#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACTL9	284382	genome.wustl.edu	37	19	8808585	8808585	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr19:8808585G>C	ENST00000324436.3	-	1	587	c.467C>G	c.(466-468)gCc>gGc	p.A156G		NM_178525.3	NP_848620.3	Q8TC94	ACTL9_HUMAN	actin-like 9	156						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(15)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	36						GCGGTTGGTGGCCGGGCTGAA	0.672																																						dbGAP											0													38.0	42.0	41.0					19																	8808585		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS12207.1	19p13.2	2014-08-08			ENSG00000181786	ENSG00000181786			28494	protein-coding gene	gene with protein product							Standard	NM_178525		Approved	MGC33407	uc002mkl.2	Q8TC94	OTTHUMG00000182194	ENST00000324436.3:c.467C>G	19.37:g.8808585G>C	ENSP00000316674:p.Ala156Gly		A8K893|Q6X960	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.A156G	ENST00000324436.3	37	c.467	CCDS12207.1	19	.	.	.	.	.	.	.	.	.	.	G	15.36	2.810366	0.50421	.	.	ENSG00000181786	ENST00000324436	D	0.94576	-3.46	4.0	2.93	0.34026	.	0.924208	0.08869	N	0.881876	D	0.92024	0.7473	L	0.49350	1.555	0.29217	N	0.874162	B	0.26445	0.149	B	0.29077	0.098	D	0.87130	0.2196	10	0.87932	D	0	.	8.0706	0.30687	0.0:0.1749:0.6446:0.1805	.	156	Q8TC94	ACTL9_HUMAN	G	156	ENSP00000316674:A156G	ENSP00000316674:A156G	A	-	2	0	ACTL9	8669585	0.350000	0.24878	0.901000	0.35422	0.992000	0.81027	0.538000	0.23160	1.019000	0.39547	0.462000	0.41574	GCC	ACTL9	-	pfam_Actin-like,smart_Actin-like	ENSG00000181786		0.672	ACTL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL9	HGNC	protein_coding	OTTHUMT00000459953.1	13	0.00	0	G	NM_178525		8808585	8808585	-1	no_errors	ENST00000324436	ensembl	human	known	69_37n	missense	14	26.32	5	SNP	0.998	C
ADAM20	8748	genome.wustl.edu	37	14	70989944	70989944	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr14:70989944G>T	ENST00000256389.3	-	2	1925	c.1681C>A	c.(1681-1683)Cat>Aat	p.H561N	RP11-486O13.4_ENST00000556646.1_lincRNA	NM_003814.4	NP_003805.3	O43506	ADA20_HUMAN	ADAM metallopeptidase domain 20	511	Cys-rich.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(2)	27			KIRC - Kidney renal clear cell carcinoma(12;0.133)|Kidney(31;0.188)	all cancers(60;0.00294)|BRCA - Breast invasive adenocarcinoma(234;0.00668)|OV - Ovarian serous cystadenocarcinoma(108;0.0344)		TGTATATCATGGTTATTACAC	0.443																																						dbGAP											0													205.0	157.0	173.0					14																	70989944		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF029899	CCDS32111.1	14q24.2	2012-04-30	2005-08-18		ENSG00000134007	ENSG00000134007		"""ADAM metallopeptidase domain containing"""	199	protein-coding gene	gene with protein product		603712	"""a disintegrin and metalloproteinase domain 20"""			9469942	Standard	NM_003814		Approved		uc001xme.3	O43506	OTTHUMG00000167548	ENST00000256389.3:c.1681C>A	14.37:g.70989944G>T	ENSP00000256389:p.His561Asn		Q6GTZ1|Q9UKJ9	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.H561N	ENST00000256389.3	37	c.1681	CCDS32111.1	14	.	.	.	.	.	.	.	.	.	.	G	17.89	3.499904	0.64298	.	.	ENSG00000134007	ENST00000256389	T	0.21734	1.99	4.66	4.66	0.58398	ADAM, cysteine-rich (2);	0.417720	0.17234	U	0.181838	T	0.51652	0.1687	M	0.91090	3.175	0.22127	N	0.999344	D	0.53151	0.958	D	0.65573	0.936	T	0.50457	-0.8826	10	0.62326	D	0.03	.	11.4515	0.50156	0.0839:0.0:0.9161:0.0	.	511	O43506	ADA20_HUMAN	N	561	ENSP00000256389:H561N	ENSP00000256389:H561N	H	-	1	0	ADAM20	70059697	1.000000	0.71417	0.921000	0.36526	0.051000	0.14879	4.108000	0.57817	2.284000	0.76573	0.557000	0.71058	CAT	ADAM20	-	pfam_ADAM_Cys-rich,smart_ADAM_Cys-rich	ENSG00000134007		0.443	ADAM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM20	HGNC	protein_coding	OTTHUMT00000395004.2	54	0.00	0	G			70989944	70989944	-1	no_errors	ENST00000256389	ensembl	human	known	69_37n	missense	49	10.91	6	SNP	0.805	T
ADCY10	55811	genome.wustl.edu	37	1	167778922	167778922	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr1:167778922T>G	ENST00000367851.4	-	33	5010	c.4826A>C	c.(4825-4827)cAt>cCt	p.H1609P	ADCY10_ENST00000545172.1_Missense_Mutation_p.H1456P|ADCY10_ENST00000367848.1_Missense_Mutation_p.H1517P	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	1609					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						ATGTTAGAAATGATTGTCCAC	0.388																																						dbGAP											0													126.0	121.0	123.0					1																	167778922		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.4826A>C	1.37:g.167778922T>G	ENSP00000356825:p.His1609Pro		B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Missense_Mutation	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,pirsf_Adenylate_cylcase_typ10,pfscan_A/G_cyclase	p.H1609P	ENST00000367851.4	37	c.4826	CCDS1265.1	1	.	.	.	.	.	.	.	.	.	.	T	0.010	-1.761330	0.00657	.	.	ENSG00000143199	ENST00000545172;ENST00000367851;ENST00000367848	T;T;T	0.28666	1.6;1.61;1.6	5.25	3.32	0.38043	.	0.811383	0.10983	N	0.612459	T	0.04003	0.0112	N	0.01267	-0.92	0.24090	N	0.995918	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.35968	-0.9767	9	0.32370	T	0.25	-2.14	10.8545	0.46792	0.0:0.0:0.6421:0.3579	.	1517;1609	Q96PN6-2;Q96PN6	.;ADCYA_HUMAN	P	1456;1609;1517	ENSP00000441992:H1456P;ENSP00000356825:H1609P;ENSP00000356822:H1517P	ENSP00000356822:H1517P	H	-	2	0	ADCY10	166045546	0.935000	0.31712	0.980000	0.43619	0.213000	0.24496	1.351000	0.34022	0.664000	0.31047	-0.452000	0.05504	CAT	ADCY10	-	pirsf_Adenylate_cylcase_typ10	ENSG00000143199		0.388	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY10	HGNC	protein_coding	OTTHUMT00000083663.1	54	0.00	0	T	NM_018417		167778922	167778922	-1	no_errors	ENST00000367851	ensembl	human	known	69_37n	missense	104	25.18	35	SNP	0.897	G
AOC4P	90586	genome.wustl.edu	37	17	41020744	41020744	+	RNA	SNP	C	C	T			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr17:41020744C>T	ENST00000585538.1	+	0	1583					NR_002773.1				amine oxidase, copper containing 4, pseudogene																		CTAATGGGGCCATAGAAATCA	0.517																																						dbGAP											0																																										-	-	-			0					17q21.31	2013-06-19			ENSG00000260105	ENSG00000260105			48869	pseudogene	pseudogene						20013028	Standard	NR_002773		Approved				OTTHUMG00000176596		17.37:g.41020744C>T				RNA	SNP	-	NULL	ENST00000585538.1	37	NULL		17																																																																																			AOC4	-	-	ENSG00000260105		0.517	AOC4P-006	KNOWN	basic	processed_transcript	AOC4	Clone_based_vega_gene	pseudogene	OTTHUMT00000452449.1	26	0.00	0	C			41020744	41020744	+1	no_errors	ENST00000562301	ensembl	human	known	69_37n	rna	8	57.89	11	SNP	0.952	T
ARPP21	10777	genome.wustl.edu	37	3	35725220	35725220	+	Silent	SNP	A	A	G			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr3:35725220A>G	ENST00000187397.4	+	5	630	c.174A>G	c.(172-174)tcA>tcG	p.S58S	ARPP21_ENST00000396482.2_Silent_p.S58S|ARPP21_ENST00000412048.1_Silent_p.S58S|ARPP21_ENST00000428373.1_Silent_p.S58S|ARPP21_ENST00000436702.1_Silent_p.S58S|ARPP21_ENST00000396481.2_Silent_p.S58S|ARPP21_ENST00000438071.1_Silent_p.S58S|ARPP21_ENST00000458225.1_Silent_p.S58S|ARPP21_ENST00000427542.1_Silent_p.S58S|ARPP21_ENST00000337271.5_Silent_p.S58S|ARPP21_ENST00000441454.1_Silent_p.S58S|ARPP21_ENST00000444190.1_Silent_p.S58S|ARPP21_ENST00000417925.1_Silent_p.S58S|ARPP21_ENST00000432682.1_Silent_p.S58S|ARPP21_ENST00000474696.1_Silent_p.S58S	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	58					cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						CCTCCTAGTCAGGAGCAGGAA	0.453																																						dbGAP											0													43.0	39.0	40.0					3																	35725220		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.174A>G	3.37:g.35725220A>G			B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Silent	SNP	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	p.S58	ENST00000187397.4	37	c.174	CCDS2661.1	3																																																																																			ARPP21	-	NULL	ENSG00000172995		0.453	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPP21	HGNC	protein_coding	OTTHUMT00000253334.2	47	0.00	0	A	NM_198399		35725220	35725220	+1	no_errors	ENST00000417925	ensembl	human	known	69_37n	silent	14	46.15	12	SNP	1.000	G
ATP13A4	84239	genome.wustl.edu	37	3	193182727	193182727	+	Splice_Site	SNP	A	A	T			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr3:193182727A>T	ENST00000342695.4	-	12	1784		c.e12+1		ATP13A4_ENST00000295548.3_Splice_Site|ATP13A4_ENST00000392443.3_Splice_Site	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4							integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		AAACACACATACCTTGTCAAA	0.433																																						dbGAP											0													157.0	145.0	149.0					3																	193182727		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.1461+1T>A	3.37:g.193182727A>T			B7WPC7|Q6UY23|Q8N1Q9|Q9H043	Splice_Site	SNP	-	e12+2	ENST00000342695.4	37	c.1461+2	CCDS3304.2	3	.	.	.	.	.	.	.	.	.	.	A	25.9	4.688427	0.88639	.	.	ENSG00000127249	ENST00000392443;ENST00000342695;ENST00000295548	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0034	0.80327	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ATP13A4	194665421	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	7.410000	0.80065	2.371000	0.80710	0.533000	0.62120	.	ATP13A4	-	-	ENSG00000127249		0.433	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A4	HGNC	protein_coding	OTTHUMT00000157244.4	28	0	0	A	NM_032279	Intron	193182727	193182727	-1	no_errors	ENST00000342695	ensembl	human	known	69_37n	splice_site	57	12.12	8	SNP	1.000	T
ATP1A4	480	genome.wustl.edu	37	1	160145985	160145985	+	Silent	SNP	C	C	A			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr1:160145985C>A	ENST00000368081.4	+	16	2886	c.2415C>A	c.(2413-2415)ccC>ccA	p.P805P	ATP1A4_ENST00000418334.1_3'UTR|ATP1A4_ENST00000470705.1_5'Flank	NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	805					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TCGGTATACCCCTGCCTCTGG	0.512																																						dbGAP											0													173.0	155.0	161.0					1																	160145985		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.2415C>A	1.37:g.160145985C>A			Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_cation-exchng_asu,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	p.P805	ENST00000368081.4	37	c.2415	CCDS1197.1	1																																																																																			ATP1A4	-	pfam_ATPase_P-typ_cation-transptr_C,prints_ATPase_P-typ_cation-exchng_asu,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000132681		0.512	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP1A4	HGNC	protein_coding	OTTHUMT00000077415.1	67	0.00	0	C	NM_144699		160145985	160145985	+1	no_errors	ENST00000368081	ensembl	human	known	69_37n	silent	91	20.87	24	SNP	0.997	A
C12orf74	338809	genome.wustl.edu	37	12	93100671	93100671	+	Silent	SNP	G	G	A			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr12:93100671G>A	ENST00000397833.3	+	2	715	c.264G>A	c.(262-264)ctG>ctA	p.L88L	C12orf74_ENST00000544406.2_Silent_p.L88L	NM_001037671.3|NM_001178097.2	NP_001032760.1|NP_001171568.1	Q32Q52	CL074_HUMAN	chromosome 12 open reading frame 74	88										kidney(1)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(2)	10						CGAAGAGCCTGCCAGGAAGCC	0.577																																						dbGAP											0													48.0	51.0	50.0					12																	93100671		1902	4115	6017	-	-	-	SO:0001819	synonymous_variant	0			BC043363	CCDS41819.1, CCDS53818.1	12q22	2012-08-16			ENSG00000214215	ENSG00000214215			27887	protein-coding gene	gene with protein product						12477932	Standard	NM_001037671		Approved		uc001tch.2	Q32Q52	OTTHUMG00000170105	ENST00000397833.3:c.264G>A	12.37:g.93100671G>A			F5H4P0	Silent	SNP	NULL	p.L88	ENST00000397833.3	37	c.264	CCDS41819.1	12																																																																																			C12orf74	-	NULL	ENSG00000214215		0.577	C12orf74-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C12orf74	HGNC	protein_coding	OTTHUMT00000407285.1	13	0.00	0	G	NM_001037671		93100671	93100671	+1	no_errors	ENST00000397833	ensembl	human	known	69_37n	silent	13	38.10	8	SNP	0.001	A
C2orf71	388939	genome.wustl.edu	37	2	29295725	29295725	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr2:29295725T>C	ENST00000331664.5	-	1	1402	c.1403A>G	c.(1402-1404)cAc>cGc	p.H468R		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	468					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						TTTGGAAAGGTGTGGTTCCAC	0.532																																						dbGAP											0													83.0	86.0	85.0					2																	29295725		2031	4198	6229	-	-	-	SO:0001583	missense	0				CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.1403A>G	2.37:g.29295725T>C	ENSP00000332809:p.His468Arg			Missense_Mutation	SNP	NULL	p.H468R	ENST00000331664.5	37	c.1403	CCDS42669.1	2	.	.	.	.	.	.	.	.	.	.	T	5.826	0.336728	0.11013	.	.	ENSG00000179270	ENST00000331664	T	0.18657	2.2	5.3	-3.01	0.05463	.	1.530900	0.03407	N	0.204192	T	0.13543	0.0328	L	0.31294	0.92	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.23691	-1.0181	10	0.18276	T	0.48	0.873	5.7359	0.18067	0.0:0.3472:0.2604:0.3924	.	468	A6NGG8	CB071_HUMAN	R	468	ENSP00000332809:H468R	ENSP00000332809:H468R	H	-	2	0	C2orf71	29149229	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.133000	0.10451	-0.217000	0.10033	0.459000	0.35465	CAC	C2orf71	-	NULL	ENSG00000179270		0.532	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	C2orf71	HGNC	protein_coding	OTTHUMT00000324924.3	31	0.00	0	T	NM_001029883		29295725	29295725	-1	no_errors	ENST00000331664	ensembl	human	novel	69_37n	missense	45	21.05	12	SNP	0.000	C
CACNA1C	775	genome.wustl.edu	37	12	2786827	2786827	+	Intron	SNP	C	C	T	rs111770231		TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr12:2786827C>T	ENST00000347598.4	+	43	5100				CACNA1C_ENST00000399606.1_Intron|CACNA1C_ENST00000399621.1_Intron|CACNA1C_ENST00000399597.1_Intron|CACNA1C_ENST00000399644.1_Intron|CACNA1C_ENST00000399641.1_Intron|CACNA1C_ENST00000399638.1_Intron|CACNA1C-AS1_ENST00000501371.1_RNA|CACNA1C_ENST00000327702.7_Intron|CACNA1C_ENST00000335762.5_Intron|CACNA1C_ENST00000399629.1_Intron|CACNA1C_ENST00000399637.1_Intron|CACNA1C_ENST00000399617.1_Intron|CACNA1C_ENST00000406454.3_Intron|CACNA1C_ENST00000399591.1_Intron|CACNA1C_ENST00000399601.1_Intron|CACNA1C_ENST00000399649.1_Intron|CACNA1C_ENST00000402845.3_Intron|CACNA1C_ENST00000399603.1_Intron|CACNA1C_ENST00000344100.3_Intron|CACNA1C_ENST00000399655.1_Intron|CACNA1C_ENST00000399595.1_Intron|CACNA1C_ENST00000399634.1_Intron	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit						adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GGTCTTGGCCCGAGGCTGTGG	0.647																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.5101-72C>T	12.37:g.2786827C>T			B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	RNA	SNP	-	NULL	ENST00000347598.4	37	NULL	CCDS44788.1	12																																																																																			CACNA1C-AS1	-	-	ENSG00000246627		0.647	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1C-AS1	HGNC	protein_coding	OTTHUMT00000317035.1	13	0.00	0	C	NM_000719		2786827	2786827	-1	no_errors	ENST00000501371	ensembl	human	known	69_37n	rna	18	33.33	9	SNP	0.002	T
CBL	867	genome.wustl.edu	37	11	119170209	119170209	+	Silent	SNP	C	C	A			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr11:119170209C>A	ENST00000264033.4	+	16	2815	c.2439C>A	c.(2437-2439)gtC>gtA	p.V813V		NM_005188.3	NP_005179.2	P22681	CBL_HUMAN	Cbl proto-oncogene, E3 ubiquitin protein ligase	813	Asp/Glu-rich (acidic).|Interaction with CD2AP.				cell surface receptor signaling pathway (GO:0007166)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|flotillin complex (GO:0016600)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ephrin receptor binding (GO:0046875)|ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(194)|kidney(3)|large_intestine(9)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	251		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)		TTCTAGATGTCACTGAAGGTT	0.423			"""T, Mis S, O"""	MLL	"""AML, JMML, MDS"""				Noonan syndrome;CBL gene-associated Juvenile Myelomonocytic Leukemia and Developmental Anomalies																													dbGAP		"""Dom, Rec"""	yes		11	11q23.3	867	Cas-Br-M (murine) ecotropic retroviral transforming		L	0													51.0	57.0	55.0					11																	119170209		2199	4295	6494	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CBL-associated JMML	X57110	CCDS8418.1	11q23.3	2014-09-17	2012-02-23		ENSG00000110395	ENSG00000110395		"""RING-type (C3HC4) zinc fingers"""	1541	protein-coding gene	gene with protein product	"""oncogene CBL2"""	165360	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence"""	CBL2		2013228	Standard	NM_005188		Approved	RNF55, c-Cbl	uc001pwe.4	P22681	OTTHUMG00000166170	ENST00000264033.4:c.2439C>A	11.37:g.119170209C>A			A3KMP8	Silent	SNP	pfam_Adaptor_Cbl_N_hlx,pfam_Adaptor_Cbl_SH2-like,pfam_Adaptor_Cbl_EF_hand-like,pfam_Znf_C3HC4_RING-type,pfam_UBA/transl_elong_EF1B_N,superfamily_Adaptor_Cbl_N_hlx,superfamily_UBA-like,smart_Znf_RING,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_RING	p.V813	ENST00000264033.4	37	c.2439	CCDS8418.1	11																																																																																			CBL	-	NULL	ENSG00000110395		0.423	CBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBL	HGNC	protein_coding	OTTHUMT00000388219.4	19	0.00	0	C	NM_005188		119170209	119170209	+1	no_errors	ENST00000264033	ensembl	human	known	69_37n	silent	15	37.50	9	SNP	0.996	A
CDH19	28513	genome.wustl.edu	37	18	64239349	64239349	+	Silent	SNP	G	G	A			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr18:64239349G>A	ENST00000540086.1	-	2	339	c.93C>T	c.(91-93)gtC>gtT	p.V31V	CDH19_ENST00000262150.2_Silent_p.V31V	NM_001271028.1	NP_001257957.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	0					branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				CTGGCTGCTTGACTTTCTTTG	0.443																																						dbGAP											0													112.0	101.0	105.0					18																	64239349		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000540086.1:c.93C>T	18.37:g.64239349G>A			O15098	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.V31	ENST00000540086.1	37	c.93	CCDS59325.1	18																																																																																			CDH19	-	NULL	ENSG00000071991		0.443	CDH19-005	PUTATIVE	basic|exp_conf|CCDS	protein_coding	CDH19	HGNC	protein_coding	OTTHUMT00000442285.1	54	0.00	0	G	NM_021153		64239349	64239349	-1	no_errors	ENST00000262150	ensembl	human	known	69_37n	silent	99	25.56	34	SNP	0.000	A
CHRFAM7A	89832	genome.wustl.edu	37	15	30664509	30664509	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr15:30664509A>C	ENST00000299847.2	-	7	817	c.364T>G	c.(364-366)Tgc>Ggc	p.C122G	CHRFAM7A_ENST00000567722.1_5'Flank|CHRFAM7A_ENST00000397827.3_Missense_Mutation_p.C31G|CHRFAM7A_ENST00000401522.3_Missense_Mutation_p.C31G	NM_139320.1	NP_647536.1	Q494W8	CRFM7_HUMAN	CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion	122						integral component of membrane (GO:0016021)	extracellular ligand-gated ion channel activity (GO:0005230)			large_intestine(3)|lung(1)|skin(2)	6		all_lung(180;3.42e-11)|Breast(32;0.000153)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		TCTTTGCAGCACTCATAGAAC	0.502																																						dbGAP											0													70.0	68.0	69.0					15																	30664509		1631	3547	5178	-	-	-	SO:0001583	missense	0			AF029838	CCDS32184.1, CCDS42008.1	15q13.2	2013-04-24	2006-02-01		ENSG00000166664	ENSG00000166664			15781	protein-coding gene	gene with protein product		609756				11829490	Standard	NM_139320		Approved	D-10, CHRNA7-DR1	uc001zdt.1	Q494W8	OTTHUMG00000175645	ENST00000299847.2:c.364T>G	15.37:g.30664509A>C	ENSP00000299847:p.Cys122Gly		A8KAB9	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	p.C122G	ENST00000299847.2	37	c.364	CCDS32184.1	15	.	.	.	.	.	.	.	.	.	.	.	10.85	1.467801	0.26335	.	.	ENSG00000166664	ENST00000299847;ENST00000397827;ENST00000401522	T;T;T	0.78364	-1.17;-1.17;-1.17	2.73	2.73	0.32206	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	T	0.81837	0.4907	M	0.77103	2.36	0.80722	D	1	P	0.43392	0.805	P	0.51170	0.661	T	0.83031	-0.0162	10	0.87932	D	0	.	9.2655	0.37639	1.0:0.0:0.0:0.0	.	122	Q494W8	CRFM7_HUMAN	G	122;31;31	ENSP00000299847:C122G;ENSP00000380927:C31G;ENSP00000385389:C31G	ENSP00000299847:C122G	C	-	1	0	CHRFAM7A	28451801	1.000000	0.71417	1.000000	0.80357	0.177000	0.22998	8.585000	0.90802	1.209000	0.43321	0.327000	0.21459	TGC	CHRFAM7A	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000166664		0.502	CHRFAM7A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRFAM7A	HGNC	protein_coding	OTTHUMT00000430700.1	17	0.00	0	A	NM_148911		30664509	30664509	-1	no_errors	ENST00000299847	ensembl	human	known	69_37n	missense	7	61.11	11	SNP	1.000	C
