#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCC9	10060	genome.wustl.edu	37	12	21962817	21962817	+	Silent	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr12:21962817C>T	ENST00000261201.4	-	35	4283	c.4284G>A	c.(4282-4284)aaG>aaA	p.K1428K	ABCC9_ENST00000261200.4_Silent_p.K1428K|ABCC9_ENST00000345162.2_Silent_p.K1392K	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	1428	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	TGACCATATTCTTCAGCTGAG	0.333																																						dbGAP											0													97.0	100.0	99.0					12																	21962817		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.4284G>A	12.37:g.21962817C>T			O60707	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,prints_Sulphorea_rcpt,prints_Sulphonylurea_rcpt-2,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.K1428	ENST00000261201.4	37	c.4284	CCDS8694.1	12																																																																																			ABCC9	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000069431		0.333	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	ABCC9	HGNC	protein_coding	OTTHUMT00000402230.1	58	0.00	0	C	NM_005691		21962817	21962817	-1	no_errors	ENST00000261200	ensembl	human	known	69_37n	silent	18	35.71	10	SNP	1.000	T
ADAM6	8755	genome.wustl.edu	37	14	106437799	106437799	+	lincRNA	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr14:106437799G>A	ENST00000452053.1	-	0	559					NR_002224.2				ADAM metallopeptidase domain 6, pseudogene																		AATCCTGGAGGGGTTTGATTT	0.542																																						dbGAP											0																																										-	-	-			0			AI024595		14q32.33	2013-09-05	2012-08-22		ENSG00000233988	ENSG00000271968		"""ADAM metallopeptidase domain containing"""	213	pseudogene	pseudogene			"""chromosome 14 open reading frame 96"", ""a disintegrin and metalloproteinase domain 6"", ""ADAM metallopeptidase domain 6"""	C14orf96			Standard	NR_002224		Approved	tMDCIV	uc001ysu.1		OTTHUMG00000152319		14.37:g.106437799G>A				RNA	SNP	-	NULL	ENST00000452053.1	37	NULL		14																																																																																			ADAM6	-	-	ENSG00000233988		0.542	ADAM6-001	KNOWN	basic	lincRNA	ADAM6	HGNC	lincRNA	OTTHUMT00000325881.1	34	0.00	0	G	NR_002224		106437799	106437799	-1	no_errors	ENST00000452053	ensembl	human	known	69_37n	rna	20	41.18	14	SNP	0.923	A
AP4E1	23431	genome.wustl.edu	37	15	51289803	51289803	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr15:51289803C>T	ENST00000261842.5	+	18	2733	c.2627C>T	c.(2626-2628)tCa>tTa	p.S876L	AP4E1_ENST00000560508.1_Missense_Mutation_p.S801L	NM_001252127.1|NM_007347.4	NP_001239056.1|NP_031373.2	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1 subunit	876					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	coated pit (GO:0005905)|Golgi apparatus (GO:0005794)|membrane coat (GO:0030117)				breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(5)|skin(2)	27				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		TCTACACCTTCATTGTTTGCT	0.378																																						dbGAP											0													114.0	110.0	111.0					15																	51289803		2196	4294	6490	-	-	-	SO:0001583	missense	0			AB030653	CCDS32240.1, CCDS58362.1	15q21.2	2014-09-17			ENSG00000081014	ENSG00000081014			573	protein-coding gene	gene with protein product		607244				10436028, 21620353	Standard	NM_007347		Approved	AP-4-EPSILON, SPG51	uc001zyx.2	Q9UPM8	OTTHUMG00000172458	ENST00000261842.5:c.2627C>T	15.37:g.51289803C>T	ENSP00000261842:p.Ser876Leu		A0AVD6|A1L4A9|A6NNX7|H0YKX4|Q68D31|Q9Y588	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Coatomer_bsu_C,superfamily_ARM-type_fold,pirsf_AP4_complex_esu	p.S876L	ENST00000261842.5	37	c.2627	CCDS32240.1	15	.	.	.	.	.	.	.	.	.	.	C	15.05	2.717032	0.48622	.	.	ENSG00000081014	ENST00000261842	T	0.19394	2.15	5.47	5.47	0.80525	Coatomer, beta subunit, C-terminal (1);	0.338920	0.31290	N	0.007912	T	0.34629	0.0904	L	0.54323	1.7	0.30590	N	0.761651	P	0.40000	0.698	P	0.48368	0.575	T	0.24693	-1.0153	10	0.87932	D	0	-10.1422	18.3207	0.90237	0.0:1.0:0.0:0.0	.	876	Q9UPM8	AP4E1_HUMAN	L	876	ENSP00000261842:S876L	ENSP00000261842:S876L	S	+	2	0	AP4E1	49077095	0.945000	0.32115	0.141000	0.22245	0.104000	0.19210	5.313000	0.65798	2.558000	0.86282	0.467000	0.42956	TCA	AP4E1	-	pfam_Coatomer_bsu_C,pirsf_AP4_complex_esu	ENSG00000081014		0.378	AP4E1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	AP4E1	HGNC	protein_coding	OTTHUMT00000418656.1	46	0.00	0	C			51289803	51289803	+1	no_errors	ENST00000261842	ensembl	human	known	69_37n	missense	29	23.68	9	SNP	0.382	T
ADAMTS17	170691	genome.wustl.edu	37	15	100672300	100672300	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr15:100672300C>T	ENST00000268070.4	-	12	1738	c.1633G>A	c.(1633-1635)Gac>Aac	p.D545N	RP11-90E5.1_ENST00000560128.1_RNA	NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	545	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		GGGCTCCAGTCTCCGTCCACA	0.672											OREG0023513	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													37.0	38.0	38.0					15																	100672300		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.1633G>A	15.37:g.100672300C>T	ENSP00000268070:p.Asp545Asn	1353	Q2I7G4|Q6ZN75	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.D545N	ENST00000268070.4	37	c.1633	CCDS10383.1	15	.	.	.	.	.	.	.	.	.	.	C	28.9	4.962286	0.92791	.	.	ENSG00000140470	ENST00000268070;ENST00000378898	T	0.17691	2.26	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.09818	0.0241	N	0.00630	-1.315	0.80722	D	1	P;B	0.49253	0.921;0.134	P;B	0.50231	0.635;0.03	T	0.54450	-0.8292	10	0.22109	T	0.4	.	18.8106	0.92056	0.0:1.0:0.0:0.0	.	302;545	Q8TE56-2;Q8TE56	.;ATS17_HUMAN	N	545;302	ENSP00000268070:D545N	ENSP00000268070:D545N	D	-	1	0	ADAMTS17	98489823	1.000000	0.71417	0.999000	0.59377	0.973000	0.67179	7.194000	0.77789	2.423000	0.82170	0.561000	0.74099	GAC	ADAMTS17	-	superfamily_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000140470		0.672	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS17	HGNC	protein_coding	OTTHUMT00000313595.1	39	0.00	0	C	NM_139057		100672300	100672300	-1	no_errors	ENST00000268070	ensembl	human	known	69_37n	missense	19	44.12	15	SNP	1.000	T
APC2	10297	genome.wustl.edu	37	19	1468432	1468432	+	Nonsense_Mutation	SNP	C	C	A	rs140312684		TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr19:1468432C>A	ENST00000535453.1	+	14	6845	c.5132C>A	c.(5131-5133)tCg>tAg	p.S1711*	APC2_ENST00000238483.4_Nonsense_Mutation_p.S1437*|C19orf25_ENST00000588427.1_Intron|APC2_ENST00000233607.2_Nonsense_Mutation_p.S1711*			P02655	APOC2_HUMAN	adenomatosis polyposis coli 2	0					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|chylomicron remnant clearance (GO:0034382)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle clearance (GO:0034384)|lipid catabolic process (GO:0016042)|lipoprotein metabolic process (GO:0042157)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipid catabolic process (GO:0060697)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|very-low-density lipoprotein particle remodeling (GO:0034372)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|kidney(4)|large_intestine(2)|lung(5)|pancreas(1)|skin(2)	18		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGGAGGCCTCGTCCGAGTCC	0.652																																						dbGAP											0													15.0	19.0	18.0					19																	1468432		2182	4292	6474	-	-	-	SO:0001587	stop_gained	0				CCDS12068.1	19p13.3	2013-02-14			ENSG00000115266	ENSG00000115266		"""Armadillo repeat containing"""	24036	protein-coding gene	gene with protein product	"""adenomatous polyposis coli like"""	612034				9823329, 10021369	Standard	XM_005259475		Approved	APCL	uc002lsr.1	O95996		ENST00000535453.1:c.5132C>A	19.37:g.1468432C>A	ENSP00000442954:p.Ser1711*		C0JYY4|Q9BS39|Q9UDE3|Q9UNK3	Nonsense_Mutation	SNP	pfam_APC_basic_dom,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_SAMP,superfamily_ARM-type_fold,superfamily_Prefoldin,smart_Armadillo	p.S1711*	ENST00000535453.1	37	c.5132	CCDS12068.1	19	.	.	.	.	.	.	.	.	.	.	c	44	10.974929	0.99497	.	.	ENSG00000115266	ENST00000233607;ENST00000238483;ENST00000535453	.	.	.	3.86	3.86	0.44501	.	0.383854	0.27595	N	0.018671	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.1819	14.3866	0.66949	0.0:1.0:0.0:0.0	.	.	.	.	X	1711;1437;1711	.	ENSP00000233607:S1711X	S	+	2	0	APC2	1419432	1.000000	0.71417	0.638000	0.29380	0.074000	0.17049	5.167000	0.64972	1.727000	0.51537	0.394000	0.25966	TCG	APC2	-	NULL	ENSG00000115266		0.652	APC2-004	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	APC2	HGNC	protein_coding	OTTHUMT00000449539.2	10	0.00	0	C	NM_005883		1468432	1468432	+1	no_errors	ENST00000233607	ensembl	human	known	69_37n	nonsense	2	75.00	6	SNP	0.998	A
ARID4A	5926	genome.wustl.edu	37	14	58785449	58785449	+	Missense_Mutation	SNP	A	A	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr14:58785449A>T	ENST00000355431.3	+	7	748	c.375A>T	c.(373-375)ttA>ttT	p.L125F	ARID4A_ENST00000348476.3_Missense_Mutation_p.L125F|ARID4A_ENST00000431317.2_Missense_Mutation_p.L125F|ARID4A_ENST00000395168.3_Missense_Mutation_p.L125F	NM_002892.3	NP_002883.3	P29374	ARI4A_HUMAN	AT rich interactive domain 4A (RBP1-like)	125					erythrocyte development (GO:0048821)|histone H3-K4 trimethylation (GO:0080182)|histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|central_nervous_system(1)|cervix(4)|endometrium(8)|kidney(2)|large_intestine(14)|lung(19)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						AGCTTCCATTAACAAATCCAG	0.368																																						dbGAP											0													76.0	78.0	77.0					14																	58785449		2203	4300	6503	-	-	-	SO:0001583	missense	0			S57153	CCDS9732.1, CCDS9733.1, CCDS45114.1	14q22.3	2013-02-07	2004-01-28	2004-01-28	ENSG00000032219	ENSG00000032219		"""-"""	9885	protein-coding gene	gene with protein product		180201	"""retinoblastoma-binding protein 1"""	RBBP1		1857421, 8455946	Standard	NM_023000		Approved	RBP1, RBP-1	uc001xdp.3	P29374	OTTHUMG00000140320	ENST00000355431.3:c.375A>T	14.37:g.58785449A>T	ENSP00000347602:p.Leu125Phe		Q15991|Q15992|Q15993	Missense_Mutation	SNP	pfam_RBB1NT,pfam_ARID/BRIGHT_DNA-bd,pfam_Tudor-knot,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Chromodomain-like,smart_Tudor,smart_ARID/BRIGHT_DNA-bd,smart_Chromo_domain/shadow,pfscan_ARID/BRIGHT_DNA-bd	p.L125F	ENST00000355431.3	37	c.375	CCDS9732.1	14	.	.	.	.	.	.	.	.	.	.	A	22.0	4.229420	0.79688	.	.	ENSG00000032219	ENST00000355431;ENST00000348476;ENST00000395168;ENST00000445108;ENST00000431317	T;T;T;T	0.48836	0.81;0.8;0.86;0.8	5.8	3.26	0.37387	.	0.000000	0.85682	D	0.000000	T	0.66886	0.2835	M	0.82323	2.585	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.68895	-0.5288	10	0.87932	D	0	-11.0817	8.5006	0.33156	0.8006:0.1309:0.0685:0.0	.	125;125;125	P29374-3;P29374;P29374-2	.;ARI4A_HUMAN;.	F	125;125;125;88;125	ENSP00000347602:L125F;ENSP00000344556:L125F;ENSP00000378597:L125F;ENSP00000397368:L125F	ENSP00000344556:L125F	L	+	3	2	ARID4A	57855202	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.040000	0.30278	0.980000	0.38523	0.459000	0.35465	TTA	ARID4A	-	NULL	ENSG00000032219		0.368	ARID4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID4A	HGNC	protein_coding	OTTHUMT00000276927.2	48	0.00	0	A	NM_023001		58785449	58785449	+1	no_errors	ENST00000355431	ensembl	human	known	69_37n	missense	23	50.00	23	SNP	1.000	T
ASCC2	84164	genome.wustl.edu	37	22	30198146	30198146	+	Missense_Mutation	SNP	C	C	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr22:30198146C>A	ENST00000397771.2	-	15	1582	c.1405G>T	c.(1405-1407)Gac>Tac	p.D469Y	ASCC2_ENST00000307790.3_Missense_Mutation_p.D469Y|ASCC2_ENST00000542393.1_Missense_Mutation_p.D393Y			Q9H1I8	ASCC2_HUMAN	activating signal cointegrator 1 complex subunit 2	469	CUE. {ECO:0000255|PROSITE- ProRule:PRU00468}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					endometrium(3)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(5;0.000103)|Epithelial(10;0.0169)|all cancers(5;0.0259)			ATGAGAGAGTCCAGTTCCACC	0.607																																						dbGAP											0													68.0	63.0	64.0					22																	30198146		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY013289	CCDS13869.1, CCDS56226.1	22q12.1	2004-07-27			ENSG00000100325	ENSG00000100325			24103	protein-coding gene	gene with protein product	"""ASC 1 complex subunit P100"""	614216				12077347, 9847074	Standard	NM_032204		Approved	ASC1p100, FLJ21588, DKFZp586O0223	uc003agr.3	Q9H1I8	OTTHUMG00000067658	ENST00000397771.2:c.1405G>T	22.37:g.30198146C>A	ENSP00000380877:p.Asp469Tyr		B7Z8E0|F5H6J9|Q4TT54|Q8TAZ0|Q9H711|Q9H9D6	Missense_Mutation	SNP	pfam_CUE,superfamily_UBA-like,smart_CUE,pfscan_CUE	p.D469Y	ENST00000397771.2	37	c.1405	CCDS13869.1	22	.	.	.	.	.	.	.	.	.	.	C	25.0	4.591382	0.86851	.	.	ENSG00000100325	ENST00000307790;ENST00000397771;ENST00000542393	T;T;T	0.44083	0.93;0.93;0.93	5.64	5.64	0.86602	Ubiquitin system component Cue (3);UBA-like (1);	0.093571	0.64402	D	0.000001	T	0.66645	0.2810	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.99	T	0.67496	-0.5656	10	0.72032	D	0.01	-30.5421	18.8715	0.92317	0.0:1.0:0.0:0.0	.	393;469	F5H6J9;Q9H1I8	.;ASCC2_HUMAN	Y	469;469;393	ENSP00000305502:D469Y;ENSP00000380877:D469Y;ENSP00000437570:D393Y	ENSP00000305502:D469Y	D	-	1	0	ASCC2	28528146	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	6.907000	0.75724	2.937000	0.99478	0.650000	0.86243	GAC	ASCC2	-	pfam_CUE,superfamily_UBA-like,smart_CUE,pfscan_CUE	ENSG00000100325		0.607	ASCC2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ASCC2	HGNC	protein_coding	OTTHUMT00000322127.1	49	0.00	0	C	NM_032204		30198146	30198146	-1	no_errors	ENST00000307790	ensembl	human	known	69_37n	missense	10	61.54	16	SNP	1.000	A
ASCC3	10973	genome.wustl.edu	37	6	100988257	100988257	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr6:100988257C>T	ENST00000369162.2	-	37	5901	c.5557G>A	c.(5557-5559)Gaa>Aaa	p.E1853K		NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	1853	SEC63 2.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		GTATATTCTTCTGCATCCTGA	0.328																																						dbGAP											0													73.0	65.0	68.0					6																	100988257		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.5557G>A	6.37:g.100988257C>T	ENSP00000358159:p.Glu1853Lys		E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	pfam_Sec63-dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_AAA+_ATPase,smart_Helicase_C,smart_Sec63-dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E1853K	ENST00000369162.2	37	c.5557	CCDS5046.1	6	.	.	.	.	.	.	.	.	.	.	C	15.18	2.757956	0.49468	.	.	ENSG00000112249	ENST00000369162	T	0.60171	0.21	5.78	4.91	0.64330	Sec63 domain (3);	0.056152	0.64402	D	0.000001	T	0.27765	0.0683	L	0.31526	0.94	0.80722	D	1	B	0.02656	0.0	B	0.08055	0.003	T	0.11397	-1.0589	10	0.19590	T	0.45	.	14.6698	0.68934	0.0:0.9305:0.0:0.0695	.	1853	Q8N3C0	HELC1_HUMAN	K	1853	ENSP00000358159:E1853K	ENSP00000358159:E1853K	E	-	1	0	ASCC3	101094978	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.391000	0.66266	1.454000	0.47793	0.650000	0.86243	GAA	ASCC3	-	pfam_Sec63-dom,smart_Sec63-dom	ENSG00000112249		0.328	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASCC3	HGNC	protein_coding	OTTHUMT00000041632.2	24	0.00	0	C	NM_006828		100988257	100988257	-1	no_errors	ENST00000369162	ensembl	human	known	69_37n	missense	19	29.63	8	SNP	1.000	T
ASIC2	40	genome.wustl.edu	37	17	31415884	31415884	+	Silent	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr17:31415884C>T	ENST00000359872.6	-	3	1592	c.831G>A	c.(829-831)caG>caA	p.Q277Q	ASIC2_ENST00000448983.1_5'UTR|ASIC2_ENST00000225823.2_Silent_p.Q328Q	NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2	277					central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)									Amiloride(DB00594)	AACTTACCCTCTGCTCCTGTG	0.577																																						dbGAP											0													48.0	48.0	48.0					17																	31415884		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.831G>A	17.37:g.31415884C>T			E9PBX2|Q13553|Q6DJU1|Q8N3E2	Silent	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	p.Q328	ENST00000359872.6	37	c.984	CCDS42296.1	17																																																																																			ASIC2	-	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	ENSG00000108684		0.577	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ASIC2	HGNC	protein_coding	OTTHUMT00000447552.1	40	0.00	0	C	NM_183377, NM_001094		31415884	31415884	-1	no_errors	ENST00000225823	ensembl	human	known	69_37n	silent	18	30.77	8	SNP	1.000	T
ASPSCR1	79058	genome.wustl.edu	37	17	79973183	79973183	+	Intron	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr17:79973183G>A	ENST00000306739.4	+	13	1450				ASPSCR1_ENST00000306729.7_Missense_Mutation_p.G529D|ASPSCR1_ENST00000582404.1_3'UTR|ASPSCR1_ENST00000580534.1_Intron	NM_024083.3	NP_076988.1	Q9BZE9	ASPC1_HUMAN	alveolar soft part sarcoma chromosome region, candidate 1						glucose homeostasis (GO:0042593)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|regulation of glucose import (GO:0046324)	cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)			ASPSCR1/TFE3(167)	breast(2)|large_intestine(2)	4	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			CCGAGCAGTGGCGATCCCTCC	0.677			T	TFE3	alveolar soft part sarcoma																																	dbGAP		Dom	yes		17	17q25	79058	"""alveolar soft part sarcoma chromosome region, candidate 1"""		M	0													53.0	51.0	52.0					17																	79973183		875	1991	2866	-	-	-	SO:0001627	intron_variant	0			AF324219	CCDS11796.1, CCDS58611.1	17q25	2011-06-28				ENSG00000169696		"""UBX domain containing"""	13825	protein-coding gene	gene with protein product	"""UBX domain protein 9"""	606236				11244503, 10506710	Standard	NM_024083		Approved	ASPS, ASPL, UBXD9, UBXN9	uc002kcy.3	Q9BZE9		ENST00000306739.4:c.1354-1169G>A	17.37:g.79973183G>A			A8K3K9|Q7Z6N7|Q8WV59|Q96LS5|Q96M40	Missense_Mutation	SNP	pfam_TUG,pfam_UBX,pfscan_UBX	p.G529D	ENST00000306739.4	37	c.1586	CCDS11796.1	17	.	.	.	.	.	.	.	.	.	.	G	7.253	0.603689	0.14002	.	.	ENSG00000169696	ENST00000306729	T	0.23552	1.9	0.53	-1.06	0.10002	.	.	.	.	.	T	0.11879	0.0289	.	.	.	0.09310	N	1	P	0.50710	0.938	B	0.34931	0.192	T	0.18085	-1.0348	6	.	.	.	.	.	.	.	.	529	Q9BZE9-2	.	D	529	ENSP00000306625:G529D	.	G	+	2	0	ASPSCR1	77566472	0.000000	0.05858	0.001000	0.08648	0.183000	0.23260	-0.558000	0.05978	-0.588000	0.05882	0.205000	0.17691	GGC	ASPSCR1	-	NULL	ENSG00000169696		0.677	ASPSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPSCR1	HGNC	protein_coding	OTTHUMT00000441972.1	38	0.00	0	G	NM_024083		79973183	79973183	+1	no_errors	ENST00000306729	ensembl	human	known	69_37n	missense	17	34.62	9	SNP	0.001	A
BAI2	576	genome.wustl.edu	37	1	32196739	32196739	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr1:32196739C>T	ENST00000373658.3	-	29	4383	c.4042G>A	c.(4042-4044)Gag>Aag	p.E1348K	BAI2_ENST00000465256.1_5'UTR|BAI2_ENST00000257070.4_Missense_Mutation_p.E1315K|BAI2_ENST00000398542.1_Missense_Mutation_p.E1248K|BAI2_ENST00000373655.2_Missense_Mutation_p.E1348K|BAI2_ENST00000440175.2_Missense_Mutation_p.E957K|BAI2_ENST00000398538.1_Missense_Mutation_p.E1336K|BAI2_ENST00000398556.3_Missense_Mutation_p.E1263K|BAI2_ENST00000398547.1_Missense_Mutation_p.E1281K|BAI2_ENST00000527361.1_Missense_Mutation_p.E1315K	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	1348					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		TAGTCTCCCTCAGAGCCTGGC	0.701																																						dbGAP											0													17.0	15.0	15.0					1																	32196739		2191	4290	6481	-	-	-	SO:0001583	missense	0			AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.4042G>A	1.37:g.32196739C>T	ENSP00000362762:p.Glu1348Lys		B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.E1348K	ENST00000373658.3	37	c.4042	CCDS346.2	1	.	.	.	.	.	.	.	.	.	.	C	31	5.075074	0.94000	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000440175;ENST00000398538	T;T;T;T;T;T;T;T;T	0.58358	1.01;1.32;0.49;0.48;1.4;0.34;0.34;1.04;0.51	5.34	5.34	0.76211	.	0.000000	0.43579	D	0.000547	T	0.71626	0.3362	M	0.61703	1.905	0.58432	D	0.999995	D;D;D;D;D;D;D	0.89917	1.0;0.984;0.972;0.991;1.0;0.972;0.976	D;P;P;P;D;P;P	0.91635	0.999;0.839;0.694;0.771;0.999;0.694;0.893	T	0.73084	-0.4094	10	0.66056	D	0.02	.	19.0256	0.92931	0.0:1.0:0.0:0.0	.	1315;1336;957;1263;1348;1348;1336	O60241-4;O60241-3;B4DKC3;A2A3C6;O60241-2;O60241;A2A3C2	.;.;.;.;.;BAI2_HUMAN;.	K	1263;1281;1348;1348;1248;1315;1315;957;1336	ENSP00000381564:E1263K;ENSP00000381555:E1281K;ENSP00000362762:E1348K;ENSP00000362759:E1348K;ENSP00000381550:E1248K;ENSP00000257070:E1315K;ENSP00000435397:E1315K;ENSP00000391071:E957K;ENSP00000381548:E1336K	ENSP00000257070:E1315K	E	-	1	0	BAI2	31969326	1.000000	0.71417	0.993000	0.49108	0.804000	0.45430	7.577000	0.82486	2.666000	0.90696	0.561000	0.74099	GAG	BAI2	-	NULL	ENSG00000121753		0.701	BAI2-015	KNOWN	basic|CCDS	protein_coding	BAI2	HGNC	protein_coding	OTTHUMT00000381838.1	48	0.00	0	C	NM_001703		32196739	32196739	-1	no_errors	ENST00000373658	ensembl	human	known	69_37n	missense	23	41.03	16	SNP	1.000	T
BIK	638	genome.wustl.edu	37	22	43524602	43524602	+	Frame_Shift_Del	DEL	T	T	-			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr22:43524602delT	ENST00000216115.2	+	4	424	c.361delT	c.(361-363)ttcfs	p.F121fs		NM_001197.4	NP_001188.1	Q13323	BIK_HUMAN	BCL2-interacting killer (apoptosis-inducing)	121					apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|male gonad development (GO:0008584)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)				breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|urinary_tract(1)	5		Ovarian(80;0.0694)				CATAATGAGGTTCTGGAGATC	0.562																																						dbGAP											0													107.0	106.0	106.0					22																	43524602		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			U34584	CCDS14044.1	22q13.31	2014-03-07			ENSG00000100290	ENSG00000100290			1051	protein-coding gene	gene with protein product		603392				7478623, 10591208	Standard	NM_001197		Approved	NBK	uc003bdk.3	Q13323	OTTHUMG00000150703	ENST00000216115.2:c.361delT	22.37:g.43524602delT	ENSP00000216115:p.Phe121fs		Q16582|Q6FH93	Frame_Shift_Del	DEL	pfam_Bcl2-int_killer	p.F121fs	ENST00000216115.2	37	c.361	CCDS14044.1	22																																																																																			BIK	-	pfam_Bcl2-int_killer	ENSG00000100290		0.562	BIK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIK	HGNC	protein_coding	OTTHUMT00000319676.1	41	0.00	0	T	NM_001197		43524602	43524602	+1	no_errors	ENST00000216115	ensembl	human	known	69_37n	frame_shift_del	15	51.61	16	DEL	0.000	-
BTBD3	22903	genome.wustl.edu	37	20	11903405	11903405	+	Silent	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr20:11903405G>A	ENST00000405977.1	+	5	1285	c.660G>A	c.(658-660)ctG>ctA	p.L220L	BTBD3_ENST00000254977.3_Silent_p.L159L|BTBD3_ENST00000378226.2_Silent_p.L220L|BTBD3_ENST00000399006.2_Silent_p.L159L|BTBD3_ENST00000488503.1_3'UTR	NM_001282550.1|NM_001282552.1|NM_001282554.1	NP_001269479.1|NP_001269481.1|NP_001269483.1	Q9Y2F9	BTBD3_HUMAN	BTB (POZ) domain containing 3	220					cerebral cortex development (GO:0021987)|dendrite morphogenesis (GO:0048813)	cytosol (GO:0005829)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(18)|ovary(3)|skin(2)	34						AGACCAGCCTGAGTGCCAAGA	0.557																																						dbGAP											0													99.0	98.0	98.0					20																	11903405		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023169	CCDS13113.1, CCDS13114.1	20p12.2	2013-01-08			ENSG00000132640	ENSG00000132640		"""BTB/POZ domain containing"""	15854	protein-coding gene	gene with protein product		615566					Standard	NM_001282551		Approved	KIAA0952, dJ742J24.1	uc002wnz.3	Q9Y2F9	OTTHUMG00000031889	ENST00000405977.1:c.660G>A	20.37:g.11903405G>A			D3DW19|Q5JY73	Silent	SNP	pfam_PHR,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.L220	ENST00000405977.1	37	c.660	CCDS13113.1	20																																																																																			BTBD3	-	superfamily_BTB/POZ_fold,smart_BTB/POZ-like	ENSG00000132640		0.557	BTBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD3	HGNC	protein_coding	OTTHUMT00000078021.3	47	0.00	0	G			11903405	11903405	+1	no_errors	ENST00000378226	ensembl	human	known	69_37n	silent	20	45.95	17	SNP	1.000	A
BTN3A1	11119	genome.wustl.edu	37	6	26406396	26406396	+	Silent	SNP	C	C	T	rs2393650	byFrequency	TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr6:26406396C>T	ENST00000289361.6	+	3	713	c.345C>T	c.(343-345)aaC>aaT	p.N115N	BTN3A1_ENST00000476549.2_Silent_p.N115N|BTN3A1_ENST00000425234.2_Silent_p.N115N|BTN3A1_ENST00000414912.2_Silent_p.N115N	NM_001145008.1|NM_001145009.1|NM_007048.5	NP_001138480.1|NP_001138481.1|NP_008979.3	O00481	BT3A1_HUMAN	butyrophilin, subfamily 3, member A1	115	Ig-like V-type 1.				activated T cell proliferation (GO:0050798)|cytokine secretion (GO:0050663)|interferon-gamma secretion (GO:0072643)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						GAATACACAACGTCACAGCCT	0.517													C|||	870	0.173722	0.5477	0.0821	5008	,	,		21385	0.0437		0.0179	False		,,,				2504	0.0276					dbGAP											0													3.0	4.0	4.0					6																	26406396		1681	3533	5214	-	-	-	SO:0001819	synonymous_variant	0			U90552	CCDS4608.1, CCDS4609.1, CCDS47388.1, CCDS47389.1	6p22.1	2014-01-14			ENSG00000026950	ENSG00000026950		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1138	protein-coding gene	gene with protein product		613593				9149941	Standard	NM_007048		Approved	BT3.1, BTF5, CD277, BTN3.1	uc003nhv.3	O00481	OTTHUMG00000014449	ENST00000289361.6:c.345C>T	6.37:g.26406396C>T			A2A278|A8K2C8|B4DIQ1|B4DRM2|E9PGB4|E9PHG8|Q0P515|Q147X5|Q53F15|Q99420|Q9HCY1	Silent	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,pfam_CD80_C2-set,superfamily_ConA-like_lec_gl,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Ig-like,prints_Butyrophylin	p.N115	ENST00000289361.6	37	c.345	CCDS4608.1	6																																																																																			BTN3A1	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000026950		0.517	BTN3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTN3A1	HGNC	protein_coding	OTTHUMT00000040112.3	19	0.00	0	C			26406396	26406396	+1	no_errors	ENST00000289361	ensembl	human	known	69_37n	silent	10	37.50	6	SNP	0.000	T
C15orf52	388115	genome.wustl.edu	37	15	40632136	40632136	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr15:40632136C>G	ENST00000559313.1	-	2	240	c.225G>C	c.(223-225)aaG>aaC	p.K75N	C15orf52_ENST00000397536.2_5'Flank|C15orf52_ENST00000557973.1_5'UTR	NM_207380.2	NP_997263.2	Q6ZUT6	CO052_HUMAN	chromosome 15 open reading frame 52	75							poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	19		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.06e-06)|Colorectal(105;0.0107)|BRCA - Breast invasive adenocarcinoma(123;0.0505)|READ - Rectum adenocarcinoma(2;0.0649)|Lung(196;0.0781)|LUAD - Lung adenocarcinoma(183;0.0841)		CCTGGTTCTTCTTGCGCAGGG	0.642																																						dbGAP											0													70.0	80.0	77.0					15																	40632136		2126	4234	6360	-	-	-	SO:0001583	missense	0			AK124643	CCDS10055.2	15q15.1	2007-06-14			ENSG00000188549	ENSG00000188549			33488	protein-coding gene	gene with protein product							Standard	NM_207380		Approved	FLJ43339	uc001zlh.4	Q6ZUT6	OTTHUMG00000129981	ENST00000559313.1:c.225G>C	15.37:g.40632136C>G	ENSP00000453969:p.Lys75Asn		B9EIQ8|Q68DG9|Q6ZTM3|Q6ZU22	Missense_Mutation	SNP	NULL	p.K75N	ENST00000559313.1	37	c.225	CCDS10055.2	15	.	.	.	.	.	.	.	.	.	.	C	25.7	4.668234	0.88348	.	.	ENSG00000188549	ENST00000382688	.	.	.	4.51	4.51	0.55191	.	0.000000	0.44902	D	0.000410	T	0.70202	0.3197	M	0.69823	2.125	0.37386	D	0.912265	D	0.63046	0.992	P	0.59948	0.866	T	0.77696	-0.2491	9	0.87932	D	0	-30.8647	12.587	0.56423	0.0:1.0:0.0:0.0	.	75	Q6ZUT6	CO052_HUMAN	N	75	.	ENSP00000372135:K75N	K	-	3	2	C15orf52	38419428	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.714000	0.47202	2.344000	0.79699	0.462000	0.41574	AAG	C15orf52	-	NULL	ENSG00000188549		0.642	C15orf52-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf52	HGNC	protein_coding	OTTHUMT00000319567.2	30	0.00	0	C	NM_207380		40632136	40632136	-1	no_errors	ENST00000559313	ensembl	human	known	69_37n	missense	13	35.00	7	SNP	1.000	G
CARD16	114769	genome.wustl.edu	37	11	104915369	104915369	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr11:104915369C>G	ENST00000375706.2	-	2	41	c.24G>C	c.(22-24)gaG>gaC	p.E8D	CASP1_ENST00000415981.2_Intron|CARD16_ENST00000375704.3_Missense_Mutation_p.E8D|CARD16_ENST00000525374.1_Missense_Mutation_p.E8D|CASP1_ENST00000598974.1_Intron|CASP1_ENST00000594519.1_Intron|CASP1_ENST00000593315.1_Intron	NM_001017534.1	NP_001017534.1	Q5EG05	CAR16_HUMAN	caspase recruitment domain family, member 16	8	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				regulation of apoptotic process (GO:0042981)		cysteine-type endopeptidase inhibitor activity (GO:0004869)			endometrium(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	11						GCTTTCTCTTCTCCTTCAGGA	0.423																																						dbGAP											0													274.0	254.0	261.0					11																	104915369		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS31661.1, CCDS41705.1	11q23	2008-09-15				ENSG00000204397			33701	protein-coding gene	gene with protein product		615680				11432859, 11536016	Standard	NM_052889		Approved	COP1, COP, PSEUDO-ICE		Q5EG05		ENST00000375706.2:c.24G>C	11.37:g.104915369C>G	ENSP00000364858:p.Glu8Asp		Q96RJ9	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like,smart_CARD,pfscan_CARD	p.E8D	ENST00000375706.2	37	c.24	CCDS31661.1	11	.	.	.	.	.	.	.	.	.	.	.	6.684	0.494761	0.12702	.	.	ENSG00000204397	ENST00000375706;ENST00000375704;ENST00000525374	T;T;T	0.16196	2.36;2.36;2.36	3.34	-2.24	0.06909	DEATH-like (2);Caspase Recruitment (3);	0.676341	0.14770	U	0.299462	T	0.11793	0.0287	L	0.51914	1.62	0.09310	N	1	B;B	0.20780	0.048;0.007	B;B	0.24701	0.055;0.013	T	0.35525	-0.9785	10	0.19590	T	0.45	.	3.8201	0.08832	0.0:0.2952:0.3807:0.3241	.	8;8	Q5EG05;Q5EG05-2	CAR16_HUMAN;.	D	8	ENSP00000364858:E8D;ENSP00000364856:E8D;ENSP00000433700:E8D	ENSP00000364856:E8D	E	-	3	2	CARD16	104420579	0.000000	0.05858	0.000000	0.03702	0.143000	0.21401	-0.101000	0.10973	-0.616000	0.05671	0.484000	0.47621	GAG	CARD16	-	pfam_CARD,superfamily_DEATH-like,smart_CARD,pfscan_CARD	ENSG00000204397		0.423	CARD16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CARD16	HGNC	protein_coding	OTTHUMT00000388147.1	56	0.00	0	C			104915369	104915369	-1	no_errors	ENST00000375706	ensembl	human	known	69_37n	missense	6	64.71	11	SNP	0.003	G
CDC42SE1	56882	genome.wustl.edu	37	1	151027748	151027748	+	Intron	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr1:151027748C>T	ENST00000439374.2	-	6	939				CDC42SE1_ENST00000357235.5_Intron|CDC42SE1_ENST00000492796.1_Intron|MLLT11_ENST00000368921.3_5'Flank|CDC42SE1_ENST00000540998.1_Intron			Q9NRR8	C42S1_HUMAN	CDC42 small effector 1						negative regulation of catalytic activity (GO:0043086)|phagocytosis (GO:0006909)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	GTPase inhibitor activity (GO:0005095)			large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	4	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			ATCACTAGGGCATGAAAGGCA	0.488																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF187845	CCDS981.1	1q21.1	2008-02-05			ENSG00000197622	ENSG00000197622			17719	protein-coding gene	gene with protein product						10816584	Standard	NM_001038707		Approved	SCIP1, SPEC1	uc001ewp.3	Q9NRR8	OTTHUMG00000035158	ENST00000439374.2:c.55-146G>A	1.37:g.151027748C>T			D3DV12|Q9HB17|Q9NQR2	RNA	SNP	-	NULL	ENST00000439374.2	37	NULL	CCDS981.1	1																																																																																			CDC42SE1	-	-	ENSG00000197622		0.488	CDC42SE1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	CDC42SE1	HGNC	protein_coding	OTTHUMT00000085096.2	18	0.00	0	C	NM_020239		151027748	151027748	-1	no_errors	ENST00000483763	ensembl	human	known	69_37n	rna	18	41.94	13	SNP	0.000	T
CDH1	999	genome.wustl.edu	37	16	68842676	68842677	+	Frame_Shift_Ins	INS	-	-	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr16:68842676_68842677insT	ENST00000261769.5	+	5	803_804	c.612_613insT	c.(613-615)tttfs	p.F205fs	CDH1_ENST00000422392.2_Frame_Shift_Ins_p.F205fs|CDH1_ENST00000562836.1_3'UTR	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	205	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.?(2)|p.F205_I207del(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		CTGTTGGTGTCTTTATTATTGA	0.426			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	3	Unknown(2)|Deletion - In frame(1)	breast(2)|stomach(1)																																								-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.615dupT	16.37:g.68842679_68842679dupT	ENSP00000261769:p.Phe205fs		A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Frame_Shift_Ins	INS	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I205fs	ENST00000261769.5	37	c.612_613	CCDS10869.1	16																																																																																			CDH1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000039068		0.426	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	16	0.00	0	-	NM_004360		68842676	68842677	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	frame_shift_ins	2	83.33	10	INS	0.552:1.000	T
C19orf44	84167	genome.wustl.edu	37	19	16631645	16631645	+	3'UTR	SNP	C	C	G			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr19:16631645C>G	ENST00000221671.3	+	0	2911				CTD-3222D19.2_ENST00000409035.1_Intron|CHERP_ENST00000198939.6_Missense_Mutation_p.K742N|CHERP_ENST00000546361.2_Missense_Mutation_p.K731N|CHERP_ENST00000544299.1_5'UTR	NM_032207.2	NP_115583.1	Q9H6X5	CS044_HUMAN	chromosome 19 open reading frame 44											endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	16						ACCTGTTCCTCTTCTCCTGGC	0.592																																						dbGAP											0													86.0	95.0	92.0					19																	16631645		1991	4159	6150	-	-	-	SO:0001624	3_prime_UTR_variant	0			AK025395	CCDS12345.1, CCDS74306.1	19p13.11	2011-11-24			ENSG00000105072	ENSG00000105072			26141	protein-coding gene	gene with protein product						12477932	Standard	NM_032207		Approved	FLJ21742	uc002neh.1	Q9H6X5		ENST00000221671.3:c.*781C>G	19.37:g.16631645C>G			Q8N6Y7	Missense_Mutation	SNP	pfam_Surp,pfam_G_patch_dom,pfam_RNA_pol_II-bd,superfamily_Surp,superfamily_ENTH_VHS,smart_Surp,smart_G_patch_dom,pfscan_Surp,pfscan_G_patch_dom	p.K731N	ENST00000221671.3	37	c.2193	CCDS12345.1	19	.	.	.	.	.	.	.	.	.	.	C	16.97	3.267724	0.59540	.	.	ENSG00000085872	ENST00000546361;ENST00000198939	T;T	0.23552	1.9;1.9	4.99	4.99	0.66335	.	.	.	.	.	T	0.40297	0.1111	L	0.40543	1.245	0.49213	D	0.999763	D	0.71674	0.998	D	0.73708	0.981	T	0.07009	-1.0795	9	0.16420	T	0.52	-29.7699	17.2542	0.87051	0.0:1.0:0.0:0.0	.	731	Q8IWX8	CHERP_HUMAN	N	731;742	ENSP00000439856:K731N;ENSP00000198939:K742N	ENSP00000198939:K742N	K	-	3	2	CHERP	16492645	1.000000	0.71417	1.000000	0.80357	0.760000	0.43138	1.644000	0.37228	2.323000	0.78572	0.462000	0.41574	AAG	CHERP	-	NULL	ENSG00000085872		0.592	C19orf44-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHERP	HGNC	protein_coding	OTTHUMT00000461218.1	51	0.00	0	C	NM_032207		16631645	16631645	-1	no_errors	ENST00000546361	ensembl	human	known	69_37n	missense	31	36.73	18	SNP	1.000	G
CLDN19	149461	genome.wustl.edu	37	1	43203908	43203908	+	Silent	SNP	G	G	C			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr1:43203908G>C	ENST00000296387.1	-	3	655	c.465C>G	c.(463-465)gtC>gtG	p.V155V	CLDN19_ENST00000539749.1_Intron|CLDN19_ENST00000372539.3_Silent_p.V155V	NM_001123395.1|NM_148960.2	NP_001116867.1|NP_683763.2	Q8N6F1	CLD19_HUMAN	claudin 19	155					apical junction assembly (GO:0043297)|calcium-independent cell-cell adhesion (GO:0016338)|neuronal action potential propagation (GO:0019227)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	apical junction complex (GO:0043296)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			breast(2)|large_intestine(1)|lung(2)|skin(1)	6	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				ACCTGGCATTGACAGGTGTGC	0.587																																						dbGAP											0													78.0	76.0	76.0					1																	43203908		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK096063	CCDS471.1, CCDS44125.1, CCDS53306.1	1p34.2	2008-05-14			ENSG00000164007	ENSG00000164007		"""Claudins"""	2040	protein-coding gene	gene with protein product		610036					Standard	NM_148960		Approved		uc001cht.1	Q8N6F1	OTTHUMG00000007524	ENST00000296387.1:c.465C>G	1.37:g.43203908G>C			B7Z5I2|F5H5P9|Q5QT57|Q8N8X0	Silent	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin	p.V155	ENST00000296387.1	37	c.465	CCDS471.1	1																																																																																			CLDN19	-	pfam_PMP22/EMP/MP20/Claudin	ENSG00000164007		0.587	CLDN19-001	KNOWN	basic|CCDS	protein_coding	CLDN19	HGNC	protein_coding	OTTHUMT00000019788.1	27	0.00	0	G	NM_148960		43203908	43203908	-1	no_errors	ENST00000296387	ensembl	human	known	69_37n	silent	18	33.33	9	SNP	0.999	C
