#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AMPD2	271	genome.wustl.edu	37	1	110168296	110168296	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr1:110168296C>T	ENST00000256578.3	+	3	757	c.397C>T	c.(397-399)Cgc>Tgc	p.R133C	RP5-1160K1.6_ENST00000369843.3_RNA|AMPD2_ENST00000342115.4_Missense_Mutation_p.R52C|AMPD2_ENST00000528667.1_Missense_Mutation_p.R133C|AMPD2_ENST00000526301.1_3'UTR|AMPD2_ENST00000393688.3_Missense_Mutation_p.R14C|AMPD2_ENST00000358729.4_Missense_Mutation_p.R58C|AMPD2_ENST00000528454.1_Missense_Mutation_p.R15C	NM_004037.7	NP_004028.3	Q01433	AMPD2_HUMAN	adenosine monophosphate deaminase 2	133					cell death (GO:0008219)|cyclic purine nucleotide metabolic process (GO:0052652)|energy homeostasis (GO:0097009)|IMP biosynthetic process (GO:0006188)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			breast(1)|large_intestine(3)|ovary(2)|skin(1)	7		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)		GCTGTTCACCCGCTCACTGGC	0.672																																						dbGAP											0													49.0	56.0	54.0					1																	110168296		2203	4300	6503	-	-	-	SO:0001583	missense	0			S47833	CCDS804.1, CCDS805.1, CCDS30796.1, CCDS58016.1	1p13.3	2014-03-03	2010-02-10		ENSG00000116337	ENSG00000116337	3.5.4.6		469	protein-coding gene	gene with protein product	"""AMPD isoform L"""	102771	"""adenosine monophosphate deaminase 2 (isoform L)"""			1400401, 24482476	Standard	NM_004037		Approved	SPG63	uc009wfh.2	Q01433	OTTHUMG00000011649	ENST00000256578.3:c.397C>T	1.37:g.110168296C>T	ENSP00000256578:p.Arg133Cys		B4DK50|B4DZI5|E9PNG0|Q14856|Q14857|Q16686|Q16687|Q16688|Q16729|Q5T693|Q5T695|Q96IA1|Q9UDX8|Q9UDX9|Q9UMU4	Missense_Mutation	SNP	pfam_A/AMP_deaminase_dom,pirsf_AMP_deaminase,tigrfam_AMP_deaminase	p.R133C	ENST00000256578.3	37	c.397	CCDS805.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.8|27.8	4.865184|4.865184	0.91511|0.91511	.|.	.|.	ENSG00000116337|ENSG00000116337	ENST00000369840|ENST00000531734;ENST00000342115;ENST00000528667;ENST00000531203;ENST00000256578;ENST00000358729;ENST00000527846;ENST00000528454;ENST00000393688	.|T;T;T;T;T;T;T;D	.|0.87809	.|1.12;1.12;1.12;1.12;1.18;1.12;1.18;-2.3	4.84|4.84	4.84|4.84	0.62591|0.62591	.|.	.|0.164918	.|0.56097	.|D	.|0.000040	D|D	0.90851|0.90851	0.7126|0.7126	L|L	0.60455|0.60455	1.87|1.87	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;0.999;0.999	.|D;D;P;P	.|0.80764	.|0.994;0.911;0.858;0.881	D|D	0.91649|0.91649	0.5333|0.5333	5|10	.|0.72032	.|D	.|0.01	-29.6856|-29.6856	16.8712|16.8712	0.86041|0.86041	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|58;14;133;52	.|Q01433-4;Q01433-3;Q01433;Q01433-2	.|.;.;AMPD2_HUMAN;.	L|C	103|52;52;133;15;133;58;100;15;14	.|ENSP00000433739:R52C;ENSP00000345498:R52C;ENSP00000436541:R133C;ENSP00000256578:R133C;ENSP00000351573:R58C;ENSP00000431904:R100C;ENSP00000437164:R15C;ENSP00000377292:R14C	.|ENSP00000256578:R133C	P|R	+|+	2|1	0|0	AMPD2|AMPD2	109969819|109969819	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.918000|0.918000	0.54935|0.54935	7.353000|7.353000	0.79414|0.79414	2.506000|2.506000	0.84524|0.84524	0.462000|0.462000	0.41574|0.41574	CCG|CGC	AMPD2	-	pirsf_AMP_deaminase	ENSG00000116337		0.672	AMPD2-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMPD2	HGNC	protein_coding	OTTHUMT00000390615.1	36	0.00	0	C			110168296	110168296	+1	no_errors	ENST00000256578	ensembl	human	known	69_37n	missense	29	39.58	19	SNP	1.000	T
ANXA6	309	genome.wustl.edu	37	5	150509044	150509044	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr5:150509044C>T	ENST00000354546.5	-	12	1069	c.842G>A	c.(841-843)cGt>cAt	p.R281H	ANXA6_ENST00000356496.5_Missense_Mutation_p.R281H|ANXA6_ENST00000523714.1_Missense_Mutation_p.R249H|ANXA6_ENST00000521512.1_Intron|ANXA6_ENST00000377751.5_Intron	NM_001155.4	NP_001146.2	P08133	ANXA6_HUMAN	annexin A6	281					calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|protein homooligomerization (GO:0051260)|regulation of muscle contraction (GO:0006937)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|cholesterol binding (GO:0015485)|GTP binding (GO:0005525)|ligand-gated ion channel activity (GO:0015276)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(1)|lung(9)	12		Medulloblastoma(196;0.0912)|all_hematologic(541;0.208)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CAACTCACTACGGGAGACCAT	0.557																																						dbGAP											0													63.0	62.0	62.0					5																	150509044		2005	4163	6168	-	-	-	SO:0001583	missense	0			J03578	CCDS47315.1, CCDS54941.1	5q33.1	2008-02-05			ENSG00000197043	ENSG00000197043		"""Annexins"""	544	protein-coding gene	gene with protein product		114070		ANX6		3258820	Standard	NM_001155		Approved		uc003ltl.2	P08133	OTTHUMG00000164179	ENST00000354546.5:c.842G>A	5.37:g.150509044C>T	ENSP00000346550:p.Arg281His		B7Z8A7|D3DQH4|E9PGK1|Q6ZT79	Missense_Mutation	SNP	pfam_Annexin_repeat,superfamily_Annexin,smart_Annexin_repeat,prints_Annexin,prints_AnnexinVI,prints_AnnexinIV	p.R281H	ENST00000354546.5	37	c.842	CCDS47315.1	5	.	.	.	.	.	.	.	.	.	.	C	35	5.558754	0.96514	.	.	ENSG00000197043	ENST00000354546;ENST00000523714;ENST00000356496;ENST00000540153	T;T;T	0.12774	2.65;2.65;2.65	5.05	5.05	0.67936	Annexin repeat, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.48607	0.1509	M	0.92784	3.345	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.62440	-0.6854	10	0.87932	D	0	.	17.1866	0.86868	0.0:1.0:0.0:0.0	.	281;281	A6NN80;P08133	.;ANXA6_HUMAN	H	281;249;281;155	ENSP00000346550:R281H;ENSP00000430517:R249H;ENSP00000348889:R281H	ENSP00000346550:R281H	R	-	2	0	ANXA6	150489237	1.000000	0.71417	0.944000	0.38274	0.966000	0.64601	7.277000	0.78572	2.358000	0.79984	0.511000	0.50034	CGT	ANXA6	-	pfam_Annexin_repeat,superfamily_Annexin,smart_Annexin_repeat,prints_Annexin	ENSG00000197043		0.557	ANXA6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANXA6	HGNC	protein_coding	OTTHUMT00000377668.2	38	0.00	0	C	NM_001155		150509044	150509044	-1	no_errors	ENST00000354546	ensembl	human	known	69_37n	missense	62	10.14	7	SNP	1.000	T
AP1M2	10053	genome.wustl.edu	37	19	10689625	10689625	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr19:10689625G>C	ENST00000250244.6	-	8	913	c.831C>G	c.(829-831)atC>atG	p.I277M	AP1M2_ENST00000590923.1_Missense_Mutation_p.I279M	NM_005498.4	NP_005489.2	Q9Y6Q5	AP1M2_HUMAN	adaptor-related protein complex 1, mu 2 subunit	277	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein targeting (GO:0006605)|regulation of defense response to virus by virus (GO:0050690)|vesicle targeting (GO:0006903)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)				endometrium(4)|large_intestine(1)|lung(1)|ovary(2)|urinary_tract(1)	9			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)			ACTCAATCCAGATCAGTGGCT	0.453																																						dbGAP											0													48.0	52.0	51.0					19																	10689625		1910	4136	6046	-	-	-	SO:0001583	missense	0			AF020797	CCDS45964.1	19p13.2	2008-10-07				ENSG00000129354			558	protein-coding gene	gene with protein product		607309				10338135	Standard	NM_005498		Approved	HSMU1B, mu2, AP1-mu2	uc002mpc.3	Q9Y6Q5		ENST00000250244.6:c.831C>G	19.37:g.10689625G>C	ENSP00000250244:p.Ile277Met		B2RDV5|Q9BSI8	Missense_Mutation	SNP	pfam_Clathrin_mu_C,pfam_AP_mu_sigma_su,superfamily_Clathrin_mu_C,superfamily_Longin-like_dom,pirsf_Clathrin_mu,pfscan_Clathrin_mu_C,prints_Clathrin_mu	p.I279M	ENST00000250244.6	37	c.837	CCDS45964.1	19	.	.	.	.	.	.	.	.	.	.	g	16.03	3.007797	0.54361	.	.	ENSG00000129354	ENST00000250244	T	0.20200	2.09	5.12	2.85	0.33270	Clathrin adaptor, mu subunit, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.49609	0.1567	M	0.92649	3.33	0.58432	D	0.999996	P;D	0.64830	0.844;0.994	B;D	0.68943	0.358;0.961	T	0.56117	-0.8032	10	0.72032	D	0.01	-45.4985	8.3967	0.32561	0.0842:0.0:0.7636:0.1522	.	279;277	Q9Y6Q5-2;Q9Y6Q5	.;AP1M2_HUMAN	M	277	ENSP00000250244:I277M	ENSP00000250244:I277M	I	-	3	3	AP1M2	10550625	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	1.476000	0.35420	1.153000	0.42468	0.555000	0.69702	ATC	AP1M2	-	pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,pirsf_Clathrin_mu,pfscan_Clathrin_mu_C	ENSG00000129354		0.453	AP1M2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	AP1M2	HGNC	protein_coding	OTTHUMT00000452034.1	54	0.00	0	G			10689625	10689625	-1	no_errors	ENST00000590923	ensembl	human	known	69_37n	missense	50	26.47	18	SNP	1.000	C
ATP11B	23200	genome.wustl.edu	37	3	182566341	182566341	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr3:182566341G>C	ENST00000323116.5	+	10	1107	c.847G>C	c.(847-849)Gaa>Caa	p.E283Q	ATP11B_ENST00000482794.1_3'UTR	NM_014616.2	NP_055431.1	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B	283					aminophospholipid transport (GO:0015917)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|ion transmembrane transporter activity (GO:0015075)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	41	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			ATCTGCAGTAGAAAAGTAAGA	0.249																																						dbGAP											0													57.0	58.0	58.0					3																	182566341		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF156548	CCDS33896.1	3q27	2010-04-20	2007-09-19		ENSG00000058063	ENSG00000058063		"""ATPases / P-type"""	13553	protein-coding gene	gene with protein product		605869	"""ATPase, Class VI, type 11B"""			10231032, 11015572	Standard	NM_014616		Approved	ATPIF, ATPIR, KIAA0956	uc003flb.3	Q9Y2G3	OTTHUMG00000158295	ENST00000323116.5:c.847G>C	3.37:g.182566341G>C	ENSP00000321195:p.Glu283Gln		Q96FN1|Q9UKK7	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.E283Q	ENST00000323116.5	37	c.847	CCDS33896.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.168715|5.168715	0.94768|0.94768	.|.	.|.	ENSG00000058063|ENSG00000058063	ENST00000323116|ENST00000498086	D|.	0.86562|.	-2.14|.	5.4|5.4	5.4|5.4	0.78164|0.78164	ATPase, P-type, ATPase-associated domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.79052|.	0.4381|.	M|M	0.80332|0.80332	2.49|2.49	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|.	0.79524|.	-0.1768|.	10|.	0.87932|.	D|.	0|.	.|.	19.2267|19.2267	0.93820|0.93820	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	283|.	Q9Y2G3|.	AT11B_HUMAN|.	Q|Y	283|83	ENSP00000321195:E283Q|.	ENSP00000321195:E283Q|.	E|X	+|+	1|3	0|2	ATP11B|ATP11B	184049035|184049035	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	9.309000|9.309000	0.96252|0.96252	2.563000|2.563000	0.86464|0.86464	0.551000|0.551000	0.68910|0.68910	GAA|TAG	ATP11B	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000058063		0.249	ATP11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP11B	HGNC	protein_coding	OTTHUMT00000350598.1	72	0.00	0	G	NM_014616		182566341	182566341	+1	no_errors	ENST00000323116	ensembl	human	known	69_37n	missense	35	28.57	14	SNP	1.000	C
