#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AAGAB	79719	genome.wustl.edu	37	15	67496430	67496430	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr15:67496430C>G	ENST00000261880.5	-	8	876	c.772G>C	c.(772-774)Gat>Cat	p.D258H	AAGAB_ENST00000538028.1_5'UTR|AAGAB_ENST00000561452.1_Missense_Mutation_p.D149H|AAGAB_ENST00000542650.1_Missense_Mutation_p.D149H	NM_001271885.1|NM_001271886.1|NM_024666.3	NP_001258814.1|NP_001258815.1|NP_078942.3	Q6PD74	AAGAB_HUMAN	alpha- and gamma-adaptin binding protein	258					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9						TTCTCCACATCTCCTCCTCCA	0.363																																						dbGAP											0													133.0	122.0	126.0					15																	67496430		1865	4117	5982	-	-	-	SO:0001583	missense	0			AL136715	CCDS42050.1, CCDS61679.1	15q22.33-q23	2014-02-12	2009-07-20		ENSG00000103591	ENSG00000103591			25662	protein-coding gene	gene with protein product		614888				11230166, 10477754	Standard	NM_024666		Approved	FLJ11506, p34	uc002aqk.5	Q6PD74	OTTHUMG00000172246	ENST00000261880.5:c.772G>C	15.37:g.67496430C>G	ENSP00000261880:p.Asp258His		B4DG44|Q6FI86|Q7Z5X9|Q9H0P1|Q9HAK0	Missense_Mutation	SNP	pfam_Alpha/Gamma-adaptin-bd_p34	p.D258H	ENST00000261880.5	37	c.772	CCDS42050.1	15	.	.	.	.	.	.	.	.	.	.	C	21.2	4.116392	0.77323	.	.	ENSG00000103591	ENST00000261880;ENST00000538028;ENST00000542650	T;T	0.55930	0.49;0.57	5.44	4.52	0.55395	.	0.000000	0.85682	D	0.000000	T	0.66982	0.2845	M	0.65498	2.005	0.80722	D	1	D	0.71674	0.998	D	0.66847	0.947	T	0.68481	-0.5397	10	0.56958	D	0.05	-15.5888	11.8887	0.52616	0.0:0.9154:0.0:0.0846	.	258	Q6PD74	AAGAB_HUMAN	H	258;18;149	ENSP00000261880:D258H;ENSP00000440735:D149H	ENSP00000261880:D258H	D	-	1	0	AAGAB	65283484	1.000000	0.71417	0.997000	0.53966	0.978000	0.69477	4.730000	0.62015	2.562000	0.86427	0.491000	0.48974	GAT	AAGAB	-	pfam_Alpha/Gamma-adaptin-bd_p34	ENSG00000103591		0.363	AAGAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AAGAB	HGNC	protein_coding	OTTHUMT00000417472.1	50	0.00	0	C	NM_024666		67496430	67496430	-1	no_errors	ENST00000261880	ensembl	human	known	69_37n	missense	29	32.56	14	SNP	1.000	G
AFAP1L2	84632	genome.wustl.edu	37	10	116068228	116068228	+	Missense_Mutation	SNP	C	C	A	rs185736692	byFrequency	TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr10:116068228C>A	ENST00000304129.4	-	9	960	c.931G>T	c.(931-933)Gtg>Ttg	p.V311L	AFAP1L2_ENST00000545353.1_Missense_Mutation_p.V364L|AFAP1L2_ENST00000369271.3_Missense_Mutation_p.V311L			Q8N4X5	AF1L2_HUMAN	actin filament associated protein 1-like 2	311					inflammatory response (GO:0006954)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of interleukin-6 production (GO:0032675)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)	protein tyrosine kinase activator activity (GO:0030296)|SH2 domain binding (GO:0042169)|SH3 domain binding (GO:0017124)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|prostate(2)	21		Colorectal(252;0.175)|Breast(234;0.231)		Epithelial(162;0.0219)|all cancers(201;0.0561)		TGGCCATCCACGGAGCTCCCA	0.542																																						dbGAP											0													129.0	120.0	123.0					10																	116068228		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC024314	CCDS31286.1, CCDS31287.1	10q26.11	2013-01-10	2007-02-07	2007-02-07	ENSG00000169129	ENSG00000169129		"""Pleckstrin homology (PH) domain containing"""	25901	protein-coding gene	gene with protein product		612420	"""KIAA1914"""	KIAA1914		11572484, 17412687	Standard	XM_005270239		Approved	FLJ14564, Em:AC005383.4, XB130	uc001lbn.3	Q8N4X5	OTTHUMG00000019086	ENST00000304129.4:c.931G>T	10.37:g.116068228C>A	ENSP00000303042:p.Val311Leu		A8K6P7|B3KVQ8|Q2UZW3|Q8TB54|Q96PX4|Q96SY5	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.V364L	ENST00000304129.4	37	c.1090	CCDS31286.1	10	.	.	.	.	.	.	.	.	.	.	C	0.173	-1.069878	0.01918	.	.	ENSG00000169129	ENST00000369271;ENST00000304129;ENST00000392974;ENST00000545353	T;T;T	0.13538	2.59;2.59;2.58	5.82	-11.6	0.00059	.	1.519580	0.03310	N	0.190405	T	0.09642	0.0237	L	0.34521	1.04	0.09310	N	1	B;B;B;B;B	0.17667	0.004;0.002;0.023;0.017;0.01	B;B;B;B;B	0.15052	0.007;0.003;0.009;0.012;0.005	T	0.09228	-1.0684	10	0.25751	T	0.34	1.0441	13.4967	0.61430	0.0834:0.5922:0.0:0.3243	.	364;365;339;311;311	F5GZE1;B7Z2Q0;Q8N4X5-4;Q8N4X5-2;Q8N4X5	.;.;.;.;AF1L2_HUMAN	L	311;311;338;364	ENSP00000358276:V311L;ENSP00000303042:V311L;ENSP00000444511:V364L	ENSP00000303042:V311L	V	-	1	0	AFAP1L2	116058218	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.818000	0.04467	-2.378000	0.00596	-1.767000	0.00664	GTG	AFAP1L2	-	NULL	ENSG00000169129		0.542	AFAP1L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFAP1L2	HGNC	protein_coding	OTTHUMT00000050462.1	57	0.00	0	C	NM_032550		116068228	116068228	-1	no_errors	ENST00000545353	ensembl	human	known	69_37n	missense	38	60.00	57	SNP	0.000	A
AMOTL1	154810	genome.wustl.edu	37	11	94603937	94603937	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr11:94603937G>C	ENST00000433060.2	+	13	2989	c.2848G>C	c.(2848-2850)Gag>Cag	p.E950Q	AMOTL1_ENST00000317837.9_Missense_Mutation_p.E537Q|AMOTL1_ENST00000317829.8_Missense_Mutation_p.E900Q	NM_130847.2	NP_570899.1	Q8IY63	AMOL1_HUMAN	angiomotin like 1	950					establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|hippo signaling (GO:0035329)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|tight junction (GO:0005923)	identical protein binding (GO:0042802)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	36		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				CCCTGATGGAGAGATGATGGA	0.522																																						dbGAP											0													34.0	36.0	35.0					11																	94603937		1948	4139	6087	-	-	-	SO:0001583	missense	0			AF453742	CCDS44712.1, CCDS73368.1	11q21	2008-07-18				ENSG00000166025			17811	protein-coding gene	gene with protein product	"""junction-enriched and associated protein"""	614657				11733531	Standard	XM_005273798		Approved	JEAP	uc001pfb.3	Q8IY63		ENST00000433060.2:c.2848G>C	11.37:g.94603937G>C	ENSP00000387739:p.Glu950Gln		Q63HK7|Q8NDN0|Q8TEN8|Q8WXD1|Q96CM5	Missense_Mutation	SNP	pfam_Angiomotin_C,prints_Angiomotin	p.E950Q	ENST00000433060.2	37	c.2848	CCDS44712.1	11	.	.	.	.	.	.	.	.	.	.	G	22.8	4.333883	0.81801	.	.	ENSG00000166025	ENST00000317829;ENST00000317837;ENST00000433060	T;T;T	0.52526	2.06;0.66;2.05	5.56	5.56	0.83823	.	0.153760	0.44688	D	0.000424	T	0.53899	0.1825	L	0.47716	1.5	0.28810	N	0.898306	P;P	0.50443	0.906;0.935	P;P	0.49192	0.602;0.494	T	0.55134	-0.8188	10	0.72032	D	0.01	-35.297	19.5336	0.95240	0.0:0.0:1.0:0.0	.	900;950	Q8IY63-2;Q8IY63	.;AMOL1_HUMAN	Q	900;537;950	ENSP00000320968:E900Q;ENSP00000323474:E537Q;ENSP00000387739:E950Q	ENSP00000320968:E900Q	E	+	1	0	AMOTL1	94243585	1.000000	0.71417	0.962000	0.40283	0.578000	0.36192	7.034000	0.76511	2.631000	0.89168	0.462000	0.41574	GAG	AMOTL1	-	NULL	ENSG00000166025		0.522	AMOTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMOTL1	HGNC	protein_coding	OTTHUMT00000396474.3	21	0.00	0	G	NM_130847		94603937	94603937	+1	no_errors	ENST00000433060	ensembl	human	known	69_37n	missense	16	40.74	11	SNP	0.999	C
ANKRD36C	400986	genome.wustl.edu	37	2	96542220	96542220	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr2:96542220C>G	ENST00000456556.1	-	59	3591	c.3507G>C	c.(3505-3507)aaG>aaC	p.K1169N	ANKRD36C_ENST00000419039.2_Missense_Mutation_p.K196N|ANKRD36C_ENST00000295246.5_Missense_Mutation_p.K590N|ANKRD36C_ENST00000420871.2_Missense_Mutation_p.K420N			Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C	1169							ion channel inhibitor activity (GO:0008200)			breast(1)|endometrium(8)|kidney(5)|lung(4)	18						CTTCAAGCCTCTTTTGCTCTC	0.308																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.3507G>C	2.37:g.96542220C>G	ENSP00000403302:p.Lys1169Asn		C9JZ08|Q15694|Q53S06|Q658V2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.K1169N	ENST00000456556.1	37	c.3507		2	.	.	.	.	.	.	.	.	.	.	c	11.37	1.617407	0.28801	.	.	ENSG00000174501	ENST00000420871;ENST00000456556;ENST00000419039;ENST00000295246	T;T;T;T	0.36157	3.94;1.27;3.92;2.0	1.3	0.0673	0.14365	.	.	.	.	.	T	0.40015	0.1100	L	0.36672	1.1	0.09310	N	1	P	0.51933	0.949	D	0.63033	0.91	T	0.22591	-1.0212	9	0.87932	D	0	.	3.0043	0.06024	0.0:0.3266:0.0:0.6734	.	1169	Q5JPF3	AN36C_HUMAN	N	420;1169;196;590	ENSP00000415231:K420N;ENSP00000403302:K1169N;ENSP00000407838:K196N;ENSP00000295246:K590N	ENSP00000295246:K590N	K	-	3	2	AC073995.2	95905947	0.449000	0.25689	0.143000	0.22291	0.518000	0.34316	0.114000	0.15520	-0.002000	0.14469	0.313000	0.20887	AAG	ANKRD36C	-	NULL	ENSG00000174501		0.308	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ANKRD36C	HGNC	protein_coding	OTTHUMT00000338799.2	73	0.00	0	C	NM_001010914		96542220	96542220	-1	no_errors	ENST00000456556	ensembl	human	known	69_37n	missense	74	19.57	18	SNP	0.201	G
ARMC4	55130	genome.wustl.edu	37	10	28250550	28250550	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr10:28250550C>A	ENST00000305242.5	-	10	1425	c.1333G>T	c.(1333-1335)Gca>Tca	p.A445S	ARMC4_ENST00000545014.1_5'UTR|ARMC4_ENST00000537576.1_Missense_Mutation_p.A137S|ARMC4_ENST00000480504.1_5'UTR|ARMC4_ENST00000239715.3_Missense_Mutation_p.A302S	NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	445					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						GGCAAATCTGCACTTGCTTCC	0.388																																						dbGAP											0													66.0	65.0	65.0					10																	28250550		2203	4297	6500	-	-	-	SO:0001583	missense	0			AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.1333G>T	10.37:g.28250550C>A	ENSP00000306410:p.Ala445Ser		A8K906|B7Z7I1|Q9H0C0	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,superfamily_GSKIP/TIF31_domain,smart_Armadillo,pfscan_Armadillo	p.A445S	ENST00000305242.5	37	c.1333	CCDS7157.1	10	.	.	.	.	.	.	.	.	.	.	C	14.29	2.491149	0.44249	.	.	ENSG00000169126	ENST00000537576;ENST00000305242;ENST00000537573;ENST00000434029;ENST00000239715	T;T;T;T	0.46819	1.1;1.53;0.86;0.88	5.4	4.27	0.50696	Armadillo-like helical (1);Armadillo-type fold (1);	0.334105	0.33419	N	0.004930	T	0.36468	0.0968	L	0.49350	1.555	0.35523	D	0.80161	B	0.17268	0.021	B	0.21708	0.036	T	0.39292	-0.9621	10	0.26408	T	0.33	-13.8082	4.8242	0.13408	0.0:0.7153:0.0:0.2847	.	445	Q5T2S8	ARMC4_HUMAN	S	137;445;137;339;302	ENSP00000443208:A137S;ENSP00000306410:A445S;ENSP00000398155:A339S;ENSP00000239715:A302S	ENSP00000239715:A302S	A	-	1	0	ARMC4	28290556	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.129000	0.57957	2.677000	0.91161	0.650000	0.86243	GCA	ARMC4	-	superfamily_ARM-type_fold	ENSG00000169126		0.388	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC4	HGNC	protein_coding	OTTHUMT00000047339.1	43	0.00	0	C	NM_018076		28250550	28250550	-1	no_errors	ENST00000305242	ensembl	human	known	69_37n	missense	35	39.66	23	SNP	1.000	A
ARPP21	10777	genome.wustl.edu	37	3	35724361	35724361	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr3:35724361C>T	ENST00000187397.4	+	4	607	c.151C>T	c.(151-153)Caa>Taa	p.Q51*	ARPP21_ENST00000412048.1_Nonsense_Mutation_p.Q51*|ARPP21_ENST00000432682.1_Nonsense_Mutation_p.Q51*|ARPP21_ENST00000417925.1_Nonsense_Mutation_p.Q51*|ARPP21_ENST00000458225.1_Nonsense_Mutation_p.Q51*|ARPP21_ENST00000427542.1_Nonsense_Mutation_p.Q51*|ARPP21_ENST00000337271.5_Nonsense_Mutation_p.Q51*|ARPP21_ENST00000441454.1_Nonsense_Mutation_p.Q51*|ARPP21_ENST00000438071.1_Nonsense_Mutation_p.Q51*|ARPP21_ENST00000444190.1_Nonsense_Mutation_p.Q51*|ARPP21_ENST00000396481.2_Nonsense_Mutation_p.Q51*|ARPP21_ENST00000428373.1_Nonsense_Mutation_p.Q51*|ARPP21_ENST00000474696.1_Nonsense_Mutation_p.Q51*|ARPP21_ENST00000436702.1_Nonsense_Mutation_p.Q51*|ARPP21_ENST00000396482.2_Nonsense_Mutation_p.Q51*	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	51					cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						GGCTCAGAATCAAGAAAGAAG	0.343																																						dbGAP											0													83.0	93.0	90.0					3																	35724361		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.151C>T	3.37:g.35724361C>T	ENSP00000187397:p.Gln51*		B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Nonsense_Mutation	SNP	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	p.Q51*	ENST00000187397.4	37	c.151	CCDS2661.1	3	.	.	.	.	.	.	.	.	.	.	C	36	5.850846	0.97023	.	.	ENSG00000172995	ENST00000450234;ENST00000428373;ENST00000458225;ENST00000337271;ENST00000444190;ENST00000449196;ENST00000187397;ENST00000452563;ENST00000438577;ENST00000427542;ENST00000474696;ENST00000412048;ENST00000396482;ENST00000432682;ENST00000432450;ENST00000413378;ENST00000417925;ENST00000396481;ENST00000441454;ENST00000436702;ENST00000438071	.	.	.	6.02	6.02	0.97574	.	0.210044	0.41605	D	0.000852	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-11.9692	16.0408	0.80680	0.0:1.0:0.0:0.0	.	.	.	.	X	51	.	ENSP00000187397:Q51X	Q	+	1	0	ARPP21	35699365	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.291000	0.59025	2.865000	0.98341	0.655000	0.94253	CAA	ARPP21	-	NULL	ENSG00000172995		0.343	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPP21	HGNC	protein_coding	OTTHUMT00000253334.2	48	0.00	0	C	NM_198399		35724361	35724361	+1	no_errors	ENST00000417925	ensembl	human	known	69_37n	nonsense	33	35.29	18	SNP	1.000	T
C3orf52	79669	genome.wustl.edu	37	3	111835691	111835691	+	3'UTR	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr3:111835691C>T	ENST00000264848.5	+	0	911				C3orf52_ENST00000430855.1_Intron|C3orf52_ENST00000467942.2_3'UTR|C3orf52_ENST00000431717.2_Missense_Mutation_p.S200L	NM_024616.2	NP_078892	Q5BVD1	TTMP_HUMAN	chromosome 3 open reading frame 52							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4						AGCACTGCTTCAGCTGGGTCC	0.552																																						dbGAP											0													48.0	51.0	50.0					3																	111835691		692	1591	2283	-	-	-	SO:0001624	3_prime_UTR_variant	0			AY830714	CCDS46887.1, CCDS54620.1	3q13.2	2006-01-30			ENSG00000114529	ENSG00000114529			26255	protein-coding gene	gene with protein product	"""TPA induced trans-membrane protein"""	611956				15737651	Standard	NM_024616		Approved	FLJ23186, TTMP	uc011bhs.2	Q5BVD1	OTTHUMG00000159230	ENST00000264848.5:c.*198C>T	3.37:g.111835691C>T			B4DNV2|B4E0Z2|Q96AJ4|Q9H5Q1	Missense_Mutation	SNP	NULL	p.S200L	ENST00000264848.5	37	c.599	CCDS46887.1	3	.	.	.	.	.	.	.	.	.	.	C	8.126	0.781968	0.16189	.	.	ENSG00000114529	ENST00000431717	T	0.36878	1.23	4.0	1.24	0.21308	.	.	.	.	.	T	0.16642	0.0400	N	0.08118	0	0.09310	N	1	B	0.16603	0.018	B	0.14023	0.01	T	0.21211	-1.0252	9	0.87932	D	0	-15.3868	2.7051	0.05160	0.1888:0.525:0.1828:0.1033	.	200	Q5BVD1-3	.	L	200	ENSP00000399392:S200L	ENSP00000399392:S200L	S	+	2	0	C3orf52	113318381	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.074000	0.11450	0.266000	0.21894	0.591000	0.81541	TCA	C3orf52	-	NULL	ENSG00000114529		0.552	C3orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf52	HGNC	protein_coding	OTTHUMT00000353961.1	36	0.00	0	C	NM_024616		111835691	111835691	+1	no_errors	ENST00000431717	ensembl	human	known	69_37n	missense	27	27.03	10	SNP	0.000	T
PRIMPOL	201973	genome.wustl.edu	37	4	185612860	185612860	+	Silent	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr4:185612860C>T	ENST00000314970.6	+	13	1852	c.1419C>T	c.(1417-1419)ttC>ttT	p.F473F	PRIMPOL_ENST00000515774.1_Silent_p.F344F|PRIMPOL_ENST00000512834.1_Silent_p.F472F|PRIMPOL_ENST00000503752.1_Silent_p.F473F	NM_152683.2	NP_689896	Q96LW4	PRIPO_HUMAN	primase and polymerase (DNA-directed)	473					mitochondrial DNA replication (GO:0006264)|replication fork processing (GO:0031297)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)	mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA primase activity (GO:0003896)|DNA-directed DNA polymerase activity (GO:0003887)|manganese ion binding (GO:0030145)										TGTTTCTTTTCAAAGAGGTAA	0.358																																						dbGAP											0													155.0	153.0	154.0					4																	185612860		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AK057729	CCDS3837.1, CCDS75211.1, CCDS75212.1	4q35.1	2013-09-27	2013-09-27	2013-09-27	ENSG00000164306	ENSG00000164306			26575	protein-coding gene	gene with protein product		615421	"""coiled-coil domain containing 111"""	CCDC111		12477932	Standard	XM_005262814		Approved	FLJ33167	uc003iwk.2	Q96LW4	OTTHUMG00000160495	ENST00000314970.6:c.1419C>T	4.37:g.185612860C>T			D3DP55|D6RDM1|Q5HYJ9	Silent	SNP	pfam_DNA_primase_UL52/UL70_Herpvir,pfam_DNA_primase_S	p.F473	ENST00000314970.6	37	c.1419	CCDS3837.1	4																																																																																			CCDC111	-	NULL	ENSG00000164306		0.358	PRIMPOL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC111	HGNC	protein_coding	OTTHUMT00000360827.1	79	0.00	0	C	NM_152683		185612860	185612860	+1	no_errors	ENST00000314970	ensembl	human	known	69_37n	silent	72	21.74	20	SNP	1.000	T