CNOT2	4848	genome.wustl.edu	37	12	70729251	70729251	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr12:70729251C>T	ENST00000418359.3	+	9	1134	c.683C>T	c.(682-684)tCa>tTa	p.S228L	CNOT2_ENST00000229195.3_Missense_Mutation_p.S228L|CNOT2_ENST00000551483.1_5'UTR	NM_001199302.1	NP_001186231.1	Q9NZN8	CNOT2_HUMAN	CCR4-NOT transcription complex, subunit 2	228					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription corepressor binding (GO:0001226)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(2)|urinary_tract(1)	20	Renal(347;0.236)		GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			TTGGACCTTTCAGATTTCCCA	0.373																																						dbGAP											0													117.0	112.0	114.0					12																	70729251		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF180473	CCDS31857.1	12q15	2008-05-14				ENSG00000111596			7878	protein-coding gene	gene with protein product		604909		NOT2		10637334	Standard	NM_014515		Approved	CDC36, NOT2H	uc001svv.3	Q9NZN8		ENST00000418359.3:c.683C>T	12.37:g.70729251C>T	ENSP00000412091:p.Ser228Leu		Q9H3E0|Q9NSX5|Q9NWR6|Q9P028	Missense_Mutation	SNP	pfam_NOT	p.S228L	ENST00000418359.3	37	c.683	CCDS31857.1	12	.	.	.	.	.	.	.	.	.	.	C	26.7	4.760041	0.89932	.	.	ENSG00000111596	ENST00000552231;ENST00000229195;ENST00000418359;ENST00000550160;ENST00000552915;ENST00000552483;ENST00000548159;ENST00000551043;ENST00000550155	T;T;T;T;T;T;T;T;T	0.77489	-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.78861	0.4350	M	0.72118	2.19	0.80722	D	1	P	0.43938	0.822	B	0.39617	0.305	T	0.82436	-0.0458	10	0.66056	D	0.02	-8.5801	19.484	0.95022	0.0:1.0:0.0:0.0	.	228	Q9NZN8	CNOT2_HUMAN	L	228;228;228;91;167;82;219;228;38	ENSP00000450318:S228L;ENSP00000229195:S228L;ENSP00000412091:S228L;ENSP00000448490:S91L;ENSP00000447497:S167L;ENSP00000450077:S82L;ENSP00000449659:S219L;ENSP00000449260:S228L;ENSP00000448499:S38L	ENSP00000229195:S228L	S	+	2	0	CNOT2	69015518	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.748000	0.85085	2.669000	0.90835	0.650000	0.86243	TCA	CNOT2	-	NULL	ENSG00000111596		0.373	CNOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNOT2	HGNC	protein_coding	OTTHUMT00000404260.1	57	0.00	0	C			70729251	70729251	+1	no_errors	ENST00000229195	ensembl	human	known	69_37n	missense	19	56.82	25	SNP	1.000	T
COL4A3BP	10087	genome.wustl.edu	37	5	74801856	74801857	+	Frame_Shift_Ins	INS	-	-	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr5:74801856_74801857insT	ENST00000405807.4	-	2	602_603	c.181_182insA	c.(181-183)acafs	p.T61fs	COL4A3BP_ENST00000261415.7_Frame_Shift_Ins_p.T61fs|COL4A3BP_ENST00000380494.5_Frame_Shift_Ins_p.T189fs	NM_005713.2	NP_005704.1	Q9Y5P4	C43BP_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen) binding protein	61	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|ceramide metabolic process (GO:0006672)|endoplasmic reticulum organization (GO:0007029)|ER to Golgi ceramide transport (GO:0035621)|heart morphogenesis (GO:0003007)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|lipid homeostasis (GO:0055088)|mitochondrion morphogenesis (GO:0070584)|muscle contraction (GO:0006936)|protein phosphorylation (GO:0006468)|response to endoplasmic reticulum stress (GO:0034976)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ceramide binding (GO:0097001)|ceramide transporter activity (GO:0035620)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein kinase activity (GO:0004672)			breast(1)|kidney(1)|large_intestine(5)|lung(4)|skin(3)|stomach(1)|urinary_tract(1)	16		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;1e-53)		GCCATACTCTGTTTCATCTTCA	0.416																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF136450	CCDS4028.1, CCDS4029.1, CCDS47235.1	5q13.3	2013-01-10	2007-06-08	2007-06-08	ENSG00000113163	ENSG00000113163		"""StAR-related lipid transfer (START) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2205	protein-coding gene	gene with protein product	"""ceramide transporter"", ""StAR-related lipid transfer (START) domain containing 11"""	604677				10212244	Standard	NM_001130105		Approved	GPBP, STARD11, CERT	uc003kdt.3	Q9Y5P4	OTTHUMG00000102068	ENST00000405807.4:c.182dupA	5.37:g.74801859_74801859dupT	ENSP00000383996:p.Thr61fs		A8K7S2|B3KUB7|Q53YV1|Q53YV2|Q96Q85|Q96Q88|Q9H2S7|Q9H2S8	Frame_Shift_Ins	INS	pfam_START_lipid-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,smart_START_lipid-bd,pfscan_Pleckstrin_homology,pfscan_START_lipid-bd	p.T189fs	ENST00000405807.4	37	c.566_565	CCDS4028.1	5																																																																																			COL4A3BP	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000113163		0.416	COL4A3BP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A3BP	HGNC	protein_coding	OTTHUMT00000219875.2	26	0.00	0	-	NM_005713		74801856	74801857	-1	no_errors	ENST00000380494	ensembl	human	known	69_37n	frame_shift_ins	18	41.94	13	INS	1.000:1.000	T
COL4A6	1288	genome.wustl.edu	37	X	107403829	107403829	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chrX:107403829C>T	ENST00000372216.4	-	43	4492	c.4392G>A	c.(4390-4392)atG>atA	p.M1464I	COL4A6_ENST00000545689.1_Missense_Mutation_p.M1439I|COL4A6_ENST00000334504.7_Missense_Mutation_p.M1463I|COL4A6_ENST00000538570.1_Missense_Mutation_p.M1406I|COL4A6_ENST00000418180.1_5'Flank|COL4A6_ENST00000394872.2_Missense_Mutation_p.M1464I	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	1464					cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						AGCCCACTCTCATGCTCTGGC	0.577									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)	dbGAP											0													114.0	97.0	103.0					X																	107403829		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database		U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.4392G>A	X.37:g.107403829C>T	ENSP00000361290:p.Met1464Ile		Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.M1464I	ENST00000372216.4	37	c.4392	CCDS14541.1	X	.	.	.	.	.	.	.	.	.	.	C	10.18	1.279106	0.23307	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D;D	0.94138	-3.36;-3.36;-3.36;-3.36;-3.36	4.9	4.03	0.46877	C-type lectin fold (1);	2.126400	0.02523	N	0.092802	D	0.89350	0.6690	N	0.20986	0.625	0.09310	N	1	B;B;B;B	0.15930	0.012;0.0;0.015;0.012	B;B;B;B	0.04013	0.0;0.0;0.001;0.0	T	0.75488	-0.3300	10	0.31617	T	0.26	.	10.7548	0.46230	0.147:0.714:0.139:0.0	.	1439;1406;1464;1463	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	I	1464;1463;1464;1451;1439;1406	ENSP00000361290:M1464I;ENSP00000334733:M1463I;ENSP00000378340:M1464I;ENSP00000443707:M1439I;ENSP00000445236:M1406I	ENSP00000334733:M1463I	M	-	3	0	COL4A6	107290485	0.000000	0.05858	0.004000	0.12327	0.308000	0.27856	0.173000	0.16724	1.128000	0.42052	0.506000	0.49869	ATG	COL4A6	-	superfamily_C-type_lectin_fold	ENSG00000197565		0.577	COL4A6-001	KNOWN	basic|CCDS	protein_coding	COL4A6	HGNC	protein_coding	OTTHUMT00000057875.2	30	0.00	0	C			107403829	107403829	-1	no_errors	ENST00000372216	ensembl	human	known	69_37n	missense	14	33.33	7	SNP	0.019	T
COX7B2	170712	genome.wustl.edu	37	4	46737164	46737164	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr4:46737164G>A	ENST00000396533.1	-	4	296	c.46C>T	c.(46-48)Caa>Taa	p.Q16*	COX7B2_ENST00000302930.5_Nonsense_Mutation_p.Q16*|COX7B2_ENST00000355591.3_Nonsense_Mutation_p.Q16*|COX7B2_ENST00000543208.1_Nonsense_Mutation_p.Q15*			Q8TF08	CX7B2_HUMAN	cytochrome c oxidase subunit VIIb2	16						integral component of membrane (GO:0016021)|mitochondrial respiratory chain (GO:0005746)	cytochrome-c oxidase activity (GO:0004129)			large_intestine(1)|lung(4)	5						AGAATGCTTTGAATCTTGAGA	0.423																																						dbGAP											0													148.0	130.0	136.0					4																	46737164		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF125109	CCDS3472.2	4p12	2011-07-04			ENSG00000170516	ENSG00000170516		"""Mitochondrial respiratory chain complex / Complex IV"""	24381	protein-coding gene	gene with protein product		609811				15623157	Standard	NM_130902		Approved		uc003gxf.3	Q8TF08	OTTHUMG00000099423	ENST00000396533.1:c.46C>T	4.37:g.46737164G>A	ENSP00000379784:p.Gln16*		Q32Q40	Nonsense_Mutation	SNP	pfam_Cyt_c_oxidase_suVIIB,superfamily_Cyt_c_oxidase_suVIIB_dom	p.Q16*	ENST00000396533.1	37	c.46	CCDS3472.2	4	.	.	.	.	.	.	.	.	.	.	G	8.313	0.822481	0.16678	.	.	ENSG00000170516	ENST00000355591;ENST00000396533;ENST00000302930;ENST00000543208;ENST00000505102	.	.	.	4.22	1.36	0.22044	.	0.422294	0.25327	N	0.031479	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	-9.2926	6.7067	0.23254	0.0:0.1766:0.4594:0.3639	.	.	.	.	X	16;16;16;15;16	.	ENSP00000305964:Q16X	Q	-	1	0	COX7B2	46431921	0.046000	0.20272	0.001000	0.08648	0.119000	0.20118	0.364000	0.20325	0.264000	0.21851	0.585000	0.79938	CAA	COX7B2	-	pfam_Cyt_c_oxidase_suVIIB	ENSG00000170516		0.423	COX7B2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	COX7B2	HGNC	protein_coding	OTTHUMT00000313899.1	52	0.00	0	G	NM_130902		46737164	46737164	-1	no_errors	ENST00000302930	ensembl	human	known	69_37n	nonsense	18	47.06	16	SNP	0.002	A
CRNN	49860	genome.wustl.edu	37	1	152383157	152383157	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr1:152383157C>T	ENST00000271835.3	-	3	463	c.401G>A	c.(400-402)gGg>gAg	p.G134E	RP1-91G5.3_ENST00000411804.1_RNA	NM_016190.2	NP_057274.1	Q9UBG3	CRNN_HUMAN	cornulin	134					response to heat (GO:0009408)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTGGCTGCTCCCCTCATAATG	0.632																																						dbGAP											0													147.0	161.0	156.0					1																	152383157		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF077831	CCDS1010.1	1q21	2014-01-28	2005-06-13	2005-06-13	ENSG00000143536	ENSG00000143536		"""EF-hand domain containing"""	1230	protein-coding gene	gene with protein product		611312	"""chromosome 1 open reading frame 10"""	C1orf10		11056050, 15854041	Standard	NM_016190		Approved	SEP53	uc001ezx.2	Q9UBG3	OTTHUMG00000012383	ENST00000271835.3:c.401G>A	1.37:g.152383157C>T	ENSP00000271835:p.Gly134Glu		B2RE60|Q8N613	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.G134E	ENST00000271835.3	37	c.401	CCDS1010.1	1	.	.	.	.	.	.	.	.	.	.	C	14.51	2.557157	0.45590	.	.	ENSG00000143536	ENST00000271835	T	0.04917	3.53	3.71	-2.13	0.07144	.	0.887861	0.09406	N	0.806500	T	0.04092	0.0114	L	0.57536	1.79	0.09310	N	1	D	0.61697	0.99	P	0.52554	0.702	T	0.22277	-1.0221	10	0.62326	D	0.03	.	4.0787	0.09916	0.0:0.3116:0.3388:0.3496	.	134	Q9UBG3	CRNN_HUMAN	E	134	ENSP00000271835:G134E	ENSP00000271835:G134E	G	-	2	0	CRNN	150649781	0.000000	0.05858	0.000000	0.03702	0.085000	0.17905	-0.182000	0.09726	-0.416000	0.07473	0.460000	0.39030	GGG	CRNN	-	NULL	ENSG00000143536		0.632	CRNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRNN	HGNC	protein_coding	OTTHUMT00000034503.1	44	0.00	0	C	NM_016190		152383157	152383157	-1	no_errors	ENST00000271835	ensembl	human	known	69_37n	missense	33	19.51	8	SNP	0.000	T
CRYGD	1421	genome.wustl.edu	37	2	208986425	208986425	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr2:208986425G>A	ENST00000264376.4	-	3	524	c.497C>T	c.(496-498)tCt>tTt	p.S166F		NM_006891.3	NP_008822.2	P07320	CRGD_HUMAN	crystallin, gamma D	166	Beta/gamma crystallin 'Greek key' 4. {ECO:0000255|PROSITE-ProRule:PRU00028}.				cellular response to reactive oxygen species (GO:0034614)|lens development in camera-type eye (GO:0002088)|lens fiber cell differentiation (GO:0070306)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	structural constituent of eye lens (GO:0005212)			breast(1)|endometrium(1)|lung(3)	5				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.0858)|Lung(261;0.133)		TCTCCTCAGAGAGCCCACTCT	0.478																																						dbGAP											0													53.0	55.0	54.0					2																	208986425		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2378.1	2q33.3	2013-02-14			ENSG00000118231	ENSG00000118231			2411	protein-coding gene	gene with protein product		123690		CRYG4			Standard	NM_006891		Approved		uc002vcn.4	P07320	OTTHUMG00000132944	ENST00000264376.4:c.497C>T	2.37:g.208986425G>A	ENSP00000264376:p.Ser166Phe		Q17RF7|Q53R51|Q99681	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,prints_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin	p.S166F	ENST00000264376.4	37	c.497	CCDS2378.1	2	.	.	.	.	.	.	.	.	.	.	G	18.15	3.560860	0.65538	.	.	ENSG00000118231	ENST00000264376	D	0.91521	-2.86	4.25	4.25	0.50352	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.000000	0.85682	D	0.000000	D	0.97455	0.9167	H	0.99425	4.56	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	D	0.98574	1.0647	10	0.87932	D	0	.	14.2187	0.65809	0.0:0.0:1.0:0.0	.	166	P07320	CRGD_HUMAN	F	166	ENSP00000264376:S166F	ENSP00000264376:S166F	S	-	2	0	CRYGD	208694670	1.000000	0.71417	0.842000	0.33263	0.961000	0.63080	3.685000	0.54678	2.203000	0.70933	0.555000	0.69702	TCT	CRYGD	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin	ENSG00000118231		0.478	CRYGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYGD	HGNC	protein_coding	OTTHUMT00000256476.2	14	0.00	0	G	NM_006891		208986425	208986425	-1	no_errors	ENST00000264376	ensembl	human	known	69_37n	missense	11	26.67	4	SNP	0.994	A
CSMD3	114788	genome.wustl.edu	37	8	113516056	113516056	+	Silent	SNP	T	T	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr8:113516056T>A	ENST00000297405.5	-	30	5290	c.5046A>T	c.(5044-5046)ggA>ggT	p.G1682G	CSMD3_ENST00000352409.3_Silent_p.G1682G|CSMD3_ENST00000455883.2_Silent_p.G1578G|CSMD3_ENST00000343508.3_Silent_p.G1642G	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1682	CUB 9. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AACTAACAGATCCATCACTCC	0.333										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												dbGAP											0													151.0	136.0	141.0					8																	113516056		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.5046A>T	8.37:g.113516056T>A			Q96PZ3	Silent	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.G1682	ENST00000297405.5	37	c.5046	CCDS6315.1	8																																																																																			CSMD3	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000164796		0.333	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	46	0.00	0	T	NM_052900		113516056	113516056	-1	no_errors	ENST00000297405	ensembl	human	known	69_37n	silent	10	47.37	9	SNP	1.000	A
CSMD3	114788	genome.wustl.edu	37	8	113585757	113585757	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr8:113585757C>T	ENST00000297405.5	-	24	4259	c.4015G>A	c.(4015-4017)Gat>Aat	p.D1339N	CSMD3_ENST00000352409.3_Missense_Mutation_p.D1339N|CSMD3_ENST00000455883.2_Missense_Mutation_p.D1235N|CSMD3_ENST00000343508.3_Missense_Mutation_p.D1299N	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1339	CUB 7. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AAGCCTTCATCTGTCCCTTCA	0.383										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												dbGAP											0													122.0	125.0	124.0					8																	113585757		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.4015G>A	8.37:g.113585757C>T	ENSP00000297405:p.Asp1339Asn		Q96PZ3	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.D1339N	ENST00000297405.5	37	c.4015	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	C	15.53	2.859474	0.51376	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.16897	2.31;2.31;2.31;2.31;2.31	4.71	4.71	0.59529	CUB (5);	0.166011	0.40908	D	0.000983	T	0.11239	0.0274	N	0.12887	0.27	0.40587	D	0.98145	B;B;B	0.22800	0.007;0.037;0.075	B;B;B	0.24006	0.03;0.05;0.023	T	0.17561	-1.0365	10	0.15952	T	0.53	.	17.8333	0.88689	0.0:1.0:0.0:0.0	.	1235;1339;1299	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	N	1299;1339;679;1235;1339	ENSP00000345799:D1299N;ENSP00000297405:D1339N;ENSP00000341558:D679N;ENSP00000412263:D1235N;ENSP00000343124:D1339N	ENSP00000297405:D1339N	D	-	1	0	CSMD3	113654933	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.455000	0.80726	2.403000	0.81681	0.591000	0.81541	GAT	CSMD3	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000164796		0.383	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	19	0.00	0	C	NM_052900		113585757	113585757	-1	no_errors	ENST00000297405	ensembl	human	known	69_37n	missense	11	31.25	5	SNP	1.000	T
CUL4A	8451	genome.wustl.edu	37	13	113899465	113899465	+	Splice_Site	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr13:113899465G>A	ENST00000375440.4	+	14	1528		c.e14-1		CUL4A_ENST00000375441.3_Splice_Site|CUL4A_ENST00000451881.1_Splice_Site|CUL4A_ENST00000326335.4_Splice_Site	NM_001008895.1	NP_001008895.1	Q13619	CUL4A_HUMAN	cullin 4A						cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of DNA damage checkpoint (GO:2000001)|regulation of nucleotide-excision repair (GO:2000819)|regulation of protein metabolic process (GO:0051246)|somatic stem cell maintenance (GO:0035019)|viral process (GO:0016032)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)				NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|skin(1)	17	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.112)			GCTGTGTCCAGAGTGCGGTGC	0.542																																						dbGAP											0													118.0	101.0	107.0					13																	113899465		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U58090	CCDS9533.1, CCDS41908.1, CCDS73604.1	13q34	2011-05-24			ENSG00000139842	ENSG00000139842			2554	protein-coding gene	gene with protein product		603137				8681378	Standard	NM_001008895		Approved		uc021rmv.1	Q13619	OTTHUMG00000017384	ENST00000375440.4:c.1445-1G>A	13.37:g.113899465G>A			A2A2W2|O75834|Q589T6|Q5TC62|Q6UP08|Q9UP17	Splice_Site	SNP	-	e14-1	ENST00000375440.4	37	c.1445-1	CCDS41908.1	13	.	.	.	.	.	.	.	.	.	.	G	18.67	3.673393	0.67928	.	.	ENSG00000139842	ENST00000375441;ENST00000451881;ENST00000326335;ENST00000375440	.	.	.	4.96	4.96	0.65561	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5682	0.91124	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CUL4A	112947466	1.000000	0.71417	0.998000	0.56505	0.650000	0.38633	9.606000	0.98325	2.444000	0.82710	0.555000	0.69702	.	CUL4A	-	-	ENSG00000139842		0.542	CUL4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL4A	HGNC	protein_coding	OTTHUMT00000045888.3	42	0.00	0	G	NM_003589	Intron	113899465	113899465	+1	no_errors	ENST00000375440	ensembl	human	known	69_37n	splice_site	20	39.39	13	SNP	1.000	A
DARS	1615	genome.wustl.edu	37	2	136680409	136680409	+	Silent	SNP	T	T	C	rs577829667		TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr2:136680409T>C	ENST00000264161.4	-	9	971	c.756A>G	c.(754-756)ctA>ctG	p.L252L	DARS_ENST00000537273.1_Silent_p.L152L	NM_001349.2	NP_001340.2	P14868	SYDC_HUMAN	aspartyl-tRNA synthetase	252	Aspartate. {ECO:0000250}.				aspartyl-tRNA aminoacylation (GO:0006422)|gene expression (GO:0010467)|protein complex assembly (GO:0006461)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacylase activity (GO:0004046)|aspartate-tRNA ligase activity (GO:0004815)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(2)	15				BRCA - Breast invasive adenocarcinoma(221;0.168)	L-Aspartic Acid(DB00128)	TTTGCTTATATAGCTGTGGGG	0.348													T|||	1	0.000199681	0.0	0.0	5008	,	,		14612	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													87.0	85.0	86.0					2																	136680409		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			J05032	CCDS2180.1	2q21.3	2011-07-01			ENSG00000115866	ENSG00000115866	6.1.1.12	"""Aminoacyl tRNA synthetases / Class II"""	2678	protein-coding gene	gene with protein product	"""aspartate tRNA ligase 1, cytoplasmic"""	603084				2674137	Standard	NM_001349		Approved		uc002tux.1	P14868	OTTHUMG00000131741	ENST00000264161.4:c.756A>G	2.37:g.136680409T>C			A8K3J2|D3DP77|Q2TNI3|Q32Q69|Q53HV4|Q53YC5|Q68CR9|Q9BW52	Silent	SNP	pfam_aa-tRNA-synt_II,pfam_NA-bd_OB_tRNA-helicase,superfamily_NA-bd_OB-fold-like,pfscan_aa-tRNA-synth_II,prints_Asp/Asn-tRNA-synth_IIb,tigrfam_Asp-tRNA-synth_arc/euk	p.L252	ENST00000264161.4	37	c.756	CCDS2180.1	2																																																																																			DARS	-	pfam_aa-tRNA-synt_II,pfscan_aa-tRNA-synth_II,prints_Asp/Asn-tRNA-synth_IIb,tigrfam_Asp-tRNA-synth_arc/euk	ENSG00000115866		0.348	DARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DARS	HGNC	protein_coding	OTTHUMT00000254660.5	54	0.00	0	T	NM_001349		136680409	136680409	-1	no_errors	ENST00000264161	ensembl	human	known	69_37n	silent	28	28.21	11	SNP	0.991	C
DCDC1	341019	genome.wustl.edu	37	11	31312200	31312200	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr11:31312200C>G	ENST00000452803.1	-	7	1155	c.954G>C	c.(952-954)atG>atC	p.M318I	DCDC1_ENST00000597505.1_Missense_Mutation_p.M318I	NM_181807.3	NP_861523.2	P59894	DCDC1_HUMAN	doublecortin domain containing 1	318					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					TTACCTTTTTCATTGTTTCTT	0.338																																						dbGAP											0													49.0	50.0	50.0					11																	31312200		2202	4299	6501	-	-	-	SO:0001583	missense	0			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000452803.1:c.954G>C	11.37:g.31312200C>G	ENSP00000389792:p.Met318Ile		A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	superfamily_Doublecortin_dom,pfscan_Doublecortin_dom	p.M318I	ENST00000452803.1	37	c.954	CCDS7872.1	11	.	.	.	.	.	.	.	.	.	.	C	7.896	0.733283	0.15574	.	.	ENSG00000188682	ENST00000452803	D	0.93133	-3.17	5.31	1.25	0.21368	Doublecortin domain (2);	0.653578	0.14445	N	0.319156	D	0.82600	0.5072	N	0.10874	0.06	0.20074	N	0.999934	B	0.02656	0.0	B	0.04013	0.001	T	0.70510	-0.4852	10	0.40728	T	0.16	-24.4537	4.524	0.11973	0.2793:0.4959:0.0:0.2248	.	318	P59894	DCDC1_HUMAN	I	318	ENSP00000389792:M318I	ENSP00000389792:M318I	M	-	3	0	DCDC1	31268776	0.003000	0.15002	0.838000	0.33150	0.874000	0.50279	-0.254000	0.08781	0.034000	0.15491	-0.136000	0.14681	ATG	DCDC1	-	superfamily_Doublecortin_dom	ENSG00000188682		0.338	DCDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCDC1	HGNC	protein_coding	OTTHUMT00000316531.1	51	0.00	0	C	NM_181807		31312200	31312200	-1	no_errors	ENST00000452803	ensembl	human	known	69_37n	missense	17	26.09	6	SNP	0.976	G
CEP95	90799	genome.wustl.edu	37	17	62503388	62503388	+	Intron	SNP	C	C	G			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr17:62503388C>G	ENST00000556440.2	+	1	529				CEP95_ENST00000553412.1_Intron|CEP95_ENST00000581056.1_Intron|DDX5_ENST00000450599.2_5'Flank|DDX5_ENST00000578804.1_5'Flank|DDX5_ENST00000225792.5_5'Flank	NM_138363.1	NP_612372.1	Q96GE4	CEP95_HUMAN	centrosomal protein 95kDa							centrosome (GO:0005813)|cytoplasm (GO:0005737)|spindle pole (GO:0000922)				endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)	13						TAGGGTCTCTCAGCTTCACCA	0.672																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AL832822	CCDS45763.1	17q24.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000258890	ENSG00000258890			25141	protein-coding gene	gene with protein product			"""coiled-coil domain containing 45"""	CCDC45		21399614	Standard	NM_138363		Approved	DKFZp667E1824	uc002jem.3	Q96GE4	OTTHUMG00000179174	ENST00000556440.2:c.19+154C>G	17.37:g.62503388C>G			B4DMD2|Q96M81	RNA	SNP	-	NULL	ENST00000556440.2	37	NULL	CCDS45763.1	17																																																																																			DDX5	-	-	ENSG00000108654		0.672	CEP95-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX5	HGNC	protein_coding	OTTHUMT00000445100.2	52	0.00	0	C	NM_138363		62503388	62503388	-1	no_errors	ENST00000583699	ensembl	human	known	69_37n	rna	18	51.35	19	SNP	0.000	G
DENND2C	163259	genome.wustl.edu	37	1	115168209	115168209	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr1:115168209C>G	ENST00000393274.1	-	4	1022	c.397G>C	c.(397-399)Gat>Cat	p.D133H	DENND2C_ENST00000481894.1_5'Flank|DENND2C_ENST00000393277.1_Missense_Mutation_p.D133H|DENND2C_ENST00000393276.3_Missense_Mutation_p.D133H	NM_001256404.1	NP_001243333.1	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	133					positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|skin(3)	37	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTCTCTGGATCTAAGACATCT	0.363																																						dbGAP											0													79.0	80.0	79.0					1																	115168209		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS875.1, CCDS58018.1	1p13.2-p13.1	2012-10-03			ENSG00000175984	ENSG00000175984		"""DENN/MADD domain containing"""	24748	protein-coding gene	gene with protein product							Standard	NM_198459		Approved	FLJ37099, DKFZp686G0351, DKFZp779P1149, dJ1156J9.1, RP5-1156J9.1	uc001efd.1	Q68D51	OTTHUMG00000011893	ENST00000393274.1:c.397G>C	1.37:g.115168209C>G	ENSP00000376955:p.Asp133His		B1AL26|Q5TCX6|Q6P3R3	Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.D133H	ENST00000393274.1	37	c.397	CCDS58018.1	1	.	.	.	.	.	.	.	.	.	.	C	6.240	0.412357	0.11812	.	.	ENSG00000175984	ENST00000393276;ENST00000393274;ENST00000369540;ENST00000393277	T;T;T	0.09350	3.52;3.6;2.99	5.66	2.28	0.28536	.	2.092610	0.01628	N	0.023415	T	0.09949	0.0244	L	0.46157	1.445	0.27065	N	0.963455	B;P	0.39535	0.004;0.677	B;P	0.49922	0.004;0.626	T	0.39761	-0.9598	10	0.59425	D	0.04	.	9.9133	0.41419	0.0:0.6501:0.2367:0.1132	.	133;133	Q68D51;Q68D51-3	DEN2C_HUMAN;.	H	133	ENSP00000376957:D133H;ENSP00000376955:D133H;ENSP00000376958:D133H	ENSP00000358553:D133H	D	-	1	0	DENND2C	114969732	0.278000	0.24230	0.470000	0.27216	0.149000	0.21700	0.583000	0.23849	0.737000	0.32582	-0.133000	0.14855	GAT	DENND2C	-	NULL	ENSG00000175984		0.363	DENND2C-005	KNOWN	basic|CCDS	protein_coding	DENND2C	HGNC	protein_coding	OTTHUMT00000314822.1	54	0.00	0	C	NM_198459		115168209	115168209	-1	no_errors	ENST00000393274	ensembl	human	known	69_37n	missense	31	34.04	16	SNP	0.644	G
DGKH	160851	genome.wustl.edu	37	13	42752318	42752318	+	Silent	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr13:42752318C>T	ENST00000337343.4	+	13	1521	c.1500C>T	c.(1498-1500)ctC>ctT	p.L500L	DGKH_ENST00000540693.1_Silent_p.L500L|DGKH_ENST00000538674.1_Silent_p.L255L|DGKH_ENST00000261491.5_Silent_p.L500L|DGKH_ENST00000379274.2_Silent_p.L364L|DGKH_ENST00000536612.1_Silent_p.L364L|DGKH_ENST00000498255.2_3'UTR	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	500					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		CAAAAATCCTCAATTCTGATG	0.363																																						dbGAP											0													181.0	171.0	174.0					13																	42752318		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	ENST00000337343.4:c.1500C>T	13.37:g.42752318C>T			A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Silent	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_SAM_2,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_SAM_type1,superfamily_SAM/pointed,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_SAM,pfscan_Pleckstrin_homology,pfscan_SAM,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.L500	ENST00000337343.4	37	c.1500	CCDS9381.1	13																																																																																			DGKH	-	NULL	ENSG00000102780		0.363	DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DGKH	HGNC	protein_coding	OTTHUMT00000044699.2	40	0.00	0	C	NM_178009		42752318	42752318	+1	no_errors	ENST00000337343	ensembl	human	known	69_37n	silent	15	31.82	7	SNP	1.000	T
DNAJA3	9093	genome.wustl.edu	37	16	4504878	4504878	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr16:4504878G>A	ENST00000262375.6	+	11	1483	c.1406G>A	c.(1405-1407)gGa>gAa	p.G469E	DNAJA3_ENST00000355296.4_Intron|DNAJA3_ENST00000431375.2_Intron	NM_005147.5	NP_005138.3	Q96EY1	DNJA3_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 3	469					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation-induced cell death of T cells (GO:0006924)|cell aging (GO:0007569)|mitochondrial DNA replication (GO:0006264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of programmed cell death (GO:0043069)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell proliferation (GO:0042102)|protein folding (GO:0006457)|protein stabilization (GO:0050821)|response to heat (GO:0009408)|response to interferon-gamma (GO:0034341)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|small GTPase mediated signal transduction (GO:0007264)|T cell differentiation in thymus (GO:0033077)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of plasma membrane (GO:0019897)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|interferon-gamma receptor binding (GO:0005133)|metal ion binding (GO:0046872)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|small GTPase regulator activity (GO:0005083)|transcription factor binding (GO:0008134)			NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|upper_aerodigestive_tract(2)	15						GACGAGGAGGGATTCCTTTCC	0.502																																						dbGAP											0													85.0	79.0	81.0					16																	4504878		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF061749	CCDS10515.1, CCDS45400.1, CCDS66930.1	16p13.3	2011-09-02			ENSG00000103423	ENSG00000103423		"""Heat shock proteins / DNAJ (HSP40)"""	11808	protein-coding gene	gene with protein product		608382		TID1		9683573	Standard	NM_005147		Approved	hTid-1	uc002cwk.3	Q96EY1	OTTHUMG00000129470	ENST00000262375.6:c.1406G>A	16.37:g.4504878G>A	ENSP00000262375:p.Gly469Glu		B2RAJ5|B4DI33|E7ES32|O75472|Q8WUJ6|Q8WXJ3|Q96D76|Q96IV1|Q9NYH8	Missense_Mutation	SNP	pfam_DnaJ_N,pfam_DnaJ_C,pfam_HSP_DnaJ_Cys-rich_dom,superfamily_DnaJ_N,superfamily_HSP40/DnaJ_pept-bd,superfamily_HSP_DnaJ_Cys-rich_dom,smart_DnaJ_N,pfscan_DnaJ_N,pfscan_HSP_DnaJ_Cys-rich_dom,prints_Hsp_DnaJ	p.G469E	ENST00000262375.6	37	c.1406	CCDS10515.1	16	.	.	.	.	.	.	.	.	.	.	G	25.8	4.678089	0.88542	.	.	ENSG00000103423	ENST00000262375	T	0.67865	-0.29	5.49	5.49	0.81192	.	0.147794	0.43416	D	0.000579	T	0.80232	0.4585	L	0.58101	1.795	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81378	-0.0960	10	0.72032	D	0.01	-9.2723	18.3574	0.90362	0.0:0.0:1.0:0.0	.	469	Q96EY1	DNJA3_HUMAN	E	469	ENSP00000262375:G469E	ENSP00000262375:G469E	G	+	2	0	DNAJA3	4444879	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.885000	0.87282	2.580000	0.87095	0.591000	0.81541	GGA	DNAJA3	-	NULL	ENSG00000103423		0.502	DNAJA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DNAJA3	HGNC	protein_coding	OTTHUMT00000251633.1	26	0.00	0	G			4504878	4504878	+1	no_errors	ENST00000262375	ensembl	human	known	69_37n	missense	17	41.38	12	SNP	1.000	A
DZIP1L	199221	genome.wustl.edu	37	3	137800589	137800589	+	Silent	SNP	G	G	C			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr3:137800589G>C	ENST00000327532.2	-	9	1583	c.1221C>G	c.(1219-1221)ctC>ctG	p.L407L	DZIP1L_ENST00000488595.1_5'UTR|DZIP1L_ENST00000469243.1_Silent_p.L407L	NM_173543.2	NP_775814.2	Q8IYY4	DZI1L_HUMAN	DAZ interacting zinc finger protein 1-like	407					cilium assembly (GO:0042384)	ciliary basal body (GO:0036064)	metal ion binding (GO:0046872)			breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(2)|prostate(1)|skin(1)	35						CCACCTTCCTGAGAGACAAGG	0.498																																						dbGAP											0													169.0	126.0	141.0					3																	137800589		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK057406	CCDS3096.1, CCDS54645.1	3q22.3	2013-05-22	2013-05-22		ENSG00000158163	ENSG00000158163			26551	protein-coding gene	gene with protein product			"""DAZ interacting protein 1-like"""			12477932	Standard	NM_173543		Approved	FLJ32844, DZIP2	uc003erq.3	Q8IYY4	OTTHUMG00000159819	ENST00000327532.2:c.1221C>G	3.37:g.137800589G>C			C9JUG5|Q96M38	Silent	SNP	pfscan_Znf_C2H2	p.L407	ENST00000327532.2	37	c.1221	CCDS3096.1	3																																																																																			DZIP1L	-	NULL	ENSG00000158163		0.498	DZIP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DZIP1L	HGNC	protein_coding	OTTHUMT00000357548.1	35	0.00	0	G	NM_173543		137800589	137800589	-1	no_errors	ENST00000327532	ensembl	human	known	69_37n	silent	8	55.56	10	SNP	0.159	C
EIF3D	8664	genome.wustl.edu	37	22	36912354	36912354	+	Intron	SNP	C	C	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr22:36912354C>A	ENST00000216190.8	-	12	1577				EIF3D_ENST00000541106.1_Intron|EIF3D_ENST00000405442.1_Intron	NM_003753.3	NP_003744.1			eukaryotic translation initiation factor 3, subunit D											cervix(1)|endometrium(2)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	15						TCTTTCTCAGCAAGGAACTAA	0.373																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U54558	CCDS13930.1	22q13.1	2007-07-27	2007-07-27	2007-07-27	ENSG00000100353	ENSG00000100353			3278	protein-coding gene	gene with protein product		603915	"""eukaryotic translation initiation factor 3, subunit 7 zeta, 66/67kDa"""	EIF3S7		9341143	Standard	NM_003753		Approved	eIF3-p66, eIF3-zeta, eIF3d	uc003apr.3	O15371	OTTHUMG00000150599	ENST00000216190.8:c.1206+170G>T	22.37:g.36912354C>A				RNA	SNP	-	NULL	ENST00000216190.8	37	NULL	CCDS13930.1	22																																																																																			EIF3D	-	-	ENSG00000100353		0.373	EIF3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3D	HGNC	protein_coding	OTTHUMT00000319026.1	14	0.00	0	C			36912354	36912354	-1	no_errors	ENST00000462794	ensembl	human	known	69_37n	rna	9	52.63	10	SNP	0.000	A
EP400	57634	genome.wustl.edu	37	12	132504703	132504703	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr12:132504703C>T	ENST00000333577.4	+	23	4604	c.4495C>T	c.(4495-4497)Cag>Tag	p.Q1499*	EP400_ENST00000330386.6_Nonsense_Mutation_p.Q1463*|EP400_ENST00000389562.2_Nonsense_Mutation_p.Q1462*|EP400_ENST00000332482.4_Nonsense_Mutation_p.Q1426*|EP400_ENST00000389561.2_Nonsense_Mutation_p.Q1463*			Q96L91	EP400_HUMAN	E1A binding protein p400	1499					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		TGCTGCTCCACAGGGCCCGCT	0.662																																						dbGAP											0													43.0	46.0	45.0					12																	132504703		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.4495C>T	12.37:g.132504703C>T	ENSP00000333602:p.Gln1499*		O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_HSA,pfam_Helicase_C,superfamily_Homeodomain-like,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Myb-like_dom,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q1499*	ENST00000333577.4	37	c.4495		12	.	.	.	.	.	.	.	.	.	.	C	44	10.789542	0.99468	.	.	ENSG00000183495	ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000541296;ENST00000542457	.	.	.	5.56	4.66	0.58398	.	0.403130	0.28612	N	0.014723	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	.	15.8239	0.78683	0.137:0.863:0.0:0.0	.	.	.	.	X	1499;1463;1462;1426;1463;1463;1463	.	ENSP00000330620:Q1463X	Q	+	1	0	EP400	131070656	0.999000	0.42202	0.305000	0.25099	0.724000	0.41520	5.085000	0.64468	1.314000	0.45095	0.650000	0.86243	CAG	EP400	-	NULL	ENSG00000183495		0.662	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	EP400	HGNC	protein_coding		19	0.00	0	C	NM_015409		132504703	132504703	+1	no_errors	ENST00000333577	ensembl	human	known	69_37n	nonsense	13	45.83	11	SNP	0.917	T
EXOC1	55763	genome.wustl.edu	37	4	56765964	56765964	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr4:56765964G>A	ENST00000381295.2	+	17	2599	c.2251G>A	c.(2251-2253)Gaa>Aaa	p.E751K	EXOC1_ENST00000349598.6_Missense_Mutation_p.E736K|EXOC1_ENST00000346134.7_Missense_Mutation_p.E751K	NM_001024924.1	NP_001020095.1	Q9NV70	EXOC1_HUMAN	exocyst complex component 1	751					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	35	Glioma(25;0.08)|all_neural(26;0.101)					TCTAGAAGCAGAAAAAAAAGA	0.338																																						dbGAP											0													85.0	94.0	91.0					4																	56765964		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027047	CCDS3502.1, CCDS3503.1	4q12	2013-01-22	2005-11-01	2005-11-01	ENSG00000090989	ENSG00000090989			30380	protein-coding gene	gene with protein product		607879	"""SEC3-like 1 (S. cerevisiae)"""	SEC3L1		11042152, 11406615	Standard	XM_005265747		Approved	SEC3, FLJ10893, BM-102, Sec3p	uc003hbf.1	Q9NV70	OTTHUMG00000102165	ENST00000381295.2:c.2251G>A	4.37:g.56765964G>A	ENSP00000370695:p.Glu751Lys		Q504V4|Q8WUE7|Q96T15|Q9NZE4	Missense_Mutation	SNP	pfam_Exocyst_Exoc1	p.E751K	ENST00000381295.2	37	c.2251	CCDS3502.1	4	.	.	.	.	.	.	.	.	.	.	G	16.46	3.129674	0.56721	.	.	ENSG00000090989	ENST00000381295;ENST00000346134;ENST00000349598	.	.	.	5.37	5.37	0.77165	.	0.045183	0.85682	D	0.000000	T	0.66356	0.2781	L	0.57536	1.79	0.80722	D	1	B;B	0.30526	0.176;0.283	B;B	0.39465	0.13;0.3	T	0.62426	-0.6857	9	0.29301	T	0.29	.	19.1021	0.93277	0.0:0.0:1.0:0.0	.	736;751	Q9NV70-2;Q9NV70	.;EXOC1_HUMAN	K	751;751;736	.	ENSP00000326514:E751K	E	+	1	0	EXOC1	56460721	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.387000	0.97232	2.492000	0.84095	0.650000	0.86243	GAA	EXOC1	-	pfam_Exocyst_Exoc1	ENSG00000090989		0.338	EXOC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	EXOC1	HGNC	protein_coding	OTTHUMT00000361799.1	19	0.00	0	G	NM_018261		56765964	56765964	+1	no_errors	ENST00000346134	ensembl	human	known	69_37n	missense	16	48.39	15	SNP	1.000	A
F13A1	2162	genome.wustl.edu	37	6	6152107	6152107	+	Nonsense_Mutation	SNP	G	G	A	rs267606789		TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr6:6152107G>A	ENST00000264870.3	-	14	2249	c.1984C>T	c.(1984-1986)Cga>Tga	p.R662*		NM_000129.3	NP_000120.2	P00488	F13A_HUMAN	coagulation factor XIII, A1 polypeptide	662					blood coagulation (GO:0007596)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	62	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	CAGACATTTCGCAGGGTTTCT	0.493																																						dbGAP											0			GRCh37	CM940387	F13A1	M							100.0	91.0	94.0					6																	6152107		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M14539	CCDS4496.1	6p24.2-p23	2014-01-24			ENSG00000124491	ENSG00000124491		"""Transglutaminases"""	3531	protein-coding gene	gene with protein product		134570		F13A			Standard	NM_000129		Approved		uc003mwv.3	P00488	OTTHUMG00000014186	ENST00000264870.3:c.1984C>T	6.37:g.6152107G>A	ENSP00000264870:p.Arg662*		Q59HA7|Q8N6X2|Q96P24|Q9BX29	Nonsense_Mutation	SNP	pfam_Transglutaminase_C,pfam_Transglutaminase_N,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.R662*	ENST00000264870.3	37	c.1984	CCDS4496.1	6	.	.	.	.	.	.	.	.	.	.	G	27.6	4.845415	0.91197	.	.	ENSG00000124491	ENST00000264870	.	.	.	5.37	-4.68	0.03309	.	1.380880	0.04669	N	0.410305	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	.	7.1028	0.25346	0.0672:0.0917:0.2552:0.5859	.	.	.	.	X	662	.	ENSP00000264870:R662X	R	-	1	2	F13A1	6097106	0.000000	0.05858	0.000000	0.03702	0.073000	0.16967	-1.048000	0.03517	-0.792000	0.04480	-0.133000	0.14855	CGA	F13A1	-	pfam_Transglutaminase_C,superfamily_Transglutaminase_C	ENSG00000124491		0.493	F13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F13A1	HGNC	protein_coding	OTTHUMT00000039756.3	15	0.00	0	G	NM_000129		6152107	6152107	-1	no_errors	ENST00000264870	ensembl	human	known	69_37n	nonsense	7	56.25	9	SNP	0.000	A