BRIP1	83990	genome.wustl.edu	37	17	59871074	59871074	+	Missense_Mutation	SNP	C	C	T	rs587780227		TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr17:59871074C>T	ENST00000259008.2	-	10	1624	c.1357G>A	c.(1357-1359)Gct>Act	p.A453T	BRIP1_ENST00000577598.1_Missense_Mutation_p.A453T	NM_032043.2	NP_114432.2	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	453					DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A453T(2)		NS(1)|breast(3)|endometrium(9)|kidney(5)|large_intestine(9)|liver(2)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	55						AGATATTCAGCGTTTGCTTCT	0.333			"""F, N, Mis"""			"""AML, leukemia, breast"""		Involved in tolerance or repair of DNA crosslinks																														dbGAP	yes	Rec		"""Fanconi anaemia J, breast cancer susceptiblity"""	17	17q22	83990	BRCA1 interacting protein C-terminal helicase 1		"""L, E"""	2	Substitution - Missense(2)	endometrium(2)											70.0	66.0	67.0					17																	59871074		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF360549	CCDS11631.1	17q22.2	2014-09-17				ENSG00000136492		"""Fanconi anemia, complementation groups"""	20473	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-associated helicase 1"""	605882				11595410, 11301010	Standard	NM_032043		Approved	OF, BACH1, FANCJ	uc002izk.2	Q9BX63		ENST00000259008.2:c.1357G>A	17.37:g.59871074C>T	ENSP00000259008:p.Ala453Thr		Q3MJE2|Q8NCI5	Missense_Mutation	SNP	pfam_DEAD_2,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_TIL_dom,smart_Helicase-like_DEXD_c2,smart_Helicase_ATP-bd,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.A453T	ENST00000259008.2	37	c.1357	CCDS11631.1	17	.	.	.	.	.	.	.	.	.	.	C	10.74	1.435001	0.25813	.	.	ENSG00000136492	ENST00000259008	T	0.74106	-0.81	4.71	-0.4	0.12411	.	0.426931	0.24014	N	0.042357	T	0.46190	0.1380	N	0.08118	0	0.19300	N	0.99998	B	0.02656	0.0	B	0.01281	0.0	T	0.24404	-1.0161	9	.	.	.	-5.7821	6.3628	0.21437	0.4734:0.136:0.0:0.3906	.	453	Q9BX63	FANCJ_HUMAN	T	453	ENSP00000259008:A453T	.	A	-	1	0	BRIP1	57225856	1.000000	0.71417	0.972000	0.41901	0.908000	0.53690	1.614000	0.36911	-0.292000	0.08999	-0.921000	0.02739	GCT	BRIP1	-	tigrfam_DNA_helicase_DNA-repair_Rad3	ENSG00000136492		0.333	BRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRIP1	HGNC	protein_coding	OTTHUMT00000445362.1	38	0.00	0	C	NM_032043		59871074	59871074	-1	no_errors	ENST00000259008	ensembl	human	known	69_37n	missense	45	35.21	25	SNP	0.998	T
CACNA2D2	9254	genome.wustl.edu	37	3	50404847	50404847	+	Silent	SNP	G	G	A			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr3:50404847G>A	ENST00000479441.1	-	28	2399	c.2400C>T	c.(2398-2400)gtC>gtT	p.V800V	XXcos-LUCA11.5_ENST00000606589.1_Intron|XXcos-LUCA11.4_ENST00000606665.1_RNA|CACNA2D2_ENST00000360963.3_Silent_p.V724V|XXcos-LUCA11.4_ENST00000607088.1_RNA|XXcos-LUCA11.4_ENST00000607362.1_RNA|XXcos-LUCA11.4_ENST00000606259.1_RNA|CACNA2D2_ENST00000395083.1_Silent_p.V793V|CACNA2D2_ENST00000424201.2_Silent_p.V793V|CACNA2D2_ENST00000266039.3_Silent_p.V793V|CACNA2D2_ENST00000429770.1_Silent_p.V793V|XXcos-LUCA11.4_ENST00000607121.1_RNA|CACNA2D2_ENST00000423994.2_Silent_p.V800V|XXcos-LUCA11.4_ENST00000607583.1_RNA|CACNA2D2_ENST00000435965.1_Silent_p.V800V			Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 2	800					energy reserve metabolic process (GO:0006112)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|positive regulation of organ growth (GO:0046622)|regulation of insulin secretion (GO:0050796)|regulation of multicellular organism growth (GO:0040014)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|cervix(1)|endometrium(4)|large_intestine(4)|lung(8)|ovary(2)|prostate(4)|skin(4)|urinary_tract(1)	31				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Amiodarone(DB01118)|Bepridil(DB01244)|Felodipine(DB01023)|Gabapentin(DB00996)|Isradipine(DB00270)|Nitrendipine(DB01054)|Spironolactone(DB00421)	GGGGCTTGAAGACATAACCGT	0.617																																						dbGAP											0													68.0	62.0	64.0					3																	50404847		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF040709	CCDS33763.1, CCDS54588.1, CCDS63647.1	3p21.3	2004-02-27			ENSG00000007402	ENSG00000007402		"""Calcium channel subunits"""	1400	protein-coding gene	gene with protein product	"""gene 26"""	607082					Standard	XM_005265581		Approved	KIAA0558	uc003daq.3	Q9NY47	OTTHUMG00000156887	ENST00000479441.1:c.2400C>T	3.37:g.50404847G>A			A7MD15|Q9NY48|Q9UEW0|Q9Y268	Silent	SNP	pfam_VWA_N,pfam_VDCC_a2/dsu,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.V800	ENST00000479441.1	37	c.2400	CCDS54588.1	3																																																																																			CACNA2D2	-	NULL	ENSG00000007402		0.617	CACNA2D2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	CACNA2D2	HGNC	protein_coding	OTTHUMT00000346457.1	47	0.00	0	G	NM_006030		50404847	50404847	-1	no_errors	ENST00000435965	ensembl	human	known	69_37n	silent	45	39.19	29	SNP	1.000	A
CASZ1	54897	genome.wustl.edu	37	1	10709343	10709343	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr1:10709343C>T	ENST00000377022.3	-	14	3349	c.3032G>A	c.(3031-3033)cGc>cAc	p.R1011H	CASZ1_ENST00000344008.5_Missense_Mutation_p.R1011H|RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	1011					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		CCCTCACCTGCGCAGGTACAC	0.692																																						dbGAP											0													27.0	27.0	27.0					1																	10709343		2189	4295	6484	-	-	-	SO:0001583	missense	0			AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.3032G>A	1.37:g.10709343C>T	ENSP00000366221:p.Arg1011His		Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R1011H	ENST00000377022.3	37	c.3032	CCDS41246.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.262591	0.95399	.	.	ENSG00000130940	ENST00000377022;ENST00000344008	.	.	.	4.78	4.78	0.61160	.	0.049914	0.85682	D	0.000000	T	0.77039	0.4072	L	0.56769	1.78	0.51233	D	0.999918	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.79874	-0.1619	9	0.87932	D	0	.	18.2231	0.89907	0.0:1.0:0.0:0.0	.	1011;1011	Q86V15-2;Q86V15	.;CASZ1_HUMAN	H	1011	.	ENSP00000339445:R1011H	R	-	2	0	CASZ1	10631930	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	6.984000	0.76186	2.370000	0.80446	0.448000	0.29417	CGC	CASZ1	-	NULL	ENSG00000130940		0.692	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CASZ1	HGNC	protein_coding	OTTHUMT00000005673.2	35	0.00	0	C	NM_017766		10709343	10709343	-1	no_errors	ENST00000377022	ensembl	human	known	69_37n	missense	10	37.50	6	SNP	1.000	T
DDX4	54514	genome.wustl.edu	37	5	55094277	55094277	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr5:55094277C>T	ENST00000505374.1	+	18	1585	c.1493C>T	c.(1492-1494)tCa>tTa	p.S498L	DDX4_ENST00000353507.5_Missense_Mutation_p.S464L|DDX4_ENST00000354991.5_Missense_Mutation_p.S464L|DDX4_ENST00000514278.2_Missense_Mutation_p.S478L|DDX4_ENST00000511853.1_Missense_Mutation_p.S349L	NM_024415.2	NP_077726.1	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4	498	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				male meiosis I (GO:0007141)|multicellular organismal development (GO:0007275)|regulation of protein localization (GO:0032880)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pi-body (GO:0071546)|piP-body (GO:0071547)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	24		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				TTTTTAAAGTCAAATTATCTG	0.398																																						dbGAP											0													158.0	157.0	157.0					5																	55094277		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF262962	CCDS3969.1, CCDS47208.1, CCDS54854.1, CCDS54855.1	5p15.2-p13.1	2008-02-05	2003-06-13		ENSG00000152670	ENSG00000152670		"""DEAD-boxes"""	18700	protein-coding gene	gene with protein product		605281	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 4"""			10920202, 11850529	Standard	NM_001142549		Approved	VASA	uc003jqg.4	Q9NQI0	OTTHUMG00000097044	ENST00000505374.1:c.1493C>T	5.37:g.55094277C>T	ENSP00000424838:p.Ser498Leu		A8K8Q2|B3KSF4|D6RDK4|E9PCD8|Q5M7Z3|Q86VX0|Q9NT92|Q9NYB1	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.S498L	ENST00000505374.1	37	c.1493	CCDS3969.1	5	.	.	.	.	.	.	.	.	.	.	C	11.27	1.590310	0.28357	.	.	ENSG00000152670	ENST00000353507;ENST00000514278;ENST00000505374;ENST00000506511;ENST00000354991;ENST00000511853	D;D;D;T;D;D	0.91843	-2.92;-2.92;-2.92;3.47;-2.92;-2.92	5.39	2.68	0.31781	DEAD-like helicase (2);	0.867437	0.10257	N	0.696466	D	0.88100	0.6346	L	0.42744	1.35	0.09310	N	1	B;B;B;B	0.06786	0.001;0.001;0.001;0.001	B;B;B;B	0.12837	0.005;0.001;0.008;0.003	T	0.76105	-0.3081	10	0.39692	T	0.17	-24.7685	9.626	0.39750	0.0:0.72:0.0:0.28	.	478;349;464;498	D6RDK4;E9PCD8;Q9NQI0-2;Q9NQI0	.;.;.;DDX4_HUMAN	L	464;478;498;478;464;349	ENSP00000334167:S464L;ENSP00000425359:S478L;ENSP00000424838:S498L;ENSP00000427167:S478L;ENSP00000347087:S464L;ENSP00000423123:S349L	ENSP00000334167:S464L	S	+	2	0	DDX4	55130034	0.000000	0.05858	0.042000	0.18584	0.890000	0.51754	0.619000	0.24388	0.361000	0.24292	-0.136000	0.14681	TCA	DDX4	-	smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000152670		0.398	DDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX4	HGNC	protein_coding	OTTHUMT00000214147.2	153	0.65	1	C	NM_024415		55094277	55094277	+1	no_errors	ENST00000505374	ensembl	human	known	69_37n	missense	188	26.85	69	SNP	0.003	T
DHX37	57647	genome.wustl.edu	37	12	125449009	125449009	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr12:125449009C>A	ENST00000308736.2	-	15	2074	c.1976G>T	c.(1975-1977)tGg>tTg	p.W659L	DHX37_ENST00000544745.1_Missense_Mutation_p.W446L	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	659	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.						ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		CTGGGAGACCCAGGTGACACG	0.627																																						dbGAP											0													116.0	101.0	106.0					12																	125449009		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.1976G>T	12.37:g.125449009C>A	ENSP00000311135:p.Trp659Leu		Q9BUI7|Q9P211	Missense_Mutation	SNP	pfam_DUF1605,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_T2SS_protein-E,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.W659L	ENST00000308736.2	37	c.1976	CCDS9261.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.7|28.7	4.944832|4.944832	0.92593|0.92593	.|.	.|.	ENSG00000150990|ENSG00000150990	ENST00000543962|ENST00000308736;ENST00000544745	.|T;T	.|0.75050	.|-0.9;-0.9	5.17|5.17	5.17|5.17	0.71159|0.71159	.|Helicase, C-terminal (3);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.88511|0.88511	0.6456|0.6456	M|M	0.93375|0.93375	3.41|3.41	0.80722|0.80722	D|D	1|1	.|D	.|0.54601	.|0.967	.|P	.|0.58620	.|0.842	D|D	0.91553|0.91553	0.5258|0.5258	6|10	0.87932|0.72032	D|D	0|0.01	-18.5972|-18.5972	18.2623|18.2623	0.90039|0.90039	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|659	.|Q8IY37	.|DHX37_HUMAN	W|L	111|659;446	.|ENSP00000311135:W659L;ENSP00000439009:W446L	ENSP00000443661:G111W|ENSP00000311135:W659L	G|W	-|-	1|2	0|0	DHX37|DHX37	124014962|124014962	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.624000|0.624000	0.37722|0.37722	5.699000|5.699000	0.68310|0.68310	2.419000|2.419000	0.82065|0.82065	0.462000|0.462000	0.41574|0.41574	GGG|TGG	DHX37	-	pfam_Helicase_C,smart_Helicase_C,pfscan_Helicase_C	ENSG00000150990		0.627	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX37	HGNC	protein_coding		46	0.00	0	C	NM_032656		125449009	125449009	-1	no_errors	ENST00000308736	ensembl	human	known	69_37n	missense	32	31.91	15	SNP	1.000	A