CCT3	7203	genome.wustl.edu	37	1	156280435	156280435	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr1:156280435C>T	ENST00000295688.3	-	13	1727	c.1447G>A	c.(1447-1449)Gag>Aag	p.E483K	CCT3_ENST00000368261.3_Missense_Mutation_p.E438K|CCT3_ENST00000472765.2_Missense_Mutation_p.E438K|CCT3_ENST00000368259.2_Missense_Mutation_p.E445K	NM_005998.4	NP_005989.3	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 (gamma)	483					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					GTACCCGTCTCACCATTTACA	0.483																																						dbGAP											0													118.0	102.0	107.0					1																	156280435		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008019	CCDS1140.2, CCDS30888.1	1q23	2011-09-02			ENSG00000163468	ENSG00000163468		"""Heat Shock Proteins / Chaperonins"""	1616	protein-coding gene	gene with protein product		600114		TRIC5		8110840	Standard	NM_005998		Approved	Cctg	uc001fol.2	P49368	OTTHUMG00000024061	ENST00000295688.3:c.1447G>A	1.37:g.156280435C>T	ENSP00000295688:p.Glu483Lys		A6NE14|Q5SZY1|Q9BR64	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_gamma	p.E483K	ENST00000295688.3	37	c.1447	CCDS1140.2	1	.	.	.	.	.	.	.	.	.	.	c	14.41	2.526838	0.44969	.	.	ENSG00000163468	ENST00000295688;ENST00000368259;ENST00000368261;ENST00000472765	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.1	5.1	0.69264	.	0.174298	0.49305	N	0.000157	T	0.55305	0.1912	L	0.31065	0.9	0.41774	D	0.98978	B;B;B	0.21520	0.002;0.057;0.006	B;B;B	0.25884	0.005;0.064;0.017	T	0.53947	-0.8366	10	0.29301	T	0.29	-13.5477	13.9148	0.63890	0.0:1.0:0.0:0.0	.	445;482;483	P49368-2;E9PAQ6;P49368	.;.;TCPG_HUMAN	K	483;445;438;438	ENSP00000295688:E483K;ENSP00000357242:E445K;ENSP00000357244:E438K;ENSP00000431543:E438K	ENSP00000295688:E483K	E	-	1	0	CCT3	154547059	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	5.496000	0.66918	2.653000	0.90120	0.552000	0.68991	GAG	CCT3	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,tigrfam_Chap_CCT_gamma	ENSG00000163468		0.483	CCT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT3	HGNC	protein_coding	OTTHUMT00000060602.3	37	0.00	0	C	NM_005998		156280435	156280435	-1	no_errors	ENST00000295688	ensembl	human	known	69_37n	missense	67	12.99	10	SNP	1.000	T
CECR2	27443	genome.wustl.edu	37	22	17983944	17983944	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr22:17983944G>A	ENST00000400585.2	+	7	715	c.277G>A	c.(277-279)Gtc>Atc	p.V93I	CECR2_ENST00000342247.5_Missense_Mutation_p.V214I|CECR2_ENST00000400573.5_Missense_Mutation_p.V234I|CECR2_ENST00000262608.8_Missense_Mutation_p.V215I			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	256					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		ATGGAGACAGGTCACCGAGAG	0.542																																						dbGAP											0													96.0	103.0	101.0					22																	17983944		1959	4135	6094	-	-	-	SO:0001583	missense	0			AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.277G>A	22.37:g.17983944G>A	ENSP00000383428:p.Val93Ile		A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.V234I	ENST00000400585.2	37	c.700		22	.	.	.	.	.	.	.	.	.	.	G	22.5	4.295286	0.81025	.	.	ENSG00000099954	ENST00000342247;ENST00000400585;ENST00000400573;ENST00000262608	T;T;T;T	0.51325	0.71;0.71;0.71;0.71	5.35	5.35	0.76521	.	0.000000	0.48286	D	0.000194	T	0.68540	0.3012	M	0.65498	2.005	0.37723	D	0.924986	D;D;P;D	0.64830	0.994;0.99;0.942;0.99	D;P;P;P	0.72625	0.978;0.86;0.543;0.69	T	0.72620	-0.4238	10	0.59425	D	0.04	-14.7589	19.4213	0.94723	0.0:0.0:1.0:0.0	.	256;93;256;234	Q9BXF3;B7WPH3;Q9BXF3-2;E2QRE6	CECR2_HUMAN;.;.;.	I	214;93;234;215	ENSP00000341219:V214I;ENSP00000383428:V93I;ENSP00000383417:V234I;ENSP00000262608:V215I	ENSP00000262608:V215I	V	+	1	0	CECR2	16363944	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	5.424000	0.66464	2.664000	0.90586	0.655000	0.94253	GTC	CECR2	-	NULL	ENSG00000099954		0.542	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	CECR2	HGNC	protein_coding	OTTHUMT00000316226.2	32	0.00	0	G	NM_031413		17983944	17983944	+1	no_errors	ENST00000400573	ensembl	human	novel	69_37n	missense	30	14.29	5	SNP	1.000	A
CEMP1	752014	genome.wustl.edu	37	16	2580796	2580796	+	Silent	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr16:2580796C>T	ENST00000567119.1	-	1	613	c.279G>A	c.(277-279)ctG>ctA	p.L93L	CEMP1_ENST00000565480.1_Intron|CEMP1_ENST00000382350.1_Silent_p.L93L|AMDHD2_ENST00000413459.3_3'UTR|MIR3178_ENST00000581887.1_RNA|AMDHD2_ENST00000565570.1_3'UTR|AMDHD2_ENST00000302956.4_3'UTR	NM_001048212.3	NP_001041677.1	Q6PRD7	CEMP1_HUMAN	cementum protein 1	93						cytoplasm (GO:0005737)				lung(1)|skin(1)	2						GGGTTGATCTCAGCCCACAAG	0.657																																						dbGAP											0													34.0	41.0	39.0					16																	2580796		2016	4158	6174	-	-	-	SO:0001819	synonymous_variant	0			AY584596	CCDS42108.1	16p13.3	2006-09-22							32553	protein-coding gene	gene with protein product	"""cementum protein-23"""	611113				16263347	Standard	NM_001048212		Approved	CP-23	uc002cqr.3	Q6PRD7		ENST00000567119.1:c.279G>A	16.37:g.2580796C>T			B2RUY1	Silent	SNP	NULL	p.L93	ENST00000567119.1	37	c.279	CCDS42108.1	16																																																																																			CEMP1	-	NULL	ENSG00000205923		0.657	CEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEMP1	HGNC	protein_coding	OTTHUMT00000435686.1	23	0.00	0	C	NM_001048212		2580796	2580796	-1	no_errors	ENST00000382350	ensembl	human	known	69_37n	silent	25	19.35	6	SNP	0.000	T
CENPC	1060	genome.wustl.edu	37	4	68355813	68355813	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr4:68355813G>A	ENST00000273853.6	-	17	2792	c.2542C>T	c.(2542-2544)Caa>Taa	p.Q848*		NM_001812.2	NP_001803.2	Q03188	CENPC_HUMAN	centromere protein C	848					chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	centromeric DNA binding (GO:0019237)|DNA binding (GO:0003677)										ACAAAAAATTGATATGTATCT	0.313																																						dbGAP											0													82.0	72.0	75.0					4																	68355813		1825	4076	5901	-	-	-	SO:0001587	stop_gained	0			M95724	CCDS47063.1	4q13.2	2013-11-05	2013-07-03	2013-07-03	ENSG00000145241	ENSG00000145241			1854	protein-coding gene	gene with protein product		117141	"""centromere protein C 1"""	CENPC1		7959789	Standard	XR_245245		Approved	CENP-C, hcp-4, MIF2	uc003hdd.1	Q03188	OTTHUMG00000160735	ENST00000273853.6:c.2542C>T	4.37:g.68355813G>A	ENSP00000273853:p.Gln848*		Q8IW27|Q9P0M5	Nonsense_Mutation	SNP	pfam_Mif2/CENP-C_cupin,pfam_Cupin_2,superfamily_RmlC_Cupin	p.Q848*	ENST00000273853.6	37	c.2542	CCDS47063.1	4	.	.	.	.	.	.	.	.	.	.	G	40	7.957104	0.98580	.	.	ENSG00000145241	ENST00000273853	.	.	.	5.31	1.33	0.21861	.	0.774989	0.11669	N	0.541064	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	-2.6922	7.3789	0.26843	0.0:0.3028:0.386:0.3112	.	.	.	.	X	848	.	ENSP00000273853:Q848X	Q	-	1	0	CENPC1	68038408	0.006000	0.16342	0.122000	0.21767	0.794000	0.44872	0.278000	0.18753	0.696000	0.31696	0.561000	0.74099	CAA	CENPC1	-	superfamily_RmlC_Cupin	ENSG00000145241		0.313	CENPC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPC1	HGNC	protein_coding	OTTHUMT00000362001.2	34	0.00	0	G			68355813	68355813	-1	no_errors	ENST00000273853	ensembl	human	known	69_37n	nonsense	32	21.95	9	SNP	0.026	A
COL5A3	50509	genome.wustl.edu	37	19	10106254	10106254	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr19:10106254G>C	ENST00000264828.3	-	16	1658	c.1573C>G	c.(1573-1575)Cga>Gga	p.R525G	CTD-2553C6.1_ENST00000592332.1_RNA	NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	525	Collagen-like 2.|Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			TTGCCCACTCGGCCAGGGGGT	0.537																																						dbGAP											0													65.0	55.0	58.0					19																	10106254		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.1573C>G	19.37:g.10106254G>C	ENSP00000264828:p.Arg525Gly		Q9NZQ6	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_Fib_collagen_C	p.R525G	ENST00000264828.3	37	c.1573	CCDS12222.1	19	.	.	.	.	.	.	.	.	.	.	G	12.97	2.097642	0.37048	.	.	ENSG00000080573	ENST00000264828	D	0.93133	-3.17	5.06	-0.808	0.10868	.	0.289408	0.26955	N	0.021645	D	0.90202	0.6937	L	0.39397	1.21	0.19775	N	0.999959	P	0.48503	0.911	P	0.48063	0.565	D	0.84572	0.0656	10	0.45353	T	0.12	.	12.2006	0.54323	0.0:0.0:0.2947:0.7053	.	525	P25940	CO5A3_HUMAN	G	525	ENSP00000264828:R525G	ENSP00000264828:R525G	R	-	1	2	COL5A3	9967254	0.374000	0.25081	0.538000	0.28064	0.855000	0.48748	1.255000	0.32909	0.182000	0.20032	0.655000	0.94253	CGA	COL5A3	-	pfam_Collagen	ENSG00000080573		0.537	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A3	HGNC	protein_coding	OTTHUMT00000315788.1	31	0.00	0	G	NM_015719		10106254	10106254	-1	no_errors	ENST00000264828	ensembl	human	known	69_37n	missense	23	28.12	9	SNP	0.521	C
CPT1C	126129	genome.wustl.edu	37	19	50216736	50216736	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr19:50216736C>G	ENST00000392518.4	+	20	2658	c.2286C>G	c.(2284-2286)ttC>ttG	p.F762L	CPT1C_ENST00000598293.1_Missense_Mutation_p.F762L|CPT1C_ENST00000323446.5_Missense_Mutation_p.F762L|CPT1C_ENST00000405931.2_Missense_Mutation_p.F751L|CPT1C_ENST00000354199.5_Missense_Mutation_p.F673L	NM_001199752.1	NP_001186681.1	Q8TCG5	CPT1C_HUMAN	carnitine palmitoyltransferase 1C	762					carnitine metabolic process (GO:0009437)|fatty acid beta-oxidation (GO:0006635)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|endoplasmic reticulum membrane (GO:0005789)|mitochondrial outer membrane (GO:0005741)|synapse (GO:0045202)	carnitine O-palmitoyltransferase activity (GO:0004095)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)		CCTCCCTGTTCCAGGCGGGAC	0.607																																						dbGAP											0													88.0	76.0	80.0					19																	50216736		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF357970	CCDS12779.1, CCDS46147.1	19q13.33	2014-03-14				ENSG00000169169			18540	protein-coding gene	gene with protein product		608846				12376098, 11001805	Standard	NM_001136052		Approved	FLJ23809, CPTIC, CPT1P	uc010eng.3	Q8TCG5		ENST00000392518.4:c.2286C>G	19.37:g.50216736C>G	ENSP00000376303:p.Phe762Leu		A8K0Z8|Q5K6N5|Q8N6Q9|Q8NDS6|Q8TE84	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.F762L	ENST00000392518.4	37	c.2286	CCDS12779.1	19	.	.	.	.	.	.	.	.	.	.	C	11.09	1.535789	0.27475	.	.	ENSG00000169169	ENST00000392518;ENST00000354199;ENST00000405931;ENST00000323446	T;D;T;T	0.84660	-1.03;-1.88;-1.03;-1.03	3.76	1.63	0.23807	.	0.000000	0.41001	D	0.000973	T	0.66771	0.2823	N	0.08118	0	0.80722	D	1	B;B	0.32829	0.258;0.386	B;B	0.38842	0.283;0.143	T	0.54516	-0.8282	10	0.10377	T	0.69	.	5.7373	0.18073	0.0:0.663:0.0:0.337	.	751;762	Q8TCG5-2;Q8TCG5	.;CPT1C_HUMAN	L	762;673;751;762	ENSP00000376303:F762L;ENSP00000346138:F673L;ENSP00000384465:F751L;ENSP00000319343:F762L	ENSP00000319343:F762L	F	+	3	2	CPT1C	54908548	0.998000	0.40836	0.874000	0.34290	0.494000	0.33585	0.542000	0.23222	0.579000	0.29504	0.313000	0.20887	TTC	CPT1C	-	NULL	ENSG00000169169		0.607	CPT1C-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CPT1C	HGNC	protein_coding	OTTHUMT00000465873.1	20	0.00	0	C	NM_152359		50216736	50216736	+1	no_errors	ENST00000323446	ensembl	human	known	69_37n	missense	17	35.71	10	SNP	0.736	G
CTNNA1	1495	genome.wustl.edu	37	5	138145810	138145810	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr5:138145810C>T	ENST00000302763.7	+	4	475	c.385C>T	c.(385-387)Cga>Tga	p.R129*	CTNNA1_ENST00000355078.5_Nonsense_Mutation_p.R26*|CTNNA1_ENST00000518825.1_Nonsense_Mutation_p.R129*	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	129	Interaction with JUP and CTNNB1.|Involved in homodimerization.			R -> P (in Ref. 3; AAA18949). {ECO:0000305}.	adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)	p.R129*(1)		NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TCGGGCAGCTCGAGCTTTGCT	0.473																																						dbGAP											1	Substitution - Nonsense(1)	cervix(1)											118.0	114.0	115.0					5																	138145810		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.385C>T	5.37:g.138145810C>T	ENSP00000304669:p.Arg129*		Q12795|Q8N1C0	Nonsense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.R129*	ENST00000302763.7	37	c.385	CCDS34243.1	5	.	.	.	.	.	.	.	.	.	.	C	18.05	3.537908	0.65085	.	.	ENSG00000044115	ENST00000523912;ENST00000355078;ENST00000302763;ENST00000518910;ENST00000537034;ENST00000541863;ENST00000518245;ENST00000519113;ENST00000520158;ENST00000518825	.	.	.	5.62	2.77	0.32553	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-6.1835	9.3279	0.38003	0.259:0.673:0.0:0.068	.	.	.	.	X	129;26;129;26;129;129;99;129;129;129	.	.	R	+	1	2	CTNNA1	138173709	0.817000	0.29147	1.000000	0.80357	0.999000	0.98932	1.628000	0.37060	0.349000	0.23975	0.655000	0.94253	CGA	CTNNA1	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin	ENSG00000044115		0.473	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA1	HGNC	protein_coding	OTTHUMT00000373868.1	45	0.00	0	C	NM_001903		138145810	138145810	+1	no_errors	ENST00000302763	ensembl	human	known	69_37n	nonsense	26	39.53	17	SNP	1.000	T
CUBN	8029	genome.wustl.edu	37	10	17142117	17142117	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr10:17142117G>C	ENST00000377833.4	-	14	1717	c.1652C>G	c.(1651-1653)tCc>tGc	p.S551C		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	551	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AGGGAGGCTGGAGCCACAAAA	0.418																																						dbGAP											0													102.0	105.0	104.0					10																	17142117		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.1652C>G	10.37:g.17142117G>C	ENSP00000367064:p.Ser551Cys		B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	pfam_CUB,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_CUB,superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_CUB,pfscan_CUB,pfscan_EG-like_dom	p.S551C	ENST00000377833.4	37	c.1652	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	G	10.91	1.483328	0.26598	.	.	ENSG00000107611	ENST00000377833	T	0.20069	2.1	5.51	4.61	0.57282	CUB (5);	0.168093	0.28606	N	0.014754	T	0.50939	0.1645	M	0.89353	3.025	0.50813	D	0.999896	D	0.89917	1.0	D	0.73708	0.981	T	0.59747	-0.7396	10	0.87932	D	0	.	12.3208	0.54983	0.1407:0.0:0.8593:0.0	.	551	O60494	CUBN_HUMAN	C	551	ENSP00000367064:S551C	ENSP00000367064:S551C	S	-	2	0	CUBN	17182123	0.996000	0.38824	0.921000	0.36526	0.007000	0.05969	2.294000	0.43567	1.329000	0.45376	-0.145000	0.13849	TCC	CUBN	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000107611		0.418	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1	33	0.00	0	G	NM_001081		17142117	17142117	-1	no_errors	ENST00000377833	ensembl	human	known	69_37n	missense	33	46.77	29	SNP	0.764	C
CXCR2	3579	genome.wustl.edu	37	2	219000457	219000457	+	Silent	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr2:219000457C>T	ENST00000318507.2	+	3	1360	c.933C>T	c.(931-933)ccC>ccT	p.P311P		NM_001557.3	NP_001548.1	P25025	CXCR2_HUMAN	chemokine (C-X-C motif) receptor 2	311					cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|inflammatory response (GO:0006954)|interleukin-8-mediated signaling pathway (GO:0038112)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	C-X-C chemokine receptor activity (GO:0016494)|interleukin-8 binding (GO:0019959)|interleukin-8 receptor activity (GO:0004918)|signal transducer activity (GO:0004871)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(11)|skin(1)|stomach(1)	22						GCCTCAACCCCCTCATCTACG	0.562																																						dbGAP											0													93.0	91.0	91.0					2																	219000457		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U11869	CCDS2408.1	2q35	2012-08-08	2009-11-25	2009-11-25	ENSG00000180871	ENSG00000180871		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"", ""Interleukins and interleukin receptors"""	6027	protein-coding gene	gene with protein product		146928	"""interleukin 8 receptor, beta"""	IL8RB		1427896	Standard	NM_001557		Approved	CMKAR2, CD182	uc002vha.2	P25025	OTTHUMG00000133107	ENST00000318507.2:c.933C>T	2.37:g.219000457C>T			Q8IUZ1|Q9P2T6|Q9P2T7	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Chemokine_CXC/IL8_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_CXCR2/IL8RB,prints_Chemokine_rcpt,prints_Chemokine_CXCR4	p.P311	ENST00000318507.2	37	c.933	CCDS2408.1	2																																																																																			CXCR2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000180871		0.562	CXCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXCR2	HGNC	protein_coding	OTTHUMT00000256772.2	20	0.00	0	C	NM_001557		219000457	219000457	+1	no_errors	ENST00000318507	ensembl	human	known	69_37n	silent	36	18.18	8	SNP	0.854	T