F8	2157	genome.wustl.edu	37	X	154158487	154158487	+	Missense_Mutation	SNP	A	A	C			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chrX:154158487A>C	ENST00000360256.4	-	14	3778	c.3578T>G	c.(3577-3579)cTa>cGa	p.L1193R		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1193	B.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	AGTAAGAAATAGGTTTCTGCT	0.323																																						dbGAP											0													41.0	41.0	41.0					X																	154158487		2202	4297	6499	-	-	-	SO:0001583	missense	0			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.3578T>G	X.37:g.154158487A>C	ENSP00000353393:p.Leu1193Arg		Q14286|Q5HY69	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.L1193R	ENST00000360256.4	37	c.3578	CCDS35457.1	X	.	.	.	.	.	.	.	.	.	.	a	4.813	0.151220	0.09185	.	.	ENSG00000185010	ENST00000360256	D	0.99105	-5.43	5.73	1.92	0.25849	.	1.133800	0.06375	N	0.714299	D	0.95840	0.8646	L	0.29908	0.895	0.09310	N	1	B	0.31931	0.347	B	0.23574	0.047	D	0.92124	0.5706	10	0.66056	D	0.02	2.0E-4	1.4816	0.02438	0.5426:0.1825:0.0959:0.1791	.	1193	P00451	FA8_HUMAN	R	1193	ENSP00000353393:L1193R	ENSP00000353393:L1193R	L	-	2	0	F8	153811681	0.000000	0.05858	0.000000	0.03702	0.154000	0.21943	0.271000	0.18626	0.246000	0.21394	0.483000	0.47432	CTA	F8	-	NULL	ENSG00000185010		0.323	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F8	HGNC	protein_coding	OTTHUMT00000058869.4	51	0.00	0	A			154158487	154158487	-1	no_errors	ENST00000360256	ensembl	human	known	69_37n	missense	16	46.67	14	SNP	0.000	C
FAM115A	9747	genome.wustl.edu	37	7	143573620	143573620	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr7:143573620C>T	ENST00000479870.1	-	2	290	c.82G>A	c.(82-84)Gaa>Aaa	p.E28K	FAM115A_ENST00000355951.2_Missense_Mutation_p.E28K|FAM115A_ENST00000392900.3_Intron	NM_001206938.1|NM_001206941.1|NM_014719.2	NP_001193867.1|NP_001193870.1|NP_055534	Q9Y4C2	F115A_HUMAN	family with sequence similarity 115, member A	28										NS(1)|endometrium(1)|lung(5)	7	Melanoma(164;0.0903)					AGAAGCAGTTCACATGGAACA	0.542																																						dbGAP											0													113.0	89.0	97.0					7																	143573620		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018281	CCDS5886.1, CCDS56514.1	7q35	2011-05-03	2006-03-23	2006-03-23	ENSG00000198420	ENSG00000198420			22201	protein-coding gene	gene with protein product						9872452	Standard	NM_014719		Approved	KIAA0738	uc003wdo.2	Q9Y4C2	OTTHUMG00000157773	ENST00000479870.1:c.82G>A	7.37:g.143573620C>T	ENSP00000419235:p.Glu28Lys		A8K6E0|Q75KM8|Q75KM9|Q7L665|Q9BW63	Missense_Mutation	SNP	NULL	p.E28K	ENST00000479870.1	37	c.82	CCDS5886.1	7	.	.	.	.	.	.	.	.	.	.	C	16.15	3.040896	0.55003	.	.	ENSG00000198420	ENST00000479870;ENST00000355951;ENST00000460532;ENST00000491908;ENST00000478172;ENST00000485416	T;T;T;T;T;T	0.21543	2.0;2.0;2.0;2.0;2.0;2.0	4.01	4.01	0.46588	.	0.125967	0.53938	D	0.000056	T	0.22166	0.0534	L	0.58302	1.8	0.38715	D	0.953305	P	0.36990	0.577	B	0.41135	0.348	T	0.02676	-1.1125	10	0.31617	T	0.26	-13.7647	7.8039	0.29191	0.0:0.8894:0.0:0.1106	.	28	Q9Y4C2	F115A_HUMAN	K	28	ENSP00000419235:E28K;ENSP00000348220:E28K;ENSP00000420607:E28K;ENSP00000417600:E28K;ENSP00000419622:E28K;ENSP00000418432:E28K	ENSP00000348220:E28K	E	-	1	0	FAM115A	143204553	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	2.131000	0.42074	2.526000	0.85167	0.585000	0.79938	GAA	FAM115A	-	NULL	ENSG00000198420		0.542	FAM115A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM115A	HGNC	protein_coding	OTTHUMT00000349583.1	34	0.00	0	C	NM_014719		143573620	143573620	-1	no_errors	ENST00000479870	ensembl	human	known	69_37n	missense	17	37.04	10	SNP	1.000	T
FAM153B	202134	genome.wustl.edu	37	5	175536140	175536140	+	Splice_Site	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr5:175536140C>T	ENST00000253490.4	+	18	1021	c.964C>T	c.(964-966)Caa>Taa	p.Q322*	FAM153B_ENST00000515817.1_Splice_Site_p.Q245*|FAM153B_ENST00000512862.1_Intron|FAM153B_ENST00000510151.1_Splice_Site_p.Q245*			P0C7A2	F153B_HUMAN	family with sequence similarity 153, member B	322										endometrium(3)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	16	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)		ACTGGCAAAGCGTACGTATTC	0.473																																						dbGAP											0													2.0	3.0	3.0					5																	175536140		1465	3328	4793	-	-	-	SO:0001630	splice_region_variant	0			AK055006	CCDS43401.1, CCDS43401.2	5q35.2	2010-05-12			ENSG00000182230	ENSG00000182230			27323	protein-coding gene	gene with protein product							Standard	NM_001265615		Approved		uc031smb.1	P0C7A2	OTTHUMG00000163181	ENST00000253490.4:c.964+1C>T	5.37:g.175536140C>T			A8MTI1	Nonsense_Mutation	SNP	prints_FAM153	p.Q322*	ENST00000253490.4	37	c.964		5	.	.	.	.	.	.	.	.	.	.	A	13.48	2.249669	0.39797	.	.	ENSG00000182230	ENST00000515817;ENST00000253490	.	.	.	1.06	-2.12	0.07165	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	0.0639	0.00016	0.3001:0.1667:0.2085:0.3247	.	.	.	.	X	245;322	.	ENSP00000253490:Q322X	Q	+	1	0	FAM153B	175468746	0.357000	0.24938	0.000000	0.03702	0.001000	0.01503	-4.000000	0.00316	-4.323000	0.00056	-3.973000	0.00014	CAA	FAM153B	-	prints_FAM153	ENSG00000182230		0.473	FAM153B-201	KNOWN	basic|appris_candidate_longest	protein_coding	FAM153B	HGNC	protein_coding		16	0.00	0	C	NM_001079529	Nonsense_Mutation	175536140	175536140	+1	no_errors	ENST00000253490	ensembl	human	known	69_37n	nonsense	15	37.50	9	SNP	0.000	T
FAM210B	116151	genome.wustl.edu	37	20	54941259	54941259	+	Silent	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr20:54941259C>T	ENST00000371384.3	+	3	586	c.495C>T	c.(493-495)atC>atT	p.I165I		NM_080821.2	NP_543011.2	Q96KR6	F210B_HUMAN	family with sequence similarity 210, member B	165	DUF1279.					integral component of membrane (GO:0016021)											CAGTGAGAATCAGCATTACGC	0.448																																						dbGAP											0													138.0	130.0	133.0					20																	54941259		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL121914	CCDS13450.1	20q13.2	2011-11-24	2011-11-24	2011-11-24	ENSG00000124098	ENSG00000124098			16102	protein-coding gene	gene with protein product	"""hypothetical protein LOC116151"""		"""chromosome 20 open reading frame 108"""	C20orf108		11780052	Standard	NM_080821		Approved	dJ1167H4.1, DKFZP434A1114	uc002xxc.3	Q96KR6	OTTHUMG00000032793	ENST00000371384.3:c.495C>T	20.37:g.54941259C>T			B2RBQ9|E1P5Y7|Q8WVN2|Q9BYL6|Q9H418	Silent	SNP	pfam_DUF1279	p.I165	ENST00000371384.3	37	c.495	CCDS13450.1	20																																																																																			FAM210B	-	pfam_DUF1279	ENSG00000124098		0.448	FAM210B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM210B	HGNC	protein_coding	OTTHUMT00000079800.2	34	0.00	0	C	NM_080821		54941259	54941259	+1	no_errors	ENST00000371384	ensembl	human	known	69_37n	silent	21	32.26	10	SNP	1.000	T
FCHSD1	89848	genome.wustl.edu	37	5	141019951	141019951	+	3'UTR	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr5:141019951C>T	ENST00000435817.2	-	0	3237				RELL2_ENST00000518856.1_Intron|RELL2_ENST00000518025.1_Intron|RELL2_ENST00000444782.1_Intron|RELL2_ENST00000521367.1_Intron|RELL2_ENST00000297164.3_Intron|FCHSD1_ENST00000523856.1_5'UTR	NM_033449.2	NP_258260.1	Q86WN1	FCSD1_HUMAN	FCH and double SH3 domains 1										FCHSD1/BRAF(2)	central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTGGTCTCTCATTGTTGACC	0.537																																						dbGAP											0													158.0	143.0	148.0					5																	141019951		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			AK027281	CCDS47295.1	5q31.3	2008-02-05			ENSG00000197948	ENSG00000197948			25463	protein-coding gene	gene with protein product						11214971, 15067381	Standard	NM_033449		Approved	FLJ00007	uc003llk.3	Q86WN1	OTTHUMG00000163762	ENST00000435817.2:c.*1114G>A	5.37:g.141019951C>T			Q6UX75|Q86Y77|Q9NXX8	RNA	SNP	-	NULL	ENST00000435817.2	37	NULL	CCDS47295.1	5																																																																																			FCHSD1	-	-	ENSG00000197948		0.537	FCHSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCHSD1	HGNC	protein_coding	OTTHUMT00000375282.2	26	0.00	0	C	NM_033449		141019951	141019951	-1	no_errors	ENST00000523856	ensembl	human	known	69_37n	rna	13	43.48	10	SNP	0.002	T
FGF8	2253	genome.wustl.edu	37	10	103534571	103534571	+	Silent	SNP	G	G	C			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr10:103534571G>C	ENST00000344255.3	-	4	221	c.222C>G	c.(220-222)ctC>ctG	p.L74L	FGF8_ENST00000347978.2_Silent_p.L56L|FGF8_ENST00000485728.1_5'UTR|FGF8_ENST00000346714.3_Silent_p.L45L|FGF8_ENST00000320185.2_Silent_p.L85L			P55075	FGF8_HUMAN	fibroblast growth factor 8 (androgen-induced)	74					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|apoptotic process (GO:0006915)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in mesendoderm migration (GO:0090134)|cell proliferation in forebrain (GO:0021846)|corticotropin hormone secreting cell differentiation (GO:0060128)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral axon guidance (GO:0033563)|embryonic hindlimb morphogenesis (GO:0035116)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain morphogenesis (GO:0048853)|forebrain neuron development (GO:0021884)|gastrulation (GO:0007369)|gonad development (GO:0008406)|heart looping (GO:0001947)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|lung morphogenesis (GO:0060425)|male genitalia development (GO:0030539)|MAPK cascade (GO:0000165)|mesodermal cell migration (GO:0008078)|mesonephros development (GO:0001823)|metanephros development (GO:0001656)|midbrain-hindbrain boundary development (GO:0030917)|motor neuron axon guidance (GO:0008045)|negative regulation of cardiac muscle tissue development (GO:0055026)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate morphogenesis (GO:0001839)|neuroepithelial cell differentiation (GO:0060563)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|organ induction (GO:0001759)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|pallium development (GO:0021543)|patterning of blood vessels (GO:0001569)|pharyngeal system development (GO:0060037)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of mitosis (GO:0045840)|positive regulation of organ growth (GO:0046622)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to oxidative stress (GO:0006979)|signal transduction involved in regulation of gene expression (GO:0023019)|subpallium development (GO:0021544)|thyroid gland development (GO:0030878)|thyroid-stimulating hormone-secreting cell differentiation (GO:0060129)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|type 1 fibroblast growth factor receptor binding (GO:0005105)|type 2 fibroblast growth factor receptor binding (GO:0005111)			endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(2)	5		Colorectal(252;0.122)		Epithelial(162;3.94e-09)|all cancers(201;2.13e-07)		TGCGGCTGTAGAGTTGGTAGG	0.602																																						dbGAP											0													73.0	72.0	72.0					10																	103534571		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D38752	CCDS7515.1, CCDS7516.1, CCDS7517.1, CCDS7518.1, CCDS73185.1	10q25-q26	2014-01-30			ENSG00000107831	ENSG00000107831		"""Endogenous ligands"""	3686	protein-coding gene	gene with protein product		600483				8595889	Standard	NM_033164		Approved	AIGF	uc001ktq.2	P55075	OTTHUMG00000018940	ENST00000344255.3:c.222C>G	10.37:g.103534571G>C			A1A514|Q14915|Q15766	Silent	SNP	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_IL1_HBGF	p.L85	ENST00000344255.3	37	c.255	CCDS7517.1	10																																																																																			FGF8	-	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF	ENSG00000107831		0.602	FGF8-004	KNOWN	basic|CCDS	protein_coding	FGF8	HGNC	protein_coding	OTTHUMT00000049999.1	40	0.00	0	G	NM_006119, NM_033165		103534571	103534571	-1	no_errors	ENST00000320185	ensembl	human	known	69_37n	silent	23	39.47	15	SNP	0.998	C
FNDC5	252995	genome.wustl.edu	37	1	33328660	33328660	+	3'UTR	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr1:33328660C>T	ENST00000373471.3	-	0	1940				FNDC5_ENST00000481487.1_5'UTR|FNDC5_ENST00000609187.1_3'UTR	NM_001171940.1|NM_153756.2	NP_001165411.2|NP_715637.2	Q8NAU1	FNDC5_HUMAN	fibronectin type III domain containing 5						positive regulation of brown fat cell differentiation (GO:0090336)|response to muscle activity (GO:0014850)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)				breast(1)|large_intestine(1)|lung(2)|ovary(1)	5		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				GTTGTCCAAGCTAGCATTTCT	0.453																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK092102	CCDS369.1, CCDS369.2, CCDS65483.1	1p34.3	2013-10-16			ENSG00000160097	ENSG00000160097		"""Fibronectin type III domain containing"""	20240	protein-coding gene	gene with protein product	"""irisin"""	611906				12384288, 22237023, 24120943	Standard	NM_153756		Approved	FRCP2	uc001bwg.3	Q8NAU1	OTTHUMG00000004015	ENST00000373471.3:c.*1235G>A	1.37:g.33328660C>T			A6NMC9|D3DPQ6|Q6P6D9|Q7Z676	RNA	SNP	-	NULL	ENST00000373471.3	37	NULL		1																																																																																			FNDC5	-	-	ENSG00000160097		0.453	FNDC5-001	KNOWN	non_ATG_start|basic	protein_coding	FNDC5	HGNC	protein_coding	OTTHUMT00000011467.3	14	0.00	0	C	NM_153756		33328660	33328660	-1	no_errors	ENST00000481487	ensembl	human	known	69_37n	rna	9	43.75	7	SNP	0.000	T
FLG	2312	genome.wustl.edu	37	1	152282080	152282080	+	Missense_Mutation	SNP	C	C	T	rs375545359		TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr1:152282080C>T	ENST00000368799.1	-	3	5317	c.5282G>A	c.(5281-5283)cGt>cAt	p.R1761H	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1761	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGACCCTGAACGTCCAGACCT	0.602									Ichthyosis																													dbGAP											0													210.0	215.0	213.0					1																	152282080		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.5282G>A	1.37:g.152282080C>T	ENSP00000357789:p.Arg1761His		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.R1761H	ENST00000368799.1	37	c.5282	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	C	9.875	1.200049	0.22121	.	.	ENSG00000143631	ENST00000368799	T	0.01323	5.01	2.94	-5.62	0.02481	.	.	.	.	.	T	0.00998	0.0033	L	0.43152	1.355	0.09310	N	1	D	0.71674	0.998	D	0.72075	0.976	T	0.38286	-0.9668	9	0.37606	T	0.19	-0.028	0.9234	0.01320	0.1662:0.2479:0.3368:0.2491	.	1761	P20930	FILA_HUMAN	H	1761	ENSP00000357789:R1761H	ENSP00000357789:R1761H	R	-	2	0	FLG	150548704	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.397000	0.07269	-1.216000	0.02607	-0.384000	0.06662	CGT	FLG	-	NULL	ENSG00000143631		0.602	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	118	0.84	1	C	NM_002016		152282080	152282080	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	missense	145	25.26	49	SNP	0.000	T
FSIP2	401024	genome.wustl.edu	37	2	186653387	186653387	+	Silent	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr2:186653387G>A	ENST00000424728.1	+	16	1524	c.1524G>A	c.(1522-1524)ctG>ctA	p.L508L	FSIP2_ENST00000343098.5_Silent_p.L597L|AC008174.3_ENST00000436557.1_RNA|AC008174.3_ENST00000429929.1_RNA			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	508										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						CTGAAGAACTGAATATTATAA	0.338																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.1524G>A	2.37:g.186653387G>A			Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Silent	SNP	NULL	p.L597	ENST00000424728.1	37	c.1791		2																																																																																			FSIP2	-	NULL	ENSG00000188738		0.338	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	35	0.00	0	G	NM_173651		186653387	186653387	+1	no_errors	ENST00000343098	ensembl	human	known	69_37n	silent	5	68.75	11	SNP	0.773	A
GAL3ST3	89792	genome.wustl.edu	37	11	65810977	65810977	+	Silent	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr11:65810977C>T	ENST00000312006.4	-	3	578	c.297G>A	c.(295-297)ccG>ccA	p.P99P	GAL3ST3_ENST00000527878.1_Silent_p.P99P	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	99					monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			kidney(1)|lung(9)|ovary(2)|skin(2)	14						GCTCGCAGCTCGGGTGCGGCA	0.672																																						dbGAP											0													24.0	23.0	24.0					11																	65810977		2198	4291	6489	-	-	-	SO:0001819	synonymous_variant	0			AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.297G>A	11.37:g.65810977C>T			Q14D05	Silent	SNP	pfam_Gal-3-0_sulfotransfrase	p.P99	ENST00000312006.4	37	c.297	CCDS8128.1	11																																																																																			GAL3ST3	-	pfam_Gal-3-0_sulfotransfrase	ENSG00000175229		0.672	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAL3ST3	HGNC	protein_coding	OTTHUMT00000391052.1	46	0.00	0	C	NM_033036		65810977	65810977	-1	no_errors	ENST00000312006	ensembl	human	known	69_37n	silent	11	66.67	22	SNP	0.840	T
GDPD4	220032	genome.wustl.edu	37	11	76928297	76928297	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr11:76928297C>T	ENST00000376217.2	-	17	1807	c.1557G>A	c.(1555-1557)atG>atA	p.M519I	GDPD4_ENST00000315938.4_3'UTR			Q6W3E5	GDPD4_HUMAN	glycerophosphodiester phosphodiesterase domain containing 4	519					glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)|skin(1)	20						CAGGAGGTTTCATGGCTATGT	0.458																																						dbGAP											0													120.0	113.0	116.0					11																	76928297		2200	4292	6492	-	-	-	SO:0001583	missense	0			AY326450	CCDS8249.1	11q13.5	2008-02-05			ENSG00000178795	ENSG00000178795			24849	protein-coding gene	gene with protein product							Standard	NM_182833		Approved	GDE6	uc001oyf.3	Q6W3E5	OTTHUMG00000165136	ENST00000376217.2:c.1557G>A	11.37:g.76928297C>T	ENSP00000365390:p.Met519Ile		Q7Z5B0	Missense_Mutation	SNP	pfam_GlyceroP-diester-Pdiesterase,superfamily_PLC-like_Pdiesterase_TIM-brl	p.M519I	ENST00000376217.2	37	c.1557		11	.	.	.	.	.	.	.	.	.	.	C	0.822	-0.748351	0.03065	.	.	ENSG00000178795	ENST00000376217	T	0.13196	2.61	2.99	-5.98	0.02220	.	4.500030	0.00616	N	0.000422	T	0.05135	0.0137	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.31166	-0.9953	7	0.14252	T	0.57	4.922	0.7472	0.00984	0.3636:0.2926:0.1271:0.2167	.	.	.	.	I	519	ENSP00000365390:M519I	ENSP00000365390:M519I	M	-	3	0	GDPD4	76605945	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.708000	0.05035	-2.453000	0.00541	-0.825000	0.03093	ATG	GDPD4	-	NULL	ENSG00000178795		0.458	GDPD4-002	KNOWN	basic|appris_candidate_longest	protein_coding	GDPD4	HGNC	protein_coding	OTTHUMT00000382075.1	51	0.00	0	C	NM_182833		76928297	76928297	-1	no_errors	ENST00000376217	ensembl	human	known	69_37n	missense	57	31.33	26	SNP	0.000	T
GPAM	57678	genome.wustl.edu	37	10	113915732	113915732	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr10:113915732G>C	ENST00000348367.4	-	20	2398	c.2201C>G	c.(2200-2202)tCt>tGt	p.S734C	GPAM_ENST00000423155.1_Missense_Mutation_p.S734C|GPAM_ENST00000369425.1_3'UTR			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	734					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		GATGGCAGCAGAGCTGTAGGC	0.468																																					Ovarian(161;1017 2606 18293 52943)	dbGAP											0													91.0	81.0	85.0					10																	113915732		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.2201C>G	10.37:g.113915732G>C	ENSP00000265276:p.Ser734Cys		Q5VW51|Q86TA3	Missense_Mutation	SNP	pfam_Acyltransferase,smart_Acyltransferase	p.S734C	ENST00000348367.4	37	c.2201	CCDS7570.1	10	.	.	.	.	.	.	.	.	.	.	G	17.13	3.310491	0.60414	.	.	ENSG00000119927	ENST00000348367;ENST00000423155	T;T	0.69561	-0.41;-0.41	5.18	5.18	0.71444	.	0.135264	0.52532	D	0.000061	T	0.65207	0.2669	L	0.51422	1.61	0.40739	D	0.982819	P	0.48640	0.913	B	0.44163	0.443	T	0.66779	-0.5837	10	0.36615	T	0.2	-18.1004	17.2377	0.87004	0.0:0.0:1.0:0.0	.	734	Q9HCL2	GPAT1_HUMAN	C	734	ENSP00000265276:S734C;ENSP00000409242:S734C	ENSP00000265276:S734C	S	-	2	0	GPAM	113905722	1.000000	0.71417	0.993000	0.49108	0.994000	0.84299	6.505000	0.73708	2.554000	0.86153	0.655000	0.94253	TCT	GPAM	-	NULL	ENSG00000119927		0.468	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPAM	HGNC	protein_coding	OTTHUMT00000050377.1	71	0.00	0	G	NM_020918		113915732	113915732	-1	no_errors	ENST00000348367	ensembl	human	known	69_37n	missense	19	53.66	22	SNP	0.998	C
GPR34	2857	genome.wustl.edu	37	X	41555198	41555198	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chrX:41555198C>G	ENST00000378142.4	+	3	596	c.312C>G	c.(310-312)atC>atG	p.I104M	CASK_ENST00000442742.2_Intron|CASK_ENST00000421587.2_Intron|CASK_ENST00000318588.9_Intron|CASK_ENST00000378166.4_Intron|CASK_ENST00000361962.4_Intron|CASK_ENST00000378158.1_Intron|CASK_ENST00000378163.1_Intron|GPR34_ENST00000378138.5_Missense_Mutation_p.I104M|CASK_ENST00000378154.1_Intron	NM_001097579.1|NM_005300.3	NP_001091048.1|NP_005291.1	Q9UPC5	GPR34_HUMAN	G protein-coupled receptor 34	104					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	14						TCCTACTCATCTTCTGCCTCC	0.388																																						dbGAP											0													148.0	137.0	141.0					X																	41555198		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039686	CCDS14258.1	Xp11.4	2012-08-21			ENSG00000171659	ENSG00000171659		"""GPCR / Class A : Orphans"""	4490	protein-coding gene	gene with protein product		300241				10395919, 10036181	Standard	NM_005300		Approved		uc004dfq.4	Q9UPC5	OTTHUMG00000021375	ENST00000378142.4:c.312C>G	X.37:g.41555198C>G	ENSP00000367384:p.Ile104Met		O95853	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor	p.I104M	ENST00000378142.4	37	c.312	CCDS14258.1	X	.	.	.	.	.	.	.	.	.	.	C	13.05	2.122197	0.37436	.	.	ENSG00000171659	ENST00000378142;ENST00000378138;ENST00000535368	T;T	0.37752	1.18;1.18	5.96	3.28	0.37604	GPCR, rhodopsin-like superfamily (1);	0.196751	0.46442	D	0.000300	T	0.54615	0.1869	M	0.75264	2.295	0.42369	D	0.992442	D	0.67145	0.996	D	0.68621	0.959	T	0.53549	-0.8423	10	0.72032	D	0.01	-14.9474	8.5375	0.33373	0.0:0.6332:0.0:0.3668	.	104	Q9UPC5	GPR34_HUMAN	M	104;104;57	ENSP00000367384:I104M;ENSP00000367378:I104M	ENSP00000367378:I104M	I	+	3	3	GPR34	41440142	0.988000	0.35896	1.000000	0.80357	0.963000	0.63663	0.232000	0.17891	0.274000	0.22072	-0.199000	0.12753	ATC	GPR34	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor	ENSG00000171659		0.388	GPR34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR34	HGNC	protein_coding	OTTHUMT00000056264.1	32	0.00	0	C	NM_005300		41555198	41555198	+1	no_errors	ENST00000378138	ensembl	human	known	69_37n	missense	20	45.95	17	SNP	0.994	G
GPR34	2857	genome.wustl.edu	37	X	41555705	41555705	+	Silent	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chrX:41555705C>T	ENST00000378142.4	+	3	1103	c.819C>T	c.(817-819)atC>atT	p.I273I	CASK_ENST00000442742.2_Intron|CASK_ENST00000421587.2_Intron|CASK_ENST00000318588.9_Intron|CASK_ENST00000378166.4_Intron|CASK_ENST00000361962.4_Intron|CASK_ENST00000378158.1_Intron|CASK_ENST00000378163.1_Intron|GPR34_ENST00000378138.5_Silent_p.I273I|CASK_ENST00000378154.1_Intron	NM_001097579.1|NM_005300.3	NP_001091048.1|NP_005291.1	Q9UPC5	GPR34_HUMAN	G protein-coupled receptor 34	273					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	14						TTGTACTTATCATTTTTACTA	0.333																																						dbGAP											0													179.0	130.0	147.0					X																	41555705		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF039686	CCDS14258.1	Xp11.4	2012-08-21			ENSG00000171659	ENSG00000171659		"""GPCR / Class A : Orphans"""	4490	protein-coding gene	gene with protein product		300241				10395919, 10036181	Standard	NM_005300		Approved		uc004dfq.4	Q9UPC5	OTTHUMG00000021375	ENST00000378142.4:c.819C>T	X.37:g.41555705C>T			O95853	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor	p.I273	ENST00000378142.4	37	c.819	CCDS14258.1	X																																																																																			GPR34	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000171659		0.333	GPR34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR34	HGNC	protein_coding	OTTHUMT00000056264.1	38	0.00	0	C	NM_005300		41555705	41555705	+1	no_errors	ENST00000378138	ensembl	human	known	69_37n	silent	18	28.00	7	SNP	1.000	T
HLA-DQB2	3120	genome.wustl.edu	37	6	32725653	32725653	+	Silent	SNP	C	C	T	rs144961216		TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr6:32725653C>T	ENST00000437316.2	-	4	717	c.654G>A	c.(652-654)caG>caA	p.Q218Q	HLA-DQB2_ENST00000435145.2_Silent_p.Q218Q|HLA-DQB2_ENST00000411527.1_Intron			P05538	DQB2_HUMAN	major histocompatibility complex, class II, DQ beta 2	222	Beta-2.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|B cell affinity maturation (GO:0002344)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of alpha-beta T cell activation (GO:0046635)|positive regulation of antigen processing and presentation (GO:0002579)|positive regulation of T-helper 1 type immune response (GO:0002827)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome (GO:0005769)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)|toxic substance binding (GO:0015643)			endometrium(1)|kidney(1)|lung(1)|prostate(2)	5						CAGATTCAGACTGAGCCCCTA	0.557																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			M83890	CCDS56419.1	6p21.3	2013-01-11			ENSG00000232629	ENSG00000232629		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4945	protein-coding gene	gene with protein product		615161		HLA-DXB		2564844	Standard	NM_001198858		Approved		uc003oby.4	P05538	OTTHUMG00000031125	ENST00000437316.2:c.654G>A	6.37:g.32725653C>T			A6NIA5|Q29826|Q29870|Q29871|Q29872|Q29873|Q5SR06	Silent	SNP	pfam_MHC_II_b_N,pfam_Ig_C1-set,pfam_CD80_C2-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like	p.Q218	ENST00000437316.2	37	c.654		6																																																																																			HLA-DQB2	-	NULL	ENSG00000232629		0.557	HLA-DQB2-003	KNOWN	basic|appris_principal	protein_coding	HLA-DQB2	HGNC	protein_coding	OTTHUMT00000076216.2	36	0.00	0	C			32725653	32725653	-1	no_errors	ENST00000435145	ensembl	human	known	69_37n	silent	35	12.50	5	SNP	0.998	T
HPS3	84343	genome.wustl.edu	37	3	148871409	148871409	+	Silent	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr3:148871409G>A	ENST00000296051.2	+	7	1514	c.1374G>A	c.(1372-1374)gaG>gaA	p.E458E	HPS3_ENST00000460120.1_Silent_p.E293E	NM_032383.3	NP_115759.2	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3	458					organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	34			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			CCATTCCAGAGAGAAGACAGT	0.423									Hermansky-Pudlak syndrome																													dbGAP											0													93.0	97.0	96.0					3																	148871409		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	HPS, HPS1-8	AY033141	CCDS3140.1	3q24	2014-06-18			ENSG00000163755	ENSG00000163755			15597	protein-coding gene	gene with protein product		606118				11455388	Standard	NM_032383		Approved	SUTAL	uc003ewu.1	Q969F9	OTTHUMG00000159548	ENST00000296051.2:c.1374G>A	3.37:g.148871409G>A			A8K6G6|Q8WTV6|Q96AP1|Q96MR3|Q9H608	Silent	SNP	pirsf_BLOC-2_complex_Hps3_subunit	p.E458	ENST00000296051.2	37	c.1374	CCDS3140.1	3																																																																																			HPS3	-	pirsf_BLOC-2_complex_Hps3_subunit	ENSG00000163755		0.423	HPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPS3	HGNC	protein_coding	OTTHUMT00000356151.1	38	0.00	0	G	NM_032383		148871409	148871409	+1	no_errors	ENST00000296051	ensembl	human	known	69_37n	silent	19	47.22	17	SNP	0.990	A
HRNR	388697	genome.wustl.edu	37	1	152189237	152189237	+	Missense_Mutation	SNP	C	C	G	rs200543988	byFrequency	TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr1:152189237C>G	ENST00000368801.2	-	3	4943	c.4868G>C	c.(4867-4869)aGc>aCc	p.S1623T	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1623					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTGGCCACTGCTGGAAGACCG	0.617																																						dbGAP											0													5.0	1.0	3.0					1																	152189237		494	616	1110	-	-	-	SO:0001583	missense	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.4868G>C	1.37:g.152189237C>G	ENSP00000357791:p.Ser1623Thr		Q5DT20|Q5U1F4	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.S1623T	ENST00000368801.2	37	c.4868	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	C	7.019	0.558245	0.13436	.	.	ENSG00000197915	ENST00000368801	T	0.05199	3.48	4.35	-1.7	0.08159	.	.	.	.	.	T	0.01254	0.0041	L	0.48642	1.525	0.09310	N	1	B	0.30281	0.275	B	0.18263	0.021	T	0.46965	-0.9153	9	0.12766	T	0.61	.	6.3832	0.21546	0.0:0.3868:0.4467:0.1665	.	1623	Q86YZ3	HORN_HUMAN	T	1623	ENSP00000357791:S1623T	ENSP00000357791:S1623T	S	-	2	0	HRNR	150455861	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.035000	0.12205	-0.146000	0.11274	-0.241000	0.12123	AGC	HRNR	-	NULL	ENSG00000197915		0.617	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	8	0.00	0	C	XM_373868		152189237	152189237	-1	no_errors	ENST00000368801	ensembl	human	known	69_37n	missense	5	50.00	5	SNP	0.000	G
HTR5A	3361	genome.wustl.edu	37	7	154863224	154863224	+	Silent	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr7:154863224C>T	ENST00000287907.2	+	1	1191	c.615C>T	c.(613-615)acC>acT	p.T205T	HTR5A-AS1_ENST00000543018.1_5'UTR|HTR5A-AS1_ENST00000395731.2_5'UTR|HTR5A-AS1_ENST00000493904.1_5'UTR	NM_024012.3	NP_076917.1	P47898	5HT5A_HUMAN	5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled	205					cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hippocampus development (GO:0021766)|response to estradiol (GO:0032355)|serotonin receptor signaling pathway (GO:0007210)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(3)|stomach(1)	48	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	Asenapine(DB06216)|Loxapine(DB00408)|Olanzapine(DB00334)	TGTTCTCCACCGTAGGCGCCT	0.607																																						dbGAP											0													80.0	69.0	73.0					7																	154863224		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5936.1	7q36.1	2012-08-08	2012-02-03		ENSG00000157219	ENSG00000157219		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5300	protein-coding gene	gene with protein product		601305	"""5-hydroxytryptamine (serotonin) receptor 5A"""			7988681	Standard	NM_024012		Approved	5-HT5A	uc003wlu.2	P47898	OTTHUMG00000151327	ENST00000287907.2:c.615C>T	7.37:g.154863224C>T			Q2M2D2	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_5HT5A_rcpt,prints_5HT_rcpt	p.T205	ENST00000287907.2	37	c.615	CCDS5936.1	7																																																																																			HTR5A	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_5HT_rcpt	ENSG00000157219		0.607	HTR5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR5A	HGNC	protein_coding	OTTHUMT00000322240.1	33	0.00	0	C	NM_024012		154863224	154863224	+1	no_errors	ENST00000287907	ensembl	human	known	69_37n	silent	20	31.03	9	SNP	0.931	T
IFIT3	3437	genome.wustl.edu	37	10	91098974	91098974	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr10:91098974G>C	ENST00000371818.4	+	2	742	c.562G>C	c.(562-564)Gag>Cag	p.E188Q	IFIT3_ENST00000371811.4_Missense_Mutation_p.E188Q|LIPA_ENST00000487618.1_Intron|LIPA_ENST00000371837.1_Intron	NM_001549.4	NP_001540.2	O14879	IFIT3_HUMAN	interferon-induced protein with tetratricopeptide repeats 3	188					cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)			breast(1)|central_nervous_system(3)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)|urinary_tract(1)	15						TAATCACCCAGAGAAACAGTT	0.468																																						dbGAP											0													73.0	82.0	79.0					10																	91098974		2203	4300	6503	-	-	-	SO:0001583	missense	0			U52513	CCDS7402.1, CCDS31241.1	10q23.31	2014-05-22	2004-07-16	2004-07-16	ENSG00000119917	ENSG00000119917		"""Tetratricopeptide (TTC) repeat domain containing"""	5411	protein-coding gene	gene with protein product		604650	"""interferon-induced protein with tetratricopeptide repeats 4"""	IFIT4		9828129, 9391139	Standard	NM_001031683		Approved	ISG60, RIG-G, CIG-49, IFI60, GARG-49, IRG2	uc001kgg.3	O14879	OTTHUMG00000018708	ENST00000371818.4:c.562G>C	10.37:g.91098974G>C	ENSP00000360883:p.Glu188Gln		Q99634|Q9BSK7	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E188Q	ENST00000371818.4	37	c.562	CCDS7402.1	10	.	.	.	.	.	.	.	.	.	.	G	0.014	-1.578178	0.00879	.	.	ENSG00000119917	ENST00000371818;ENST00000371811;ENST00000543062	T;T	0.42513	0.97;0.97	4.48	-2.33	0.06724	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	1.267680	0.05044	N	0.476795	T	0.23210	0.0561	N	0.12746	0.255	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.23547	-1.0185	10	0.12766	T	0.61	-0.0831	9.6186	0.39708	0.0:0.2856:0.4957:0.2187	.	188	O14879	IFIT3_HUMAN	Q	188;188;9	ENSP00000360883:E188Q;ENSP00000360876:E188Q	ENSP00000360876:E188Q	E	+	1	0	IFIT3	91088954	0.000000	0.05858	0.000000	0.03702	0.093000	0.18481	-1.605000	0.02074	-0.403000	0.07622	-0.845000	0.03042	GAG	IFIT3	-	pfscan_TPR-contain_dom	ENSG00000119917		0.468	IFIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFIT3	HGNC	protein_coding	OTTHUMT00000049294.1	16	0.00	0	G	NM_001549		91098974	91098974	+1	no_errors	ENST00000371811	ensembl	human	known	69_37n	missense	12	33.33	6	SNP	0.000	C
IGFBP1	3484	genome.wustl.edu	37	7	45928353	45928353	+	Silent	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr7:45928353C>T	ENST00000275525.3	+	1	398	c.102C>T	c.(100-102)tcC>tcT	p.S34S	IGFBP1_ENST00000457280.1_Silent_p.S34S|IGFBP1_ENST00000468955.1_Silent_p.S34S	NM_000596.2	NP_000587.1	P08833	IBP1_HUMAN	insulin-like growth factor binding protein 1	34	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|insulin receptor signaling pathway (GO:0008286)|positive regulation of cell growth (GO:0030307)|signal transduction (GO:0007165)|tissue regeneration (GO:0042246)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	insulin-like growth factor binding (GO:0005520)			large_intestine(2)|lung(4)	6						CGCCCTGCTCCGCCGAGAAGC	0.721																																						dbGAP											0													10.0	12.0	11.0					7																	45928353		2165	4257	6422	-	-	-	SO:0001819	synonymous_variant	0				CCDS5504.1	7p12.3	2014-09-16			ENSG00000146678	ENSG00000146678			5469	protein-coding gene	gene with protein product	"""placental protein 12"", ""amniotic fluid binding protein"", ""alpha-pregnancy-associated endometrial globulin"", ""growth hormone independent-binding protein"", ""binding protein-28"", ""binding protein-26"", ""binding protein-25"", ""IGF-binding protein 1"""	146730		IBP1		2461294	Standard	NM_000596		Approved	IGF-BP25, AFBP, hIGFBP-1, PP12	uc003tnp.3	P08833	OTTHUMG00000152343	ENST00000275525.3:c.102C>T	7.37:g.45928353C>T			A4D2F4|D3DVL9|Q8IYP5	Silent	SNP	pfam_Thyroglobulin_1,pfam_IGFBP-like,superfamily_Thyroglobulin_1,superfamily_Growth_fac_rcpt,smart_IGFBP-like,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1,prints_IGFBP_1-6_chordata,prints_IGFBP1	p.S34	ENST00000275525.3	37	c.102	CCDS5504.1	7																																																																																			IGFBP1	-	pfam_IGFBP-like,smart_IGFBP-like	ENSG00000146678		0.721	IGFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IGFBP1	HGNC	protein_coding	OTTHUMT00000251355.2	26	0.00	0	C	NM_000596		45928353	45928353	+1	no_errors	ENST00000275525	ensembl	human	known	69_37n	silent	9	43.75	7	SNP	0.000	T
IGHV4-28	28400	genome.wustl.edu	37	14	106780570	106780570	+	RNA	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr14:106780570G>A	ENST00000390612.2	-	0	365									immunoglobulin heavy variable 4-28																		GCTTCAGGGAGAACTGGTTCT	0.537																																						dbGAP											0													202.0	199.0	200.0					14																	106780570		2000	4141	6141	-	-	-			0			X05714		14q32.33	2012-02-08			ENSG00000211952	ENSG00000211952		"""Immunoglobulins / IGH locus"""	5645	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000152062		14.37:g.106780570G>A				Silent	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.F98	ENST00000390612.2	37	c.294		14																																																																																			IGHV4-28	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211952		0.537	IGHV4-28-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGHV4-28	HGNC	IG_V_gene	OTTHUMT00000325156.1	134	0.00	0	G	NG_001019		106780570	106780570	-1	no_stop_codon	ENST00000390612	ensembl	human	known	69_37n	silent	77	36.89	45	SNP	0.000	A
ITGAM	3684	genome.wustl.edu	37	16	31336677	31336679	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	CTT	CTT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr16:31336677_31336679delCTT	ENST00000287497.8	+	20	2532_2534	c.2457_2459delCTT	c.(2455-2460)accttc>acc	p.F822del	ITGAM_ENST00000544665.3_In_Frame_Del_p.F823del			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	822					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						CACAGGTCACCTTCTTCTTCCCG	0.586																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.2457_2459delCTT	16.37:g.31336683_31336685delCTT	ENSP00000287497:p.Phe822del		Q4VAK0|Q4VAK1|Q4VAK2	In_Frame_Del	DEL	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.F823in_frame_del	ENST00000287497.8	37	c.2460_2462	CCDS45470.1	16																																																																																			ITGAM	-	pfam_Integrin_alpha-2	ENSG00000169896		0.586	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAM	HGNC	protein_coding	OTTHUMT00000432816.1	47	0.00	0	CTT	NM_000632		31336677	31336679	+1	no_errors	ENST00000544665	ensembl	human	known	69_37n	in_frame_del	24	56.36	31	DEL	0.333:0.341:0.383	-
PSCA	8000	genome.wustl.edu	37	8	143762039	143762039	+	Intron	SNP	G	G	C			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr8:143762039G>C	ENST00000301258.4	+	1	108				PSCA_ENST00000505305.1_Intron|PSCA_ENST00000513264.1_Intron	NM_005672.4	NP_005663.2	O43653	PSCA_HUMAN	prostate stem cell antigen							anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(1)	2	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					GGGGAGGCCAGAGGGATACCT	0.672																																						dbGAP											0													17.0	21.0	20.0					8																	143762039		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AF043498	CCDS47925.1, CCDS47925.2	8q24.2	2004-02-03				ENSG00000167653			9500	protein-coding gene	gene with protein product		602470				9465086	Standard	NM_005672		Approved		uc022bcd.1	O43653		ENST00000301258.4:c.25+58G>C	8.37:g.143762039G>C			Q6UW92	RNA	SNP	-	NULL	ENST00000301258.4	37	NULL	CCDS47925.2	8																																																																																			JRK	-	-	ENSG00000234616		0.672	PSCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JRK	HGNC	protein_coding	OTTHUMT00000367112.2	42	0.00	0	G	NM_005672		143762039	143762039	-1	no_errors	ENST00000585503	ensembl	human	known	69_37n	rna	13	53.57	15	SNP	0.000	C