DNAL1	83544	genome.wustl.edu	37	14	74156135	74156135	+	Missense_Mutation	SNP	A	A	G	rs387907021		TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr14:74156135A>G	ENST00000553645.2	+	7	490	c.449A>G	c.(448-450)aAt>aGt	p.N150S	DNAL1_ENST00000554339.1_Missense_Mutation_p.N63S|DNAL1_ENST00000540526.1_Missense_Mutation_p.N111S|DNAL1_ENST00000554871.1_Missense_Mutation_p.N111S|DNAL1_ENST00000311089.3_Missense_Mutation_p.N37S	NM_031427.3	NP_113615.2	Q4LDG9	DNAL1_HUMAN	dynein, axonemal, light chain 1	150	LRRCT.		N -> S (in CILD16). {ECO:0000269|PubMed:21496787}.							kidney(1)|lung(2)	3				BRCA - Breast invasive adenocarcinoma(234;0.00384)|KIRC - Kidney renal clear cell carcinoma(182;0.095)		TTTGTAGGCAATCCCTTGGAA	0.413																																						dbGAP											0													74.0	73.0	74.0					14																	74156135		1883	4101	5984	-	-	-	SO:0001583	missense	0			BC005343	CCDS45134.1, CCDS55928.1	14q24.3	2012-05-03	2006-09-04	2006-09-04	ENSG00000119661	ENSG00000119661			23247	protein-coding gene	gene with protein product		610062	"""chromosome 14 open reading frame 168"""	C14orf168		15845866	Standard	NM_031427		Approved	MGC12435, 1700010H15RiK, CILD16	uc001xoq.4	Q4LDG9		ENST00000553645.2:c.449A>G	14.37:g.74156135A>G	ENSP00000452037:p.Asn150Ser		B2RD38|Q5JPB7|Q9BS43	Missense_Mutation	SNP	NULL	p.N150S	ENST00000553645.2	37	c.449	CCDS45134.1	14	.	.	.	.	.	.	.	.	.	.	A	28.3	4.910298	0.92107	.	.	ENSG00000119661	ENST00000554113;ENST00000555631;ENST00000553645;ENST00000311089;ENST00000554339;ENST00000554871;ENST00000540526	T;T;T;T;T;T	0.56776	0.44;0.44;0.44;0.44;0.44;0.44	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.78020	0.4218	M	0.89968	3.075	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.83156	-0.0101	10	0.87932	D	0	-7.8249	15.933	0.79679	1.0:0.0:0.0:0.0	.	150	Q4LDG9	DNAL1_HUMAN	S	37;37;150;37;63;111;111	ENSP00000452368:N37S;ENSP00000452037:N150S;ENSP00000310360:N37S;ENSP00000450744:N63S;ENSP00000451834:N111S;ENSP00000439695:N111S	ENSP00000310360:N150S	N	+	2	0	DNAL1	73225888	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.251000	0.95483	2.155000	0.67459	0.460000	0.39030	AAT	DNAL1	-	NULL	ENSG00000119661		0.413	DNAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAL1	HGNC	protein_coding	OTTHUMT00000414565.2	67	0.00	0	A	NM_031427		74156135	74156135	+1	no_errors	ENST00000553645	ensembl	human	known	69_37n	missense	62	24.39	20	SNP	1.000	G
ELF2	1998	genome.wustl.edu	37	4	139981717	139981717	+	Silent	SNP	G	G	T			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr4:139981717G>T	ENST00000394235.2	-	9	1384	c.882C>A	c.(880-882)acC>acA	p.T294T	ELF2_ENST00000379550.1_Silent_p.T306T|ELF2_ENST00000379549.2_Silent_p.T217T|ELF2_ENST00000515489.1_5'UTR|ELF2_ENST00000510408.1_Silent_p.T234T|ELF2_ENST00000265495.4_Silent_p.T294T|ELF2_ENST00000358635.3_Silent_p.T246T	NM_001276458.1	NP_001263387.1			E74-like factor 2 (ets domain transcription factor)											endometrium(1)|kidney(4)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	19	all_hematologic(180;0.162)					CTTCATTACAGGTTTCACTTT	0.408																																						dbGAP											0													121.0	114.0	116.0					4																	139981717		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF256222	CCDS3744.1, CCDS3745.1, CCDS64062.1, CCDS64063.1	4q28	2008-02-05			ENSG00000109381	ENSG00000109381			3317	protein-coding gene	gene with protein product						8756667	Standard	NM_201999		Approved	EU32, NERF, NERF-2, NERF-1A, NERF-1B	uc003ihm.2	Q15723	OTTHUMG00000133383	ENST00000394235.2:c.882C>A	4.37:g.139981717G>T				Silent	SNP	pfam_TF_Elf_N,pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	p.T306	ENST00000394235.2	37	c.918	CCDS3744.1	4																																																																																			ELF2	-	NULL	ENSG00000109381		0.408	ELF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELF2	HGNC	protein_coding	OTTHUMT00000257233.2	51	0.00	0	G	NM_006874		139981717	139981717	-1	no_errors	ENST00000379550	ensembl	human	known	69_37n	silent	31	40.38	21	SNP	0.863	T
FBLN2	2199	genome.wustl.edu	37	3	13669372	13669372	+	Silent	SNP	G	G	A			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr3:13669372G>A	ENST00000295760.7	+	10	2400	c.2331G>A	c.(2329-2331)ccG>ccA	p.P777P	FBLN2_ENST00000535798.1_Silent_p.P803P|FBLN2_ENST00000404922.3_Silent_p.P824P|FBLN2_ENST00000492059.1_Silent_p.P824P	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	777	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			CCTGCCAGCCGGGCTTCTTGT	0.627																																						dbGAP											0													37.0	41.0	40.0					3																	13669372		2071	4201	6272	-	-	-	SO:0001819	synonymous_variant	0			X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.2331G>A	3.37:g.13669372G>A			B7Z9C5|Q8IUI0|Q8IUI1	Silent	SNP	pfam_EGF-like_Ca-bd,pfam_Anaphylatoxin/fibulin,superfamily_Anaphylatoxin_,smart_EGF-like,smart_Anaphylatoxin/fibulin,smart_EGF-like_Ca-bd,pfscan_Anaphylatoxin/fibulin,pfscan_EG-like_dom	p.P824	ENST00000295760.7	37	c.2472	CCDS46762.1	3																																																																																			FBLN2	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like	ENSG00000163520		0.627	FBLN2-002	KNOWN	basic|CCDS	protein_coding	FBLN2	HGNC	protein_coding	OTTHUMT00000340083.3	27	0.00	0	G	NM_001004019		13669372	13669372	+1	no_errors	ENST00000404922	ensembl	human	known	69_37n	silent	22	37.14	13	SNP	0.000	A
HEY1	23462	genome.wustl.edu	37	8	80677525	80677525	+	Silent	SNP	G	G	A			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr8:80677525G>A	ENST00000354724.3	-	5	1012	c.813C>T	c.(811-813)ttC>ttT	p.F271F	HEY1_ENST00000523976.1_Silent_p.F181F|HEY1_ENST00000435063.2_5'UTR|HEY1_ENST00000337919.5_Silent_p.F275F|RP11-27N21.3_ENST00000607172.1_lincRNA	NM_012258.3	NP_036390.3	Q9Y5J3	HEY1_HUMAN	hes-related family bHLH transcription factor with YRPW motif 1	271					angiogenesis (GO:0001525)|anterior/posterior axis specification (GO:0009948)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular valve formation (GO:0003190)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac septum morphogenesis (GO:0060411)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to glucocorticoid stimulus (GO:0071385)|dorsal aorta morphogenesis (GO:0035912)|endocardial cushion morphogenesis (GO:0003203)|endocardial cushion to mesenchymal transition involved in heart valve formation (GO:0003199)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000820)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve morphogenesis (GO:0003184)|regulation of vasculogenesis (GO:2001212)|transcription from RNA polymerase II promoter (GO:0006366)|umbilical cord morphogenesis (GO:0036304)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		HEY1/NCOA2(10)	cervix(1)|kidney(2)|large_intestine(5)|lung(14)	22	all_lung(9;5.1e-05)		Epithelial(68;0.076)|all cancers(69;0.179)			ACAGTAAGTGGAAGGAGCCGA	0.607			T	NCOA2	mesenchymal chondrosarcoma						OREG0018837	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP		Dom	yes		8	8q21	23462	hairy/enhancer-of-split related with YRPW motif 1		M	0													34.0	24.0	27.0					8																	80677525		2185	4272	6457	-	-	-	SO:0001819	synonymous_variant	0			AF151522	CCDS6225.1, CCDS43749.1, CCDS64915.1	8q21	2013-10-17	2013-10-17					"""Basic helix-loop-helix proteins"""	4880	protein-coding gene	gene with protein product		602953	"""hairy/enhancer-of-split related with YRPW motif 1"""			10415358, 10403790	Standard	NM_001040708		Approved	HESR-1, CHF2, HESR1, HRT-1, CHF-2, HERP2, BHLHb31	uc003ybl.3	Q9Y5J3		ENST00000354724.3:c.813C>T	8.37:g.80677525G>A		1200	B2R883|Q5TZS3|Q8NAM2|Q9NYP4	Silent	SNP	pfam_HLH_DNA-bd,pfam_Orange,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_Orange_subgr,pfscan_Orange,pfscan_HLH_DNA-bd	p.F275	ENST00000354724.3	37	c.825	CCDS6225.1	8																																																																																			HEY1	-	NULL	ENSG00000164683		0.607	HEY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HEY1	HGNC	protein_coding	OTTHUMT00000379516.1	44	0.00	0	G	NM_012258		80677525	80677525	-1	no_errors	ENST00000337919	ensembl	human	known	69_37n	silent	50	35.06	27	SNP	0.997	A
HLA-DRB1	3123	genome.wustl.edu	37	6	32549548	32549548	+	Silent	SNP	G	G	A	rs2308764	byFrequency	TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr6:32549548G>A	ENST00000360004.5	-	3	543	c.438C>T	c.(436-438)tgC>tgT	p.C146C		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	146	Beta-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)				large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						CACTCACAGAGCAGACCAGGA	0.522										Multiple Myeloma(14;0.17)																												dbGAP											0													107.0	128.0	120.0					6																	32549548		1511	2709	4220	-	-	-	SO:0001819	synonymous_variant	0			AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.438C>T	6.37:g.32549548G>A			P01914|Q9MYF5	Silent	SNP	pfam_MHC_II_b_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like	p.C146	ENST00000360004.5	37	c.438	CCDS47409.1	6																																																																																			HLA-DRB1	-	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like	ENSG00000196126		0.522	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DRB1	HGNC	protein_coding	OTTHUMT00000076393.3	37	0.00	0	G	NM_002124		32549548	32549548	-1	no_errors	ENST00000360004	ensembl	human	known	69_37n	silent	81	18.18	18	SNP	1.000	A
HLA-DRB1	3123	genome.wustl.edu	37	6	32549563	32549563	+	Silent	SNP	G	G	A	rs77689370	byFrequency	TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr6:32549563G>A	ENST00000360004.5	-	3	528	c.423C>T	c.(421-423)caC>caT	p.H141H		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	141	Beta-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)				large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						CCAGGAGGTTGTGGTGCTGCA	0.517										Multiple Myeloma(14;0.17)																												dbGAP											0													92.0	112.0	105.0					6																	32549563		1511	2709	4220	-	-	-	SO:0001819	synonymous_variant	0			AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.423C>T	6.37:g.32549563G>A			P01914|Q9MYF5	Silent	SNP	pfam_MHC_II_b_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like	p.H141	ENST00000360004.5	37	c.423	CCDS47409.1	6																																																																																			HLA-DRB1	-	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like	ENSG00000196126		0.517	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DRB1	HGNC	protein_coding	OTTHUMT00000076393.3	34	0.00	0	G	NM_002124		32549563	32549563	-1	no_errors	ENST00000360004	ensembl	human	known	69_37n	silent	82	18.00	18	SNP	1.000	A