CXorf40A	91966	genome.wustl.edu	37	X	148628334	148628334	+	Silent	SNP	C	C	G			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chrX:148628334C>G	ENST00000441248.1	+	4	1890	c.303C>G	c.(301-303)ccC>ccG	p.P101P	CXorf40A_ENST00000428236.1_Silent_p.P39P|CXorf40A_ENST00000423421.1_Silent_p.P101P|CXorf40A_ENST00000514208.1_Silent_p.P101P|CXorf40A_ENST00000450602.2_Silent_p.P101P|CXorf40A_ENST00000423540.2_Silent_p.P101P|RP5-937E21.8_ENST00000431993.1_RNA|CXorf40A_ENST00000422892.2_Silent_p.P101P|CXorf40A_ENST00000359293.5_Silent_p.P101P|CXorf40A_ENST00000434353.2_Silent_p.P101P|CXorf40A_ENST00000393985.3_Silent_p.P101P			Q8TE69	CX04A_HUMAN	chromosome X open reading frame 40A	101										breast(1)|endometrium(3)|large_intestine(1)|lung(2)	7	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					ACTTAACTCCCGATGAGGTTG	0.468																																						dbGAP											0													112.0	81.0	92.0					X																	148628334		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AF011889	CCDS14687.1, CCDS55522.1	Xq28	2010-03-16	2005-09-13	2005-09-13	ENSG00000197620	ENSG00000197620			28089	protein-coding gene	gene with protein product	"""endothelial-overexpressed lipopolysaccharide-associated factor 1"""		"""chromosome X open reading frame 40"""	CXorf40		8717057, 9147653, 16383041	Standard	XM_005278212		Approved	EOLA1	uc004fdg.3	Q8TE69	OTTHUMG00000022622	ENST00000441248.1:c.303C>G	X.37:g.148628334C>G			A8K784|B7Z6H6|B7ZL96|D6RA72|E7ENU3|Q2M3E9	Silent	SNP	superfamily_PUA-like_domain	p.P101	ENST00000441248.1	37	c.303	CCDS14687.1	X																																																																																			CXorf40A	-	superfamily_PUA-like_domain	ENSG00000197620		0.468	CXorf40A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf40A	HGNC	protein_coding	OTTHUMT00000058699.3	44	0.00	0	C	NM_178124		148628334	148628334	+1	no_errors	ENST00000359293	ensembl	human	known	69_37n	silent	54	26.03	19	SNP	0.000	G
CYB561D2	11068	genome.wustl.edu	37	3	50391063	50391063	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr3:50391063C>T	ENST00000418577.1	+	3	1133	c.557C>T	c.(556-558)tCt>tTt	p.S186F	XXcos-LUCA11.5_ENST00000606589.1_Intron|CYB561D2_ENST00000232508.5_Missense_Mutation_p.S186F|CYB561D2_ENST00000425346.1_Missense_Mutation_p.S186F|CYB561D2_ENST00000424512.1_Missense_Mutation_p.S186F|NPRL2_ENST00000232501.3_5'Flank			O14569	C56D2_HUMAN	cytochrome b561 family, member D2	186	Cytochrome b561. {ECO:0000255|PROSITE- ProRule:PRU00242}.				oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			endometrium(1)|lung(1)|urinary_tract(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		TTCACTGCCTCTGTCACTGGT	0.557																																						dbGAP											0													141.0	135.0	137.0					3																	50391063		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF040704	CCDS2827.1	3p21.3	2013-03-14	2013-03-14		ENSG00000114395	ENSG00000114395		"""Cytochrome b genes"""	30253	protein-coding gene	gene with protein product	"""putative tumor suppressor 101F6"""	607068	"""cytochrome b-561 domain containing 2"""			9122200, 11085536, 23249217	Standard	XM_005264832		Approved	101F6, TSP10	uc003dal.3	O14569	OTTHUMG00000156813	ENST00000418577.1:c.557C>T	3.37:g.50391063C>T	ENSP00000391209:p.Ser186Phe		A8K552	Missense_Mutation	SNP	pfam_Cyt_b561_euk,smart_Cyt_b561/ferric_Rdtase_TM,pfscan_Cyt_b561/ferric_Rdtase_TM	p.S186F	ENST00000418577.1	37	c.557	CCDS2827.1	3	.	.	.	.	.	.	.	.	.	.	C	9.890	1.204017	0.22205	.	.	ENSG00000114395	ENST00000425346;ENST00000424512;ENST00000232508;ENST00000418577	.	.	.	5.58	3.78	0.43462	Cytochrome b561/ferric reductase transmembrane (1);	0.335633	0.36482	N	0.002567	T	0.32102	0.0818	L	0.40543	1.245	0.09310	N	1	B	0.26258	0.145	B	0.23419	0.046	T	0.15521	-1.0434	9	0.30078	T	0.28	.	10.5314	0.44979	0.1332:0.7967:0.0:0.0701	.	186	O14569	C56D2_HUMAN	F	186	.	ENSP00000232508:S186F	S	+	2	0	CYB561D2	50366067	0.003000	0.15002	0.423000	0.26634	0.378000	0.30076	2.038000	0.41184	0.715000	0.32103	0.561000	0.74099	TCT	CYB561D2	-	pfscan_Cyt_b561/ferric_Rdtase_TM	ENSG00000114395		0.557	CYB561D2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CYB561D2	HGNC	protein_coding	OTTHUMT00000345973.1	21	0.00	0	C	NM_007022		50391063	50391063	+1	no_errors	ENST00000232508	ensembl	human	known	69_37n	missense	16	38.46	10	SNP	0.028	T
CYP2W1	54905	genome.wustl.edu	37	7	1024666	1024666	+	Missense_Mutation	SNP	C	C	T	rs558437445		TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr7:1024666C>T	ENST00000308919.7	+	3	431	c.418C>T	c.(418-420)Cgg>Tgg	p.R140W	CYP2W1_ENST00000340150.6_Missense_Mutation_p.R84W	NM_017781.2	NP_060251.2	Q8TAV3	CP2W1_HUMAN	cytochrome P450, family 2, subfamily W, polypeptide 1	140					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			breast(1)|large_intestine(1)|lung(4)|urinary_tract(1)	7		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		GGGCGTGGGCCGGGAGCCGGT	0.672																																						dbGAP											0													28.0	35.0	33.0					7																	1024666		2199	4297	6496	-	-	-	SO:0001583	missense	0			AK000366	CCDS5319.2	7p22.3	2004-07-05			ENSG00000073067	ENSG00000073067		"""Cytochrome P450s"""	20243	protein-coding gene	gene with protein product		615967					Standard	XM_005249792		Approved	FLJ20359, MGC34287	uc003sjq.1	Q8TAV3	OTTHUMG00000074071	ENST00000308919.7:c.418C>T	7.37:g.1024666C>T	ENSP00000310149:p.Arg140Trp			Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.R140W	ENST00000308919.7	37	c.418	CCDS5319.2	7	.	.	.	.	.	.	.	.	.	.	C	11.98	1.799972	0.31869	.	.	ENSG00000073067	ENST00000308919;ENST00000340150	T;T	0.69040	-0.37;-0.37	4.95	-0.0923	0.13657	.	0.144113	0.64402	D	0.000013	T	0.77678	0.4166	M	0.70903	2.155	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.67725	0.953;0.953	T	0.73665	-0.3911	10	0.87932	D	0	.	14.8981	0.70659	0.3773:0.6227:0.0:0.0	.	84;140	A6NJ10;Q8TAV3	.;CP2W1_HUMAN	W	140;84	ENSP00000310149:R140W;ENSP00000344178:R84W	ENSP00000310149:R140W	R	+	1	2	CYP2W1	991192	0.003000	0.15002	0.001000	0.08648	0.073000	0.16967	1.415000	0.34748	0.028000	0.15324	0.491000	0.48974	CGG	CYP2W1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000073067		0.672	CYP2W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2W1	HGNC	protein_coding	OTTHUMT00000157249.1	16	0.00	0	C	NM_017781		1024666	1024666	+1	no_errors	ENST00000308919	ensembl	human	known	69_37n	missense	17	28.00	7	SNP	0.000	T
DNAJB7	150353	genome.wustl.edu	37	22	41257383	41257383	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr22:41257383C>T	ENST00000307221.4	-	1	747	c.616G>A	c.(616-618)Gaa>Aaa	p.E206K	XPNPEP3_ENST00000414396.1_Intron|XPNPEP3_ENST00000541156.1_Intron|XPNPEP3_ENST00000357137.4_Intron|XPNPEP3_ENST00000482652.1_Intron|XPNPEP3_ENST00000544094.1_5'Flank	NM_145174.1	NP_660157.1	Q7Z6W7	DNJB7_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 7	206							chaperone binding (GO:0051087)			breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	10						TGATCACTTTCAATAATTTTC	0.348																																						dbGAP											0													68.0	74.0	72.0					22																	41257383		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF085232	CCDS14008.1	22q13.2	2011-09-02			ENSG00000172404	ENSG00000172404		"""Heat shock proteins / DNAJ (HSP40)"""	24986	protein-coding gene	gene with protein product		611336				12477932	Standard	NM_145174		Approved	HSC3	uc003azj.3	Q7Z6W7	OTTHUMG00000151202	ENST00000307221.4:c.616G>A	22.37:g.41257383C>T	ENSP00000307197:p.Glu206Lys		Q2M220|Q5H904|Q8WYJ7	Missense_Mutation	SNP	pfam_DnaJ_N,superfamily_DnaJ_N,superfamily_ConA-like_lec_gl,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.E206K	ENST00000307221.4	37	c.616	CCDS14008.1	22	.	.	.	.	.	.	.	.	.	.	C	13.23	2.176465	0.38413	.	.	ENSG00000172404	ENST00000307221	T	0.44083	0.93	4.7	3.68	0.42216	.	0.580733	0.15291	N	0.270141	T	0.63616	0.2526	M	0.90082	3.085	0.31636	N	0.648403	D	0.57571	0.98	P	0.58577	0.841	T	0.70761	-0.4784	10	0.66056	D	0.02	.	9.0811	0.36552	0.0:0.9022:0.0:0.0978	.	206	Q7Z6W7	DNJB7_HUMAN	K	206	ENSP00000307197:E206K	ENSP00000307197:E206K	E	-	1	0	DNAJB7	39587329	0.002000	0.14202	0.749000	0.31150	0.119000	0.20118	1.411000	0.34702	1.589000	0.49982	0.591000	0.81541	GAA	DNAJB7	-	NULL	ENSG00000172404		0.348	DNAJB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJB7	HGNC	protein_coding	OTTHUMT00000321765.1	26	0.00	0	C	NM_145174		41257383	41257383	-1	no_errors	ENST00000307221	ensembl	human	known	69_37n	missense	35	22.22	10	SNP	0.158	T
E2F4	1874	genome.wustl.edu	37	16	67235311	67235311	+	IGR	SNP	G	G	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr16:67235311G>A	ENST00000379378.3	+	0	2096				ELMO3_ENST00000571638.1_3'UTR|ELMO3_ENST00000393997.2_Silent_p.Q309Q|ELMO3_ENST00000477898.1_Silent_p.Q143Q|MIR328_ENST00000385213.1_RNA|ELMO3_ENST00000360833.1_Silent_p.Q292Q	NM_001950.3	NP_001941.2	Q16254	E2F4_HUMAN	E2F transcription factor 4, p107/p130-binding						blood circulation (GO:0008015)|cell volume homeostasis (GO:0006884)|cilium assembly (GO:0042384)|epithelial cell development (GO:0002064)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of cell size (GO:0008361)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(4)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)	11		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000697)|Epithelial(162;0.00303)|all cancers(182;0.0325)		ATCTTTGGCAGAGGAACCTTC	0.602																																						dbGAP											0													146.0	152.0	150.0					16																	67235311		1970	4160	6130	-	-	-	SO:0001628	intergenic_variant	0			BC021050	CCDS32464.1	16q22.1	2014-05-06			ENSG00000205250	ENSG00000205250			3118	protein-coding gene	gene with protein product		600659				7958924, 7892279	Standard	NM_001950		Approved	E2F-4	uc002erz.3	Q16254	OTTHUMG00000172975		16.37:g.67235311G>A			A6NGR8|B5BU56|Q12991|Q15328	Splice_Site	SNP	-	e4-1	ENST00000379378.3	37	c.288-1	CCDS32464.1	16																																																																																			ELMO3	-	-	ENSG00000102890		0.602	E2F4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	ELMO3	HGNC	protein_coding	OTTHUMT00000421565.1	60	0.00	0	G	NM_001950		67235311	67235311	+1	no_errors	ENST00000571587	ensembl	human	known	69_37n	splice_site	56	11.11	7	SNP	1.000	A
EML5	161436	genome.wustl.edu	37	14	89153606	89153606	+	Silent	SNP	G	G	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr14:89153606G>T	ENST00000380664.5	-	19	2807	c.2808C>A	c.(2806-2808)ctC>ctA	p.L936L	EML5_ENST00000554922.1_Silent_p.L936L|EML5_ENST00000352093.5_Silent_p.L898L			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	936						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						CATAGGTCTTGAGACATCTTT	0.363																																						dbGAP											0													55.0	49.0	51.0					14																	89153606		1801	4075	5876	-	-	-	SO:0001819	synonymous_variant	0			AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.2808C>A	14.37:g.89153606G>T			B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Silent	SNP	pfam_WD40_repeat,pfam_HELP,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L936	ENST00000380664.5	37	c.2808	CCDS45148.1	14																																																																																			EML5	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000165521		0.363	EML5-010	KNOWN	basic|CCDS	protein_coding	EML5	HGNC	protein_coding	OTTHUMT00000410491.1	44	0.00	0	G			89153606	89153606	-1	no_errors	ENST00000554922	ensembl	human	known	69_37n	silent	37	27.45	14	SNP	1.000	T
EPB41L2	2037	genome.wustl.edu	37	6	131247796	131247796	+	Silent	SNP	G	G	C			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr6:131247796G>C	ENST00000337057.3	-	4	940	c.759C>G	c.(757-759)ctC>ctG	p.L253L	EPB41L2_ENST00000445890.2_Silent_p.L253L|EPB41L2_ENST00000525271.1_Silent_p.L253L|EPB41L2_ENST00000527411.1_Silent_p.L253L|EPB41L2_ENST00000529208.1_Silent_p.L253L|EPB41L2_ENST00000392427.3_Silent_p.L253L|EPB41L2_ENST00000368128.2_Silent_p.L253L|EPB41L2_ENST00000527659.1_Silent_p.L253L|EPB41L2_ENST00000530481.1_Silent_p.L253L|EPB41L2_ENST00000525193.1_Silent_p.L253L|EPB41L2_ENST00000530148.1_5'UTR|EPB41L2_ENST00000528282.1_Silent_p.L253L	NM_001431.3	NP_001422.1	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	253	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cortical actin cytoskeleton organization (GO:0030866)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|spectrin (GO:0008091)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(23)|prostate(1)|skin(2)	44	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		CTTTCTCCAAGAGATTGAGGT	0.318																																						dbGAP											0													119.0	117.0	118.0					6																	131247796		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF027299	CCDS5141.1, CCDS47474.1, CCDS56450.1, CCDS59037.1	6q23	2008-08-29			ENSG00000079819	ENSG00000079819			3379	protein-coding gene	gene with protein product		603237				9598318, 9828140	Standard	NM_001431		Approved	4.1-G	uc003qch.2	O43491	OTTHUMG00000015560	ENST00000337057.3:c.759C>G	6.37:g.131247796G>C			B4DHI8|E9PPD9|Q5T4F0|Q68DV2	Silent	SNP	pirsf_Band_41_protein,pfam_Band_4.1_C,pfam_SAB,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,prints_Band_41_fam,prints_Ez/rad/moesin,pfscan_FERM_domain	p.L253	ENST00000337057.3	37	c.759	CCDS5141.1	6																																																																																			EPB41L2	-	pirsf_Band_41_protein,pfam_FERM_N,smart_Band_41_domain,prints_Band_41_fam,pfscan_FERM_domain	ENSG00000079819		0.318	EPB41L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB41L2	HGNC	protein_coding	OTTHUMT00000042204.3	52	0.00	0	G			131247796	131247796	-1	no_errors	ENST00000337057	ensembl	human	known	69_37n	silent	58	18.31	13	SNP	0.833	C
EPHB3	2049	genome.wustl.edu	37	3	184298586	184298586	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr3:184298586G>A	ENST00000330394.2	+	13	2910	c.2458G>A	c.(2458-2460)Gat>Aat	p.D820N	EIF2B5_ENST00000444495.1_Intron	NM_004443.3	NP_004434.2	P54753	EPHB3_HUMAN	EPH receptor B3	820	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell migration (GO:0016477)|central nervous system projection neuron axonogenesis (GO:0021952)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|digestive tract morphogenesis (GO:0048546)|ephrin receptor signaling pathway (GO:0048013)|palate development (GO:0060021)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of axonogenesis (GO:0050770)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell-cell adhesion (GO:0022407)|regulation of Rac GTPase activity (GO:0032314)|retinal ganglion cell axon guidance (GO:0031290)|substrate adhesion-dependent cell spreading (GO:0034446)|thymus development (GO:0048538)|urogenital system development (GO:0001655)	cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|ephrin receptor activity (GO:0005003)			breast(5)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)			TTCTGCTAGTGATGTCTGGAG	0.587																																						dbGAP											0													120.0	109.0	113.0					3																	184298586		2203	4300	6503	-	-	-	SO:0001583	missense	0			X75208	CCDS3268.1	3q27.1	2013-09-19	2004-10-28		ENSG00000182580	ENSG00000182580		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3394	protein-coding gene	gene with protein product		601839	"""EphB3"""	ETK2		8397371	Standard	NM_004443		Approved	Hek2, Tyro6	uc003foz.3	P54753	OTTHUMG00000156710	ENST00000330394.2:c.2458G>A	3.37:g.184298586G>A	ENSP00000332118:p.Asp820Asn		Q7Z740	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom	p.D820N	ENST00000330394.2	37	c.2458	CCDS3268.1	3	.	.	.	.	.	.	.	.	.	.	G	23.5	4.426788	0.83667	.	.	ENSG00000182580	ENST00000330394	D	0.88509	-2.39	4.12	4.12	0.48240	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.96364	0.8814	H	0.96720	3.87	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97909	1.0307	10	0.87932	D	0	.	16.259	0.82532	0.0:0.0:1.0:0.0	.	820	P54753	EPHB3_HUMAN	N	820	ENSP00000332118:D820N	ENSP00000332118:D820N	D	+	1	0	EPHB3	185781280	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	9.859000	0.99545	2.260000	0.74910	0.643000	0.83706	GAT	EPHB3	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000182580		0.587	EPHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB3	HGNC	protein_coding	OTTHUMT00000345413.1	27	0.00	0	G	NM_004443		184298586	184298586	+1	no_errors	ENST00000330394	ensembl	human	known	69_37n	missense	34	20.93	9	SNP	1.000	A