COL18A1	80781	genome.wustl.edu	37	21	46925826	46925826	+	Silent	SNP	G	G	C			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr21:46925826G>C	ENST00000359759.4	+	36	4428	c.4407G>C	c.(4405-4407)gtG>gtC	p.V1469V	SLC19A1_ENST00000567670.1_Intron|COL18A1_ENST00000400337.2_Silent_p.V1054V|COL18A1_ENST00000355480.5_Silent_p.V1234V			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	1469	Nonhelical region 11 (NC11).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		TCATCTTCGTGGCCGAGCAGG	0.652																																						dbGAP											0													82.0	98.0	93.0					21																	46925826		2097	4190	6287	-	-	-	SO:0001819	synonymous_variant	0				CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.4407G>C	21.37:g.46925826G>C			A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Missense_Mutation	SNP	pfam_Collagenase_NC10/endostatin,superfamily_C-type_lectin_fold	p.W50S	ENST00000359759.4	37	c.149		21	.	.	.	.	.	.	.	.	.	.	G	9.090	1.001473	0.19121	.	.	ENSG00000182871	ENST00000423214	.	.	.	3.93	-0.431	0.12295	.	.	.	.	.	T	0.24122	0.0584	.	.	.	0.24575	N	0.993902	.	.	.	.	.	.	T	0.28235	-1.0050	4	.	.	.	.	4.9053	0.13795	0.2958:0.1544:0.5498:0.0	.	.	.	.	S	50	.	.	W	+	2	0	COL18A1	45750254	0.009000	0.17119	0.331000	0.25455	0.924000	0.55760	-0.062000	0.11674	-0.009000	0.14296	0.491000	0.48974	TGG	COL18A1	-	pfam_Collagenase_NC10/endostatin	ENSG00000182871		0.652	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	COL18A1	HGNC	protein_coding	OTTHUMT00000206827.1	28	0.00	0	G			46925826	46925826	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000423214	ensembl	human	putative	69_37n	missense	56	21.13	15	SNP	0.284	C
CSMD2	114784	genome.wustl.edu	37	1	34498201	34498201	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr1:34498201A>G	ENST00000373381.4	-	3	687	c.511T>C	c.(511-513)Tat>Cat	p.Y171H		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	131	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TTACCTTCATAGGTGGCGTGG	0.562																																						dbGAP											0													95.0	71.0	79.0					1																	34498201		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.511T>C	1.37:g.34498201A>G	ENSP00000362479:p.Tyr171His		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.Y171H	ENST00000373381.4	37	c.511		1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.525518	0.85600	.	.	ENSG00000121904	ENST00000373381	T	0.57107	0.42	5.87	5.87	0.94306	CUB (5);	0.101012	0.41500	U	0.000861	T	0.72740	0.3498	M	0.81802	2.56	0.80722	D	1	D;D	0.76494	0.995;0.999	D;D	0.91635	0.949;0.999	T	0.75775	-0.3199	10	0.56958	D	0.05	.	12.6594	0.56806	1.0:0.0:0.0:0.0	.	131;171	Q7Z408;E7EUA6	CSMD2_HUMAN;.	H	171	ENSP00000362479:Y171H	ENSP00000241312:Y131H	Y	-	1	0	CSMD2	34270788	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.572000	0.74005	2.243000	0.73865	0.533000	0.62120	TAT	CSMD2	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000121904		0.562	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	HGNC	protein_coding		31	0.00	0	A	NM_052896		34498201	34498201	-1	no_errors	ENST00000373381	ensembl	human	known	69_37n	missense	44	18.52	10	SNP	1.000	G
COL9A2	1298	genome.wustl.edu	37	1	40776400	40776400	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr1:40776400T>A	ENST00000372748.3	-	13	766	c.670A>T	c.(670-672)Atc>Ttc	p.I224F		NM_001852.3	NP_001843.1	Q14055	CO9A2_HUMAN	collagen, type IX, alpha 2	224	Triple-helical region 3 (COL3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(4)|stomach(2)|urinary_tract(2)	22	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.08e-17)			GGTCCAGGGATGCCTTGCTCT	0.577																																						dbGAP											0													54.0	52.0	52.0					1																	40776400		2201	4295	6496	-	-	-	SO:0001583	missense	0			M95610	CCDS450.1	1p33-p32	2013-01-16			ENSG00000049089	ENSG00000049089		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2218	protein-coding gene	gene with protein product		120260		EDM2		8454052, 8528240, 1429648	Standard	NM_001852		Approved	MED	uc001cfh.1	Q14055	OTTHUMG00000005761	ENST00000372748.3:c.670A>T	1.37:g.40776400T>A	ENSP00000361834:p.Ile224Phe		B2RMP9	Missense_Mutation	SNP	pfam_Collagen	p.I224F	ENST00000372748.3	37	c.670	CCDS450.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	24.1|24.1	4.494134|4.494134	0.85069|0.85069	.|.	.|.	ENSG00000049089|ENSG00000049089	ENST00000417105|ENST00000372748	.|D	.|0.93604	.|-3.25	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.92440|0.92440	0.7600|0.7600	N|N	0.12746|0.12746	0.255|0.255	0.58432|0.58432	D|D	0.999996|0.999996	.|D	.|0.76494	.|0.999	.|D	.|0.83275	.|0.996	D|D	0.93194|0.93194	0.6586|0.6586	5|10	.|0.54805	.|T	.|0.06	.|.	12.2772|12.2772	0.54741|0.54741	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|224	.|Q14055	.|CO9A2_HUMAN	L|F	212|224	.|ENSP00000361834:I224F	.|ENSP00000361834:I224F	H|I	-|-	2|1	0|0	COL9A2|COL9A2	40548987|40548987	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	2.006000|2.006000	0.40874|0.40874	2.150000|2.150000	0.67090|0.67090	0.456000|0.456000	0.33151|0.33151	CAT|ATC	COL9A2	-	pfam_Collagen	ENSG00000049089		0.577	COL9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL9A2	HGNC	protein_coding	OTTHUMT00000015764.3	33	0.00	0	T	NM_001852		40776400	40776400	-1	no_errors	ENST00000372748	ensembl	human	known	69_37n	missense	62	13.89	10	SNP	1.000	A
DCC	1630	genome.wustl.edu	37	18	50918111	50918111	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr18:50918111G>T	ENST00000442544.2	+	17	3158	c.2542G>T	c.(2542-2544)Gta>Tta	p.V848L	DCC_ENST00000581580.1_Missense_Mutation_p.V483L|DCC_ENST00000412726.1_Missense_Mutation_p.V676L	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	848	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		GCTCCCACCAGTAGGTGTACA	0.512																																						dbGAP											0													141.0	131.0	134.0					18																	50918111		2203	4300	6503	-	-	-	SO:0001583	missense	0			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.2542G>T	18.37:g.50918111G>T	ENSP00000389140:p.Val848Leu			Missense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.V848L	ENST00000442544.2	37	c.2542	CCDS11952.1	18	.	.	.	.	.	.	.	.	.	.	G	15.76	2.929412	0.52759	.	.	ENSG00000187323	ENST00000442544;ENST00000412726	T;T	0.56275	0.47;0.47	5.37	5.37	0.77165	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000003	T	0.70552	0.3237	M	0.72353	2.195	0.58432	D	0.999999	D;D;D	0.76494	0.983;0.983;0.999	P;P;D	0.71184	0.899;0.899;0.972	T	0.66917	-0.5802	10	0.27082	T	0.32	.	17.8905	0.88870	0.0:0.0:1.0:0.0	.	676;676;848	E7EQM8;B4DYX2;P43146	.;.;DCC_HUMAN	L	848;676	ENSP00000389140:V848L;ENSP00000397322:V676L	ENSP00000397322:V676L	V	+	1	0	DCC	49172109	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.682000	0.98655	2.506000	0.84524	0.557000	0.71058	GTA	DCC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000187323		0.512	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3	37	0.00	0	G	NM_005215		50918111	50918111	+1	no_errors	ENST00000442544	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	1.000	T
DENND2C	163259	genome.wustl.edu	37	1	115168068	115168068	+	Missense_Mutation	SNP	C	C	T	rs41274126	byFrequency	TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr1:115168068C>T	ENST00000393274.1	-	4	1163	c.538G>A	c.(538-540)Gtt>Att	p.V180I	DENND2C_ENST00000393277.1_Missense_Mutation_p.V180I|DENND2C_ENST00000393276.3_Missense_Mutation_p.V180I|DENND2C_ENST00000481894.1_5'Flank	NM_001256404.1	NP_001243333.1	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	180					positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|skin(3)	37	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTATCCAGAACTCTGAAGTTC	0.378																																						dbGAP											0													60.0	62.0	62.0					1																	115168068		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS875.1, CCDS58018.1	1p13.2-p13.1	2012-10-03			ENSG00000175984	ENSG00000175984		"""DENN/MADD domain containing"""	24748	protein-coding gene	gene with protein product							Standard	NM_198459		Approved	FLJ37099, DKFZp686G0351, DKFZp779P1149, dJ1156J9.1, RP5-1156J9.1	uc001efd.1	Q68D51	OTTHUMG00000011893	ENST00000393274.1:c.538G>A	1.37:g.115168068C>T	ENSP00000376955:p.Val180Ile		B1AL26|Q5TCX6|Q6P3R3	Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.V180I	ENST00000393274.1	37	c.538	CCDS58018.1	1	.	.	.	.	.	.	.	.	.	.	C	11.20	1.567857	0.28003	.	.	ENSG00000175984	ENST00000393276;ENST00000393274;ENST00000369540;ENST00000393277	T;T;T	0.48201	3.68;3.71;0.82	5.31	2.44	0.29823	.	0.693792	0.13043	N	0.418398	T	0.15912	0.0383	L	0.41236	1.265	0.22389	N	0.99914	B;B	0.10296	0.002;0.003	B;B	0.10450	0.002;0.005	T	0.25363	-1.0134	10	0.38643	T	0.18	.	5.2331	0.15432	0.1451:0.639:0.0:0.2158	.	180;180	Q68D51;Q68D51-3	DEN2C_HUMAN;.	I	180	ENSP00000376957:V180I;ENSP00000376955:V180I;ENSP00000376958:V180I	ENSP00000358553:V180I	V	-	1	0	DENND2C	114969591	0.002000	0.14202	0.754000	0.31244	0.745000	0.42441	0.610000	0.24253	0.256000	0.21614	0.650000	0.86243	GTT	DENND2C	-	NULL	ENSG00000175984		0.378	DENND2C-005	KNOWN	basic|CCDS	protein_coding	DENND2C	HGNC	protein_coding	OTTHUMT00000314822.1	43	0.00	0	C	NM_198459		115168068	115168068	-1	no_errors	ENST00000393274	ensembl	human	known	69_37n	missense	28	15.15	5	SNP	0.949	T
DICER1	23405	genome.wustl.edu	37	14	95582139	95582139	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr14:95582139G>C	ENST00000526495.1	-	13	2063	c.1772C>G	c.(1771-1773)tCc>tGc	p.S591C	DICER1_ENST00000541352.1_Missense_Mutation_p.S591C|DICER1_ENST00000527414.1_Missense_Mutation_p.S591C|DICER1_ENST00000343455.3_Missense_Mutation_p.S591C|DICER1_ENST00000393063.1_Missense_Mutation_p.S591C			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	591	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Required for interaction with PRKRA and TARBP2.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		AACCGACTTGGAACACTTGTT	0.428			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																													dbGAP	yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	0													145.0	113.0	124.0					14																	95582139		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.1772C>G	14.37:g.95582139G>C	ENSP00000437256:p.Ser591Cys		A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Missense_Mutation	SNP	pfam_RNase_III_dom,pfam_PAZ,pfam_Dicer_dsRNA_binding_fold,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,superfamily_RNase_III_dom,superfamily_PAZ,smart_Helicase_ATP-bd,smart_Helicase_C,smart_PAZ,smart_RNase_III_dom,smart_Ds-RNA-bd,pfscan_PAZ,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Ds-RNA-bd,pfscan_RNase_III_dom	p.S591C	ENST00000526495.1	37	c.1772	CCDS9931.1	14	.	.	.	.	.	.	.	.	.	.	G	23.0	4.368684	0.82463	.	.	ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000541352	T;T;T;T;T	0.59638	0.25;0.25;0.25;0.25;0.56	4.95	4.95	0.65309	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.57533	0.2060	L	0.43923	1.385	0.80722	D	1	P	0.45569	0.861	P	0.45138	0.471	T	0.61207	-0.7109	10	0.51188	T	0.08	-6.018	18.5497	0.91058	0.0:0.0:1.0:0.0	.	591	Q9UPY3	DICER_HUMAN	C	591	ENSP00000343745:S591C;ENSP00000437256:S591C;ENSP00000376783:S591C;ENSP00000435681:S591C;ENSP00000444719:S591C	ENSP00000343745:S591C	S	-	2	0	DICER1	94651892	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	9.573000	0.98181	2.453000	0.82957	0.655000	0.94253	TCC	DICER1	-	pfscan_Helicase_C	ENSG00000100697		0.428	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	DICER1	HGNC	protein_coding	OTTHUMT00000387997.1	47	0.00	0	G			95582139	95582139	-1	no_errors	ENST00000343455	ensembl	human	known	69_37n	missense	34	33.33	17	SNP	1.000	C
DLC1	10395	genome.wustl.edu	37	8	12956004	12956005	+	Frame_Shift_Ins	INS	-	-	T			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr8:12956004_12956005insT	ENST00000276297.4	-	10	3479_3480	c.3070_3071insA	c.(3070-3072)tctfs	p.S1024fs	DLC1_ENST00000510318.1_5'Flank|DLC1_ENST00000358919.2_Frame_Shift_Ins_p.S587fs|DLC1_ENST00000520226.1_Frame_Shift_Ins_p.S513fs|DLC1_ENST00000512044.2_Frame_Shift_Ins_p.S621fs	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	1024					actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						CTGGGCCACAGACTGGCAGTTA	0.5																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.3070_3071insA	8.37:g.12956004_12956005insT	ENSP00000276297:p.Ser1024fs		B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Frame_Shift_Ins	INS	pfam_START_lipid-bd,pfam_RhoGAP_dom,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,smart_START_lipid-bd,pfscan_START_lipid-bd,pfscan_RhoGAP_dom	p.S1024fs	ENST00000276297.4	37	c.3071_3070	CCDS5989.1	8																																																																																			DLC1	-	NULL	ENSG00000164741		0.500	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DLC1	HGNC	protein_coding	OTTHUMT00000207632.2	55	0.00	0	-	NM_182643, NM_006094		12956004	12956005	-1	no_errors	ENST00000276297	ensembl	human	known	69_37n	frame_shift_ins	25	30.56	11	INS	1.000:1.000	T
DOCK3	1795	genome.wustl.edu	37	3	51263131	51263131	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr3:51263131G>C	ENST00000266037.9	+	15	1327	c.1304G>C	c.(1303-1305)aGa>aCa	p.R435T		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	435	DHR-1.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		GATTTCGAGAGAGGAGGAAAG	0.463																																						dbGAP											0													151.0	148.0	149.0					3																	51263131		1884	4124	6008	-	-	-	SO:0001583	missense	0			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.1304G>C	3.37:g.51263131G>C	ENSP00000266037:p.Arg435Thr		O15017	Missense_Mutation	SNP	pfam_DOCK,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.R435T	ENST00000266037.9	37	c.1304	CCDS46835.1	3	.	.	.	.	.	.	.	.	.	.	G	23.6	4.436735	0.83885	.	.	ENSG00000088538	ENST00000266037	T	0.14516	2.5	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.34890	0.0913	L	0.61218	1.895	0.80722	D	1	D	0.60160	0.987	P	0.62298	0.9	T	0.01195	-1.1422	10	0.54805	T	0.06	.	19.7077	0.96081	0.0:0.0:1.0:0.0	.	435	Q8IZD9	DOCK3_HUMAN	T	435	ENSP00000266037:R435T	ENSP00000266037:R435T	R	+	2	0	DOCK3	51238171	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.733000	0.93635	0.655000	0.94253	AGA	DOCK3	-	NULL	ENSG00000088538		0.463	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK3	HGNC	protein_coding	OTTHUMT00000346478.5	47	0.00	0	G	NM_004947		51263131	51263131	+1	no_errors	ENST00000266037	ensembl	human	known	69_37n	missense	49	22.22	14	SNP	1.000	C
DST	667	genome.wustl.edu	37	6	56473334	56473334	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr6:56473334G>C	ENST00000361203.3	-	36	5466	c.5459C>G	c.(5458-5460)aCt>aGt	p.T1820S	DST_ENST00000446842.2_Missense_Mutation_p.T1494S|DST_ENST00000421834.2_Intron|DST_ENST00000370754.5_Missense_Mutation_p.T1998S|DST_ENST00000312431.6_Missense_Mutation_p.T1820S|DST_ENST00000370788.2_Intron|DST_ENST00000370769.4_Missense_Mutation_p.T1820S|DST_ENST00000244364.6_Intron			Q03001	DYST_HUMAN	dystonin	1820					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GATTCCACCAGTTTGAACCTG	0.458																																						dbGAP											0													62.0	60.0	61.0					6																	56473334		1912	4120	6032	-	-	-	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.5459C>G	6.37:g.56473334G>C	ENSP00000354508:p.Thr1820Ser		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.T1998S	ENST00000361203.3	37	c.5993		6	.	.	.	.	.	.	.	.	.	.	G	14.39	2.522179	0.44866	.	.	ENSG00000151914	ENST00000370754;ENST00000370769;ENST00000446842;ENST00000312431;ENST00000361203;ENST00000439203	D;D;D;D;D;D	0.82167	-1.58;-1.58;-1.58;-1.58;-1.58;-1.58	5.21	4.34	0.51931	.	0.000000	0.53938	D	0.000046	T	0.72882	0.3516	.	.	.	0.29729	N	0.838034	P	0.42584	0.784	B	0.43867	0.434	T	0.75342	-0.3351	8	0.51188	T	0.08	.	10.971	0.47438	0.0:0.1406:0.7132:0.1461	.	1494	Q03001-9	.	S	1998;1820;1494;1820;1820;1494	ENSP00000359790:T1998S;ENSP00000359805:T1820S;ENSP00000393645:T1494S;ENSP00000307959:T1820S;ENSP00000354508:T1820S;ENSP00000404924:T1494S	ENSP00000307959:T1820S	T	-	2	0	DST	56581293	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	2.667000	0.46808	1.337000	0.45525	-0.373000	0.07131	ACT	DST	-	pfam_Plectin_repeat,superfamily_ABC_transptrTM_dom_typ1,smart_Plectin_repeat	ENSG00000151914		0.458	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	42	0.00	0	G	NM_001723		56473334	56473334	-1	no_errors	ENST00000370754	ensembl	human	known	69_37n	missense	31	35.42	17	SNP	0.999	C
EEF1D	1936	genome.wustl.edu	37	8	144662368	144662368	+	Silent	SNP	A	A	G			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr8:144662368A>G	ENST00000529272.1	-	7	1021	c.621T>C	c.(619-621)gaT>gaC	p.D207D	EEF1D_ENST00000442189.2_Silent_p.D573D|EEF1D_ENST00000419152.2_Silent_p.D207D|NAPRT1_ENST00000435154.3_5'Flank|EEF1D_ENST00000531621.1_Silent_p.D164D|EEF1D_ENST00000532400.1_Intron|EEF1D_ENST00000528610.1_Silent_p.D183D|NAPRT1_ENST00000449291.2_5'Flank|EEF1D_ENST00000526838.1_Silent_p.D188D|EEF1D_ENST00000395119.3_Silent_p.D207D|RP11-661A12.9_ENST00000531730.1_RNA|EEF1D_ENST00000532741.1_Silent_p.D623D|EEF1D_ENST00000524624.1_Silent_p.D183D|EEF1D_ENST00000317198.6_Silent_p.D207D|EEF1D_ENST00000423316.2_Silent_p.D573D|RP11-661A12.7_ENST00000529247.1_RNA|NAPRT1_ENST00000426292.3_5'Flank|NAPRT1_ENST00000276844.7_5'Flank			P29692	EF1D_HUMAN	eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)	207	Catalytic (GEF).				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)			breast(2)|cervix(1)|endometrium(1)|kidney(4)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			TGTCCGTCTCATCATCCCACT	0.622																																						dbGAP											0													27.0	31.0	30.0					8																	144662368		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			AK024550	CCDS6404.1, CCDS6405.1, CCDS47930.1, CCDS56559.1	8q24	2011-09-15			ENSG00000104529	ENSG00000104529			3211	protein-coding gene	gene with protein product		130592				8334168	Standard	NM_001960		Approved	EF-1D, FLJ20897	uc003yyt.3	P29692	OTTHUMG00000165191	ENST00000529272.1:c.621T>C	8.37:g.144662368A>G			B4DDU4|D3DWK3|E9PBQ9|Q4VBZ6|Q969J1|Q96I38	Nonstop_Mutation	SNP	pfam_Transl_elong_fac_EF1B_bsu/dsu,pfam_EF-1_beta_acid_region_euk,superfamily_Transl_elong_fac_EF1B_bsu/dsu,smart_Transl_elong_fac_EF1B_bsu/dsu	p.*82R	ENST00000529272.1	37	c.244	CCDS6405.1	8	.	.	.	.	.	.	.	.	.	.	A	10.23	1.292202	0.23564	.	.	ENSG00000104529	ENST00000530109	.	.	.	5.14	-0.934	0.10428	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.212	0.48804	0.5541:0.0:0.4459:0.0	.	.	.	.	R	82	.	.	X	-	1	0	EEF1D	144733511	0.010000	0.17322	0.996000	0.52242	0.898000	0.52572	-0.593000	0.05740	-0.113000	0.11958	0.477000	0.44152	TGA	EEF1D	-	pfam_Transl_elong_fac_EF1B_bsu/dsu,superfamily_Transl_elong_fac_EF1B_bsu/dsu,smart_Transl_elong_fac_EF1B_bsu/dsu	ENSG00000104529		0.622	EEF1D-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	EEF1D	HGNC	protein_coding	OTTHUMT00000382592.2	29	0.00	0	A	NM_032378		144662368	144662368	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000530109	ensembl	human	putative	69_37n	nonstop	38	19.15	9	SNP	0.985	G
EHD1	10938	genome.wustl.edu	37	11	64622246	64622246	+	Silent	SNP	G	G	A			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr11:64622246G>A	ENST00000320631.3	-	5	1418	c.1164C>T	c.(1162-1164)aaC>aaT	p.N388N	EHD1_ENST00000488711.1_5'UTR|EHD1_ENST00000359393.2_Silent_p.N388N	NM_001282445.1|NM_006795.2	NP_001269374.1|NP_006786.2	Q9H4M9	EHD1_HUMAN	EH-domain containing 1	388					blood coagulation (GO:0007596)|cellular response to nerve growth factor stimulus (GO:1990090)|cholesterol homeostasis (GO:0042632)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|low-density lipoprotein particle clearance (GO:0034383)|neuron projection development (GO:0031175)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of myoblast fusion (GO:1901741)|protein homooligomerization (GO:0051260)	early endosome membrane (GO:0031901)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	12						GCGCGATGTCGTTGGCCAGCA	0.642																																						dbGAP											0													225.0	209.0	214.0					11																	64622246		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0			AF099011	CCDS8084.1, CCDS73315.1	11q13	2013-01-10			ENSG00000110047	ENSG00000110047		"""EF-hand domain containing"""	3242	protein-coding gene	gene with protein product	"""testilin"""	605888		PAST1		10395801, 10673336	Standard	NM_001282444		Approved	H-PAST, HPAST1, FLJ42622, FLJ44618	uc001obu.1	Q9H4M9	OTTHUMG00000066832	ENST00000320631.3:c.1164C>T	11.37:g.64622246G>A			O14611|Q2M3Q4|Q9UNR3	Silent	SNP	pfam_Dynamin_GTPase,smart_EPS15_homology,pfscan_EF_HAND_2,pfscan_EPS15_homology	p.N388	ENST00000320631.3	37	c.1164	CCDS8084.1	11																																																																																			EHD1	-	NULL	ENSG00000110047		0.642	EHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHD1	HGNC	protein_coding	OTTHUMT00000143229.2	25	0.00	0	G	NM_006795		64622246	64622246	-1	no_errors	ENST00000320631	ensembl	human	known	69_37n	silent	43	33.85	22	SNP	0.997	A