IGHA1	3493	genome.wustl.edu	37	14	106174399	106174399	+	RNA	SNP	G	G	T			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr14:106174399G>T	ENST00000390547.2	-	0	389							P01876	IGHA1_HUMAN	immunoglobulin heavy constant alpha 1						antibacterial humoral response (GO:0019731)|glomerular filtration (GO:0003094)|immune response (GO:0006955)|positive regulation of respiratory burst (GO:0060267)|protein-chromophore linkage (GO:0018298)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|monomeric IgA immunoglobulin complex (GO:0071748)|secretory dimeric IgA immunoglobulin complex (GO:0071752)|secretory IgA immunoglobulin complex (GO:0071751)	antigen binding (GO:0003823)										GGGCCGGTCGGTGCAGTGACA	0.612																																						dbGAP											0													41.0	47.0	45.0					14																	106174399		2129	4224	6353	-	-	-			0			J00220		14q32.33	2012-10-02			ENSG00000211895	ENSG00000211895		"""Immunoglobulins / IGH locus"""	5478	other	immunoglobulin gene		146900					Standard	NG_001019		Approved			P01876	OTTHUMG00000152494		14.37:g.106174399G>T				Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	p.H130Q	ENST00000390547.2	37	c.390		14																																																																																			IGHA1	-	pfscan_Ig-like	ENSG00000211895		0.612	IGHA1-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IGHA1	HGNC	IG_C_gene	OTTHUMT00000326459.1	59	0.00	0	G	NG_001019		106174399	106174399	-1	no_start_codon	ENST00000390547	ensembl	human	known	69_37n	missense	53	40.45	36	SNP	0.005	T
IREB2	3658	genome.wustl.edu	37	15	78783006	78783006	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr15:78783006T>G	ENST00000258886.8	+	18	2376	c.2227T>G	c.(2227-2229)Tta>Gta	p.L743V		NM_004136.2	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2	743					aging (GO:0007568)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|erythrocyte homeostasis (GO:0034101)|intestinal absorption (GO:0050892)|iron ion transport (GO:0006826)|osteoclast differentiation (GO:0030316)|post-embryonic development (GO:0009791)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to iron(II) ion (GO:0010040)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|translation repressor activity (GO:0030371)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	41				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		TGCCCATGTCTTATTATATTT	0.388																																					NSCLC(200;764 2208 35157 49871 50830)	dbGAP											0													142.0	145.0	144.0					15																	78783006		2196	4293	6489	-	-	-	SO:0001583	missense	0			M58511	CCDS10302.1	15q25.1	2013-09-20			ENSG00000136381	ENSG00000136381			6115	protein-coding gene	gene with protein product		147582				2172968	Standard	NM_004136		Approved	IRP2	uc002bdr.2	P48200	OTTHUMG00000143861	ENST00000258886.8:c.2227T>G	15.37:g.78783006T>G	ENSP00000258886:p.Leu743Val		A8KAC7|E1CJT9|H0YKU0|Q13095|Q1HE21|Q59FQ7|Q8WVK6|Q9UF17	Missense_Mutation	SNP	pfam_Acoase/IPM_deHydtase_lsu_aba,pfam_AconitaseA/IPMdHydase_ssu_swvl,superfamily_Acoase/IPM_deHydtase_lsu_aba,superfamily_Aconitase/3IPM_dehydase_swvl,prints_Acoase/IPM_deHydtase_lsu_aba,tigrfam_Aconitase/Fe_reg_prot_2	p.L743V	ENST00000258886.8	37	c.2227	CCDS10302.1	15	.	.	.	.	.	.	.	.	.	.	T	20.4	3.988862	0.74589	.	.	ENSG00000136381	ENST00000258886	T	0.30714	1.52	6.16	-1.59	0.08453	Aconitase/3-isopropylmalate dehydratase, swivel (2);	0.000000	0.64402	D	0.000001	T	0.60547	0.2277	H	0.94734	3.575	0.80722	D	1	D	0.53312	0.959	D	0.68192	0.956	T	0.67313	-0.5702	10	0.62326	D	0.03	.	12.5588	0.56269	0.0:0.4685:0.0:0.5315	.	743	P48200	IREB2_HUMAN	V	743	ENSP00000258886:L743V	ENSP00000258886:L743V	L	+	1	2	IREB2	76570061	0.626000	0.27120	0.041000	0.18516	0.997000	0.91878	0.348000	0.20031	-0.531000	0.06340	0.528000	0.53228	TTA	IREB2	-	superfamily_Aconitase/3IPM_dehydase_swvl,tigrfam_Aconitase/Fe_reg_prot_2	ENSG00000136381		0.388	IREB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IREB2	HGNC	protein_coding	OTTHUMT00000290109.3	66	0.00	0	T	NM_004136		78783006	78783006	+1	no_errors	ENST00000258886	ensembl	human	known	69_37n	missense	60	11.76	8	SNP	0.407	G
ITPKB	3707	genome.wustl.edu	37	1	226924884	226924885	+	In_Frame_Ins	INS	-	-	CCA	rs147889095	byFrequency	TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr1:226924884_226924885insCCA	ENST00000272117.3	-	1	274_275	c.275_276insTGG	c.(274-276)agc>agTGGc	p.92_93insG	ITPKB_ENST00000429204.1_In_Frame_Ins_p.92_93insG|ITPKB_ENST00000366784.1_In_Frame_Ins_p.92_93insG			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	92					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				tactgccgctgctgccgctgcc	0.752																																					Colon(84;110 1851 5306 33547)	dbGAP											0										569,2567		147,275,1146						0.9	1.0		dbSNP_120	5	1387,5285		295,797,2244	no	coding	ITPKB	NM_002221.3		442,1072,3390	A1A1,A1R,RR		20.7884,18.1441,19.9429				1956,7852				-	-	-	SO:0001652	inframe_insertion	0			AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.275_276insTGG	1.37:g.226924884_226924885insCCA	ENSP00000272117:p.Ser92_Ser93insGly		Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	In_Frame_Ins	INS	pfam_IPK	p.93in_frame_insG	ENST00000272117.3	37	c.276_275	CCDS1555.1	1																																																																																			ITPKB	-	NULL	ENSG00000143772		0.752	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPKB	HGNC	protein_coding	OTTHUMT00000091632.1	12	0.00	0	-	NM_002221		226924884	226924885	-1	no_errors	ENST00000272117	ensembl	human	known	69_37n	in_frame_ins	5	28.57	2	INS	0.091:0.097	CCA
KGFLP2	654466	genome.wustl.edu	37	9	41962602	41962602	+	lincRNA	SNP	G	G	C	rs201713470	byFrequency	TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr9:41962602G>C	ENST00000454645.1	-	0	902					NR_003670.1																						TTCTTTCTTTGTTTTTTTTCC	0.373																																						dbGAP											0																																										-	-	-			0																															9.37:g.41962602G>C				RNA	SNP	-	NULL	ENST00000454645.1	37	NULL		9																																																																																			RP11-204M4.2	-	-	ENSG00000204837		0.373	RP11-204M4.2-001	KNOWN	basic	lincRNA	KGFLP2	Clone_based_vega_gene	lincRNA	OTTHUMT00000143738.1	42	0.00	0	G			41962602	41962602	-1	no_errors	ENST00000454645	ensembl	human	known	69_37n	rna	68	12.82	10	SNP	0.999	C
MAMDC4	158056	genome.wustl.edu	37	9	139752492	139752492	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr9:139752492C>A	ENST00000317446.2	+	20	2576	c.2526C>A	c.(2524-2526)caC>caA	p.H842Q	MAMDC4_ENST00000445819.1_Missense_Mutation_p.H921Q|MAMDC4_ENST00000485732.1_3'UTR	NM_206920.2	NP_996803.2			MAM domain containing 4											breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	19	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		TCAGTGCCCACGGCGGGCTTG	0.736																																						dbGAP											0													5.0	9.0	8.0					9																	139752492		1931	3827	5758	-	-	-	SO:0001583	missense	0			AL834531	CCDS7010.1	9q34.3	2013-10-21			ENSG00000177943	ENSG00000177943			24083	protein-coding gene	gene with protein product	"""apical early endosomal glycoprotein precursor"", ""endotubin"""					7829488	Standard	NM_206920		Approved	AEGP, DKFZp434M1411	uc004cjs.3	Q6UXC1	OTTHUMG00000020951	ENST00000317446.2:c.2526C>A	9.37:g.139752492C>A	ENSP00000319388:p.His842Gln			Missense_Mutation	SNP	pfam_MAM_dom,pfam_LDrepeatLR_classA_rpt,superfamily_ConA-like_lec_gl,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_MAM_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom	p.H921Q	ENST00000317446.2	37	c.2763	CCDS7010.1	9	.	.	.	.	.	.	.	.	.	.	.	7.895	0.733210	0.15574	.	.	ENSG00000177943	ENST00000317446;ENST00000445819	T;T	0.01918	4.56;4.56	4.8	-9.6	0.00553	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	1.570730	0.03654	N	0.241454	T	0.02083	0.0065	L	0.43701	1.375	0.09310	N	0.999992	B;P	0.48407	0.16;0.91	B;B	0.44085	0.191;0.44	T	0.30416	-0.9979	10	0.11794	T	0.64	-0.3037	5.1586	0.15048	0.1521:0.6006:0.1145:0.1328	.	921;842	Q6UXC1;Q6UXC1-2	AEGP_HUMAN;.	Q	842;921	ENSP00000319388:H842Q;ENSP00000411339:H921Q	ENSP00000319388:H842Q	H	+	3	2	MAMDC4	138872313	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-4.143000	0.00286	-2.547000	0.00482	-1.288000	0.01363	CAC	MAMDC4	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl,smart_MAM_dom,pfscan_MAM_dom	ENSG00000177943		0.736	MAMDC4-005	KNOWN	basic|CCDS	protein_coding	MAMDC4	HGNC	protein_coding	OTTHUMT00000254642.3	13	0.00	0	C	NM_206920		139752492	139752492	+1	no_errors	ENST00000445819	ensembl	human	known	69_37n	missense	2	66.67	4	SNP	0.000	A
MEN1	4221	genome.wustl.edu	37	11	64572092	64572093	+	Frame_Shift_Ins	INS	-	-	G			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr11:64572092_64572093insG	ENST00000337652.1	-	10	2064_2065	c.1561_1562insC	c.(1561-1563)cggfs	p.R521fs	MEN1_ENST00000312049.6_Frame_Shift_Ins_p.R516fs|MEN1_ENST00000394376.1_Frame_Shift_Ins_p.R521fs|MAP4K2_ENST00000468062.1_5'Flank|MEN1_ENST00000478548.1_5'UTR|MEN1_ENST00000377313.1_Frame_Shift_Ins_p.R521fs|MEN1_ENST00000315422.4_Frame_Shift_Ins_p.R516fs|MEN1_ENST00000394374.2_Frame_Shift_Ins_p.R521fs|MEN1_ENST00000377316.2_Frame_Shift_Ins_p.R461fs|MEN1_ENST00000377321.1_Frame_Shift_Ins_p.R481fs|MAP4K2_ENST00000377350.3_5'Flank|MAP4K2_ENST00000294066.2_5'Flank|MEN1_ENST00000377326.3_Frame_Shift_Ins_p.R516fs|MEN1_ENST00000443283.1_Frame_Shift_Ins_p.R521fs	NM_130803.2	NP_570715	O00255	MEN1_HUMAN	multiple endocrine neoplasia I	521					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)	p.R516fs*15(3)		NS(7)|adrenal_gland(5)|breast(2)|central_nervous_system(5)|endometrium(1)|gastrointestinal_tract_(site_indeterminate)(15)|large_intestine(2)|lung(21)|ovary(1)|pancreas(64)|parathyroid(181)|pituitary(7)|prostate(4)|retroperitoneum(1)|skin(1)|small_intestine(13)|soft_tissue(4)|stomach(1)|thymus(2)	337						AGGAGGCTTCCGGGGGGGTCCT	0.713			"""D, Mis, N, F, S"""		"""parathyroid tumors, Pancreatic neuroendocrine tumors"""	"""parathyroid adenoma, pituitary adenoma, pancreatic islet cell, carcinoid"""			Multiple Endocrine Neoplasia, type 1;Hyperparathyroidism, Familial Isolated																												Esophageal Squamous(1;83 158 15500 18603 18803 29295)	dbGAP	yes	Rec	yes	Multiple Endocrine Neoplasia Type 1	11	11q13	4221	multiple endocrine neoplasia type 1 gene		E	3	Insertion - Frameshift(3)	parathyroid(2)|large_intestine(1)	GRCh37	CD972318|CI972640|CM080439	MEN1	D|I|M																																				-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	MEN1, Wermer disease;FIHP, FIHPT, HRPT1, Familial Isolated Primary Hyperparathyroidism	U93236	CCDS8083.1, CCDS31600.1	11q13	2014-09-17			ENSG00000133895	ENSG00000133895			7010	protein-coding gene	gene with protein product	"""menin"""	613733					Standard	NM_130799		Approved		uc001obn.3	O00255	OTTHUMG00000045366	ENST00000337652.1:c.1562dupC	11.37:g.64572099_64572099dupG	ENSP00000337088:p.Arg521fs		A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Frame_Shift_Ins	INS	pfam_Menin	p.R521fs	ENST00000337652.1	37	c.1562_1561	CCDS8083.1	11																																																																																			MEN1	-	pfam_Menin	ENSG00000133895		0.713	MEN1-201	KNOWN	basic|CCDS	protein_coding	MEN1	HGNC	protein_coding	OTTHUMT00000143881.1	21	0.00	0	-			64572092	64572093	-1	no_errors	ENST00000337652	ensembl	human	known	69_37n	frame_shift_ins	14	53.33	16	INS	1.000:0.999	G