EPS15	2060	genome.wustl.edu	37	1	51874002	51874002	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr1:51874002G>C	ENST00000371733.3	-	15	1374	c.1278C>G	c.(1276-1278)atC>atG	p.I426M	EPS15_ENST00000493793.1_5'UTR|EPS15_ENST00000371730.2_Intron|EPS15_ENST00000396122.4_Missense_Mutation_p.I103M	NM_001981.2	NP_001972.1	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway substrate 15	426					cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|protein transport (GO:0015031)|vesicle organization (GO:0016050)	AP-2 adaptor complex (GO:0030122)|ciliary membrane (GO:0060170)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|polyubiquitin binding (GO:0031593)	p.0?(2)		endometrium(3)|kidney(5)|large_intestine(8)|lung(13)|prostate(2)|skin(1)|stomach(1)|urinary_tract(2)	35						TCAGAGAAGAGATCTATAATG	0.353			T	MLL	ALL																																	dbGAP		Dom	yes		1	1p32	2060	epidermal growth factor receptor pathway substrate 15 (AF1p)		L	2	Whole gene deletion(2)	thyroid(1)|central_nervous_system(1)											75.0	75.0	75.0					1																	51874002		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC054006	CCDS557.1	1p32	2013-01-10			ENSG00000085832	ENSG00000085832		"""EF-hand domain containing"""	3419	protein-coding gene	gene with protein product		600051				8183552	Standard	NM_001159969		Approved	AF-1P, MLLT5	uc001csq.1	P42566	OTTHUMG00000008192	ENST00000371733.3:c.1278C>G	1.37:g.51874002G>C	ENSP00000360798:p.Ile426Met		B2R8J7|D3DPJ2|Q5SRH4	Missense_Mutation	SNP	smart_EPS15_homology,smart_EF_hand_Ca-bd,smart_Ubiquitin-int_motif,pfscan_EF_HAND_2,pfscan_EPS15_homology,pfscan_Ubiquitin-int_motif	p.I426M	ENST00000371733.3	37	c.1278	CCDS557.1	1	.	.	.	.	.	.	.	.	.	.	G	15.38	2.817272	0.50633	.	.	ENSG00000085832	ENST00000371733;ENST00000396122	D;T	0.83075	-1.68;2.24	5.48	-3.38	0.04883	.	0.000000	0.32671	N	0.005788	D	0.84669	0.5523	M	0.67397	2.05	0.52099	D	0.999944	D;D	0.69078	0.997;0.994	D;D	0.67103	0.949;0.909	T	0.80761	-0.1238	10	0.72032	D	0.01	.	5.1816	0.15163	0.5253:0.0:0.2446:0.2301	.	426;112	P42566;P42566-2	EPS15_HUMAN;.	M	426;103	ENSP00000360798:I426M;ENSP00000379428:I103M	ENSP00000360798:I426M	I	-	3	3	EPS15	51646590	1.000000	0.71417	0.973000	0.42090	0.725000	0.41563	0.959000	0.29240	-0.522000	0.06417	-0.311000	0.09066	ATC	EPS15	-	NULL	ENSG00000085832		0.353	EPS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPS15	HGNC	protein_coding	OTTHUMT00000022422.1	40	0.00	0	G	NM_001981		51874002	51874002	-1	no_errors	ENST00000371733	ensembl	human	known	69_37n	missense	66	19.51	16	SNP	0.931	C
FAM186A	121006	genome.wustl.edu	37	12	50749200	50749200	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr12:50749200G>C	ENST00000327337.5	-	4	1414	c.1415C>G	c.(1414-1416)tCt>tGt	p.S472C	FAM186A_ENST00000543111.1_Missense_Mutation_p.S472C	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	472																	ATTTGGTCCAGAGGTCTCATA	0.363																																					NSCLC(138;1796 1887 12511 19463 37884)	dbGAP											0													131.0	90.0	102.0					12																	50749200		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.1415C>G	12.37:g.50749200G>C	ENSP00000329995:p.Ser472Cys			Missense_Mutation	SNP	NULL	p.S472C	ENST00000327337.5	37	c.1415	CCDS44878.1	12	.	.	.	.	.	.	.	.	.	.	G	13.32	2.203210	0.38905	.	.	ENSG00000185958	ENST00000543111;ENST00000327337	T;T	0.17691	2.27;2.26	4.09	1.16	0.20824	.	.	.	.	.	T	0.19805	0.0476	N	0.19112	0.55	0.09310	N	1	D;D	0.71674	0.998;0.998	D;P	0.64321	0.924;0.906	T	0.11446	-1.0587	9	0.72032	D	0.01	.	4.9476	0.13997	0.1925:0.3332:0.4743:0.0	.	472;472	F5GYN0;A6NE01	.;F186A_HUMAN	C	472	ENSP00000441337:S472C;ENSP00000329995:S472C	ENSP00000329995:S472C	S	-	2	0	FAM186A	49035467	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.086000	0.14935	0.262000	0.21774	-0.136000	0.14681	TCT	FAM186A	-	NULL	ENSG00000185958		0.363	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM186A	HGNC	protein_coding	OTTHUMT00000396838.1	51	0.00	0	G	XM_001718353		50749200	50749200	-1	no_errors	ENST00000327337	ensembl	human	known	69_37n	missense	48	15.52	9	SNP	0.000	C
GAREML	150946	genome.wustl.edu	37	2	26410420	26410420	+	Nonsense_Mutation	SNP	C	C	G			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr2:26410420C>G	ENST00000401533.2	+	6	2049	c.1919C>G	c.(1918-1920)tCa>tGa	p.S640*	GAREML_ENST00000407684.1_Intron	NM_001168241.1	NP_001161713.1	Q75VX8	GAREL_HUMAN	GRB2 associated, regulator of MAPK1-like	640	Pro-rich.					extracellular vesicular exosome (GO:0070062)											GCCTACCCCTCAGGCCCTTCA	0.632																																						dbGAP											0													72.0	63.0	66.0					2																	26410420		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			AK090454, AB015349, AB124552	CCDS54336.1, CCDS54337.1	2p23.3	2012-11-30	2012-11-30	2012-11-30	ENSG00000157833	ENSG00000157833			27172	protein-coding gene	gene with protein product			"""family with sequence similarity 59, member B"""	FAM59B			Standard	NM_001168241		Approved	KIAA2038, FLJ00375	uc002rgw.2	Q75VX8	OTTHUMG00000151935	ENST00000401533.2:c.1919C>G	2.37:g.26410420C>G	ENSP00000384593:p.Ser640*		B5MC97|B7WNK9|Q8NF27|Q9UIK8	Nonsense_Mutation	SNP	superfamily_SAM/pointed	p.S640*	ENST00000401533.2	37	c.1919	CCDS54336.1	2	.	.	.	.	.	.	.	.	.	.	C	28.6	4.936283	0.92458	.	.	ENSG00000157833	ENST00000401533	.	.	.	4.86	4.86	0.63082	.	0.606476	0.13567	N	0.378338	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-2.2569	16.558	0.84491	0.0:1.0:0.0:0.0	.	.	.	.	X	640	.	ENSP00000384593:S640X	S	+	2	0	FAM59B	26263924	0.030000	0.19436	0.879000	0.34478	0.411000	0.31082	3.360000	0.52299	2.235000	0.73313	0.655000	0.94253	TCA	FAM59B	-	NULL	ENSG00000157833		0.632	GAREML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM59B	HGNC	protein_coding	OTTHUMT00000324498.2	40	0.00	0	C	NM_001168241		26410420	26410420	+1	no_errors	ENST00000401533	ensembl	human	known	69_37n	nonsense	42	17.65	9	SNP	0.975	G
FANCB	2187	genome.wustl.edu	37	X	14861741	14861741	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chrX:14861741G>A	ENST00000324138.3	-	9	2681	c.2528C>T	c.(2527-2529)gCt>gTt	p.A843V	FANCB_ENST00000398334.1_Missense_Mutation_p.A843V	NM_152633.2	NP_689846.1	Q8NB91	FANCB_HUMAN	Fanconi anemia, complementation group B	843					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24	Hepatocellular(33;0.183)					CTGAACCTCAGCTACTTTCAA	0.323								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP											0													112.0	102.0	105.0					X																	14861741		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK091383	CCDS14161.1	Xp22.2	2014-09-17			ENSG00000181544	ENSG00000181544		"""Fanconi anemia, complementation groups"""	3583	protein-coding gene	gene with protein product		300515				9382107, 15502827	Standard	NM_152633		Approved	FAB, FLJ34064, FAAP95	uc004cwh.1	Q8NB91	OTTHUMG00000021168	ENST00000324138.3:c.2528C>T	X.37:g.14861741G>A	ENSP00000326819:p.Ala843Val		B2RMZ4|Q7Z2U2|Q86XG1	Missense_Mutation	SNP	NULL	p.A843V	ENST00000324138.3	37	c.2528	CCDS14161.1	X	.	.	.	.	.	.	.	.	.	.	G	11.40	1.627127	0.28978	.	.	ENSG00000181544	ENST00000324138;ENST00000398334	.	.	.	5.43	3.67	0.42095	.	0.339151	0.31167	N	0.008130	T	0.40222	0.1108	M	0.63843	1.955	0.31553	N	0.658462	P	0.49358	0.923	B	0.42771	0.397	T	0.50415	-0.8831	9	0.44086	T	0.13	-1.6632	9.5786	0.39472	0.232:0.0:0.768:0.0	.	843	Q8NB91	FANCB_HUMAN	V	843	.	ENSP00000326819:A843V	A	-	2	0	FANCB	14771662	0.996000	0.38824	0.104000	0.21259	0.279000	0.26890	1.947000	0.40293	0.496000	0.27904	0.594000	0.82650	GCT	FANCB	-	NULL	ENSG00000181544		0.323	FANCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCB	HGNC	protein_coding	OTTHUMT00000055835.1	64	0.00	0	G	NM_152633		14861741	14861741	-1	no_errors	ENST00000324138	ensembl	human	known	69_37n	missense	67	22.09	19	SNP	0.977	A
FGR	2268	genome.wustl.edu	37	1	27939763	27939763	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr1:27939763C>T	ENST00000374005.3	-	12	1636	c.1348G>A	c.(1348-1350)Gag>Aag	p.E450K	FGR_ENST00000545953.1_Missense_Mutation_p.E384K|FGR_ENST00000399173.1_Missense_Mutation_p.E450K|FGR_ENST00000374004.1_Missense_Mutation_p.E450K	NM_005248.2	NP_005239.1	P09769	FGR_HUMAN	FGR proto-oncogene, Src family tyrosine kinase	450	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|defense response to Gram-positive bacterium (GO:0050830)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of innate immune response (GO:0045088)|regulation of phagocytosis (GO:0050764)|regulation of protein kinase activity (GO:0045859)|response to virus (GO:0009615)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|Fc-gamma receptor I complex binding (GO:0034988)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphotyrosine binding (GO:0001784)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(4)	16		all_lung(284;2.05e-05)|Colorectal(325;3.46e-05)|Lung NSC(340;3.67e-05)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00244)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		GTGATGAGCTCAGTGAGCAGG	0.602																																						dbGAP											0													88.0	88.0	88.0					1																	27939763		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC064382	CCDS305.1	1p36.2-p36.1	2014-06-25	2014-06-25		ENSG00000000938	ENSG00000000938		"""SH2 domain containing"""	3697	protein-coding gene	gene with protein product		164940	"""Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog"", ""v-fgr feline Gardner-Rasheed sarcoma viral oncogene homolog"", ""feline Gardner-Rasheed sarcoma viral oncogene homolog"""	SRC2		3922831	Standard	NM_001042729		Approved	c-fgr, p55c-fgr	uc001bom.3	P09769	OTTHUMG00000003516	ENST00000374005.3:c.1348G>A	1.37:g.27939763C>T	ENSP00000363117:p.Glu450Lys		D3DPL7|Q9UIQ3	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.E450K	ENST00000374005.3	37	c.1348	CCDS305.1	1	.	.	.	.	.	.	.	.	.	.	c	34	5.350102	0.95830	.	.	ENSG00000000938	ENST00000374005;ENST00000545953;ENST00000399173;ENST00000374004;ENST00000374003	D;D;D;D;D	0.94576	-3.46;-3.46;-3.46;-3.46;-3.46	4.65	4.65	0.58169	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.53938	D	0.000051	D	0.98235	0.9416	H	0.96889	3.9	0.48632	D	0.999688	D	0.89917	1.0	D	0.97110	1.0	D	0.99723	1.1010	10	0.87932	D	0	.	16.4665	0.84080	0.0:1.0:0.0:0.0	.	450	P09769	FGR_HUMAN	K	450;384;450;450;450	ENSP00000363117:E450K;ENSP00000445302:E384K;ENSP00000382126:E450K;ENSP00000363116:E450K;ENSP00000363115:E450K	ENSP00000363115:E450K	E	-	1	0	FGR	27812350	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	7.770000	0.85390	2.314000	0.78098	0.586000	0.80456	GAG	FGR	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000000938		0.602	FGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGR	HGNC	protein_coding	OTTHUMT00000009772.1	22	0.00	0	C	NM_005248		27939763	27939763	-1	no_errors	ENST00000374003	ensembl	human	known	69_37n	missense	12	40.00	8	SNP	1.000	T
FLG	2312	genome.wustl.edu	37	1	152280830	152280830	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr1:152280830C>T	ENST00000368799.1	-	3	6567	c.6532G>A	c.(6532-6534)Gat>Aat	p.D2178N	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2178	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGGGAGGCATCAGACCTTCCC	0.537									Ichthyosis																													dbGAP											0													438.0	382.0	401.0					1																	152280830		2203	4297	6500	-	-	-	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6532G>A	1.37:g.152280830C>T	ENSP00000357789:p.Asp2178Asn		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.D2178N	ENST00000368799.1	37	c.6532	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	c	7.210	0.595240	0.13875	.	.	ENSG00000143631	ENST00000368799	T	0.01745	4.66	2.82	0.796	0.18648	.	.	.	.	.	T	0.00815	0.0027	M	0.77820	2.39	0.09310	N	1	P	0.47604	0.898	B	0.39904	0.313	T	0.46721	-0.9171	9	0.16896	T	0.51	.	5.4527	0.16574	0.0:0.703:0.0:0.297	.	2178	P20930	FILA_HUMAN	N	2178	ENSP00000357789:D2178N	ENSP00000357789:D2178N	D	-	1	0	FLG	150547454	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	0.723000	0.25939	0.057000	0.16193	0.485000	0.47835	GAT	FLG	-	NULL	ENSG00000143631		0.537	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	136	0.00	0	C	NM_002016		152280830	152280830	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	missense	218	13.83	35	SNP	0.000	T
FNDC3B	64778	genome.wustl.edu	37	3	172070865	172070865	+	Silent	SNP	C	C	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr3:172070865C>A	ENST00000336824.4	+	22	2886	c.2787C>A	c.(2785-2787)acC>acA	p.T929T	FNDC3B_ENST00000416957.1_Silent_p.T929T|FNDC3B_ENST00000415807.2_Silent_p.T929T	NM_001135095.1	NP_001128567.1	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	929	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell migration (GO:0016477)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast proliferation (GO:0048146)|substrate adhesion-dependent cell spreading (GO:0034446)|Type II pneumocyte differentiation (GO:0060510)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(26)|ovary(3)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	69	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		TTCCAGAAACCACCTACCGGT	0.473																																						dbGAP											0													72.0	63.0	66.0					3																	172070865		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF543840	CCDS3217.1	3q26.31	2013-11-06			ENSG00000075420	ENSG00000075420		"""Fibronectin type III domain containing"""	24670	protein-coding gene	gene with protein product		611909				15527760	Standard	NM_022763		Approved	FAD104, DKFZp762K137, FLJ23399, PRO4979, YVTM2421	uc003fhy.3	Q53EP0	OTTHUMG00000156761	ENST00000336824.4:c.2787C>A	3.37:g.172070865C>A			B2RB36|B3KXR8|D3DNQ7|Q5U5T8|Q6PIJ3|Q6UXG1|Q6UXZ5|Q8IXB2|Q8NBU7|Q96D78|Q9H5I7|Q9NSQ8	Silent	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.T929	ENST00000336824.4	37	c.2787	CCDS3217.1	3																																																																																			FNDC3B	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000075420		0.473	FNDC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNDC3B	HGNC	protein_coding	OTTHUMT00000345618.2	16	0.00	0	C	NM_022763		172070865	172070865	+1	no_errors	ENST00000336824	ensembl	human	known	69_37n	silent	19	34.48	10	SNP	0.996	A
FRMD1	79981	genome.wustl.edu	37	6	168462627	168462627	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr6:168462627G>A	ENST00000283309.6	-	8	969	c.905C>T	c.(904-906)cCc>cTc	p.P302L	FRMD1_ENST00000440994.2_Missense_Mutation_p.P234L|FRMD1_ENST00000537786.1_Missense_Mutation_p.P73L|FRMD1_ENST00000432403.1_5'UTR	NM_024919.3	NP_079195.3	Q8N878	FRMD1_HUMAN	FERM domain containing 1	302	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)				endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	19		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		CTGTGCTGCGGGCAGCCCATC	0.622																																					GBM(50;8 1094 9538 34399)|Ovarian(80;676 1857 8675 49015)	dbGAP											0													25.0	26.0	26.0					6																	168462627		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS5306.1, CCDS47518.1	6q27	2008-10-23			ENSG00000153303	ENSG00000153303			21240	protein-coding gene	gene with protein product							Standard	NM_001122841		Approved	FLJ00181, DKFZp434O0117, FLJ40260, FLJ22615, bA164L23.1	uc003qwo.4	Q8N878	OTTHUMG00000016037	ENST00000283309.6:c.905C>T	6.37:g.168462627G>A	ENSP00000283309:p.Pro302Leu		B2RNV8|B3KUM6|Q5SZU7|Q9UFB0	Missense_Mutation	SNP	pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	p.P302L	ENST00000283309.6	37	c.905	CCDS5306.1	6	.	.	.	.	.	.	.	.	.	.	G	10.49	1.364361	0.24684	.	.	ENSG00000153303	ENST00000283309;ENST00000440994;ENST00000537786	D;D;D	0.83075	-1.68;-1.68;-1.68	2.37	1.44	0.22558	FERM domain (1);	0.000000	0.64402	U	0.000013	T	0.78799	0.4340	L	0.49455	1.56	0.53688	D	0.999973	P;P;D;P	0.52996	0.924;0.928;0.957;0.924	P;P;P;P	0.59595	0.734;0.728;0.86;0.734	T	0.77778	-0.2460	10	0.56958	D	0.05	.	7.8052	0.29198	0.1284:0.0:0.8716:0.0	.	237;302;234;197	B7Z8G9;Q8N878;Q8N878-2;Q5SZU5	.;FRMD1_HUMAN;.;.	L	302;234;73	ENSP00000283309:P302L;ENSP00000414115:P234L;ENSP00000440078:P73L	ENSP00000283309:P302L	P	-	2	0	FRMD1	168205476	1.000000	0.71417	0.005000	0.12908	0.021000	0.10359	5.077000	0.64419	0.302000	0.22762	0.313000	0.20887	CCC	FRMD1	-	pfscan_FERM_domain	ENSG00000153303		0.622	FRMD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD1	HGNC	protein_coding	OTTHUMT00000362513.2	14	0.00	0	G	NM_024919		168462627	168462627	-1	no_errors	ENST00000283309	ensembl	human	known	69_37n	missense	9	59.09	13	SNP	0.993	A
