.398	ZZZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZZ3	HGNC	protein_coding	OTTHUMT00000026615.1	48	0.00	0	G	NM_015534		78099032	78099032	-1	no_errors	ENST00000370801	ensembl	human	known	69_37n	missense	24	51.02	25	SNP	1.000	C