KANK1	23189	genome.wustl.edu	37	9	711674	711674	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr9:711674C>T	ENST00000382303.1	+	7	1560	c.908C>T	c.(907-909)tCa>tTa	p.S303L	KANK1_ENST00000489369.1_3'UTR|KANK1_ENST00000382293.3_Missense_Mutation_p.S145L|KANK1_ENST00000382297.2_Missense_Mutation_p.S303L	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	303	Interaction with KIF21A.				negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		CAGTTGGTCTCACAGCTGAAA	0.547																																						dbGAP											0													79.0	74.0	76.0					9																	711674		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.908C>T	9.37:g.711674C>T	ENSP00000371740:p.Ser303Leu		A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S303L	ENST00000382303.1	37	c.908	CCDS34976.1	9	.	.	.	.	.	.	.	.	.	.	C	14.56	2.571864	0.45798	.	.	ENSG00000107104	ENST00000382303;ENST00000354485;ENST00000382297;ENST00000382293	T;T;T	0.00940	5.52;5.52;5.52	5.84	5.84	0.93424	.	0.000000	0.49305	D	0.000148	T	0.02047	0.0064	M	0.64997	1.995	0.80722	D	1	B;B	0.14438	0.006;0.01	B;B	0.17433	0.018;0.005	T	0.61093	-0.7132	10	0.30078	T	0.28	0.0476	20.1466	0.98079	0.0:1.0:0.0:0.0	.	303;303	Q5W0W1;Q14678	.;KANK1_HUMAN	L	303;303;303;145	ENSP00000371740:S303L;ENSP00000371734:S303L;ENSP00000371730:S145L	ENSP00000346479:S303L	S	+	2	0	KANK1	701674	1.000000	0.71417	0.987000	0.45799	0.984000	0.73092	4.626000	0.61269	2.779000	0.95612	0.591000	0.81541	TCA	KANK1	-	NULL	ENSG00000107104		0.547	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KANK1	HGNC	protein_coding	OTTHUMT00000051484.2	34	0.00	0	C	NM_015158		711674	711674	+1	no_errors	ENST00000382297	ensembl	human	known	69_37n	missense	15	34.78	8	SNP	1.000	T
KCNF1	3754	genome.wustl.edu	37	2	11052864	11052864	+	Silent	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr2:11052864C>T	ENST00000295082.1	+	1	802	c.312C>T	c.(310-312)atC>atT	p.I104I		NM_002236.4	NP_002227.2	Q9H3M0	KCNF1_HUMAN	potassium voltage-gated channel, subfamily F, member 1	104					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			NS(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(2)|skin(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.128)		AGAAGGGCATCTGCCCCATCT	0.567																																						dbGAP											0													61.0	65.0	64.0					2																	11052864		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF033382	CCDS1676.1	2p25	2011-07-05			ENSG00000162975	ENSG00000162975		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6246	protein-coding gene	gene with protein product		603787		KCNF		9434767, 16382104	Standard	NM_002236		Approved	Kv5.1, kH1, IK8	uc002rax.3	Q9H3M0	OTTHUMG00000119054	ENST00000295082.1:c.312C>T	2.37:g.11052864C>T			O43527|Q585L3	Silent	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,pfam_PKD1_2_channel,superfamily_BTB/POZ_fold,prints_K_chnl,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv6	p.I104	ENST00000295082.1	37	c.312	CCDS1676.1	2																																																																																			KCNF1	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv6	ENSG00000162975		0.567	KCNF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNF1	HGNC	protein_coding	OTTHUMT00000239265.1	47	0.00	0	C	NM_002236		11052864	11052864	+1	no_errors	ENST00000295082	ensembl	human	known	69_37n	silent	27	25.00	9	SNP	1.000	T
KCNH8	131096	genome.wustl.edu	37	3	19432101	19432101	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr3:19432101G>A	ENST00000328405.2	+	6	1206	c.940G>A	c.(940-942)Gat>Aat	p.D314N	KCNH8_ENST00000475063.1_3'UTR|KCNH8_ENST00000537696.1_5'UTR	NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	314					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						CCTGCCTTTTGATCTTCTGTA	0.423																																					NSCLC(124;1625 1765 8018 24930 42026)	dbGAP											0													127.0	130.0	129.0					3																	19432101		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.940G>A	3.37:g.19432101G>A	ENSP00000328813:p.Asp314Asn		B7Z2I7|Q59GQ6	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_Ion_trans_2,pfam_PAS_fold_3,pfam_PAS_4,pfam_PAS_fold,superfamily_cNMP-bd-like,superfamily_tRNA-bd_arm,smart_PAC,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,pfscan_PAS-assoc_C,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,prints_K_chnl_volt-dep_EAG,tigrfam_PAS	p.D314N	ENST00000328405.2	37	c.940	CCDS2632.1	3	.	.	.	.	.	.	.	.	.	.	G	35	5.442955	0.96187	.	.	ENSG00000183960	ENST00000328405	D	0.99868	-7.32	5.41	5.41	0.78517	Ion transport (1);	.	.	.	.	D	0.99880	0.9943	M	0.88241	2.94	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.96758	0.9559	8	.	.	.	.	19.2076	0.93739	0.0:0.0:1.0:0.0	.	314;314	B7Z398;Q96L42	.;KCNH8_HUMAN	N	314	ENSP00000328813:D314N	.	D	+	1	0	KCNH8	19407105	1.000000	0.71417	0.991000	0.47740	0.937000	0.57800	9.869000	0.99810	2.517000	0.84864	0.650000	0.86243	GAT	KCNH8	-	pfam_Ion_trans_dom	ENSG00000183960		0.423	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH8	HGNC	protein_coding	OTTHUMT00000252139.2	32	0.00	0	G	NM_144633		19432101	19432101	+1	no_errors	ENST00000328405	ensembl	human	known	69_37n	missense	6	57.14	8	SNP	1.000	A
KDM2A	22992	genome.wustl.edu	37	11	66985342	66985342	+	Silent	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr11:66985342C>T	ENST00000529006.2	+	9	1274	c.828C>T	c.(826-828)ttC>ttT	p.F276F	KDM2A_ENST00000526258.1_3'UTR|KDM2A_ENST00000398645.2_Silent_p.F276F	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	276	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						GCTATACCTTCGTCATTCCCT	0.433																																						dbGAP											0													69.0	62.0	64.0					11																	66985342		1938	4136	6074	-	-	-	SO:0001819	synonymous_variant	0			BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.828C>T	11.37:g.66985342C>T			D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Silent	SNP	pfam_Znf_CXXC,pfam_F-box_dom_cyclin-like,pfam_JmjC_dom,superfamily_Znf_FYVE_PHD,smart_JmjC_dom,smart_Znf_PHD,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.F276	ENST00000529006.2	37	c.828	CCDS44657.1	11																																																																																			KDM2A	-	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	ENSG00000173120		0.433	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM2A	HGNC	protein_coding	OTTHUMT00000393140.2	44	0.00	0	C	NM_012308		66985342	66985342	+1	no_errors	ENST00000529006	ensembl	human	known	69_37n	silent	57	17.39	12	SNP	1.000	T
KIAA0100	9703	genome.wustl.edu	37	17	26962559	26962559	+	Silent	SNP	G	G	C			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr17:26962559G>C	ENST00000528896.2	-	16	2120	c.2046C>G	c.(2044-2046)gtC>gtG	p.V682V	KIAA0100_ENST00000544884.1_Silent_p.V539V|RP11-192H23.7_ENST00000583787.1_RNA|KIAA0100_ENST00000389003.3_Silent_p.V539V|RP11-192H23.7_ENST00000577814.1_RNA	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	682						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					GAGTGGCCAGGACATGCTGGT	0.507																																						dbGAP											0													72.0	70.0	70.0					17																	26962559		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.2046C>G	17.37:g.26962559G>C			A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Silent	SNP	pfam_FMP27_C,pfam_FMP27_N,pfam_FMP27_GFWDK_dom	p.V682	ENST00000528896.2	37	c.2046	CCDS32595.1	17																																																																																			KIAA0100	-	NULL	ENSG00000007202		0.507	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0100	HGNC	protein_coding	OTTHUMT00000390571.3	63	0.00	0	G	NM_014680		26962559	26962559	-1	no_errors	ENST00000005905	ensembl	human	known	69_37n	silent	23	32.35	11	SNP	0.064	C
KIAA0195	9772	genome.wustl.edu	37	17	73489891	73489891	+	Silent	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr17:73489891C>T	ENST00000314256.7	+	18	2695	c.2301C>T	c.(2299-2301)atC>atT	p.I767I	KIAA0195_ENST00000375248.5_Silent_p.I777I|AC100787.1_ENST00000579379.1_RNA|KIAA0195_ENST00000579208.1_Silent_p.I418I	NM_014738.4	NP_055553.3	Q12767	K0195_HUMAN	KIAA0195	767						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(2)|endometrium(5)|kidney(2)|large_intestine(7)|lung(17)|ovary(5)|skin(2)|stomach(1)|urinary_tract(1)	42	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			GCAAGTGCATCGAGCTGGTAC	0.607																																						dbGAP											0													134.0	111.0	119.0					17																	73489891		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32732.1	17q25.1	2012-03-01			ENSG00000177728	ENSG00000177728			28983	protein-coding gene	gene with protein product						8724849	Standard	NM_014738		Approved	TMEM94	uc002jnz.4	Q12767		ENST00000314256.7:c.2301C>T	17.37:g.73489891C>T			O75536|Q86XF1	Silent	SNP	pfam_ATPase_P-typ_cation-transptr_C	p.I767	ENST00000314256.7	37	c.2301	CCDS32732.1	17																																																																																			KIAA0195	-	NULL	ENSG00000177728		0.607	KIAA0195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0195	HGNC	protein_coding	OTTHUMT00000447303.1	30	0.00	0	C	NM_014738		73489891	73489891	+1	no_errors	ENST00000314256	ensembl	human	known	69_37n	silent	9	50.00	9	SNP	0.044	T
KIAA1919	91749	genome.wustl.edu	37	6	111583513	111583513	+	Silent	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr6:111583513G>A	ENST00000368847.4	+	2	434	c.81G>A	c.(79-81)gtG>gtA	p.V27V		NM_153369.2	NP_699200.2	Q5TF39	NAGT1_HUMAN	KIAA1919	27					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			large_intestine(3)|lung(2)|ovary(4)|skin(3)	12		all_cancers(87;2.35e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.055)|all cancers(137;0.0871)|Epithelial(106;0.0884)		CAACAAACGTGAACCGAAATA	0.358																																						dbGAP											0													296.0	279.0	285.0					6																	111583513		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC036115	CCDS5090.1	6q22	2013-10-02			ENSG00000173214	ENSG00000173214			21053	protein-coding gene	gene with protein product							Standard	NM_153369		Approved	MGC33953, MFSD4B	uc003puv.4	Q5TF39	OTTHUMG00000015372	ENST00000368847.4:c.81G>A	6.37:g.111583513G>A			A8K9M0|Q8IYB6|Q96PW9|Q9P0D6	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.V27	ENST00000368847.4	37	c.81	CCDS5090.1	6																																																																																			KIAA1919	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000173214		0.358	KIAA1919-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1919	HGNC	protein_coding	OTTHUMT00000041827.1	69	0.00	0	G	NM_153369		111583513	111583513	+1	no_errors	ENST00000368847	ensembl	human	known	69_37n	silent	34	44.26	27	SNP	1.000	A
KIF24	347240	genome.wustl.edu	37	9	34256034	34256034	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr9:34256034G>A	ENST00000402558.2	-	10	3595	c.3571C>T	c.(3571-3573)Ccc>Tcc	p.P1191S	KIF24_ENST00000345050.2_Missense_Mutation_p.P1057S|KIF24_ENST00000379166.2_Missense_Mutation_p.P1191S|KIF24_ENST00000379174.3_Missense_Mutation_p.P1057S			Q5T7B8	KIF24_HUMAN	kinesin family member 24	1191					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)	centriole (GO:0005814)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(13)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	32			LUSC - Lung squamous cell carcinoma(29;0.0107)			GTGGTGAAGGGCTTTCCTGGG	0.557																																						dbGAP											0													96.0	94.0	95.0					9																	34256034		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001795	CCDS6551.2	9p13.3	2013-01-10			ENSG00000186638	ENSG00000186638		"""Kinesins"", ""Sterile alpha motif (SAM) domain containing"""	19916	protein-coding gene	gene with protein product		613747	"""chromosome 9 open reading frame 48"""	C9orf48		12477932	Standard	NM_194313		Approved	bA571F15.4, FLJ10933, FLJ43884	uc003zua.4	Q5T7B8	OTTHUMG00000019810	ENST00000402558.2:c.3571C>T	9.37:g.34256034G>A	ENSP00000384433:p.Pro1191Ser		Q2TB93|Q5T7B5|Q5T7B7|Q6ZU97|Q6ZUZ2|Q86XZ0|Q9NV43	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_SAM_type1,superfamily_SAM/pointed,smart_Kinesin_motor_dom,pfscan_SAM,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.P1191S	ENST00000402558.2	37	c.3571	CCDS6551.2	9	.	.	.	.	.	.	.	.	.	.	G	5.621	0.299269	0.10622	.	.	ENSG00000186638	ENST00000402558;ENST00000379174;ENST00000379166;ENST00000345050	T;T;T;T	0.73897	-0.52;-0.79;-0.52;-0.79	5.01	0.873	0.19118	.	0.494783	0.17300	N	0.179317	T	0.66297	0.2775	M	0.69823	2.125	0.09310	N	1	P	0.38535	0.635	B	0.35073	0.195	T	0.56306	-0.8001	9	.	.	.	.	5.9447	0.19211	0.2489:0.0:0.6153:0.1358	.	1191	Q5T7B8	KIF24_HUMAN	S	1191;1057;1191;1057	ENSP00000384433:P1191S;ENSP00000368472:P1057S;ENSP00000368464:P1191S;ENSP00000340179:P1057S	.	P	-	1	0	KIF24	34246034	0.509000	0.26163	0.205000	0.23548	0.100000	0.18952	0.599000	0.24089	0.052000	0.16007	-0.797000	0.03246	CCC	KIF24	-	NULL	ENSG00000186638		0.557	KIF24-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF24	HGNC	protein_coding	OTTHUMT00000052150.5	37	0.00	0	G			34256034	34256034	-1	no_errors	ENST00000379166	ensembl	human	known	69_37n	missense	18	41.94	13	SNP	0.139	A
KPNA1	3836	genome.wustl.edu	37	3	122146503	122146503	+	Silent	SNP	A	A	G			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr3:122146503A>G	ENST00000344337.6	-	13	1487	c.1311T>C	c.(1309-1311)tcT>tcC	p.S437S	KPNA1_ENST00000466923.1_5'UTR|RP11-299J3.8_ENST00000608346.1_RNA|RP11-299J3.8_ENST00000608015.1_RNA|RP11-299J3.8_ENST00000609469.1_RNA|RP11-299J3.8_ENST00000608756.1_RNA	NM_002264.3	NP_002255.3	P52294	IMA5_HUMAN	karyopherin alpha 1 (importin alpha 5)	437	Binding to RAG1.				apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|regulation of DNA recombination (GO:0000018)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|protein transporter activity (GO:0008565)			NS(1)|breast(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	21				GBM - Glioblastoma multiforme(114;0.0898)		GTACAATCTTAGAGTCCATGA	0.418																																					Melanoma(12;340 801 11196 19797)	dbGAP											0													95.0	87.0	90.0					3																	122146503		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			S75295	CCDS3013.1	3q21	2013-02-14			ENSG00000114030	ENSG00000114030		"""Importins"", ""Armadillo repeat containing"""	6394	protein-coding gene	gene with protein product		600686				8052633	Standard	NM_002264		Approved	SRP1, RCH2, NPI-1, IPOA5	uc003efe.2	P52294	OTTHUMG00000159487	ENST00000344337.6:c.1311T>C	3.37:g.122146503A>G			D3DN93|Q6IBQ9|Q9BQ56	Silent	SNP	pfam_Armadillo,pfam_Importin-a_IBB,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.S437	ENST00000344337.6	37	c.1311	CCDS3013.1	3																																																																																			KPNA1	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo	ENSG00000114030		0.418	KPNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNA1	HGNC	protein_coding	OTTHUMT00000355740.1	37	0.00	0	A	NM_002264		122146503	122146503	-1	no_errors	ENST00000344337	ensembl	human	known	69_37n	silent	15	40.00	10	SNP	1.000	G
LAMA3	3909	genome.wustl.edu	37	18	21355771	21355771	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr18:21355771C>T	ENST00000313654.9	+	10	1530	c.1289C>T	c.(1288-1290)cCt>cTt	p.P430L	LAMA3_ENST00000399516.3_Missense_Mutation_p.P430L	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	430	Domain V.|Laminin EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00460}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					AGCTGTGACCCTGAGCATGCG	0.483																																						dbGAP											0													68.0	67.0	67.0					18																	21355771		2004	4175	6179	-	-	-	SO:0001583	missense	0			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.1289C>T	18.37:g.21355771C>T	ENSP00000324532:p.Pro430Leu		B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_G,pfam_Laminin_I,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl,superfamily_Growth_fac_rcpt,superfamily_Galactose-bd-like,superfamily_STAT_TF_coiled-coil,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.P430L	ENST00000313654.9	37	c.1289	CCDS42419.1	18	.	.	.	.	.	.	.	.	.	.	C	15.59	2.878154	0.51801	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000416669;ENST00000538801	T;T	0.62364	0.03;0.03	4.96	4.96	0.65561	EGF-like, laminin (3);	.	.	.	.	T	0.63200	0.2491	L	0.56124	1.755	0.80722	D	1	B;P;P	0.37038	0.284;0.469;0.579	B;B;B	0.42593	0.076;0.286;0.392	T	0.59958	-0.7356	9	0.26408	T	0.33	.	17.1424	0.86757	0.0:1.0:0.0:0.0	.	430;430;430	F5H8G3;Q6VU67;Q16787	.;.;LAMA3_HUMAN	L	430;430;428;430	ENSP00000324532:P430L;ENSP00000382432:P430L	ENSP00000324532:P430L	P	+	2	0	LAMA3	19609769	0.016000	0.18221	0.984000	0.44739	0.974000	0.67602	1.131000	0.31406	2.591000	0.87537	0.591000	0.81541	CCT	LAMA3	-	pfam_EGF_laminin,smart_EGF-like,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000053747		0.483	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA3	HGNC	protein_coding	OTTHUMT00000254824.3	48	0.00	0	C	NM_000227, NM_198129		21355771	21355771	+1	no_errors	ENST00000313654	ensembl	human	known	69_37n	missense	9	68.97	20	SNP	0.985	T
LARP1	23367	genome.wustl.edu	37	5	154173389	154173390	+	Frame_Shift_Ins	INS	-	-	C			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr5:154173389_154173390insC	ENST00000336314.4	+	6	691_692	c.667_668insC	c.(667-669)gccfs	p.A223fs		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	300					cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)	p.T303fs*19(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CGTGCCCGTGGCCCCCCCCACC	0.644																																						dbGAP											1	Insertion - Frameshift(1)	large_intestine(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.675dupC	5.37:g.154173397_154173397dupC	ENSP00000336721:p.Ala223fs		O94836|Q8N4M2|Q8NB73|Q9UFD7	Frame_Shift_Ins	INS	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,smart_DM15,pfscan_Lupus_La_RNA-bd	p.T226fs	ENST00000336314.4	37	c.667_668	CCDS4328.1	5																																																																																			LARP1	-	NULL	ENSG00000155506		0.644	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP1	HGNC	protein_coding	OTTHUMT00000252509.1	25	0.00	0	-	NM_033551		154173389	154173390	+1	no_errors	ENST00000336314	ensembl	human	known	69_37n	frame_shift_ins	25	39.02	16	INS	0.998:0.999	C
LOR	4014	genome.wustl.edu	37	1	153233506	153233506	+	Silent	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr1:153233506C>T	ENST00000368742.3	+	2	138	c.81C>T	c.(79-81)ggC>ggT	p.G27G		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	27					keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.G27G(1)		lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			gcggtggcggcggcagcggcg	0.682																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											8.0	10.0	9.0					1																	153233506		2045	4027	6072	-	-	-	SO:0001819	synonymous_variant	0			M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	ENST00000368742.3:c.81C>T	1.37:g.153233506C>T			Q5T869|Q5XKF8	Silent	SNP	NULL	p.G27	ENST00000368742.3	37	c.81	CCDS30870.1	1																																																																																			LOR	-	NULL	ENSG00000203782		0.682	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOR	HGNC	protein_coding	OTTHUMT00000039107.1	11	0.00	0	C	NM_000427		153233506	153233506	+1	no_errors	ENST00000368742	ensembl	human	known	69_37n	silent	10	41.18	7	SNP	0.000	T
LOXHD1	125336	genome.wustl.edu	37	18	44065084	44065084	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr18:44065084C>T	ENST00000398722.4	-	32	5245	c.5246G>A	c.(5245-5247)gGa>gAa	p.G1749E	LOXHD1_ENST00000579038.1_Missense_Mutation_p.G820E|LOXHD1_ENST00000398705.2_Missense_Mutation_p.G266E|LOXHD1_ENST00000536736.1_Missense_Mutation_p.G1965E|LOXHD1_ENST00000300591.6_Missense_Mutation_p.G916E|LOXHD1_ENST00000398686.4_Missense_Mutation_p.G266E|LOXHD1_ENST00000582408.1_Missense_Mutation_p.G854E|LOXHD1_ENST00000441551.2_Missense_Mutation_p.G1821E|LOXHD1_ENST00000441893.2_Missense_Mutation_p.G898E			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	1749	PLAT 13. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						GGTTTCGCCTCCGTTGCCCGT	0.572																																						dbGAP											0													87.0	77.0	80.0					18																	44065084		692	1591	2283	-	-	-	SO:0001583	missense	0			AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.5246G>A	18.37:g.44065084C>T	ENSP00000381707:p.Gly1749Glu		B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2	p.G1965E	ENST00000398722.4	37	c.5894		18	.	.	.	.	.	.	.	.	.	.	C	13.86	2.363003	0.41902	.	.	ENSG00000167210	ENST00000300591;ENST00000398722;ENST00000398705;ENST00000536736;ENST00000441893;ENST00000398686	T;T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21;-0.21	5.6	4.73	0.59995	Lipoxygenase, LH2 (3);Lipase/lipooxygenase, PLAT/LH2 (1);	.	.	.	.	T	0.50973	0.1647	N	0.14661	0.345	0.35497	D	0.799457	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.003;0.002;0.003	T	0.55335	-0.8157	9	0.40728	T	0.16	.	15.0586	0.71933	0.0:0.9311:0.0:0.0689	.	1965;898;1749	F5GZB4;F8WA52;Q8IVV2	.;.;LOXH1_HUMAN	E	916;1749;266;1965;898;266	ENSP00000300591:G916E;ENSP00000381707:G1749E;ENSP00000381692:G266E;ENSP00000444586:G1965E;ENSP00000409062:G898E;ENSP00000381676:G266E	ENSP00000300591:G916E	G	-	2	0	LOXHD1	42319082	0.406000	0.25344	0.935000	0.37517	0.968000	0.65278	0.871000	0.28023	1.501000	0.48654	0.655000	0.94253	GGA	LOXHD1	-	pfam_LipOase_LH2,superfamily_Lipase_LipOase,pfscan_LipOase_LH2	ENSG00000167210		0.572	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	HGNC	protein_coding		29	0.00	0	C	NM_144612		44065084	44065084	-1	no_errors	ENST00000536736	ensembl	human	known	69_37n	missense	14	44.00	11	SNP	0.973	T
LRPAP1	4043	genome.wustl.edu	37	4	3526751	3526751	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr4:3526751C>T	ENST00000500728.2	-	2	378	c.232G>A	c.(232-234)Gag>Aag	p.E78K	LRPAP1_ENST00000296325.5_5'UTR	NM_002337.3	NP_002328.1	P30533	AMRP_HUMAN	low density lipoprotein receptor-related protein associated protein 1	78					extracellular negative regulation of signal transduction (GO:1900116)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of protein binding (GO:0032091)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|protein folding (GO:0006457)|receptor-mediated endocytosis (GO:0006898)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|rough endoplasmic reticulum lumen (GO:0048237)|vesicle (GO:0031982)	asialoglycoprotein receptor activity (GO:0004873)|heparin binding (GO:0008201)|low-density lipoprotein particle receptor binding (GO:0050750)|receptor antagonist activity (GO:0048019)|unfolded protein binding (GO:0051082)|very-low-density lipoprotein particle receptor binding (GO:0070326)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(2)	14				UCEC - Uterine corpus endometrioid carcinoma (64;0.165)		GCGTGGAGCTCGGCCAGCCTC	0.587																																						dbGAP											0													150.0	156.0	154.0					4																	3526751		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3371.1	4p16.3	2008-05-02	2003-03-17		ENSG00000163956	ENSG00000163956			6701	protein-coding gene	gene with protein product		104225	"""low density lipoprotein-related protein-associated protein 1 (alpha-2-macroglobulin receptor-associated protein 1)"""	A2MRAP		1712782	Standard	NM_002337		Approved	HBP44	uc003ghh.4	P30533	OTTHUMG00000090299	ENST00000500728.2:c.232G>A	4.37:g.3526751C>T	ENSP00000421922:p.Glu78Lys		D3DVR9|Q2M310|Q53HQ3|Q53HS6	Missense_Mutation	SNP	pfam_Alpha_2_MRAP_C,pfam_MG_RAP_rcpt_1,superfamily_MG_RAP_rcpt_1	p.E78K	ENST00000500728.2	37	c.232	CCDS3371.1	4	.	.	.	.	.	.	.	.	.	.	C	19.40	3.819717	0.71028	.	.	ENSG00000163956	ENST00000500728	T	0.49720	0.77	4.18	4.18	0.49190	Alpha-2-macroglobulin receptor-associated protein, domain 1 (3);	0.189526	0.46758	D	0.000270	T	0.41811	0.1175	L	0.49350	1.555	0.80722	D	1	B	0.19817	0.039	B	0.18561	0.022	T	0.28073	-1.0055	10	0.25751	T	0.34	-33.9383	14.3961	0.67013	0.0:1.0:0.0:0.0	.	78	P30533	AMRP_HUMAN	K	78	ENSP00000421922:E78K	ENSP00000421922:E78K	E	-	1	0	LRPAP1	3496549	1.000000	0.71417	0.997000	0.53966	0.884000	0.51177	6.378000	0.73150	2.340000	0.79590	0.655000	0.94253	GAG	LRPAP1	-	pfam_MG_RAP_rcpt_1,superfamily_MG_RAP_rcpt_1	ENSG00000163956		0.587	LRPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRPAP1	HGNC	protein_coding	OTTHUMT00000206659.4	20	0.00	0	C			3526751	3526751	-1	no_errors	ENST00000500728	ensembl	human	known	69_37n	missense	16	30.43	7	SNP	1.000	T
LRRN2	10446	genome.wustl.edu	37	1	204587686	204587686	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr1:204587686C>T	ENST00000367175.1	-	1	3647	c.1435G>A	c.(1435-1437)Gag>Aag	p.E479K	LRRN2_ENST00000367177.3_Missense_Mutation_p.E479K|RP11-430C7.4_ENST00000453895.1_RNA|LRRN2_ENST00000496057.1_5'Flank|LRRN2_ENST00000367176.3_Missense_Mutation_p.E479K			O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2	479	Ig-like C2-type.				cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|liver(1)|lung(22)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			AGGGTCCCCTCGGGGTACACC	0.637																																						dbGAP											0													52.0	52.0	52.0					1																	204587686		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF030435	CCDS1448.1	1q32.1	2013-01-11	2007-01-31	2007-01-31	ENSG00000170382	ENSG00000170382		"""Immunoglobulin superfamily / I-set domain containing"""	16914	protein-coding gene	gene with protein product	"""leucine rich and ankyrin repeats 1"", ""fibronectin type III, immunoglobulin and leucine rich repeat domain 7"""	605492	"""leucine rich repeat neuronal 5"""	LRRN5		9662332	Standard	NM_006338		Approved	GAC1, LRANK1, FIGLER7	uc001hbf.1	O75325	OTTHUMG00000035989	ENST00000367175.1:c.1435G>A	1.37:g.204587686C>T	ENSP00000356143:p.Glu479Lys		B2R624|Q5T0Y0|Q6UXM0|Q8N182	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.E479K	ENST00000367175.1	37	c.1435	CCDS1448.1	1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.733903	0.89482	.	.	ENSG00000170382	ENST00000367176;ENST00000367177;ENST00000367175	T;T;T	0.67171	-0.25;-0.25;-0.25	5.53	5.53	0.82687	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.43747	D	0.000540	T	0.79873	0.4521	L	0.55834	1.745	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.80630	-0.1297	10	0.66056	D	0.02	.	19.0525	0.93051	0.0:1.0:0.0:0.0	.	479	O75325	LRRN2_HUMAN	K	479	ENSP00000356144:E479K;ENSP00000356145:E479K;ENSP00000356143:E479K	ENSP00000356143:E479K	E	-	1	0	LRRN2	202854309	1.000000	0.71417	0.966000	0.40874	0.996000	0.88848	7.751000	0.85126	2.604000	0.88044	0.591000	0.81541	GAG	LRRN2	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000170382		0.637	LRRN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRN2	HGNC	protein_coding	OTTHUMT00000089894.1	32	0.00	0	C	NM_006338		204587686	204587686	-1	no_errors	ENST00000367175	ensembl	human	known	69_37n	missense	42	23.64	13	SNP	1.000	T
MADD	8567	genome.wustl.edu	37	11	47330180	47330180	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr11:47330180G>C	ENST00000311027.5	+	25	3963	c.3798G>C	c.(3796-3798)aaG>aaC	p.K1266N	MADD_ENST00000405573.2_Missense_Mutation_p.K76N|MADD_ENST00000395336.3_Missense_Mutation_p.K1266N|MADD_ENST00000395344.3_Missense_Mutation_p.K1181N|MADD_ENST00000402799.1_Missense_Mutation_p.K1185N|MADD_ENST00000406482.1_Missense_Mutation_p.K1185N|MADD_ENST00000342922.4_Missense_Mutation_p.K1228N|MADD_ENST00000402192.2_Missense_Mutation_p.K1227N|MADD_ENST00000407859.3_Missense_Mutation_p.K1205N|MADD_ENST00000349238.3_Missense_Mutation_p.K1248N	NM_003682.3	NP_003673.3			MAP-kinase activating death domain											breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		TAAAGGAGAAGCTGGCAGGCA	0.507																																						dbGAP											0													64.0	64.0	64.0					11																	47330180		2201	4298	6499	-	-	-	SO:0001583	missense	0			AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.3798G>C	11.37:g.47330180G>C	ENSP00000310933:p.Lys1266Asn			Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.K1266N	ENST00000311027.5	37	c.3798	CCDS7930.1	11	.	.	.	.	.	.	.	.	.	.	G	11.15	1.552533	0.27739	.	.	ENSG00000110514	ENST00000342922;ENST00000395342;ENST00000402799;ENST00000406482;ENST00000349238;ENST00000311027;ENST00000407859;ENST00000395344;ENST00000395336;ENST00000402192;ENST00000405573	T;T;T;T;T;T;T;T;T;T	0.48836	3.51;3.38;3.38;3.51;3.46;3.38;3.38;3.46;3.51;0.8	5.46	2.11	0.27256	.	0.405477	0.29822	N	0.011108	T	0.22936	0.0554	N	0.12182	0.205	0.09310	N	1	B;B;B;B;B;B;B;B;B;B;B	0.10296	0.003;0.001;0.001;0.001;0.001;0.001;0.001;0.0;0.002;0.001;0.0	B;B;B;B;B;B;B;B;B;B;B	0.12837	0.007;0.001;0.003;0.008;0.006;0.002;0.001;0.006;0.006;0.003;0.006	T	0.08764	-1.0706	10	0.26408	T	0.33	-15.2185	3.6417	0.08169	0.2357:0.1237:0.5267:0.1139	.	76;1181;1181;1266;1185;1185;1185;1248;1205;1266;1228	F8W8U2;B5MEE5;A8K8S7;Q8WXG6-7;F8W9P9;Q8WXG6-6;Q8WXG6-5;Q8WXG6-2;Q8WXG6-4;Q8WXG6;Q8WXG6-3	.;.;.;.;.;.;.;.;.;MADD_HUMAN;.	N	1228;1185;1185;1185;1248;1266;1205;1181;1266;1227;76	ENSP00000343902:K1228N;ENSP00000385585:K1185N;ENSP00000384435:K1185N;ENSP00000304505:K1248N;ENSP00000310933:K1266N;ENSP00000384204:K1205N;ENSP00000378753:K1181N;ENSP00000378745:K1266N;ENSP00000384287:K1227N;ENSP00000384483:K76N	ENSP00000310933:K1266N	K	+	3	2	MADD	47286756	0.989000	0.36119	1.000000	0.80357	0.974000	0.67602	0.820000	0.27323	0.667000	0.31107	0.563000	0.77884	AAG	MADD	-	NULL	ENSG00000110514		0.507	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MADD	HGNC	protein_coding	OTTHUMT00000317746.1	36	0.00	0	G			47330180	47330180	+1	no_errors	ENST00000311027	ensembl	human	known	69_37n	missense	13	48.00	12	SNP	0.084	C
MAPKAPK5	8550	genome.wustl.edu	37	12	112323732	112323732	+	Silent	SNP	C	C	G			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr12:112323732C>G	ENST00000551404.2	+	10	969	c.861C>G	c.(859-861)gtC>gtG	p.V287V	MAPKAPK5_ENST00000550735.2_Silent_p.V287V			Q8IW41	MAPK5_HUMAN	mitogen-activated protein kinase-activated protein kinase 5	287	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|MAPK cascade (GO:0000165)|negative regulation of TOR signaling (GO:0032007)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)|stress-induced premature senescence (GO:0090400)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(11)|ovary(1)	13						TCCTGAAGGTCAAACCGGAGG	0.557																																						dbGAP											0													71.0	74.0	73.0					12																	112323732		1956	4161	6117	-	-	-	SO:0001819	synonymous_variant	0			AF032437	CCDS44975.1, CCDS44976.1	12q24.13	2012-05-30			ENSG00000089022	ENSG00000089022			6889	protein-coding gene	gene with protein product		606723				9628874	Standard	NM_003668		Approved	PRAK	uc001tta.4	Q8IW41	OTTHUMG00000169605	ENST00000551404.2:c.861C>G	12.37:g.112323732C>G			B3KVA5|O60491|Q86X46|Q9BVX9|Q9UG86	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.V287	ENST00000551404.2	37	c.861	CCDS44975.1	12																																																																																			MAPKAPK5	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000089022		0.557	MAPKAPK5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAPKAPK5	HGNC	protein_coding	OTTHUMT00000405019.2	72	0.00	0	C	NM_139078		112323732	112323732	+1	no_errors	ENST00000202788	ensembl	human	known	69_37n	silent	29	43.14	22	SNP	1.000	G
MASP1	5648	genome.wustl.edu	37	3	186968079	186968079	+	Silent	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr3:186968079C>T	ENST00000337774.5	-	8	1439	c.1050G>A	c.(1048-1050)ctG>ctA	p.L350L	MASP1_ENST00000296280.6_Silent_p.L350L|MASP1_ENST00000392472.2_Silent_p.L237L|MASP1_ENST00000495249.1_Intron|MASP1_ENST00000169293.6_Silent_p.L350L|MASP1_ENST00000392470.2_Silent_p.L324L	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	350	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		TCCCATCCTTCAGACACTCAA	0.498																																						dbGAP											0													189.0	190.0	190.0					3																	186968079		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.1050G>A	3.37:g.186968079C>T			A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Silent	SNP	pfam_Peptidase_S1_S6,pfam_CUB,pfam_Sushi_SCR_CCP,pfam_EGF-like_Ca-bd,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_EGF-like_Ca-bd,smart_Sushi_SCR_CCP,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_CUB,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1_S6	p.L350	ENST00000337774.5	37	c.1050	CCDS33907.1	3																																																																																			MASP1	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000127241		0.498	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MASP1	HGNC	protein_coding	OTTHUMT00000344262.1	23	0.00	0	C	NM_001879		186968079	186968079	-1	no_errors	ENST00000296280	ensembl	human	known	69_37n	silent	10	47.37	9	SNP	1.000	T
MED13L	23389	genome.wustl.edu	37	12	116429416	116429416	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr12:116429416G>C	ENST00000281928.3	-	17	3549	c.3343C>G	c.(3343-3345)Ctc>Gtc	p.L1115V		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	1115						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		GAATCGGAGAGAATCAGGGTA	0.527																																						dbGAP											0													62.0	60.0	61.0					12																	116429416		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.3343C>G	12.37:g.116429416G>C	ENSP00000281928:p.Leu1115Val		A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	pfam_Mediator_Med13,pfam_Mediator_Med13_N_met/fun	p.L1115V	ENST00000281928.3	37	c.3343	CCDS9177.1	12	.	.	.	.	.	.	.	.	.	.	G	16.40	3.113851	0.56398	.	.	ENSG00000123066	ENST00000281928	D	0.90676	-2.71	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	D	0.94958	0.8369	M	0.70595	2.14	0.80722	D	1	D	0.63880	0.993	D	0.76071	0.987	D	0.95319	0.8419	10	0.87932	D	0	.	18.488	0.90836	0.0:0.0:1.0:0.0	.	1115	Q71F56	MD13L_HUMAN	V	1115	ENSP00000281928:L1115V	ENSP00000281928:L1115V	L	-	1	0	MED13L	114913799	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	9.263000	0.95617	2.597000	0.87782	0.460000	0.39030	CTC	MED13L	-	NULL	ENSG00000123066		0.527	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED13L	HGNC	protein_coding	OTTHUMT00000403879.3	26	0.00	0	G			116429416	116429416	-1	no_errors	ENST00000281928	ensembl	human	known	69_37n	missense	13	35.00	7	SNP	1.000	C
MED14	9282	genome.wustl.edu	37	X	40514245	40514245	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chrX:40514245G>A	ENST00000324817.1	-	29	4158	c.4040C>T	c.(4039-4041)cCg>cTg	p.P1347L		NM_004229.3	NP_004220.2	O60244	MED14_HUMAN	mediator complex subunit 14	1347					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(2)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TGCAATCGGCGGCGCGCTGGG	0.488																																						dbGAP											0													88.0	75.0	79.0					X																	40514245		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006651	CCDS14254.1	Xp11.4	2008-05-14	2007-07-30	2007-07-30	ENSG00000180182	ENSG00000180182			2370	protein-coding gene	gene with protein product		300182	"""cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa"""	CXorf4, CRSP2		9989412, 9598311	Standard	NM_004229		Approved	EXLM1, CRSP150, TRAP170, RGR1, CSRP	uc004dex.4	O60244	OTTHUMG00000024107	ENST00000324817.1:c.4040C>T	X.37:g.40514245G>A	ENSP00000323720:p.Pro1347Leu		Q4KMR7|Q9UNB3	Missense_Mutation	SNP	pfam_Mediator_Med14	p.P1347L	ENST00000324817.1	37	c.4040	CCDS14254.1	X	.	.	.	.	.	.	.	.	.	.	G	12.19	1.864993	0.32977	.	.	ENSG00000180182	ENST00000324817;ENST00000416199;ENST00000433003	.	.	.	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	T	0.48429	0.1499	L	0.38175	1.15	0.80722	D	1	D;D	0.57571	0.98;0.98	P;P	0.45037	0.467;0.467	T	0.51663	-0.8677	9	0.44086	T	0.13	.	17.0398	0.86486	0.0:0.0:1.0:0.0	.	1347;1347	A8KAK5;O60244	.;MED14_HUMAN	L	1347;59;246	.	ENSP00000323720:P1347L	P	-	2	0	MED14	40399189	1.000000	0.71417	0.061000	0.19648	0.016000	0.09150	9.420000	0.97426	2.030000	0.59900	0.544000	0.68410	CCG	MED14	-	NULL	ENSG00000180182		0.488	MED14-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MED14	HGNC	protein_coding	OTTHUMT00000060692.1	64	0.00	0	G	NM_004229		40514245	40514245	-1	no_errors	ENST00000324817	ensembl	human	known	69_37n	missense	32	45.76	27	SNP	0.995	A
MEX3C	51320	genome.wustl.edu	37	18	48703857	48703857	+	5'UTR	DEL	T	T	-			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr18:48703857delT	ENST00000591040.1	-	0	132							Q5U5Q3	MEX3C_HUMAN	mex-3 RNA binding family member C						chondrocyte hypertrophy (GO:0003415)|energy homeostasis (GO:0097009)|regulation of fat cell differentiation (GO:0045598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|skin(1)	17		Colorectal(6;0.003)|all_epithelial(6;0.0473)		Colorectal(16;0.0175)|READ - Rectum adenocarcinoma(32;0.15)		TCTTCTTTCCTTCCAGTGACA	0.458																																						dbGAP											0													99.0	92.0	95.0					18																	48703857		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			BC041122	CCDS11951.2	18q21.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000176624	ENSG00000176624		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	28040	protein-coding gene	gene with protein product		611005	"""ring finger and KH domain containing 2"", ""mex-3 homolog C (C. elegans)"""	RKHD2		17267406	Standard	NM_016626		Approved	FLJ38871, RNF194	uc002lfc.4	Q5U5Q3	OTTHUMG00000132693	ENST00000591040.1:c.-667A>-	18.37:g.48703857delT			A1L022|Q9NZE3	Frame_Shift_Del	DEL	pfam_KH_dom_type_1,smart_KH_dom,smart_Znf_RING,pfscan_Znf_RING,pfscan_KH_dom_type_1	p.R282fs	ENST00000591040.1	37	c.844		18																																																																																			MEX3C	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	ENSG00000176624		0.458	MEX3C-003	KNOWN	mRNA_end_NF|basic	processed_transcript	MEX3C	HGNC	protein_coding	OTTHUMT00000449559.1	48	0.00	0	T	NM_016626		48703857	48703857	-1	no_errors	ENST00000406189	ensembl	human	known	69_37n	frame_shift_del	15	11.76	2	DEL	1.000	-