GPR108	56927	genome.wustl.edu	37	19	6731093	6731093	+	Silent	SNP	G	G	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr19:6731093G>A	ENST00000264080.7	-	17	1490	c.1464C>T	c.(1462-1464)ttC>ttT	p.F488F	GPR108_ENST00000598626.1_Intron|GPR108_ENST00000430424.4_Silent_p.F246F	NM_001080452.1	NP_001073921.1	Q9NPR9	GP108_HUMAN	G protein-coupled receptor 108	488						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|large_intestine(4)|lung(4)|skin(1)|urinary_tract(1)	13						TGAGCACGAAGAAGGCCAGGG	0.677																																						dbGAP											0													53.0	58.0	57.0					19																	6731093		2009	4167	6176	-	-	-	SO:0001819	synonymous_variant	0				CCDS42479.1	19p13.3	2014-01-30				ENSG00000125734		"""GPCR / Unclassified : 7TM orphan receptors"""	17829	protein-coding gene	gene with protein product							Standard	NM_001080452		Approved	LUSTR2	uc002mfp.3	Q9NPR9	OTTHUMG00000170129	ENST00000264080.7:c.1464C>T	19.37:g.6731093G>A			B9EJD7	Silent	SNP	pfam_TM_rcpt_euk	p.F488	ENST00000264080.7	37	c.1464	CCDS42479.1	19																																																																																			GPR108	-	pfam_TM_rcpt_euk	ENSG00000125734		0.677	GPR108-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR108	HGNC	protein_coding	OTTHUMT00000407508.2	14	0.00	0	G			6731093	6731093	-1	no_errors	ENST00000264080	ensembl	human	known	69_37n	silent	13	27.78	5	SNP	1.000	A
GPR137	56834	genome.wustl.edu	37	11	64054186	64054186	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr11:64054186G>C	ENST00000313074.3	+	1	295	c.190G>C	c.(190-192)Gcc>Ccc	p.A64P	BAD_ENST00000544785.1_5'Flank|GPR137_ENST00000438980.2_Missense_Mutation_p.A64P|BAD_ENST00000309032.3_5'Flank|BAD_ENST00000394531.3_5'Flank|GPR137_ENST00000377702.4_Missense_Mutation_p.A64P|GPR137_ENST00000539851.1_Missense_Mutation_p.A64P|BAD_ENST00000394532.3_5'Flank|GPR137_ENST00000411458.1_Missense_Mutation_p.A122P	NM_020155.3	NP_064540.3	Q96N19	G137A_HUMAN	G protein-coupled receptor 137	64						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(1)|lung(4)|skin(1)	10						GGTGTTCCTGGCCCTCTGTCT	0.612																																						dbGAP											0													153.0	150.0	151.0					11																	64054186		2201	4297	6498	-	-	-	SO:0001583	missense	0			AJ250392	CCDS8066.1, CCDS53655.1, CCDS53656.1, CCDS53657.1, CCDS53658.1	11q13.1	2014-02-12	2006-01-26		ENSG00000173264	ENSG00000173264		"""GPCR / Unclassified : 7TM orphan receptors"""	24300	protein-coding gene	gene with protein product						10873569, 12732197	Standard	NM_001170726		Approved	C11orf4, GPR137A, TM7SF1L1	uc010rni.2	Q96N19	OTTHUMG00000167817	ENST00000313074.3:c.190G>C	11.37:g.64054186G>C	ENSP00000321698:p.Ala64Pro		B4DTG7|B7Z7M1|Q4G0Y9|Q8N4K6	Missense_Mutation	SNP	NULL	p.A64P	ENST00000313074.3	37	c.190	CCDS8066.1	11	.	.	.	.	.	.	.	.	.	.	G	22.1	4.238556	0.79800	.	.	ENSG00000173264	ENST00000546139;ENST00000411458;ENST00000539851;ENST00000539833;ENST00000377702;ENST00000535675;ENST00000543383;ENST00000538032;ENST00000540370;ENST00000540969;ENST00000438980;ENST00000313074;ENST00000542190;ENST00000541952	T;T;T;T;T;T;T;T;T;T;T;T;T	0.22743	1.94;2.34;2.34;1.94;2.34;1.94;1.94;1.94;2.34;2.34;2.34;1.94;1.94	4.33	3.37	0.38596	.	0.231100	0.36972	N	0.002308	T	0.13457	0.0326	N	0.08118	0	0.36958	D	0.893204	B;B;B;D;B;B;B	0.54772	0.089;0.022;0.004;0.968;0.008;0.089;0.089	B;B;B;P;B;B;B	0.49332	0.008;0.057;0.005;0.607;0.009;0.057;0.015	T	0.14448	-1.0472	10	0.45353	T	0.12	-3.5594	6.979	0.24692	0.0:0.194:0.6059:0.2001	.	64;122;70;64;64;64;64	B7Z7M1;B4DTG7;F5H234;Q96N19-2;F5GXI8;Q96N19;Q96N19-3	.;.;.;.;.;G137A_HUMAN;.	P	70;122;64;64;64;64;64;64;64;64;64;64;64;64	ENSP00000445570:A70P;ENSP00000411827:A122P;ENSP00000442792:A64P;ENSP00000438716:A64P;ENSP00000366931:A64P;ENSP00000446342:A64P;ENSP00000441003:A64P;ENSP00000445000:A64P;ENSP00000446387:A64P;ENSP00000415698:A64P;ENSP00000321698:A64P;ENSP00000441034:A64P;ENSP00000442929:A64P	ENSP00000321698:A64P	A	+	1	0	GPR137	63810762	1.000000	0.71417	0.982000	0.44146	0.979000	0.70002	5.458000	0.66679	0.982000	0.38575	0.561000	0.74099	GCC	GPR137	-	NULL	ENSG00000173264		0.612	GPR137-003	KNOWN	basic|CCDS	protein_coding	GPR137	HGNC	protein_coding	OTTHUMT00000396412.1	36	0.00	0	G	NM_020155		64054186	64054186	+1	no_errors	ENST00000313074	ensembl	human	known	69_37n	missense	32	34.69	17	SNP	0.996	C
GUCY1A2	2977	genome.wustl.edu	37	11	106681104	106681104	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr11:106681104C>T	ENST00000526355.2	-	5	1775	c.1307G>A	c.(1306-1308)cGa>cAa	p.R436Q	GUCY1A2_ENST00000282249.2_Missense_Mutation_p.R436Q|GUCY1A2_ENST00000347596.2_Missense_Mutation_p.R457Q	NM_000855.2	NP_000846.1	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	436					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|positive regulation of cGMP biosynthetic process (GO:0030828)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)			breast(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(18)|liver(1)|lung(32)|ovary(1)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	74		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	Isosorbide Mononitrate(DB01020)|Nitric Oxide(DB00435)	ATGTAGCCCTCGGCCCATGAG	0.463																																						dbGAP											0													95.0	94.0	94.0					11																	106681104		2201	4298	6499	-	-	-	SO:0001583	missense	0			X63282	CCDS8335.1, CCDS58170.1	11q21-q22	2008-03-18			ENSG00000152402	ENSG00000152402	4.6.1.2		4684	protein-coding gene	gene with protein product		601244		GUC1A2		1683630	Standard	NM_000855		Approved	GC-SA2	uc001pjg.2	P33402	OTTHUMG00000166296	ENST00000526355.2:c.1307G>A	11.37:g.106681104C>T	ENSP00000431245:p.Arg436Gln		A1L4C4|B7ZLT5	Missense_Mutation	SNP	pfam_Haem_no_assoc-bd,pfam_A/G_cyclase,pfam_Heme_NO-bd,superfamily_A/G_cyclase,superfamily_NO_sig/Golgi_transp_ligand-bd,smart_A/G_cyclase,pfscan_A/G_cyclase	p.R436Q	ENST00000526355.2	37	c.1307	CCDS8335.1	11	.	.	.	.	.	.	.	.	.	.	C	32	5.139307	0.94560	.	.	ENSG00000152402	ENST00000526355;ENST00000282249;ENST00000347596	D;D;D	0.88586	-2.4;-2.4;-2.4	5.64	5.64	0.86602	Haem NO binding associated (1);	0.000000	0.38959	U	0.001502	D	0.93255	0.7851	L	0.58302	1.8	0.80722	D	1	D;D;D	0.89917	1.0;0.997;1.0	D;P;D	0.75020	0.985;0.843;0.928	D	0.92462	0.5978	10	0.44086	T	0.13	.	18.6821	0.91549	0.0:1.0:0.0:0.0	.	457;436;436	B7ZLT5;P33402-2;P33402	.;.;GCYA2_HUMAN	Q	436;436;457	ENSP00000431245:R436Q;ENSP00000282249:R436Q;ENSP00000344874:R457Q	ENSP00000282249:R436Q	R	-	2	0	GUCY1A2	106186314	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.644000	0.89710	0.650000	0.86243	CGA	GUCY1A2	-	pfam_Haem_no_assoc-bd	ENSG00000152402		0.463	GUCY1A2-001	KNOWN	basic|CCDS	protein_coding	GUCY1A2	HGNC	protein_coding	OTTHUMT00000389003.2	50	0.00	0	C			106681104	106681104	-1	no_errors	ENST00000282249	ensembl	human	known	69_37n	missense	44	15.38	8	SNP	1.000	T
HIST1H2BC	8347	genome.wustl.edu	37	6	26124000	26124000	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr6:26124000C>G	ENST00000314332.5	-	1	138	c.133G>C	c.(133-135)Gtg>Ctg	p.V45L	HIST1H2AC_ENST00000377791.2_5'Flank|HIST1H2BC_ENST00000396984.1_Missense_Mutation_p.V45L|HIST1H2AC_ENST00000602637.1_5'Flank			P62807	H2B1C_HUMAN	histone cluster 1, H2bc	45					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	16						TGTTTCAGCACCTTGTACACG	0.532																																						dbGAP											0													215.0	190.0	199.0					6																	26124000		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z80783	CCDS4584.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000180596	ENSG00000180596		"""Histones / Replication-dependent"""	4757	protein-coding gene	gene with protein product		602847	"""H2B histone family, member L"", ""histone 1, H2bc"""	H2BFL		9119399, 12408966	Standard	NM_003526		Approved	H2B/l, H2B.1	uc003ngl.3	P62807	OTTHUMG00000014425	ENST00000314332.5:c.133G>C	6.37:g.26124000C>G	ENSP00000321744:p.Val45Leu		P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.V45L	ENST00000314332.5	37	c.133	CCDS4584.1	6	.	.	.	.	.	.	.	.	.	.	.	17.93	3.509614	0.64522	.	.	ENSG00000180596	ENST00000314332;ENST00000396984	T;T	0.69435	-0.4;-0.4	5.76	5.76	0.90799	Histone-fold (2);Histone core (1);	.	.	.	.	T	0.54191	0.1843	.	.	.	0.43439	D	0.995616	B	0.19583	0.037	B	0.22880	0.042	T	0.53837	-0.8382	8	0.72032	D	0.01	.	19.3155	0.94211	0.0:1.0:0.0:0.0	.	45	P62807	H2B1C_HUMAN	L	45	ENSP00000321744:V45L;ENSP00000380180:V45L	ENSP00000321744:V45L	V	-	1	0	HIST1H2BC	26231979	1.000000	0.71417	1.000000	0.80357	0.238000	0.25445	5.858000	0.69532	2.879000	0.98667	0.650000	0.86243	GTG	HIST1H2BC	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	ENSG00000180596		0.532	HIST1H2BC-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BC	HGNC	protein_coding	OTTHUMT00000468022.1	67	0.00	0	C	NM_003526		26124000	26124000	-1	no_errors	ENST00000314332	ensembl	human	known	69_37n	missense	94	28.24	37	SNP	1.000	G
IGDCC3	9543	genome.wustl.edu	37	15	65627716	65627716	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr15:65627716G>A	ENST00000327987.4	-	4	849	c.598C>T	c.(598-600)Cga>Tga	p.R200*	IGDCC3_ENST00000559231.1_5'Flank	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	200	Ig-like C2-type 2.				neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)		p.R200*(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TCCTCAGCTCGAAGTCCTGTG	0.582																																						dbGAP											1	Substitution - Nonsense(1)	large_intestine(1)											162.0	142.0	149.0					15																	65627716		2201	4299	6500	-	-	-	SO:0001587	stop_gained	0			AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.598C>T	15.37:g.65627716G>A	ENSP00000332773:p.Arg200*		O95215	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.R200*	ENST00000327987.4	37	c.598	CCDS10205.1	15	.	.	.	.	.	.	.	.	.	.	G	27.7	4.858013	0.91433	.	.	ENSG00000174498	ENST00000327987;ENST00000443278	.	.	.	5.51	2.48	0.30137	.	0.075525	0.50627	D	0.000107	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.8499	6.7747	0.23613	0.1552:0.0:0.7013:0.1435	.	.	.	.	X	200;63	.	ENSP00000332773:R200X	R	-	1	2	IGDCC3	63414769	0.992000	0.36948	0.174000	0.22961	0.404000	0.30871	2.704000	0.47118	0.692000	0.31613	-0.136000	0.14681	CGA	IGDCC3	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000174498		0.582	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGDCC3	HGNC	protein_coding	OTTHUMT00000256826.1	23	0.00	0	G	NM_004884		65627716	65627716	-1	no_errors	ENST00000327987	ensembl	human	known	69_37n	nonsense	14	48.15	13	SNP	0.966	A
IL10RA	3587	genome.wustl.edu	37	11	117859104	117859104	+	Silent	SNP	G	G	A	rs150140303	byFrequency	TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr11:117859104G>A	ENST00000227752.3	+	2	195	c.75G>A	c.(73-75)gaG>gaA	p.E25E	IL10RA_ENST00000541785.1_Silent_p.E5E|IL10RA_ENST00000533700.1_3'UTR|IL10RA_ENST00000545409.1_De_novo_Start_OutOfFrame	NM_001558.3	NP_001549.2	Q13651	I10R1_HUMAN	interleukin 10 receptor, alpha	25					cytokine-mediated signaling pathway (GO:0019221)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-10 receptor activity (GO:0004920)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)|Epithelial(105;0.00108)		CAGGGACAGAGCTGCCCAGCC	0.532																																						dbGAP											0													112.0	108.0	110.0					11																	117859104		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			U00672	CCDS8388.1	11q23	2014-09-17			ENSG00000110324	ENSG00000110324		"""Interleukins and interleukin receptors"", ""CD molecules"""	5964	protein-coding gene	gene with protein product		146933		IL10R		8120391	Standard	NR_026691		Approved	HIL-10R, CDW210A, CD210a, CD210	uc001prv.3	Q13651	OTTHUMG00000166523	ENST00000227752.3:c.75G>A	11.37:g.117859104G>A			A8K6I0|B0YJ27	Silent	SNP	superfamily_Fibronectin_type3	p.E25	ENST00000227752.3	37	c.75	CCDS8388.1	11																																																																																			IL10RA	-	superfamily_Fibronectin_type3	ENSG00000110324		0.532	IL10RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL10RA	HGNC	protein_coding	OTTHUMT00000390167.1	33	0.00	0	G			117859104	117859104	+1	no_errors	ENST00000227752	ensembl	human	known	69_37n	silent	24	42.86	18	SNP	0.816	A
IL19	29949	genome.wustl.edu	37	1	206972245	206972245	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr1:206972245C>A	ENST00000340758.2	+	1	31	c.6C>A	c.(4-6)tgC>tgA	p.C2*		NM_153758.2	NP_715639.1	Q9UHD0	IL19_HUMAN	interleukin 19	0					apoptotic process (GO:0006915)|immune response (GO:0006955)|interleukin-6 biosynthetic process (GO:0042226)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|reactive oxygen species metabolic process (GO:0072593)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)			central_nervous_system(2)|large_intestine(1)|lung(2)|ovary(1)|stomach(1)	7			BRCA - Breast invasive adenocarcinoma(75;0.211)			CAAGAATGTGCACTGAGGGAG	0.498																																						dbGAP											0													160.0	127.0	138.0					1																	206972245		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF192498	CCDS1468.1, CCDS1469.1	1q32.2	2008-07-18			ENSG00000142224	ENSG00000142224		"""Interleukins and interleukin receptors"""	5990	protein-coding gene	gene with protein product	"""melanoma differentiation associated protein-like protein"""	605687				11196675	Standard	NM_153758		Approved	IL-19, MDA1, ZMDA1, IL-10C, NG.1	uc001heo.3	Q9UHD0	OTTHUMG00000036387	ENST00000340758.2:c.6C>A	1.37:g.206972245C>A	ENSP00000343000:p.Cys2*		B6VEV9|Q5VUT3|Q96QR4|Q9NUA0	Nonsense_Mutation	SNP	pfam_Interleukin-10/19/20/24,superfamily_4_helix_cytokine-like_core,prints_Interleukin-19,prints_Interleukin-24	p.C2*	ENST00000340758.2	37	c.6	CCDS1468.1	1	.	.	.	.	.	.	.	.	.	.	C	15.30	2.793464	0.50102	.	.	ENSG00000142224	ENST00000340758	.	.	.	4.15	-8.3	0.01005	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.8119	0.40828	0.0:0.1551:0.1958:0.6491	.	.	.	.	X	2	.	ENSP00000343000:C2X	C	+	3	2	IL19	205038868	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.046000	0.01409	-2.592000	0.00456	-0.150000	0.13652	TGC	IL19	-	NULL	ENSG00000142224		0.498	IL19-001	KNOWN	basic|CCDS	protein_coding	IL19	HGNC	protein_coding	OTTHUMT00000088566.3	34	0.00	0	C	NM_153758		206972245	206972245	+1	no_errors	ENST00000340758	ensembl	human	known	69_37n	nonsense	25	28.57	10	SNP	0.000	A