MMGT1	93380	genome.wustl.edu	37	X	135053263	135053263	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chrX:135053263G>A	ENST00000305963.2	-	2	473	c.86C>T	c.(85-87)tCt>tTt	p.S29F	MMGT1_ENST00000433339.2_Missense_Mutation_p.S94F	NM_173470.1	NP_775741.1	Q8N4V1	MMGT1_HUMAN	membrane magnesium transporter 1	29					magnesium ion transport (GO:0015693)	early endosome (GO:0005769)|ER membrane protein complex (GO:0072546)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	magnesium ion transmembrane transporter activity (GO:0015095)			cervix(1)|endometrium(1)|kidney(1)	3						TCGCATATAAGAACGATCTAT	0.318																																						dbGAP											0													157.0	148.0	151.0					X																	135053263		2203	4299	6502	-	-	-	SO:0001583	missense	0			AL157477	CCDS14653.1	Xq26.3	2012-05-23	2008-11-21	2008-11-21	ENSG00000169446	ENSG00000169446			28100	protein-coding gene	gene with protein product	"""ER membrane protein complex subunit 5"""		"""transmembrane protein 32"""	TMEM32		18057121, 22119785	Standard	NM_173470		Approved	EMC5	uc004ezi.1	Q8N4V1	OTTHUMG00000022499	ENST00000305963.2:c.86C>T	X.37:g.135053263G>A	ENSP00000306220:p.Ser29Phe		B2R625|B4DIY3|D3DWG7|Q5JPP7	Missense_Mutation	SNP	pfam_Magnesium_transport	p.S94F	ENST00000305963.2	37	c.281	CCDS14653.1	X	.	.	.	.	.	.	.	.	.	.	G	18.72	3.684651	0.68157	.	.	ENSG00000169446	ENST00000305963;ENST00000433339	.	.	.	5.17	4.29	0.51040	.	0.056069	0.64402	D	0.000001	T	0.66781	0.2824	L	0.47716	1.5	0.53688	D	0.99997	D;P	0.76494	0.999;0.948	D;P	0.65010	0.931;0.701	T	0.66925	-0.5800	9	0.49607	T	0.09	.	13.0534	0.58967	0.0:0.0:0.8378:0.1622	.	94;29	Q8N4V1-2;Q8N4V1	.;MMGT1_HUMAN	F	29;94	.	ENSP00000306220:S29F	S	-	2	0	MMGT1	134880929	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.606000	0.82863	1.052000	0.40392	0.594000	0.82650	TCT	MMGT1	-	pfam_Magnesium_transport	ENSG00000169446		0.318	MMGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMGT1	HGNC	protein_coding	OTTHUMT00000058453.3	88	0.00	0	G	NM_173470		135053263	135053263	-1	no_errors	ENST00000433339	ensembl	human	known	69_37n	missense	89	10.10	10	SNP	1.000	A
MTOR	2475	genome.wustl.edu	37	1	11294317	11294317	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr1:11294317C>G	ENST00000361445.4	-	14	2290	c.2214G>C	c.(2212-2214)ttG>ttC	p.L738F		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	738					cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	CCAACTCTGTCAAAATCTGTA	0.517																																						dbGAP											0													130.0	139.0	136.0					1																	11294317		2203	4300	6503	-	-	-	SO:0001583	missense	0			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.2214G>C	1.37:g.11294317C>G	ENSP00000354558:p.Leu738Phe		Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_DUF3385_TOR,pfam_FKBP_rapamycin-assoc_FKBP12-bd,pfam_FATC,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,superfamily_FKBP_rapamycin-assoc_FKBP12-bd,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.L738F	ENST00000361445.4	37	c.2214	CCDS127.1	1	.	.	.	.	.	.	.	.	.	.	C	17.71	3.457649	0.63401	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.75050	-0.9	5.7	4.78	0.61160	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000006	D	0.87935	0.6303	H	0.94658	3.565	0.80722	D	1	D	0.69078	0.997	D	0.64237	0.923	D	0.89949	0.4078	10	0.87932	D	0	.	10.5439	0.45050	0.0:0.7874:0.1357:0.0769	.	738	P42345	MTOR_HUMAN	F	738	ENSP00000354558:L738F	ENSP00000354558:L738F	L	-	3	2	MTOR	11216904	1.000000	0.71417	0.997000	0.53966	0.975000	0.68041	2.394000	0.44450	1.402000	0.46780	0.561000	0.74099	TTG	MTOR	-	superfamily_ARM-type_fold	ENSG00000198793		0.517	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTOR	HGNC	protein_coding	OTTHUMT00000005558.1	65	0.00	0	C	NM_004958		11294317	11294317	-1	no_errors	ENST00000361445	ensembl	human	known	69_37n	missense	38	28.30	15	SNP	1.000	G
MUC16	94025	genome.wustl.edu	37	19	9070657	9070657	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr19:9070657C>T	ENST00000397910.4	-	3	16992	c.16789G>A	c.(16789-16791)Gtg>Atg	p.V5597M		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5599	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.V5597L(2)|p.V5597M(2)|p.V1230L(1)|p.V1230M(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CCCTGAGACACGGTTGAATGA	0.532																																						dbGAP											6	Substitution - Missense(6)	lung(3)|kidney(3)											128.0	119.0	122.0					19																	9070657		1964	4154	6118	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.16789G>A	19.37:g.9070657C>T	ENSP00000381008:p.Val5597Met		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.V5597M	ENST00000397910.4	37	c.16789	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	t	1.558	-0.537491	0.04082	.	.	ENSG00000181143	ENST00000397910	T	0.24908	1.83	1.67	-3.34	0.04943	.	.	.	.	.	T	0.11452	0.0279	N	0.24115	0.695	.	.	.	B	0.32128	0.357	B	0.19391	0.025	T	0.13710	-1.0499	8	0.87932	D	0	.	2.3336	0.04241	0.4071:0.2891:0.0:0.3038	.	5597	B5ME49	.	M	5597	ENSP00000381008:V5597M	ENSP00000381008:V5597M	V	-	1	0	MUC16	8931657	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.370000	0.07523	-1.104000	0.03015	-0.701000	0.03672	GTG	MUC16	-	NULL	ENSG00000181143		0.532	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	56	0.00	0	C	NM_024690		9070657	9070657	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	56	36.36	32	SNP	0.000	T
MYF5	4617	genome.wustl.edu	37	12	81111126	81111126	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr12:81111126G>A	ENST00000228644.3	+	1	436	c.284G>A	c.(283-285)cGc>cAc	p.R95H		NM_005593.2	NP_005584.2	P13349	MYF5_HUMAN	myogenic factor 5	95	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				camera-type eye development (GO:0043010)|cartilage condensation (GO:0001502)|embryonic skeletal system morphogenesis (GO:0048704)|extracellular matrix organization (GO:0030198)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|muscle tissue morphogenesis (GO:0060415)|ossification (GO:0001503)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)	protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(8)|lung(15)|ovary(2)|pancreas(1)	30						GAGCGGAGGCGCCTGAAGAAG	0.602																																						dbGAP											0													52.0	46.0	48.0					12																	81111126		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9020.1	12q21	2013-05-21			ENSG00000111049	ENSG00000111049		"""Basic helix-loop-helix proteins"""	7565	protein-coding gene	gene with protein product		159990				8978788, 12105204	Standard	NM_005593		Approved	bHLHc2	uc001szg.2	P13349	OTTHUMG00000170166	ENST00000228644.3:c.284G>A	12.37:g.81111126G>A	ENSP00000228644:p.Arg95His		Q6ISR9	Missense_Mutation	SNP	pfam_Basic,pfam_Myf5,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_Basic,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.R95H	ENST00000228644.3	37	c.284	CCDS9020.1	12	.	.	.	.	.	.	.	.	.	.	G	35	5.451347	0.96205	.	.	ENSG00000111049	ENST00000228644	D	0.99722	-6.53	6.06	6.06	0.98353	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.99887	0.9946	H	0.99074	4.42	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96506	0.9375	10	0.87932	D	0	-8.6871	20.6208	0.99490	0.0:0.0:1.0:0.0	.	95	P13349	MYF5_HUMAN	H	95	ENSP00000228644:R95H	ENSP00000228644:R95H	R	+	2	0	MYF5	79635257	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.882000	0.98803	0.655000	0.94253	CGC	MYF5	-	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	ENSG00000111049		0.602	MYF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYF5	HGNC	protein_coding	OTTHUMT00000407757.1	22	0.00	0	G	NM_005593		81111126	81111126	+1	no_errors	ENST00000228644	ensembl	human	known	69_37n	missense	10	41.18	7	SNP	1.000	A
NFE2L3	9603	genome.wustl.edu	37	7	26224525	26224525	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr7:26224525T>A	ENST00000056233.3	+	4	1466	c.1207T>A	c.(1207-1209)Ttt>Att	p.F403I		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	403					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						AGAAGACAACTTTGATCCAAT	0.353																																						dbGAP											0													94.0	100.0	98.0					7																	26224525		2202	4299	6501	-	-	-	SO:0001583	missense	0			AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.1207T>A	7.37:g.26224525T>A	ENSP00000056233:p.Phe403Ile		Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Missense_Mutation	SNP	pfam_bZIP_1,pfam_bZIP_Maf,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.F403I	ENST00000056233.3	37	c.1207	CCDS5396.1	7	.	.	.	.	.	.	.	.	.	.	T	6.585	0.476220	0.12521	.	.	ENSG00000050344	ENST00000056233;ENST00000398175	T	0.35421	1.31	5.12	2.73	0.32206	.	0.269079	0.42964	D	0.000626	T	0.34890	0.0913	M	0.81802	2.56	0.22389	N	0.99915	B	0.31968	0.349	B	0.28139	0.086	T	0.34950	-0.9808	10	0.54805	T	0.06	-14.487	5.5389	0.17028	0.1272:0.1432:0.0:0.7296	.	403	Q9Y4A8	NF2L3_HUMAN	I	403;109	ENSP00000056233:F403I	ENSP00000056233:F403I	F	+	1	0	NFE2L3	26191050	0.999000	0.42202	0.017000	0.16124	0.009000	0.06853	3.243000	0.51392	0.363000	0.24346	-0.376000	0.06991	TTT	NFE2L3	-	NULL	ENSG00000050344		0.353	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFE2L3	HGNC	protein_coding	OTTHUMT00000214088.1	54	0.00	0	T			26224525	26224525	+1	no_errors	ENST00000056233	ensembl	human	known	69_37n	missense	41	28.07	16	SNP	0.364	A
NME7	29922	genome.wustl.edu	37	1	169279296	169279296	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr1:169279296C>T	ENST00000367811.3	-	4	557	c.301G>A	c.(301-303)Gat>Aat	p.D101N	RP4-800F24.1_ENST00000432081.1_RNA|NME7_ENST00000469474.1_5'UTR|NME7_ENST00000472647.1_Missense_Mutation_p.D65N	NM_013330.3	NP_037462.1	Q9Y5B8	NDK7_HUMAN	NME/NM23 family member 7	101					brain development (GO:0007420)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|CTP biosynthetic process (GO:0006241)|determination of left/right symmetry (GO:0007368)|epithelial cilium movement (GO:0003351)|GTP biosynthetic process (GO:0006183)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|UTP biosynthetic process (GO:0006228)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(8)|skin(1)	16	all_hematologic(923;0.208)					GATATTGCATCTGGTTTAATT	0.279																																						dbGAP											0													84.0	87.0	86.0					1																	169279296		2200	4287	6487	-	-	-	SO:0001583	missense	0			AF153191	CCDS1277.1, CCDS44274.1	1q24.2	2014-07-31	2012-05-18		ENSG00000143156	ENSG00000143156			20461	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 67"""	613465	"""non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase)"""			19852809	Standard	NM_197972		Approved	FLJ37194, NM23-H7, CFAP67	uc001gfu.3	Q9Y5B8	OTTHUMG00000034586	ENST00000367811.3:c.301G>A	1.37:g.169279296C>T	ENSP00000356785:p.Asp101Asn		A8K3T6|A8MY09|B3KSW9|Q5TGZ4	Missense_Mutation	SNP	pfam_Nucleoside_diP_kinase,superfamily_Nucleoside_diP_kinase,smart_Uncharacterised_DM10,smart_Nucleoside_diP_kinase,pirsf_NDK7,prints_Nucleoside_diP_kinase	p.D101N	ENST00000367811.3	37	c.301	CCDS1277.1	1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.592424	0.86953	.	.	ENSG00000143156	ENST00000472647;ENST00000367811	T;T	0.65916	-0.18;-0.18	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.76948	0.4059	M	0.86268	2.805	0.45806	D	0.998685	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.77797	-0.2453	9	0.41790	T	0.15	-31.2889	15.77	0.78162	0.0:1.0:0.0:0.0	.	105;101	Q59GR0;Q9Y5B8	.;NDK7_HUMAN	N	65;101	ENSP00000433341:D65N;ENSP00000356785:D101N	ENSP00000356785:D101N	D	-	1	0	NME7	167545920	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	4.108000	0.57817	2.513000	0.84729	0.650000	0.86243	GAT	NME7	-	pfam_Nucleoside_diP_kinase,superfamily_Nucleoside_diP_kinase,smart_Nucleoside_diP_kinase,pirsf_NDK7	ENSG00000143156		0.279	NME7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NME7	HGNC	protein_coding	OTTHUMT00000083688.1	84	0.00	0	C	NM_013330		169279296	169279296	-1	no_errors	ENST00000367811	ensembl	human	known	69_37n	missense	75	46.43	65	SNP	1.000	T