NR2C2	7182	genome.wustl.edu	37	3	15084312	15084312	+	Intron	SNP	T	T	C			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr3:15084312T>C	ENST00000425241.1	+	14	1978				MRPS25_ENST00000496484.1_5'UTR|NR2C2_ENST00000478572.1_Intron|NR2C2_ENST00000323373.6_Intron|NR2C2_ENST00000406272.2_Intron|NR2C2_ENST00000393102.3_Intron			P49116	NR2C2_HUMAN	nuclear receptor subfamily 2, group C, member 2						cell differentiation (GO:0030154)|gene expression (GO:0010467)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(5)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						TCAAACAGTCTCCTTTTCTAA	0.502																																						dbGAP											0													43.0	42.0	42.0					3																	15084312		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			L27586	CCDS2621.1, CCDS74905.1	3p25	2013-01-16			ENSG00000177463	ENSG00000177463		"""Nuclear hormone receptors"""	7972	protein-coding gene	gene with protein product		601426		TR4		8661150, 8016112	Standard	XM_005265428		Approved	TAK1, TR2R1, hTAK1	uc003bzi.3	P49116	OTTHUMG00000129839	ENST00000425241.1:c.1617-29T>C	3.37:g.15084312T>C			A8K3H5|B6ZGT8|P55092	RNA	SNP	-	NULL	ENST00000425241.1	37	NULL		3																																																																																			MRPS25	-	-	ENSG00000131368		0.502	NR2C2-002	NOVEL	basic|appris_principal	protein_coding	MRPS25	HGNC	protein_coding	OTTHUMT00000340729.1	59	0.00	0	T	NM_003298		15084312	15084312	-1	no_errors	ENST00000496484	ensembl	human	known	69_37n	rna	36	42.86	27	SNP	0.001	C
MTERF3	51001	genome.wustl.edu	37	8	97263176	97263176	+	Missense_Mutation	SNP	T	T	G			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr8:97263176T>G	ENST00000287025.3	-	4	733	c.635A>C	c.(634-636)aAt>aCt	p.N212T	MTERFD1_ENST00000522822.1_Missense_Mutation_p.N91T|MTERFD1_ENST00000523821.1_Missense_Mutation_p.N212T|MTERFD1_ENST00000524341.1_Missense_Mutation_p.N22T	NM_015942.3	NP_057026.3	Q96E29	MTEF3_HUMAN		212					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)	transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	24	Breast(36;5.16e-05)					AATTGCATGATTTTTTGTCAG	0.348																																						dbGAP											0													114.0	117.0	116.0					8																	97263176		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000287025.3:c.635A>C	8.37:g.97263176T>G	ENSP00000287025:p.Asn212Thr		B3KMG6|G3V130|Q9Y301	Missense_Mutation	SNP	pfam_Mit_transcrip_term-rel,smart_Mit_transcrip_term-rel	p.N212T	ENST00000287025.3	37	c.635	CCDS6270.1	8	.	.	.	.	.	.	.	.	.	.	T	22.2	4.262059	0.80358	.	.	ENSG00000156469	ENST00000523821;ENST00000522822;ENST00000524341;ENST00000287025	T;T;T;T	0.11169	2.8;2.8;2.81;2.8	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.37073	0.0990	M	0.86268	2.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.16335	-1.0406	10	0.37606	T	0.19	-4.8748	14.8338	0.70166	0.0:0.0:0.0:1.0	.	212;212	E5RIK9;Q96E29	.;MTER1_HUMAN	T	212;91;22;212	ENSP00000429400:N212T;ENSP00000430138:N91T;ENSP00000429267:N22T;ENSP00000287025:N212T	ENSP00000287025:N212T	N	-	2	0	MTERFD1	97332352	1.000000	0.71417	0.996000	0.52242	0.933000	0.57130	7.047000	0.76599	2.233000	0.73108	0.482000	0.46254	AAT	MTERFD1	-	pfam_Mit_transcrip_term-rel,smart_Mit_transcrip_term-rel	ENSG00000156469		0.348	MTERFD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MTERFD1	HGNC	protein_coding	OTTHUMT00000379876.1	51	0.00	0	T			97263176	97263176	-1	no_errors	ENST00000287025	ensembl	human	known	69_37n	missense	21	47.50	19	SNP	1.000	G
NEDD1	121441	genome.wustl.edu	37	12	97303610	97303610	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr12:97303610G>A	ENST00000266742.4	+	3	412	c.73G>A	c.(73-75)Gtg>Atg	p.V25M	NEDD1_ENST00000411739.2_Intron|NEDD1_ENST00000457368.2_5'Flank|NEDD1_ENST00000555114.1_Intron|NEDD1_ENST00000429527.2_Missense_Mutation_p.V25M|NEDD1_ENST00000557644.1_Missense_Mutation_p.V32M	NM_152905.3	NP_690869.1	Q8NHV4	NEDD1_HUMAN	neural precursor cell expressed, developmentally down-regulated 1	25					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	apical part of cell (GO:0045177)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|pericentriolar material (GO:0000242)|spindle pole (GO:0000922)				breast(2)|endometrium(1)|kidney(2)|large_intestine(9)|lung(8)	22						TATGACATTGGTGGATAAATT	0.368																																						dbGAP											0													106.0	98.0	101.0					12																	97303610		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9063.1, CCDS44955.1, CCDS44956.1	12q23.1	2013-01-10			ENSG00000139350	ENSG00000139350		"""WD repeat domain containing"""	7723	protein-coding gene	gene with protein product		600372					Standard	NM_001135175		Approved	GCP-WD, TUBGCP7	uc001tev.4	Q8NHV4	OTTHUMG00000170604	ENST00000266742.4:c.73G>A	12.37:g.97303610G>A	ENSP00000266742:p.Val25Met		B0AZN0|B4E145|G3V3F1|Q8NA30	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V32M	ENST00000266742.4	37	c.94	CCDS9063.1	12	.	.	.	.	.	.	.	.	.	.	G	14.29	2.492772	0.44352	.	.	ENSG00000139350	ENST00000266742;ENST00000429527;ENST00000554226;ENST00000557478;ENST00000557092;ENST00000557644	T;T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;4.83;1.46	5.46	1.52	0.23074	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.273852	0.36234	N	0.002704	T	0.35711	0.0941	L	0.56769	1.78	0.80722	D	1	P;B	0.46512	0.879;0.332	P;B	0.51385	0.668;0.049	T	0.05419	-1.0886	10	0.45353	T	0.12	7.6711	7.057	0.25106	0.1992:0.0:0.6802:0.1206	.	32;25	G3V3F1;Q8NHV4	.;NEDD1_HUMAN	M	25;25;32;25;25;32	ENSP00000266742:V25M;ENSP00000404978:V25M;ENSP00000450881:V32M;ENSP00000451869:V25M;ENSP00000450757:V25M;ENSP00000451211:V32M	ENSP00000266742:V25M	V	+	1	0	NEDD1	95827741	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	2.590000	0.46154	0.282000	0.22254	-0.314000	0.08810	GTG	NEDD1	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000139350		0.368	NEDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEDD1	HGNC	protein_coding	OTTHUMT00000409792.1	22	0.00	0	G			97303610	97303610	+1	no_errors	ENST00000557644	ensembl	human	known	69_37n	missense	7	46.15	6	SNP	1.000	A
NAA25	80018	genome.wustl.edu	37	12	112516491	112516491	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr12:112516491C>T	ENST00000261745.4	-	6	780	c.532G>A	c.(532-534)Gag>Aag	p.E178K		NM_024953.3	NP_079229.2	Q14CX7	NAA25_HUMAN	N(alpha)-acetyltransferase 25, NatB auxiliary subunit	178						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(1)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	46						ACCATTCTCTCAGCAAGGGGC	0.378																																						dbGAP											0													168.0	153.0	158.0					12																	112516491		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB054990	CCDS9159.1	12q24.13	2013-10-11	2010-01-14	2010-01-14		ENSG00000111300		"""N(alpha)-acetyltransferase subunits"""	25783	protein-coding gene	gene with protein product		612755	"""chromosome 12 open reading frame 30"""	C12orf30		19660095	Standard	NM_024953		Approved	FLJ13089	uc001ttm.3	Q14CX7	OTTHUMG00000169638	ENST00000261745.4:c.532G>A	12.37:g.112516491C>T	ENSP00000261745:p.Glu178Lys		A0JLU7|Q6MZH1|Q7Z4N6|Q9H911	Missense_Mutation	SNP	pfam_N-acetylTrfase_B_cplx_non-cat,pfscan_TPR-contain_dom	p.E178K	ENST00000261745.4	37	c.532	CCDS9159.1	12	.	.	.	.	.	.	.	.	.	.	C	36	5.958107	0.97145	.	.	ENSG00000111300	ENST00000261745	T	0.37752	1.18	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	T	0.63896	0.2550	M	0.81497	2.545	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.994	T	0.56318	-0.7999	10	0.24483	T	0.36	-16.5813	20.6013	0.99457	0.0:1.0:0.0:0.0	.	178;178	A8K8X0;Q14CX7	.;NAA25_HUMAN	K	178	ENSP00000261745:E178K	ENSP00000261745:E178K	E	-	1	0	NAA25	111000874	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.251000	0.78297	2.878000	0.98634	0.650000	0.86243	GAG	NAA25	-	NULL	ENSG00000111300		0.378	NAA25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA25	HGNC	protein_coding	OTTHUMT00000405205.1	85	0.00	0	C	NM_024953		112516491	112516491	-1	no_errors	ENST00000261745	ensembl	human	known	69_37n	missense	39	42.65	29	SNP	1.000	T
NES	10763	genome.wustl.edu	37	1	156641423	156641423	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr1:156641423C>T	ENST00000368223.3	-	4	2689	c.2557G>A	c.(2557-2559)Gaa>Aaa	p.E853K		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	853	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TTTATTTCTTCTGGAGTCCAC	0.438																																						dbGAP											0													106.0	108.0	108.0					1																	156641423		2203	4300	6503	-	-	-	SO:0001583	missense	0			X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.2557G>A	1.37:g.156641423C>T	ENSP00000357206:p.Glu853Lys		O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	pfam_F	p.E853K	ENST00000368223.3	37	c.2557	CCDS1151.1	1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.532872	0.85812	.	.	ENSG00000132688	ENST00000368223	D	0.92858	-3.12	5.32	5.32	0.75619	.	.	.	.	.	D	0.91264	0.7246	L	0.48642	1.525	0.21579	N	0.999633	D	0.76494	0.999	P	0.61397	0.888	D	0.85938	0.1456	9	0.87932	D	0	.	11.5811	0.50891	0.1783:0.8217:0.0:0.0	.	853	P48681	NEST_HUMAN	K	853	ENSP00000357206:E853K	ENSP00000357206:E853K	E	-	1	0	NES	154908047	0.387000	0.25188	0.171000	0.22900	0.447000	0.32167	2.244000	0.43124	2.492000	0.84095	0.563000	0.77884	GAA	NES	-	NULL	ENSG00000132688		0.438	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NES	HGNC	protein_coding	OTTHUMT00000082844.2	28	0.00	0	C	NM_006617		156641423	156641423	-1	no_errors	ENST00000368223	ensembl	human	known	69_37n	missense	39	23.53	12	SNP	0.428	T
NT5C2	22978	genome.wustl.edu	37	10	104853661	104853661	+	Intron	SNP	G	G	C	rs566046855		TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr10:104853661G>C	ENST00000404739.3	-	12	1012				NT5C2_ENST00000369857.4_Intron|NT5C2_ENST00000423468.2_Intron|NT5C2_ENST00000343289.5_Intron			P49902	5NTC_HUMAN	5'-nucleotidase, cytosolic II						cell death (GO:0008219)|dephosphorylation (GO:0016311)|drug metabolic process (GO:0017144)|nucleobase-containing small molecule metabolic process (GO:0055086)|phosphorylation (GO:0016310)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleoside phosphotransferase activity (GO:0050146)|nucleotide binding (GO:0000166)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|urinary_tract(1)	16		all_hematologic(284;0.176)|Colorectal(252;0.178)		Epithelial(162;1.33e-08)|all cancers(201;1.04e-07)|BRCA - Breast invasive adenocarcinoma(275;0.159)	Adenosine triphosphate(DB00171)|Ribavirin(DB00811)	ACTTTGCTGAGAGATTACCAA	0.418																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			D38524	CCDS7544.1	10q24.32	2014-03-03	2002-04-18	2002-04-19	ENSG00000076685	ENSG00000076685			8022	protein-coding gene	gene with protein product	"""purine 5' nucleotidase"""	600417	"""5'-nucleotidase (purine), cytosolic type B"""	NT5B		7999131, 24482476	Standard	NM_012229		Approved	PNT5, GMP, cN-II, SPG65	uc001kwq.3	P49902	OTTHUMG00000018981	ENST00000404739.3:c.988+67C>G	10.37:g.104853661G>C			B7Z382|D3DR91|Q5JUV5	RNA	SNP	-	NULL	ENST00000404739.3	37	NULL	CCDS7544.1	10																																																																																			NT5C2	-	-	ENSG00000076685		0.418	NT5C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NT5C2	HGNC	protein_coding	OTTHUMT00000050121.1	21	0.00	0	G	NM_012229		104853661	104853661	-1	no_errors	ENST00000469228	ensembl	human	known	69_37n	rna	3	50.00	3	SNP	0.021	C
OBSCN	84033	genome.wustl.edu	37	1	228552692	228552692	+	Silent	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr1:228552692G>A	ENST00000422127.1	+	81	18896	c.18852G>A	c.(18850-18852)ccG>ccA	p.P6284P	OBSCN_ENST00000570156.2_Silent_p.P7241P|OBSCN_ENST00000366707.4_Silent_p.P3918P	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	6284					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CCGTGCCCCCGAGGGTGCCAC	0.657																																						dbGAP											0													13.0	19.0	17.0					1																	228552692		2075	4187	6262	-	-	-	SO:0001819	synonymous_variant	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.18852G>A	1.37:g.228552692G>A			Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Immunoglobulin,pfam_DH-domain,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub2,smart_Ig_sub,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.E901K	ENST00000422127.1	37	c.2701	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	G	10.30	1.311183	0.23821	.	.	ENSG00000154358	ENST00000441106	.	.	.	2.95	-0.906	0.10524	.	.	.	.	.	T	0.20577	0.0495	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24440	-1.0160	4	.	.	.	.	2.1691	0.03845	0.4164:0.0:0.3419:0.2418	.	.	.	.	K	901	.	.	E	+	1	0	OBSCN	226619315	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.418000	0.07080	-0.145000	0.11294	0.491000	0.48974	GAG	OBSCN	-	NULL	ENSG00000154358		0.657	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		88	0.00	0	G	NM_052843		228552692	228552692	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000441106	ensembl	human	known	69_37n	missense	69	28.87	28	SNP	0.000	A
OCSTAMP	128506	genome.wustl.edu	37	20	45174689	45174689	+	Silent	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr20:45174689G>A	ENST00000279028.2	-	2	337	c.324C>T	c.(322-324)ctC>ctT	p.L108L		NM_080721.1	NP_542452.1	Q9BR26	OCSTP_HUMAN	osteoclast stimulatory transmembrane protein	108					cellular response to estrogen stimulus (GO:0071391)|cellular response to tumor necrosis factor (GO:0071356)|multinuclear osteoclast differentiation (GO:0072674)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of osteoclast proliferation (GO:0090290)	integral component of membrane (GO:0016021)				breast(1)|endometrium(1)	2						TGGGCACGCTGAGTGCAAACA	0.642																																						dbGAP											0													38.0	45.0	43.0					20																	45174689		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AL034424	CCDS54468.1	20q13.12	2012-03-27	2012-03-27	2012-03-27	ENSG00000149635	ENSG00000149635			16116	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 123"""	C20orf123		18064667	Standard	NM_080721		Approved	dJ257E24.3	uc010zxu.2	Q9BR26	OTTHUMG00000032652	ENST00000279028.2:c.324C>T	20.37:g.45174689G>A				Silent	SNP	pfam_DC_STAMP-like	p.L108	ENST00000279028.2	37	c.324	CCDS54468.1	20																																																																																			OCSTAMP	-	NULL	ENSG00000149635		0.642	OCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OCSTAMP	HGNC	protein_coding	OTTHUMT00000079573.2	30	0.00	0	G	XM_496476		45174689	45174689	-1	no_errors	ENST00000279028	ensembl	human	known	69_37n	silent	7	41.67	5	SNP	0.871	A
OGG1	4968	genome.wustl.edu	37	3	9791867	9791867	+	5'UTR	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr3:9791867G>A	ENST00000344629.7	+	0	240				OGG1_ENST00000436092.1_3'UTR|OGG1_ENST00000383826.5_5'UTR|OGG1_ENST00000339511.5_5'UTR|OGG1_ENST00000449570.2_5'UTR|OGG1_ENST00000302008.8_5'UTR|OGG1_ENST00000302003.7_5'UTR|OGG1_ENST00000302036.7_5'UTR|OGG1_ENST00000349503.5_5'UTR			O15527	OGG1_HUMAN	8-oxoguanine DNA glycosylase						acute inflammatory response (GO:0002526)|base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|cellular response to cadmium ion (GO:0071276)|depurination (GO:0045007)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair (GO:0006289)|regulation of protein import into nucleus, translocation (GO:0033158)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|response to oxidative stress (GO:0006979)|response to radiation (GO:0009314)	mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	8-oxo-7,8-dihydroguanine DNA N-glycosylase activity (GO:0034039)|damaged DNA binding (GO:0003684)|endonuclease activity (GO:0004519)|oxidized purine nucleobase lesion DNA N-glycosylase activity (GO:0008534)			kidney(2)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	8	Medulloblastoma(99;0.227)					CCGTGTGGGCGAGGCCTTAAG	0.622								Base excision repair (BER), DNA glycosylases																														dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			U96710	CCDS2576.1, CCDS2577.1, CCDS2578.1, CCDS2579.1, CCDS2580.1, CCDS2581.1, CCDS43046.1, CCDS46742.1	3p26	2010-11-23			ENSG00000114026	ENSG00000114026	3.2.2.-, 4.2.99.18		8125	protein-coding gene	gene with protein product	"""8-hydroxyguanine DNA glycosylase"", ""OGG1 type 1e"", ""OGG1 type 1d"", ""OGG1 type 1g"", ""OGG1 type 1h"""	601982				9207108, 10449904	Standard	NM_002542		Approved	HMMH, HOGG1, OGH1, MUTM	uc003bsj.3	O15527	OTTHUMG00000097091	ENST00000344629.7:c.-104G>A	3.37:g.9791867G>A			A8K1E3|O00390|O00670|O00705|O14876|O95488|P78554|Q9BW42|Q9UIK0|Q9UIK1|Q9UIK2|Q9UL34|Q9Y2C0|Q9Y2C1|Q9Y6C3|Q9Y6C4	RNA	SNP	-	NULL	ENST00000344629.7	37	NULL	CCDS2581.1	3																																																																																			OGG1	-	-	ENSG00000114026		0.622	OGG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	OGG1	HGNC	protein_coding	OTTHUMT00000214223.2	16	0.00	0	G	NM_016821		9791867	9791867	+1	no_errors	ENST00000436092	ensembl	human	putative	69_37n	rna	2	75.00	6	SNP	0.000	A
ONECUT3	390874	genome.wustl.edu	37	19	1775382	1775382	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr19:1775382G>A	ENST00000382349.4	+	2	2713	c.1423G>A	c.(1423-1425)Gag>Aag	p.E475K		NM_001080488.1	NP_001073957.1	O60422	ONEC3_HUMAN	one cut homeobox 3	475					endocrine pancreas development (GO:0031018)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)						Acute lymphoblastic leukemia(61;4.66e-11)|all_hematologic(61;4.59e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGCTGGGCTGAGGAGCCCAG	0.716																																						dbGAP											0													7.0	7.0	7.0					19																	1775382		1756	3895	5651	-	-	-	SO:0001583	missense	0			AC004755	CCDS45900.1	19p13.3	2012-03-09	2007-07-16			ENSG00000205922		"""Homeoboxes / CUT class"""	13399	protein-coding gene	gene with protein product		611294	"""one cut domain, family member 3"""			9915796	Standard	NM_001080488		Approved		uc010xgr.2	O60422		ENST00000382349.4:c.1423G>A	19.37:g.1775382G>A	ENSP00000371786:p.Glu475Lys		A8MZM7	Missense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Hmoeo_CUT	p.E475K	ENST00000382349.4	37	c.1423	CCDS45900.1	19	.	.	.	.	.	.	.	.	.	.	g	20.8	4.054672	0.75960	.	.	ENSG00000205922	ENST00000382349	D	0.86164	-2.08	2.85	2.85	0.33270	Homeobox (1);Homeodomain-like (1);	0.238354	0.32175	U	0.006464	T	0.80939	0.4720	L	0.55481	1.735	0.38075	D	0.936506	P	0.39480	0.675	B	0.30943	0.122	T	0.83177	-0.0091	10	0.87932	D	0	.	11.0747	0.48025	0.0:0.0:1.0:0.0	.	475	O60422	ONEC3_HUMAN	K	475	ENSP00000371786:E475K	ENSP00000371786:E475K	E	+	1	0	ONECUT3	1726382	1.000000	0.71417	0.998000	0.56505	0.807000	0.45602	5.868000	0.69605	1.122000	0.41944	0.401000	0.26515	GAG	ONECUT3	-	superfamily_Homeodomain-like,smart_Homeodomain	ENSG00000205922		0.716	ONECUT3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ONECUT3	HGNC	protein_coding	OTTHUMT00000418499.1	11	0.00	0	G			1775382	1775382	+1	no_errors	ENST00000382349	ensembl	human	known	69_37n	missense	6	40.00	4	SNP	1.000	A
OR10J3	441911	genome.wustl.edu	37	1	159283943	159283943	+	Silent	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr1:159283943G>A	ENST00000332217.5	-	1	506	c.507C>T	c.(505-507)ttC>ttT	p.F169F		NM_001004467.1	NP_001004467.1	Q5JRS4	O10J3_HUMAN	olfactory receptor, family 10, subfamily J, member 3	169						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F169F(1)		breast(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(19)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	47	all_hematologic(112;0.0429)					AGGCATCACAGAATGGCAGGC	0.502																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											71.0	64.0	66.0					1																	159283943		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS30909.1	1q23.2	2012-08-09		2004-03-10	ENSG00000196266	ENSG00000196266		"""GPCR / Class A : Olfactory receptors"""	14992	protein-coding gene	gene with protein product				OR10J3P			Standard	NM_001004467		Approved		uc010piu.2	Q5JRS4	OTTHUMG00000037233	ENST00000332217.5:c.507C>T	1.37:g.159283943G>A				Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F169	ENST00000332217.5	37	c.507	CCDS30909.1	1																																																																																			OR10J3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196266		0.502	OR10J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10J3	HGNC	protein_coding	OTTHUMT00000090629.1	10	0.00	0	G			159283943	159283943	-1	no_errors	ENST00000332217	ensembl	human	known	69_37n	silent	26	21.21	7	SNP	1.000	A
OR2AK2	391191	genome.wustl.edu	37	1	248128807	248128807	+	Silent	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr1:248128807C>T	ENST00000366480.3	+	1	273	c.174C>T	c.(172-174)atC>atT	p.I58I	OR2L13_ENST00000366478.2_Intron	NM_001004491.1	NP_001004491.1	Q8NG84	O2AK2_HUMAN	olfactory receptor, family 2, subfamily AK, member 2	58						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			CAGGAAATATCATGCTGATCC	0.448																																					Melanoma(45;390 1181 23848 28461 41504)	dbGAP											0													216.0	202.0	207.0					1																	248128807		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BK004457	CCDS31102.1	1q44	2012-08-09			ENSG00000187080	ENSG00000187080		"""GPCR / Class A : Olfactory receptors"""	19569	protein-coding gene	gene with protein product				OR2AK1P			Standard	NM_001004491		Approved		uc010pzd.2	Q8NG84	OTTHUMG00000040201	ENST00000366480.3:c.174C>T	1.37:g.248128807C>T			B2RND1|Q6IF05	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I58	ENST00000366480.3	37	c.174	CCDS31102.1	1																																																																																			OR2AK2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000187080		0.448	OR2AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2AK2	HGNC	protein_coding	OTTHUMT00000096858.2	27	0.00	0	C	NM_001004491		248128807	248128807	+1	no_errors	ENST00000366480	ensembl	human	known	69_37n	silent	44	27.87	17	SNP	0.000	T
OR4M1	441670	genome.wustl.edu	37	14	20249178	20249178	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr14:20249178G>A	ENST00000315957.4	+	1	778	c.697G>A	c.(697-699)Gag>Aag	p.E233K		NM_001005500.1	NP_001005500.1	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M, member 1	233						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(32)|prostate(1)|skin(2)	42	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		AGGCTCAGGTGAGAATACCAA	0.468																																						dbGAP											0													345.0	294.0	312.0					14																	20249178		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32021.1	14q11.2	2013-09-23			ENSG00000176299	ENSG00000176299		"""GPCR / Class A : Olfactory receptors"""	14735	protein-coding gene	gene with protein product							Standard	NM_001005500		Approved		uc010tku.2	Q8NGD0	OTTHUMG00000170599	ENST00000315957.4:c.697G>A	14.37:g.20249178G>A	ENSP00000319654:p.Glu233Lys		B9EH18|Q6IFA3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.E233K	ENST00000315957.4	37	c.697	CCDS32021.1	14	.	.	.	.	.	.	.	.	.	.	.	9.658	1.143305	0.21205	.	.	ENSG00000176299	ENST00000315957	T	0.00042	8.84	4.42	4.42	0.53409	GPCR, rhodopsin-like superfamily (1);	0.147283	0.32068	N	0.006636	T	0.00210	0.0006	L	0.54323	1.7	0.32421	N	0.549359	B	0.29909	0.261	B	0.33295	0.161	T	0.55509	-0.8130	10	0.42905	T	0.14	-13.618	14.9222	0.70847	0.0:0.0:1.0:0.0	.	233	Q8NGD0	OR4M1_HUMAN	K	233	ENSP00000319654:E233K	ENSP00000319654:E233K	E	+	1	0	OR4M1	19319018	0.936000	0.31750	1.000000	0.80357	0.597000	0.36814	2.651000	0.46674	2.468000	0.83385	0.506000	0.49869	GAG	OR4M1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000176299		0.468	OR4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4M1	HGNC	protein_coding	OTTHUMT00000409770.1	75	0.00	0	G			20249178	20249178	+1	no_errors	ENST00000315957	ensembl	human	known	69_37n	missense	28	37.78	17	SNP	1.000	A
OR5M11	219487	genome.wustl.edu	37	11	56309909	56309909	+	Silent	SNP	G	G	C			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr11:56309909G>C	ENST00000528616.2	-	1	848	c.825C>G	c.(823-825)gtC>gtG	p.V275V		NM_001005245.1	NP_001005245.1	Q96RB7	OR5MB_HUMAN	olfactory receptor, family 5, subfamily M, member 11	275						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(14)	18						AGGTGTAAAAGACAGCTATTA	0.393																																						dbGAP											0													95.0	90.0	91.0					11																	56309909		1888	4126	6014	-	-	-	SO:0001819	synonymous_variant	0			AP002517	CCDS53629.1	11q11	2012-08-09				ENSG00000255223		"""GPCR / Class A : Olfactory receptors"""	15291	protein-coding gene	gene with protein product							Standard	NM_001005245		Approved	OR11-199	uc010rjl.2	Q96RB7		ENST00000528616.2:c.825C>G	11.37:g.56309909G>C			B2RNL5|B2RNL7	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V275	ENST00000528616.2	37	c.825	CCDS53629.1	11																																																																																			OR5M11	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000255223		0.393	OR5M11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M11	HGNC	protein_coding	OTTHUMT00000391608.1	18	0.00	0	G	NM_001005245		56309909	56309909	-1	no_errors	ENST00000528616	ensembl	human	known	69_37n	silent	7	58.82	10	SNP	0.981	C
PCDHB7	56129	genome.wustl.edu	37	5	140554697	140554697	+	Nonsense_Mutation	SNP	G	G	T	rs180836755		TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr5:140554697G>T	ENST00000231137.3	+	1	2455	c.2281G>T	c.(2281-2283)Gag>Tag	p.E761*	PCDHB8_ENST00000239444.2_5'Flank	NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	761					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGGGACAAATGAGTTCAAGTT	0.532																																						dbGAP											0													85.0	126.0	112.0					5																	140554697		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.2281G>T	5.37:g.140554697G>T	ENSP00000231137:p.Glu761*		A1L3Y8	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E761*	ENST00000231137.3	37	c.2281	CCDS4249.1	5	.	.	.	.	.	.	.	.	.	.	G	36	5.836718	0.97009	.	.	ENSG00000113212	ENST00000231137	.	.	.	4.33	4.33	0.51752	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	16.8123	0.85724	0.0:0.0:1.0:0.0	.	.	.	.	X	761	.	ENSP00000231137:E761X	E	+	1	0	PCDHB7	140534881	1.000000	0.71417	0.857000	0.33713	0.143000	0.21401	7.779000	0.85648	2.104000	0.64026	0.455000	0.32223	GAG	PCDHB7	-	NULL	ENSG00000113212		0.532	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB7	HGNC	protein_coding	OTTHUMT00000251803.2	197	0.00	0	G	NM_018940		140554697	140554697	+1	no_errors	ENST00000231137	ensembl	human	known	69_37n	nonsense	164	16.33	32	SNP	0.999	T
PCLO	27445	genome.wustl.edu	37	7	82467655	82467655	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr7:82467655G>A	ENST00000333891.9	-	15	14438	c.14101C>T	c.(14101-14103)Caa>Taa	p.Q4701*	PCLO_ENST00000423517.2_Nonsense_Mutation_p.Q4701*|PCLO_ENST00000426442.2_5'UTR	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TAGTTAATTTGAAGCTTTAGG	0.274																																						dbGAP											0													38.0	37.0	37.0					7																	82467655		1792	4051	5843	-	-	-	SO:0001587	stop_gained	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.14101C>T	7.37:g.82467655G>A	ENSP00000334319:p.Gln4701*			Nonsense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ	p.Q4701*	ENST00000333891.9	37	c.14101	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	G	56	25.998635	0.99967	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000380195	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.3486	0.94374	0.0:0.0:1.0:0.0	.	.	.	.	X	4701;4701;197	.	ENSP00000334319:Q4701X	Q	-	1	0	PCLO	82305591	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.086000	0.94088	2.546000	0.85860	0.655000	0.94253	CAA	PCLO	-	superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000186472		0.274	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	62	0.00	0	G	NM_014510		82467655	82467655	-1	no_errors	ENST00000333891	ensembl	human	known	69_37n	nonsense	29	27.50	11	SNP	1.000	A
PDE4DIP	9659	genome.wustl.edu	37	1	144879078	144879078	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr1:144879078C>G	ENST00000369354.3	-	27	4561	c.4372G>C	c.(4372-4374)Gaa>Caa	p.E1458Q	PDE4DIP_ENST00000369356.4_Missense_Mutation_p.E1458Q|PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.E1414Q|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.E1594Q|RP4-791M13.5_ENST00000531288.1_RNA|AL138796.1_ENST00000582173.1_RNA|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.E1594Q			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1458					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		AGCTTCTCTTCTAGTCCATTT	0.512			T	PDGFRB	MPD																																	dbGAP		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0													142.0	156.0	151.0					1																	144879078		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.4372G>C	1.37:g.144879078C>G	ENSP00000358360:p.Glu1458Gln		A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	pfam_Spindle_assoc,superfamily_ARM-type_fold	p.E1458Q	ENST00000369354.3	37	c.4372	CCDS30824.1	1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.348863	0.82132	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359	T;T;T;T;T	0.02050	4.48;4.57;4.57;4.6;4.59	5.44	5.44	0.79542	.	.	.	.	.	T	0.04998	0.0134	L	0.60455	1.87	0.80722	D	1	D;D	0.71674	0.993;0.998	P;D	0.77557	0.836;0.99	T	0.17107	-1.0380	9	0.51188	T	0.08	.	10.0522	0.42223	0.0:0.9114:0.0:0.0886	.	1414;1458	Q5VU43-3;Q5VU43	.;MYOME_HUMAN	Q	1414;1458;1458;1594;1594	ENSP00000327209:E1414Q;ENSP00000358360:E1458Q;ENSP00000358363:E1458Q;ENSP00000435654:E1594Q;ENSP00000358366:E1594Q	ENSP00000327209:E1414Q	E	-	1	0	PDE4DIP	143590435	0.597000	0.26874	0.527000	0.27925	0.960000	0.62799	1.419000	0.34793	2.835000	0.97688	0.591000	0.81541	GAA	PDE4DIP	-	NULL	ENSG00000178104		0.512	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000038858.2	68	0.00	0	C	NM_022359		144879078	144879078	-1	no_errors	ENST00000369356	ensembl	human	known	69_37n	missense	60	11.76	8	SNP	0.977	G
PEX6	5190	genome.wustl.edu	37	6	42934590	42934590	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr6:42934590C>T	ENST00000304611.8	-	9	1960	c.1891G>A	c.(1891-1893)Gtg>Atg	p.V631M	PEX6_ENST00000244546.4_Missense_Mutation_p.V631M	NM_000287.3	NP_000278.3	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	631					ATP catabolic process (GO:0006200)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix, translocation (GO:0016561)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(3)	15			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			TCCCCTACCACAAAGCCCTAG	0.597																																						dbGAP											0													128.0	134.0	132.0					6																	42934590		2203	4300	6503	-	-	-	SO:0001583	missense	0			U56602	CCDS4877.1	6p22-p11	2010-04-21			ENSG00000124587	ENSG00000124587		"""ATPases / AAA-type"""	8859	protein-coding gene	gene with protein product		601498				8670792	Standard	NM_000287		Approved	PXAAA1, PAF-2	uc003otf.3	Q13608	OTTHUMG00000014713	ENST00000304611.8:c.1891G>A	6.37:g.42934590C>T	ENSP00000303511:p.Val631Met		Q5T8W1|Q8WYQ0|Q8WYQ1|Q8WYQ2|Q99476	Missense_Mutation	SNP	pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.V631M	ENST00000304611.8	37	c.1891	CCDS4877.1	6	.	.	.	.	.	.	.	.	.	.	C	25.8	4.673319	0.88445	.	.	ENSG00000124587	ENST00000304611;ENST00000244546	T;T	0.78481	-1.18;-1.18	5.35	5.35	0.76521	.	0.167321	0.52532	D	0.000063	T	0.77558	0.4148	M	0.81497	2.545	0.58432	D	0.999999	P	0.45768	0.866	P	0.44359	0.447	T	0.82810	-0.0273	10	0.87932	D	0	-20.1599	16.8648	0.86026	0.0:1.0:0.0:0.0	.	631	Q13608	PEX6_HUMAN	M	631	ENSP00000303511:V631M;ENSP00000244546:V631M	ENSP00000244546:V631M	V	-	1	0	PEX6	43042568	1.000000	0.71417	0.999000	0.59377	0.948000	0.59901	5.073000	0.64395	2.495000	0.84180	0.462000	0.41574	GTG	PEX6	-	NULL	ENSG00000124587		0.597	PEX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX6	HGNC	protein_coding	OTTHUMT00000040569.1	27	0.00	0	C	NM_000287		42934590	42934590	-1	no_errors	ENST00000304611	ensembl	human	known	69_37n	missense	17	37.04	10	SNP	1.000	T
PGBD2	267002	genome.wustl.edu	37	1	249212291	249212291	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr1:249212291G>A	ENST00000329291.5	+	3	1655	c.1508G>A	c.(1507-1509)aGa>aAa	p.R503K	PGBD2_ENST00000355360.4_Missense_Mutation_p.R252K|PGBD2_ENST00000539153.1_Missense_Mutation_p.R500K	NM_170725.2	NP_733843.1	Q6P3X8	PGBD2_HUMAN	piggyBac transposable element derived 2	503										NS(1)|endometrium(3)|lung(6)|ovary(1)|skin(3)	14	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			CAGCTGCATAGAATCTGCTGC	0.498																																						dbGAP											0													152.0	123.0	133.0					1																	249212291		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF229602	CCDS31128.1, CCDS31129.1	1q	2008-02-05			ENSG00000185220	ENSG00000185220			19399	protein-coding gene	gene with protein product							Standard	XM_005270333		Approved		uc001ifh.3	Q6P3X8	OTTHUMG00000040424	ENST00000329291.5:c.1508G>A	1.37:g.249212291G>A	ENSP00000331643:p.Arg503Lys		B3KVR8|Q6MZF8	Missense_Mutation	SNP	NULL	p.R503K	ENST00000329291.5	37	c.1508	CCDS31128.1	1	.	.	.	.	.	.	.	.	.	.	.	3.510	-0.100034	0.07010	.	.	ENSG00000185220	ENST00000355360;ENST00000329291;ENST00000539153	T;T;T	0.13196	2.61;2.85;2.86	3.05	2.13	0.27403	.	0.089365	0.40385	N	0.001119	T	0.04952	0.0133	N	0.08118	0	0.18873	N	0.999982	B;B	0.19817	0.039;0.018	B;B	0.20384	0.029;0.007	T	0.42965	-0.9420	10	0.06757	T	0.87	.	6.2753	0.20977	0.1402:0.0:0.8598:0.0	.	500;503	F5H4U7;Q6P3X8	.;PGBD2_HUMAN	K	252;503;500	ENSP00000355424:R252K;ENSP00000331643:R503K;ENSP00000439950:R500K	ENSP00000331643:R503K	R	+	2	0	PGBD2	247178914	1.000000	0.71417	0.939000	0.37840	0.207000	0.24258	2.559000	0.45888	0.839000	0.34971	0.467000	0.42956	AGA	PGBD2	-	NULL	ENSG00000185220		0.498	PGBD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PGBD2	HGNC	protein_coding	OTTHUMT00000097318.1	30	0.00	0	G			249212291	249212291	+1	no_errors	ENST00000329291	ensembl	human	known	69_37n	missense	34	38.18	21	SNP	0.889	A
PITPNM1	9600	genome.wustl.edu	37	11	67269467	67269467	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr11:67269467C>T	ENST00000534749.1	-	4	694	c.506G>A	c.(505-507)cGa>cAa	p.R169Q	PITPNM1_ENST00000356404.3_Missense_Mutation_p.R169Q|PITPNM1_ENST00000436757.2_Missense_Mutation_p.R169Q			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	169					brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						CAGTGGCCCTCGGCCCGTCTT	0.612																																					GBM(28;144 709 4607 5525)	dbGAP											0													55.0	51.0	52.0					11																	67269467		2200	4294	6494	-	-	-	SO:0001583	missense	0			X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.506G>A	11.37:g.67269467C>T	ENSP00000437286:p.Arg169Gln		A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Missense_Mutation	SNP	pfam_PI_transfer,pfam_DDHD,pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2,pfscan_DDHD,prints_PI_transfer	p.R169Q	ENST00000534749.1	37	c.506	CCDS31620.1	11	.	.	.	.	.	.	.	.	.	.	C	35	5.414320	0.96092	.	.	ENSG00000110697	ENST00000534749;ENST00000436757;ENST00000356404	T;T;T	0.58060	0.36;0.36;0.36	4.23	4.23	0.50019	START-like domain (1);	0.000000	0.42821	D	0.000648	T	0.79281	0.4419	H	0.96460	3.825	0.46586	D	0.999115	D;D	0.67145	0.996;0.989	P;P	0.62649	0.905;0.854	D	0.86783	0.1980	10	0.87932	D	0	-3.4254	15.7356	0.77839	0.0:1.0:0.0:0.0	.	169;169	O00562-2;O00562	.;PITM1_HUMAN	Q	169	ENSP00000437286:R169Q;ENSP00000398787:R169Q;ENSP00000348772:R169Q	ENSP00000348772:R169Q	R	-	2	0	PITPNM1	67026043	0.991000	0.36638	0.989000	0.46669	0.937000	0.57800	7.571000	0.82399	2.359000	0.80004	0.655000	0.94253	CGA	PITPNM1	-	pfam_PI_transfer	ENSG00000110697		0.612	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	PITPNM1	HGNC	protein_coding	OTTHUMT00000395520.1	35	0.00	0	C	NM_004910		67269467	67269467	-1	no_errors	ENST00000356404	ensembl	human	known	69_37n	missense	19	40.62	13	SNP	1.000	T
PLIN2	123	genome.wustl.edu	37	9	19108734	19108734	+	RNA	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr9:19108734G>A	ENST00000583933.1	-	0	0									RNA, 7SL, cytoplasmic 158, pseudogene																		CTATGGTGGTGAAATCAAACA	0.403																																						dbGAP											0																																										-	-	-			0					9p22.1	2013-04-02			ENSG00000264126			"""ncRNAs / Small cytoplasmic RNAs"""	46174	pseudogene	RNA, pseudogene							Standard			Approved						9.37:g.19108734G>A				RNA	SNP	-	NULL	ENST00000583933.1	37	NULL		9																																																																																			PLIN2	-	-	ENSG00000147872		0.403	RN7SL158P-201	KNOWN	basic	misc_RNA	PLIN2	HGNC	misc_RNA		23	0.00	0	G			19108734	19108734	-1	no_errors	ENST00000464326	ensembl	human	known	69_37n	rna	16	30.43	7	SNP	0.917	A
PLOD3	8985	genome.wustl.edu	37	7	100860012	100860012	+	Silent	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr7:100860012G>A	ENST00000223127.3	-	2	563	c.165C>T	c.(163-165)ttC>ttT	p.F55F	ZNHIT1_ENST00000305105.2_5'Flank	NM_001084.4	NP_001075.1	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3	55					basement membrane assembly (GO:0070831)|cellular protein modification process (GO:0006464)|cellular response to hormone stimulus (GO:0032870)|collagen fibril organization (GO:0030199)|endothelial cell morphogenesis (GO:0001886)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|lung morphogenesis (GO:0060425)|neural tube development (GO:0021915)|protein localization (GO:0008104)|vasodilation (GO:0042311)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen galactosyltransferase activity (GO:0050211)|procollagen glucosyltransferase activity (GO:0033823)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	31	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)	CAGAGCGCAGGAAACGCAGGT	0.607																																						dbGAP											0													73.0	72.0	72.0					7																	100860012		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF046889	CCDS5715.1	7q22.1	2011-08-24			ENSG00000106397	ENSG00000106397	1.14.11.4		9083	protein-coding gene	gene with protein product	"""lysyl hydroxlase 3"""	603066				9724729, 9582318	Standard	NM_001084		Approved	LH3	uc003uyd.3	O60568	OTTHUMG00000157111	ENST00000223127.3:c.165C>T	7.37:g.100860012G>A			B2R6W6|Q540C3	Silent	SNP	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.F55	ENST00000223127.3	37	c.165	CCDS5715.1	7																																																																																			PLOD3	-	NULL	ENSG00000106397		0.607	PLOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLOD3	HGNC	protein_coding	OTTHUMT00000347470.1	26	0.00	0	G			100860012	100860012	-1	no_errors	ENST00000223127	ensembl	human	known	69_37n	silent	17	45.16	14	SNP	1.000	A