ELFN2	114794	genome.wustl.edu	37	22	37771398	37771398	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr22:37771398G>T	ENST00000402918.2	-	3	962	c.177C>A	c.(175-177)gaC>gaA	p.D59E	RP1-63G5.5_ENST00000430883.1_RNA|RP1-63G5.8_ENST00000609322.1_RNA|ELFN2_ENST00000435824.1_5'Flank	NM_052906.3	NP_443138.2	Q5R3F8	PPR29_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 2	59					negative regulation of phosphatase activity (GO:0010923)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	35	Melanoma(58;0.0574)					TGAGCCGCAGGTCGTGCACGG	0.587																																						dbGAP											0													241.0	231.0	234.0					22																	37771398		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC041596	CCDS33642.1	22q13.1	2013-02-11	2011-10-27	2011-10-27	ENSG00000166897	ENSG00000166897		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	29396	protein-coding gene	gene with protein product			"""leucine rich repeat containing 62"", ""extracellular leucine-rich repeat and fibronectin type III containing 2"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 2"", ""protein phosphatase 1, regulatory subunit 29"""	LRRC62, PPP1R29		17868438	Standard	XR_244427		Approved	dJ63G5.3, KIAA1904	uc003asq.4	Q5R3F8	OTTHUMG00000150558	ENST00000402918.2:c.177C>A	22.37:g.37771398G>T	ENSP00000385277:p.Asp59Glu		Q96PY3	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,pfscan_LPXTG-motif_cell_wall_anchor	p.D59E	ENST00000402918.2	37	c.177	CCDS33642.1	22	.	.	.	.	.	.	.	.	.	.	G	17.73	3.462342	0.63513	.	.	ENSG00000166897	ENST00000349653;ENST00000402918	T;T	0.49139	0.79;0.79	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.57315	0.2045	L	0.31065	0.9	0.58432	D	0.999998	D	0.76494	0.999	D	0.79784	0.993	T	0.53844	-0.8381	10	0.28530	T	0.3	-34.6549	18.2319	0.89937	0.0:0.0:1.0:0.0	.	59	Q5R3F8	PPR29_HUMAN	E	59	ENSP00000300147:D59E;ENSP00000385277:D59E	ENSP00000300147:D59E	D	-	3	2	ELFN2	36101344	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	5.485000	0.66850	2.297000	0.77311	0.407000	0.27541	GAC	ELFN2	-	NULL	ENSG00000166897		0.587	ELFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELFN2	HGNC	protein_coding	OTTHUMT00000318900.2	54	0.00	0	G	NM_052906		37771398	37771398	-1	no_errors	ENST00000349653	ensembl	human	known	69_37n	missense	114	29.45	48	SNP	1.000	T
ETS2	2114	genome.wustl.edu	37	21	40191520	40191520	+	Nonsense_Mutation	SNP	T	T	A			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr21:40191520T>A	ENST00000360214.3	+	9	1365	c.905T>A	c.(904-906)tTg>tAg	p.L302*	ETS2_ENST00000360938.3_Nonsense_Mutation_p.L302*	NM_001256295.1	NP_001243224.1	P15036	ETS2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 2	302					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18		Prostate(19;6.33e-08)|all_epithelial(19;0.123)				CAGTCGTCCTTGCTGGATGTG	0.552																																						dbGAP											0													87.0	76.0	80.0					21																	40191520		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS13659.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157557	ENSG00000157557			3489	protein-coding gene	gene with protein product		164740	"""v-ets erythroblastosis virus E26 oncogene homolog 2 (avian)"""			17986575	Standard	NM_001256295		Approved		uc002yxf.3	P15036	OTTHUMG00000090769	ENST00000360214.3:c.905T>A	21.37:g.40191520T>A	ENSP00000353344:p.Leu302*		A6NM68|D3DSH6|Q53Y89	Nonsense_Mutation	SNP	pfam_Ets,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets,pirsf_Transforming_factor_C-ets,pfscan_Ets,prints_Ets	p.L302*	ENST00000360214.3	37	c.905	CCDS13659.1	21	.	.	.	.	.	.	.	.	.	.	T	42	9.749403	0.99255	.	.	ENSG00000157557	ENST00000360214;ENST00000360938	.	.	.	5.9	5.9	0.94986	.	0.219920	0.38436	N	0.001681	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.3322	0.83039	0.0:0.0:0.0:1.0	.	.	.	.	X	302	.	ENSP00000353344:L302X	L	+	2	0	ETS2	39113390	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.555000	0.82223	2.251000	0.74343	0.528000	0.53228	TTG	ETS2	-	pirsf_Transforming_factor_C-ets	ENSG00000157557		0.552	ETS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETS2	HGNC	protein_coding	OTTHUMT00000207544.1	40	0.00	0	T			40191520	40191520	+1	no_errors	ENST00000360214	ensembl	human	known	69_37n	nonsense	64	16.88	13	SNP	0.998	A
BRINP3	339479	genome.wustl.edu	37	1	190067723	190067723	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr1:190067723A>C	ENST00000367462.3	-	8	1957	c.1726T>G	c.(1726-1728)Ttc>Gtc	p.F576V	BRINP3_ENST00000534846.1_Missense_Mutation_p.F474V	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	576					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.F576I(1)									CTGCCTCCGAAGGGATTGACA	0.463																																						dbGAP											1	Substitution - Missense(1)	lung(1)											84.0	90.0	88.0					1																	190067723		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1726T>G	1.37:g.190067723A>C	ENSP00000356432:p.Phe576Val		B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.F576V	ENST00000367462.3	37	c.1726	CCDS1373.1	1	.	.	.	.	.	.	.	.	.	.	A	17.34	3.364419	0.61513	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.25414	2.04;1.8	5.64	5.64	0.86602	.	0.151580	0.56097	D	0.000022	T	0.50548	0.1622	M	0.73962	2.25	0.58432	D	0.999999	D;D	0.61080	0.989;0.967	D;P	0.70487	0.969;0.879	T	0.54410	-0.8298	10	0.87932	D	0	.	13.7983	0.63184	1.0:0.0:0.0:0.0	.	474;576	B7Z260;Q76B58	.;FAM5C_HUMAN	V	576;474	ENSP00000356432:F576V;ENSP00000438022:F474V	ENSP00000356432:F576V	F	-	1	0	FAM5C	188334346	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	9.237000	0.95368	2.143000	0.66587	0.482000	0.46254	TTC	FAM5C	-	NULL	ENSG00000162670		0.463	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM5C	HGNC	protein_coding	OTTHUMT00000086278.1	32	0.00	0	A	NM_199051		190067723	190067723	-1	no_errors	ENST00000367462	ensembl	human	known	69_37n	missense	54	21.74	15	SNP	1.000	C
FATE1	89885	genome.wustl.edu	37	X	150889973	150889973	+	Splice_Site	SNP	G	G	C	rs149441058		TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chrX:150889973G>C	ENST00000370350.3	+	3	426	c.341G>C	c.(340-342)cGc>cCc	p.R114P		NM_033085.2	NP_149076.1	Q969F0	FATE1_HUMAN	fetal and adult testis expressed 1	114						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(6)|ovary(1)	15	Acute lymphoblastic leukemia(192;6.56e-05)					CATTATGATCGGTAAGAGCTG	0.602																																						dbGAP											0													76.0	60.0	65.0					X																	150889973		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF249872	CCDS14700.1	Xq28	2009-03-25			ENSG00000147378	ENSG00000147378			24683	protein-coding gene	gene with protein product	"""cancer/testis antigen 43"""	300450				11694338	Standard	NM_033085		Approved	FATE, CT43	uc004fex.3	Q969F0	OTTHUMG00000024172	ENST00000370350.3:c.341+1G>C	X.37:g.150889973G>C				Missense_Mutation	SNP	pfam_FATE/Miff/Tango-11	p.R114P	ENST00000370350.3	37	c.341	CCDS14700.1	X	.	.	.	.	.	.	.	.	.	.	G	7.901	0.734375	0.15574	.	.	ENSG00000147378	ENST00000370350	T	0.48201	0.82	3.92	1.14	0.20703	.	1.132520	0.06614	N	0.756234	T	0.47266	0.1436	L	0.29908	0.895	0.09310	N	1	D	0.60575	0.988	P	0.54965	0.765	T	0.35325	-0.9793	10	0.59425	D	0.04	-0.0367	5.8408	0.18633	0.3632:0.0:0.6368:0.0	.	114	Q969F0	FATE1_HUMAN	P	114	ENSP00000359375:R114P	ENSP00000359375:R114P	R	+	2	0	FATE1	150640629	0.516000	0.26218	0.017000	0.16124	0.023000	0.10783	0.465000	0.22004	0.114000	0.18032	0.529000	0.55759	CGC	FATE1	-	pfam_FATE/Miff/Tango-11	ENSG00000147378		0.602	FATE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FATE1	HGNC	protein_coding	OTTHUMT00000060885.1	36	0.00	0	G	NM_033085	Missense_Mutation	150889973	150889973	+1	no_errors	ENST00000370350	ensembl	human	known	69_37n	missense	18	28.00	7	SNP	0.016	C
FCER1A	2205	genome.wustl.edu	37	1	159273897	159273897	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr1:159273897G>A	ENST00000368115.1	+	4	355	c.256G>A	c.(256-258)Gaa>Aaa	p.E86K	FCER1A_ENST00000368114.1_Missense_Mutation_p.E53K	NM_002001.3	NP_001992.1	P12319	FCERA_HUMAN	Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide	86	Ig-like 1.				activation of JUN kinase activity (GO:0007257)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|leukotriene biosynthetic process (GO:0019370)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-3 biosynthetic process (GO:0045401)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of type I hypersensitivity (GO:0001812)|serotonin secretion (GO:0001820)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	IgE receptor activity (GO:0019767)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(19)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33	all_hematologic(112;0.0429)				Benzylpenicilloyl Polylysine(DB00895)|Omalizumab(DB00043)	TGCCAAATTTGAAGACAGTGG	0.398																																						dbGAP											0													77.0	77.0	77.0					1																	159273897		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC015195	CCDS1184.1	1q23	2013-01-11			ENSG00000179639	ENSG00000179639		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3609	protein-coding gene	gene with protein product		147140		FCE1A		8245459	Standard	NM_002001		Approved		uc001ftq.3	P12319	OTTHUMG00000037176	ENST00000368115.1:c.256G>A	1.37:g.159273897G>A	ENSP00000357097:p.Glu86Lys			Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.E86K	ENST00000368115.1	37	c.256	CCDS1184.1	1	.	.	.	.	.	.	.	.	.	.	G	9.858	1.195592	0.22037	.	.	ENSG00000179639	ENST00000368115;ENST00000368114	T;T	0.13420	2.59;2.96	4.7	-2.71	0.05986	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	1.669550	0.03376	N	0.199744	T	0.02230	0.0069	N	0.16743	0.435	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.42258	-0.9462	10	0.21014	T	0.42	.	8.0154	0.30379	0.3771:0.2086:0.4143:0.0	.	86	P12319	FCERA_HUMAN	K	86;53	ENSP00000357097:E86K;ENSP00000357096:E53K	ENSP00000357096:E53K	E	+	1	0	FCER1A	157540521	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-1.086000	0.03386	-0.285000	0.09089	-0.251000	0.11542	GAA	FCER1A	-	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000179639		0.398	FCER1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCER1A	HGNC	protein_coding	OTTHUMT00000090328.2	31	0.00	0	G	NM_002001		159273897	159273897	+1	no_errors	ENST00000368115	ensembl	human	known	69_37n	missense	29	23.68	9	SNP	0.000	A
FREM3	166752	genome.wustl.edu	37	4	144548913	144548913	+	Splice_Site	SNP	C	C	A			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr4:144548913C>A	ENST00000329798.5	-	3	5275	c.5276G>T	c.(5275-5277)gGa>gTa	p.G1759V		NM_001168235.1	NP_001161707.1	P0C091	FREM3_HUMAN	FRAS1 related extracellular matrix 3	1759					cell adhesion (GO:0007155)|cell communication (GO:0007154)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|prostate(1)	8						TTTATTTCCTCCTGCAATTGA	0.373																																						dbGAP											0													151.0	118.0	128.0					4																	144548913		692	1591	2283	-	-	-	SO:0001630	splice_region_variant	0			BX091796	CCDS54808.1	4q31.21	2011-06-09			ENSG00000183090	ENSG00000183090			25172	protein-coding gene	gene with protein product		608946				15345741	Standard	NM_001168235		Approved		uc021xsj.1	P0C091	OTTHUMG00000161577	ENST00000329798.5:c.5276-1G>T	4.37:g.144548913C>A				Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.G1759V	ENST00000329798.5	37	c.5276	CCDS54808.1	4	.	.	.	.	.	.	.	.	.	.	C	11.48	1.650809	0.29336	.	.	ENSG00000183090	ENST00000329798	T	0.20463	2.07	3.68	1.94	0.25998	.	0.072416	0.53938	D	0.000046	T	0.41926	0.1180	M	0.88310	2.945	0.80722	D	1	.	.	.	.	.	.	T	0.27739	-1.0065	8	0.52906	T	0.07	.	8.5081	0.33199	0.0:0.8011:0.0:0.1989	.	.	.	.	V	1759	ENSP00000332886:G1759V	ENSP00000332886:G1759V	G	-	2	0	FREM3	144768363	1.000000	0.71417	0.964000	0.40570	0.211000	0.24417	1.271000	0.33098	0.246000	0.21394	-0.251000	0.11542	GGA	FREM3	-	NULL	ENSG00000183090		0.373	FREM3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	FREM3	HGNC	protein_coding	OTTHUMT00000365391.1	45	0.00	0	C	XM_094074	Missense_Mutation	144548913	144548913	-1	no_errors	ENST00000329798	ensembl	human	putative	69_37n	missense	45	19.64	11	SNP	1.000	A
GLCCI1	113263	genome.wustl.edu	37	7	8126035	8126035	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr7:8126035C>T	ENST00000223145.5	+	8	2068	c.1511C>T	c.(1510-1512)aCg>aTg	p.T504M		NM_138426.3	NP_612435.1	Q86VQ1	GLCI1_HUMAN	glucocorticoid induced transcript 1	504						cytoplasm (GO:0005737)				endometrium(4)|large_intestine(4)|lung(13)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	25		Ovarian(82;0.0608)		UCEC - Uterine corpus endometrioid carcinoma (126;0.206)		GTTTCCTTTACGTCTCTTTCT	0.577																																						dbGAP											0													179.0	196.0	190.0					7																	8126035		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC050291	CCDS34601.1	7p22.2	2008-08-18			ENSG00000106415	ENSG00000106415			18713	protein-coding gene	gene with protein product		614283					Standard	NM_138426		Approved	GIG18, FAM117C, TSSN1	uc003srk.4	Q86VQ1	OTTHUMG00000151984	ENST00000223145.5:c.1511C>T	7.37:g.8126035C>T	ENSP00000223145:p.Thr504Met		A4D103|Q96FD0	Missense_Mutation	SNP	NULL	p.T504M	ENST00000223145.5	37	c.1511	CCDS34601.1	7	.	.	.	.	.	.	.	.	.	.	C	10.67	1.414419	0.25465	.	.	ENSG00000106415	ENST00000223145	.	.	.	5.32	5.32	0.75619	.	0.414302	0.26935	N	0.021750	T	0.42966	0.1226	N	0.19112	0.55	0.09310	N	1	D	0.61080	0.989	P	0.51582	0.674	T	0.39702	-0.9601	9	0.72032	D	0.01	-19.6874	19.5787	0.95455	0.0:1.0:0.0:0.0	.	504	Q86VQ1	GLCI1_HUMAN	M	504	.	ENSP00000223145:T504M	T	+	2	0	GLCCI1	8092560	0.981000	0.34729	0.026000	0.17262	0.247000	0.25773	7.032000	0.76498	2.941000	0.99782	0.655000	0.94253	ACG	GLCCI1	-	NULL	ENSG00000106415		0.577	GLCCI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLCCI1	HGNC	protein_coding	OTTHUMT00000324672.1	45	0.00	0	C	NM_138426		8126035	8126035	+1	no_errors	ENST00000223145	ensembl	human	known	69_37n	missense	41	21.15	11	SNP	0.062	T
HCFC2	29915	genome.wustl.edu	37	12	104459971	104459971	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr12:104459971G>C	ENST00000229330.4	+	2	294	c.190G>C	c.(190-192)Gtt>Ctt	p.V64L	GLT8D2_ENST00000548660.1_5'Flank	NM_013320.2	NP_037452.1	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2	64					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						TCTGCCAGCTGTTAGAGGAGA	0.388																																					Esophageal Squamous(184;1814 2036 4771 6974 15702)	dbGAP											0													136.0	132.0	133.0					12																	104459971		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF117210	CCDS9097.1	12q23.3	2011-03-30			ENSG00000111727	ENSG00000111727			24972	protein-coding gene	gene with protein product		607926				10196288	Standard	NM_013320		Approved	HCF-2	uc001tkj.4	Q9Y5Z7	OTTHUMG00000170175	ENST00000229330.4:c.190G>C	12.37:g.104459971G>C	ENSP00000229330:p.Val64Leu		B2R8Q5|C0H5X3	Missense_Mutation	SNP	pfam_Kelch_1,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.V64L	ENST00000229330.4	37	c.190	CCDS9097.1	12	.	.	.	.	.	.	.	.	.	.	G	17.32	3.360338	0.61403	.	.	ENSG00000111727	ENST00000229330	T	0.73258	-0.73	4.11	4.11	0.48088	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.79040	0.4379	L	0.46614	1.455	0.58432	D	0.999994	D	0.58970	0.984	D	0.70016	0.967	T	0.79095	-0.1944	10	0.40728	T	0.16	-12.4564	16.7318	0.85436	0.0:0.0:1.0:0.0	.	64	Q9Y5Z7	HCFC2_HUMAN	L	64	ENSP00000229330:V64L	ENSP00000229330:V64L	V	+	1	0	HCFC2	102984101	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	9.575000	0.98187	1.986000	0.57962	0.655000	0.94253	GTT	HCFC2	-	NULL	ENSG00000111727		0.388	HCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCFC2	HGNC	protein_coding	OTTHUMT00000407780.1	50	0.00	0	G	NM_013320		104459971	104459971	+1	no_errors	ENST00000229330	ensembl	human	known	69_37n	missense	44	29.03	18	SNP	1.000	C
IGFALS	3483	genome.wustl.edu	37	16	1840820	1840820	+	Silent	SNP	C	C	T			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr16:1840820C>T	ENST00000215539.3	-	2	1709	c.1599G>A	c.(1597-1599)ctG>ctA	p.L533L	IGFALS_ENST00000415638.3_Silent_p.L571L			P35858	ALS_HUMAN	insulin-like growth factor binding protein, acid labile subunit	533					cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin-like growth factor binding (GO:0005520)			endometrium(2)|lung(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	8						GGTTACCCTCCAGCCACAGGC	0.687																																						dbGAP											0													14.0	13.0	13.0					16																	1840820		2133	4226	6359	-	-	-	SO:0001819	synonymous_variant	0			M86826	CCDS10446.1, CCDS53982.1	16p13.3	2008-07-28			ENSG00000099769	ENSG00000099769			5468	protein-coding gene	gene with protein product		601489				1379671, 16114275	Standard	NM_004970		Approved	ALS	uc010uvn.2	P35858	OTTHUMG00000128638	ENST00000215539.3:c.1599G>A	16.37:g.1840820C>T			B4DZY8|E9PGU3	Silent	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.L571	ENST00000215539.3	37	c.1713	CCDS10446.1	16																																																																																			IGFALS	-	NULL	ENSG00000099769		0.687	IGFALS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFALS	HGNC	protein_coding	OTTHUMT00000250509.2	12	0.00	0	C			1840820	1840820	-1	no_errors	ENST00000415638	ensembl	human	known	69_37n	silent	14	26.32	5	SNP	0.000	T
IGHV1-46	28465	genome.wustl.edu	37	14	106967297	106967297	+	RNA	SNP	C	C	A	rs372749973		TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr14:106967297C>A	ENST00000390622.2	-	0	406									immunoglobulin heavy variable 1-46																		TTCACTGAGGCCCCAGGCTTC	0.572																																						dbGAP											0													92.0	90.0	91.0					14																	106967297		1909	4116	6025	-	-	-			0			X92343		14q32.33	2012-02-08			ENSG00000211962	ENSG00000211962		"""Immunoglobulins / IGH locus"""	5554	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000151963		14.37:g.106967297C>A				Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.A35S	ENST00000390622.2	37	c.103		14																																																																																			IGHV1-46	-	pfam_Ig_V-set,pfscan_Ig-like	ENSG00000211962		0.572	IGHV1-46-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGHV1-46	HGNC	IG_V_gene	OTTHUMT00000324609.1	56	0.00	0	C	NG_001019		106967297	106967297	-1	no_stop_codon	ENST00000390622	ensembl	human	known	69_37n	missense	74	18.68	17	SNP	0.025	A
IQGAP3	128239	genome.wustl.edu	37	1	156532441	156532441	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr1:156532441T>A	ENST00000361170.2	-	9	825	c.815A>T	c.(814-816)cAg>cTg	p.Q272L		NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	272					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					ATAGATGTCCTGGCTTTCTCT	0.483																																						dbGAP											0													239.0	209.0	219.0					1																	156532441		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.815A>T	1.37:g.156532441T>A	ENSP00000354451:p.Gln272Leu		Q5T3H8	Missense_Mutation	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_RasGAP	p.Q272L	ENST00000361170.2	37	c.815	CCDS1144.1	1	.	.	.	.	.	.	.	.	.	.	T	13.37	2.215725	0.39102	.	.	ENSG00000183856	ENST00000361170	T	0.42900	0.96	5.24	-1.83	0.07833	.	0.685094	0.14557	N	0.312315	T	0.04407	0.0121	N	0.04508	-0.205	0.27834	N	0.941337	B	0.02656	0.0	B	0.01281	0.0	T	0.33650	-0.9860	10	0.27785	T	0.31	-0.3657	0.4185	0.00452	0.2455:0.1497:0.2529:0.3518	.	272	Q86VI3	IQGA3_HUMAN	L	272	ENSP00000354451:Q272L	ENSP00000354451:Q272L	Q	-	2	0	IQGAP3	154799065	0.105000	0.21958	0.754000	0.31244	0.932000	0.56968	0.452000	0.21795	-0.377000	0.07930	-0.333000	0.08304	CAG	IQGAP3	-	NULL	ENSG00000183856		0.483	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP3	HGNC	protein_coding	OTTHUMT00000080657.1	78	0.00	0	T	NM_178229		156532441	156532441	-1	no_errors	ENST00000361170	ensembl	human	known	69_37n	missense	240	14.29	40	SNP	0.986	A