NID1	4811	genome.wustl.edu	37	1	236156947	236156947	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr1:236156947G>A	ENST00000264187.6	-	13	2835	c.2753C>T	c.(2752-2754)cCg>cTg	p.P918L	NID1_ENST00000366595.3_Missense_Mutation_p.P785L	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	918	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)			breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	CCACTTACACGGGGGCGTCAT	0.672																																						dbGAP											0													14.0	13.0	13.0					1																	236156947		2180	4278	6458	-	-	-	SO:0001583	missense	0			BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.2753C>T	1.37:g.236156947G>A	ENSP00000264187:p.Pro918Leu		Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Missense_Mutation	SNP	pfam_G2_nidogen/fibulin_G2F,pfam_LDLR_classB_rpt,pfam_Nidogen_extracell_dom,pfam_Thyroglobulin_1,pfam_EGF-like_Ca-bd,superfamily_Green_fluorescent_prot-like,superfamily_Thyroglobulin_1,smart_Nidogen_extracell_dom,smart_EGF-like_Ca-bd,smart_EGF-like,smart_G2_nidogen/fibulin_G2F,smart_Thyroglobulin_1,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thyroglobulin_1	p.P918L	ENST00000264187.6	37	c.2753	CCDS1608.1	1	.	.	.	.	.	.	.	.	.	.	G	13.85	2.359713	0.41801	.	.	ENSG00000116962	ENST00000264187;ENST00000366595	T;T	0.63096	-0.02;-0.02	5.69	5.69	0.88448	Thyroglobulin type-1 (4);	0.194831	0.56097	D	0.000040	T	0.52240	0.1722	L	0.39245	1.2	0.28747	N	0.901656	P;B	0.37141	0.584;0.327	B;B	0.26770	0.073;0.053	T	0.53613	-0.8414	10	0.36615	T	0.2	.	19.3905	0.94581	0.0:0.0:1.0:0.0	.	785;918	P14543-2;P14543	.;NID1_HUMAN	L	918;785	ENSP00000264187:P918L;ENSP00000355554:P785L	ENSP00000264187:P918L	P	-	2	0	NID1	234223570	1.000000	0.71417	0.907000	0.35723	0.478000	0.33099	5.715000	0.68430	2.677000	0.91161	0.555000	0.69702	CCG	NID1	-	pfam_Thyroglobulin_1,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1	ENSG00000116962		0.672	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NID1	HGNC	protein_coding	OTTHUMT00000096647.2	13	0.00	0	G	NM_002508		236156947	236156947	-1	no_errors	ENST00000264187	ensembl	human	known	69_37n	missense	4	55.56	5	SNP	0.763	A
PCDHGA3	56112	genome.wustl.edu	37	5	140725490	140725490	+	Silent	SNP	A	A	C			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr5:140725490A>C	ENST00000253812.6	+	1	1890	c.1890A>C	c.(1888-1890)cgA>cgC	p.R630R	PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	630	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCACGGCGCGAGCCCTGCTGG	0.706																																						dbGAP											0													11.0	17.0	15.0					5																	140725490		2062	4123	6185	-	-	-	SO:0001819	synonymous_variant	0			AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.1890A>C	5.37:g.140725490A>C			Q9Y5D4	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R630	ENST00000253812.6	37	c.1890	CCDS47290.1	5																																																																																			PCDHGA3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000254245		0.706	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA3	HGNC	protein_coding	OTTHUMT00000377017.1	29	0.00	0	A	NM_018916		140725490	140725490	+1	no_errors	ENST00000253812	ensembl	human	known	69_37n	silent	26	16.13	5	SNP	0.688	C
PIF1	80119	genome.wustl.edu	37	15	65114690	65114690	+	Silent	SNP	G	G	A			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr15:65114690G>A	ENST00000268043.4	-	3	772	c.678C>T	c.(676-678)ttC>ttT	p.F226F	PIF1_ENST00000333425.6_Silent_p.F226F|PIF1_ENST00000559239.1_Silent_p.F226F					PIF1 5'-to-3' DNA helicase											kidney(1)|lung(1)	2						CACTCCCAGTGAAGAAGATGC	0.597																																						dbGAP											0													71.0	59.0	63.0					15																	65114690		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AK026345	CCDS10195.2, CCDS66797.1	15q22.1	2013-05-13	2013-05-13	2006-11-24	ENSG00000140451	ENSG00000140451	3.6.4.12		26220	protein-coding gene	gene with protein product		610953	"""chromosome 15 open reading frame 20"", ""PIF1 5'-to-3' DNA helicase homolog (S. cerevisiae)"""	C15orf20		10926538, 16522649	Standard	NM_025049		Approved	FLJ22692	uc002ant.2	Q9H611	OTTHUMG00000132974	ENST00000268043.4:c.678C>T	15.37:g.65114690G>A				Silent	SNP	pfam_DNA_helicase_PIF1,pfam_DNA_helicase	p.F226	ENST00000268043.4	37	c.678	CCDS10195.2	15																																																																																			PIF1	-	NULL	ENSG00000140451		0.597	PIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIF1	HGNC	protein_coding	OTTHUMT00000256533.1	39	0.00	0	G	NM_025049		65114690	65114690	-1	no_errors	ENST00000333425	ensembl	human	known	69_37n	silent	24	25.00	8	SNP	1.000	A
PPP1R12A	4659	genome.wustl.edu	37	12	80199488	80199488	+	Silent	SNP	C	C	T			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr12:80199488C>T	ENST00000450142.2	-	14	2150	c.1884G>A	c.(1882-1884)acG>acA	p.T628T	PPP1R12A_ENST00000261207.5_Silent_p.T628T|PPP1R12A_ENST00000437004.2_Silent_p.T628T|PPP1R12A_ENST00000550107.1_Silent_p.T572T|PPP1R12A_ENST00000546369.1_Silent_p.T541T|AC073569.1_ENST00000598624.1_Intron	NM_002480.2	NP_002471.1	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory subunit 12A	628	Ser/Thr-rich.				centrosome organization (GO:0051297)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)|regulation of nucleocytoplasmic transport (GO:0046822)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|PTW/PP1 phosphatase complex (GO:0072357)	14-3-3 protein binding (GO:0071889)|enzyme inhibitor activity (GO:0004857)|phosphatase regulator activity (GO:0019208)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|liver(1)|lung(4)|ovary(2)|skin(1)	29						TGGTCACTGCCGTAGGAACAC	0.458																																						dbGAP											0													122.0	120.0	121.0					12																	80199488		2086	4216	6302	-	-	-	SO:0001819	synonymous_variant	0			D87930	CCDS44947.1, CCDS44948.1, CCDS58259.1, CCDS58260.1	12q15-q21	2013-01-18	2011-10-04	2001-08-10	ENSG00000058272	ENSG00000058272		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7618	protein-coding gene	gene with protein product	"""myosin phosphatase-targeting subunit 1"", ""myosin binding subunit"""	602021	"""protein phosphatase 1, regulatory (inhibitor) subunit 12A"""	MYPT1		9286714	Standard	NM_002480		Approved	MBS, M130	uc001syz.3	O14974	OTTHUMG00000170100	ENST00000450142.2:c.1884G>A	12.37:g.80199488C>T			B4DZ09|F8VWB4|Q2NKL4|Q569H0|Q86WU3|Q8NFR6|Q9BYH0	Missense_Mutation	SNP	NULL	p.R220Q	ENST00000450142.2	37	c.659	CCDS44947.1	12	.	.	.	.	.	.	.	.	.	.	C	6.143	0.394678	0.11638	.	.	ENSG00000058272	ENST00000553081	.	.	.	5.54	1.55	0.23275	.	.	.	.	.	T	0.42539	0.1207	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.21690	-1.0238	4	.	.	.	.	1.3872	0.02243	0.3984:0.2966:0.13:0.175	.	.	.	.	Q	220	.	.	R	-	2	0	PPP1R12A	78723619	0.997000	0.39634	0.995000	0.50966	0.984000	0.73092	0.283000	0.18846	0.007000	0.14760	-0.216000	0.12614	CGG	PPP1R12A	-	NULL	ENSG00000058272		0.458	PPP1R12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R12A	HGNC	protein_coding	OTTHUMT00000407254.2	81	0.00	0	C	NM_002480		80199488	80199488	-1	no_start_codon:pseudogene:no_stop_codon	ENST00000553081	ensembl	human	novel	69_37n	missense	80	27.27	30	SNP	0.996	T
PRDM6	93166	genome.wustl.edu	37	5	122506701	122506701	+	Silent	SNP	G	G	A			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr5:122506701G>A	ENST00000407847.4	+	6	1809	c.1395G>A	c.(1393-1395)tcG>tcA	p.S465S		NM_001136239.1	NP_001129711.1	Q9NQX0	PRDM6_HUMAN	PR domain containing 6	465					negative regulation of smooth muscle cell differentiation (GO:0051151)|negative regulation of transcription, DNA-templated (GO:0045892)|neurogenesis (GO:0022008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	7						AGCTCCACTCGGAGTTCAGTG	0.502																																						dbGAP											0													74.0	69.0	70.0					5																	122506701		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AF272898	CCDS47259.1	5q21-q23	2013-01-08			ENSG00000061455	ENSG00000061455		"""Zinc fingers, C2H2-type"""	9350	protein-coding gene	gene with protein product							Standard	NM_001136239		Approved		uc003kti.3	Q9NQX0	OTTHUMG00000150469	ENST00000407847.4:c.1395G>A	5.37:g.122506701G>A			B5MCJ4|Q9NQW9	Silent	SNP	pfam_Znf_C2H2,pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.S465	ENST00000407847.4	37	c.1395	CCDS47259.1	5																																																																																			PRDM6	-	NULL	ENSG00000061455		0.502	PRDM6-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRDM6	HGNC	protein_coding	OTTHUMT00000318226.2	52	0.00	0	G	XM_049619		122506701	122506701	+1	no_errors	ENST00000407847	ensembl	human	known	69_37n	silent	18	53.85	21	SNP	0.996	A
SALL3	27164	genome.wustl.edu	37	18	76754213	76754213	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr18:76754213G>A	ENST00000537592.2	+	2	2222	c.2222G>A	c.(2221-2223)tGc>tAc	p.C741Y	SALL3_ENST00000536229.3_Missense_Mutation_p.C608Y|SALL3_ENST00000575389.2_Missense_Mutation_p.C741Y	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	741					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CAGCACTCCTGCCCCATCTGC	0.657																																						dbGAP											0													66.0	56.0	59.0					18																	76754213		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.2222G>A	18.37:g.76754213G>A	ENSP00000441823:p.Cys741Tyr		Q9UGH1	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C741Y	ENST00000537592.2	37	c.2222	CCDS12013.1	18	.	.	.	.	.	.	.	.	.	.	G	12.84	2.057483	0.36277	.	.	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	D	0.99494	-6.01	5.2	5.2	0.72013	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000006	D	0.99616	0.9860	M	0.89785	3.06	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.97960	1.0337	10	0.87932	D	0	-39.1936	18.7528	0.91821	0.0:0.0:1.0:0.0	.	473;741	F5GXY4;Q9BXA9	.;SALL3_HUMAN	Y	741;741;473	ENSP00000441823:C741Y	ENSP00000299466:C741Y	C	+	2	0	SALL3	74855201	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.787000	0.99055	2.430000	0.82344	0.561000	0.74099	TGC	SALL3	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000256463		0.657	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SALL3	HGNC	protein_coding	OTTHUMT00000256397.1	30	0.00	0	G	NM_171999		76754213	76754213	+1	no_errors	ENST00000537592	ensembl	human	known	69_37n	missense	19	56.82	25	SNP	1.000	A