PODN	127435	genome.wustl.edu	37	1	53535792	53535792	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr1:53535792G>A	ENST00000312553.5	+	2	416	c.409G>A	c.(409-411)Gag>Aag	p.E137K	PODN_ENST00000371500.3_Missense_Mutation_p.E118K|RP11-334A14.5_ENST00000447867.1_RNA|PODN_ENST00000395871.2_Missense_Mutation_p.E137K	NM_001199081.1|NM_153703.4	NP_001186010.1|NP_714914.2	Q7Z5L7	PODN_HUMAN	podocan	89					negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						TGACCTGCGTGAGTTCCCGGG	0.677																																						dbGAP											0													81.0	64.0	70.0					1																	53535792		2202	4300	6502	-	-	-	SO:0001583	missense	0			AY313607	CCDS573.1, CCDS55601.1, CCDS55602.1	1p32.3	2008-02-05			ENSG00000174348	ENSG00000174348		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	23174	protein-coding gene	gene with protein product	"""podocan proteoglycan"""	608661					Standard	NM_153703		Approved	PCAN, PODOCAN, MGC24995, SLRR5A	uc010onr.2	Q7Z5L7	OTTHUMG00000008934	ENST00000312553.5:c.409G>A	1.37:g.53535792G>A	ENSP00000308315:p.Glu137Lys		B4DKN5|B4E373|Q5VVZ2|Q5VVZ3|Q6PIR3|Q6UXL8|Q8N641	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_LRR-contain_N,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_typical-subtyp	p.E137K	ENST00000312553.5	37	c.409	CCDS573.1	1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.948638	0.92660	.	.	ENSG00000174348	ENST00000371500;ENST00000395871;ENST00000312553	T;T;T	0.24723	3.59;1.84;2.19	4.82	4.82	0.62117	.	0.833630	0.10520	N	0.665082	T	0.41766	0.1173	L	0.50333	1.59	0.23636	N	0.997231	B;D;D	0.67145	0.01;0.996;0.995	B;D;P	0.77557	0.037;0.99;0.885	T	0.21793	-1.0235	10	0.07990	T	0.79	.	13.2558	0.60079	0.0:0.0:1.0:0.0	.	137;118;137	Q7Z5L7-4;Q7Z5L7-2;Q7Z5L7-3	.;.;.	K	118;137;137	ENSP00000360555:E118K;ENSP00000379212:E137K;ENSP00000308315:E137K	ENSP00000308315:E137K	E	+	1	0	PODN	53308380	1.000000	0.71417	0.969000	0.41365	0.990000	0.78478	4.017000	0.57167	2.509000	0.84616	0.561000	0.74099	GAG	PODN	-	smart_LRR-contain_N	ENSG00000174348		0.677	PODN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PODN	HGNC	protein_coding	OTTHUMT00000024735.1	48	0.00	0	G	NM_153703		53535792	53535792	+1	no_errors	ENST00000312553	ensembl	human	known	69_37n	missense	29	27.50	11	SNP	0.995	A
HELZ2	85441	genome.wustl.edu	37	20	62202785	62202785	+	Intron	SNP	A	A	G	rs112398509|rs71335511		TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr20:62202785A>G	ENST00000467148.1	-	2	348				HELZ2_ENST00000479540.1_5'UTR	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator						cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GCTCCTGGGAACCTCTGGCTC	0.687																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.279-564T>C	20.37:g.62202785A>G			Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	RNA	SNP	-	NULL	ENST00000467148.1	37	NULL	CCDS33508.1	20																																																																																			RP4-697K14.7	-	-	ENSG00000130589		0.687	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PRIC285	Clone_based_vega_gene	protein_coding	OTTHUMT00000354127.1	28	0.00	0	A	NM_001037335		62202785	62202785	-1	no_errors	ENST00000479540	ensembl	human	known	69_37n	rna	26	38.10	16	SNP	0.741	G
PRKCE	5581	genome.wustl.edu	37	2	45879318	45879318	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr2:45879318C>T	ENST00000306156.3	+	1	406	c.79C>T	c.(79-81)Cat>Tat	p.H27Y		NM_005400.2	NP_005391.1	Q02156	KPCE_HUMAN	protein kinase C, epsilon	27	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to ethanol (GO:0071361)|cellular response to hypoxia (GO:0071456)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|locomotory exploration behavior (GO:0035641)|macrophage activation involved in immune response (GO:0002281)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cellular glucuronidation (GO:2001031)|positive regulation of cytokinesis (GO:0032467)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of insulin secretion (GO:0032024)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|release of sequestered calcium ion into cytosol (GO:0051209)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|TRAM-dependent toll-like receptor 4 signaling pathway (GO:0035669)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|ethanol binding (GO:0035276)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|receptor activator activity (GO:0030546)|signal transducer activity (GO:0004871)		MBOAT2/PRKCE(2)	breast(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(13)|ovary(3)|upper_aerodigestive_tract(2)	34		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)		Tamoxifen(DB00675)	GTCGCTGCGCCATGCGGTGGG	0.617																																						dbGAP											0													50.0	53.0	52.0					2																	45879318		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS1824.1	2p21	2009-07-10			ENSG00000171132	ENSG00000171132	2.7.11.1		9401	protein-coding gene	gene with protein product		176975				1382605, 7877991	Standard	NM_005400		Approved		uc002rut.3	Q02156	OTTHUMG00000128817	ENST00000306156.3:c.79C>T	2.37:g.45879318C>T	ENSP00000306124:p.His27Tyr		B0LPH7|Q32MQ3|Q53SL4|Q53SM5|Q9UE81	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,pfam_C2_Ca-dep,superfamily_Kinase-like_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Prot_kin_PKC_delta,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd	p.H27Y	ENST00000306156.3	37	c.79	CCDS1824.1	2	.	.	.	.	.	.	.	.	.	.	C	29.8	5.037171	0.93630	.	.	ENSG00000171132	ENST00000421201;ENST00000306156	T;T	0.09445	2.98;2.98	4.71	4.71	0.59529	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.36717	0.0977	M	0.86343	2.81	0.80722	D	1	D	0.55172	0.97	P	0.62089	0.898	T	0.37103	-0.9720	10	0.45353	T	0.12	.	17.673	0.88224	0.0:1.0:0.0:0.0	.	27	Q02156	KPCE_HUMAN	Y	27	ENSP00000394574:H27Y;ENSP00000306124:H27Y	ENSP00000306124:H27Y	H	+	1	0	PRKCE	45732822	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.739000	0.84976	2.152000	0.67230	0.561000	0.74099	CAT	PRKCE	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pirsf_Prot_kin_PKC_delta,pfscan_C2_membr_targeting	ENSG00000171132		0.617	PRKCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCE	HGNC	protein_coding	OTTHUMT00000250751.2	27	0.00	0	C			45879318	45879318	+1	no_errors	ENST00000306156	ensembl	human	known	69_37n	missense	2	84.62	11	SNP	1.000	T
PRSS12	8492	genome.wustl.edu	37	4	119273484	119273484	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr4:119273484C>T	ENST00000296498.3	-	1	674	c.392G>A	c.(391-393)cGa>cAa	p.R131Q		NM_003619.3	NP_003610.2	P56730	NETR_HUMAN	protease, serine, 12 (neurotrypsin, motopsin)	131	Kringle. {ECO:0000255|PROSITE- ProRule:PRU00121}.				exocytosis (GO:0006887)|zymogen activation (GO:0031638)	axon (GO:0030424)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)|terminal bouton (GO:0043195)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(3)|kidney(1)|large_intestine(9)|lung(11)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	29						GCGCTGTCCTCGCAGCTGAGC	0.697																																						dbGAP											0													10.0	11.0	11.0					4																	119273484		2195	4290	6485	-	-	-	SO:0001583	missense	0			AJ001531	CCDS3709.1	4q25-q26	2010-05-07			ENSG00000164099	ENSG00000164099		"""Serine peptidases / Serine peptidases"""	9477	protein-coding gene	gene with protein product		606709				9540828, 9245503	Standard	NM_003619		Approved	BSSP-3, MRT1	uc003ica.2	P56730	OTTHUMG00000161166	ENST00000296498.3:c.392G>A	4.37:g.119273484C>T	ENSP00000296498:p.Arg131Gln		Q9UP16	Missense_Mutation	SNP	pfam_Srcr_rcpt,pfam_Peptidase_S1_S6,pfam_Kringle,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Srcr_rcpt-rel,superfamily_Kringle-like,smart_Kringle,smart_Srcr_rcpt-rel,smart_Peptidase_S1_S6,pfscan_Kringle,pfscan_Srcr_rcpt,pfscan_Peptidase_S1_S6,prints_Srcr_rcpt,prints_Peptidase_S1A	p.R131Q	ENST00000296498.3	37	c.392	CCDS3709.1	4	.	.	.	.	.	.	.	.	.	.	C	22.0	4.228279	0.79576	.	.	ENSG00000164099	ENST00000296498	T	0.65549	-0.16	4.33	0.589	0.17452	Kringle (4);Kringle-like fold (1);	0.559252	0.14124	N	0.339838	T	0.45175	0.1329	L	0.39085	1.19	0.19300	N	0.999975	B	0.15930	0.015	B	0.09377	0.004	T	0.28996	-1.0026	10	0.40728	T	0.16	.	4.5235	0.11971	0.1584:0.5664:0.0:0.2751	.	131	P56730	NETR_HUMAN	Q	131	ENSP00000296498:R131Q	ENSP00000296498:R131Q	R	-	2	0	PRSS12	119492932	0.936000	0.31750	0.383000	0.26132	0.891000	0.51852	1.130000	0.31393	0.188000	0.20168	0.467000	0.42956	CGA	PRSS12	-	pfam_Kringle,superfamily_Kringle-like,smart_Kringle,pfscan_Kringle	ENSG00000164099		0.697	PRSS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS12	HGNC	protein_coding	OTTHUMT00000256516.2	15	0.00	0	C			119273484	119273484	-1	no_errors	ENST00000296498	ensembl	human	known	69_37n	missense	8	38.46	5	SNP	0.224	T
RALGAPA2	57186	genome.wustl.edu	37	20	20599982	20599982	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr20:20599982C>T	ENST00000202677.7	-	12	1485	c.1478G>A	c.(1477-1479)aGa>aAa	p.R493K		NM_020343.3	NP_065076.2	Q2PPJ7	RGPA2_HUMAN	Ral GTPase activating protein, alpha subunit 2 (catalytic)	493					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	54						CACACACCCTCTGCTCATTGC	0.498																																						dbGAP											0													85.0	80.0	81.0					20																	20599982		1940	4154	6094	-	-	-	SO:0001583	missense	0			AL078634, DQ310704	CCDS46584.1	20p11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000188559	ENSG00000188559			16207	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 74"""	C20orf74		16490346, 19520869	Standard	NM_020343		Approved	dJ1049G11.4, AS250, KIAA1272, RapGAPalpha2	uc002wrz.3	Q2PPJ7	OTTHUMG00000032010	ENST00000202677.7:c.1478G>A	20.37:g.20599982C>T	ENSP00000202677:p.Arg493Lys		Q4VXU6|Q5JUA3|Q5JUA4|Q5T9K3|Q96CX9|Q9BQT7|Q9H9D9|Q9ULE8	Missense_Mutation	SNP	pfam_Rap_GAP,superfamily_ARM-type_fold,pfscan_Rap_GAP	p.R493K	ENST00000202677.7	37	c.1478	CCDS46584.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.20|15.20	2.763612|2.763612	0.49574|0.49574	.|.	.|.	ENSG00000188559|ENSG00000188559	ENST00000430436|ENST00000202677	.|T	.|0.75260	.|-0.92	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.69269|0.69269	0.3092|0.3092	L|L	0.46157|0.46157	1.445|1.445	0.47276|0.47276	D|D	0.999372|0.999372	.|B	.|0.20780	.|0.048	.|B	.|0.15052	.|0.012	T|T	0.63541|0.63541	-0.6614|-0.6614	5|10	.|0.15952	.|T	.|0.53	.|.	19.9738|19.9738	0.97296|0.97296	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|493	.|Q2PPJ7	.|RGPA2_HUMAN	K|K	310|493	.|ENSP00000202677:R493K	.|ENSP00000202677:R493K	E|R	-|-	1|2	0|0	RALGAPA2|RALGAPA2	20547982|20547982	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	5.519000|5.519000	0.67074|0.67074	2.732000|2.732000	0.93576|0.93576	0.655000|0.655000	0.94253|0.94253	GAG|AGA	RALGAPA2	-	NULL	ENSG00000188559		0.498	RALGAPA2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	RALGAPA2	HGNC	protein_coding	OTTHUMT00000471941.1	51	0.00	0	C	NM_020343		20599982	20599982	-1	no_errors	ENST00000202677	ensembl	human	known	69_37n	missense	16	40.74	11	SNP	1.000	T
REV3L	5980	genome.wustl.edu	37	6	111697741	111697741	+	Missense_Mutation	SNP	G	G	T	rs201601521		TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr6:111697741G>T	ENST00000358835.3	-	14	2271	c.1817C>A	c.(1816-1818)aCa>aAa	p.T606K	REV3L_ENST00000435970.1_Missense_Mutation_p.T528K|REV3L_ENST00000368802.3_Missense_Mutation_p.T606K|REV3L_ENST00000368805.1_Missense_Mutation_p.T606K			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	606					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		ACCTTTTTCTGTATTTTTGTT	0.343								DNA polymerases (catalytic subunits)																														dbGAP											0													69.0	72.0	71.0					6																	111697741		2200	4300	6500	-	-	-	SO:0001583	missense	0			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.1817C>A	6.37:g.111697741G>T	ENSP00000351697:p.Thr606Lys		O43214|Q5TC33	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B	p.T606K	ENST00000358835.3	37	c.1817	CCDS5091.2	6	.	.	.	.	.	.	.	.	.	.	G	7.785	0.710288	0.15239	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.01446	4.97;4.97;4.97;4.88	5.52	-6.29	0.02013	Ribonuclease H-like (1);	1.786910	0.02671	N	0.108566	T	0.00524	0.0017	N	0.19112	0.55	0.09310	N	0.999999	B	0.10296	0.003	B	0.09377	0.004	T	0.47262	-0.9131	10	0.62326	D	0.03	-11.1816	10.2647	0.43447	0.3252:0.1212:0.5535:0.0	.	606	O60673	DPOLZ_HUMAN	K	606;606;606;528	ENSP00000357792:T606K;ENSP00000357795:T606K;ENSP00000351697:T606K;ENSP00000402003:T528K	ENSP00000351697:T606K	T	-	2	0	REV3L	111804434	0.195000	0.23338	0.003000	0.11579	0.912000	0.54170	0.075000	0.14686	-1.270000	0.02433	-0.414000	0.06135	ACA	REV3L	-	superfamily_RNaseH-like_dom	ENSG00000009413		0.343	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	REV3L	HGNC	protein_coding	OTTHUMT00000043695.1	40	0.00	0	G	NM_002912		111697741	111697741	-1	no_errors	ENST00000358835	ensembl	human	known	69_37n	missense	21	12.50	3	SNP	0.006	T
RFXAP	5994	genome.wustl.edu	37	13	37393936	37393936	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr13:37393936G>A	ENST00000255476.2	+	1	576	c.442G>A	c.(442-444)Gag>Aag	p.E148K		NM_000538.3	NP_000529.1	O00287	RFXAP_HUMAN	regulatory factor X-associated protein	148					positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|ovary(1)	4		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)		all cancers(112;3.5e-07)|Epithelial(112;1.27e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.0069)|BRCA - Breast invasive adenocarcinoma(63;0.0116)|GBM - Glioblastoma multiforme(144;0.0405)		AGGCTGCAGCGAGACCACGAG	0.622																																						dbGAP											0													42.0	36.0	38.0					13																	37393936		2200	4299	6499	-	-	-	SO:0001583	missense	0			Y12812	CCDS9359.1	13q14	2014-09-17			ENSG00000133111	ENSG00000133111			9988	protein-coding gene	gene with protein product		601861				9118943	Standard	NM_000538		Approved		uc001uvu.1	O00287	OTTHUMG00000016738	ENST00000255476.2:c.442G>A	13.37:g.37393936G>A	ENSP00000255476:p.Glu148Lys		B2R9T8|Q5VZM6|Q8TC40	Missense_Mutation	SNP	NULL	p.E148K	ENST00000255476.2	37	c.442	CCDS9359.1	13	.	.	.	.	.	.	.	.	.	.	g	33	5.249931	0.95305	.	.	ENSG00000133111	ENST00000255476	.	.	.	5.05	4.2	0.49525	.	0.000000	0.85682	D	0.000000	T	0.50565	0.1623	M	0.63843	1.955	0.80722	D	1	D	0.56287	0.975	B	0.43052	0.406	T	0.59606	-0.7423	9	0.87932	D	0	-21.6999	11.6517	0.51292	0.0872:0.0:0.9128:0.0	.	148	O00287	RFXAP_HUMAN	K	148	.	ENSP00000255476:E148K	E	+	1	0	RFXAP	36291936	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	6.666000	0.74446	2.356000	0.79943	0.645000	0.84053	GAG	RFXAP	-	NULL	ENSG00000133111		0.622	RFXAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFXAP	HGNC	protein_coding	OTTHUMT00000044521.1	14	0.00	0	G	NM_000538		37393936	37393936	+1	no_errors	ENST00000255476	ensembl	human	known	69_37n	missense	4	75.00	12	SNP	1.000	A
RGL4	266747	genome.wustl.edu	37	22	24038606	24038606	+	Intron	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr22:24038606G>A	ENST00000290691.5	+	7	2256				RGL4_ENST00000401461.1_Intron|KB-1572G7.2_ENST00000421064.1_RNA	NM_153615.1	NP_705843.1	Q8IZJ4	RGDSR_HUMAN	ral guanine nucleotide dissociation stimulator-like 4						small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)	guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(3)	15						actctttacagaagaggaaac	0.572																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS13811.1	22q11.23	2008-02-22			ENSG00000159496	ENSG00000159496			31911	protein-coding gene	gene with protein product	"""RalGDS related oncogene"""	612214				9178890, 10851075	Standard	NM_153615		Approved	Rgr	uc002zxn.3	Q8IZJ4	OTTHUMG00000150711	ENST00000290691.5:c.1087-195G>A	22.37:g.24038606G>A			Q495L8	Missense_Mutation	SNP	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25	p.R393K	ENST00000290691.5	37	c.1178	CCDS13811.1	22																																																																																			RGL4	-	smart_RasGRF_CDC25,pfscan_RasGRF_CDC25	ENSG00000159496		0.572	RGL4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGL4	HGNC	protein_coding	OTTHUMT00000319711.1	40	0.00	0	G	NM_153615		24038606	24038606	+1	no_errors	ENST00000441897	ensembl	human	known	69_37n	missense	21	46.15	18	SNP	0.002	A
RPS6KC1	26750	genome.wustl.edu	37	1	213446633	213446633	+	3'UTR	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr1:213446633C>T	ENST00000366960.3	+	0	4007				RPS6KC1_ENST00000366959.3_3'UTR|RPS6KC1_ENST00000490299.1_3'UTR	NM_012424.3	NP_036556.2	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide 1						signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(6)|kidney(4)|large_intestine(8)|liver(2)|lung(15)|ovary(3)|prostate(1)|urinary_tract(3)	43				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		TCTGTGTCTTCAACAGCATCT	0.388																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF037447	CCDS1513.1, CCDS44317.1, CCDS73028.1, CCDS73029.1, CCDS73030.1	1q41	2011-04-05	2002-08-29		ENSG00000136643	ENSG00000136643			10439	protein-coding gene	gene with protein product			"""ribosomal protein S6 kinase, 52kD, polypeptide 1"""			10552933	Standard	XM_005273095		Approved	humS6PKh1	uc010ptr.2	Q96S38	OTTHUMG00000036926	ENST00000366960.3:c.*656C>T	1.37:g.213446633C>T			B1APS8|B3KVM4|D3DTA4|Q8TDD3|Q9NSF4|Q9UL66	RNA	SNP	-	NULL	ENST00000366960.3	37	NULL	CCDS1513.1	1																																																																																			RPS6KC1	-	-	ENSG00000136643		0.388	RPS6KC1-001	KNOWN	basic|CCDS	protein_coding	RPS6KC1	HGNC	protein_coding	OTTHUMT00000089690.3	39	0.00	0	C	NM_012424		213446633	213446633	+1	no_errors	ENST00000490299	ensembl	human	known	69_37n	rna	66	18.52	15	SNP	0.000	T
RPTOR	57521	genome.wustl.edu	37	17	78936301	78936301	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr17:78936301G>A	ENST00000306801.3	+	32	4095	c.3733G>A	c.(3733-3735)Gag>Aag	p.E1245K	RPTOR_ENST00000544334.2_Missense_Mutation_p.E1087K|CTD-2561B21.3_ENST00000571591.1_RNA|RPTOR_ENST00000575542.1_3'UTR	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	1245					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						CCGGATGCCTGAGTCGGTAAA	0.637																																						dbGAP											0													114.0	101.0	105.0					17																	78936301		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.3733G>A	17.37:g.78936301G>A	ENSP00000307272:p.Glu1245Lys		B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Missense_Mutation	SNP	pfam_HEAT,pfam_WD40_repeat,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom,prints_Raptor	p.E1245K	ENST00000306801.3	37	c.3733	CCDS11773.1	17	.	.	.	.	.	.	.	.	.	.	G	11.65	1.701521	0.30142	.	.	ENSG00000141564	ENST00000306801;ENST00000544334	T;T	0.26660	1.72;1.72	4.28	4.28	0.50868	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.053759	0.64402	D	0.000001	T	0.21062	0.0507	L	0.47716	1.5	0.80722	D	1	B;B	0.34290	0.447;0.003	B;B	0.27608	0.081;0.002	T	0.05582	-1.0876	10	0.14656	T	0.56	.	16.4941	0.84223	0.0:0.0:1.0:0.0	.	1087;1245	F5H7J5;Q8N122	.;RPTOR_HUMAN	K	1245;1087	ENSP00000307272:E1245K;ENSP00000442479:E1087K	ENSP00000307272:E1245K	E	+	1	0	RPTOR	76550896	1.000000	0.71417	0.938000	0.37757	0.180000	0.23129	8.921000	0.92784	2.212000	0.71576	0.655000	0.94253	GAG	RPTOR	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000141564		0.637	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTOR	HGNC	protein_coding	OTTHUMT00000438125.1	53	0.00	0	G	NM_020761		78936301	78936301	+1	no_errors	ENST00000306801	ensembl	human	known	69_37n	missense	26	33.33	13	SNP	0.999	A
RREB1	6239	genome.wustl.edu	37	6	7189489	7189489	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr6:7189489C>T	ENST00000349384.6	+	6	673	c.359C>T	c.(358-360)tCt>tTt	p.S120F	RREB1_ENST00000334984.6_Missense_Mutation_p.S120F|RREB1_ENST00000379938.2_Missense_Mutation_p.S120F|Y_RNA_ENST00000364613.1_RNA|RREB1_ENST00000379933.3_Missense_Mutation_p.S120F	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	120					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				CTGGTGCACTCTGGCGAGAGG	0.597																																						dbGAP											0													70.0	52.0	58.0					6																	7189489		2203	4300	6503	-	-	-	SO:0001583	missense	0			U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.359C>T	6.37:g.7189489C>T	ENSP00000305560:p.Ser120Phe		A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S120F	ENST00000349384.6	37	c.359	CCDS34336.1	6	.	.	.	.	.	.	.	.	.	.	C	26.6	4.752634	0.89753	.	.	ENSG00000124782	ENST00000379933;ENST00000491191;ENST00000379938;ENST00000471433;ENST00000349384;ENST00000334984;ENST00000483150	T;T;T;T;T;T;T	0.19806	2.12;2.12;2.12;2.12;2.12;2.12;2.12	5.65	5.65	0.86999	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.56097	D	0.000022	T	0.45677	0.1354	M	0.82056	2.57	0.58432	D	0.999998	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.999	T	0.48502	-0.9030	10	0.87932	D	0	-28.8691	19.7284	0.96174	0.0:1.0:0.0:0.0	.	120;120;120	Q92766-3;Q92766;Q92766-2	.;RREB1_HUMAN;.	F	120	ENSP00000369265:S120F;ENSP00000420519:S120F;ENSP00000369270:S120F;ENSP00000420299:S120F;ENSP00000305560:S120F;ENSP00000335574:S120F;ENSP00000419511:S120F	ENSP00000335574:S120F	S	+	2	0	RREB1	7134488	1.000000	0.71417	0.977000	0.42913	0.995000	0.86356	5.766000	0.68843	2.668000	0.90789	0.591000	0.81541	TCT	RREB1	-	pfscan_Znf_C2H2	ENSG00000124782		0.597	RREB1-002	KNOWN	basic|CCDS	protein_coding	RREB1	HGNC	protein_coding	OTTHUMT00000352985.1	29	0.00	0	C			7189489	7189489	+1	no_errors	ENST00000379938	ensembl	human	known	69_37n	missense	12	33.33	6	SNP	1.000	T
SCAF4	57466	genome.wustl.edu	37	21	33103985	33103985	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr21:33103985delG	ENST00000286835.7	-	1	403	c.21delC	c.(19-21)ttcfs	p.F7fs	SCAF4_ENST00000434667.3_Frame_Shift_Del_p.F7fs|SCAF4_ENST00000399804.1_Frame_Shift_Del_p.F7fs	NM_020706.2	NP_065757.1	O95104	SFR15_HUMAN	SR-related CTD-associated factor 4	7	CID. {ECO:0000255|PROSITE- ProRule:PRU00724}.					nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(11)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						CCTCCTGGTTGAAGGCGTTGA	0.711																																						dbGAP											0													21.0	21.0	21.0					21																	33103985		2152	4228	6380	-	-	-	SO:0001589	frameshift_variant	0			AB032998	CCDS33537.1, CCDS46644.1, CCDS54482.1	21q22.1	2013-02-12	2011-01-10	2011-01-10	ENSG00000156304	ENSG00000156304		"""RNA binding motif (RRM) containing"""	19304	protein-coding gene	gene with protein product			"""splicing factor, arginine/serine-rich 15"""	SFRS15		10574461	Standard	NM_020706		Approved	KIAA1172, DKFZp434E098, SRA4	uc002ypd.2	O95104	OTTHUMG00000084903	ENST00000286835.7:c.21delC	21.37:g.33103985delG	ENSP00000286835:p.Phe7fs		C9JLZ0|Q0P5W8|Q6P1M5|Q8N3I8|Q9UFM1|Q9ULP8	Frame_Shift_Del	DEL	pfam_RNA_pol_II-bd,pfam_RRM_dom,superfamily_ENTH_VHS,smart_RNA_polymerase_II_lsu_CTD,smart_RRM_dom,pfscan_RRM_dom	p.F7fs	ENST00000286835.7	37	c.21	CCDS33537.1	21																																																																																			SCAF4	-	superfamily_ENTH_VHS,smart_RNA_polymerase_II_lsu_CTD	ENSG00000156304		0.711	SCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCAF4	HGNC	protein_coding	OTTHUMT00000192659.1	19	0.00	0	G	XM_047889		33103985	33103985	-1	no_errors	ENST00000286835	ensembl	human	known	69_37n	frame_shift_del	4	33.33	2	DEL	1.000	-
SCAP	22937	genome.wustl.edu	37	3	47484391	47484391	+	Silent	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr3:47484391G>A	ENST00000265565.5	-	2	505	c.93C>T	c.(91-93)ctC>ctT	p.L31L	SCAP_ENST00000545718.1_5'UTR|SCAP_ENST00000441517.2_5'UTR	NM_012235.2	NP_036367.2	Q12770	SCAP_HUMAN	SREBF chaperone	31					aging (GO:0007568)|cholesterol metabolic process (GO:0008203)|negative regulation of cholesterol biosynthetic process (GO:0045541)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of fatty acid biosynthetic process (GO:0042304)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)	unfolded protein binding (GO:0051082)			endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	26				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		ACCCTGTGAAGAGGATGATGG	0.517																																					Pancreas(149;978 1908 29304 37806 46700)	dbGAP											0													159.0	132.0	141.0					3																	47484391		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC020987	CCDS2755.2	3p21.31	2013-01-10			ENSG00000114650	ENSG00000114650		"""WD repeat domain containing"""	30634	protein-coding gene	gene with protein product	"""SREBP cleavage activating protein"""	601510				8898195, 8724849, 10570913	Standard	XM_005264967		Approved	KIAA0199	uc003crh.1	Q12770	OTTHUMG00000125539	ENST00000265565.5:c.93C>T	3.37:g.47484391G>A			Q8N2E0|Q8WUA1	Silent	SNP	pfam_Patched,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_SSD,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L31	ENST00000265565.5	37	c.93	CCDS2755.2	3																																																																																			SCAP	-	NULL	ENSG00000114650		0.517	SCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAP	HGNC	protein_coding	OTTHUMT00000246872.2	58	0.00	0	G	NM_012235		47484391	47484391	-1	no_errors	ENST00000265565	ensembl	human	known	69_37n	silent	30	33.33	15	SNP	1.000	A
SELE	6401	genome.wustl.edu	37	1	169696916	169696916	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr1:169696916G>A	ENST00000333360.7	-	9	1571	c.1432C>T	c.(1432-1434)Cag>Tag	p.Q478*	SELE_ENST00000367776.1_Nonsense_Mutation_p.Q415*|SELE_ENST00000367781.4_Nonsense_Mutation_p.Q415*|SELE_ENST00000367777.1_Intron|SELE_ENST00000367780.4_Nonsense_Mutation_p.Q353*|SELE_ENST00000367782.4_Intron|C1orf112_ENST00000498289.1_Intron|SELE_ENST00000367775.1_Nonsense_Mutation_p.Q353*|SELE_ENST00000367779.4_Intron|SELE_ENST00000367774.1_Intron	NM_000450.2	NP_000441.2	P16581	LYAM2_HUMAN	selectin E	478	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				actin filament-based process (GO:0030029)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of receptor internalization (GO:0002092)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)	caveola (GO:0005901)|coated pit (GO:0005905)|cortical cytoskeleton (GO:0030863)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	oligosaccharide binding (GO:0070492)|phospholipase binding (GO:0043274)|sialic acid binding (GO:0033691)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(3)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	all_hematologic(923;0.208)				Carvedilol(DB01136)	CATTGTCCCTGAGATGTGCAC	0.433																																						dbGAP											0													133.0	127.0	129.0					1																	169696916		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M30640	CCDS1283.1	1q22-q25	2008-07-31	2008-07-31		ENSG00000007908	ENSG00000007908		"""CD molecules"""	10718	protein-coding gene	gene with protein product		131210	"""endothelial adhesion molecule 1"""	ELAM1, ELAM		1375831	Standard	NM_000450		Approved	ESEL, CD62E	uc001ggm.4	P16581	OTTHUMG00000034851	ENST00000333360.7:c.1432C>T	1.37:g.169696916G>A	ENSP00000331736:p.Gln478*		A2RRD6|P16111	Nonsense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_C-type_lectin,pfam_EGF-like_dom,pfam_EGF_extracell,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_C-type_lectin,smart_EGF-like,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Sushi_SCR_CCP,prints_Selectin_superfamily	p.Q478*	ENST00000333360.7	37	c.1432	CCDS1283.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.108401	0.97291	.	.	ENSG00000007908	ENST00000367781;ENST00000367780;ENST00000333360;ENST00000367775;ENST00000367776	.	.	.	5.9	5.9	0.94986	.	0.190115	0.26196	N	0.025761	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-7.736	12.1916	0.54275	0.0777:0.0:0.9223:0.0	.	.	.	.	X	415;353;478;353;415	.	ENSP00000331736:Q478X	Q	-	1	0	SELE	167963540	0.954000	0.32549	0.966000	0.40874	0.980000	0.70556	3.413000	0.52686	2.788000	0.95919	0.650000	0.86243	CAG	SELE	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,smart_EGF-like,pfscan_Sushi_SCR_CCP	ENSG00000007908		0.433	SELE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SELE	HGNC	protein_coding	OTTHUMT00000084333.1	27	0.00	0	G	NM_000450		169696916	169696916	-1	no_errors	ENST00000333360	ensembl	human	known	69_37n	nonsense	28	22.22	8	SNP	0.975	A
SEPT7	989	genome.wustl.edu	37	7	35942763	35942763	+	Silent	SNP	C	C	T	rs148964270	byFrequency	TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr7:35942763C>T	ENST00000435235.1	+	12	1485	c.1053C>T	c.(1051-1053)ttC>ttT	p.F351F	SEPT7_ENST00000494488.2_3'UTR|SEPT7_ENST00000399034.2_Silent_p.F405F|SEPT7_ENST00000350320.6_Silent_p.F403F|SEPT7_ENST00000432293.2_Silent_p.F55F|SEPT7_ENST00000399035.3_Silent_p.F403F			Q16181	SEPT7_HUMAN	septin 7	404					cilium morphogenesis (GO:0060271)|cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein heterooligomerization (GO:0051291)|regulation of embryonic cell shape (GO:0016476)	actin cytoskeleton (GO:0015629)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|septin complex (GO:0031105)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)	14						GTCGTCAGTTCGAGGATGAGA	0.378													.|||	91	0.0181709	0.0023	0.072	5008	,	,		18818	0.0298		0.003	False		,,,				2504	0.0051					dbGAP											0													67.0	63.0	64.0					7																	35942763		1858	4098	5956	-	-	-	SO:0001819	synonymous_variant	0			S72008	CCDS75582.1	7p14.2	2013-01-21	2005-01-11	2005-01-12	ENSG00000122545	ENSG00000122545		"""Septins"""	1717	protein-coding gene	gene with protein product		603151	"""CDC10 cell division cycle 10 homolog (S. cerevisiae)"""	CDC10		8037772	Standard	NM_001788		Approved	CDC3, SEPT7A	uc011kau.2	Q16181	OTTHUMG00000155063	ENST00000435235.1:c.1053C>T	7.37:g.35942763C>T			Q52M76|Q6NX50	Silent	SNP	pfam_Cell_div_GTP-bd,pirsf_Septin,prints_Septin7	p.F405	ENST00000435235.1	37	c.1215		7																																																																																			SEPT7	-	pirsf_Septin	ENSG00000122545		0.378	SEPT7-001	NOVEL	basic	protein_coding	SEPT7	HGNC	protein_coding	OTTHUMT00000338285.1	32	0.00	0	C	NM_001788		35942763	35942763	+1	no_errors	ENST00000399034	ensembl	human	known	69_37n	silent	15	42.31	11	SNP	1.000	T
SLC20A2	6575	genome.wustl.edu	37	8	42294814	42294814	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr8:42294814C>T	ENST00000342228.3	-	8	1585	c.1216G>A	c.(1216-1218)Gac>Aac	p.D406N	SLC20A2_ENST00000520179.1_Missense_Mutation_p.D406N|SLC20A2_ENST00000520262.1_Missense_Mutation_p.D406N	NM_006749.4	NP_006740.1	Q08357	S20A2_HUMAN	solute carrier family 20 (phosphate transporter), member 2	406					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|sodium:phosphate symporter activity (GO:0005436)|virus receptor activity (GO:0001618)			breast(1)|endometrium(6)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|stomach(1)	26	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;5.73e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00419)|Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)			GCCGATGAGTCCGCAGCTCGA	0.597																																						dbGAP											0													75.0	70.0	72.0					8																	42294814		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6132.1	8p11.21	2013-05-22			ENSG00000168575	ENSG00000168575		"""Solute carriers"""	10947	protein-coding gene	gene with protein product		158378		MLVAR, GLVR2		7745689, 16790504	Standard	NM_001257180		Approved	PiT-2, Glvr-2	uc010lxm.4	Q08357	OTTHUMG00000164169	ENST00000342228.3:c.1216G>A	8.37:g.42294814C>T	ENSP00000340465:p.Asp406Asn			Missense_Mutation	SNP	pfam_Phos_transporter	p.D406N	ENST00000342228.3	37	c.1216	CCDS6132.1	8	.	.	.	.	.	.	.	.	.	.	C	10.46	1.356011	0.24598	.	.	ENSG00000168575	ENST00000342228;ENST00000520262;ENST00000520179	D;D;D	0.90385	-2.66;-2.66;-2.66	5.74	4.86	0.63082	.	0.251129	0.46145	D	0.000310	D	0.84929	0.5581	N	0.25201	0.72	0.09310	N	1	B	0.24317	0.101	B	0.35353	0.201	T	0.70791	-0.4776	10	0.16420	T	0.52	-17.5577	12.5714	0.56339	0.0:0.9193:0.0:0.0807	.	406	Q08357	S20A2_HUMAN	N	406	ENSP00000340465:D406N;ENSP00000429754:D406N;ENSP00000429712:D406N	ENSP00000340465:D406N	D	-	1	0	SLC20A2	42413971	0.917000	0.31117	0.023000	0.16930	0.018000	0.09664	2.209000	0.42806	1.431000	0.47355	0.655000	0.94253	GAC	SLC20A2	-	pfam_Phos_transporter	ENSG00000168575		0.597	SLC20A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC20A2	HGNC	protein_coding	OTTHUMT00000377578.1	88	0.00	0	C			42294814	42294814	-1	no_errors	ENST00000342228	ensembl	human	known	69_37n	missense	77	10.47	9	SNP	0.046	T
SLC5A6	8884	genome.wustl.edu	37	2	27428898	27428898	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr2:27428898G>T	ENST00000310574.3	-	6	1048	c.575C>A	c.(574-576)gCt>gAt	p.A192D	SLC5A6_ENST00000408041.1_Missense_Mutation_p.A192D|SLC5A6_ENST00000461319.1_5'Flank	NM_021095.2	NP_066918.2	Q9Y289	SC5A6_HUMAN	solute carrier family 5 (sodium/multivitamin and iodide cotransporter), member 6	192					biotin metabolic process (GO:0006768)|biotin transport (GO:0015878)|pantothenate metabolic process (GO:0015939)|pantothenate transmembrane transport (GO:0015887)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)			endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(3)|prostate(1)|skin(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Biotin(DB00121)|gabapentin enacarbil(DB08872)|Lipoic Acid(DB00166)	ACTTACCAGAGCTGTATAGAC	0.498																																						dbGAP											0													91.0	79.0	83.0					2																	27428898		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF069307	CCDS1740.1	2p23	2013-07-19	2013-07-19		ENSG00000138074	ENSG00000138074		"""Solute carriers"""	11041	protein-coding gene	gene with protein product		604024	"""solute carrier family 5 (sodium-dependent vitamin transporter), member 6"""			9516450, 10329687	Standard	NM_021095		Approved	SMVT	uc002rjd.3	Q9Y289	OTTHUMG00000097075	ENST00000310574.3:c.575C>A	2.37:g.27428898G>T	ENSP00000310208:p.Ala192Asp		B2RB85|D6W549|Q969Y5	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.A192D	ENST00000310574.3	37	c.575	CCDS1740.1	2	.	.	.	.	.	.	.	.	.	.	G	14.82	2.649414	0.47362	.	.	ENSG00000138074	ENST00000310574;ENST00000408041;ENST00000412471	D;D;D	0.88509	-2.39;-2.39;-2.39	5.8	4.88	0.63580	Sodium/solute symporter, conserved site (1);	0.177010	0.49916	D	0.000139	D	0.89774	0.6812	M	0.73598	2.24	0.52501	D	0.999953	B	0.33940	0.433	B	0.37943	0.261	D	0.90554	0.4511	10	0.87932	D	0	.	16.0939	0.81109	0.0:0.1459:0.8541:0.0	.	192	Q9Y289	SC5A6_HUMAN	D	192	ENSP00000310208:A192D;ENSP00000384853:A192D;ENSP00000403851:A192D	ENSP00000310208:A192D	A	-	2	0	SLC5A6	27282402	1.000000	0.71417	0.995000	0.50966	0.137000	0.21094	7.253000	0.78320	2.735000	0.93741	0.655000	0.94253	GCT	SLC5A6	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000138074		0.498	SLC5A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A6	HGNC	protein_coding	OTTHUMT00000214194.1	29	0.00	0	G	NM_021095		27428898	27428898	-1	no_errors	ENST00000310574	ensembl	human	known	69_37n	missense	33	13.16	5	SNP	0.989	T
SLC6A16	28968	genome.wustl.edu	37	19	49793936	49793936	+	Silent	SNP	G	G	A	rs17853338		TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr19:49793936G>A	ENST00000335875.4	-	11	2108	c.1867C>T	c.(1867-1869)Cta>Tta	p.L623L	SLC6A16_ENST00000454748.3_Silent_p.L623L	NM_014037.2	NP_054756.2	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	623					neurotransmitter transport (GO:0006836)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		AAGATGATTAGCAGCACAACT	0.552																																						dbGAP											0													48.0	48.0	48.0					19																	49793936		1989	4170	6159	-	-	-	SO:0001819	synonymous_variant	0			AF265578	CCDS42590.1	19q13.33	2013-05-22			ENSG00000063127	ENSG00000063127		"""Solute carriers"""	13622	protein-coding gene	gene with protein product	"""NTT5 protein"""	607972	"""solute carrier family 6 (neurotransmitter transporter), member 16"""			10471414, 11112352	Standard	XM_005258820		Approved	NTT5	uc002pmz.3	Q9GZN6		ENST00000335875.4:c.1867C>T	19.37:g.49793936G>A			Q8IYV4|Q9Y5I9	Silent	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	p.L623	ENST00000335875.4	37	c.1867	CCDS42590.1	19																																																																																			SLC6A16	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	ENSG00000063127		0.552	SLC6A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A16	HGNC	protein_coding	OTTHUMT00000465503.2	17	0.00	0	G	NM_014037		49793936	49793936	-1	no_errors	ENST00000335875	ensembl	human	known	69_37n	silent	17	37.04	10	SNP	0.960	A