KCNA4	3739	genome.wustl.edu	37	11	30033730	30033730	+	Missense_Mutation	SNP	A	A	T			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr11:30033730A>T	ENST00000328224.6	-	2	1729	c.496T>A	c.(496-498)Tac>Aac	p.Y166N	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	166					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	ACTGAACTGTAGCCGCCACCG	0.507																																						dbGAP											0													59.0	60.0	60.0					11																	30033730		2169	4262	6431	-	-	-	SO:0001583	missense	0			M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.496T>A	11.37:g.30033730A>T	ENSP00000328511:p.Tyr166Asn			Missense_Mutation	SNP	pfam_K_chnl_volt-dep_Kv1.4_TID,pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.4,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.Y166N	ENST00000328224.6	37	c.496	CCDS41629.1	11	.	.	.	.	.	.	.	.	.	.	A	18.15	3.560246	0.65538	.	.	ENSG00000182255	ENST00000328224	D	0.96940	-4.18	4.66	4.66	0.58398	.	0.520499	0.17835	U	0.160384	D	0.92044	0.7479	N	0.24115	0.695	0.80722	D	1	B	0.15141	0.012	B	0.15870	0.014	D	0.88425	0.3031	10	0.27785	T	0.31	.	14.1174	0.65164	1.0:0.0:0.0:0.0	.	166	P22459	KCNA4_HUMAN	N	166	ENSP00000328511:Y166N	ENSP00000328511:Y166N	Y	-	1	0	KCNA4	29990306	1.000000	0.71417	0.953000	0.39169	0.793000	0.44817	7.437000	0.80417	1.743000	0.51761	0.459000	0.35465	TAC	KCNA4	-	NULL	ENSG00000182255		0.507	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA4	HGNC	protein_coding	OTTHUMT00000388074.2	35	0.00	0	A	NM_002233		30033730	30033730	-1	no_errors	ENST00000328224	ensembl	human	known	69_37n	missense	32	20.00	8	SNP	1.000	T
KCNJ10	3766	genome.wustl.edu	37	1	160011189	160011189	+	Silent	SNP	A	A	G			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr1:160011189A>G	ENST00000368089.3	-	2	1360	c.1134T>C	c.(1132-1134)aaT>aaC	p.N378N	KCNJ10_ENST00000509700.1_Intron	NM_002241.4	NP_002232.2	P78508	KCJ10_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 10	378					adult walking behavior (GO:0007628)|central nervous system myelination (GO:0022010)|inflammatory response (GO:0006954)|L-glutamate uptake involved in synaptic transmission (GO:0051935)|membrane hyperpolarization (GO:0060081)|optic nerve development (GO:0021554)|potassium ion homeostasis (GO:0055075)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of resting membrane potential (GO:0060075)|regulation of sensory perception of pain (GO:0051930)|response to blue light (GO:0009637)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|synaptic transmission (GO:0007268)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)	17	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)		Yohimbine(DB01392)	GTCATCAGACATTGCTGATGC	0.537																																					GBM(167;1368 2014 14817 36425 43215)	dbGAP											0													87.0	66.0	73.0					1																	160011189		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U52155	CCDS1193.1	1q23.2	2011-07-05			ENSG00000177807	ENSG00000177807		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6256	protein-coding gene	gene with protein product		602208				9367690, 8995301, 16382105	Standard	NM_002241		Approved	Kir4.1, Kir1.2	uc001fuw.2	P78508	OTTHUMG00000024073	ENST00000368089.3:c.1134T>C	1.37:g.160011189A>G			A3KME7|Q5VUT9|Q8N4I7|Q92808	Silent	SNP	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir_Cr2,prints_K_chnl_inward-rec_Kir1.2,prints_K_chnl_inward-rec_Kir1.1	p.N378	ENST00000368089.3	37	c.1134	CCDS1193.1	1																																																																																			KCNJ10	-	pirsf_K_chnl_inward-rec_Kir	ENSG00000177807		0.537	KCNJ10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ10	HGNC	protein_coding	OTTHUMT00000060629.1	36	0.00	0	A	NM_002241		160011189	160011189	-1	no_errors	ENST00000368089	ensembl	human	known	69_37n	silent	55	15.38	10	SNP	0.414	G
KIAA1549L	25758	genome.wustl.edu	37	11	33596315	33596315	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr11:33596315A>G	ENST00000321505.4	+	9	3587	c.3407A>G	c.(3406-3408)aAc>aGc	p.N1136S	KIAA1549L_ENST00000389726.3_Missense_Mutation_p.N1142S|KIAA1549L_ENST00000265654.5_Missense_Mutation_p.N1142S			Q6ZVL6	K154L_HUMAN	KIAA1549-like	1136						integral component of membrane (GO:0016021)											ACCCTGTACAACGGGAAGCCT	0.547																																						dbGAP											0													104.0	108.0	107.0					11																	33596315		2020	4169	6189	-	-	-	SO:0001583	missense	0			U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.3407A>G	11.37:g.33596315A>G	ENSP00000315295:p.Asn1136Ser		B0QYU0	Missense_Mutation	SNP	NULL	p.N1142S	ENST00000321505.4	37	c.3425	CCDS44565.2	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.8|24.8	4.568454|4.568454	0.86439|0.86439	.|.	.|.	ENSG00000110427|ENSG00000110427	ENST00000321505;ENST00000389726;ENST00000265654;ENST00000536568|ENST00000526400	.|.	.|.	.|.	5.45|5.45	5.45|5.45	0.79879|0.79879	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.70263|0.70263	0.3204|0.3204	L|L	0.58101|0.58101	1.795|1.795	0.42055|0.42055	D|D	0.991133|0.991133	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.87578|.	0.998;0.998|.	T|T	0.69540|0.69540	-0.5118|-0.5118	9|5	0.72032|.	D|.	0.01|.	-24.5456|-24.5456	15.5188|15.5188	0.75846|0.75846	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1142;1142|.	E9PAT2;Q6ZVL6-2|.	.;.|.	S|A	1136;1142;1142;975|534	.|.	ENSP00000265654:N1142S|.	N|T	+|+	2|1	0|0	C11orf41|C11orf41	33552891|33552891	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.980000|0.980000	0.70556|0.70556	8.948000|8.948000	0.93006|0.93006	2.078000|2.078000	0.62432|0.62432	0.533000|0.533000	0.62120|0.62120	AAC|ACG	KIAA1549L	-	NULL	ENSG00000110427		0.547	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1549L	HGNC	protein_coding	OTTHUMT00000317998.1	38	0.00	0	A	NM_012194		33596315	33596315	+1	no_errors	ENST00000389726	ensembl	human	known	69_37n	missense	43	15.69	8	SNP	1.000	G
KPNA7	402569	genome.wustl.edu	37	7	98782623	98782623	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr7:98782623C>T	ENST00000327442.6	-	7	1102	c.1063G>A	c.(1063-1065)Ggg>Agg	p.G355R		NM_001145715.1	NP_001139187.1	A9QM74	IMA8_HUMAN	karyopherin alpha 7 (importin alpha 8)	355					cytokine-mediated signaling pathway (GO:0019221)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)			breast(3)|endometrium(2)|kidney(1)|prostate(1)|skin(1)	8						TGACAAGGCCCCGCTGCTACG	0.587																																						dbGAP											0													98.0	89.0	92.0					7																	98782623		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS47651.1	7q22.1	2013-02-14			ENSG00000185467	ENSG00000185467		"""Importins"", ""Armadillo repeat containing"""	21839	protein-coding gene	gene with protein product		614107					Standard	NM_001145715		Approved		uc010lft.2	A9QM74	OTTHUMG00000154412	ENST00000327442.6:c.1063G>A	7.37:g.98782623C>T	ENSP00000330878:p.Gly355Arg		A4D277	Missense_Mutation	SNP	pfam_Armadillo,pfam_HEAT,pfam_Importin-a_IBB,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.G355R	ENST00000327442.6	37	c.1063	CCDS47651.1	7	.	.	.	.	.	.	.	.	.	.	C	16.17	3.048832	0.55110	.	.	ENSG00000185467	ENST00000327442	T	0.30714	1.52	5.8	3.98	0.46160	Armadillo-like helical (1);Armadillo-type fold (1);	0.045657	0.85682	N	0.000000	T	0.63426	0.2510	M	0.93854	3.465	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.72959	-0.4133	10	0.87932	D	0	-10.3974	11.8418	0.52359	0.0:0.8563:0.0:0.1437	.	355	A9QM74	IMA8_HUMAN	R	355	ENSP00000330878:G355R	ENSP00000330878:G355R	G	-	1	0	KPNA7	98620559	1.000000	0.71417	0.406000	0.26421	0.010000	0.07245	7.692000	0.84203	1.444000	0.47605	0.563000	0.77884	GGG	KPNA7	-	superfamily_ARM-type_fold	ENSG00000185467		0.587	KPNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNA7	HGNC	protein_coding	OTTHUMT00000335118.1	35	0.00	0	C	NM_001145715		98782623	98782623	-1	no_errors	ENST00000327442	ensembl	human	known	69_37n	missense	63	17.11	13	SNP	0.995	T
KRT76	51350	genome.wustl.edu	37	12	53169205	53169205	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr12:53169205C>T	ENST00000332411.2	-	2	835	c.782G>A	c.(781-783)aGc>aAc	p.S261N		NM_015848.4	NP_056932.2	Q01546	K22O_HUMAN	keratin 76	261	Coil 1B.|Rod.				cytoskeleton organization (GO:0007010)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GTCCTGCATGCTTTTCAGCTC	0.522																																						dbGAP											0													133.0	134.0	134.0					12																	53169205		2203	4300	6503	-	-	-	SO:0001583	missense	0			M99063	CCDS8838.1	12q13.13	2013-06-25			ENSG00000185069	ENSG00000185069		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24430	protein-coding gene	gene with protein product						1282112, 16831889	Standard	NM_015848		Approved	HUMCYT2A, KRT2B, KRT2P	uc001sax.3	Q01546	OTTHUMG00000169797	ENST00000332411.2:c.782G>A	12.37:g.53169205C>T	ENSP00000330101:p.Ser261Asn		B4DRR3|Q7Z795	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II,prints_Keratin_I	p.S261N	ENST00000332411.2	37	c.782	CCDS8838.1	12	.	.	.	.	.	.	.	.	.	.	C	2.408	-0.336000	0.05278	.	.	ENSG00000185069	ENST00000332411	D	0.87256	-2.23	4.56	-5.49	0.02584	Filament (1);	0.401088	0.21017	N	0.081585	T	0.56337	0.1978	N	0.03154	-0.405	0.22366	N	0.999169	B	0.16603	0.018	B	0.15052	0.012	T	0.61840	-0.6980	10	0.02654	T	1	.	2.46	0.04538	0.0997:0.3181:0.2028:0.3793	.	261	Q01546	K22O_HUMAN	N	261	ENSP00000330101:S261N	ENSP00000330101:S261N	S	-	2	0	KRT76	51455472	0.001000	0.12720	0.722000	0.30670	0.922000	0.55478	-0.335000	0.07873	-0.921000	0.03794	-0.672000	0.03802	AGC	KRT76	-	pfam_F,prints_Keratin_II	ENSG00000185069		0.522	KRT76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT76	HGNC	protein_coding	OTTHUMT00000405928.1	47	0.00	0	C	NM_015848		53169205	53169205	-1	no_errors	ENST00000332411	ensembl	human	known	69_37n	missense	25	37.50	15	SNP	0.770	T
LCE3A	353142	genome.wustl.edu	37	1	152595499	152595499	+	Silent	SNP	T	T	G			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr1:152595499T>G	ENST00000335674.1	-	1	80	c.81A>C	c.(79-81)ccA>ccC	p.P27P		NM_178431.1	NP_848518.1	Q5TA76	LCE3A_HUMAN	late cornified envelope 3A	27					keratinization (GO:0031424)					endometrium(1)|lung(5)	6	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGGAGGAAGCTGGAGGCAGAC	0.657																																						dbGAP											0													55.0	57.0	56.0					1																	152595499		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS1017.1	1q21.3	2008-02-05			ENSG00000185962	ENSG00000185962		"""Late cornified envelopes"""	29461	protein-coding gene	gene with protein product		612613				11698679	Standard	NM_178431		Approved	LEP13	uc010pdt.2	Q5TA76	OTTHUMG00000012397	ENST00000335674.1:c.81A>C	1.37:g.152595499T>G				Silent	SNP	NULL	p.P27	ENST00000335674.1	37	c.81	CCDS1017.1	1																																																																																			LCE3A	-	NULL	ENSG00000185962		0.657	LCE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE3A	HGNC	protein_coding	OTTHUMT00000034517.2	41	0.00	0	T	NM_178431		152595499	152595499	-1	no_errors	ENST00000335674	ensembl	human	known	69_37n	silent	134	12.42	19	SNP	0.002	G
LRRC15	131578	genome.wustl.edu	37	3	194081730	194081730	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr3:194081730C>T	ENST00000347624.3	-	2	128	c.43G>A	c.(43-45)Gcc>Acc	p.A15T	LRRC15_ENST00000428839.1_Missense_Mutation_p.A21T|LRRC15_ENST00000439944.2_Missense_Mutation_p.A21T	NM_130830.4	NP_570843.2	Q8TF66	LRC15_HUMAN	leucine rich repeat containing 15	15					negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|positive regulation of cell migration (GO:0030335)|receptor-mediated virion attachment to host cell (GO:0046813)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	collagen binding (GO:0005518)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)			biliary_tract(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(20)|ovary(4)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)		GCACCCCAGGCTTGGCAGCCC	0.612																																						dbGAP											0													27.0	25.0	26.0					3																	194081730		2202	4299	6501	-	-	-	SO:0001583	missense	0			AB071037	CCDS3306.1, CCDS46984.1	3q29	2008-02-05			ENSG00000172061	ENSG00000172061			20818	protein-coding gene	gene with protein product						12923058	Standard	NM_001135057		Approved	LIB	uc003ftu.3	Q8TF66	OTTHUMG00000156048	ENST00000347624.3:c.43G>A	3.37:g.194081730C>T	ENSP00000306276:p.Ala15Thr		Q495Q6|Q7RTN7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.A21T	ENST00000347624.3	37	c.61	CCDS3306.1	3	.	.	.	.	.	.	.	.	.	.	C	12.47	1.946512	0.34377	.	.	ENSG00000172061	ENST00000347624;ENST00000439944;ENST00000428839	T;T;T	0.58210	0.35;0.38;0.38	4.68	3.8	0.43715	.	0.317981	0.23720	N	0.045240	T	0.33644	0.0870	N	0.24115	0.695	0.23879	N	0.996589	B;B	0.15473	0.008;0.013	B;B	0.17722	0.009;0.019	T	0.16247	-1.0409	10	0.12430	T	0.62	.	9.1868	0.37176	0.0:0.8965:0.0:0.1035	.	15;21	Q8TF66;Q8TF66-2	LRC15_HUMAN;.	T	15;21;21	ENSP00000306276:A15T;ENSP00000389128:A21T;ENSP00000413707:A21T	ENSP00000306276:A15T	A	-	1	0	LRRC15	195563025	0.861000	0.29849	0.847000	0.33407	0.929000	0.56500	3.170000	0.50816	1.272000	0.44329	0.462000	0.41574	GCC	LRRC15	-	NULL	ENSG00000172061		0.612	LRRC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC15	HGNC	protein_coding	OTTHUMT00000342858.2	22	0.00	0	C			194081730	194081730	-1	no_errors	ENST00000439944	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	0.707	T
LRRC66	339977	genome.wustl.edu	37	4	52861775	52861775	+	Silent	SNP	A	A	T			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr4:52861775A>T	ENST00000343457.3	-	4	1419	c.1413T>A	c.(1411-1413)ccT>ccA	p.P471P		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	471						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						GAGTTCTATCAGGAATTACGG	0.562																																						dbGAP											0													85.0	90.0	88.0					4																	52861775		2013	4173	6186	-	-	-	SO:0001819	synonymous_variant	0			BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.1413T>A	4.37:g.52861775A>T				Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.P471	ENST00000343457.3	37	c.1413	CCDS43229.1	4																																																																																			LRRC66	-	NULL	ENSG00000188993		0.562	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC66	HGNC	protein_coding	OTTHUMT00000361473.1	41	0.00	0	A	NM_001024611		52861775	52861775	-1	no_errors	ENST00000343457	ensembl	human	known	69_37n	silent	68	20.00	17	SNP	0.000	T
MMP9	4318	genome.wustl.edu	37	20	44639885	44639885	+	Silent	SNP	C	C	T			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr20:44639885C>T	ENST00000372330.3	+	5	772	c.753C>T	c.(751-753)gaC>gaT	p.D251D	RP11-465L10.10_ENST00000535913.1_RNA	NM_004994.2	NP_004985.2	P14780	MMP9_HUMAN	matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)	251	Fibronectin type-II 1. {ECO:0000255|PROSITE-ProRule:PRU00479}.				collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|macrophage differentiation (GO:0030225)|negative regulation of cation channel activity (GO:2001258)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of receptor binding (GO:1900122)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|identical protein binding (GO:0042802)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|large_intestine(14)|liver(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	46		Myeloproliferative disorder(115;0.0122)			Captopril(DB01197)|Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)	GTCGCTCCGACGGCTTGCCCT	0.657																																						dbGAP											0													74.0	77.0	76.0					20																	44639885		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS13390.1	20q12-q13	2008-01-07	2005-08-08		ENSG00000100985	ENSG00000100985	3.4.24.35		7176	protein-coding gene	gene with protein product		120361	"""matrix metalloproteinase 9 (gelatinase B, 92kD gelatinase, 92kD type IV collagenase)"", ""matrix metalloproteinase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)"""	CLG4B		2158484	Standard	NM_004994		Approved		uc002xqz.3	P14780	OTTHUMG00000033044	ENST00000372330.3:c.753C>T	20.37:g.44639885C>T			B2R7V9|Q3LR70|Q8N725|Q9H4Z1|Q9UCJ9|Q9UCL1|Q9UDK2	Silent	SNP	pfam_Pept_M10_metallopeptidase,pfam_FN_type2_col-bd,pfam_Hemopexin/matrixin_repeat,pfam_PT,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Kringle-like,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_FN_type2_col-bd,smart_Hemopexin/matrixin_repeat,pfscan_FN_type2_col-bd,prints_Pept_M10A_matrixin	p.D251	ENST00000372330.3	37	c.753	CCDS13390.1	20																																																																																			MMP9	-	pfam_Pept_M10_metallopeptidase,pfam_FN_type2_col-bd,superfamily_Kringle-like,smart_Peptidase_Metallo,smart_FN_type2_col-bd,pfscan_FN_type2_col-bd	ENSG00000100985		0.657	MMP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP9	HGNC	protein_coding	OTTHUMT00000080337.1	17	0.00	0	C			44639885	44639885	+1	no_errors	ENST00000372330	ensembl	human	known	69_37n	silent	11	35.29	6	SNP	1.000	T
MRPS5	64969	genome.wustl.edu	37	2	95775737	95775737	+	Silent	SNP	T	T	C			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr2:95775737T>C	ENST00000272418.2	-	4	535	c.327A>G	c.(325-327)ggA>ggG	p.G109G		NM_031902.3	NP_114108.1	P82675	RT05_HUMAN	mitochondrial ribosomal protein S5	109					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20						CTTTTTTTGCTCCAGCACCAG	0.388																																						dbGAP											0													106.0	109.0	108.0					2																	95775737		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB049940	CCDS2010.1	2p11.2-q11.2	2012-09-13			ENSG00000144029	ENSG00000144029		"""Mitochondrial ribosomal proteins / small subunits"""	14498	protein-coding gene	gene with protein product	"""mitochondrial 28S ribosomal protein S5"""	611972					Standard	NM_031902		Approved	MRP-S5, S5mt	uc002sub.3	P82675	OTTHUMG00000130394	ENST00000272418.2:c.327A>G	2.37:g.95775737T>C			Q4ZFY5|Q96LJ6|Q9BWI4|Q9BYC4	Silent	SNP	pfam_Ribosomal_S5_C,pfam_Ribosomal_S5_N,superfamily_Ribosomal_S5_D2-typ_fold,pfscan_Ribosomal_S5_N	p.G109	ENST00000272418.2	37	c.327	CCDS2010.1	2																																																																																			MRPS5	-	NULL	ENSG00000144029		0.388	MRPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS5	HGNC	protein_coding	OTTHUMT00000252772.1	52	0.00	0	T	NM_031902		95775737	95775737	-1	no_errors	ENST00000272418	ensembl	human	known	69_37n	silent	64	37.86	39	SNP	0.998	C
MYOF	26509	genome.wustl.edu	37	10	95072909	95072909	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr10:95072909G>C	ENST00000359263.4	-	51	5756	c.5757C>G	c.(5755-5757)tgC>tgG	p.C1919W	MYOF_ENST00000371501.4_Missense_Mutation_p.C1919W|MYOF_ENST00000371502.4_Missense_Mutation_p.C1909W|MYOF_ENST00000358334.5_Missense_Mutation_p.C1906W	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	1919					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						TGTCCAATCTGCATTTCTCTG	0.473																																						dbGAP											0													213.0	208.0	210.0					10																	95072909		1987	4167	6154	-	-	-	SO:0001583	missense	0			AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.5757C>G	10.37:g.95072909G>C	ENSP00000352208:p.Cys1919Trp		B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_Ferlin_B-domain,pfam_FerIin-domain,pfam_Ferlin_A-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_Peroxin/Ferlin,pfscan_C2_membr_targeting	p.C1919W	ENST00000359263.4	37	c.5757	CCDS41551.1	10	.	.	.	.	.	.	.	.	.	.	G	15.19	2.758961	0.49468	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	T;T;T;T	0.71817	-0.6;-0.6;-0.6;-0.6	5.42	4.5	0.54988	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.87051	0.6081	M	0.93594	3.435	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.89369	0.3673	10	0.87932	D	0	-18.455	13.0716	0.59064	0.1294:0.0:0.8706:0.0	.	1906;1919	Q9NZM1-6;Q9NZM1	.;MYOF_HUMAN	W	1906;1919;1919;1909	ENSP00000351094:C1906W;ENSP00000352208:C1919W;ENSP00000360556:C1919W;ENSP00000360557:C1909W	ENSP00000351094:C1906W	C	-	3	2	MYOF	95062899	1.000000	0.71417	0.991000	0.47740	0.564000	0.35744	3.367000	0.52350	2.815000	0.96918	0.643000	0.83706	TGC	MYOF	-	superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep	ENSG00000138119		0.473	MYOF-005	KNOWN	basic|CCDS	protein_coding	MYOF	HGNC	protein_coding	OTTHUMT00000049423.2	75	0.00	0	G	NM_013451		95072909	95072909	-1	no_errors	ENST00000359263	ensembl	human	known	69_37n	missense	109	15.38	20	SNP	0.961	C