SFXN5	94097	genome.wustl.edu	37	2	73249692	73249692	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr2:73249692G>C	ENST00000272433.2	-	5	420	c.290C>G	c.(289-291)cCg>cGg	p.P97R	SFXN5_ENST00000474528.1_5'UTR|SFXN5_ENST00000410065.1_Missense_Mutation_p.P97R	NM_144579.2	NP_653180.1	Q8TD22	SFXN5_HUMAN	sideroflexin 5	97					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)|citrate transmembrane transporter activity (GO:0015137)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9						ATTGGTGTCCGGATGTAGAAT	0.562																																						dbGAP											0													63.0	58.0	60.0					2																	73249692		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY044437	CCDS1922.1	2p13	2008-05-21			ENSG00000144040	ENSG00000144040		"""Sideroflexins"""	16073	protein-coding gene	gene with protein product		615572				12039050, 12150972	Standard	XM_005264648		Approved	BBG-TCC	uc002siq.3	Q8TD22	OTTHUMG00000129775	ENST00000272433.2:c.290C>G	2.37:g.73249692G>C	ENSP00000272433:p.Pro97Arg		A8K116|Q494Y3|Q53T29	Missense_Mutation	SNP	pfam_Mtc,tigrfam_Mtc	p.P97R	ENST00000272433.2	37	c.290	CCDS1922.1	2	.	.	.	.	.	.	.	.	.	.	G	21.1	4.093741	0.76870	.	.	ENSG00000144040	ENST00000272433;ENST00000410065	T;T	0.63417	-0.04;-0.04	5.5	5.5	0.81552	.	0.050905	0.85682	D	0.000000	D	0.85287	0.5662	H	0.95917	3.74	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.989;0.998	D	0.89063	0.3464	10	0.87932	D	0	-31.7474	14.7802	0.69760	0.0:0.0:1.0:0.0	.	97;97	B8ZZJ6;Q8TD22	.;SFXN5_HUMAN	R	97	ENSP00000272433:P97R;ENSP00000387076:P97R	ENSP00000272433:P97R	P	-	2	0	SFXN5	73103200	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.914000	0.63348	2.854000	0.98071	0.655000	0.94253	CCG	SFXN5	-	pfam_Mtc,tigrfam_Mtc	ENSG00000144040		0.562	SFXN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFXN5	HGNC	protein_coding	OTTHUMT00000251991.1	77	0.00	0	G	NM_144579		73249692	73249692	-1	no_errors	ENST00000272433	ensembl	human	known	69_37n	missense	19	36.67	11	SNP	1.000	C
SLC35F3	148641	genome.wustl.edu	37	1	234041449	234041449	+	Silent	SNP	G	G	A			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr1:234041449G>A	ENST00000366618.3	+	2	373	c.228G>A	c.(226-228)cgG>cgA	p.R76R		NM_173508.2	NP_775779.1	Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3	0					thiamine transport (GO:0015888)	integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|urinary_tract(1)	32	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			TCGAGGAGCGGATCCTGCGCA	0.597																																						dbGAP											0													66.0	62.0	63.0					1																	234041449		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS1600.1, CCDS73050.1	1q42.3	2013-05-22			ENSG00000183780	ENSG00000183780		"""Solute carriers"""	23616	protein-coding gene	gene with protein product							Standard	XM_005273070		Approved	FLJ37712	uc001hvy.1	Q8IY50	OTTHUMG00000037929	ENST00000366618.3:c.228G>A	1.37:g.234041449G>A			Q5TDD6|Q8N9C9	Silent	SNP	pfam_DMT,pfam_DUF250,pfam_DUF914_euk	p.R76	ENST00000366618.3	37	c.228	CCDS1600.1	1																																																																																			SLC35F3	-	NULL	ENSG00000183780		0.597	SLC35F3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	SLC35F3	HGNC	protein_coding	OTTHUMT00000092579.2	29	0.00	0	G	NM_173508		234041449	234041449	+1	no_errors	ENST00000366618	ensembl	human	known	69_37n	silent	5	44.44	4	SNP	1.000	A
SOGA1	140710	genome.wustl.edu	37	20	35443721	35443721	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr20:35443721C>A	ENST00000357779.3	-	5	1736	c.1410G>T	c.(1408-1410)aaG>aaT	p.K470N	SOGA1_ENST00000456801.2_Missense_Mutation_p.K311N|SOGA1_ENST00000279034.6_Missense_Mutation_p.K470N|SOGA1_ENST00000237536.4_Missense_Mutation_p.K708N			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	470					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						CATGGATGAGCTTGGTGTCCC	0.632																																						dbGAP											0													43.0	48.0	46.0					20																	35443721		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.1410G>T	20.37:g.35443721C>A	ENSP00000350424:p.Lys470Asn		A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Missense_Mutation	SNP	pfam_DUF3166	p.K470N	ENST00000357779.3	37	c.1410		20	.	.	.	.	.	.	.	.	.	.	C	15.98	2.993708	0.54041	.	.	ENSG00000149639	ENST00000237536;ENST00000279034;ENST00000456801;ENST00000357779	T;T;T;T	0.19105	2.17;2.17;2.18;2.17	5.04	1.84	0.25277	.	0.122142	0.56097	D	0.000030	T	0.28466	0.0704	L	0.51422	1.61	0.35409	D	0.792291	P	0.45348	0.856	P	0.52217	0.693	T	0.37731	-0.9693	10	0.56958	D	0.05	-45.9115	10.4263	0.44380	0.0:0.7438:0.0:0.2562	.	470	O94964-4	.	N	708;470;311;470	ENSP00000237536:K708N;ENSP00000279034:K470N;ENSP00000413886:K311N;ENSP00000350424:K470N	ENSP00000237536:K708N	K	-	3	2	KIAA0889	34877135	0.918000	0.31147	1.000000	0.80357	0.992000	0.81027	0.234000	0.17930	0.716000	0.32124	0.561000	0.74099	AAG	SOGA1	-	NULL	ENSG00000149639		0.632	SOGA1-201	KNOWN	basic	protein_coding	SOGA1	HGNC	protein_coding		39	0.00	0	C	NM_199181		35443721	35443721	-1	no_errors	ENST00000357779	ensembl	human	known	69_37n	missense	30	14.29	5	SNP	1.000	A
STRADA	92335	genome.wustl.edu	37	17	61788157	61788157	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr17:61788157T>C	ENST00000336174.6	-	7	500	c.388A>G	c.(388-390)Atc>Gtc	p.I130V	STRADA_ENST00000579340.1_Missense_Mutation_p.I72V|STRADA_ENST00000375840.4_Missense_Mutation_p.I72V|STRADA_ENST00000447001.3_Missense_Mutation_p.I86V|RP11-51F16.8_ENST00000580553.1_3'UTR|STRADA_ENST00000580039.1_5'UTR|STRADA_ENST00000582137.1_Missense_Mutation_p.I101V|STRADA_ENST00000392950.4_Missense_Mutation_p.I93V|STRADA_ENST00000245865.5_Missense_Mutation_p.I72V	NM_001003787.2	NP_001003787.1	Q7RTN6	STRAA_HUMAN	STE20-related kinase adaptor alpha	130	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|insulin receptor signaling pathway (GO:0008286)|protein export from nucleus (GO:0006611)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase binding (GO:0019900)|protein kinase activator activity (GO:0030295)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|prostate(2)	13						TATGGCACGATATTGGGATGG	0.488																																						dbGAP											0													149.0	119.0	130.0					17																	61788157		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF308302	CCDS11642.1, CCDS32703.1, CCDS42367.1, CCDS54156.1, CCDS58585.1	17q23.3	2014-09-04			ENSG00000266173	ENSG00000266173			30172	protein-coding gene	gene with protein product	"""STE20-like pseudokinase"""	608626				12805220, 17921699	Standard	NM_153335		Approved	NY-BR-96, LYK5, Stlk, STRAD	uc002jbm.3	Q7RTN6	OTTHUMG00000178908	ENST00000336174.6:c.388A>G	17.37:g.61788157T>C	ENSP00000336655:p.Ile130Val		B4DDE3|B4DW17|J3KTC9|Q5JPI2|Q7Z4K9|Q8NC31|Q8NCF1|Q9H272	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.I130V	ENST00000336174.6	37	c.388	CCDS32703.1	17	.	.	.	.	.	.	.	.	.	.	T	13.54	2.267138	0.40095	.	.	ENSG00000125695	ENST00000336174;ENST00000375840;ENST00000447001;ENST00000392950;ENST00000245865	T;T;T;T	0.78246	-1.16;-1.16;-1.16;1.49	4.97	4.97	0.65823	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.048273	0.85682	D	0.000000	T	0.72137	0.3423	L	0.39020	1.185	0.80722	D	1	B;B;P;B;B;P;B	0.40794	0.131;0.131;0.726;0.128;0.378;0.729;0.22	B;B;P;B;B;P;B	0.46172	0.072;0.089;0.506;0.237;0.069;0.452;0.116	T	0.67722	-0.5597	10	0.19147	T	0.46	.	11.5123	0.50500	0.0:0.0:0.1497:0.8503	.	101;86;72;72;93;93;130	B4DW17;B4DDE3;Q5JPI2;Q86YC8;Q7RTN6-2;Q7RTN6-3;Q7RTN6	.;.;.;.;.;.;STRAA_HUMAN	V	130;72;86;93;92	ENSP00000336655:I130V;ENSP00000365000:I72V;ENSP00000398841:I86V;ENSP00000376677:I93V	ENSP00000245865:I92V	I	-	1	0	STRADA	59141889	1.000000	0.71417	0.977000	0.42913	0.934000	0.57294	5.873000	0.69644	2.090000	0.63153	0.459000	0.35465	ATC	STRADA	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000266173		0.488	STRADA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STRADA	HGNC	protein_coding	OTTHUMT00000443894.1	90	0.00	0	T			61788157	61788157	-1	no_errors	ENST00000336174	ensembl	human	known	69_37n	missense	117	30.36	51	SNP	1.000	C
STXBP6	29091	genome.wustl.edu	37	14	25288273	25288273	+	Silent	SNP	G	G	A			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr14:25288273G>A	ENST00000323944.5	-	5	1030	c.579C>T	c.(577-579)agC>agT	p.S193S	STXBP6_ENST00000396700.1_Silent_p.S193S|STXBP6_ENST00000548724.1_Silent_p.S193S|STXBP6_ENST00000419632.2_Silent_p.S193S|STXBP6_ENST00000546511.1_Silent_p.S193S|STXBP6_ENST00000548369.1_Silent_p.S91S|STXBP6_ENST00000358326.2_Silent_p.S193S|STXBP6_ENST00000550887.1_Silent_p.S193S			Q8NFX7	STXB6_HUMAN	syntaxin binding protein 6 (amisyn)	193	v-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00290}.				negative regulation of exocytosis (GO:0045920)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(2)|large_intestine(3)	7				GBM - Glioblastoma multiforme(265;0.0296)		ACTGCTGGGCGCTGTTCTTCA	0.562																																						dbGAP											0													154.0	134.0	141.0					14																	25288273		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF161505	CCDS9634.1	14q11.2	2002-12-18			ENSG00000168952	ENSG00000168952			19666	protein-coding gene	gene with protein product		607958				12145319	Standard	NM_014178		Approved	amisyn, HSPC156	uc001wpu.3	Q8NFX7	OTTHUMG00000140186	ENST00000323944.5:c.579C>T	14.37:g.25288273G>A			D3DS78|Q8N3H1|Q8N8D5|Q96GF3|Q9P008	Silent	SNP	pfam_Synaptobrevin,pfscan_Synaptobrevin	p.S193	ENST00000323944.5	37	c.579	CCDS9634.1	14																																																																																			STXBP6	-	pfam_Synaptobrevin,pfscan_Synaptobrevin	ENSG00000168952		0.562	STXBP6-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	STXBP6	HGNC	protein_coding	OTTHUMT00000409166.1	81	0.00	0	G			25288273	25288273	-1	no_errors	ENST00000323944	ensembl	human	known	69_37n	silent	48	25.00	16	SNP	0.989	A
SYNJ1	8867	genome.wustl.edu	37	21	34014274	34014274	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr21:34014274G>A	ENST00000322229.7	-	28	3519	c.3520C>T	c.(3520-3522)Cgc>Tgc	p.R1174C	SYNJ1_ENST00000357345.3_Missense_Mutation_p.R1158C|SYNJ1_ENST00000382491.3_Missense_Mutation_p.R1127C|SYNJ1_ENST00000433931.2_Missense_Mutation_p.R1213C|SYNJ1_ENST00000382499.2_Missense_Mutation_p.R1213C			O43426	SYNJ1_HUMAN	synaptojanin 1	1174	Pro-rich.				cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						GGCTGACTGCGTCCTGGAACA	0.448																																						dbGAP											0													82.0	77.0	79.0					21																	34014274		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926	ENST00000322229.7:c.3520C>T	21.37:g.34014274G>A	ENSP00000322234:p.Arg1174Cys		O43425|O94984|Q4KMR1	Missense_Mutation	SNP	pfam_Syja_N,pfam_Endo/exonuclease/phosphatase,pfam_DUF1866,superfamily_Endo/exonuclease/phosphatase,smart_IPPc,pfscan_RRM_dom,pfscan_Syja_N	p.R1213C	ENST00000322229.7	37	c.3637	CCDS54484.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.91|18.91	3.723606|3.723606	0.68959|0.68959	.|.	.|.	ENSG00000159082|ENSG00000159082	ENST00000382491;ENST00000357345;ENST00000382499;ENST00000433931;ENST00000322229|ENST00000438952;ENST00000416083	D;D;D;D;D|.	0.94376|.	-2.58;-3.41;-3.32;-2.52;-2.51|.	5.96|5.96	5.96|5.96	0.96718|0.96718	.|.	0.301495|.	0.36519|.	N|.	0.002548|.	T|T	0.72787|0.72787	0.3504|0.3504	L|L	0.59436|0.59436	1.845|1.845	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D;D;D|.	0.76494|.	0.99;0.991;0.999;0.999;0.994|.	P;P;P;P;P|.	0.56700|.	0.451;0.549;0.804;0.719;0.653|.	T|T	0.68484|0.68484	-0.5396|-0.5396	10|5	0.52906|.	T|.	0.07|.	.|.	18.5813|18.5813	0.91172|0.91172	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1127;1213;1174;1174;1158|.	B9EGN3;C9JFZ1;O43426-2;O43426;O43426-4|.	.;.;.;SYNJ1_HUMAN;.|.	C|M	1127;1158;1213;1213;1174|49;26	ENSP00000371931:R1127C;ENSP00000349903:R1158C;ENSP00000371939:R1213C;ENSP00000409667:R1213C;ENSP00000322234:R1174C|.	ENSP00000322234:R1174C|.	R|T	-|-	1|2	0|0	SYNJ1|SYNJ1	32936145|32936145	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.994000|0.994000	0.84299|0.84299	6.688000|6.688000	0.74557|0.74557	2.826000|2.826000	0.97356|0.97356	0.655000|0.655000	0.94253|0.94253	CGC|ACG	SYNJ1	-	NULL	ENSG00000159082		0.448	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	SYNJ1	HGNC	protein_coding		80	0.00	0	G			34014274	34014274	-1	no_errors	ENST00000433931	ensembl	human	known	69_37n	missense	55	42.11	40	SNP	0.998	A