INPP5A	3632	genome.wustl.edu	37	10	134523866	134523866	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr10:134523866C>T	ENST00000368594.3	+	8	830	c.553C>T	c.(553-555)Ctt>Ttt	p.L185F	INPP5A_ENST00000368593.3_Missense_Mutation_p.L185F|INPP5A_ENST00000487614.1_3'UTR	NM_005539.3	NP_005530.3	Q14642	I5P1_HUMAN	inositol polyphosphate-5-phosphatase, 40kDa	185					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol dephosphorylation (GO:0046856)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inositol-1,3,4,5-tetrakisphosphate 5-phosphatase activity (GO:0052659)|inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|inositol-polyphosphate 5-phosphatase activity (GO:0004445)|PH domain binding (GO:0042731)			cervix(1)|kidney(1)|large_intestine(2)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		all_cancers(35;8.59e-13)|all_epithelial(44;5.49e-09)|Lung NSC(174;0.000854)|all_lung(145;0.00146)|all_neural(114;0.0299)|Colorectal(31;0.0599)|Breast(234;0.0849)|Melanoma(40;0.124)|all_hematologic(284;0.196)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;0.000102)|Epithelial(32;0.00023)|all cancers(32;0.000326)		GAATATCCATCTTTTCCATGA	0.547																																					Pancreas(63;823 1267 11107 20380 51626)	dbGAP											0													96.0	77.0	84.0					10																	134523866		2203	4300	6503	-	-	-	SO:0001583	missense	0			X77567	CCDS7669.2	10q26.3	2008-08-07	2002-08-29		ENSG00000068383	ENSG00000068383	3.1.3.56		6076	protein-coding gene	gene with protein product	"""CTCL tumor antigen HD-CL-02"", ""43 kDa inositol polyphosphate 5-phophatase"", ""inositol polyphosphate 5-phophatase, 40kDa"", ""InsP3 5-phosphatase"", ""type I inositol-1,4,5-trisphosphate 5-phosphatase"""	600106	"""inositol polyphosphate-5-phosphatase, 40kD"""			8013665	Standard	NM_005539		Approved	5PTASE	uc001llp.3	Q14642	OTTHUMG00000019293	ENST00000368594.3:c.553C>T	10.37:g.134523866C>T	ENSP00000357583:p.Leu185Phe		D3DXI3|Q14640|Q5JSF1	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc	p.L185F	ENST00000368594.3	37	c.553	CCDS7669.2	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.5|24.5	4.534374|4.534374	0.85812|0.85812	.|.	.|.	ENSG00000068383|ENSG00000068383	ENST00000368594;ENST00000368593;ENST00000416326;ENST00000536599;ENST00000432898;ENST00000423490|ENST00000342652	T;T;T|.	0.55413|.	0.52;0.52;0.52|.	4.38|4.38	4.38|4.38	0.52667|0.52667	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);|.	0.135610|.	0.51477|.	D|.	0.000088|.	T|T	0.74306|0.74306	0.3699|0.3699	M|M	0.71296|0.71296	2.17|2.17	0.80722|0.80722	D|D	1|1	D;D;D|.	0.76494|.	0.995;0.994;0.999|.	D;P;D|.	0.87578|.	0.991;0.882;0.998|.	T|T	0.75560|0.75560	-0.3275|-0.3275	9|5	.|.	.|.	.|.	-11.9279|-11.9279	17.3832|17.3832	0.87409|0.87409	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	185;185;185|.	F5GWM1;Q14642;Q5T1B5|.	.;I5P1_HUMAN;.|.	F|F	185;185;185;122;102;108|156	ENSP00000357583:L185F;ENSP00000357582:L185F;ENSP00000390936:L108F|.	.|.	L|S	+|+	1|2	0|0	INPP5A|INPP5A	134373856|134373856	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	5.109000|5.109000	0.64615|0.64615	2.177000|2.177000	0.69029|0.69029	0.650000|0.650000	0.86243|0.86243	CTT|TCT	INPP5A	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc	ENSG00000068383		0.547	INPP5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP5A	HGNC	protein_coding	OTTHUMT00000051085.1	39	0.00	0	C	NM_005539		134523866	134523866	+1	no_errors	ENST00000368594	ensembl	human	known	69_37n	missense	53	36.90	31	SNP	1.000	T
INTS7	25896	genome.wustl.edu	37	1	212141942	212141942	+	Silent	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr1:212141942C>T	ENST00000366994.3	-	14	2027	c.1923G>A	c.(1921-1923)ctG>ctA	p.L641L	INTS7_ENST00000469606.1_5'UTR|INTS7_ENST00000366993.3_Silent_p.L641L|INTS7_ENST00000366992.3_Silent_p.L641L|INTS7_ENST00000440600.2_Silent_p.L592L	NM_001199811.1|NM_001199812.1|NM_015434.3	NP_001186740.1|NP_001186741.1|NP_056249.1	Q9NVH2	INT7_HUMAN	integrator complex subunit 7	641					cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|snRNA processing (GO:0016180)	chromosome (GO:0005694)|integrator complex (GO:0032039)				NS(1)|breast(1)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(81;0.00584)|all cancers(67;0.0318)|Epithelial(68;0.0852)		GGCTTGTCTTCAGGCTATTAC	0.433																																						dbGAP											0													143.0	126.0	132.0					1																	212141942		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK022509	CCDS1501.1, CCDS55684.1, CCDS55683.1, CCDS55685.1	1q32.3	2008-02-05	2006-03-15	2006-03-15	ENSG00000143493	ENSG00000143493			24484	protein-coding gene	gene with protein product		611350	"""chromosome 1 open reading frame 73"""	C1orf73		16239144	Standard	NM_015434		Approved	DKFZP434B168, INT7	uc001hiw.2	Q9NVH2	OTTHUMG00000037119	ENST00000366994.3:c.1923G>A	1.37:g.212141942C>T			B4DLZ6|B7WNP6|B7WPB6|Q8N4K7|Q8WUH5|Q9H9V3|Q9NVU5|Q9UFC6|Q9UFM3	Silent	SNP	superfamily_ARM-type_fold	p.L641	ENST00000366994.3	37	c.1923	CCDS1501.1	1																																																																																			INTS7	-	NULL	ENSG00000143493		0.433	INTS7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	INTS7	HGNC	protein_coding	OTTHUMT00000090142.1	33	0.00	0	C	NM_015434		212141942	212141942	-1	no_errors	ENST00000366994	ensembl	human	known	69_37n	silent	41	26.79	15	SNP	0.652	T
KIAA2022	340533	genome.wustl.edu	37	X	73962009	73962009	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chrX:73962009C>T	ENST00000055682.6	-	3	2994	c.2383G>A	c.(2383-2385)Gaa>Aaa	p.E795K		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	795					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						AAAGGCATTTCAGAAGAGCAT	0.413																																						dbGAP											0													110.0	102.0	105.0					X																	73962009		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.2383G>A	X.37:g.73962009C>T	ENSP00000055682:p.Glu795Lys		A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	NULL	p.E795K	ENST00000055682.6	37	c.2383	CCDS35337.1	X	.	.	.	.	.	.	.	.	.	.	C	15.35	2.806860	0.50421	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.33438	1.41;1.41	5.73	5.73	0.89815	.	0.261879	0.43919	D	0.000506	T	0.24198	0.0586	N	0.22421	0.69	0.40843	D	0.983689	P	0.41848	0.763	B	0.35770	0.21	T	0.07139	-1.0788	10	0.66056	D	0.02	-17.421	18.9182	0.92515	0.0:1.0:0.0:0.0	.	795	Q5QGS0	K2022_HUMAN	K	795	ENSP00000362567:E795K;ENSP00000055682:E795K	ENSP00000055682:E795K	E	-	1	0	KIAA2022	73878734	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	4.440000	0.59975	2.415000	0.81967	0.600000	0.82982	GAA	KIAA2022	-	NULL	ENSG00000050030		0.413	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA2022	HGNC	protein_coding	OTTHUMT00000057270.2	31	0.00	0	C	NM_001008537		73962009	73962009	-1	no_errors	ENST00000055682	ensembl	human	known	69_37n	missense	32	17.95	7	SNP	1.000	T
KIAA2022	340533	genome.wustl.edu	37	X	73964065	73964065	+	Silent	SNP	C	C	T	rs201978990		TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chrX:73964065C>T	ENST00000055682.6	-	3	938	c.327G>A	c.(325-327)ctG>ctA	p.L109L		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	109					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						ACCATGTGTTCAGGCCTTTTG	0.517																																						dbGAP											0													111.0	100.0	104.0					X																	73964065		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.327G>A	X.37:g.73964065C>T			A7YY87|Q5JUX9|Q8IVE9	Silent	SNP	NULL	p.L109	ENST00000055682.6	37	c.327	CCDS35337.1	X																																																																																			KIAA2022	-	NULL	ENSG00000050030		0.517	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA2022	HGNC	protein_coding	OTTHUMT00000057270.2	38	0.00	0	C	NM_001008537		73964065	73964065	-1	no_errors	ENST00000055682	ensembl	human	known	69_37n	silent	41	12.77	6	SNP	1.000	T
MAGEA4	4103	genome.wustl.edu	37	X	151092751	151092751	+	Silent	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chrX:151092751C>T	ENST00000360243.2	+	3	882	c.615C>T	c.(613-615)atC>atT	p.I205I	MAGEA4_ENST00000370340.3_Silent_p.I205I|MAGEA4_ENST00000370335.1_Silent_p.I205I|MAGEA4_ENST00000393921.1_Silent_p.I205I|MAGEA4_ENST00000370337.4_Silent_p.I205I|MAGEA4_ENST00000276344.2_Silent_p.I205I|MAGEA4_ENST00000393920.1_Silent_p.I205I	NM_001011550.1	NP_001011550.1	P43358	MAGA4_HUMAN	melanoma antigen family A, 4	205	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(2)|central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)	27	Acute lymphoblastic leukemia(192;6.56e-05)					TTCTGATAATCGTCCTGGGCA	0.562																																						dbGAP											0													100.0	102.0	101.0					X																	151092751		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14702.1	Xq28	2009-03-13			ENSG00000147381	ENSG00000147381			6802	protein-coding gene	gene with protein product	"""melanoma-associated antigen 4"", ""cancer/testis antigen family 1, member 4"""	300175		MAGE4		8575766	Standard	XM_005274677		Approved	MAGE4A, MAGE4B, MAGE-41, MAGE-X2, MGC21336, CT1.4	uc004ffa.3	P43358	OTTHUMG00000024174	ENST00000360243.2:c.615C>T	X.37:g.151092751C>T			Q14798	Silent	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.I205	ENST00000360243.2	37	c.615	CCDS14702.1	X																																																																																			MAGEA4	-	pfam_MAGE,pfscan_MAGE	ENSG00000147381		0.562	MAGEA4-010	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEA4	HGNC	protein_coding	OTTHUMT00000060898.1	60	0.00	0	C	NM_002362		151092751	151092751	+1	no_errors	ENST00000276344	ensembl	human	known	69_37n	silent	83	10.75	10	SNP	0.000	T
MED1	5469	genome.wustl.edu	37	17	37590562	37590562	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr17:37590562A>G	ENST00000394287.3	-	7	645	c.440T>C	c.(439-441)tTt>tCt	p.F147S	MED1_ENST00000300651.6_Missense_Mutation_p.F147S			O95243	MBD4_HUMAN	mediator complex subunit 1	0	MBD. {ECO:0000255|PROSITE- ProRule:PRU00338}.				base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		AAATTCATCAAAATTTTTTTC	0.318										HNSCC(31;0.082)																											Pancreas(21;279 768 2492 4877 24026)	dbGAP											0													45.0	47.0	47.0					17																	37590562		2201	4297	6498	-	-	-	SO:0001583	missense	0			L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000394287.3:c.440T>C	17.37:g.37590562A>G	ENSP00000377828:p.Phe147Ser		B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	pfam_Mediator_Med1_met/fun	p.F147S	ENST00000394287.3	37	c.440		17	.	.	.	.	.	.	.	.	.	.	A	25.3	4.624862	0.87560	.	.	ENSG00000125686	ENST00000394287;ENST00000300651	T	0.59502	0.26	5.78	5.78	0.91487	Mediator complex, subunit Med1, metazoa/fungi (1);	.	.	.	.	T	0.77418	0.4127	M	0.81497	2.545	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.79108	0.992;0.961	T	0.80832	-0.1206	9	0.87932	D	0	-13.8184	15.7642	0.78114	1.0:0.0:0.0:0.0	.	147;147	Q15648;Q15648-3	MED1_HUMAN;.	S	147	ENSP00000300651:F147S	ENSP00000300651:F147S	F	-	2	0	MED1	34844088	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.308000	0.89966	2.198000	0.70561	0.455000	0.32223	TTT	MED1	-	pfam_Mediator_Med1_met/fun	ENSG00000125686		0.318	MED1-002	PUTATIVE	basic|exp_conf	protein_coding	MED1	HGNC	protein_coding	OTTHUMT00000256944.1	40	0.00	0	A	NM_004774		37590562	37590562	-1	no_errors	ENST00000300651	ensembl	human	known	69_37n	missense	23	32.35	11	SNP	1.000	G
MORC1	27136	genome.wustl.edu	37	3	108724021	108724021	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr3:108724021C>G	ENST00000483760.1	-	18	1889	c.1846G>C	c.(1846-1848)Gaa>Caa	p.E616Q	MORC1_ENST00000232603.5_Missense_Mutation_p.E637Q					MORC family CW-type zinc finger 1											breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						ATTTTTGTTTCTGAAATATAC	0.388																																						dbGAP											0													82.0	85.0	84.0					3																	108724021		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.1846G>C	3.37:g.108724021C>G	ENSP00000417282:p.Glu616Gln			Missense_Mutation	SNP	pfam_Znf_CW,superfamily_ATPase-like_ATP-bd,pfscan_Znf_CW	p.E637Q	ENST00000483760.1	37	c.1909		3	.	.	.	.	.	.	.	.	.	.	C	8.475	0.858470	0.17178	.	.	ENSG00000114487	ENST00000232603;ENST00000483760	T;T	0.06449	3.3;3.32	4.33	2.5	0.30297	.	0.473988	0.17894	N	0.158414	T	0.04363	0.0120	L	0.27053	0.805	0.09310	N	1	B;B	0.33694	0.421;0.062	B;B	0.33042	0.157;0.016	T	0.43294	-0.9400	10	0.20046	T	0.44	-1.3797	7.453	0.27250	0.0:0.8149:0.0:0.1851	.	616;637	E7ERX1;Q86VD1	.;MORC1_HUMAN	Q	637;616	ENSP00000232603:E637Q;ENSP00000417282:E616Q	ENSP00000232603:E637Q	E	-	1	0	MORC1	110206711	0.035000	0.19736	0.043000	0.18650	0.015000	0.08874	0.926000	0.28804	0.740000	0.32651	0.557000	0.71058	GAA	MORC1	-	NULL	ENSG00000114487		0.388	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	MORC1	HGNC	protein_coding	OTTHUMT00000353844.1	49	0.00	0	C			108724021	108724021	-1	no_errors	ENST00000232603	ensembl	human	known	69_37n	missense	59	30.59	26	SNP	0.059	G
MST1L	11223	genome.wustl.edu	37	1	17083838	17083838	+	RNA	SNP	C	C	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr1:17083838C>A	ENST00000455405.2	-	0	750							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										TAATTCCTTTCAGGACCCAGC	0.572																																						dbGAP											0																																										-	-	-			0			U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17083838C>A			B7WPB1|Q13209	Silent	SNP	pfam_Kringle,pfam_Peptidase_S1_S6,pfam_PAN-1_domain,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1_S6,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1_S6	p.L653	ENST00000455405.2	37	c.1959		1																																																																																			MST1P9	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000186715		0.572	MST1L-002	KNOWN	basic	processed_transcript	MST1P9	HGNC	pseudogene	OTTHUMT00000400328.1	32	0.00	0	C	NM_001271733		17083838	17083838	-1	no_errors	ENST00000334998	ensembl	human	known	69_37n	silent	25	16.67	5	SNP	1.000	A
MUC12	10071	genome.wustl.edu	37	7	100648336	100648336	+	Nonsense_Mutation	SNP	C	C	G			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr7:100648336C>G	ENST00000379442.3	+	5	14921	c.14921C>G	c.(14920-14922)tCa>tGa	p.S4974*	MUC12_ENST00000536621.1_Nonsense_Mutation_p.S4831*			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	4974	Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						CAACCAGGCTCAGCTCTGTCA	0.532																																						dbGAP											0													189.0	166.0	173.0					7																	100648336		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.14921C>G	7.37:g.100648336C>G	ENSP00000368755:p.Ser4974*		A6ND38|F5GWV9|Q9UKN0	Nonsense_Mutation	SNP	pfam_SEA	p.S4974*	ENST00000379442.3	37	c.14921		7	.	.	.	.	.	.	.	.	.	.	C	53	20.825934	0.99934	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	.	.	.	0.663	0.663	0.17885	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	7.1813	0.25774	0.0:0.9999:0.0:1.0E-4	.	.	.	.	X	4974;4831	.	ENSP00000368755:S4974X	S	+	2	0	MUC12	100435056	0.006000	0.16342	0.001000	0.08648	0.002000	0.02628	1.711000	0.37930	0.641000	0.30601	0.430000	0.28490	TCA	MUC12	-	NULL	ENSG00000205277		0.532	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	74	0.00	0	C	XM_379904		100648336	100648336	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	nonsense	89	20.54	23	SNP	0.003	G
NOS1	4842	genome.wustl.edu	37	12	117696209	117696209	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr12:117696209C>G	ENST00000338101.4	-	15	2528	c.2524G>C	c.(2524-2526)Gaa>Caa	p.E842Q	NOS1_ENST00000317775.6_Missense_Mutation_p.E842Q|NOS1_ENST00000344089.3_3'UTR			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		TACTTCCTTTCTTCCTGCACA	0.488																																					Esophageal Squamous(162;1748 2599 51982 52956)	dbGAP											0													90.0	88.0	88.0					12																	117696209		1956	4131	6087	-	-	-	SO:0001583	missense	0				CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.2524G>C	12.37:g.117696209C>G	ENSP00000337459:p.Glu842Gln			Missense_Mutation	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,pfam_PDZ,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,superfamily_PDZ,smart_PDZ,pirsf_NOS_met,pfscan_PDZ,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.E842Q	ENST00000338101.4	37	c.2524	CCDS55890.1	12	.	.	.	.	.	.	.	.	.	.	C	14.50	2.554571	0.45487	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000541241;ENST00000338101;ENST00000544320	T;T	0.58358	0.34;4.91	5.42	5.42	0.78866	Flavodoxin/nitric oxide synthase (2);	0.047323	0.85682	D	0.000000	T	0.44222	0.1283	L	0.32530	0.975	0.80722	D	1	B	0.16166	0.016	B	0.25405	0.06	T	0.33979	-0.9847	10	0.10111	T	0.7	-22.8766	18.8369	0.92167	0.0:1.0:0.0:0.0	.	842	P29475	NOS1_HUMAN	Q	737;842;842;842;8	ENSP00000320758:E842Q;ENSP00000337459:E842Q	ENSP00000320758:E842Q	E	-	1	0	NOS1	116180592	1.000000	0.71417	0.998000	0.56505	0.861000	0.49209	6.906000	0.75719	2.537000	0.85549	0.655000	0.94253	GAA	NOS1	-	pfam_Flavodoxin/NO_synth,pirsf_NOS_met,pfscan_Flavodoxin/NO_synth	ENSG00000089250		0.488	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	NOS1	HGNC	protein_coding	OTTHUMT00000268053.1	46	0.00	0	C			117696209	117696209	-1	no_errors	ENST00000317775	ensembl	human	known	69_37n	missense	62	12.68	9	SNP	1.000	G