NCKAP5L	57701	genome.wustl.edu	37	12	50188850	50188850	+	Silent	SNP	C	C	A			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr12:50188850C>A	ENST00000335999.6	-	8	2994	c.2793G>T	c.(2791-2793)ctG>ctT	p.L931L		NM_001037806.3	NP_001032895.2	Q9HCH0	NCK5L_HUMAN	NCK-associated protein 5-like	927										central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(8)|prostate(2)	18						TGCGGCGGTTCAGCGCTGGCA	0.672																																						dbGAP											0													14.0	16.0	15.0					12																	50188850		1970	4156	6126	-	-	-	SO:0001819	synonymous_variant	0			AB046822	CCDS41781.2	12q13.12	2009-08-14	2009-08-14	2009-08-14	ENSG00000167566	ENSG00000167566			29321	protein-coding gene	gene with protein product		615104	"""KIAA1602"""	KIAA1602			Standard	NM_001037806		Approved		uc009zlk.2	Q9HCH0	OTTHUMG00000156969	ENST00000335999.6:c.2793G>T	12.37:g.50188850C>A			Q2TB26|Q71RH1|Q8N4W1|Q96HX2	Nonsense_Mutation	SNP	NULL	p.E646*	ENST00000335999.6	37	c.1936	CCDS41781.2	12	.	.	.	.	.	.	.	.	.	.	C	5.958	0.360686	0.11296	.	.	ENSG00000167566	ENST00000433948	.	.	.	5.23	1.32	0.21799	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-9.4223	1.4738	0.02421	0.1374:0.4221:0.1336:0.3069	.	.	.	.	X	646	.	.	E	-	1	0	NCKAP5L	48475117	0.980000	0.34600	0.824000	0.32777	0.985000	0.73830	0.092000	0.15066	0.041000	0.15688	0.462000	0.41574	GAA	NCKAP5L	-	NULL	ENSG00000167566		0.672	NCKAP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCKAP5L	HGNC	protein_coding	OTTHUMT00000346884.2	33	0.00	0	C	XM_035497		50188850	50188850	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000433948	ensembl	human	putative	69_37n	nonsense	13	43.48	10	SNP	0.950	A
NOS1	4842	genome.wustl.edu	37	12	117691526	117691526	+	Silent	SNP	G	G	T	rs376834281		TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr12:117691526G>T	ENST00000338101.4	-	17	2671	c.2667C>A	c.(2665-2667)tcC>tcA	p.S889S	NOS1_ENST00000317775.6_Silent_p.S855S|NOS1_ENST00000344089.3_3'UTR			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		AGTCAGAGTAGGAGGAGACGC	0.547																																					Esophageal Squamous(162;1748 2599 51982 52956)	dbGAP											0													98.0	104.0	102.0					12																	117691526		2155	4270	6425	-	-	-	SO:0001819	synonymous_variant	0				CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.2667C>A	12.37:g.117691526G>T				Silent	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,pfam_PDZ,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,superfamily_PDZ,smart_PDZ,pirsf_NOS_met,pfscan_PDZ,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.S855	ENST00000338101.4	37	c.2565	CCDS55890.1	12																																																																																			NOS1	-	pfam_Flavodoxin/NO_synth,pirsf_NOS_met,pfscan_Flavodoxin/NO_synth	ENSG00000089250		0.547	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	NOS1	HGNC	protein_coding	OTTHUMT00000268053.1	45	0.00	0	G			117691526	117691526	-1	no_errors	ENST00000317775	ensembl	human	known	69_37n	silent	27	48.08	25	SNP	0.016	T
NOTCH2	4853	genome.wustl.edu	37	1	120458436	120458436	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr1:120458436delG	ENST00000256646.2	-	34	7128	c.6909delC	c.(6907-6909)cccfs	p.P2303fs		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	2303					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAGTCACAATGGGGGGCAAGG	0.647			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																													dbGAP		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0													49.0	54.0	53.0					1																	120458436		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.6909delC	1.37:g.120458436delG	ENSP00000256646:p.Pro2303fs		Q5T3X7|Q99734|Q9H240	Frame_Shift_Del	DEL	pirsf_Notch,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,pfam_EGF_extracell,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_2,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.I2304fs	ENST00000256646.2	37	c.6909	CCDS908.1	1																																																																																			NOTCH2	-	pirsf_Notch,prints_Notch_2	ENSG00000134250		0.647	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH2	HGNC	protein_coding	OTTHUMT00000033679.1	24	0.00	0	G	NM_024408		120458436	120458436	-1	no_errors	ENST00000256646	ensembl	human	known	69_37n	frame_shift_del	15	48.48	16	DEL	0.957	-
NOTCH4	4855	genome.wustl.edu	37	6	32188550	32188550	+	Missense_Mutation	SNP	C	C	A	rs201017612		TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr6:32188550C>A	ENST00000375023.3	-	5	1043	c.905G>T	c.(904-906)tGc>tTc	p.C302F		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	302	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						GGTTTCTGGGCAGAGGCAGGT	0.582																																						dbGAP											0													89.0	84.0	86.0					6																	32188550		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.905G>T	6.37:g.32188550C>A	ENSP00000364163:p.Cys302Phe		B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_Ankyrin_rpt,pfam_EGF-like_Ca-bd,pfam_Notch_dom,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_4,prints_Notch_dom	p.C302F	ENST00000375023.3	37	c.905	CCDS34420.1	6	.	.	.	.	.	.	.	.	.	.	C	18.63	3.665885	0.67700	.	.	ENSG00000204301	ENST00000375023	D	0.99992	-12.4	4.6	4.6	0.57074	EGF (1);Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.46758	D	0.000268	D	0.99994	0.9999	H	0.98487	4.245	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.999;1.0	D	0.99992	1.4630	10	0.87932	D	0	.	14.9378	0.70970	0.0:1.0:0.0:0.0	.	302;302	Q6P3V5;Q99466	.;NOTC4_HUMAN	F	302	ENSP00000364163:C302F	ENSP00000364163:C302F	C	-	2	0	NOTCH4	32296528	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	5.477000	0.66799	2.380000	0.81148	0.491000	0.48974	TGC	NOTCH4	-	pfam_EGF-like_dom,smart_EGF-like_Ca-bd,smart_EGF-like,pirsf_Notch,pfscan_EG-like_dom	ENSG00000204301		0.582	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH4	HGNC	protein_coding	OTTHUMT00000076045.2	26	0.00	0	C			32188550	32188550	-1	no_errors	ENST00000375023	ensembl	human	known	69_37n	missense	44	30.16	19	SNP	1.000	A
OR8B2	26595	genome.wustl.edu	37	11	124252388	124252388	+	Silent	SNP	G	G	A			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr11:124252388G>A	ENST00000375013.2	-	1	870	c.852C>T	c.(850-852)ctC>ctT	p.L284L		NM_001005468.1	NP_001005468.1	Q96RD0	OR8B2_HUMAN	olfactory receptor, family 8, subfamily B, member 2	284						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(13)|ovary(1)	23		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		TGAGGGGATTGAGCATGGGCA	0.383																																						dbGAP											0													90.0	91.0	91.0					11																	124252388		2200	4299	6499	-	-	-	SO:0001819	synonymous_variant	0			AB065826	CCDS31708.1	11q24.1	2012-08-09			ENSG00000204293	ENSG00000204293		"""GPCR / Class A : Olfactory receptors"""	8471	protein-coding gene	gene with protein product							Standard	XM_005271500		Approved		uc010sai.2	Q96RD0	OTTHUMG00000165982	ENST00000375013.2:c.852C>T	11.37:g.124252388G>A			Q8NGH2	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L284	ENST00000375013.2	37	c.852	CCDS31708.1	11																																																																																			OR8B2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000204293		0.383	OR8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8B2	HGNC	protein_coding	OTTHUMT00000387290.1	41	0.00	0	G	NM_001005468		124252388	124252388	-1	no_errors	ENST00000375013	ensembl	human	known	69_37n	silent	50	40.00	34	SNP	0.460	A
P2RX5	5026	genome.wustl.edu	37	17	3593780	3593780	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr17:3593780C>G	ENST00000225328.5	-	5	872	c.474G>C	c.(472-474)ttG>ttC	p.L158F	P2RX5_ENST00000345901.3_Missense_Mutation_p.L134F|P2RX5_ENST00000547178.1_Missense_Mutation_p.L158F|P2RX5_ENST00000550772.1_5'UTR|P2RX5_ENST00000552050.1_Missense_Mutation_p.L98F|P2RX5_ENST00000552276.1_Missense_Mutation_p.L158F|P2RX5_ENST00000551178.1_Missense_Mutation_p.L134F|P2RX5_ENST00000435558.1_Missense_Mutation_p.L158F|P2RX5-TAX1BP3_ENST00000550383.1_Missense_Mutation_p.L158F	NM_001204519.1|NM_002561.3	NP_001191448.1|NP_002552.2	Q93086	P2RX5_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 5	158					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|purinergic nucleotide receptor signaling pathway (GO:0035590)|signal transduction (GO:0007165)|transport (GO:0006810)	integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|ion channel activity (GO:0005216)|purinergic nucleotide receptor activity (GO:0001614)|transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	11						TGCCCCTGGCCAAGTTCTCTC	0.647																																						dbGAP											0													34.0	37.0	36.0					17																	3593780		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF016709	CCDS11034.1, CCDS11035.1, CCDS56014.1, CCDS56015.1	17p13.3	2012-01-17			ENSG00000083454	ENSG00000083454		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8536	protein-coding gene	gene with protein product		602836				9414125	Standard	NM_002561		Approved	P2X5	uc002fwi.3	Q93086	OTTHUMG00000090700	ENST00000225328.5:c.474G>C	17.37:g.3593780C>G	ENSP00000225328:p.Leu158Phe		G5E981|O43450|O75540|Q308M5|Q59F38|Q8IXW4|Q93087|Q9NZV0	Missense_Mutation	SNP	pfam_P2X_purnocptor,prints_P2X_purnocptor,prints_P2X5_purnocptor,tigrfam_P2X_purnocptor	p.L158F	ENST00000225328.5	37	c.474	CCDS11034.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.04|13.04	2.119202|2.119202	0.37436|0.37436	.|.	.|.	ENSG00000083454|ENSG00000083454	ENST00000552723|ENST00000435558;ENST00000551178;ENST00000547178;ENST00000225328;ENST00000345901;ENST00000552050;ENST00000440619	.|T;T;T;T;T;T	.|0.06849	.|3.62;3.63;3.62;3.62;3.63;3.25	5.05|5.05	-10.1|-10.1	0.00402|0.00402	.|.	.|3.355440	.|0.01069	.|N	.|0.004785	T|T	0.05090|0.05090	0.0136|0.0136	N|N	0.24115|0.24115	0.695|0.695	0.09310|0.09310	N|N	1|1	.|B;B;B;B;B;B	.|0.30634	.|0.288;0.038;0.038;0.038;0.047;0.038	.|B;B;B;B;B;B	.|0.31101	.|0.107;0.06;0.078;0.097;0.1;0.124	T|T	0.24548|0.24548	-1.0157|-1.0157	5|10	.|0.59425	.|D	.|0.04	-5.3158|-5.3158	5.1036|5.1036	0.14772|0.14772	0.0809:0.1195:0.3128:0.4867|0.0809:0.1195:0.3128:0.4867	.|.	.|98;134;158;134;158;158	.|B4DEG2;G5E981;Q93086-1;Q93086-2;Q93086;Q93086-4	.|.;.;.;.;P2RX5_HUMAN;.	R|F	106|158;134;158;158;134;98;158	.|ENSP00000415370:L158F;ENSP00000447545:L134F;ENSP00000448355:L158F;ENSP00000225328:L158F;ENSP00000342161:L134F;ENSP00000450006:L98F	.|ENSP00000225328:L158F	G|L	-|-	1|3	0|2	P2RX5|P2RX5	3540529|3540529	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-0.816000|-0.816000	0.04477|0.04477	-1.926000|-1.926000	0.01061|0.01061	-0.291000|-0.291000	0.09656|0.09656	GGC|TTG	P2RX5	-	pfam_P2X_purnocptor,tigrfam_P2X_purnocptor	ENSG00000083454		0.647	P2RX5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	P2RX5	HGNC	protein_coding	OTTHUMT00000207388.3	24	0.00	0	C	NM_002561, NM_175080, NM_175081		3593780	3593780	-1	no_errors	ENST00000435558	ensembl	human	known	69_37n	missense	35	33.96	18	SNP	0.000	G
PAPPA2	60676	genome.wustl.edu	37	1	176564589	176564589	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr1:176564589C>T	ENST00000367662.3	+	3	3013	c.1849C>T	c.(1849-1851)Cgc>Tgc	p.R617C	PAPPA2_ENST00000367661.3_Missense_Mutation_p.R617C	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	617	Metalloprotease.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CCTGCAGGGCCGCTGCTACTC	0.597																																						dbGAP											0													67.0	73.0	71.0					1																	176564589		2113	4231	6344	-	-	-	SO:0001583	missense	0			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.1849C>T	1.37:g.176564589C>T	ENSP00000356634:p.Arg617Cys		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	pfam_Notch_dom,pfam_Sushi_SCR_CCP,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl,superfamily_Complement_control_module,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.R617C	ENST00000367662.3	37	c.1849	CCDS41438.1	1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.186537	0.78789	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.35048	4.57;1.33	5.42	4.49	0.54785	.	0.255164	0.40144	N	0.001171	T	0.38665	0.1049	L	0.55481	1.735	0.58432	D	0.999997	D;D	0.67145	0.986;0.996	P;B	0.44561	0.453;0.425	T	0.39583	-0.9607	10	0.66056	D	0.02	-9.8418	14.9404	0.70989	0.1442:0.8558:0.0:0.0	.	617;617	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	C	617	ENSP00000356634:R617C;ENSP00000356633:R617C	ENSP00000356633:R617C	R	+	1	0	PAPPA2	174831212	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.538000	0.36094	1.244000	0.43870	0.650000	0.86243	CGC	PAPPA2	-	NULL	ENSG00000116183		0.597	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	HGNC	protein_coding	OTTHUMT00000084763.1	34	0.00	0	C			176564589	176564589	+1	no_errors	ENST00000367662	ensembl	human	known	69_37n	missense	54	11.48	7	SNP	1.000	T
PCDHA1	56147	genome.wustl.edu	37	5	140167566	140167566	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr5:140167566C>T	ENST00000504120.2	+	1	1691	c.1691C>T	c.(1690-1692)gCg>gTg	p.A564V	PCDHA1_ENST00000378133.3_Missense_Mutation_p.A564V|PCDHA1_ENST00000394633.3_Intron	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	564	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AACGCGCCGGCGCTGCTGGCG	0.677																																						dbGAP											0													83.0	83.0	83.0					5																	140167566		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.1691C>T	5.37:g.140167566C>T	ENSP00000420840:p.Ala564Val		O75288|Q9NRT7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A564V	ENST00000504120.2	37	c.1691	CCDS54913.1	5	.	.	.	.	.	.	.	.	.	.	c	0.989	-0.694663	0.03303	.	.	ENSG00000204970	ENST00000504120;ENST00000378133	T;T	0.34667	1.35;1.35	3.68	-0.641	0.11490	Cadherin (3);Cadherin-like (1);	0.685951	0.11751	N	0.532999	T	0.09598	0.0236	N	0.01874	-0.695	0.09310	N	1	B;B	0.16166	0.014;0.016	B;B	0.15484	0.002;0.013	T	0.28776	-1.0033	10	0.09084	T	0.74	.	1.0763	0.01633	0.1619:0.3761:0.1608:0.3012	.	564;564	Q9Y5I3;Q9Y5I3-3	PCDA1_HUMAN;.	V	564	ENSP00000420840:A564V;ENSP00000367373:A564V	ENSP00000367373:A564V	A	+	2	0	PCDHA1	140147750	0.000000	0.05858	0.004000	0.12327	0.317000	0.28152	-0.323000	0.07997	-0.126000	0.11682	-0.516000	0.04426	GCG	PCDHA1	-	superfamily_Cadherin-like,prints_Cadherin,pfscan_Cadherin	ENSG00000204970		0.677	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHA1	HGNC	protein_coding	OTTHUMT00000389127.1	24	0.00	0	C	NM_018900		140167566	140167566	+1	no_errors	ENST00000504120	ensembl	human	known	69_37n	missense	16	48.48	16	SNP	0.003	T
PCNXL4	64430	genome.wustl.edu	37	14	60592455	60592455	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr14:60592455A>C	ENST00000406854.1	+	10	3735	c.3181A>C	c.(3181-3183)Att>Ctt	p.I1061L	PCNXL4_ENST00000535349.1_Missense_Mutation_p.I268L|PCNXL4_ENST00000406949.1_Missense_Mutation_p.I827L|PCNXL4_ENST00000404681.2_Missense_Mutation_p.I1061L|PCNXL4_ENST00000317623.4_Missense_Mutation_p.I827L			Q63HM2	PCX4_HUMAN	pecanex-like 4 (Drosophila)	1061						integral component of membrane (GO:0016021)											TGACTGGTACATTGGTTTGGT	0.333																																						dbGAP											0													70.0	71.0	71.0					14																	60592455		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK022861		14q23.1	2012-07-18	2012-07-18	2012-07-18	ENSG00000126773	ENSG00000126773			20349	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 135"""	C14orf135			Standard	NM_022495		Approved		uc001xer.4	Q63HM2	OTTHUMG00000150361	ENST00000406854.1:c.3181A>C	14.37:g.60592455A>C	ENSP00000384801:p.Ile1061Leu		A8MXM2|Q9BQG8|Q9H9F2	Missense_Mutation	SNP	pfam_Pecanex	p.I1061L	ENST00000406854.1	37	c.3181		14	.	.	.	.	.	.	.	.	.	.	A	21.4	4.150833	0.78001	.	.	ENSG00000126773	ENST00000317623;ENST00000406854;ENST00000406949;ENST00000404681;ENST00000535349	T;T;T;T;T	0.56941	0.43;0.43;0.43;0.43;0.43	5.02	3.86	0.44501	.	0.000000	0.85682	D	0.000000	T	0.62853	0.2462	M	0.79011	2.435	0.58432	D	0.999999	P;D	0.53745	0.685;0.962	B;P	0.53450	0.379;0.726	T	0.64833	-0.6314	10	0.72032	D	0.01	.	8.8532	0.35212	0.8458:0.0:0.1542:0.0	.	1061;827	Q63HM2;B5MC47	CN135_HUMAN;.	L	827;1061;827;1061;268	ENSP00000317396:I827L;ENSP00000384801:I1061L;ENSP00000385201:I827L;ENSP00000385713:I1061L;ENSP00000445644:I268L	ENSP00000317396:I827L	I	+	1	0	C14orf135	59662208	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.183000	0.77697	0.746000	0.32786	0.455000	0.32223	ATT	PCNXL4	-	pfam_Pecanex	ENSG00000126773		0.333	PCNXL4-005	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	PCNXL4	HGNC	protein_coding	OTTHUMT00000317847.1	42	0.00	0	A	NM_022495		60592455	60592455	+1	no_errors	ENST00000404681	ensembl	human	known	69_37n	missense	36	34.55	19	SNP	1.000	C
PCSK6	5046	genome.wustl.edu	37	15	101910615	101910615	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr15:101910615G>T	ENST00000348070.1	-	13	1642	c.1643C>A	c.(1642-1644)tCa>tAa	p.S548*	PCSK6_ENST00000358417.3_Nonsense_Mutation_p.S548*|PCSK6_ENST00000561177.1_5'UTR|PCSK6_ENST00000331826.7_Nonsense_Mutation_p.S383*|PCSK6_ENST00000398181.2_Nonsense_Mutation_p.S548*|PCSK6_ENST00000344273.2_Nonsense_Mutation_p.S548*	NM_002570.3|NM_138320.1	NP_002561.1|NP_612193.1	P29122	PCSK6_HUMAN	proprotein convertase subtilisin/kexin type 6	549					determination of left/right symmetry (GO:0007368)|glycoprotein metabolic process (GO:0009100)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|regulation of BMP signaling pathway (GO:0030510)|secretion by cell (GO:0032940)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|nerve growth factor binding (GO:0048406)|serine-type endopeptidase activity (GO:0004252)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GCGTGGGTGTGAGATGGAGGT	0.632																																						dbGAP											0													38.0	44.0	42.0					15																	101910615		1983	4052	6035	-	-	-	SO:0001587	stop_gained	0				CCDS73789.1, CCDS73790.1, CCDS73791.1, CCDS73792.1, CCDS73793.1	15q26	2008-07-18	2004-06-14	2004-06-16		ENSG00000140479			8569	protein-coding gene	gene with protein product	"""subtilisin-like protease"", ""subtilisin-like proprotein convertase 4"", ""subtilisin/kexin-like protease PACE4"""	167405	"""paired basic amino acid cleaving system 4"""	PACE4		1741956	Standard	NM_002570		Approved	SPC4	uc002bwy.3	P29122		ENST00000348070.1:c.1643C>A	15.37:g.101910615G>T	ENSP00000305056:p.Ser548*		Q15099|Q15100|Q9UEG7|Q9UEJ1|Q9UEJ2|Q9UEJ7|Q9UEJ8|Q9UEJ9|Q9Y4G9|Q9Y4H0|Q9Y4H1	Nonsense_Mutation	SNP	pfam_Peptidase_S8/S53,pfam_PrprotnconvertsP,pfam_PLAC,superfamily_Peptidase_S8/S53,superfamily_Galactose-bd-like,superfamily_Growth_fac_rcpt,superfamily_Prot_inh_propept,smart_Furin_repeat,smart_EGF-like,prints_Peptidase_S8_subtilisin-rel,pfscan_PLAC	p.S548*	ENST00000348070.1	37	c.1643		15	.	.	.	.	.	.	.	.	.	.	G	37	6.563194	0.97667	.	.	ENSG00000140479	ENST00000348070;ENST00000358417;ENST00000398185;ENST00000344273;ENST00000398181;ENST00000331826	.	.	.	5.3	4.39	0.52855	.	0.369343	0.28595	N	0.014790	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.6686	12.8631	0.57924	0.0788:0.0:0.9212:0.0	.	.	.	.	X	548;548;379;548;548;383	.	ENSP00000332052:S383X	S	-	2	0	PCSK6	99728138	0.032000	0.19561	0.765000	0.31456	0.349000	0.29174	2.260000	0.43267	1.230000	0.43646	0.561000	0.74099	TCA	PCSK6	-	pfam_PrprotnconvertsP,superfamily_Galactose-bd-like	ENSG00000140479		0.632	PCSK6-203	KNOWN	basic|appris_candidate_longest	protein_coding	PCSK6	HGNC	protein_coding		26	0.00	0	G	NM_002570		101910615	101910615	-1	no_errors	ENST00000348070	ensembl	human	known	69_37n	nonsense	28	20.00	7	SNP	0.857	T