TOX4	9878	genome.wustl.edu	37	14	21963403	21963403	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr14:21963403C>T	ENST00000405508.1	+	9	1933	c.1657C>T	c.(1657-1659)Cag>Tag	p.Q553*	TOX4_ENST00000448790.2_Nonsense_Mutation_p.Q530*|TOX4_ENST00000262709.3_Nonsense_Mutation_p.Q553*			O94842	TOX4_HUMAN	TOX high mobility group box family member 4	553						chromatin (GO:0000785)|nucleus (GO:0005634)|PTW/PP1 phosphatase complex (GO:0072357)	DNA binding (GO:0003677)			large_intestine(8)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(95;0.000465)		Epithelial(56;6.61e-06)|all cancers(55;5.15e-05)	GBM - Glioblastoma multiforme(265;0.0149)		GTCTCCTTCTCAGATGGATGT	0.478																																						dbGAP											0													211.0	170.0	184.0					14																	21963403		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB018280	CCDS32043.1	14q11.2	2007-03-20	2007-03-20	2007-03-20	ENSG00000092203	ENSG00000092203			20161	protein-coding gene	gene with protein product		614032	"""chromosome 14 open reading frame 92"", ""KIAA0737"""	C14orf92, KIAA0737			Standard	NM_014828		Approved	LCP1	uc001waz.3	O94842	OTTHUMG00000150278	ENST00000405508.1:c.1657C>T	14.37:g.21963403C>T	ENSP00000385102:p.Gln553*		B4DPY8|B4DSM0|E7EV69	Nonsense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.Q553*	ENST00000405508.1	37	c.1657	CCDS32043.1	14	.	.	.	.	.	.	.	.	.	.	C	40	8.080072	0.98643	.	.	ENSG00000092203	ENST00000405508;ENST00000262709;ENST00000448790;ENST00000545559	.	.	.	5.48	5.48	0.80851	.	0.475882	0.22595	N	0.058029	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	18.4909	0.90846	0.0:1.0:0.0:0.0	.	.	.	.	X	553;553;530;481	.	ENSP00000262709:Q553X	Q	+	1	0	TOX4	21033243	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.757000	0.74924	2.723000	0.93209	0.585000	0.79938	CAG	TOX4	-	NULL	ENSG00000092203		0.478	TOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOX4	HGNC	protein_coding	OTTHUMT00000317287.2	79	0.00	0	C	NM_014828		21963403	21963403	+1	no_errors	ENST00000262709	ensembl	human	known	69_37n	nonsense	69	31.68	32	SNP	1.000	T
TTLL2	83887	genome.wustl.edu	37	6	167754327	167754327	+	Missense_Mutation	SNP	A	A	T			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr6:167754327A>T	ENST00000239587.5	+	3	1027	c.939A>T	c.(937-939)aaA>aaT	p.K313N		NM_031949.4	NP_114155.4	Q9BWV7	TTLL2_HUMAN	tubulin tyrosine ligase-like family, member 2	313	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)		ligase activity (GO:0016874)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		AGAAGATCAAAGAAGTGATTG	0.428																																						dbGAP											0													141.0	151.0	147.0					6																	167754327		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK093039	CCDS5301.1	6q27	2013-02-14		2004-01-14	ENSG00000120440	ENSG00000120440		"""Tubulin tyrosine ligase-like family"""	21211	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 104"""	C6orf104		11054573	Standard	XM_006715572		Approved	NYD-TSPG, dJ366N23.3	uc003qvs.1	Q9BWV7	OTTHUMG00000016023	ENST00000239587.5:c.939A>T	6.37:g.167754327A>T	ENSP00000239587:p.Lys313Asn		B2RB11|B3KS77|Q7Z6R8|Q86X22	Missense_Mutation	SNP	pfam_Tub_tyr_ligase	p.K313N	ENST00000239587.5	37	c.939	CCDS5301.1	6	.	.	.	.	.	.	.	.	.	.	A	12.03	1.814873	0.32053	.	.	ENSG00000120440	ENST00000239587;ENST00000540954	T	0.05717	3.4	3.65	-2.05	0.07321	.	0.074339	0.50627	D	0.000110	T	0.06325	0.0163	L	0.48986	1.54	0.38036	D	0.935316	D	0.89917	1.0	D	0.77004	0.989	T	0.25847	-1.0120	10	0.52906	T	0.07	.	4.7912	0.13250	0.589:0.1515:0.2595:0.0	.	313	Q9BWV7	TTLL2_HUMAN	N	313;240	ENSP00000239587:K313N	ENSP00000239587:K313N	K	+	3	2	TTLL2	167674317	0.999000	0.42202	0.084000	0.20598	0.096000	0.18686	0.650000	0.24858	-0.486000	0.06744	-0.415000	0.06103	AAA	TTLL2	-	pfam_Tub_tyr_ligase	ENSG00000120440		0.428	TTLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL2	HGNC	protein_coding	OTTHUMT00000043127.3	80	0.00	0	A	NM_031949		167754327	167754327	+1	no_errors	ENST00000239587	ensembl	human	known	69_37n	missense	26	64.86	48	SNP	0.973	T
VPS26A	9559	genome.wustl.edu	37	10	70917832	70917832	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr10:70917832G>A	ENST00000373382.1	+	6	1069	c.416G>A	c.(415-417)aGa>aAa	p.R139K	VPS26A_ENST00000490696.1_Intron|VPS26A_ENST00000489794.1_Missense_Mutation_p.R114K|VPS26A_ENST00000541711.1_Missense_Mutation_p.R28K|VPS26A_ENST00000546041.1_Missense_Mutation_p.R122K|VPS26A_ENST00000395098.1_Missense_Mutation_p.R139K|VPS26A_ENST00000263559.6_Missense_Mutation_p.R139K			O75436	VP26A_HUMAN	vacuolar protein sorting 26 homolog A (S. pombe)	139					retrograde transport, endosome to Golgi (GO:0042147)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|vesicle (GO:0031982)	protein transporter activity (GO:0008565)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)	8						ATAGTGAGAAGACTGACAGAT	0.338																																					Colon(90;545 1358 4729 6702 16773)	dbGAP											0													93.0	91.0	92.0					10																	70917832		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF054179	CCDS7286.1, CCDS41536.1	10q21.1	2007-01-12	2007-01-12	2005-10-11	ENSG00000122958	ENSG00000122958			12711	protein-coding gene	gene with protein product		605506	"""vacuolar protein sorting 26 (yeast homolog)"", ""vacuolar protein sorting 26 (yeast)"", ""vacuolar protein sorting 26 homolog A (yeast)"""	VPS26		1638986, 9653160	Standard	NM_004896		Approved	Hbeta58, PEP8A	uc001jpb.3	O75436	OTTHUMG00000018376	ENST00000373382.1:c.416G>A	10.37:g.70917832G>A	ENSP00000362480:p.Arg139Lys		A8MZ56|B2RDD3|Q8TBH4|Q9H982	Missense_Mutation	SNP	pfam_VPS26	p.R139K	ENST00000373382.1	37	c.416	CCDS7286.1	10	.	.	.	.	.	.	.	.	.	.	G	22.0	4.230370	0.79688	.	.	ENSG00000122958	ENST00000373382;ENST00000263559;ENST00000395098;ENST00000546041;ENST00000541711	.	.	.	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.75324	0.3834	L	0.46885	1.475	0.80722	D	1	B;B;B	0.33379	0.357;0.41;0.006	P;P;B	0.54270	0.721;0.747;0.062	T	0.65768	-0.6088	9	0.11182	T	0.66	-7.6281	19.2582	0.93955	0.0:0.0:1.0:0.0	.	122;139;139	F5H4L7;A8MZ56;O75436	.;.;VP26A_HUMAN	K	139;139;139;122;28	.	ENSP00000263559:R139K	R	+	2	0	VPS26A	70587838	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.636000	0.98440	2.622000	0.88805	0.655000	0.94253	AGA	VPS26A	-	pfam_VPS26	ENSG00000122958		0.338	VPS26A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS26A	HGNC	protein_coding	OTTHUMT00000048403.1	69	0.00	0	G	NM_004896		70917832	70917832	+1	no_errors	ENST00000263559	ensembl	human	known	69_37n	missense	70	16.67	14	SNP	1.000	A
VWA3A	146177	genome.wustl.edu	37	16	22152977	22152977	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr16:22152977C>T	ENST00000389398.5	+	24	2554	c.2458C>T	c.(2458-2460)Ctt>Ttt	p.L820F	VWA3A_ENST00000389397.4_5'UTR	NM_173615.3	NP_775886.3	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	820						extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				GBM - Glioblastoma multiforme(48;0.0439)		AGAGACATCTCTTTTACTGTT	0.537																																						dbGAP											0													76.0	83.0	81.0					16																	22152977		2004	4165	6169	-	-	-	SO:0001583	missense	0			AK128606, AK098260	CCDS45441.1	16p12.1	2008-02-05				ENSG00000175267			27088	protein-coding gene	gene with protein product						12477932	Standard	XM_006721021		Approved	FLJ46765, FLJ40941	uc010vbq.2	A6NCI4		ENST00000389398.5:c.2458C>T	16.37:g.22152977C>T	ENSP00000374049:p.Leu820Phe		A4QMU8|A6NNC0|Q6UTX4|Q6ZQZ9|Q8IUY6|Q8N9W1	Missense_Mutation	SNP	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.L820F	ENST00000389398.5	37	c.2458	CCDS45441.1	16	.	.	.	.	.	.	.	.	.	.	C	10.47	1.359989	0.24598	.	.	ENSG00000175267	ENST00000389398;ENST00000299840	T	0.12255	2.7	5.49	2.39	0.29439	.	0.485779	0.20212	N	0.096869	T	0.09642	0.0237	L	0.46741	1.465	0.26291	N	0.978126	B	0.09022	0.002	B	0.08055	0.003	T	0.37596	-0.9699	10	0.09590	T	0.72	.	6.1239	0.20167	0.0:0.6455:0.1741:0.1803	.	820	A6NCI4	VWA3A_HUMAN	F	820;443	ENSP00000374049:L820F	ENSP00000299840:L443F	L	+	1	0	VWA3A	22060478	0.022000	0.18835	0.107000	0.21349	0.188000	0.23474	0.192000	0.17096	0.767000	0.33267	0.655000	0.94253	CTT	VWA3A	-	NULL	ENSG00000175267		0.537	VWA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA3A	HGNC	protein_coding	OTTHUMT00000430052.1	45	0.00	0	C			22152977	22152977	+1	no_errors	ENST00000389398	ensembl	human	known	69_37n	missense	56	27.27	21	SNP	0.326	T
ZNF461	92283	genome.wustl.edu	37	19	37134740	37134740	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A228-01A-31D-A159-09	TCGA-E9-A228-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	4a804a8d-7dc8-4b5b-9537-b7f8f7133bda	c618a148-78cb-425d-b026-e2f1c10773bd	g.chr19:37134740T>C	ENST00000588268.1	-	5	484	c.257A>G	c.(256-258)cAc>cGc	p.H86R	ZNF461_ENST00000360357.4_Intron|ZNF461_ENST00000540605.2_5'Flank	NM_153257.2	NP_694989.2	Q8TAF7	ZN461_HUMAN	zinc finger protein 461	86					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|prostate(1)|urinary_tract(2)	29	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			gaaattattgtgaaatcccca	0.274																																						dbGAP											0													103.0	91.0	95.0					19																	37134740		922	2076	2998	-	-	-	SO:0001583	missense	0			BX649031	CCDS54257.1, CCDS74348.1	19q13.13	2013-01-08				ENSG00000197808		"""Zinc fingers, C2H2-type"", ""-"""	21629	protein-coding gene	gene with protein product		608640				11579202, 15004467	Standard	XM_005259402		Approved	GIOT-1, MGC33911	uc002oem.3	Q8TAF7		ENST00000588268.1:c.257A>G	19.37:g.37134740T>C	ENSP00000467931:p.His86Arg		A8K9W9|Q6VSF7|Q9ULZ8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H86R	ENST00000588268.1	37	c.257	CCDS54257.1	19	.	.	.	.	.	.	.	.	.	.	T	2.896	-0.228493	0.06022	.	.	ENSG00000197808	ENST00000396893;ENST00000396892	.	.	.	0.625	0.625	0.17665	.	.	.	.	.	T	0.17619	0.0423	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.01281	0.0	T	0.20371	-1.0277	7	0.54805	T	0.06	.	.	.	.	.	86	Q8TAF7	ZN461_HUMAN	R	86;21	.	ENSP00000380101:H21R	H	-	2	0	ZNF461	41826580	0.058000	0.20735	0.031000	0.17742	0.623000	0.37688	0.533000	0.23082	0.488000	0.27723	0.164000	0.16699	CAC	ZNF461	-	NULL	ENSG00000197808		0.274	ZNF461-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF461	HGNC	protein_coding	OTTHUMT00000453202.1	63	0.00	0	T	NM_153257		37134740	37134740	-1	no_errors	ENST00000588268	ensembl	human	known	69_37n	missense	55	28.57	22	SNP	0.054	C