NT5M	56953	genome.wustl.edu	37	17	17248215	17248215	+	Silent	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr17:17248215C>T	ENST00000389022.4	+	4	753	c.537C>T	c.(535-537)gaC>gaT	p.D179D	NT5M_ENST00000582909.1_3'UTR	NM_020201.3	NP_064586.1	Q9NPB1	NT5M_HUMAN	5',3'-nucleotidase, mitochondrial	179					dephosphorylation (GO:0016311)|DNA replication (GO:0006260)|dUMP catabolic process (GO:0046079)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine deoxyribonucleotide catabolic process (GO:0009223)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotidase activity (GO:0008252)|nucleotide binding (GO:0000166)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4						ACCGGCCGGACATCACAGGCA	0.612																																						dbGAP											0													96.0	80.0	85.0					17																	17248215		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF210652	CCDS32581.1	17p11.2	2007-08-01	2002-05-23		ENSG00000205309	ENSG00000205309	3.1.3.5		15769	protein-coding gene	gene with protein product		605292	"""5' nucleotidase, mitochondrial"""			10899995	Standard	XM_005256731		Approved	dNT-2, dNT2, mdN	uc002grf.3	Q9NPB1	OTTHUMG00000059277	ENST00000389022.4:c.537C>T	17.37:g.17248215C>T				Silent	SNP	pfam_5'(3')-deoxyribonucleotidase,superfamily_HAD-like_dom	p.D179	ENST00000389022.4	37	c.537	CCDS32581.1	17																																																																																			NT5M	-	pfam_5'(3')-deoxyribonucleotidase,superfamily_HAD-like_dom	ENSG00000205309		0.612	NT5M-007	KNOWN	basic|appris_principal|CCDS	protein_coding	NT5M	HGNC	protein_coding	OTTHUMT00000446045.1	30	0.00	0	C			17248215	17248215	+1	no_errors	ENST00000389022	ensembl	human	known	69_37n	silent	23	41.46	17	SNP	1.000	T
OGT	8473	genome.wustl.edu	37	X	70776923	70776923	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chrX:70776923G>A	ENST00000373719.3	+	10	1505	c.1288G>A	c.(1288-1290)Gat>Aat	p.D430N	OGT_ENST00000373701.3_Missense_Mutation_p.D420N	NM_181672.2|NM_181673.2	NP_858058.1|NP_858059.1	O15294	OGT1_HUMAN	O-linked N-acetylglucosamine (GlcNAc) transferase	430					apoptotic process (GO:0006915)|cellular response to retinoic acid (GO:0071300)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of protein ubiquitination (GO:0031397)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of catalytic activity (GO:0043085)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glycolytic process (GO:0006110)|regulation of insulin receptor signaling pathway (GO:0046626)|regulation of Rac protein signal transduction (GO:0035020)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone acetyltransferase complex (GO:0000123)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)|MLL5-L complex (GO:0070688)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	acetylglucosaminyltransferase activity (GO:0008375)|enzyme activator activity (GO:0008047)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein N-acetylglucosaminyltransferase activity (GO:0016262)|protein O-GlcNAc transferase activity (GO:0097363)			breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|liver(3)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Renal(35;0.156)					TGCATTTGCAGATGCACATAG	0.373																																						dbGAP											0													86.0	67.0	73.0					X																	70776923		2203	4300	6503	-	-	-	SO:0001583	missense	0			U77413	CCDS14414.1, CCDS35502.1	Xq13	2013-07-24	2012-05-04		ENSG00000147162	ENSG00000147162	2.4.1.255	"""Tetratricopeptide (TTC) repeat domain containing"""	8127	protein-coding gene	gene with protein product	"""UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase"""	300255	"""O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)"""			9083068	Standard	NM_181672		Approved	O-GLCNAC, HRNT1, MGC22921, FLJ23071	uc004eaa.2	O15294	OTTHUMG00000033316	ENST00000373719.3:c.1288G>A	X.37:g.70776923G>A	ENSP00000362824:p.Asp430Asn		Q7Z3K0|Q8WWM8|Q96CC1|Q9UG57	Missense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.D430N	ENST00000373719.3	37	c.1288	CCDS14414.1	X	.	.	.	.	.	.	.	.	.	.	G	31	5.073703	0.94000	.	.	ENSG00000147162	ENST00000373719;ENST00000373701	T;T	0.59364	0.27;0.27	5.54	5.54	0.83059	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.70351	0.3214	L	0.45285	1.41	0.80722	D	1	D;D;D	0.89917	0.991;0.994;1.0	D;D;D	0.80764	0.96;0.994;0.984	T	0.69165	-0.5217	10	0.45353	T	0.12	-10.1471	18.4676	0.90761	0.0:0.0:1.0:0.0	.	304;420;430	Q548W1;O15294-3;O15294	.;.;OGT1_HUMAN	N	430;420	ENSP00000362824:D430N;ENSP00000362805:D420N	ENSP00000362805:D420N	D	+	1	0	OGT	70693648	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.582000	0.98214	2.557000	0.86248	0.594000	0.82650	GAT	OGT	-	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000147162		0.373	OGT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OGT	HGNC	protein_coding	OTTHUMT00000081829.3	40	0.00	0	G	NM_003605, NM_181672		70776923	70776923	+1	no_errors	ENST00000373719	ensembl	human	known	69_37n	missense	44	20.00	11	SNP	1.000	A
OR6C6	283365	genome.wustl.edu	37	12	55688858	55688858	+	Silent	SNP	G	G	C	rs201362654	byFrequency	TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr12:55688858G>C	ENST00000358433.2	-	1	158	c.159C>G	c.(157-159)ctC>ctG	p.L53L		NM_001005493.1	NP_001005493.1	A6NF89	OR6C6_HUMAN	olfactory receptor, family 6, subfamily C, member 6	53						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						TTGGCGTCTTGAGCCGGGGAT	0.403													G|||	3	0.000599042	0.0	0.0	5008	,	,		15986	0.003		0.0	False		,,,				2504	0.0					dbGAP											0													84.0	86.0	85.0					12																	55688858		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS31817.1	12q13.13	2012-08-09			ENSG00000188324	ENSG00000188324		"""GPCR / Class A : Olfactory receptors"""	31293	protein-coding gene	gene with protein product							Standard	NM_001005493		Approved		uc010sph.2	A6NF89	OTTHUMG00000168101	ENST00000358433.2:c.159C>G	12.37:g.55688858G>C				Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L53	ENST00000358433.2	37	c.159	CCDS31817.1	12																																																																																			OR6C6	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000188324		0.403	OR6C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C6	HGNC	protein_coding	OTTHUMT00000398151.1	26	0.00	0	G			55688858	55688858	-1	no_errors	ENST00000358433	ensembl	human	known	69_37n	silent	39	27.78	15	SNP	0.077	C
OR6Y1	391112	genome.wustl.edu	37	1	158517323	158517323	+	Missense_Mutation	SNP	G	G	C	rs528185495	byFrequency	TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr1:158517323G>C	ENST00000302617.3	-	1	572	c.573C>G	c.(571-573)aaC>aaG	p.N191K		NM_001005189.1	NP_001005189.1	Q8NGX8	OR6Y1_HUMAN	olfactory receptor, family 6, subfamily Y, member 1	191						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_hematologic(112;0.0378)					CACAGGAGACGTTAAGGAGTG	0.463																																						dbGAP											0													74.0	65.0	68.0					1																	158517323		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK004192	CCDS30899.1	1q23.1	2012-08-09			ENSG00000197532	ENSG00000197532		"""GPCR / Class A : Olfactory receptors"""	14823	protein-coding gene	gene with protein product				OR6Y2			Standard	NM_001005189		Approved		uc010pil.2	Q8NGX8	OTTHUMG00000019629	ENST00000302617.3:c.573C>G	1.37:g.158517323G>C	ENSP00000304807:p.Asn191Lys		Q6IFS0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.N191K	ENST00000302617.3	37	c.573	CCDS30899.1	1	.	.	.	.	.	.	.	.	.	.	G	6.337	0.430251	0.12045	.	.	ENSG00000197532	ENST00000302617	T	0.00015	9.17	5.34	-3.42	0.04825	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44902	D	0.000404	T	0.00012	0.0000	N	0.00510	-1.415	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.59123	-0.7513	10	0.02654	T	1	.	5.5497	0.17083	0.2723:0.1149:0.5003:0.1125	.	191	Q8NGX8	OR6Y1_HUMAN	K	191	ENSP00000304807:N191K	ENSP00000304807:N191K	N	-	3	2	OR6Y1	156783947	0.000000	0.05858	0.921000	0.36526	0.968000	0.65278	-4.551000	0.00217	-0.486000	0.06744	-0.302000	0.09304	AAC	OR6Y1	-	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000197532		0.463	OR6Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6Y1	HGNC	protein_coding	OTTHUMT00000051844.1	34	0.00	0	G	NM_001005189		158517323	158517323	-1	no_errors	ENST00000302617	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	0.000	C
PCDHB11	56125	genome.wustl.edu	37	5	140579848	140579848	+	Silent	SNP	A	A	G	rs368066688	byFrequency	TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr5:140579848A>G	ENST00000354757.3	+	1	501	c.501A>G	c.(499-501)gtA>gtG	p.V167V	PCDHB11_ENST00000536699.1_Intron	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	167	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.V167V(1)		NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCAATGCTGTAAAAAGCTACA	0.423													A|||	4	0.000798722	0.0	0.0	5008	,	,		19779	0.004		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - coding silent(1)	lung(1)											80.0	86.0	84.0					5																	140579848		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.501A>G	5.37:g.140579848A>G			B4DSF7|Q2M223	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V167	ENST00000354757.3	37	c.501	CCDS4253.1	5																																																																																			PCDHB11	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000197479		0.423	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB11	HGNC	protein_coding	OTTHUMT00000251813.1	42	0.00	0	A	NM_018931		140579848	140579848	+1	no_errors	ENST00000354757	ensembl	human	known	69_37n	silent	32	21.95	9	SNP	0.003	G
PDIA5	10954	genome.wustl.edu	37	3	122835135	122835135	+	Missense_Mutation	SNP	G	G	A	rs544687330		TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr3:122835135G>A	ENST00000316218.7	+	8	694	c.599G>A	c.(598-600)cGa>cAa	p.R200Q		NM_006810.3	NP_006801.1	Q14554	PDIA5_HUMAN	protein disulfide isomerase family A, member 5	200	Thioredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00691}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|oxidation-reduction process (GO:0055114)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	oxidoreductase activity (GO:0016491)|protein disulfide isomerase activity (GO:0003756)			breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	21				GBM - Glioblastoma multiforme(114;0.0427)		ACTCAGCTGCGAGGCCACGCC	0.617													G|||	0	0.0	0.0	0.0	5008	,	,		18808	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													85.0	73.0	77.0					3																	122835135		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK054963	CCDS3020.1	3q21.1	2009-11-20	2005-06-29		ENSG00000065485	ENSG00000065485	5.3.4.1	"""Protein disulfide isomerases"""	24811	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 5"""			7556671	Standard	NM_006810		Approved	PDIR, FLJ30401	uc003egc.2	Q14554	OTTHUMG00000159558	ENST00000316218.7:c.599G>A	3.37:g.122835135G>A	ENSP00000323313:p.Arg200Gln		D3DN95|Q9BV43	Missense_Mutation	SNP	pfam_Thioredoxin_domain,pfam_AhpC/TSA,superfamily_Thioredoxin-like_fold,prints_Thioredoxin	p.R200Q	ENST00000316218.7	37	c.599	CCDS3020.1	3	.	.	.	.	.	.	.	.	.	.	G	21.5	4.163765	0.78226	.	.	ENSG00000065485	ENST00000316218	T	0.03212	4.01	5.65	4.7	0.59300	Thioredoxin domain (1);Thioredoxin-like fold (3);	0.123621	0.53938	D	0.000059	T	0.04137	0.0115	N	0.13043	0.29	0.36488	D	0.868278	D	0.55800	0.973	P	0.52481	0.7	T	0.41662	-0.9496	10	0.51188	T	0.08	.	6.7258	0.23355	0.1439:0.0:0.8561:0.0	.	200	Q14554	PDIA5_HUMAN	Q	200	ENSP00000323313:R200Q	ENSP00000323313:R200Q	R	+	2	0	PDIA5	124317825	1.000000	0.71417	0.995000	0.50966	0.671000	0.39405	4.248000	0.58760	2.941000	0.99782	0.655000	0.94253	CGA	PDIA5	-	pfam_Thioredoxin_domain,pfam_AhpC/TSA,superfamily_Thioredoxin-like_fold	ENSG00000065485		0.617	PDIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDIA5	HGNC	protein_coding	OTTHUMT00000356192.1	11	0.00	0	G	NM_006810		122835135	122835135	+1	no_errors	ENST00000316218	ensembl	human	known	69_37n	missense	10	37.50	6	SNP	0.984	A
PDZRN4	29951	genome.wustl.edu	37	12	41966376	41966376	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr12:41966376G>A	ENST00000402685.2	+	10	1803	c.1795G>A	c.(1795-1797)Gaa>Aaa	p.E599K	PDZRN4_ENST00000298919.7_Missense_Mutation_p.E339K|PDZRN4_ENST00000539469.2_Missense_Mutation_p.E341K	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	599							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				GGGAAGTGTTGAACTTCAGTA	0.502																																						dbGAP											0													83.0	82.0	82.0					12																	41966376		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.1795G>A	12.37:g.41966376G>A	ENSP00000384197:p.Glu599Lys		Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,superfamily_TRAF-like,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING	p.E599K	ENST00000402685.2	37	c.1795	CCDS53777.1	12	.	.	.	.	.	.	.	.	.	.	G	16.82	3.229395	0.58777	.	.	ENSG00000165966	ENST00000402685;ENST00000539469;ENST00000298919	T;T;T	0.73681	-0.77;3.78;3.78	4.64	3.73	0.42828	.	0.075147	0.53938	D	0.000051	T	0.78755	0.4333	M	0.63843	1.955	0.51233	D	0.999913	P;P;P	0.50528	0.69;0.936;0.876	B;P;P	0.51415	0.164;0.669;0.669	T	0.81061	-0.1103	10	0.54805	T	0.06	-22.9171	15.3432	0.74314	0.0:0.1407:0.8593:0.0	.	599;339;341	Q6ZMN7;Q6ZMN7-4;Q6ZMN7-2	PZRN4_HUMAN;.;.	K	599;341;339	ENSP00000384197:E599K;ENSP00000439990:E341K;ENSP00000298919:E339K	ENSP00000298919:E339K	E	+	1	0	PDZRN4	40252643	0.999000	0.42202	0.052000	0.19188	0.568000	0.35870	3.325000	0.52030	1.239000	0.43787	0.650000	0.86243	GAA	PDZRN4	-	NULL	ENSG00000165966		0.502	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZRN4	HGNC	protein_coding	OTTHUMT00000403701.1	34	0.00	0	G	NM_013377		41966376	41966376	+1	no_errors	ENST00000402685	ensembl	human	known	69_37n	missense	35	23.91	11	SNP	0.954	A
PHOX2B	8929	genome.wustl.edu	37	4	41748265	41748265	+	Silent	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr4:41748265C>T	ENST00000226382.2	-	3	863	c.504G>A	c.(502-504)aaG>aaA	p.K168K	RP11-227F19.1_ENST00000508038.1_RNA	NM_003924.3	NP_003915.2	Q99453	PHX2B_HUMAN	paired-like homeobox 2b	168					autonomic nervous system development (GO:0048483)|brainstem development (GO:0003360)|cell differentiation in hindbrain (GO:0021533)|cellular response to BMP stimulus (GO:0071773)|dopaminergic neuron differentiation (GO:0071542)|efferent axon development in a lateral line nerve (GO:0048894)|enteric nervous system development (GO:0048484)|glial cell differentiation (GO:0010001)|hindbrain tangential cell migration (GO:0021934)|inner ear development (GO:0048839)|medullary reticular formation development (GO:0021723)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neuron migration (GO:0001764)|noradrenergic neuron development (GO:0003358)|noradrenergic neuron differentiation (GO:0003357)|parasympathetic nervous system development (GO:0048486)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression (GO:0010468)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|respiratory system development (GO:0060541)|retrotrapezoid nucleus neuron differentiation (GO:0061452)|skeletal muscle cell differentiation (GO:0035914)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)			autonomic_ganglia(7)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	30						AGGAGCCGTTCTTGGCCGCGG	0.657			"""Mis, F"""		neuroblastoma	neuroblastoma	congenital central hypoventilation syndrome		Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																													dbGAP	yes	Rec	yes	familial neuroblastoma	4	4p12	8929	paired-like homeobox 2b	yes	O	0													35.0	35.0	35.0					4																	41748265		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	D82344	CCDS3463.1	4p13	2014-09-17	2003-02-10	2003-02-14	ENSG00000109132	ENSG00000109132		"""Homeoboxes / PRD class"""	9143	protein-coding gene	gene with protein product		603851	"""paired mesoderm homeobox 2b"""	PMX2B		9039501, 10395798	Standard	NM_003924		Approved	Phox2b, NBPhox	uc003gwf.4	Q99453	OTTHUMG00000099379	ENST00000226382.2:c.504G>A	4.37:g.41748265C>T			Q6PJD9	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.R108K	ENST00000226382.2	37	c.323	CCDS3463.1	4	.	.	.	.	.	.	.	.	.	.	C	5.526	0.281898	0.10458	.	.	ENSG00000109132	ENST00000510424	.	.	.	4.46	-0.575	0.11734	.	.	.	.	.	T	0.42063	0.1186	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23833	-1.0177	4	.	.	.	.	2.3468	0.04273	0.1187:0.4625:0.1163:0.3025	.	.	.	.	K	108	.	.	R	-	2	0	PHOX2B	41443022	0.670000	0.27512	0.994000	0.49952	0.411000	0.31082	0.218000	0.17622	-0.094000	0.12374	-0.150000	0.13652	AGA	PHOX2B	-	NULL	ENSG00000109132		0.657	PHOX2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHOX2B	HGNC	protein_coding	OTTHUMT00000216832.2	12	0.00	0	C			41748265	41748265	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000510424	ensembl	human	novel	69_37n	missense	17	29.17	7	SNP	0.999	T