PDGFB	5155	genome.wustl.edu	37	22	39621808	39621808	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr22:39621808G>A	ENST00000331163.6	-	6	1433	c.646C>T	c.(646-648)Cgc>Tgc	p.R216C	PDGFB_ENST00000381551.4_Missense_Mutation_p.R201C	NM_002608.2	NP_002599.1	P01127	PDGFB_HUMAN	platelet-derived growth factor beta polypeptide	216					actin cytoskeleton organization (GO:0030036)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|branching involved in salivary gland morphogenesis (GO:0060445)|cell chemotaxis (GO:0060326)|cell growth (GO:0016049)|cell projection assembly (GO:0030031)|cellular response to growth factor stimulus (GO:0071363)|cellular response to mycophenolic acid (GO:0071506)|DNA replication (GO:0006260)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|extracellular matrix organization (GO:0030198)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|metanephric glomerular endothelium development (GO:0072264)|metanephric glomerular mesangial cell development (GO:0072255)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|monocyte chemotaxis (GO:0002548)|negative regulation of cell migration (GO:0030336)|negative regulation of phosphatidylinositol biosynthetic process (GO:0010512)|negative regulation of platelet activation (GO:0010544)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|paracrine signaling (GO:0038001)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of DNA replication (GO:0045740)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of glomerular mesangial cell proliferation (GO:0072126)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of metanephric mesenchymal cell migration (GO:2000591)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to wounding (GO:0009611)|substrate-dependent cell migration (GO:0006929)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)|collagen binding (GO:0005518)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|superoxide-generating NADPH oxidase activator activity (GO:0016176)		COL1A1/PDGFB(429)	central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(2)	7	Melanoma(58;0.04)					GGGGGCCGGCGGACTCGCACC	0.592			T	COL1A1	DFSP																																	dbGAP		Dom	yes		22	22q12.3-q13.1	5155	platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog)		M	0													129.0	100.0	109.0					22																	39621808		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13987.1, CCDS33650.1	22q13.1	2012-10-02	2011-05-19		ENSG00000100311	ENSG00000100311			8800	protein-coding gene	gene with protein product	"""oncogene SIS"", ""becaplermin"""	190040	"""platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog)"""	SIS		2991848, 1661670	Standard	NM_002608		Approved	SSV	uc003axf.3	P01127	OTTHUMG00000151029	ENST00000331163.6:c.646C>T	22.37:g.39621808G>A	ENSP00000330382:p.Arg216Cys		G3XAG8|P78431|Q15354|Q6FHE7|Q9UF23	Missense_Mutation	SNP	pfam_PD_growth_factor,pfam_PDGF_N,smart_PD_growth_factor,pfscan_PD_growth_factor	p.R216C	ENST00000331163.6	37	c.646	CCDS13987.1	22	.	.	.	.	.	.	.	.	.	.	G	26.9	4.779507	0.90195	.	.	ENSG00000100311	ENST00000331163;ENST00000381551	T;T	0.48522	0.81;0.81	5.3	5.3	0.74995	.	0.421488	0.25143	N	0.032819	T	0.55893	0.1949	N	0.24115	0.695	0.53005	D	0.999967	D;D	0.89917	1.0;1.0	D;D	0.87578	0.981;0.998	T	0.57934	-0.7725	10	0.59425	D	0.04	-25.8145	15.8118	0.78571	0.0:0.0:1.0:0.0	.	216;201	P01127;G3XAG8	PDGFB_HUMAN;.	C	216;201	ENSP00000330382:R216C;ENSP00000370963:R201C	ENSP00000330382:R216C	R	-	1	0	PDGFB	37951754	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.037000	0.64170	2.769000	0.95229	0.655000	0.94253	CGC	PDGFB	-	NULL	ENSG00000100311		0.592	PDGFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDGFB	HGNC	protein_coding	OTTHUMT00000321043.1	47	0.00	0	G	NM_002608		39621808	39621808	-1	no_errors	ENST00000331163	ensembl	human	known	69_37n	missense	40	31.03	18	SNP	1.000	A
PEX1	5189	genome.wustl.edu	37	7	92122328	92122328	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr7:92122328G>C	ENST00000248633.4	-	20	3241	c.3146C>G	c.(3145-3147)gCt>gGt	p.A1049G	AC007566.10_ENST00000441539.1_RNA|PEX1_ENST00000438045.1_Missense_Mutation_p.A727G|AC007566.10_ENST00000427458.1_RNA|PEX1_ENST00000428214.1_Missense_Mutation_p.A992G	NM_000466.2	NP_000457.1	O43933	PEX1_HUMAN	peroxisomal biogenesis factor 1	1049					ATP catabolic process (GO:0006200)|microtubule-based peroxisome localization (GO:0060152)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			GTAAAGTAAAGCTTTCAGATC	0.423																																						dbGAP											0													142.0	137.0	139.0					7																	92122328		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF026086	CCDS5627.1, CCDS64710.1	7q21.2	2010-04-21	2008-08-26		ENSG00000127980	ENSG00000127980		"""ATPases / AAA-type"""	8850	protein-coding gene	gene with protein product		602136	"""peroxisome biogenesis factor 1"", ""Zellweger syndrome 1"", ""Zellweger syndrome"""	ZWS1, ZWS		9398848	Standard	NM_001282677		Approved		uc003uly.3	O43933	OTTHUMG00000023926	ENST00000248633.4:c.3146C>G	7.37:g.92122328G>C	ENSP00000248633:p.Ala1049Gly		A4D1G3|A8KA90|B4DIM7|E9PE75|Q96S71|Q96S72|Q96S73|Q99994	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Peroxisome_synth_fac_1_a/b,pfam_PEX-1N,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_Asp_de-COase-like_fold,smart_AAA+_ATPase	p.A1049G	ENST00000248633.4	37	c.3146	CCDS5627.1	7	.	.	.	.	.	.	.	.	.	.	G	25.4	4.631029	0.87660	.	.	ENSG00000127980	ENST00000438045;ENST00000248633;ENST00000428214	D;D;D	0.95001	-3.58;-3.58;-3.58	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	D	0.96068	0.8719	L	0.43554	1.36	0.80722	D	1	D;D;D	0.65815	0.99;0.985;0.995	D;P;D	0.67103	0.925;0.844;0.949	D	0.95824	0.8852	10	0.59425	D	0.04	-18.1553	20.3138	0.98647	0.0:0.0:1.0:0.0	.	727;841;1049	E9PE75;B4DER6;O43933	.;.;PEX1_HUMAN	G	727;1049;992	ENSP00000410438:A727G;ENSP00000248633:A1049G;ENSP00000394413:A992G	ENSP00000248633:A1049G	A	-	2	0	PEX1	91960264	1.000000	0.71417	0.960000	0.40013	0.334000	0.28698	9.596000	0.98267	2.814000	0.96858	0.585000	0.79938	GCT	PEX1	-	NULL	ENSG00000127980		0.423	PEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX1	HGNC	protein_coding	OTTHUMT00000254066.3	39	0.00	0	G	NM_000466		92122328	92122328	-1	no_errors	ENST00000248633	ensembl	human	known	69_37n	missense	50	21.88	14	SNP	1.000	C
PEX26	55670	genome.wustl.edu	37	22	18562666	18562666	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr22:18562666G>C	ENST00000329627.7	+	3	463	c.257G>C	c.(256-258)tGt>tCt	p.C86S	PEX26_ENST00000428061.2_Missense_Mutation_p.C86S|XXbac-B476C20.9_ENST00000426483.1_RNA|XXbac-B476C20.9_ENST00000607927.1_RNA|PEX26_ENST00000399744.3_Missense_Mutation_p.C86S	NM_017929.5	NP_060399.1	Q7Z412	PEX26_HUMAN	peroxisomal biogenesis factor 26	86					protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome membrane (GO:0045046)	integral component of peroxisomal membrane (GO:0005779)|peroxisome (GO:0005777)	ATPase binding (GO:0051117)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			breast(1)|kidney(2)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						TGCTCCCTGTGTGTTGTGGGG	0.527																																						dbGAP											0													164.0	147.0	153.0					22																	18562666		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB089678	CCDS13750.1, CCDS56221.1	22q11.21	2008-08-26	2008-08-26		ENSG00000215193	ENSG00000215193			22965	protein-coding gene	gene with protein product		608666	"""peroxisome biogenesis factor 26"""			12717447, 12851857	Standard	NM_017929		Approved	FLJ20695	uc002znp.4	Q7Z412	OTTHUMG00000149970	ENST00000329627.7:c.257G>C	22.37:g.18562666G>C	ENSP00000331106:p.Cys86Ser		F6UBB5|Q7Z413|Q7Z414|Q7Z415|Q7Z416|Q96B12|Q9NWQ0|Q9NXU0	Missense_Mutation	SNP	pfam_Pex26	p.C86S	ENST00000329627.7	37	c.257	CCDS13750.1	22	.	.	.	.	.	.	.	.	.	.	G	18.07	3.542394	0.65198	.	.	ENSG00000215193	ENST00000329627;ENST00000399744;ENST00000428061;ENST00000399746	D;D;D	0.93906	-3.31;-3.31;-3.31	5.46	5.46	0.80206	.	0.156140	0.42172	U	0.000754	D	0.91761	0.7394	L	0.60455	1.87	0.47547	D	0.999453	P;P	0.43788	0.782;0.817	B;B	0.40534	0.223;0.332	D	0.91116	0.4926	10	0.36615	T	0.2	-6.6262	16.8283	0.85937	0.0:0.0:1.0:0.0	.	86;86	F6UBB5;Q7Z412	.;PEX26_HUMAN	S	86	ENSP00000331106:C86S;ENSP00000382648:C86S;ENSP00000412441:C86S	ENSP00000331106:C86S	C	+	2	0	PEX26	16942666	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.392000	0.90180	2.724000	0.93272	0.491000	0.48974	TGT	PEX26	-	pfam_Pex26	ENSG00000215193		0.527	PEX26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX26	HGNC	protein_coding	OTTHUMT00000314644.3	55	0.00	0	G	NM_017929		18562666	18562666	+1	no_errors	ENST00000329627	ensembl	human	known	69_37n	missense	80	23.08	24	SNP	1.000	C
PHLDA1	22822	genome.wustl.edu	37	12	76424952	76424952	+	Missense_Mutation	SNP	C	C	G	rs200070422		TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr12:76424952C>G	ENST00000266671.5	-	1	2760	c.570G>C	c.(568-570)caG>caC	p.Q190H	RP11-290L1.2_ENST00000547721.1_RNA|RP11-290L1.3_ENST00000552367.1_RNA|PHLDA1_ENST00000602540.1_Missense_Mutation_p.Q49H			Q8WV24	PHLA1_HUMAN	pleckstrin homology-like domain, family A, member 1	190	PH.|Poly-Gln.				apoptotic process (GO:0006915)|FasL biosynthetic process (GO:0045210)|forebrain neuron differentiation (GO:0021879)|positive regulation of apoptotic process (GO:0043065)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	14		Colorectal(145;0.09)				gctgctgctgctggtgttgca	0.647																																						dbGAP											0													15.0	16.0	16.0					12																	76424952		2187	4269	6456	-	-	-	SO:0001583	missense	0			Z50194	CCDS31861.1	12q15	2008-08-05				ENSG00000139289			8933	protein-coding gene	gene with protein product	"""proline-histidine rich protein"""	605335				12384558, 15037619	Standard	NM_007350		Approved	TDAG51, DT1P1B11, PHRIP	uc001sxu.3	Q8WV24		ENST00000266671.5:c.570G>C	12.37:g.76424952C>G	ENSP00000266671:p.Gln190His		A1A4G9|Q15184|Q2TAN2|Q9NZ17	Missense_Mutation	SNP	smart_Pleckstrin_homology	p.Q190H	ENST00000266671.5	37	c.570	CCDS31861.1	12	.	.	.	.	.	.	.	.	.	.	C	12.14	1.847435	0.32606	.	.	ENSG00000139289	ENST00000266671;ENST00000421361	T	0.25749	1.78	3.66	2.74	0.32292	Pleckstrin homology domain (1);	.	.	.	.	T	0.15478	0.0373	N	0.14661	0.345	0.26866	N	0.967856	B	0.06786	0.001	B	0.04013	0.001	T	0.19549	-1.0302	9	0.87932	D	0	.	8.7699	0.34726	0.0:0.767:0.233:0.0	.	190	Q8WV24	PHLA1_HUMAN	H	190;49	ENSP00000266671:Q190H	ENSP00000266671:Q190H	Q	-	3	2	PHLDA1	74711219	0.991000	0.36638	0.886000	0.34754	0.865000	0.49528	0.349000	0.20055	0.710000	0.31997	0.561000	0.74099	CAG	PHLDA1	-	smart_Pleckstrin_homology	ENSG00000139289		0.647	PHLDA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PHLDA1	HGNC	protein_coding	OTTHUMT00000405846.2	25	0.00	0	C	NM_007350		76424952	76424952	-1	no_errors	ENST00000266671	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	0.996	G
PIPSL	266971	genome.wustl.edu	37	10	95721266	95721266	+	RNA	DEL	C	C	-			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr10:95721266delC	ENST00000480546.1	-	0	31					NR_002319.2		A2A3N6	PIPSL_HUMAN	PIP5K1A and PSMD4-like, pseudogene							cytoplasm (GO:0005737)	phosphatidylinositol phosphate kinase activity (GO:0016307)										ATCTTGGCAGCCCCCTCCCCC	0.582																																						dbGAP											0																																										-	-	-			0			BC068549		10q23.33	2010-10-27	2010-10-27	2007-07-06	ENSG00000180764	ENSG00000180764		"""Proteasome (prosome, macropain) subunits"""	23733	pseudogene	pseudogene			"""proteasome (prosome, macropain) 26S subunit, non-ATPase, 4, pseudogene 2"", ""phosphatidylinositol-4-phosphate 5-kinase, type I-like 1"", ""PIP5K1A and PSMD4-like"""	PSMD4P2, PIP5K1L1		16344562	Standard	NR_002319		Approved	PIP5K1A-PSMD4, PIP5K1P3	uc009xuj.2	A2A3N6	OTTHUMG00000137480		10.37:g.95721266delC			Q6NUK8	RNA	DEL	-	NULL	ENST00000480546.1	37	NULL		10																																																																																			PIPSL	-	-	ENSG00000180764		0.582	PIPSL-002	PUTATIVE	basic	processed_transcript	PIPSL	HGNC	pseudogene	OTTHUMT00000351483.1	43	0.00	0	C	NR_002319		95721266	95721266	-1	no_errors	ENST00000480546	ensembl	human	putative	69_37n	rna	32	21.43	9	DEL	0.852	-
PPP1R15B	84919	genome.wustl.edu	37	1	204379798	204379798	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr1:204379798C>G	ENST00000367188.4	-	1	1121	c.742G>C	c.(742-744)Gtc>Ctc	p.V248L	RP11-739N20.2_ENST00000443515.1_RNA	NM_032833.3	NP_116222.3	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	248					ER overload response (GO:0006983)|regulation of translation (GO:0006417)|response to hydrogen peroxide (GO:0042542)	protein phosphatase type 1 complex (GO:0000164)	protein serine/threonine phosphatase activity (GO:0004722)			breast(3)|cervix(1)|kidney(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(2)|skin(1)|urinary_tract(3)	34	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			TGGAAGCCGACTACCTCGCTA	0.532																																						dbGAP											0													92.0	89.0	90.0					1																	204379798		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027650	CCDS1445.1	1q32.1	2012-04-17	2011-10-04		ENSG00000158615	ENSG00000158615		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14951	protein-coding gene	gene with protein product		613257	"""protein phosphatase 1, regulatory (inhibitor) subunit 15B"""			11948623	Standard	XM_005245551		Approved	FLJ14744	uc001hav.4	Q5SWA1	OTTHUMG00000036105	ENST00000367188.4:c.742G>C	1.37:g.204379798C>G	ENSP00000356156:p.Val248Leu		Q53GQ4|Q658M2|Q6P156|Q96SN1	Missense_Mutation	SNP	pfam_Prot_Pase1_reg-su15B_N,pfam_Prot_Pase1_reg-su15A/B_C	p.V248L	ENST00000367188.4	37	c.742	CCDS1445.1	1	.	.	.	.	.	.	.	.	.	.	C	15.68	2.905292	0.52333	.	.	ENSG00000158615	ENST00000367188;ENST00000543650	T	0.24350	1.86	5.2	4.27	0.50696	Protein phosphatase 1, regulatory subunit 15B, N-terminal (1);	0.837088	0.10231	N	0.699689	T	0.29882	0.0747	L	0.56769	1.78	0.09310	N	1	B	0.18610	0.029	B	0.23018	0.043	T	0.24368	-1.0162	10	0.62326	D	0.03	-4.7092	11.617	0.51096	0.0:0.8202:0.1798:0.0	.	248	Q5SWA1	PR15B_HUMAN	L	248;158	ENSP00000356156:V248L	ENSP00000356156:V248L	V	-	1	0	PPP1R15B	202646421	0.013000	0.17824	0.001000	0.08648	0.002000	0.02628	2.618000	0.46393	1.135000	0.42183	0.655000	0.94253	GTC	PPP1R15B	-	pfam_Prot_Pase1_reg-su15B_N	ENSG00000158615		0.532	PPP1R15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R15B	HGNC	protein_coding	OTTHUMT00000087974.1	31	0.00	0	C	NM_032833		204379798	204379798	-1	no_errors	ENST00000367188	ensembl	human	known	69_37n	missense	60	10.45	7	SNP	0.006	G
PTPRB	5787	genome.wustl.edu	37	12	70970306	70970306	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr12:70970306C>G	ENST00000261266.5	-	9	2073	c.2044G>C	c.(2044-2046)Ggc>Cgc	p.G682R	PTPRB_ENST00000334414.6_Missense_Mutation_p.G900R|PTPRB_ENST00000451516.2_Missense_Mutation_p.G592R|PTPRB_ENST00000551525.1_Missense_Mutation_p.G899R|PTPRB_ENST00000550857.1_Missense_Mutation_p.G592R|PTPRB_ENST00000550358.1_Intron|PTPRB_ENST00000538708.1_Missense_Mutation_p.G682R	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	682	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			ACCACCTTGCCGTCATGAGAC	0.522																																						dbGAP											0													52.0	56.0	55.0					12																	70970306		2083	4208	6291	-	-	-	SO:0001583	missense	0			X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.2044G>C	12.37:g.70970306C>G	ENSP00000261266:p.Gly682Arg		B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Ricin_B_lectin,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.G900R	ENST00000261266.5	37	c.2698	CCDS44944.1	12	.	.	.	.	.	.	.	.	.	.	C	9.891	1.204241	0.22205	.	.	ENSG00000127329	ENST00000334414;ENST00000451516;ENST00000538708;ENST00000550857;ENST00000261266;ENST00000551525;ENST00000548122	T;T;T;T;T;T;T	0.59083	0.29;0.29;0.29;0.29;0.29;0.29;0.29	5.16	-3.63	0.04529	Fibronectin, type III (4);Immunoglobulin-like fold (1);	1.142920	0.06167	N	0.677053	T	0.56046	0.1959	L	0.43923	1.385	0.09310	N	1	B;B;P;P;B;B	0.43412	0.257;0.257;0.806;0.463;0.257;0.302	B;B;P;B;B;B	0.50570	0.232;0.232;0.644;0.246;0.232;0.342	T	0.52403	-0.8580	10	0.18710	T	0.47	.	11.0174	0.47698	0.0:0.4587:0.0:0.5413	.	592;682;779;899;900;682	P23467-2;F5H3G6;Q6ZR19;F8VSD5;P23467-3;P23467	.;.;.;.;.;PTPRB_HUMAN	R	900;592;682;592;682;899;779	ENSP00000334928:G900R;ENSP00000393028:G592R;ENSP00000438927:G682R;ENSP00000447302:G592R;ENSP00000261266:G682R;ENSP00000448349:G899R;ENSP00000446982:G779R	ENSP00000261266:G682R	G	-	1	0	PTPRB	69256573	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.128000	0.10531	-1.293000	0.02362	-1.124000	0.02001	GGC	PTPRB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000127329		0.522	PTPRB-007	KNOWN	basic|CCDS	protein_coding	PTPRB	HGNC	protein_coding	OTTHUMT00000404439.1	41	0.00	0	C			70970306	70970306	-1	no_errors	ENST00000334414	ensembl	human	known	69_37n	missense	72	10.00	8	SNP	0.000	G
RHBDF2	79651	genome.wustl.edu	37	17	74469974	74469974	+	Nonsense_Mutation	SNP	C	C	A			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr17:74469974C>A	ENST00000313080.4	-	14	1945	c.1672G>T	c.(1672-1674)Gag>Tag	p.E558*	RHBDF2_ENST00000591885.1_Nonsense_Mutation_p.E529*|RHBDF2_ENST00000389760.4_Nonsense_Mutation_p.E529*	NM_024599.5	NP_078875.4	Q6PJF5	RHDF2_HUMAN	rhomboid 5 homolog 2 (Drosophila)	558					negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(4)|skin(1)	27						GAGGCTGGCTCCTCGCAGGTC	0.652																																						dbGAP											0													46.0	41.0	43.0					17																	74469974		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC016034	CCDS32743.1, CCDS32744.1	17q25.3	2014-09-17	2006-02-22	2006-02-22		ENSG00000129667			20788	protein-coding gene	gene with protein product		614404	"""rhomboid, veinlet-like 6 (Drosophila)"", ""tylosis with oesophageal cancer"""	RHBDL6, TOC		12838346, 22265016	Standard	NM_024599		Approved	FLJ22341, RHBDL5, TOCG	uc002jrq.2	Q6PJF5		ENST00000313080.4:c.1672G>T	17.37:g.74469974C>A	ENSP00000322775:p.Glu558*		A6NEM3|A8K801|Q5U607|Q5YGQ8|Q9H6E9	Nonsense_Mutation	SNP	pfam_Rhomboid_SP,pfam_Peptidase_S54_rhomboid_dom	p.E558*	ENST00000313080.4	37	c.1672	CCDS32743.1	17	.	.	.	.	.	.	.	.	.	.	C	41	8.903469	0.98996	.	.	ENSG00000129667	ENST00000313080;ENST00000389760;ENST00000389762	.	.	.	5.39	5.39	0.77823	.	0.047936	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	-34.582	19.1516	0.93491	0.0:1.0:0.0:0.0	.	.	.	.	X	558;529;504	.	ENSP00000322775:E558X	E	-	1	0	RHBDF2	71981569	1.000000	0.71417	1.000000	0.80357	0.770000	0.43624	4.885000	0.63142	2.537000	0.85549	0.491000	0.48974	GAG	RHBDF2	-	NULL	ENSG00000129667		0.652	RHBDF2-001	KNOWN	basic|CCDS	protein_coding	RHBDF2	HGNC	protein_coding	OTTHUMT00000450134.1	26	0.00	0	C	NM_024599		74469974	74469974	-1	no_errors	ENST00000313080	ensembl	human	known	69_37n	nonsense	31	13.89	5	SNP	1.000	A
RNF208	727800	genome.wustl.edu	37	9	140115554	140115554	+	Missense_Mutation	SNP	G	G	C	rs144152667	byFrequency	TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr9:140115554G>C	ENST00000392827.1	-	2	279	c.111C>G	c.(109-111)caC>caG	p.H37Q	RNF208_ENST00000391553.1_Missense_Mutation_p.H37Q			Q9H0X6	RN208_HUMAN	ring finger protein 208	37					protein autoubiquitination (GO:0051865)		ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			lung(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		ACTTTTCAGGGTGGACAATCT	0.667																																						dbGAP											0													17.0	21.0	20.0					9																	140115554		1962	4143	6105	-	-	-	SO:0001583	missense	0			AF416715	CCDS7037.2	9q34.3	2007-01-19				ENSG00000212864		"""RING-type (C3HC4) zinc fingers"""	25420	protein-coding gene	gene with protein product						11230166	Standard	NM_031297		Approved	DKFZP761H1710	uc004clz.2	Q9H0X6		ENST00000392827.1:c.111C>G	9.37:g.140115554G>C	ENSP00000376572:p.His37Gln		A2BFA0	Missense_Mutation	SNP	pfscan_Znf_RING	p.H37Q	ENST00000392827.1	37	c.111	CCDS7037.2	9	.	.	.	.	.	.	.	.	.	.	G	4.483	0.089475	0.08632	.	.	ENSG00000212864	ENST00000392827;ENST00000391553	T;T	0.27890	1.64;1.64	4.26	0.209	0.15226	.	457.525000	0.01720	U	0.028202	T	0.13798	0.0334	N	0.02539	-0.55	0.23113	N	0.998277	B	0.16396	0.017	B	0.12837	0.008	T	0.16719	-1.0393	10	0.37606	T	0.19	-11.0168	5.0359	0.14434	0.3421:0.1413:0.5166:0.0	.	37	Q9H0X6	RN208_HUMAN	Q	37	ENSP00000376572:H37Q;ENSP00000375397:H37Q	ENSP00000375397:H37Q	H	-	3	2	RNF208	139235375	0.997000	0.39634	0.990000	0.47175	0.885000	0.51271	0.348000	0.20031	-0.010000	0.14271	-0.254000	0.11334	CAC	RNF208	-	NULL	ENSG00000212864		0.667	RNF208-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	RNF208	HGNC	protein_coding	OTTHUMT00000254714.1	16	0.00	0	G	NM_031297		140115554	140115554	-1	no_errors	ENST00000391553	ensembl	human	known	69_37n	missense	4	73.33	11	SNP	1.000	C
RPLP0P2	113157	genome.wustl.edu	37	11	61404585	61404585	+	RNA	SNP	C	C	G			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr11:61404585C>G	ENST00000496593.1	+	0	1189					NR_002775.2				ribosomal protein, large, P0 pseudogene 2																		GGTATCATCACTAAAATCTCC	0.542																																						dbGAP											0																																										-	-	-			0			BC010523		11q12.2	2014-08-07			ENSG00000243742	ENSG00000243742		"""L ribosomal proteins"""	17960	pseudogene	pseudogene						19123937, 25089627	Standard	NR_002775		Approved		uc001nrz.1		OTTHUMG00000158396		11.37:g.61404585C>G				RNA	SNP	-	NULL	ENST00000496593.1	37	NULL		11																																																																																			RPLP0P2	-	-	ENSG00000243742		0.542	RPLP0P2-002	KNOWN	basic	processed_transcript	RPLP0P2	HGNC	pseudogene	OTTHUMT00000350911.1	27	0.00	0	C	NR_002775		61404585	61404585	+1	no_errors	ENST00000496593	ensembl	human	known	69_37n	rna	35	20.45	9	SNP	1.000	G