SLC6A16	28968	genome.wustl.edu	37	19	49796595	49796595	+	Missense_Mutation	SNP	G	G	C	rs544619102		TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr19:49796595G>C	ENST00000335875.4	-	10	1904	c.1663C>G	c.(1663-1665)Cga>Gga	p.R555G	SLC6A16_ENST00000454748.3_Missense_Mutation_p.R555G	NM_014037.2	NP_054756.2	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	555					neurotransmitter transport (GO:0006836)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		CCTGAAGGTCGAGTGAAGAAG	0.502																																						dbGAP											0													77.0	84.0	82.0					19																	49796595		2025	4185	6210	-	-	-	SO:0001583	missense	0			AF265578	CCDS42590.1	19q13.33	2013-05-22			ENSG00000063127	ENSG00000063127		"""Solute carriers"""	13622	protein-coding gene	gene with protein product	"""NTT5 protein"""	607972	"""solute carrier family 6 (neurotransmitter transporter), member 16"""			10471414, 11112352	Standard	XM_005258820		Approved	NTT5	uc002pmz.3	Q9GZN6		ENST00000335875.4:c.1663C>G	19.37:g.49796595G>C	ENSP00000338627:p.Arg555Gly		Q8IYV4|Q9Y5I9	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	p.R555G	ENST00000335875.4	37	c.1663	CCDS42590.1	19	.	.	.	.	.	.	.	.	.	.	G	14.88	2.668661	0.47677	.	.	ENSG00000063127	ENST00000335875;ENST00000454748	T;T	0.74209	-0.82;-0.82	4.3	2.12	0.27331	.	0.620591	0.16820	N	0.198188	T	0.79902	0.4526	M	0.65975	2.015	0.09310	N	1	P;P	0.47350	0.894;0.894	P;P	0.54174	0.744;0.638	T	0.71427	-0.4596	10	0.59425	D	0.04	.	12.7683	0.57405	0.0:0.3151:0.6849:0.0	.	555;555	Q8IYV4;Q9GZN6	.;S6A16_HUMAN	G	555	ENSP00000338627:R555G;ENSP00000404022:R555G	ENSP00000338627:R555G	R	-	1	2	SLC6A16	54488407	0.494000	0.26043	0.000000	0.03702	0.000000	0.00434	3.860000	0.55995	0.735000	0.32537	-0.438000	0.05819	CGA	SLC6A16	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000063127		0.502	SLC6A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A16	HGNC	protein_coding	OTTHUMT00000465503.2	37	0.00	0	G	NM_014037		49796595	49796595	-1	no_errors	ENST00000335875	ensembl	human	known	69_37n	missense	11	26.67	4	SNP	0.007	C
SLC6A16	28968	genome.wustl.edu	37	19	49796601	49796601	+	Missense_Mutation	SNP	A	A	G			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr19:49796601A>G	ENST00000335875.4	-	10	1898	c.1657T>C	c.(1657-1659)Ttc>Ctc	p.F553L	SLC6A16_ENST00000454748.3_Missense_Mutation_p.F553L	NM_014037.2	NP_054756.2	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	553					neurotransmitter transport (GO:0006836)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		GGTCGAGTGAAGAAGAGGCCG	0.488																																						dbGAP											0													76.0	84.0	82.0					19																	49796601		2031	4187	6218	-	-	-	SO:0001583	missense	0			AF265578	CCDS42590.1	19q13.33	2013-05-22			ENSG00000063127	ENSG00000063127		"""Solute carriers"""	13622	protein-coding gene	gene with protein product	"""NTT5 protein"""	607972	"""solute carrier family 6 (neurotransmitter transporter), member 16"""			10471414, 11112352	Standard	XM_005258820		Approved	NTT5	uc002pmz.3	Q9GZN6		ENST00000335875.4:c.1657T>C	19.37:g.49796601A>G	ENSP00000338627:p.Phe553Leu		Q8IYV4|Q9Y5I9	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	p.F553L	ENST00000335875.4	37	c.1657	CCDS42590.1	19	.	.	.	.	.	.	.	.	.	.	A	16.68	3.189592	0.57909	.	.	ENSG00000063127	ENST00000335875;ENST00000454748	T;T	0.72615	-0.67;-0.67	4.3	4.3	0.51218	.	0.105453	0.64402	D	0.000004	T	0.80363	0.4609	M	0.62088	1.915	0.50813	D	0.99989	D;D	0.69078	0.997;0.997	D;D	0.73708	0.963;0.981	T	0.82301	-0.0525	10	0.87932	D	0	.	12.0599	0.53557	1.0:0.0:0.0:0.0	.	553;553	Q8IYV4;Q9GZN6	.;S6A16_HUMAN	L	553	ENSP00000338627:F553L;ENSP00000404022:F553L	ENSP00000338627:F553L	F	-	1	0	SLC6A16	54488413	1.000000	0.71417	0.992000	0.48379	0.004000	0.04260	7.242000	0.78210	2.169000	0.68431	0.418000	0.28097	TTC	SLC6A16	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000063127		0.488	SLC6A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A16	HGNC	protein_coding	OTTHUMT00000465503.2	38	0.00	0	A	NM_014037		49796601	49796601	-1	no_errors	ENST00000335875	ensembl	human	known	69_37n	missense	11	26.67	4	SNP	1.000	G
SLC6A16	28968	genome.wustl.edu	37	19	49812289	49812289	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr19:49812289G>A	ENST00000335875.4	-	7	1314	c.1073C>T	c.(1072-1074)gCc>gTc	p.A358V	MIR4324_ENST00000584846.1_RNA|SLC6A16_ENST00000454748.3_Missense_Mutation_p.A358V	NM_014037.2	NP_054756.2	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	358					neurotransmitter transport (GO:0006836)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		GGCTAAGGAGGCAACGGAGCC	0.468																																						dbGAP											0													157.0	150.0	153.0					19																	49812289		2064	4181	6245	-	-	-	SO:0001583	missense	0			AF265578	CCDS42590.1	19q13.33	2013-05-22			ENSG00000063127	ENSG00000063127		"""Solute carriers"""	13622	protein-coding gene	gene with protein product	"""NTT5 protein"""	607972	"""solute carrier family 6 (neurotransmitter transporter), member 16"""			10471414, 11112352	Standard	XM_005258820		Approved	NTT5	uc002pmz.3	Q9GZN6		ENST00000335875.4:c.1073C>T	19.37:g.49812289G>A	ENSP00000338627:p.Ala358Val		Q8IYV4|Q9Y5I9	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	p.A358V	ENST00000335875.4	37	c.1073	CCDS42590.1	19	.	.	.	.	.	.	.	.	.	.	G	10.02	1.235491	0.22626	.	.	ENSG00000063127	ENST00000335875;ENST00000454748	T;T	0.71934	-0.61;-0.61	4.38	-2.36	0.06663	.	0.700908	0.14059	N	0.344195	T	0.30166	0.0756	N	0.00385	-1.57	0.09310	N	1	B;B	0.18310	0.027;0.027	B;B	0.17979	0.02;0.02	T	0.36065	-0.9763	10	0.41790	T	0.15	.	5.8327	0.18588	0.5412:0.1393:0.3195:0.0	.	358;358	Q8IYV4;Q9GZN6	.;S6A16_HUMAN	V	358	ENSP00000338627:A358V;ENSP00000404022:A358V	ENSP00000338627:A358V	A	-	2	0	SLC6A16	54504101	0.960000	0.32886	0.000000	0.03702	0.001000	0.01503	2.646000	0.46630	-0.327000	0.08551	0.561000	0.74099	GCC	SLC6A16	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000063127		0.468	SLC6A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A16	HGNC	protein_coding	OTTHUMT00000465503.2	24	0.00	0	G	NM_014037		49812289	49812289	-1	no_errors	ENST00000335875	ensembl	human	known	69_37n	missense	11	25.00	4	SNP	0.001	A
SLC6A16	28968	genome.wustl.edu	37	19	49812932	49812932	+	Silent	SNP	G	G	A	rs372514145		TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr19:49812932G>A	ENST00000335875.4	-	5	1093	c.852C>T	c.(850-852)atC>atT	p.I284I	MIR4324_ENST00000584846.1_RNA|SLC6A16_ENST00000454748.3_Silent_p.I284I	NM_014037.2	NP_054756.2	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	284					neurotransmitter transport (GO:0006836)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		TGAGCCCATTGATCATGAAAG	0.483																																						dbGAP											0													74.0	73.0	74.0					19																	49812932		1971	4147	6118	-	-	-	SO:0001819	synonymous_variant	0			AF265578	CCDS42590.1	19q13.33	2013-05-22			ENSG00000063127	ENSG00000063127		"""Solute carriers"""	13622	protein-coding gene	gene with protein product	"""NTT5 protein"""	607972	"""solute carrier family 6 (neurotransmitter transporter), member 16"""			10471414, 11112352	Standard	XM_005258820		Approved	NTT5	uc002pmz.3	Q9GZN6		ENST00000335875.4:c.852C>T	19.37:g.49812932G>A			Q8IYV4|Q9Y5I9	Silent	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	p.I284	ENST00000335875.4	37	c.852	CCDS42590.1	19																																																																																			SLC6A16	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000063127		0.483	SLC6A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A16	HGNC	protein_coding	OTTHUMT00000465503.2	36	0.00	0	G	NM_014037		49812932	49812932	-1	no_errors	ENST00000335875	ensembl	human	known	69_37n	silent	17	22.73	5	SNP	0.597	A
SLC6A16	28968	genome.wustl.edu	37	19	49813324	49813324	+	Missense_Mutation	SNP	G	G	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr19:49813324G>T	ENST00000335875.4	-	4	914	c.673C>A	c.(673-675)Ccc>Acc	p.P225T	MIR4324_ENST00000584846.1_RNA|SLC6A16_ENST00000454748.3_Missense_Mutation_p.P225T	NM_014037.2	NP_054756.2	Q9GZN6	S6A16_HUMAN	solute carrier family 6, member 16	225					neurotransmitter transport (GO:0006836)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00099)|GBM - Glioblastoma multiforme(486;0.0336)		ATCGTTAAGGGACATTTCTCC	0.463																																						dbGAP											0													96.0	86.0	89.0					19																	49813324		1915	4129	6044	-	-	-	SO:0001583	missense	0			AF265578	CCDS42590.1	19q13.33	2013-05-22			ENSG00000063127	ENSG00000063127		"""Solute carriers"""	13622	protein-coding gene	gene with protein product	"""NTT5 protein"""	607972	"""solute carrier family 6 (neurotransmitter transporter), member 16"""			10471414, 11112352	Standard	XM_005258820		Approved	NTT5	uc002pmz.3	Q9GZN6		ENST00000335875.4:c.673C>A	19.37:g.49813324G>T	ENSP00000338627:p.Pro225Thr		Q8IYV4|Q9Y5I9	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	p.P225T	ENST00000335875.4	37	c.673	CCDS42590.1	19	.	.	.	.	.	.	.	.	.	.	G	15.34	2.804507	0.50315	.	.	ENSG00000063127	ENST00000335875;ENST00000454748	T;T	0.74526	-0.85;-0.85	4.44	4.44	0.53790	.	0.000000	0.45867	D	0.000325	D	0.84347	0.5452	M	0.69185	2.1	0.47659	D	0.999487	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.85779	0.1360	10	0.87932	D	0	.	15.3728	0.74581	0.0:0.0:1.0:0.0	.	225;225	Q8IYV4;Q9GZN6	.;S6A16_HUMAN	T	225	ENSP00000338627:P225T;ENSP00000404022:P225T	ENSP00000338627:P225T	P	-	1	0	SLC6A16	54505136	1.000000	0.71417	0.959000	0.39883	0.003000	0.03518	8.391000	0.90177	2.740000	0.93945	0.655000	0.94253	CCC	SLC6A16	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000063127		0.463	SLC6A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A16	HGNC	protein_coding	OTTHUMT00000465503.2	45	0.00	0	G	NM_014037		49813324	49813324	-1	no_errors	ENST00000335875	ensembl	human	known	69_37n	missense	27	30.77	12	SNP	1.000	T
SLCO1A2	6579	genome.wustl.edu	37	12	21445246	21445246	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr12:21445246G>A	ENST00000307378.6	-	13	2182	c.1462C>T	c.(1462-1464)Caa>Taa	p.Q488*	SLCO1A2_ENST00000537524.1_Nonsense_Mutation_p.Q356*|SLCO1A2_ENST00000452078.1_Nonsense_Mutation_p.Q488*|SLCO1A2_ENST00000390670.3_Nonsense_Mutation_p.Q486*|SLCO1A2_ENST00000458504.1_Nonsense_Mutation_p.Q356*	NM_134431.3	NP_602307.1	P46721	SO1A2_HUMAN	solute carrier organic anion transporter family, member 1A2	488	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)	p.Q488E(1)		breast(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(6)|upper_aerodigestive_tract(1)	48					Aminohippurate(DB00345)|Atorvastatin(DB01076)|Bumetanide(DB00887)|Chlorambucil(DB00291)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Enalapril(DB00584)|Erythromycin(DB00199)|Estradiol(DB00783)|Estriol(DB04573)|Estrone(DB00655)|Fexofenadine(DB00950)|Glyburide(DB01016)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Indinavir(DB00224)|Indomethacin(DB00328)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Mirabegron(DB08893)|Naloxone(DB01183)|Naproxen(DB00788)|Nelfinavir(DB00220)|Ouabain(DB01092)|Pravastatin(DB00175)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rocuronium(DB00728)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Simvastatin(DB00641)|Spironolactone(DB00421)|Sumatriptan(DB00669)|Tauroursodeoxycholic acid(DB08834)|Testosterone(DB00624)|Tolbutamide(DB01124)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)	CCTGATGTTTGAATACAGCTG	0.383																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											82.0	81.0	81.0					12																	21445246		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS8686.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000084453	ENSG00000084453		"""Solute carriers"""	10956	protein-coding gene	gene with protein product		602883	"""solute carrier family 21 (organic anion transporter), member 3"""	SLC21A3		9007731	Standard	NM_134431		Approved	OATP, OATP1A2, OATP-A	uc001rer.3	P46721	OTTHUMG00000156259	ENST00000307378.6:c.1462C>T	12.37:g.21445246G>A	ENSP00000305974:p.Gln488*		Q9UGP7|Q9UL38	Nonsense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.Q488*	ENST00000307378.6	37	c.1462	CCDS8686.1	12	.	.	.	.	.	.	.	.	.	.	G	24.4	4.527062	0.85706	.	.	ENSG00000084453	ENST00000307378;ENST00000452078;ENST00000458504;ENST00000537524;ENST00000390670	.	.	.	5.09	1.97	0.26223	.	1.624010	0.02998	N	0.147698	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	.	2.944	0.05840	0.0849:0.2878:0.3351:0.2921	.	.	.	.	X	488;488;356;356;486	.	ENSP00000305974:Q488X	Q	-	1	0	SLCO1A2	21336513	0.043000	0.20138	0.595000	0.28798	0.179000	0.23085	0.551000	0.23361	0.711000	0.32018	-0.311000	0.09066	CAA	SLCO1A2	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000084453		0.383	SLCO1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1A2	HGNC	protein_coding	OTTHUMT00000343648.3	35	0.00	0	G	NM_021094		21445246	21445246	-1	no_errors	ENST00000307378	ensembl	human	known	69_37n	nonsense	10	41.18	7	SNP	0.155	A
SNAP29	9342	genome.wustl.edu	37	22	21237758	21237758	+	Splice_Site	SNP	G	G	A	rs5761153		TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr22:21237758G>A	ENST00000215730.7	+	4	648		c.e4-1			NM_004782.3	NP_004773.1	O95721	SNP29_HUMAN	synaptosomal-associated protein, 29kDa						autophagic vacuole fusion (GO:0000046)|exocytosis (GO:0006887)|membrane fusion (GO:0061025)|protein transport (GO:0015031)|vesicle targeting (GO:0006903)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|synapse (GO:0045202)	SNAP receptor activity (GO:0005484)			breast(1)|endometrium(1)|large_intestine(5)|lung(1)|upper_aerodigestive_tract(1)	9	all_cancers(11;2.77e-25)|all_epithelial(7;8.92e-24)|Lung NSC(8;1.49e-15)|all_lung(8;2.54e-14)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000592)|Lung(15;0.0117)			TCTAAACTTAGACCCTGTCCC	0.483																																						dbGAP											0													158.0	149.0	152.0					22																	21237758		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF115436	CCDS13784.1	22q11.21	2008-06-10	2002-08-29		ENSG00000099940	ENSG00000099940			11133	protein-coding gene	gene with protein product	"""soluble 29 kDa NSF attachment protein"""	604202	"""synaptosomal-associated protein, 29kD"""			9852078, 10591208	Standard	NM_004782		Approved	SNAP-29, CEDNIK	uc011ahw.2	O95721	OTTHUMG00000150765	ENST00000215730.7:c.521-1G>A	22.37:g.21237758G>A				Splice_Site	SNP	-	e4-1	ENST00000215730.7	37	c.521-1	CCDS13784.1	22	.	.	.	.	.	.	.	.	.	.	G	12.10	1.836961	0.32421	.	.	ENSG00000099940	ENST00000215730;ENST00000439214	.	.	.	4.38	3.36	0.38483	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.7491	0.40464	0.0984:0.0:0.9016:0.0	rs5761153	.	.	.	.	-1	.	.	.	+	.	.	SNAP29	19567758	1.000000	0.71417	0.151000	0.22473	0.010000	0.07245	5.957000	0.70323	1.062000	0.40625	0.591000	0.81541	.	SNAP29	-	-	ENSG00000099940		0.483	SNAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAP29	HGNC	protein_coding	OTTHUMT00000320000.4	57	0.00	0	G	NM_004782	Intron	21237758	21237758	+1	no_errors	ENST00000215730	ensembl	human	known	69_37n	splice_site	40	13.04	6	SNP	0.821	A
SPIRE2	84501	genome.wustl.edu	37	16	89924757	89924757	+	Silent	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr16:89924757C>T	ENST00000378247.3	+	8	1157	c.1114C>T	c.(1114-1116)Ctg>Ttg	p.L372L	SPIRE2_ENST00000393062.2_Silent_p.L372L	NM_032451.1	NP_115827.1	Q8WWL2	SPIR2_HUMAN	spire-type actin nucleation factor 2	372					actin cytoskeleton organization (GO:0030036)|cleavage furrow formation (GO:0036089)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|intracellular transport (GO:0046907)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasmic vesicle membrane (GO:0030659)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)		p.L372V(1)		central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(10)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)		GTTTGGCTCTCTGCCCTGCAT	0.657																																						dbGAP											1	Substitution - Missense(1)	urinary_tract(1)											101.0	108.0	106.0					16																	89924757		2198	4299	6497	-	-	-	SO:0001819	synonymous_variant	0			AL834408	CCDS32516.1	16q24	2013-08-27	2013-08-27			ENSG00000204991			30623	protein-coding gene	gene with protein product		609217	"""spire homolog 2 (Drosophila)"", ""spire family actin nucleation factor 2"""			11347906	Standard	NM_032451		Approved	spir-2, KIAA1832	uc002foz.1	Q8WWL2		ENST00000378247.3:c.1114C>T	16.37:g.89924757C>T			A4QPB1|Q2TA98|Q6P433|Q8ND47|Q96JJ5	Silent	SNP	superfamily_Znf_FYVE_PHD,smart_KIND	p.L372	ENST00000378247.3	37	c.1114	CCDS32516.1	16																																																																																			SPIRE2	-	NULL	ENSG00000204991		0.657	SPIRE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPIRE2	HGNC	protein_coding	OTTHUMT00000421843.1	60	0.00	0	C	XM_047462		89924757	89924757	+1	no_errors	ENST00000378247	ensembl	human	known	69_37n	silent	14	61.11	22	SNP	1.000	T
SQRDL	58472	genome.wustl.edu	37	15	45965918	45965918	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr15:45965918C>G	ENST00000260324.7	+	5	959	c.573C>G	c.(571-573)atC>atG	p.I191M	SQRDL_ENST00000568606.1_Missense_Mutation_p.I191M|RP11-96O20.4_ENST00000564080.1_Missense_Mutation_p.I191M	NM_021199.3	NP_067022.1	Q9Y6N5	SQRD_HUMAN	sulfide quinone reductase-like (yeast)	191					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	mitochondrial inner membrane (GO:0005743)	sulfide:quinone oxidoreductase activity (GO:0070224)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	11		Lung NSC(122;0.000117)|all_lung(180;0.000737)|Melanoma(134;0.0417)		all cancers(107;5.89e-18)|GBM - Glioblastoma multiforme(94;1.21e-06)|COAD - Colon adenocarcinoma(120;0.17)|Colorectal(133;0.188)		GCAATGCCATCTTCACCTTCC	0.463																																						dbGAP											0													135.0	121.0	126.0					15																	45965918		2198	4297	6495	-	-	-	SO:0001583	missense	0			AF042284	CCDS10127.1	15q21.1	2010-08-05			ENSG00000137767	ENSG00000137767			20390	protein-coding gene	gene with protein product						10810093, 10224084	Standard	NM_021199		Approved	CGI-44	uc001zvu.4	Q9Y6N5	OTTHUMG00000131476	ENST00000260324.7:c.573C>G	15.37:g.45965918C>G	ENSP00000260324:p.Ile191Met		Q9UQM8	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD	p.I191M	ENST00000260324.7	37	c.573	CCDS10127.1	15	.	.	.	.	.	.	.	.	.	.	C	16.59	3.166924	0.57476	.	.	ENSG00000137767	ENST00000260324	T	0.59906	0.23	5.62	2.66	0.31614	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.285549	0.40728	N	0.001036	T	0.71660	0.3366	M	0.92784	3.345	0.42354	D	0.992386	P	0.37101	0.582	P	0.49922	0.626	T	0.69903	-0.5019	10	0.87932	D	0	.	4.5617	0.12163	0.1635:0.5916:0.0:0.245	.	191	Q9Y6N5	SQRD_HUMAN	M	191	ENSP00000260324:I191M	ENSP00000260324:I191M	I	+	3	3	SQRDL	43753210	0.985000	0.35326	0.995000	0.50966	0.877000	0.50540	0.246000	0.18160	0.286000	0.22352	0.563000	0.77884	ATC	SQRDL	-	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD	ENSG00000137767		0.463	SQRDL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SQRDL	HGNC	protein_coding	OTTHUMT00000254319.2	51	0.00	0	C			45965918	45965918	+1	no_errors	ENST00000260324	ensembl	human	known	69_37n	missense	24	27.27	9	SNP	0.999	G
SRP19	6728	genome.wustl.edu	37	5	112196928	112196928	+	De_novo_Start_OutOfFrame	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr5:112196928G>A	ENST00000505459.1	+	0	10				CTC-487M23.8_ENST00000506997.1_5'Flank|SRP19_ENST00000515463.1_5'Flank|SRP19_ENST00000282999.3_5'Flank|CTC-554D6.1_ENST00000520401.1_Intron	NM_001204193.1|NM_003135.2	NP_001191122.1|NP_003126.1	P09132	SRP19_HUMAN	signal recognition particle 19kDa						cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|large_intestine(1)	3		all_cancers(142;0.00328)|all_epithelial(76;6.39e-05)|Prostate(80;0.00174)|Colorectal(10;0.00372)|Ovarian(225;0.156)		Epithelial(69;1.7e-09)|OV - Ovarian serous cystadenocarcinoma(64;1.17e-08)|all cancers(49;3.96e-07)|Colorectal(14;0.0056)|COAD - Colon adenocarcinoma(37;0.0104)		ACAAACAGGCGATGAGAAATC	0.577																																						dbGAP											0																																										-	-	-			0				CCDS4108.1, CCDS56375.1, CCDS56376.1, CCDS75286.1	5q21-q22	2008-07-18	2002-08-29		ENSG00000153037	ENSG00000153037			11300	protein-coding gene	gene with protein product		182175	"""signal recognition particle 19kD"""			2460823	Standard	NM_003135		Approved		uc011cvu.2	P09132	OTTHUMG00000128805	ENST00000505459.1:c.-146G>A	5.37:g.112196928G>A			B2R4E9|D6RCQ5|Q05D77|Q96FG6	RNA	SNP	-	NULL	ENST00000505459.1	37	NULL	CCDS4108.1	5																																																																																			SRP19	-	-	ENSG00000153037		0.577	SRP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRP19	HGNC	protein_coding	OTTHUMT00000250737.3	47	0.00	0	G	NM_003135		112196928	112196928	+1	no_errors	ENST00000503445	ensembl	human	known	69_37n	rna	20	39.39	13	SNP	0.000	A
SRRM2	23524	genome.wustl.edu	37	16	2815000	2815000	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr16:2815000C>T	ENST00000301740.8	+	11	5020	c.4471C>T	c.(4471-4473)Cag>Tag	p.Q1491*		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1491	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						AGCTTTGCCTCAGACTCCTAG	0.512																																						dbGAP											0													115.0	118.0	117.0					16																	2815000		2198	4300	6498	-	-	-	SO:0001587	stop_gained	0			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.4471C>T	16.37:g.2815000C>T	ENSP00000301740:p.Gln1491*		A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Nonsense_Mutation	SNP	pfam_mRNA_splic_Cwf21	p.Q1491*	ENST00000301740.8	37	c.4471	CCDS32373.1	16	.	.	.	.	.	.	.	.	.	.	C	40	8.236083	0.98719	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	.	.	.	6.06	3.94	0.45596	.	0.213983	0.32593	N	0.005887	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	-7.0823	16.2112	0.82164	0.0:0.7329:0.2671:0.0	.	.	.	.	X	1491;1491;743	.	ENSP00000301740:Q1491X	Q	+	1	0	SRRM2	2755001	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.805000	0.38883	1.536000	0.49237	0.655000	0.94253	CAG	SRRM2	-	NULL	ENSG00000167978		0.512	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	HGNC	protein_coding	OTTHUMT00000436411.1	26	0.00	0	C			2815000	2815000	+1	no_errors	ENST00000301740	ensembl	human	known	69_37n	nonsense	31	22.50	9	SNP	1.000	T
SRRM2	23524	genome.wustl.edu	37	16	2816501	2816501	+	Missense_Mutation	SNP	G	G	A	rs549557408		TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr16:2816501G>A	ENST00000301740.8	+	11	6521	c.5972G>A	c.(5971-5973)cGa>cAa	p.R1991Q		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1991	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						CCGGTCACCCGAAGGAGATCT	0.567													G|||	1	0.000199681	0.0	0.0	5008	,	,		17653	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													68.0	71.0	70.0					16																	2816501		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.5972G>A	16.37:g.2816501G>A	ENSP00000301740:p.Arg1991Gln		A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	pfam_mRNA_splic_Cwf21	p.R1991Q	ENST00000301740.8	37	c.5972	CCDS32373.1	16	.	.	.	.	.	.	.	.	.	.	G	11.03	1.519239	0.27211	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.26067	1.76	5.26	5.26	0.73747	.	0.000000	0.56097	D	0.000029	T	0.28599	0.0708	N	0.08118	0	0.21579	N	0.999634	D	0.76494	0.999	D	0.65010	0.931	T	0.27806	-1.0063	10	0.27785	T	0.31	-6.9001	16.354	0.83228	0.0:0.0:1.0:0.0	.	1991	Q9UQ35	SRRM2_HUMAN	Q	1991;1991;1243	ENSP00000301740:R1991Q	ENSP00000301740:R1991Q	R	+	2	0	SRRM2	2756502	0.174000	0.23070	0.647000	0.29507	0.778000	0.44026	3.451000	0.52964	2.466000	0.83321	0.650000	0.86243	CGA	SRRM2	-	NULL	ENSG00000167978		0.567	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	HGNC	protein_coding	OTTHUMT00000436411.1	17	0.00	0	G			2816501	2816501	+1	no_errors	ENST00000301740	ensembl	human	known	69_37n	missense	17	43.33	13	SNP	0.404	A
SRXN1	140809	genome.wustl.edu	37	20	629441	629441	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr20:629441C>T	ENST00000381962.3	-	2	515	c.331G>A	c.(331-333)Gag>Aag	p.E111K	RP5-850E9.3_ENST00000488788.2_3'UTR	NM_080725.1	NP_542763.1	Q9BYN0	SRXN1_HUMAN	sulfiredoxin 1	111					response to oxidative stress (GO:0006979)	cytosol (GO:0005829)	ATP binding (GO:0005524)|oxidoreductase activity, acting on a sulfur group of donors (GO:0016667)|sulfiredoxin activity (GO:0032542)	p.E111*(1)		large_intestine(1)|lung(2)|ovary(1)|prostate(1)	5						GGGATGGTCTCTCGCTGCAGT	0.602																																						dbGAP											1	Substitution - Nonsense(1)	lung(1)											111.0	107.0	109.0					20																	629441		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF075053	CCDS13005.1	20p13	2013-05-22	2010-06-24	2005-05-10	ENSG00000271303	ENSG00000271303			16132	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 139"", ""sulfiredoxin 1 homolog (S. cerevisiae)"""	C20orf139			Standard	NM_080725		Approved	Npn3, SRX1, YKL086W, dJ850E9.2	uc002wea.4	Q9BYN0	OTTHUMG00000031644	ENST00000381962.3:c.331G>A	20.37:g.629441C>T	ENSP00000371388:p.Glu111Lys		B2R543|Q8NDM3|Q96AK6	Missense_Mutation	SNP	pfam_ParBc,superfamily_ParBc,smart_ParBc,pirsf_Sulfiredoxin	p.E111K	ENST00000381962.3	37	c.331	CCDS13005.1	20	.	.	.	.	.	.	.	.	.	.	C	16.01	3.001735	0.54254	.	.	ENSG00000172070	ENST00000381962	.	.	.	5.69	4.75	0.60458	ParB-like nuclease (1);	0.310205	0.26723	U	0.022835	T	0.50017	0.1591	L	0.47716	1.5	0.34333	D	0.687897	B	0.14805	0.011	B	0.26864	0.074	T	0.56080	-0.8038	9	0.21014	T	0.42	-27.0256	11.4831	0.50337	0.0:0.9168:0.0:0.0832	.	111	Q9BYN0	SRXN1_HUMAN	K	111	.	ENSP00000371388:E111K	E	-	1	0	SRXN1	577441	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	3.335000	0.52105	1.422000	0.47177	0.650000	0.86243	GAG	SRXN1	-	pfam_ParBc,superfamily_ParBc,smart_ParBc,pirsf_Sulfiredoxin	ENSG00000172070		0.602	SRXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRXN1	HGNC	protein_coding	OTTHUMT00000077479.2	65	0.00	0	C	NM_080725		629441	629441	-1	no_errors	ENST00000381962	ensembl	human	known	69_37n	missense	37	37.29	22	SNP	1.000	T
SYN2	6854	genome.wustl.edu	37	3	12226464	12226464	+	RNA	SNP	G	G	C			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr3:12226464G>C	ENST00000432424.2	+	0	3133							Q92777	SYN2_HUMAN	synapsin II						neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)			breast(5)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	18						TCCCAGATCTGAGAAGGAACT	0.463																																						dbGAP											0																																										-	-	-			0				CCDS74900.1, CCDS74901.1	3p25.2	2013-09-20			ENSG00000157152	ENSG00000157152			11495	protein-coding gene	gene with protein product		600755				8530057	Standard	XM_006713311		Approved	SYNII, SYNIIa, SYNIIb	uc003bwm.3	Q92777	OTTHUMG00000155335		3.37:g.12226464G>C			A8MY98	RNA	SNP	-	NULL	ENST00000432424.2	37	NULL		3																																																																																			SYN2	-	-	ENSG00000157152		0.463	SYN2-002	KNOWN	basic	processed_transcript	SYN2	HGNC	processed_transcript	OTTHUMT00000339528.3	8	0.00	0	G	NM_133625		12226464	12226464	+1	no_errors	ENST00000425297	ensembl	human	known	69_37n	rna	7	41.67	5	SNP	0.001	C
SYN2	6854	genome.wustl.edu	37	3	12226682	12226682	+	RNA	SNP	G	G	C			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr3:12226682G>C	ENST00000432424.2	+	0	3351							Q92777	SYN2_HUMAN	synapsin II						neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)			breast(5)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	18						GGTTGCATAAGAATCAGGTCC	0.343																																						dbGAP											0																																										-	-	-			0				CCDS74900.1, CCDS74901.1	3p25.2	2013-09-20			ENSG00000157152	ENSG00000157152			11495	protein-coding gene	gene with protein product		600755				8530057	Standard	XM_006713311		Approved	SYNII, SYNIIa, SYNIIb	uc003bwm.3	Q92777	OTTHUMG00000155335		3.37:g.12226682G>C			A8MY98	RNA	SNP	-	NULL	ENST00000432424.2	37	NULL		3																																																																																			SYN2	-	-	ENSG00000157152		0.343	SYN2-002	KNOWN	basic	processed_transcript	SYN2	HGNC	processed_transcript	OTTHUMT00000339528.3	15	0.00	0	G	NM_133625		12226682	12226682	+1	no_errors	ENST00000425297	ensembl	human	known	69_37n	rna	14	39.13	9	SNP	0.161	C
SYT12	91683	genome.wustl.edu	37	11	66811263	66811263	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr11:66811263C>T	ENST00000393946.2	+	8	1938	c.776C>T	c.(775-777)tCt>tTt	p.S259F	SYT12_ENST00000527043.1_Missense_Mutation_p.S259F|SYT12_ENST00000525457.1_Missense_Mutation_p.S259F			Q8IV01	SYT12_HUMAN	synaptotagmin XII	259	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.					cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|synapse (GO:0045202)				NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|urinary_tract(1)	20						CTGAAGCTTTCTGTGCTTGAC	0.572																																					Ovarian(65;2862 3307)	dbGAP											0													115.0	89.0	98.0					11																	66811263		2200	4295	6495	-	-	-	SO:0001583	missense	0			AK024280	CCDS8154.1	11q13.2	2014-07-02			ENSG00000173227	ENSG00000173227		"""Synaptotagmins"""	18381	protein-coding gene	gene with protein product		606436				8987811	Standard	NM_177963		Approved	SRG1	uc001oju.3	Q8IV01	OTTHUMG00000167101	ENST00000393946.2:c.776C>T	11.37:g.66811263C>T	ENSP00000377520:p.Ser259Phe			Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.S259F	ENST00000393946.2	37	c.776	CCDS8154.1	11	.	.	.	.	.	.	.	.	.	.	C	19.54	3.846901	0.71603	.	.	ENSG00000173227	ENST00000393946;ENST00000525457;ENST00000527043	T;T;T	0.74002	-0.8;-0.8;-0.8	5.27	5.27	0.74061	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.221299	0.39687	N	0.001298	T	0.78304	0.4262	L	0.56769	1.78	0.53005	D	0.999968	D	0.57571	0.98	P	0.50440	0.641	T	0.81261	-0.1013	10	0.72032	D	0.01	.	16.4027	0.83647	0.0:1.0:0.0:0.0	.	259	Q8IV01	SYT12_HUMAN	F	259	ENSP00000377520:S259F;ENSP00000431400:S259F;ENSP00000435316:S259F	ENSP00000377520:S259F	S	+	2	0	SYT12	66567839	0.994000	0.37717	0.538000	0.28064	0.967000	0.64934	3.179000	0.50887	2.467000	0.83353	0.462000	0.41574	TCT	SYT12	-	superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep	ENSG00000173227		0.572	SYT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT12	HGNC	protein_coding	OTTHUMT00000393129.1	20	0.00	0	C	NM_177963		66811263	66811263	+1	no_errors	ENST00000393946	ensembl	human	known	69_37n	missense	21	25.00	7	SNP	0.973	T
TAB3	257397	genome.wustl.edu	37	X	30873431	30873431	+	Silent	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chrX:30873431C>T	ENST00000378933.1	-	3	528	c.351G>A	c.(349-351)ctG>ctA	p.L117L	TAB3-AS2_ENST00000445240.1_RNA|TAB3_ENST00000378930.3_Silent_p.L117L|TAB3_ENST00000378932.2_Silent_p.L117L|TAB3_ENST00000378928.1_5'Flank|TAB3_ENST00000288422.2_Silent_p.L117L	NM_152787.3	NP_690000.2	Q8N5C8	TAB3_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 3	117					activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|skin(1)	27						CTAAACATATCAGCTGTTTAC	0.448																																					Pancreas(164;1598 1985 29022 43301 49529)	dbGAP											0													164.0	112.0	130.0					X																	30873431		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AY331591	CCDS14226.1	Xp21.2	2010-02-05	2010-02-05	2010-02-05	ENSG00000157625	ENSG00000157625			30681	protein-coding gene	gene with protein product	"""TAK1 binding protein 3"""	300480	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 3"""	MAP3K7IP3		14633987, 14670075	Standard	XM_005274482		Approved		uc004dcj.3	Q8N5C8	OTTHUMG00000021329	ENST00000378933.1:c.351G>A	X.37:g.30873431C>T			A6NDD9|Q6VQR0	Silent	SNP	pfam_CUE,pfam_Znf_RanBP2,superfamily_UBA-like,smart_CUE,smart_Znf_RanBP2,pfscan_CUE,pfscan_Znf_RanBP2	p.L117	ENST00000378933.1	37	c.351	CCDS14226.1	X																																																																																			TAB3	-	NULL	ENSG00000157625		0.448	TAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAB3	HGNC	protein_coding	OTTHUMT00000056173.1	45	0.00	0	C	NM_152787		30873431	30873431	-1	no_errors	ENST00000288422	ensembl	human	known	69_37n	silent	32	23.81	10	SNP	0.996	T
TBCB	1155	genome.wustl.edu	37	19	36611614	36611614	+	Silent	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr19:36611614C>T	ENST00000221855.3	+	3	836	c.261C>T	c.(259-261)gtC>gtT	p.V87V	TBCB_ENST00000392178.4_3'UTR|TBCB_ENST00000586868.1_Intron|TBCB_ENST00000589996.1_Silent_p.V87V|TBCB_ENST00000585746.1_Silent_p.V36V	NM_001281.2	NP_001272.2	Q99426	TBCB_HUMAN	tubulin folding cofactor B	87					'de novo' posttranslational protein folding (GO:0051084)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	5	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			TCACACAGGTCATTGACCACA	0.612																																						dbGAP											0													72.0	57.0	62.0					19																	36611614		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF013488	CCDS12488.1, CCDS74344.1	19q13.11-q13.12	2008-02-05	2006-11-22	2006-11-22	ENSG00000105254	ENSG00000105254			1989	protein-coding gene	gene with protein product		601303	"""cytoskeleton-associated protein 1"", ""cytoskeleton associated protein 1"""	CKAP1		8978778	Standard	NM_001281		Approved	CG22, CKAPI	uc002odg.1	Q99426	OTTHUMG00000048143	ENST00000221855.3:c.261C>T	19.37:g.36611614C>T			O00111|O00674|O14728|Q6FGY5	Silent	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	p.V87	ENST00000221855.3	37	c.261	CCDS12488.1	19																																																																																			TBCB	-	NULL	ENSG00000105254		0.612	TBCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBCB	HGNC	protein_coding	OTTHUMT00000156291.2	23	0.00	0	C	NM_001281		36611614	36611614	+1	no_errors	ENST00000221855	ensembl	human	known	69_37n	silent	11	38.89	7	SNP	1.000	T
TNPO1	3842	genome.wustl.edu	37	5	72112537	72112537	+	5'UTR	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr5:72112537G>A	ENST00000337273.5	+	0	399				TNPO1_ENST00000454282.1_5'UTR|TNPO1_ENST00000447967.2_5'UTR|CTD-2631K10.1_ENST00000507957.1_RNA|TNPO1_ENST00000523768.1_5'UTR	NM_002270.3	NP_002261.3	Q92973	TNPO1_HUMAN	transportin 1						gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|protein import into nucleus, translocation (GO:0000060)|RNA metabolic process (GO:0016070)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(6)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	36		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		CGCTTCGGCCGAAGGCCCGAG	0.711																																						dbGAP											0													10.0	18.0	15.0					5																	72112537		1808	4039	5847	-	-	-	SO:0001623	5_prime_UTR_variant	0			U70322	CCDS4016.1, CCDS43329.1	5q13.1	2009-01-12	2004-01-29	2004-01-30	ENSG00000083312	ENSG00000083312		"""Importins"""	6401	protein-coding gene	gene with protein product	"""importin 2"""	602901	"""karyopherin (importin) beta 2"""	KPNB2		8808633, 9144189	Standard	NM_153188		Approved	MIP, TRN, IPO2, MIP1	uc003kci.4	Q92973	OTTHUMG00000100967	ENST00000337273.5:c.-28G>A	5.37:g.72112537G>A			B4DVC6|Q92957|Q92975	RNA	SNP	-	NULL	ENST00000337273.5	37	NULL	CCDS43329.1	5																																																																																			TNPO1	-	-	ENSG00000083312		0.711	TNPO1-001	KNOWN	basic|CCDS	protein_coding	TNPO1	HGNC	protein_coding	OTTHUMT00000218577.3	39	0.00	0	G	NM_002270		72112537	72112537	+1	no_errors	ENST00000515483	ensembl	human	known	69_37n	rna	29	27.50	11	SNP	1.000	A
TNFAIP8	25816	genome.wustl.edu	37	5	118728890	118728890	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr5:118728890G>C	ENST00000503646.1	+	3	1099	c.411G>C	c.(409-411)gaG>gaC	p.E137D	TNFAIP8_ENST00000274456.6_Missense_Mutation_p.E127D|TNFAIP8_ENST00000513374.1_Missense_Mutation_p.E149D|TNFAIP8_ENST00000504642.1_Missense_Mutation_p.E139D|TNFAIP8_ENST00000415806.2_3'UTR|TNFAIP8_ENST00000504771.2_Missense_Mutation_p.E137D			O95379	TFIP8_HUMAN	tumor necrosis factor, alpha-induced protein 8	137					defense response to Gram-positive bacterium (GO:0050830)|interleukin-1 beta production (GO:0032611)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)	cytoplasm (GO:0005737)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)			ovary(1)	1		all_cancers(142;0.0317)|Prostate(80;0.111)|Breast(839;0.231)		Epithelial(69;4.63e-83)|OV - Ovarian serous cystadenocarcinoma(64;1.39e-82)|all cancers(49;4.88e-75)|GBM - Glioblastoma multiforme(465;0.00338)|BRCA - Breast invasive adenocarcinoma(61;0.0148)|COAD - Colon adenocarcinoma(49;0.0829)		AATGCAGAGAGATGCTGCACC	0.433																																						dbGAP											0													112.0	114.0	113.0					5																	118728890		2004	4193	6197	-	-	-	SO:0001583	missense	0			AF070671	CCDS47257.1, CCDS47258.1, CCDS68933.1	5q23.1	2008-02-05			ENSG00000145779	ENSG00000145779			17260	protein-coding gene	gene with protein product		612111				10233894, 10644768	Standard	NM_001286813		Approved	GG2-1, MDC-3.13, SCC-S2	uc003ksi.3	O95379	OTTHUMG00000162949	ENST00000503646.1:c.411G>C	5.37:g.118728890G>C	ENSP00000421848:p.Glu137Asp		B3KMH1|B3KMI2|B7Z713|Q9P1Q1|Q9UER5|Q9UP47	Missense_Mutation	SNP	pfam_DUF758	p.E137D	ENST00000503646.1	37	c.411	CCDS47258.1	5	.	.	.	.	.	.	.	.	.	.	G	2.979	-0.210733	0.06140	.	.	ENSG00000145779	ENST00000274456;ENST00000513374;ENST00000504771;ENST00000503646;ENST00000504642	T;T;T;T;T	0.27720	1.65;1.65;1.65;1.65;1.65	5.8	3.99	0.46301	.	0.073630	0.56097	N	0.000032	T	0.11879	0.0289	N	0.02129	-0.67	0.80722	D	1	B;B;B	0.11235	0.004;0.001;0.002	B;B;B	0.13407	0.007;0.009;0.003	T	0.22591	-1.0212	10	0.02654	T	1	-17.9135	16.3196	0.82941	0.0:0.3732:0.6268:0.0	.	149;137;127	B7Z713;O95379;O95379-3	.;TFIP8_HUMAN;.	D	127;149;137;137;139	ENSP00000274456:E127D;ENSP00000427424:E149D;ENSP00000422245:E137D;ENSP00000421848:E137D;ENSP00000427160:E139D	ENSP00000274456:E127D	E	+	3	2	TNFAIP8	118756789	0.001000	0.12720	0.945000	0.38365	0.983000	0.72400	-0.412000	0.07132	0.777000	0.33496	0.655000	0.94253	GAG	TNFAIP8	-	pfam_DUF758	ENSG00000145779		0.433	TNFAIP8-002	PUTATIVE	alternative_5_UTR|basic|exp_conf|CCDS	protein_coding	TNFAIP8	HGNC	protein_coding	OTTHUMT00000371134.2	67	0.00	0	G	NM_014350		118728890	118728890	+1	no_errors	ENST00000504771	ensembl	human	known	69_37n	missense	34	45.16	28	SNP	0.988	C