RTN4	57142	genome.wustl.edu	37	2	55252437	55252437	+	Missense_Mutation	SNP	C	C	G	rs200793021		TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr2:55252437C>G	ENST00000337526.6	-	3	3041	c.2798G>C	c.(2797-2799)aGt>aCt	p.S933T	RTN4_ENST00000394611.2_Missense_Mutation_p.S727T|RTN4_ENST00000357732.4_Intron|RTN4_ENST00000317610.7_Intron|RTN4_ENST00000405240.1_Missense_Mutation_p.S727T|RTN4_ENST00000404909.1_Missense_Mutation_p.S727T|RTN4_ENST00000354474.6_Missense_Mutation_p.S701T|RTN4_ENST00000402434.2_Intron|RTN4_ENST00000357376.3_Missense_Mutation_p.S727T	NM_020532.4	NP_065393.1	Q9NQC3	RTN4_HUMAN	reticulon 4	933					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonal fasciculation (GO:0007413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cerebral cortex radial glia guided migration (GO:0021801)|endoplasmic reticulum tubular network organization (GO:0071786)|negative regulation of axon extension (GO:0030517)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell growth (GO:0030308)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of apoptotic process (GO:0042981)|regulation of axonogenesis (GO:0050770)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of cell migration (GO:0030334)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(1)|skin(1)|stomach(1)	36						ATCTGAGAAACTGATTTTCTC	0.443																																						dbGAP											0													97.0	97.0	97.0					2																	55252437		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF087901	CCDS1851.1, CCDS1852.1, CCDS42683.1, CCDS42684.1, CCDS42685.1	2p14-p13	2008-05-23			ENSG00000115310	ENSG00000115310			14085	protein-coding gene	gene with protein product		604475				10667797, 10773680	Standard	NM_020532		Approved	NSP-CL, KIAA0886, NOGO, ASY	uc002rye.3	Q9NQC3	OTTHUMG00000129337	ENST00000337526.6:c.2798G>C	2.37:g.55252437C>G	ENSP00000337838:p.Ser933Thr		O94962|Q7L7Q5|Q7L7Q6|Q7L7Q8|Q8IUA4|Q96B16|Q9BXG5|Q9H212|Q9H3I3|Q9UQ42|Q9Y293|Q9Y2Y7|Q9Y5U6	Missense_Mutation	SNP	pfam_Reticulon,pfscan_Reticulon	p.S933T	ENST00000337526.6	37	c.2798	CCDS42684.1	2	.	.	.	.	.	.	.	.	.	.	c	1.538	-0.542481	0.04053	.	.	ENSG00000115310	ENST00000405240;ENST00000357376;ENST00000337526;ENST00000394611;ENST00000404909;ENST00000354474	T;T;T;T;T;T	0.17370	2.28;2.28;2.28;2.28;2.28;2.28	5.7	-9.81	0.00487	.	1.913480	0.02856	N	0.129692	T	0.05547	0.0146	N	0.08118	0	0.09310	N	1	B	0.23185	0.081	B	0.16289	0.015	T	0.24225	-1.0166	10	0.16420	T	0.52	8.7544	2.9171	0.05756	0.1747:0.0848:0.0881:0.6523	.	933	Q9NQC3	RTN4_HUMAN	T	727;727;933;727;727;701	ENSP00000384471:S727T;ENSP00000349944:S727T;ENSP00000337838:S933T;ENSP00000378109:S727T;ENSP00000385650:S727T;ENSP00000346465:S701T	ENSP00000337838:S933T	S	-	2	0	RTN4	55105941	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.104000	0.03326	-1.257000	0.02475	-2.896000	0.00094	AGT	RTN4	-	NULL	ENSG00000115310		0.443	RTN4-001	KNOWN	basic|CCDS	protein_coding	RTN4	HGNC	protein_coding	OTTHUMT00000251484.1	50	0.00	0	C			55252437	55252437	-1	no_errors	ENST00000337526	ensembl	human	known	69_37n	missense	52	22.39	15	SNP	0.000	G
RYR1	6261	genome.wustl.edu	37	19	38979876	38979876	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr19:38979876G>T	ENST00000359596.3	+	35	5607	c.5607G>T	c.(5605-5607)gaG>gaT	p.E1869D	RYR1_ENST00000360985.3_Missense_Mutation_p.E1869D|RYR1_ENST00000355481.4_Missense_Mutation_p.E1869D			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1869	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TTGAGCCTGAGGTCTTCACTg	0.512																																						dbGAP											0													106.0	89.0	94.0					19																	38979876		2203	4300	6503	-	-	-	SO:0001583	missense	0			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.5607G>T	19.37:g.38979876G>T	ENSP00000352608:p.Glu1869Asp		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.E1869D	ENST00000359596.3	37	c.5607	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	a	10.36	1.329407	0.24167	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	T;T;T	0.06528	3.29;3.29;3.29	4.06	2.96	0.34315	.	0.630262	0.13644	U	0.372753	T	0.03651	0.0104	N	0.19112	0.55	0.28322	N	0.922206	P;P	0.37548	0.599;0.467	B;B	0.35312	0.137;0.2	T	0.35699	-0.9778	10	0.30854	T	0.27	.	2.7872	0.05377	0.425:0.0:0.232:0.3431	.	1869;1869	P21817-2;P21817	.;RYR1_HUMAN	D	1869	ENSP00000352608:E1869D;ENSP00000347667:E1869D;ENSP00000354254:E1869D	ENSP00000347667:E1869D	E	+	3	2	RYR1	43671716	0.348000	0.24861	0.975000	0.42487	0.666000	0.39218	0.066000	0.14489	0.595000	0.29777	-0.407000	0.06327	GAG	RYR1	-	NULL	ENSG00000196218		0.512	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	54	0.00	0	G			38979876	38979876	+1	no_errors	ENST00000359596	ensembl	human	known	69_37n	missense	64	13.51	10	SNP	1.000	T
SCUBE3	222663	genome.wustl.edu	37	6	35213839	35213839	+	Silent	SNP	C	C	T			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr6:35213839C>T	ENST00000274938.7	+	20	2718	c.2718C>T	c.(2716-2718)gcC>gcT	p.A906A	SCUBE3_ENST00000394681.1_Silent_p.A922A	NM_152753.2	NP_689966.2			signal peptide, CUB domain, EGF-like 3											breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	37						CCAACAGCGCCCGTGGCTTCC	0.547																																						dbGAP											0													146.0	149.0	148.0					6																	35213839		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF452494.1	CCDS4800.1	6p21.3	2008-02-05	2004-05-19	2004-05-21		ENSG00000146197			13655	protein-coding gene	gene with protein product		614708	"""CUB domain and EGF-like repeat containing 3"""	CEGF3		12270931	Standard	NM_152753		Approved	FLJ34743	uc003okf.1	Q8IX30		ENST00000274938.7:c.2718C>T	6.37:g.35213839C>T				Silent	SNP	pfam_EGF-like_Ca-bd,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_EGF-like_dom,pfam_CUB,superfamily_CUB,superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_CUB,prints_Thrombomodulin,pfscan_CUB,pfscan_EG-like_dom	p.A922	ENST00000274938.7	37	c.2766	CCDS4800.1	6																																																																																			SCUBE3	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000146197		0.547	SCUBE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCUBE3	HGNC	protein_coding	OTTHUMT00000040275.1	52	0.00	0	C	NM_152753		35213839	35213839	+1	no_errors	ENST00000394681	ensembl	human	known	69_37n	silent	53	19.40	13	SNP	0.992	T
SCML4	256380	genome.wustl.edu	37	6	108067977	108067977	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr6:108067977C>T	ENST00000369020.3	-	4	648	c.403G>A	c.(403-405)Gtc>Atc	p.V135I	SCML4_ENST00000369022.2_Missense_Mutation_p.V77I|SCML4_ENST00000479803.1_5'Flank|SCML4_ENST00000369021.3_Missense_Mutation_p.V106I	NM_198081.3	NP_932347.2	Q8N228	SCML4_HUMAN	sex comb on midleg-like 4 (Drosophila)	135					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(1)	25		all_cancers(87;3.26e-06)|Acute lymphoblastic leukemia(125;3.08e-08)|all_hematologic(75;1.15e-06)|all_epithelial(87;0.00142)|Colorectal(196;0.0316)		BRCA - Breast invasive adenocarcinoma(108;0.01)|Epithelial(106;0.0509)|all cancers(137;0.0586)|OV - Ovarian serous cystadenocarcinoma(136;0.0758)		CAGGCTTGGACGGCCTGCTGC	0.642																																						dbGAP											0													54.0	54.0	54.0					6																	108067977		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5060.2, CCDS69163.1, CCDS75500.1	6q21	2013-01-10			ENSG00000146285	ENSG00000146285		"""Sterile alpha motif (SAM) domain containing"""	21397	protein-coding gene	gene with protein product							Standard	NM_001286409		Approved	dJ47M23.1	uc010kdf.3	Q8N228	OTTHUMG00000015313	ENST00000369020.3:c.403G>A	6.37:g.108067977C>T	ENSP00000358016:p.Val135Ile		B0QZ10|B0QZ11|B7ZBX3|Q5JXD0|Q5T0T6|Q8IYY6	Missense_Mutation	SNP	pfam_DUF3588	p.V106I	ENST00000369020.3	37	c.316	CCDS5060.2	6	.	.	.	.	.	.	.	.	.	.	C	20.9	4.066002	0.76187	.	.	ENSG00000146285	ENST00000369022;ENST00000369020;ENST00000369021;ENST00000440927	T;T;T;T	0.50548	0.74;0.74;0.74;0.74	4.98	3.21	0.36854	.	0.058883	0.64402	N	0.000002	T	0.59376	0.2189	M	0.84585	2.705	0.58432	D	0.999996	P;D;D	0.89917	0.634;1.0;1.0	B;D;D	0.81914	0.225;0.995;0.965	T	0.62964	-0.6742	10	0.41790	T	0.15	.	11.4743	0.50288	0.0:0.8665:0.0:0.1335	.	135;135;106	B4E0X3;Q8N228;Q8N228-3	.;SCML4_HUMAN;.	I	77;135;106;106	ENSP00000358018:V77I;ENSP00000358016:V135I;ENSP00000358017:V106I;ENSP00000404688:V106I	ENSP00000358016:V135I	V	-	1	0	SCML4	108174670	1.000000	0.71417	0.389000	0.26208	0.971000	0.66376	5.555000	0.67301	0.698000	0.31739	0.563000	0.77884	GTC	SCML4	-	pfam_DUF3588	ENSG00000146285		0.642	SCML4-005	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	SCML4	HGNC	protein_coding	OTTHUMT00000041700.3	14	0.00	0	C	XM_171128		108067977	108067977	-1	no_errors	ENST00000369021	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	0.989	T
SETD2	29072	genome.wustl.edu	37	3	47164556	47164556	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr3:47164556T>G	ENST00000409792.3	-	3	1612	c.1570A>C	c.(1570-1572)Aat>Cat	p.N524H		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	524					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		ATTGCTTCATTTTCTGAAGTC	0.388			"""N, F, S, Mis"""		clear cell renal carcinoma																																	dbGAP		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	0													78.0	74.0	75.0					3																	47164556		2183	4250	6433	-	-	-	SO:0001583	missense	0			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.1570A>C	3.37:g.47164556T>G	ENSP00000386759:p.Asn524His		O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	pfam_SRI,pfam_SET_dom,pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,superfamily_Ferritin/RR-like,smart_AWS,smart_SET_dom,smart_Post-SET_dom,smart_WW_Rsp5_WWP,pfscan_AWS,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_WW_Rsp5_WWP	p.N524H	ENST00000409792.3	37	c.1570	CCDS2749.2	3	.	.	.	.	.	.	.	.	.	.	T	7.898	0.733755	0.15574	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792;ENST00000412450	T;T	0.13538	2.58;2.58	5.09	3.92	0.45320	.	0.515806	0.19105	N	0.122582	T	0.07728	0.0194	N	0.08118	0	0.24819	N	0.992594	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.27297	-1.0078	10	0.38643	T	0.18	.	12.1504	0.54046	0.0:0.0:0.1484:0.8516	.	524;524	F2Z317;Q9BYW2	.;SETD2_HUMAN	H	524;524;524;480	ENSP00000386759:N524H;ENSP00000416401:N480H	ENSP00000386759:N524H	N	-	1	0	SETD2	47139560	.	.	1.000000	0.80357	0.994000	0.84299	.	.	1.041000	0.40125	0.528000	0.53228	AAT	SETD2	-	NULL	ENSG00000181555		0.388	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD2	HGNC	protein_coding	OTTHUMT00000257479.2	44	0.00	0	T	NM_014159		47164556	47164556	-1	no_errors	ENST00000409792	ensembl	human	known	69_37n	missense	50	23.08	15	SNP	1.000	G
SHISA7	729956	genome.wustl.edu	37	19	55952018	55952018	+	Silent	SNP	C	C	T			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr19:55952018C>T	ENST00000376325.4	-	2	785	c.786G>A	c.(784-786)acG>acA	p.T262T		NM_001145176.1	NP_001138648.1	A6NL88	SHSA7_HUMAN	shisa family member 7	262						integral component of membrane (GO:0016021)				skin(1)	1						GGTTCTTGGGCGTCCTGGGGG	0.677																																						dbGAP											0													38.0	44.0	42.0					19																	55952018		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS46193.1	19q13.42	2013-07-31	2013-07-31					"""Shisa homologs"""	35409	protein-coding gene	gene with protein product			"""shisa homolog 7 (Xenopus laevis)"""				Standard	NM_001145176		Approved		uc002qkz.3	A6NL88		ENST00000376325.4:c.786G>A	19.37:g.55952018C>T				Missense_Mutation	SNP	NULL	p.R87H	ENST00000376325.4	37	c.260	CCDS46193.1	19	.	.	.	.	.	.	.	.	.	.	C	12.11	1.838742	0.32513	.	.	ENSG00000187902	ENST00000416792	.	.	.	4.18	-2.72	0.05968	.	.	.	.	.	T	0.47893	0.1470	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43212	-0.9405	4	.	.	.	.	5.058	0.14542	0.0:0.3573:0.1553:0.4874	.	.	.	.	H	87	.	.	R	-	2	0	SHISA7	60643830	0.257000	0.24022	0.996000	0.52242	0.874000	0.50279	-0.856000	0.04290	-0.109000	0.12044	-0.258000	0.10820	CGC	SHISA7	-	NULL	ENSG00000187902		0.677	SHISA7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SHISA7	HGNC	protein_coding	OTTHUMT00000334533.2	36	0.00	0	C	NM_001145176		55952018	55952018	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000416792	ensembl	human	novel	69_37n	missense	55	11.29	7	SNP	0.880	T
SLC36A1	206358	genome.wustl.edu	37	5	150846797	150846797	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr5:150846797G>T	ENST00000243389.3	+	6	680	c.457G>T	c.(457-459)Gga>Tga	p.G153*	SLC36A1_ENST00000429484.2_Nonsense_Mutation_p.G153*|SLC36A1_ENST00000520701.1_Nonsense_Mutation_p.G153*|SLC36A1_ENST00000521925.1_Nonsense_Mutation_p.G153*	NM_078483.2	NP_510968.2	Q7Z2H8	S36A1_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 1	153					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)|hydrogen ion transmembrane transporter activity (GO:0015078)|L-alanine transmembrane transporter activity (GO:0015180)|L-proline transmembrane transporter activity (GO:0015193)|symporter activity (GO:0015293)			endometrium(5)|kidney(9)|lung(8)|skin(2)|urinary_tract(1)	25		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)|all_neural(839;0.138)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Acamprosate(DB00659)|Glycine(DB00145)|Hydroxyproline(DB08847)|L-Alanine(DB00160)|Spaglumic Acid(DB08835)|Vigabatrin(DB01080)	CACCCAGCTGGGATTCTGCTG	0.428																																					Melanoma(151;1534 1860 12947 32979 37872)	dbGAP											0													179.0	167.0	171.0					5																	150846797		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK057340	CCDS4316.1	5q33.1	2013-05-22			ENSG00000123643	ENSG00000123643		"""Solute carriers"""	18761	protein-coding gene	gene with protein product		606561				11959859, 11390972	Standard	NM_078483		Approved	LYAAT-1, PAT1, TRAMD3	uc003luc.3	Q7Z2H8	OTTHUMG00000130125	ENST00000243389.3:c.457G>T	5.37:g.150846797G>T	ENSP00000243389:p.Gly153*		C9JI34|Q1LZ56|Q7Z7C0|Q86YK4|Q96M74	Nonsense_Mutation	SNP	pfam_AA_transpt_TM	p.G153*	ENST00000243389.3	37	c.457	CCDS4316.1	5	.	.	.	.	.	.	.	.	.	.	G	37	6.031570	0.97221	.	.	ENSG00000123643	ENST00000520701;ENST00000429484;ENST00000243389;ENST00000456739;ENST00000521925	.	.	.	5.04	5.04	0.67666	.	0.106706	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.5913	0.91214	0.0:0.0:1.0:0.0	.	.	.	.	X	153	.	ENSP00000243389:G153X	G	+	1	0	SLC36A1	150826990	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.113000	0.94321	2.614000	0.88457	0.563000	0.77884	GGA	SLC36A1	-	pfam_AA_transpt_TM	ENSG00000123643		0.428	SLC36A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC36A1	HGNC	protein_coding	OTTHUMT00000252433.1	87	0.00	0	G	NM_078483		150846797	150846797	+1	no_errors	ENST00000243389	ensembl	human	known	69_37n	nonsense	74	24.49	24	SNP	1.000	T
SLC38A7	55238	genome.wustl.edu	37	16	58712260	58712260	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr16:58712260C>A	ENST00000570101.1	-	4	1471	c.588G>T	c.(586-588)gaG>gaT	p.E196D	SLC38A7_ENST00000566953.1_Intron|SLC38A7_ENST00000564010.1_Missense_Mutation_p.E107D|SLC38A7_ENST00000219320.4_Missense_Mutation_p.E196D|SLC38A7_ENST00000564100.1_Missense_Mutation_p.E196D			Q9NVC3	S38A7_HUMAN	solute carrier family 38, member 7	196					sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	L-alanine transmembrane transporter activity (GO:0015180)|L-amino acid transmembrane transporter activity (GO:0015179)|L-asparagine transmembrane transporter activity (GO:0015182)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|L-glutamine transmembrane transporter activity (GO:0015186)|L-histidine transmembrane transporter activity (GO:0005290)|L-leucine transmembrane transporter activity (GO:0015190)|L-methionine transmembrane transporter activity (GO:0015191)|L-serine transmembrane transporter activity (GO:0015194)			endometrium(1)|large_intestine(2)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	13						GGAAACCAATCTCCCTGGGGA	0.602																																						dbGAP											0													83.0	75.0	78.0					16																	58712260		2198	4300	6498	-	-	-	SO:0001583	missense	0			BC001961	CCDS10800.1	16q21	2013-05-22			ENSG00000103042	ENSG00000103042		"""Solute carriers"""	25582	protein-coding gene	gene with protein product		614236					Standard	XM_006721229		Approved	FLJ10815	uc002eod.1	Q9NVC3	OTTHUMG00000133491	ENST00000570101.1:c.588G>T	16.37:g.58712260C>A	ENSP00000454646:p.Glu196Asp		Q53GJ9|Q9H9I5	Missense_Mutation	SNP	pfam_AA_transpt_TM,pfam_Tryptophan/tyrosine_permease	p.E196D	ENST00000570101.1	37	c.588	CCDS10800.1	16	.	.	.	.	.	.	.	.	.	.	C	19.07	3.756045	0.69648	.	.	ENSG00000103042	ENST00000219320	T	0.02236	4.38	5.95	5.01	0.66863	.	0.043370	0.85682	D	0.000000	T	0.03827	0.0108	L	0.43152	1.355	0.80722	D	1	P;B	0.37083	0.581;0.285	B;B	0.41646	0.362;0.122	T	0.58752	-0.7581	9	.	.	.	.	14.0386	0.64660	0.0:0.9282:0.0:0.0718	.	196;196	Q9NVC3;Q9NVC3-2	S38A7_HUMAN;.	D	196	ENSP00000219320:E196D	.	E	-	3	2	SLC38A7	57269761	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.751000	0.55165	1.531000	0.49152	0.655000	0.94253	GAG	SLC38A7	-	pfam_AA_transpt_TM,pfam_Tryptophan/tyrosine_permease	ENSG00000103042		0.602	SLC38A7-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC38A7	HGNC	protein_coding	OTTHUMT00000422206.2	59	0.00	0	C	NM_018231		58712260	58712260	-1	no_errors	ENST00000219320	ensembl	human	known	69_37n	missense	46	26.98	17	SNP	1.000	A
SLC9A3	6550	genome.wustl.edu	37	5	485334	485334	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr5:485334C>T	ENST00000264938.3	-	4	697	c.688G>A	c.(688-690)Gtg>Atg	p.V230M	SLC9A3_ENST00000514375.1_Missense_Mutation_p.V230M	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3	230					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)			NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			GATTCAAACACATTGTACAGA	0.637																																						dbGAP											0													154.0	127.0	136.0					5																	485334		2201	4300	6501	-	-	-	SO:0001583	missense	0				CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.688G>A	5.37:g.485334C>T	ENSP00000264938:p.Val230Met		B7ZKR2|E9PF67|Q3MIW3	Missense_Mutation	SNP	pfam_Cation/H_exchanger,superfamily_Reg_factor_effector_bac,prints_Na/H_exchanger_3/5,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.V230M	ENST00000264938.3	37	c.688	CCDS3855.1	5	.	.	.	.	.	.	.	.	.	.	C	13.21	2.167718	0.38315	.	.	ENSG00000066230	ENST00000264938;ENST00000514375	T;T	0.19938	2.11;2.11	4.14	4.14	0.48551	Cation/H+ exchanger (1);	0.292367	0.31884	N	0.006902	T	0.30696	0.0773	N	0.25957	0.775	0.51482	D	0.999928	D;D	0.65815	0.995;0.981	D;P	0.68192	0.956;0.82	T	0.04495	-1.0947	10	0.20519	T	0.43	.	16.3914	0.83541	0.0:1.0:0.0:0.0	.	230;230	E9PF67;P48764	.;SL9A3_HUMAN	M	230	ENSP00000264938:V230M;ENSP00000422983:V230M	ENSP00000264938:V230M	V	-	1	0	SLC9A3	538334	1.000000	0.71417	0.996000	0.52242	0.143000	0.21401	5.314000	0.65804	2.027000	0.59764	0.555000	0.69702	GTG	SLC9A3	-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger	ENSG00000066230		0.637	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A3	HGNC	protein_coding	OTTHUMT00000206677.2	42	0.00	0	C	NM_004174		485334	485334	-1	no_errors	ENST00000264938	ensembl	human	known	69_37n	missense	55	32.93	27	SNP	1.000	T
SPTB	6710	genome.wustl.edu	37	14	65267588	65267588	+	Splice_Site	SNP	T	T	G			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr14:65267588T>G	ENST00000389721.5	-	7	796		c.e7-2		SPTB_ENST00000542895.1_Splice_Site|SPTB_ENST00000389720.3_Splice_Site|SPTB_ENST00000389722.3_Splice_Site|SPTB_ENST00000556626.1_Splice_Site	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic						actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		TAAAGACATCTGTTAGGGAAA	0.483											OREG0022735	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													82.0	77.0	79.0					14																	65267588		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.764-2A>C	14.37:g.65267588T>G		1082	Q15510|Q15519	Splice_Site	SNP	-	e7-2	ENST00000389721.5	37	c.764-2	CCDS32100.1	14	.	.	.	.	.	.	.	.	.	.	T	20.7	4.028088	0.75390	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.409	0.67103	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SPTB	64337341	1.000000	0.71417	0.999000	0.59377	0.818000	0.46254	8.040000	0.89188	2.049000	0.60858	0.455000	0.32223	.	SPTB	-	-	ENSG00000070182		0.483	SPTB-004	KNOWN	basic|CCDS	protein_coding	SPTB	HGNC	protein_coding	OTTHUMT00000414080.1	41	0.00	0	T		Intron	65267588	65267588	-1	no_errors	ENST00000389722	ensembl	human	known	69_37n	splice_site	51	25.00	17	SNP	1.000	G
ST6GALNAC1	55808	genome.wustl.edu	37	17	74623249	74623249	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr17:74623249C>T	ENST00000156626.7	-	4	1271	c.1072G>A	c.(1072-1074)Ggg>Agg	p.G358R	ST6GALNAC1_ENST00000590878.1_5'UTR	NM_018414.3	NP_060884.1	Q9NSC7	SIA7A_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1	358					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	22						CGGAGGCTCCCAGCGGGGAGG	0.632																																						dbGAP											0													57.0	51.0	53.0					17																	74623249		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y11339	CCDS11748.1	17q25.3	2013-03-01	2005-02-07	2005-02-07	ENSG00000070526	ENSG00000070526		"""Sialyltransferases"""	23614	protein-coding gene	gene with protein product		610138	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) A"""	SIAT7A			Standard	NM_001289107		Approved	ST6GalNAcI	uc002jsh.3	Q9NSC7	OTTHUMG00000180369	ENST00000156626.7:c.1072G>A	17.37:g.74623249C>T	ENSP00000156626:p.Gly358Arg		Q6UW90|Q9NSC6	Missense_Mutation	SNP	pfam_Glyco_trans_29	p.G358R	ENST00000156626.7	37	c.1072	CCDS11748.1	17	.	.	.	.	.	.	.	.	.	.	C	4.193	0.034465	0.08101	.	.	ENSG00000070526	ENST00000156626;ENST00000359088	T;T	0.24151	1.89;1.87	4.65	2.61	0.31194	.	0.442225	0.21811	N	0.068775	T	0.16514	0.0397	L	0.31065	0.9	0.19300	N	0.99998	B	0.28820	0.224	B	0.31191	0.125	T	0.19160	-1.0314	10	0.27785	T	0.31	-23.5106	6.9651	0.24619	0.0:0.6538:0.0:0.3462	.	358	Q9NSC7	SIA7A_HUMAN	R	358	ENSP00000156626:G358R;ENSP00000351991:G358R	ENSP00000156626:G358R	G	-	1	0	ST6GALNAC1	72134844	0.026000	0.19158	0.011000	0.14972	0.003000	0.03518	2.342000	0.43992	0.498000	0.27948	-0.198000	0.12761	GGG	ST6GALNAC1	-	pfam_Glyco_trans_29	ENSG00000070526		0.632	ST6GALNAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST6GALNAC1	HGNC	protein_coding	OTTHUMT00000450974.1	12	0.00	0	C	NM_018414		74623249	74623249	-1	no_errors	ENST00000156626	ensembl	human	known	69_37n	missense	31	24.39	10	SNP	0.020	T
STAM2	10254	genome.wustl.edu	37	2	153000517	153000517	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr2:153000517T>A	ENST00000263904.4	-	7	877	c.528A>T	c.(526-528)ttA>ttT	p.L176F	STAM2_ENST00000465460.1_5'UTR	NM_005843.4	NP_005834.4	O75886	STAM2_HUMAN	signal transducing adaptor molecule (SH3 domain and ITAM motif) 2	176					endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(3)|large_intestine(4)|lung(8)|ovary(1)	16				BRCA - Breast invasive adenocarcinoma(221;0.22)		CTTGCAGCGATAATTCAATAG	0.274																																						dbGAP											0													97.0	93.0	94.0					2																	153000517		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF042274	CCDS2196.1	2q23.3	2009-04-29			ENSG00000115145	ENSG00000115145			11358	protein-coding gene	gene with protein product	"""HSE1 homolog (S. cerevisiae)"""	606244				10899310, 10993906	Standard	NM_005843		Approved	Hbp	uc002tyc.4	O75886	OTTHUMG00000131885	ENST00000263904.4:c.528A>T	2.37:g.153000517T>A	ENSP00000263904:p.Leu176Phe		A8K8A0|D3DPA1|Q7LDQ0|Q9UF58	Missense_Mutation	SNP	pfam_VHS,pfam_SH3_domain,pfam_SH3_2,pfam_Ubiquitin-int_motif,superfamily_ENTH_VHS,superfamily_SH3_domain,smart_VHS_subgr,smart_Ubiquitin-int_motif,smart_SH3_domain,pfscan_SH3_domain,pfscan_Ubiquitin-int_motif,pfscan_VHS,prints_SH3_domain,prints_p67phox	p.L176F	ENST00000263904.4	37	c.528	CCDS2196.1	2	.	.	.	.	.	.	.	.	.	.	T	18.51	3.640376	0.67244	.	.	ENSG00000115145	ENST00000263904	T	0.26810	1.71	5.55	1.85	0.25348	Src homology-3 domain (1);Ubiquitin interacting motif (3);	0.281001	0.35067	N	0.003480	T	0.46347	0.1388	M	0.81942	2.565	0.58432	D	0.999999	D;D	0.59357	0.984;0.985	P;D	0.66196	0.843;0.942	T	0.39461	-0.9613	10	0.51188	T	0.08	-11.6744	9.3077	0.37885	0.0:0.3743:0.0:0.6257	.	176;176	O75886-2;O75886	.;STAM2_HUMAN	F	176	ENSP00000263904:L176F	ENSP00000263904:L176F	L	-	3	2	STAM2	152708763	0.957000	0.32711	0.999000	0.59377	0.982000	0.71751	0.035000	0.13797	0.421000	0.25980	0.460000	0.39030	TTA	STAM2	-	pfam_Ubiquitin-int_motif,superfamily_SH3_domain,smart_Ubiquitin-int_motif,pfscan_Ubiquitin-int_motif	ENSG00000115145		0.274	STAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAM2	HGNC	protein_coding	OTTHUMT00000254835.2	79	0.00	0	T	NM_005843		153000517	153000517	-1	no_errors	ENST00000263904	ensembl	human	known	69_37n	missense	89	39.86	59	SNP	1.000	A
TCHH	7062	genome.wustl.edu	37	1	152081930	152081930	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr1:152081930C>T	ENST00000368804.1	-	2	3762	c.3763G>A	c.(3763-3765)Gat>Aat	p.D1255N		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1255					keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGCTGGGAATCTTCCAACTGC	0.512																																						dbGAP											0													83.0	83.0	83.0					1																	152081930		2017	4178	6195	-	-	-	SO:0001583	missense	0			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.3763G>A	1.37:g.152081930C>T	ENSP00000357794:p.Asp1255Asn		Q5VUI3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.D1255N	ENST00000368804.1	37	c.3763	CCDS41396.1	1	.	.	.	.	.	.	.	.	.	.	C	15.66	2.898268	0.52227	.	.	ENSG00000159450	ENST00000368804	T	0.16897	2.31	4.07	0.535	0.17133	.	.	.	.	.	T	0.02970	0.0088	L	0.29908	0.895	0.09310	N	1	B	0.30281	0.275	B	0.24155	0.051	T	0.40308	-0.9570	9	0.48119	T	0.1	.	1.0704	0.01620	0.1794:0.4281:0.1753:0.2172	.	1255	Q07283	TRHY_HUMAN	N	1255	ENSP00000357794:D1255N	ENSP00000357794:D1255N	D	-	1	0	TCHH	150348554	0.000000	0.05858	0.023000	0.16930	0.646000	0.38490	0.039000	0.13884	0.715000	0.32103	0.563000	0.77884	GAT	TCHH	-	NULL	ENSG00000159450		0.512	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHH	HGNC	protein_coding	OTTHUMT00000036671.2	42	0.00	0	C	NM_007113		152081930	152081930	-1	no_errors	ENST00000368804	ensembl	human	known	69_37n	missense	121	15.38	22	SNP	0.001	T
TMEM218	219854	genome.wustl.edu	37	11	124971139	124971140	+	Frame_Shift_Ins	INS	-	-	A			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr11:124971139_124971140insA	ENST00000279968.4	-	4	493_494	c.170_171insT	c.(169-171)ttcfs	p.F57fs	TMEM218_ENST00000529609.1_Frame_Shift_Ins_p.P42fs|TMEM218_ENST00000527271.1_Frame_Shift_Ins_p.F57fs|TMEM218_ENST00000526175.1_Frame_Shift_Ins_p.F57fs|TMEM218_ENST00000532156.1_Frame_Shift_Ins_p.P42fs|TMEM218_ENST00000455225.1_Frame_Shift_Ins_p.F57fs|TMEM218_ENST00000527766.1_Frame_Shift_Ins_p.F57fs|TMEM218_ENST00000531909.1_Frame_Shift_Ins_p.F57fs|TMEM218_ENST00000532407.1_Frame_Shift_Ins_p.F57fs|TMEM218_ENST00000529583.1_Frame_Shift_Ins_p.F57fs|TMEM218_ENST00000531262.1_5'UTR|TMEM218_ENST00000528724.1_Frame_Shift_Ins_p.F83fs			A2RU14	TM218_HUMAN	transmembrane protein 218	57						integral component of membrane (GO:0016021)				breast(1)|large_intestine(2)|lung(1)|prostate(1)	5						CAGCTCGCGGGAAAAGCAACAG	0.416																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS31715.1	11q24.2	2008-08-08			ENSG00000150433	ENSG00000150433			27344	protein-coding gene	gene with protein product							Standard	NM_001258238		Approved		uc031qeu.1	A2RU14		ENST00000279968.4:c.171dupT	11.37:g.124971143_124971143dupA	ENSP00000279968:p.Phe57fs		B7ZM48	Frame_Shift_Ins	INS	NULL	p.R59fs	ENST00000279968.4	37	c.171_170	CCDS31715.1	11																																																																																			TMEM218	-	NULL	ENSG00000150433		0.416	TMEM218-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	TMEM218	HGNC	protein_coding	OTTHUMT00000386849.1	35	0.00	0	-	NM_001080546		124971139	124971140	-1	no_errors	ENST00000455225	ensembl	human	known	69_37n	frame_shift_ins	60	16.67	12	INS	0.993:0.998	A
TP53	7157	genome.wustl.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000359597.4_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	GRCh37	CM062017|CM951224	TP53	M	rs28934578						50.0	50.0	50.0					17																	7578406		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R175H	ENST00000269305.4	37	c.524	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	34	0.00	0	C	NM_000546		7578406	7578406	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	14	62.50	25	SNP	1.000	T
USP28	57646	genome.wustl.edu	37	11	113704197	113704197	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr11:113704197G>A	ENST00000003302.4	-	7	772	c.704C>T	c.(703-705)cCg>cTg	p.P235L	USP28_ENST00000260188.5_Missense_Mutation_p.P235L|USP28_ENST00000545540.1_Missense_Mutation_p.P110L|USP28_ENST00000537706.1_Missense_Mutation_p.P235L|USP28_ENST00000542033.1_5'UTR	NM_020886.2	NP_065937.1	Q96RU2	UBP28_HUMAN	ubiquitin specific peptidase 28	235	USP.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|protein deubiquitination (GO:0016579)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(24)|ovary(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	59		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		GGCTGCAGACGGGTCTACAAA	0.398																																					Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)	dbGAP											0													119.0	119.0	119.0					11																	113704197		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB040948	CCDS31680.1, CCDS73394.1	11q23	2008-04-11	2005-08-08		ENSG00000048028	ENSG00000048028		"""Ubiquitin-specific peptidases"""	12625	protein-coding gene	gene with protein product		610748	"""ubiquitin specific protease 28"""			12838346, 11597335	Standard	XM_005271630		Approved	KIAA1515	uc001poh.3	Q96RU2	OTTHUMG00000168205	ENST00000003302.4:c.704C>T	11.37:g.113704197G>A	ENSP00000003302:p.Pro235Leu		B0YJC0|B0YJC1|Q9P213	Missense_Mutation	SNP	pfam_Peptidase_C19,superfamily_UBA-like,pfscan_Peptidase_C19	p.P235L	ENST00000003302.4	37	c.704	CCDS31680.1	11	.	.	.	.	.	.	.	.	.	.	G	26.5	4.741206	0.89573	.	.	ENSG00000048028	ENST00000003302;ENST00000260188;ENST00000545540;ENST00000537706;ENST00000537642	T;T;T;T;T	0.79940	1.1;1.1;1.1;-1.32;3.03	4.74	4.74	0.60224	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	D	0.92648	0.7664	H	0.94385	3.53	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;0.999	D	0.94680	0.7864	10	0.87932	D	0	-16.9505	17.9802	0.89139	0.0:0.0:1.0:0.0	.	235;110;235;235	B4E2Q2;B4E3L3;Q6NZX9;Q96RU2	.;.;.;UBP28_HUMAN	L	235;235;110;235;134	ENSP00000003302:P235L;ENSP00000260188:P235L;ENSP00000444991:P110L;ENSP00000445743:P235L;ENSP00000440799:P134L	ENSP00000003302:P235L	P	-	2	0	USP28	113209407	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	9.228000	0.95250	2.492000	0.84095	0.558000	0.71614	CCG	USP28	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000048028		0.398	USP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP28	HGNC	protein_coding	OTTHUMT00000398789.1	49	0.00	0	G			113704197	113704197	-1	no_errors	ENST00000003302	ensembl	human	known	69_37n	missense	28	54.84	34	SNP	1.000	A
ZNF44	51710	genome.wustl.edu	37	19	12384316	12384316	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr19:12384316G>A	ENST00000356109.5	-	5	1016	c.898C>T	c.(898-900)Ccg>Tcg	p.P300S	ZNF44_ENST00000355684.5_Missense_Mutation_p.P252S	NM_001164276.1	NP_001157748.1	P15621	ZNF44_HUMAN	zinc finger protein 44	300					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(1)	1		Renal(1328;0.157)		GBM - Glioblastoma multiforme(1328;0.0164)|Lung(535;0.179)		CATTCATACGGTTTCTCCCCA	0.388																																						dbGAP											0													116.0	123.0	121.0					19																	12384316		2199	4299	6498	-	-	-	SO:0001583	missense	0			X52338	CCDS45988.1, CCDS54223.1	19p13.2	2013-01-08	2006-05-11		ENSG00000197857	ENSG00000197857		"""Zinc fingers, C2H2-type"", ""-"""	13110	protein-coding gene	gene with protein product		194542	"""zinc finger protein 58"", ""zinc finger protein 44 (KOX 7)"", ""zinc finger protein 55"""	ZNF58, ZNF55		1946370, 1505991	Standard	NM_016264		Approved	KOX7, ZNF504	uc010xmj.2	P15621	OTTHUMG00000156424	ENST00000356109.5:c.898C>T	19.37:g.12384316G>A	ENSP00000348419:p.Pro300Ser		B4DML9|B9EGJ5|B9ZVM2|P17018|Q9ULZ7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P300S	ENST00000356109.5	37	c.898	CCDS54223.1	19	.	.	.	.	.	.	.	.	.	.	G	17.23	3.335546	0.60853	.	.	ENSG00000197857	ENST00000393337;ENST00000356109;ENST00000457673;ENST00000355684	T;T;T	0.16743	2.32;2.32;2.32	0.997	0.997	0.19851	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.16471	0.0396	L	0.41710	1.295	.	.	.	P;P	0.47106	0.851;0.89	P;B	0.44897	0.463;0.333	T	0.28713	-1.0035	8	0.66056	D	0.02	.	9.5314	0.39196	0.0:0.0:1.0:0.0	.	300;252	P15621;F8W7T7	ZNF44_HUMAN;.	S	300;300;252;252	ENSP00000377008:P300S;ENSP00000348419:P300S;ENSP00000347910:P252S	ENSP00000347910:P252S	P	-	1	0	ZNF44	12245316	0.997000	0.39634	0.298000	0.25002	0.819000	0.46315	3.295000	0.51794	0.862000	0.35528	0.305000	0.20034	CCG	ZNF44	-	pfscan_Znf_C2H2	ENSG00000197857		0.388	ZNF44-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	ZNF44	HGNC	protein_coding	OTTHUMT00000344132.1	72	0.00	0	G	NM_016264		12384316	12384316	-1	no_errors	ENST00000393337	ensembl	human	known	69_37n	missense	91	29.46	38	SNP	1.000	A
PRAP1	118471	genome.wustl.edu	37	10	135165568	135165568	+	Silent	SNP	G	G	T	rs371635577		TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr10:135165568G>T	ENST00000433452.2	+	4	458	c.186G>T	c.(184-186)ctG>ctT	p.L62L	PRAP1_ENST00000463201.1_3'UTR|RP11-122K13.7_ENST00000452591.1_RNA|ZNF511_ENST00000368554.4_Silent_p.L221L|PRAP1_ENST00000458230.1_Silent_p.L62L|PRAP1_ENST00000423766.1_Silent_p.L63L			Q96NZ9	PRAP1_HUMAN	proline-rich acidic protein 1	62						extracellular region (GO:0005576)				large_intestine(1)|lung(2)	3		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		all cancers(32;7.08e-06)|OV - Ovarian serous cystadenocarcinoma(35;7.88e-06)|Epithelial(32;9.48e-06)		TGGTGGTGCTGTTCCCTGTCC	0.652																																						dbGAP											0													77.0	75.0	76.0					10																	135165568		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF421885	CCDS7679.1	10q26.3	2012-10-01			ENSG00000165828	ENSG00000165828			23304	protein-coding gene	gene with protein product		609776				14583459, 20674898	Standard	NM_001145201		Approved	UPA		Q96NZ9	OTTHUMG00000019312	ENST00000433452.2:c.186G>T	10.37:g.135165568G>T			B7ZL57|B7ZL58|E9KL31|Q5VWY4|Q7Z4X5|Q8IWR3|Q8NCS2	Silent	SNP	smart_Znf_C2H2-like	p.L221	ENST00000433452.2	37	c.663	CCDS7679.1	10																																																																																			ZNF511	-	NULL	ENSG00000198546		0.652	PRAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF511	HGNC	protein_coding	OTTHUMT00000051132.1	26	0.00	0	G	NM_145202		135165568	135165568	+1	no_errors	ENST00000368554	ensembl	human	known	69_37n	silent	25	16.67	5	SNP	0.000	T
PRAP1	118471	genome.wustl.edu	37	10	135165631	135165631	+	Silent	SNP	C	C	T			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr10:135165631C>T	ENST00000433452.2	+	4	521	c.249C>T	c.(247-249)ggC>ggT	p.G83G	PRAP1_ENST00000463201.1_Intron|RP11-122K13.7_ENST00000452591.1_RNA|ZNF511_ENST00000368554.4_Silent_p.G242G|PRAP1_ENST00000458230.1_Intron|PRAP1_ENST00000423766.1_Silent_p.G84G			Q96NZ9	PRAP1_HUMAN	proline-rich acidic protein 1	83						extracellular region (GO:0005576)				large_intestine(1)|lung(2)	3		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		all cancers(32;7.08e-06)|OV - Ovarian serous cystadenocarcinoma(35;7.88e-06)|Epithelial(32;9.48e-06)		AGGGCAGGGGCCCCATCCTTC	0.602																																						dbGAP											0													71.0	71.0	71.0					10																	135165631		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF421885	CCDS7679.1	10q26.3	2012-10-01			ENSG00000165828	ENSG00000165828			23304	protein-coding gene	gene with protein product		609776				14583459, 20674898	Standard	NM_001145201		Approved	UPA		Q96NZ9	OTTHUMG00000019312	ENST00000433452.2:c.249C>T	10.37:g.135165631C>T			B7ZL57|B7ZL58|E9KL31|Q5VWY4|Q7Z4X5|Q8IWR3|Q8NCS2	Silent	SNP	smart_Znf_C2H2-like	p.G242	ENST00000433452.2	37	c.726	CCDS7679.1	10																																																																																			ZNF511	-	NULL	ENSG00000198546		0.602	PRAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF511	HGNC	protein_coding	OTTHUMT00000051132.1	23	0.00	0	C	NM_145202		135165631	135165631	+1	no_errors	ENST00000368554	ensembl	human	known	69_37n	silent	24	17.24	5	SNP	0.000	T
ZNF729	100287226	genome.wustl.edu	37	19	22497241	22497241	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr19:22497241T>C	ENST00000601693.1	+	4	1140	c.1022T>C	c.(1021-1023)aTt>aCt	p.I341T	ZNF729_ENST00000357491.6_Missense_Mutation_p.I341T			A6NN14	ZN729_HUMAN	zinc finger protein 729	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|lung(32)|ovary(3)	41						CATAAGATAATTCATACTGGA	0.368																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS59368.1	19p12	2014-02-14			ENSG00000196350	ENSG00000196350		"""Zinc fingers, C2H2-type"", ""-"""	32464	protein-coding gene	gene with protein product							Standard	NM_001242680		Approved		uc021urs.1	A6NN14	OTTHUMG00000182938	ENST00000601693.1:c.1022T>C	19.37:g.22497241T>C	ENSP00000469582:p.Ile341Thr		M0QY45	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I341T	ENST00000601693.1	37	c.1022	CCDS59368.1	19	.	.	.	.	.	.	.	.	.	.	.	4.379	0.069902	0.08436	.	.	ENSG00000196350	ENST00000357491	T	0.00801	5.68	0.428	-0.855	0.10700	.	.	.	.	.	T	0.00468	0.0015	N	0.02345	-0.59	.	.	.	.	.	.	.	.	.	T	0.45600	-0.9250	6	0.54805	T	0.06	.	1.7754	0.03020	0.2812:0.228:0.0:0.4908	.	.	.	.	T	341	ENSP00000350085:I341T	ENSP00000350085:I341T	I	+	2	0	ZNF729	22289081	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-1.341000	0.02647	-0.618000	0.05656	-0.687000	0.03738	ATT	ZNF729	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196350		0.368	ZNF729-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF729	HGNC	protein_coding	OTTHUMT00000464396.1	18	0.00	0	T	XM_496301		22497241	22497241	+1	no_stop_codon	ENST00000357491	ensembl	human	known	69_37n	missense	7	41.67	5	SNP	0.022	C
ZNF552	79818	genome.wustl.edu	37	19	58319711	58319711	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr19:58319711G>T	ENST00000391701.1	-	3	1090	c.921C>A	c.(919-921)caC>caA	p.H307Q	ZNF586_ENST00000599802.1_Intron|ZNF586_ENST00000598885.1_Intron	NM_024762.3	NP_079038.2	Q9H707	ZN552_HUMAN	zinc finger protein 552	307					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		GGTGGTACTTGTGCCTAAAAA	0.438																																						dbGAP											0													85.0	76.0	79.0					19																	58319711		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097041	CCDS12963.1	19q13.43	2013-09-20			ENSG00000178935	ENSG00000178935		"""Zinc fingers, C2H2-type"", ""-"""	26135	protein-coding gene	gene with protein product							Standard	XM_005259267		Approved	FLJ21603	uc002qqg.3	Q9H707	OTTHUMG00000183478	ENST00000391701.1:c.921C>A	19.37:g.58319711G>T	ENSP00000375582:p.His307Gln		B3KUE9|Q6P5A6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H307Q	ENST00000391701.1	37	c.921	CCDS12963.1	19	.	.	.	.	.	.	.	.	.	.	G	0.053	-1.243140	0.01481	.	.	ENSG00000178935	ENST00000391701	T	0.07444	3.19	1.74	-3.49	0.04724	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01940	0.0061	N	0.02802	-0.49	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.09377	0.002;0.004	T	0.43327	-0.9398	9	0.02654	T	1	.	0.1576	0.00100	0.3415:0.1966:0.2409:0.221	.	303;307	B7Z1H1;Q9H707	.;ZN552_HUMAN	Q	307	ENSP00000375582:H307Q	ENSP00000375582:H307Q	H	-	3	2	ZNF552	63011523	0.000000	0.05858	0.000000	0.03702	0.581000	0.36288	-12.416000	0.00002	-0.456000	0.07043	0.205000	0.17691	CAC	ZNF552	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000178935		0.438	ZNF552-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF552	HGNC	protein_coding	OTTHUMT00000466829.1	71	0.00	0	G	NM_024762		58319711	58319711	-1	no_errors	ENST00000391701	ensembl	human	known	69_37n	missense	57	19.72	14	SNP	0.000	T
ZP2	7783	genome.wustl.edu	37	16	21221500	21221500	+	Silent	SNP	G	G	A	rs200172756		TCGA-E9-A244-01A-11D-A167-09	TCGA-E9-A244-10A-01D-A167-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9edf63e8-ae94-4b2f-8521-b56dadc21cd5	c067e16d-40af-44b1-bb55-b8c71ed021d3	g.chr16:21221500G>A	ENST00000574002.1	-	4	647	c.165C>T	c.(163-165)tgC>tgT	p.C55C	ZP2_ENST00000574091.1_Silent_p.C55C|ZP2_ENST00000219593.4_Silent_p.C55C			Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 (sperm receptor)	55					binding of sperm to zona pellucida (GO:0007339)|intracellular protein transport (GO:0006886)|multicellular organism reproduction (GO:0032504)|prevention of polyspermy (GO:0060468)|signal transduction (GO:0007165)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|coreceptor activity (GO:0015026)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(16)|ovary(1)|prostate(1)|stomach(1)	41				GBM - Glioblastoma multiforme(48;0.0573)		CCCTTTCATCGCAAGTGACAG	0.483																																						dbGAP											0													187.0	134.0	152.0					16																	21221500		2199	4300	6499	-	-	-	SO:0001819	synonymous_variant	0			M90366	CCDS10596.1, CCDS73843.1	16p12	2014-07-04			ENSG00000103310	ENSG00000103310		"""Zona pellucida glycoproteins"""	13188	protein-coding gene	gene with protein product		182888				8385033	Standard	XM_005255562		Approved	ZPA	uc002dii.2	Q05996	OTTHUMG00000090681	ENST00000574002.1:c.165C>T	16.37:g.21221500G>A			B2R7J2|Q4VAN9|Q4VAP0|Q4VAP1	Silent	SNP	pfam_Zona_pellucida_Endoglin/CD105,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.C55	ENST00000574002.1	37	c.165	CCDS10596.1	16																																																																																			ZP2	-	NULL	ENSG00000103310		0.483	ZP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZP2	HGNC	protein_coding	OTTHUMT00000207365.2	39	0.00	0	G			21221500	21221500	-1	no_errors	ENST00000219593	ensembl	human	known	69_37n	silent	68	19.05	16	SNP	0.573	A