TRPM3	80036	genome.wustl.edu	37	9	73233936	73233936	+	Silent	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr9:73233936C>T	ENST00000377111.2	-	16	2412	c.2169G>A	c.(2167-2169)ctG>ctA	p.L723L	TRPM3_ENST00000396280.5_Silent_p.L572L|TRPM3_ENST00000396292.4_Silent_p.L595L|TRPM3_ENST00000358082.3_Silent_p.L585L|TRPM3_ENST00000377105.1_Silent_p.L582L|TRPM3_ENST00000408909.2_Silent_p.L582L|TRPM3_ENST00000360823.2_Silent_p.L585L|TRPM3_ENST00000377106.1_Silent_p.L595L|TRPM3_ENST00000396285.1_Silent_p.L570L|TRPM3_ENST00000357533.2_Silent_p.L727L|TRPM3_ENST00000423814.3_Silent_p.L750L|TRPM3_ENST00000377110.3_Silent_p.L723L	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	748					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						GCTCATACGTCAGCAGTTTCA	0.582																																						dbGAP											0													106.0	74.0	85.0					9																	73233936		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.2169G>A	9.37:g.73233936C>T			A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.D572N	ENST00000377111.2	37	c.1714		9	.	.	.	.	.	.	.	.	.	.	C	9.916	1.210928	0.22289	.	.	ENSG00000083067	ENST00000396280	.	.	.	5.65	4.75	0.60458	.	.	.	.	.	T	0.70527	0.3234	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70342	-0.4898	4	.	.	.	-13.002	14.8285	0.70130	0.0:0.9316:0.0:0.0684	.	.	.	.	N	572	.	.	D	-	1	0	TRPM3	72423756	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.826000	0.39092	1.625000	0.50366	0.655000	0.94253	GAC	TRPM3	-	NULL	ENSG00000083067		0.582	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	TRPM3	HGNC	protein_coding	OTTHUMT00000214157.5	36	0.00	0	C	NM_206945		73233936	73233936	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000396280	ensembl	human	known	69_37n	missense	15	37.50	9	SNP	1.000	T
TSHZ3	57616	genome.wustl.edu	37	19	31767861	31767861	+	Silent	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr19:31767861G>A	ENST00000240587.4	-	2	3165	c.2838C>T	c.(2836-2838)atC>atT	p.I946I		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	946					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					GCCAGTGGCTGATGGTGGTCA	0.552																																						dbGAP											0													51.0	50.0	50.0					19																	31767861		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.2838C>T	19.37:g.31767861G>A			Q9H0G6|Q9P254	Silent	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.I946	ENST00000240587.4	37	c.2838	CCDS12421.2	19																																																																																			TSHZ3	-	superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000121297		0.552	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ3	HGNC	protein_coding	OTTHUMT00000316743.2	44	0.00	0	G	NM_020856		31767861	31767861	-1	no_errors	ENST00000240587	ensembl	human	known	69_37n	silent	19	45.71	16	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179463375	179463375	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr2:179463375G>A	ENST00000591111.1	-	242	52270	c.52046C>T	c.(52045-52047)cCt>cTt	p.P17349L	TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P10117L|TTN_ENST00000460472.2_Missense_Mutation_p.P9925L|TTN_ENST00000342992.6_Missense_Mutation_p.P16422L|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P18990L|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P10050L|TTN-AS1_ENST00000456053.1_RNA			Q8WZ42	TITIN_HUMAN	titin	17349	Fibronectin type-III 26. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGAGGACCAGGAGGGGCTGC	0.428																																						dbGAP											0													56.0	55.0	56.0					2																	179463375		1841	4096	5937	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.52046C>T	2.37:g.179463375G>A	ENSP00000465570:p.Pro17349Leu		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.P16422L	ENST00000591111.1	37	c.49265		2	.	.	.	.	.	.	.	.	.	.	G	15.24	2.774233	0.49786	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;D;D;D	0.86432	0.61;-2.12;-2.12;-2.12	5.91	5.91	0.95273	Fibronectin, type III (3);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.95655	0.8587	M	0.93462	3.42	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.95968	0.8967	9	0.87932	D	0	.	20.2885	0.98538	0.0:0.0:1.0:0.0	.	9925;10050;10117;17349	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	L	16422;9925;10117;10050;9923	ENSP00000343764:P16422L;ENSP00000434586:P9925L;ENSP00000340554:P10117L;ENSP00000352154:P10050L	ENSP00000340554:P10117L	P	-	2	0	TTN	179171620	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	9.793000	0.99091	2.791000	0.96007	0.650000	0.86243	CCT	TTN	-	superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.428	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	58	0.00	0	G	NM_133378		179463375	179463375	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	15	42.31	11	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179539799	179539799	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr2:179539799G>A	ENST00000591111.1	-	146	33681	c.33457C>T	c.(33457-33459)Ctc>Ttc	p.L11153F	TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.L10226F|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.L11527F|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000359218.5_Intron			Q8WZ42	TITIN_HUMAN	titin	11153	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTTTAGGGAGAATGATTCGT	0.323																																						dbGAP											0													96.0	91.0	93.0					2																	179539799		1830	4079	5909	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.33457C>T	2.37:g.179539799G>A	ENSP00000465570:p.Leu11153Phe		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.L10226F	ENST00000591111.1	37	c.30676		2	.	.	.	.	.	.	.	.	.	.	G	8.121	0.780985	0.16120	.	.	ENSG00000155657	ENST00000342992	T	0.66815	-0.23	5.56	3.75	0.43078	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.48624	0.1510	N	0.08118	0	0.09310	N	1	B	0.19445	0.036	B	0.23574	0.047	T	0.47235	-0.9133	9	0.87932	D	0	.	11.6804	0.51455	0.0:0.387:0.4917:0.1213	.	11153	Q8WZ42	TITIN_HUMAN	F	10226	ENSP00000343764:L10226F	ENSP00000343764:L10226F	L	-	1	0	TTN	179248044	0.000000	0.05858	0.013000	0.15412	0.601000	0.36947	0.278000	0.18753	0.697000	0.31718	0.557000	0.71058	CTC	TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.323	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	61	0.00	0	G	NM_133378		179539799	179539799	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	4	55.56	5	SNP	0.012	A
UBR1	197131	genome.wustl.edu	37	15	43363018	43363018	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr15:43363018C>T	ENST00000290650.4	-	5	712	c.634G>A	c.(634-636)Gaa>Aaa	p.E212K	UBR1_ENST00000382177.2_Missense_Mutation_p.E212K	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	212					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E212*(1)		NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		GGAGGCAGTTCTTTTTCCTCT	0.373																																						dbGAP											1	Substitution - Nonsense(1)	lung(1)											183.0	173.0	176.0					15																	43363018		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.634G>A	15.37:g.43363018C>T	ENSP00000290650:p.Glu212Lys		O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Missense_Mutation	SNP	pfam_ClpS_core,pfam_Znf_N-recognin,superfamily_Ribosomal_L7/12_C/ClpS-like,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.E212K	ENST00000290650.4	37	c.634	CCDS10091.1	15	.	.	.	.	.	.	.	.	.	.	C	16.04	3.011434	0.54468	.	.	ENSG00000159459	ENST00000290650;ENST00000382177;ENST00000546274	T;T	0.70164	0.36;-0.46	5.59	4.65	0.58169	.	0.209782	0.43919	D	0.000511	T	0.51873	0.1700	L	0.40543	1.245	0.48236	D	0.999616	B;B	0.22800	0.075;0.002	B;B	0.17098	0.017;0.009	T	0.41787	-0.9489	10	0.10111	T	0.7	-5.99	9.7766	0.40623	0.0:0.7855:0.1416:0.0729	.	212;212	B4DYL2;Q8IWV7	.;UBR1_HUMAN	K	212	ENSP00000290650:E212K;ENSP00000371612:E212K	ENSP00000290650:E212K	E	-	1	0	UBR1	41150310	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.835000	0.48175	1.328000	0.45358	0.655000	0.94253	GAA	UBR1	-	NULL	ENSG00000159459		0.373	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR1	HGNC	protein_coding	OTTHUMT00000253202.1	63	0.00	0	C	NM_174916		43363018	43363018	-1	no_errors	ENST00000290650	ensembl	human	known	69_37n	missense	31	38.00	19	SNP	1.000	T
UBR1	197131	genome.wustl.edu	37	15	43363024	43363024	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr15:43363024C>T	ENST00000290650.4	-	5	706	c.628G>A	c.(628-630)Gaa>Aaa	p.E210K	UBR1_ENST00000382177.2_Missense_Mutation_p.E210K	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	210					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		AGTTCTTTTTCCTCTTCCCAT	0.378																																						dbGAP											0													176.0	167.0	170.0					15																	43363024		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.628G>A	15.37:g.43363024C>T	ENSP00000290650:p.Glu210Lys		O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Missense_Mutation	SNP	pfam_ClpS_core,pfam_Znf_N-recognin,superfamily_Ribosomal_L7/12_C/ClpS-like,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.E210K	ENST00000290650.4	37	c.628	CCDS10091.1	15	.	.	.	.	.	.	.	.	.	.	C	18.07	3.541468	0.65085	.	.	ENSG00000159459	ENST00000290650;ENST00000382177;ENST00000546274	T;T	0.70869	0.29;-0.52	5.59	4.62	0.57501	.	0.220406	0.47093	D	0.000251	T	0.61048	0.2316	L	0.50333	1.59	0.43814	D	0.996378	P;P	0.43542	0.81;0.524	B;B	0.36666	0.23;0.095	T	0.60010	-0.7346	10	0.19147	T	0.46	-14.8836	14.5248	0.67881	0.0:0.7313:0.2687:0.0	.	210;210	B4DYL2;Q8IWV7	.;UBR1_HUMAN	K	210	ENSP00000290650:E210K;ENSP00000371612:E210K	ENSP00000290650:E210K	E	-	1	0	UBR1	41150316	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.076000	0.41548	2.639000	0.89480	0.655000	0.94253	GAA	UBR1	-	NULL	ENSG00000159459		0.378	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR1	HGNC	protein_coding	OTTHUMT00000253202.1	63	0.00	0	C	NM_174916		43363024	43363024	-1	no_errors	ENST00000290650	ensembl	human	known	69_37n	missense	31	36.73	18	SNP	1.000	T
UBR2	23304	genome.wustl.edu	37	6	42620364	42620364	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr6:42620364C>T	ENST00000372899.1	+	25	3008	c.2750C>T	c.(2749-2751)tCa>tTa	p.S917L	UBR2_ENST00000372883.3_Missense_Mutation_p.S421L|UBR2_ENST00000372901.1_Missense_Mutation_p.S917L	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2	917					cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			TATGCCTGGTCAGAGTCCATG	0.373																																						dbGAP											0													146.0	131.0	136.0					6																	42620364		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.2750C>T	6.37:g.42620364C>T	ENSP00000361990:p.Ser917Leu		O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Missense_Mutation	SNP	pfam_ClpS_core,pfam_Znf_N-recognin,superfamily_Ribosomal_L7/12_C/ClpS-like,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.S917L	ENST00000372899.1	37	c.2750	CCDS4870.1	6	.	.	.	.	.	.	.	.	.	.	C	26.6	4.751128	0.89753	.	.	ENSG00000024048	ENST00000372899;ENST00000372901;ENST00000372883	T;T;T	0.58797	0.31;0.31;0.31	5.52	5.52	0.82312	.	0.061971	0.64402	D	0.000002	T	0.66886	0.2835	M	0.73962	2.25	0.80722	D	1	P;D	0.62365	0.95;0.991	P;P	0.56127	0.487;0.792	T	0.68284	-0.5449	10	0.49607	T	0.09	-15.9844	19.4267	0.94743	0.0:1.0:0.0:0.0	.	917;917	Q8IWV8-4;Q8IWV8	.;UBR2_HUMAN	L	917;917;421	ENSP00000361990:S917L;ENSP00000361992:S917L;ENSP00000361974:S421L	ENSP00000361974:S421L	S	+	2	0	UBR2	42728342	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.084000	0.76866	2.582000	0.87167	0.655000	0.94253	TCA	UBR2	-	NULL	ENSG00000024048		0.373	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UBR2	HGNC	protein_coding	OTTHUMT00000040558.2	24	0.00	0	C	NM_015255		42620364	42620364	+1	no_errors	ENST00000372899	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	1.000	T
UBR4	23352	genome.wustl.edu	37	1	19487465	19487465	+	Silent	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr1:19487465C>T	ENST00000375254.3	-	38	5379	c.5352G>A	c.(5350-5352)aaG>aaA	p.K1784K	UBR4_ENST00000375267.2_Silent_p.K1784K|UBR4_ENST00000375217.2_Silent_p.K1784K|UBR4_ENST00000375226.2_Silent_p.K1784K	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	1784					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		GGCTGCTCTTCTTGGGCTTCT	0.552																																						dbGAP											0													70.0	65.0	67.0					1																	19487465		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.5352G>A	1.37:g.19487465C>T			A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Silent	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.K1784	ENST00000375254.3	37	c.5352	CCDS189.1	1																																																																																			UBR4	-	superfamily_ARM-type_fold	ENSG00000127481		0.552	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	35	0.00	0	C	NM_020765		19487465	19487465	-1	no_errors	ENST00000375267	ensembl	human	known	69_37n	silent	3	70.00	7	SNP	1.000	T
USP17L2	377630	genome.wustl.edu	37	8	11995160	11995160	+	Silent	SNP	G	G	C			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr8:11995160G>C	ENST00000333796.3	-	1	1426	c.1110C>G	c.(1108-1110)ctC>ctG	p.L370L	FAM66D_ENST00000434078.2_RNA	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	Q6R6M4	U17L2_HUMAN	ubiquitin specific peptidase 17-like family member 2	370	USP.				apoptotic process (GO:0006915)|CAAX-box protein processing (GO:0071586)|cell cycle checkpoint (GO:0000075)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of protein processing (GO:0010955)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of Ras GTPase activity (GO:0034261)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of RIG-I signaling pathway (GO:1900246)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of apoptotic process (GO:0042981)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of defense response to virus by host (GO:0050691)|regulation of ruffle assembly (GO:1900027)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(1)|kidney(1)|large_intestine(11)|liver(1)|lung(8)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	29						GGATGTAAAAGAGGACATAGG	0.498																																						dbGAP											0													32.0	35.0	34.0					8																	11995160		1524	3487	5011	-	-	-	SO:0001819	synonymous_variant	0			BC156290	CCDS43713.1	8p23.1	2012-10-09	2012-10-09		ENSG00000223443	ENSG00000223443			34434	protein-coding gene	gene with protein product	"""deubiquitinating enzyme 3"""	610186	"""ubiquitin specific peptidase 17-like 2"""				Standard	NM_201402		Approved	DUB3	uc003wvc.1	Q6R6M4	OTTHUMG00000165295	ENST00000333796.3:c.1110C>G	8.37:g.11995160G>C				Silent	SNP	pfam_Peptidase_C19,pfam_HABP4_PAIRBP1-bd,pfscan_Peptidase_C19	p.L370	ENST00000333796.3	37	c.1110	CCDS43713.1	8																																																																																			USP17L2	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000223443		0.498	USP17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP17L2	HGNC	protein_coding	OTTHUMT00000383303.2	57	0.00	0	G	NM_201402		11995160	11995160	-1	no_errors	ENST00000333796	ensembl	human	known	69_37n	silent	42	23.64	13	SNP	1.000	C
USP45	85015	genome.wustl.edu	37	6	99924030	99924030	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr6:99924030delC	ENST00000327681.6	-	9	1454	c.922delG	c.(922-924)gaafs	p.E309fs	USP45_ENST00000392738.2_Frame_Shift_Del_p.E47fs|USP45_ENST00000369233.2_Frame_Shift_Del_p.E309fs|USP45_ENST00000500704.2_Frame_Shift_Del_p.E309fs	NM_001080481.1	NP_001073950.1	Q70EL2	UBP45_HUMAN	ubiquitin specific peptidase 45	309	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(2)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	22		all_cancers(76;0.000208)|Acute lymphoblastic leukemia(125;8.41e-11)|all_hematologic(75;2.56e-07)|all_epithelial(107;0.122)|Colorectal(196;0.133)		BRCA - Breast invasive adenocarcinoma(108;0.0718)		TTTGTTTCTTCTGTCCTCACT	0.418																																						dbGAP											0													77.0	77.0	77.0					6																	99924030		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AL832030	CCDS34501.1	6q16.2	2008-02-05	2005-08-08		ENSG00000123552	ENSG00000123552		"""Ubiquitin-specific peptidases"""	20080	protein-coding gene	gene with protein product			"""ubiquitin specific protease 45"""			12838346	Standard	NM_001080481		Approved	MGC14793	uc003ppx.2	Q70EL2	OTTHUMG00000015267	ENST00000327681.6:c.922delG	6.37:g.99924030delC	ENSP00000333376:p.Glu309fs		B2RXG0|Q5T062|Q86T44|Q86TC0|Q9BRU1	Frame_Shift_Del	DEL	pfam_Peptidase_C19,pfam_Znf_UBP,superfamily_Znf_FYVE_PHD,pfscan_Znf_UBP,pfscan_Peptidase_C19	p.E308fs	ENST00000327681.6	37	c.922	CCDS34501.1	6																																																																																			USP45	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000123552		0.418	USP45-003	KNOWN	basic|appris_principal|CCDS	protein_coding	USP45	HGNC	protein_coding	OTTHUMT00000041609.2	49	0.00	0	C	NM_032929		99924030	99924030	-1	no_errors	ENST00000327681	ensembl	human	known	69_37n	frame_shift_del	14	12.50	2	DEL	1.000	-
VCAN	1462	genome.wustl.edu	37	5	82868278	82868278	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr5:82868278C>T	ENST00000265077.3	+	13	10344	c.9779C>T	c.(9778-9780)tCt>tTt	p.S3260F	VCAN_ENST00000502527.2_Missense_Mutation_p.S519F|VCAN_ENST00000513016.1_3'UTR|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000342785.4_Missense_Mutation_p.S1506F|VCAN_ENST00000512590.2_Missense_Mutation_p.S1458F|VCAN_ENST00000343200.5_Missense_Mutation_p.S2273F	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	3260	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	AGCTTCTTTTCTGCTGGAGAA	0.433																																						dbGAP											0													141.0	138.0	139.0					5																	82868278		2203	4300	6503	-	-	-	SO:0001583	missense	0			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.9779C>T	5.37:g.82868278C>T	ENSP00000265077:p.Ser3260Phe		P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_EGF-like_dom,pfam_Sushi_SCR_CCP,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_Ig_sub,smart_Link,smart_EGF-like,smart_EGF-like_Ca-bd,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like,prints_Link	p.S3260F	ENST00000265077.3	37	c.9779	CCDS4060.1	5	.	.	.	.	.	.	.	.	.	.	C	21.7	4.186726	0.78789	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000342785;ENST00000512590;ENST00000502527	T;T;T;T;T	0.19250	2.16;2.16;2.16;2.16;2.16	5.94	5.94	0.96194	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.51477	D	0.000085	T	0.42063	0.1186	L	0.43923	1.385	0.48696	D	0.999698	D;B;P;D	0.89917	0.976;0.379;0.841;1.0	P;B;P;D	0.97110	0.81;0.091;0.829;1.0	T	0.02020	-1.1228	10	0.39692	T	0.17	.	20.3593	0.98849	0.0:1.0:0.0:0.0	.	1506;519;2273;3260	P13611-3;P13611-4;P13611-2;P13611	.;.;.;CSPG2_HUMAN	F	3260;2273;1506;1458;519	ENSP00000265077:S3260F;ENSP00000340062:S2273F;ENSP00000342768:S1506F;ENSP00000425959:S1458F;ENSP00000421362:S519F	ENSP00000265077:S3260F	S	+	2	0	VCAN	82904034	0.998000	0.40836	1.000000	0.80357	0.947000	0.59692	3.932000	0.56537	2.807000	0.96579	0.591000	0.81541	TCT	VCAN	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000038427		0.433	VCAN-001	KNOWN	basic|CCDS	protein_coding	VCAN	HGNC	protein_coding	OTTHUMT00000254092.3	47	0.00	0	C	NM_004385		82868278	82868278	+1	no_errors	ENST00000265077	ensembl	human	known	69_37n	missense	14	39.13	9	SNP	1.000	T
VPS45	11311	genome.wustl.edu	37	1	150053517	150053517	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr1:150053517G>A	ENST00000369130.3	+	8	1327	c.781G>A	c.(781-783)Gaa>Aaa	p.E261K	VPS45_ENST00000535106.1_Missense_Mutation_p.E192K|VPS45_ENST00000369128.5_Missense_Mutation_p.E156K	NM_001279354.1|NM_007259.3	NP_001266283.1|NP_009190.2	Q9NRW7	VPS45_HUMAN	vacuolar protein sorting 45 homolog (S. cerevisiae)	261					blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|vesicle docking involved in exocytosis (GO:0006904)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	21	Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGACTTAAGAGAAGTGGTCCT	0.348																																						dbGAP											0													98.0	100.0	99.0					1																	150053517		2203	4300	6503	-	-	-	SO:0001583	missense	0			U35246	CCDS944.1, CCDS60244.1, CCDS72904.1	1q21.2	2008-02-05	2006-12-19	2006-12-19	ENSG00000136631	ENSG00000136631			14579	protein-coding gene	gene with protein product		610035	"""vacuolar protein sorting 45A (yeast homolog)"", ""vacuolar protein sorting 45A (yeast)"""	VPS45B, VPS45A		8996080	Standard	NM_007259		Approved	h-vps45, H1	uc001etp.3	Q9NRW7	OTTHUMG00000012511	ENST00000369130.3:c.781G>A	1.37:g.150053517G>A	ENSP00000358126:p.Glu261Lys		D3DUZ9|F5H8K1|Q15715|Q53FR8|Q5T4P6|Q9Y4Z6	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.E261K	ENST00000369130.3	37	c.781	CCDS944.1	1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.245287	0.80024	.	.	ENSG00000136631	ENST00000369130;ENST00000369128;ENST00000543996;ENST00000535106;ENST00000419023	T;T;T;T	0.76709	2.03;-1.04;2.03;2.03	5.36	5.36	0.76844	.	0.091852	0.85682	D	0.000000	T	0.74473	0.3721	M	0.78916	2.43	0.80722	D	1	P;B;P;B	0.37207	0.532;0.05;0.587;0.106	B;B;B;B	0.37091	0.237;0.223;0.241;0.223	T	0.79470	-0.1790	10	0.66056	D	0.02	.	18.2643	0.90048	0.0:0.0:1.0:0.0	.	156;261;81;261	F5H8K1;Q53FR8;A0AR27;Q9NRW7	.;.;.;VPS45_HUMAN	K	261;156;136;192;192	ENSP00000358126:E261K;ENSP00000358124:E156K;ENSP00000440690:E192K;ENSP00000400143:E192K	ENSP00000358124:E156K	E	+	1	0	VPS45	148320141	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.622000	0.98378	2.788000	0.95919	0.557000	0.71058	GAA	VPS45	-	pfam_Sec1-like,superfamily_Sec1-like	ENSG00000136631		0.348	VPS45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS45	HGNC	protein_coding	OTTHUMT00000034964.1	34	0.00	0	G	NM_007259		150053517	150053517	+1	no_errors	ENST00000369130	ensembl	human	known	69_37n	missense	49	16.95	10	SNP	1.000	A
WDFY3	23001	genome.wustl.edu	37	4	85888197	85888197	+	5'Flank	SNP	C	C	G			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr4:85888197C>G	ENST00000295888.4	-	0	0				WDFY3-AS2_ENST00000451762.1_RNA|WDFY3_ENST00000322366.6_5'Flank	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3						aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		AAGGACTCAGCTGAGAAAGGA	0.592																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424		4.37:g.85888197C>G	Exception_encountered		Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	RNA	SNP	-	NULL	ENST00000295888.4	37	NULL	CCDS3609.1	4																																																																																			WDFY3-AS2	-	-	ENSG00000180769		0.592	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3-AS2	HGNC	protein_coding	OTTHUMT00000252811.2	39	0.00	0	C	NM_014991		85888197	85888197	+1	no_errors	ENST00000318186	ensembl	human	known	69_37n	rna	17	46.88	15	SNP	0.701	G
TSIX	9383	genome.wustl.edu	37	X	73050952	73050952	+	lincRNA	SNP	G	G	C			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chrX:73050952G>C	ENST00000604411.1	+	0	74054				XIST_ENST00000429829.1_lincRNA	NR_003255.2				TSIX transcript, XIST antisense RNA																		CTGGGACCAGGAAAGTATCTT	0.463																																						dbGAP											0													46.0	42.0	43.0					X																	73050952		876	1991	2867	-	-	-			0					Xq13.2	2012-10-19	2012-08-15			ENSG00000270641		"""Long non-coding RNAs"", ""-"""	12377	non-coding RNA	RNA, long non-coding	"""XIST antisense RNA (non-protein coding)"", ""long intergenic non-protein coding RNA 13"""	300181	"""X (inactive)-specific transcript, antisense"", ""TSIX transcript, XIST antisense RNA (non-protein coding)"""			10192391	Standard	NR_003255		Approved	NCRNA00013, XIST-AS1, LINC00013	uc004ebn.2				X.37:g.73050952G>C				RNA	SNP	-	NULL	ENST00000604411.1	37	NULL		X																																																																																			XIST	-	-	ENSG00000229807		0.463	TSIX-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000469120.1	85	0.00	0	G	NR_003255		73050952	73050952	-1	no_errors	ENST00000429829	ensembl	human	known	69_37n	rna	39	39.06	25	SNP	0.002	C
YARS	8565	genome.wustl.edu	37	1	33248074	33248074	+	Missense_Mutation	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr1:33248074G>A	ENST00000373477.4	-	9	1881	c.973C>T	c.(973-975)Cgg>Tgg	p.R325W	YARS_ENST00000469100.1_5'Flank	NM_003680.3	NP_003671.1	P54577	SYYC_HUMAN	tyrosyl-tRNA synthetase	325					apoptotic process (GO:0006915)|gene expression (GO:0010467)|signal transduction (GO:0007165)|tRNA aminoacylation for protein translation (GO:0006418)|tyrosyl-tRNA aminoacylation (GO:0006437)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	ATP binding (GO:0005524)|interleukin-8 receptor binding (GO:0005153)|poly(A) RNA binding (GO:0044822)|signal transducer activity (GO:0004871)|tRNA binding (GO:0000049)|tyrosine-tRNA ligase activity (GO:0004831)	p.R325W(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|skin(2)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)			L-Tyrosine(DB00135)	AACTTTTCCCGGATTGGATCC	0.498																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											113.0	109.0	110.0					1																	33248074		2203	4300	6503	-	-	-	SO:0001583	missense	0			U89436	CCDS368.1	1p35.1	2014-09-17			ENSG00000134684	ENSG00000134684	6.1.1.1	"""Aminoacyl tRNA synthetases / Class I"""	12840	protein-coding gene	gene with protein product	"""tyrosine tRNA ligase 1, cytoplasmic"""	603623				8552597, 9162081	Standard	NM_003680		Approved	YTS, YRS, tyrRS	uc001bvy.1	P54577	OTTHUMG00000003933	ENST00000373477.4:c.973C>T	1.37:g.33248074G>A	ENSP00000362576:p.Arg325Trp		B3KWK4|D3DPQ4|O43276|Q53EN1	Missense_Mutation	SNP	pfam_aa-tRNA-synth_Ic,pfam_tRNA-bd_dom,superfamily_NA-bd_OB-fold-like,pfscan_tRNA-bd_dom,prints_Tyr-tRNA-synth,tigrfam_Tyr-tRNA-synth	p.R325W	ENST00000373477.4	37	c.973	CCDS368.1	1	.	.	.	.	.	.	.	.	.	.	G	18.74	3.688930	0.68271	.	.	ENSG00000134684	ENST00000373477	T	0.75154	-0.91	4.78	1.71	0.24356	.	0.090855	0.85682	D	0.000000	D	0.84750	0.5541	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.85871	0.1416	10	0.87932	D	0	-14.2024	14.2692	0.66140	0.0:0.0:0.3225:0.6775	.	325	P54577	SYYC_HUMAN	W	325	ENSP00000362576:R325W	ENSP00000362576:R325W	R	-	1	2	YARS	33020661	1.000000	0.71417	1.000000	0.80357	0.764000	0.43329	3.506000	0.53364	0.267000	0.21916	0.655000	0.94253	CGG	YARS	-	NULL	ENSG00000134684		0.498	YARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YARS	HGNC	protein_coding	OTTHUMT00000011225.1	49	0.00	0	G	NM_003680		33248074	33248074	-1	no_errors	ENST00000373477	ensembl	human	known	69_37n	missense	37	40.32	25	SNP	1.000	A
ZNF208	7757	genome.wustl.edu	37	19	22155532	22155532	+	Missense_Mutation	SNP	C	C	G			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr19:22155532C>G	ENST00000397126.4	-	4	2452	c.2304G>C	c.(2302-2304)aaG>aaC	p.K768N	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	768					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TATGAATTTTCTTATGATAAC	0.353																																						dbGAP											0													29.0	32.0	31.0					19																	22155532		1977	4183	6160	-	-	-	SO:0001583	missense	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.2304G>C	19.37:g.22155532C>G	ENSP00000380315:p.Lys768Asn			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K768N	ENST00000397126.4	37	c.2304	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	C	11.84	1.758770	0.31137	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.18657	2.2	2.28	1.05	0.20165	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.35941	0.0949	.	.	.	0.09310	N	1	D	0.76494	0.999	D	0.76575	0.988	T	0.08848	-1.0702	8	0.54805	T	0.06	.	4.3039	0.10937	0.224:0.634:0.0:0.142	.	668	O43345	ZN208_HUMAN	N	768;668	ENSP00000380315:K768N	ENSP00000380315:K768N	K	-	3	2	ZNF208	21947372	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	0.134000	0.15932	0.846000	0.35142	0.280000	0.19369	AAG	ZNF208	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160321		0.353	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	23	0.00	0	C	NM_007153		22155532	22155532	-1	no_errors	ENST00000397126	ensembl	human	known	69_37n	missense	5	61.54	8	SNP	0.071	G
ZNF160	90338	genome.wustl.edu	37	19	53571914	53571914	+	Missense_Mutation	SNP	C	C	T			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr19:53571914C>T	ENST00000429604.1	-	7	2288	c.1873G>A	c.(1873-1875)Gaa>Aaa	p.E625K	ZNF160_ENST00000601421.1_Missense_Mutation_p.E589K|ZNF160_ENST00000418871.1_Missense_Mutation_p.E625K|ZNF160_ENST00000599056.1_Missense_Mutation_p.E625K	NM_001102603.1|NM_198893.2	NP_001096073.1|NP_942596.1	Q9HCG1	ZN160_HUMAN	zinc finger protein 160	625					hemopoiesis (GO:0030097)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	35				GBM - Glioblastoma multiforme(134;0.02)		TTGCCGCATTCATGACATTTG	0.418																																						dbGAP											0													96.0	94.0	95.0					19																	53571914		2203	4300	6503	-	-	-	SO:0001583	missense	0			X78928	CCDS12859.1	19q13.42	2013-01-08				ENSG00000170949		"""Zinc fingers, C2H2-type"", ""-"""	12948	protein-coding gene	gene with protein product		600398				7774943, 7865130	Standard	NM_198893		Approved	HZF5, F11, KR18, HKr18, FLJ00032, KIAA1611	uc002qar.4	Q9HCG1		ENST00000429604.1:c.1873G>A	19.37:g.53571914C>T	ENSP00000406201:p.Glu625Lys		Q14589|Q504Q8|Q96JC5|Q9BVY9|Q9H7N6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E625K	ENST00000429604.1	37	c.1873	CCDS12859.1	19	.	.	.	.	.	.	.	.	.	.	C	13.57	2.276708	0.40294	.	.	ENSG00000170949	ENST00000429604;ENST00000418871	T;T	0.07327	3.2;3.2	2.35	-0.418	0.12344	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06962	0.0177	L	0.31371	0.925	0.09310	N	1	B	0.28552	0.215	B	0.34093	0.175	T	0.40646	-0.9552	9	0.56958	D	0.05	.	6.1977	0.20559	0.1785:0.4895:0.3321:0.0	.	625	Q9HCG1	ZN160_HUMAN	K	625	ENSP00000406201:E625K;ENSP00000409597:E625K	ENSP00000409597:E625K	E	-	1	0	ZNF160	58263726	0.000000	0.05858	0.003000	0.11579	0.006000	0.05464	-2.103000	0.01341	0.282000	0.22254	0.561000	0.74099	GAA	ZNF160	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000170949		0.418	ZNF160-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF160	HGNC	protein_coding	OTTHUMT00000463994.2	38	0.00	0	C	NM_033288		53571914	53571914	-1	no_errors	ENST00000418871	ensembl	human	known	69_37n	missense	20	25.93	7	SNP	0.000	T
ZNF22	7570	genome.wustl.edu	37	10	45499206	45499206	+	Silent	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr10:45499206G>A	ENST00000298299.3	+	2	983	c.390G>A	c.(388-390)caG>caA	p.Q130Q	CEP164P1_ENST00000456938.2_RNA|C10orf25_ENST00000298298.1_5'Flank	NM_006963.4	NP_008894.2	P17026	ZNF22_HUMAN	zinc finger protein 22	130					odontogenesis (GO:0042476)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(2)|lung(2)	8		Prostate(175;0.0352)|all_neural(218;0.202)				TTCAGCACCAGAGAATTCATA	0.478																																						dbGAP											0													79.0	79.0	79.0					10																	45499206		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC041139	CCDS7211.1	10q11	2013-01-08	2012-07-12		ENSG00000165512	ENSG00000165512		"""Zinc fingers, C2H2-type"""	13012	protein-coding gene	gene with protein product		194529					Standard	NM_006963		Approved	KOX15, HKR-T1, ZNF422, Zfp422	uc001jbw.3	P17026	OTTHUMG00000018064	ENST00000298299.3:c.390G>A	10.37:g.45499206G>A			Q5T741|Q96FM4	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q130	ENST00000298299.3	37	c.390	CCDS7211.1	10																																																																																			ZNF22	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000165512		0.478	ZNF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF22	HGNC	protein_coding	OTTHUMT00000047761.1	25	0.00	0	G	NM_006963		45499206	45499206	+1	no_errors	ENST00000298299	ensembl	human	known	69_37n	silent	17	39.29	11	SNP	1.000	A
ZNF292	23036	genome.wustl.edu	37	6	87955222	87955222	+	Splice_Site	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr6:87955222G>A	ENST00000369577.3	+	7	923	c.880G>A	c.(880-882)Gaa>Aaa	p.E294K	ZNF292_ENST00000339907.4_Splice_Site_p.E289K	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	294						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		TTTTTTAAGGGAACTTACTCT	0.313																																						dbGAP											0													25.0	24.0	25.0					6																	87955222		1774	4028	5802	-	-	-	SO:0001630	splice_region_variant	0			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.879-1G>A	6.37:g.87955222G>A			Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E294K	ENST00000369577.3	37	c.880	CCDS47457.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.427392|5.427392	0.96131|0.96131	.|.	.|.	ENSG00000188994|ENSG00000188994	ENST00000369577;ENST00000339907|ENST00000466062	T;T|.	0.43688|.	0.94;0.94|.	5.64|5.64	5.64|5.64	0.86602|0.86602	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73249|0.73249	0.3563|0.3563	M|M	0.73962|0.73962	2.25|2.25	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.76071|.	0.987|.	T|T	0.70673|0.70673	-0.4807|-0.4807	10|5	0.87932|.	D|.	0|.	.|.	20.0534|20.0534	0.97636|0.97636	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	294|.	O60281|.	ZN292_HUMAN|.	K|E	294;289|48	ENSP00000358590:E294K;ENSP00000342847:E289K|.	ENSP00000342847:E289K|.	E|G	+|+	1|2	0|0	ZNF292|ZNF292	88011941|88011941	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.947000|0.947000	0.59692|0.59692	9.804000|9.804000	0.99143|0.99143	2.807000|2.807000	0.96579|0.96579	0.650000|0.650000	0.86243|0.86243	GAA|GGA	ZNF292	-	NULL	ENSG00000188994		0.313	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF292	HGNC	protein_coding	OTTHUMT00000376192.2	18	0.00	0	G	NM_015021	Missense_Mutation	87955222	87955222	+1	no_errors	ENST00000369577	ensembl	human	known	69_37n	missense	3	50.00	3	SNP	1.000	A
ZNF471	57573	genome.wustl.edu	37	19	57036209	57036209	+	Missense_Mutation	SNP	G	G	C			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr19:57036209G>C	ENST00000308031.5	+	5	906	c.773G>C	c.(772-774)gGa>gCa	p.G258A	ZNF471_ENST00000593197.1_Intron|ZNF471_ENST00000591537.1_Missense_Mutation_p.E118Q	NM_020813.2	NP_065864.2	Q9BX82	ZN471_HUMAN	zinc finger protein 471	258					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(8)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0307)		ACACATACTGGAGAGAAACTC	0.363																																					Colon(65;957 1402 6678 10163)|Esophageal Squamous(159;2295 2541 15408 21211)	dbGAP											0													91.0	101.0	98.0					19																	57036209		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037817	CCDS12945.1	19q13.43	2013-01-08				ENSG00000196263		"""Zinc fingers, C2H2-type"", ""-"""	23226	protein-coding gene	gene with protein product						10718198	Standard	NM_020813		Approved	KIAA1396, Z1971	uc002qnh.3	Q9BX82		ENST00000308031.5:c.773G>C	19.37:g.57036209G>C	ENSP00000309161:p.Gly258Ala		B4DF32|O75260|Q08AD6|Q08AD7|Q8N3V1|Q9P2F1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G258A	ENST00000308031.5	37	c.773	CCDS12945.1	19	.	.	.	.	.	.	.	.	.	.	G	15.96	2.986791	0.53934	.	.	ENSG00000196263	ENST00000308031	T	0.26373	1.74	4.29	1.96	0.26148	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.41050	0.1142	M	0.66506	2.035	0.18873	N	0.999988	D	0.76494	0.999	D	0.62955	0.909	T	0.16158	-1.0412	9	0.72032	D	0.01	.	5.8227	0.18536	0.1285:0.1943:0.6771:0.0	.	258	Q9BX82	ZN471_HUMAN	A	258	ENSP00000309161:G258A	ENSP00000309161:G258A	G	+	2	0	ZNF471	61728021	.	.	0.064000	0.19789	0.962000	0.63368	.	.	0.280000	0.22209	0.462000	0.41574	GGA	ZNF471	-	pfscan_Znf_C2H2	ENSG00000196263		0.363	ZNF471-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF471	HGNC	protein_coding	OTTHUMT00000458405.1	17	0.00	0	G	NM_020813		57036209	57036209	+1	no_errors	ENST00000308031	ensembl	human	known	69_37n	missense	10	37.50	6	SNP	0.735	C
ZNF630	57232	genome.wustl.edu	37	X	47919407	47919407	+	Missense_Mutation	SNP	T	T	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chrX:47919407T>A	ENST00000409324.3	-	5	650	c.424A>T	c.(424-426)Atc>Ttc	p.I142F	ZNF630_ENST00000442455.3_Missense_Mutation_p.I128F|ZNF630-AS1_ENST00000436124.1_RNA|ZNF630_ENST00000276054.4_Missense_Mutation_p.I18F	NM_001037735.2	NP_001032824.2	Q2M218	ZN630_HUMAN	zinc finger protein 630	142					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(6)|lung(11)|ovary(1)	19						TCACGACTGATGACTGTGACC	0.378																																						dbGAP											0													87.0	69.0	75.0					X																	47919407		2194	4286	6480	-	-	-	SO:0001583	missense	0			AK000580	CCDS35237.2, CCDS75971.1	Xp11.3-p11.1	2013-01-08			ENSG00000221994	ENSG00000221994		"""Zinc fingers, C2H2-type"", ""-"""	28855	protein-coding gene	gene with protein product		300819					Standard	NM_001037735		Approved	BC037316, dJ54B20.2, FLJ20573, MGC138344	uc004div.4	Q2M218	OTTHUMG00000021463	ENST00000409324.3:c.424A>T	X.37:g.47919407T>A	ENSP00000386393:p.Ile142Phe		F8WAG4|Q5H8Z5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I142F	ENST00000409324.3	37	c.424	CCDS35237.2	X	.	.	.	.	.	.	.	.	.	.	.	3.538	-0.094325	0.07053	.	.	ENSG00000221994	ENST00000442455;ENST00000276054;ENST00000409324;ENST00000428686;ENST00000421903	T;T;T;T	0.09723	3.16;2.95;3.23;5.24	2.33	1.01	0.19927	.	.	.	.	.	T	0.08268	0.0206	L	0.28556	0.865	0.09310	N	1	P	0.38565	0.637	B	0.38655	0.278	T	0.28267	-1.0049	9	0.56958	D	0.05	.	6.122	0.20157	0.0:0.0:0.2587:0.7413	.	142	Q2M218	ZN630_HUMAN	F	128;18;142;142;18	ENSP00000393163:I128F;ENSP00000354683:I18F;ENSP00000386393:I142F;ENSP00000407278:I142F	ENSP00000354683:I18F	I	-	1	0	ZNF630	47804351	0.016000	0.18221	0.012000	0.15200	0.111000	0.19643	1.382000	0.34374	0.060000	0.16281	0.345000	0.21793	ATC	ZNF630	-	NULL	ENSG00000221994		0.378	ZNF630-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF630	HGNC	protein_coding	OTTHUMT00000327254.1	51	0.00	0	T	NM_001037735		47919407	47919407	-1	no_errors	ENST00000409324	ensembl	human	known	69_37n	missense	30	41.18	21	SNP	0.008	A
ZNF733P	643955	genome.wustl.edu	37	7	62752455	62752455	+	RNA	SNP	G	G	A			TCGA-E2-A2P6-01A-11D-A19Y-09	TCGA-E2-A2P6-10B-01D-A19Y-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b5d4557a-10ec-430e-a01a-c8b79c6fe3ea	bf78c46f-db59-42d8-85a1-56bb2498126e	g.chr7:62752455G>A	ENST00000331425.6	-	0	980					NR_003952.1				zinc finger protein 733, pseudogene																		AAGGTTTGAGGACCAGCTAAA	0.448																																						dbGAP											0																																										-	-	-			0					7q11.21	2012-04-20	2012-04-20	2012-04-20	ENSG00000185037	ENSG00000185037			32473	pseudogene	pseudogene			"""zinc finger protein 733"""	ZNF733			Standard	NR_003952		Approved		uc011kdj.2		OTTHUMG00000156270		7.37:g.62752455G>A				RNA	SNP	-	NULL	ENST00000331425.6	37	NULL		7																																																																																			ZNF733P	-	-	ENSG00000185037		0.448	ZNF733P-002	KNOWN	basic	processed_transcript	ZNF733P	HGNC	pseudogene	OTTHUMT00000343679.1	39	0.00	0	G			62752455	62752455	-1	no_errors	ENST00000331425	ensembl	human	known	69_37n	rna	20	31.03	9	SNP	0.000	A