PIK3CA	5290	genome.wustl.edu	37	3	178916854	178916854	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr3:178916854G>A	ENST00000263967.3	+	2	398	c.241G>A	c.(241-243)Gaa>Aaa	p.E81K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	81	PI3K-ABD. {ECO:0000255|PROSITE- ProRule:PRU00877}.		E -> K (in MCAP). {ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E81K(8)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AGAAAGGGAAGAATTTTTTGA	0.358		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	8	Substitution - Missense(8)	endometrium(4)|large_intestine(3)|breast(1)											107.0	101.0	103.0					3																	178916854		1820	4081	5901	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.241G>A	3.37:g.178916854G>A	ENSP00000263967:p.Glu81Lys		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E81K	ENST00000263967.3	37	c.241	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	29.2	4.983574	0.93044	.	.	ENSG00000121879	ENST00000263967;ENST00000468036	T;T	0.77620	-1.11;-1.11	5.44	5.44	0.79542	Phosphatidylinositol 3-kinase, p85-binding (2);	0.000000	0.85682	D	0.000000	D	0.89305	0.6677	M	0.83384	2.64	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89493	0.3758	9	.	.	.	-5.0909	19.2635	0.93977	0.0:0.0:1.0:0.0	.	81	P42336	PK3CA_HUMAN	K	81	ENSP00000263967:E81K;ENSP00000417479:E81K	.	E	+	1	0	PIK3CA	180399548	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.571000	0.82399	2.547000	0.85894	0.555000	0.69702	GAA	PIK3CA	-	pfam_PI3K_adapt-bd_dom,smart_PI3K_adapt-bd_dom	ENSG00000121879		0.358	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	38	0.00	0	G			178916854	178916854	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	38	13.64	6	SNP	1.000	A
PIWIL3	440822	genome.wustl.edu	37	22	25147426	25147426	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr22:25147426C>T	ENST00000332271.5	-	9	1433	c.1017G>A	c.(1015-1017)tgG>tgA	p.W339*	PIWIL3_ENST00000533313.1_Nonsense_Mutation_p.W230*|PIWIL3_ENST00000527701.1_Nonsense_Mutation_p.W230*|PIWIL3_ENST00000532537.2_5'UTR	NM_001008496.3|NM_001255975.1	NP_001008496.2|NP_001242904.1	Q7Z3Z3	PIWL3_HUMAN	piwi-like RNA-mediated gene silencing 3	339	PAZ. {ECO:0000255|PROSITE- ProRule:PRU00142}.				cell differentiation (GO:0030154)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	RNA binding (GO:0003723)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(15)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						GATTCTGCTTCCAATCAATAT	0.328																																						dbGAP											0													284.0	278.0	280.0					22																	25147426		2202	4299	6501	-	-	-	SO:0001587	stop_gained	0			AB079368	CCDS33623.1	22q11.23	2013-02-15	2013-02-15		ENSG00000184571	ENSG00000184571		"""Argonaute/PIWI family"""	18443	protein-coding gene	gene with protein product		610314	"""piwi-like 3 (Drosophila)"""			12906857	Standard	NM_001008496		Approved	HIWI3	uc003abd.2	Q7Z3Z3	OTTHUMG00000150788	ENST00000332271.5:c.1017G>A	22.37:g.25147426C>T	ENSP00000330031:p.Trp339*			Nonsense_Mutation	SNP	pfam_Piwi,pfam_PAZ,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.W339*	ENST00000332271.5	37	c.1017	CCDS33623.1	22	.	.	.	.	.	.	.	.	.	.	C	37	6.588174	0.97684	.	.	ENSG00000184571	ENST00000332271;ENST00000533313;ENST00000527701	.	.	.	2.64	2.64	0.31445	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.028	0.47757	0.0:1.0:0.0:0.0	.	.	.	.	X	339;230;230	.	ENSP00000330031:W339X	W	-	3	0	PIWIL3	23477426	0.994000	0.37717	0.060000	0.19600	0.008000	0.06430	4.188000	0.58351	1.480000	0.48289	0.557000	0.71058	TGG	PIWIL3	-	pfam_PAZ,superfamily_PAZ,smart_PAZ,pfscan_PAZ	ENSG00000184571		0.328	PIWIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIWIL3	HGNC	protein_coding	OTTHUMT00000320084.2	114	0.00	0	C	NM_001008496		25147426	25147426	-1	no_errors	ENST00000332271	ensembl	human	known	69_37n	nonsense	124	26.19	44	SNP	0.959	T
PKHD1L1	93035	genome.wustl.edu	37	8	110447418	110447418	+	Splice_Site	SNP	G	G	C			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr8:110447418G>C	ENST00000378402.5	+	29	3444		c.e29-1			NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1						immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TTTTTCACAAGAAAAAGAGCT	0.388										HNSCC(38;0.096)																												dbGAP											0													97.0	96.0	97.0					8																	110447418		1825	4086	5911	-	-	-	SO:0001630	splice_region_variant	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.3341-1G>C	8.37:g.110447418G>C			Q567P2|Q9UF27	Splice_Site	SNP	-	e29-1	ENST00000378402.5	37	c.3341-1	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	G	14.19	2.461333	0.43736	.	.	ENSG00000205038	ENST00000378402	.	.	.	6.06	6.06	0.98353	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1398	0.81515	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PKHD1L1	110516594	1.000000	0.71417	0.993000	0.49108	0.367000	0.29736	4.858000	0.62947	2.880000	0.98712	0.650000	0.86243	.	PKHD1L1	-	-	ENSG00000205038		0.388	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	31	0.00	0	G	NM_177531	Intron	110447418	110447418	+1	no_errors	ENST00000378402	ensembl	human	known	69_37n	splice_site	53	13.11	8	SNP	1.000	C
PTEN	5728	genome.wustl.edu	37	10	89717752	89717752	+	Frame_Shift_Del	DEL	C	C	-			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr10:89717752delC	ENST00000371953.3	+	7	2134	c.777delC	c.(775-777)cacfs	p.H259fs	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	259	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.?(1)|p.D252_K263>AKE(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AGTTCTTCCACAAACAGAACA	0.378		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																												dbGAP	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	49	Whole gene deletion(37)|Deletion - Frameshift(9)|Complex - deletion inframe(1)|Deletion - In frame(1)|Unknown(1)	prostate(16)|central_nervous_system(10)|skin(6)|haematopoietic_and_lymphoid_tissue(4)|lung(4)|breast(3)|ovary(3)|urinary_tract(2)|soft_tissue(1)											106.0	95.0	99.0					10																	89717752		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.777delC	10.37:g.89717752delC	ENSP00000361021:p.His259fs		B2R904|F2YHV0|O00633|O02679|Q6ICT7	Frame_Shift_Del	DEL	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.H259fs	ENST00000371953.3	37	c.777	CCDS31238.1	10																																																																																			PTEN	-	pfam_Tensin_phosphatase_C2-dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tensin_phosphatase_C2-dom	ENSG00000171862		0.378	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTEN	HGNC	protein_coding	OTTHUMT00000049241.1	27	0.00	0	C	NM_000314		89717752	89717752	+1	no_errors	ENST00000371953	ensembl	human	known	69_37n	frame_shift_del	24	49.06	26	DEL	1.000	-
PTPDC1	138639	genome.wustl.edu	37	9	96870160	96870160	+	Missense_Mutation	SNP	A	A	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr9:96870160A>T	ENST00000375360.3	+	10	2539	c.2199A>T	c.(2197-2199)aaA>aaT	p.K733N	PTPDC1_ENST00000467049.1_3'UTR|PTPDC1_ENST00000288976.3_Missense_Mutation_p.K785N	NM_001253830.1|NM_177995.2	NP_001240759.1|NP_818931.1	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	733					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	32						CCCTGAAGAAAATATTTAAGC	0.363																																						dbGAP											0													38.0	40.0	39.0					9																	96870160		2200	4298	6498	-	-	-	SO:0001583	missense	0			BC051654	CCDS6707.1, CCDS6708.1, CCDS75860.1	9q22.32	2011-06-09			ENSG00000158079	ENSG00000158079		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	30184	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase PTP9Q22"""					14702039	Standard	NM_152422		Approved	PTP9Q22, FLJ37312	uc010mrj.2	A2A3K4	OTTHUMG00000020258	ENST00000375360.3:c.2199A>T	9.37:g.96870160A>T	ENSP00000364509:p.Lys733Asn		Q5T3M4|Q6NXE8|Q8IWM1|Q8N1X4|Q8N9F5	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Dual-sp_phosphatase_subgr_cat,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase	p.K733N	ENST00000375360.3	37	c.2199	CCDS6707.1	9	.	.	.	.	.	.	.	.	.	.	A	15.82	2.947573	0.53186	.	.	ENSG00000158079	ENST00000375360;ENST00000288976	T;T	0.16897	2.31;2.31	5.71	5.71	0.89125	.	0.689531	0.16025	N	0.233126	T	0.22003	0.0530	M	0.70595	2.14	0.35944	D	0.833424	B;B;B;B	0.15473	0.008;0.013;0.008;0.008	B;B;B;B	0.17433	0.008;0.018;0.008;0.005	T	0.10567	-1.0624	10	0.44086	T	0.13	-18.7218	10.3081	0.43693	0.8536:0.0:0.0:0.1464	.	787;785;787;733	E7EN59;A2A3K4-2;A8K0X7;A2A3K4	.;.;.;PTPC1_HUMAN	N	733;785	ENSP00000364509:K733N;ENSP00000288976:K785N	ENSP00000288976:K785N	K	+	3	2	PTPDC1	95909981	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.507000	0.35758	2.191000	0.70037	0.528000	0.53228	AAA	PTPDC1	-	NULL	ENSG00000158079		0.363	PTPDC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPDC1	HGNC	protein_coding	OTTHUMT00000215007.1	29	0.00	0	A	NM_177995, NM_152422		96870160	96870160	+1	no_errors	ENST00000375360	ensembl	human	known	69_37n	missense	21	27.59	8	SNP	1.000	T
RAB39B	116442	genome.wustl.edu	37	X	154493495	154493495	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chrX:154493495G>A	ENST00000369454.3	-	1	379	c.79C>T	c.(79-81)Cgc>Tgc	p.R27C		NM_171998.2	NP_741995.1	Q96DA2	RB39B_HUMAN	RAB39B, member RAS oncogene family	27					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|synapse organization (GO:0050808)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	GTP binding (GO:0005525)|myosin V binding (GO:0031489)			breast(1)|central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(12)	19	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TCGGTGAAGCGGCGGATCAGG	0.607																																						dbGAP											0													93.0	93.0	93.0					X																	154493495		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY052478	CCDS14766.1	Xq28	2014-01-31			ENSG00000155961	ENSG00000155961		"""RAB, member RAS oncogene"""	16499	protein-coding gene	gene with protein product		300774	"""mental retardation, X-linked 72"""	MRX72		12438742, 20159109	Standard	NM_171998		Approved		uc004fne.3	Q96DA2	OTTHUMG00000022659	ENST00000369454.3:c.79C>T	X.37:g.154493495G>A	ENSP00000358466:p.Arg27Cys		Q5JT79|Q8NEX3	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R27C	ENST00000369454.3	37	c.79	CCDS14766.1	X	.	.	.	.	.	.	.	.	.	.	G	20.4	3.979533	0.74360	.	.	ENSG00000155961	ENST00000369454	D	0.82619	-1.63	4.91	4.91	0.64330	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.91761	0.7394	M	0.91406	3.205	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.92781	0.6240	10	0.87932	D	0	.	10.1816	0.42972	0.0:0.0:0.8012:0.1988	.	27	Q96DA2	RB39B_HUMAN	C	27	ENSP00000358466:R27C	ENSP00000358466:R27C	R	-	1	0	RAB39B	154146689	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.371000	0.66150	2.180000	0.69256	0.600000	0.82982	CGC	RAB39B	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000155961		0.607	RAB39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB39B	HGNC	protein_coding	OTTHUMT00000058792.1	15	0.00	0	G	NM_171998		154493495	154493495	-1	no_errors	ENST00000369454	ensembl	human	known	69_37n	missense	33	23.26	10	SNP	1.000	A
RANBP2	5903	genome.wustl.edu	37	2	109380048	109380048	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr2:109380048C>G	ENST00000283195.6	+	20	3179	c.3053C>G	c.(3052-3054)tCt>tGt	p.S1018C		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1018					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						TTAAGGCCATCTTTGCCAACA	0.408																																						dbGAP											0													119.0	118.0	119.0					2																	109380048		2203	4299	6502	-	-	-	SO:0001583	missense	0			D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.3053C>G	2.37:g.109380048C>G	ENSP00000283195:p.Ser1018Cys		Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_Znf_RanBP2,pfam_IR1-M,pfam_Cyclophilin-like_PPIase_dom,pfam_TPR-1,superfamily_Cyclophilin-like_PPIase_dom,smart_TPR_repeat,smart_Ran_bind_dom,smart_Znf_RanBP2,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Znf_RanBP2,pfscan_Cyclophilin-like_PPIase_dom,pfscan_Ran_bind_dom,prints_Cyclophilin-like_PPIase_dom	p.S1018C	ENST00000283195.6	37	c.3053	CCDS2079.1	2	.	.	.	.	.	.	.	.	.	.	C	13.46	2.243636	0.39697	.	.	ENSG00000153201	ENST00000283195	T	0.29142	1.58	5.69	4.82	0.62117	.	.	.	.	.	T	0.24314	0.0589	N	0.19112	0.55	0.25641	N	0.986203	P	0.52463	0.953	B	0.43155	0.41	T	0.05599	-1.0875	9	0.40728	T	0.16	-6.5651	14.6494	0.68786	0.0:0.9303:0.0:0.0697	.	1018	P49792	RBP2_HUMAN	C	1018	ENSP00000283195:S1018C	ENSP00000283195:S1018C	S	+	2	0	RANBP2	108746480	0.664000	0.27457	0.092000	0.20876	0.868000	0.49771	2.725000	0.47294	1.407000	0.46875	0.563000	0.77884	TCT	RANBP2	-	NULL	ENSG00000153201		0.408	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RANBP2	HGNC	protein_coding	OTTHUMT00000253594.1	52	0.00	0	C	NM_006267		109380048	109380048	+1	no_errors	ENST00000283195	ensembl	human	known	69_37n	missense	37	21.28	10	SNP	0.982	G
RC3H2	54542	genome.wustl.edu	37	9	125621108	125621108	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr9:125621108C>T	ENST00000373670.1	-	11	2723	c.2123G>A	c.(2122-2124)cGa>cAa	p.R708Q	RC3H2_ENST00000357244.2_Missense_Mutation_p.R708Q|RC3H2_ENST00000423239.2_Missense_Mutation_p.R708Q			Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type domains 2	708					B cell homeostasis (GO:0001782)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymph node development (GO:0048535)|multicellular organism growth (GO:0035264)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|post-embryonic development (GO:0009791)|posttranscriptional regulation of gene expression (GO:0010608)|protein polyubiquitination (GO:0000209)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|large_intestine(4)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33						AATGTCATCTCGTTGGTACAT	0.478																																						dbGAP											0													135.0	133.0	134.0					9																	125621108		1929	4139	6068	-	-	-	SO:0001583	missense	0			AK000308	CCDS43874.1, CCDS48014.1	9q34	2013-01-18	2010-09-15	2007-02-06	ENSG00000056586	ENSG00000056586		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	21461	protein-coding gene	gene with protein product		615231	"""membrane associated DNA binding protein"", ""ring finger and CCCH-type zinc finger domains 2"""	MNAB		10938276	Standard	NM_001100588		Approved	FLJ20301, FLJ20713, RNF164	uc010mwc.1	Q9HBD1	OTTHUMG00000020632	ENST00000373670.1:c.2123G>A	9.37:g.125621108C>T	ENSP00000362774:p.Arg708Gln		Q4VXB1|Q5JPD7|Q86ST6|Q8N3D6|Q96F27|Q9H5J2|Q9HBD2|Q9NWN9|Q9NXE1	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_RING,smart_Znf_CCCH,pfscan_Znf_RING	p.R708Q	ENST00000373670.1	37	c.2123	CCDS43874.1	9	.	.	.	.	.	.	.	.	.	.	C	28.7	4.939445	0.92526	.	.	ENSG00000056586	ENST00000373670;ENST00000357244;ENST00000373663;ENST00000423239	T;T;T	0.59772	0.24;0.24;0.3	5.71	5.71	0.89125	.	0.115799	0.64402	D	0.000020	T	0.66636	0.2809	L	0.34521	1.04	0.80722	D	1	D;D	0.69078	0.994;0.997	P;D	0.66847	0.885;0.947	T	0.67699	-0.5603	10	0.59425	D	0.04	-10.4201	17.0106	0.86405	0.0:1.0:0.0:0.0	.	708;708	Q9HBD1;Q9HBD1-4	RC3H2_HUMAN;.	Q	708;708;579;708	ENSP00000362774:R708Q;ENSP00000349783:R708Q;ENSP00000411767:R708Q	ENSP00000349783:R708Q	R	-	2	0	RC3H2	124660929	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.519000	0.73768	2.697000	0.92050	0.655000	0.94253	CGA	RC3H2	-	NULL	ENSG00000056586		0.478	RC3H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RC3H2	HGNC	protein_coding	OTTHUMT00000053966.1	33	0.00	0	C	NM_018835		125621108	125621108	-1	no_errors	ENST00000357244	ensembl	human	known	69_37n	missense	31	26.19	11	SNP	1.000	T
REPS1	85021	genome.wustl.edu	37	6	139241412	139241412	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr6:139241412C>T	ENST00000450536.2	-	12	2042	c.1468G>A	c.(1468-1470)Gac>Aac	p.D490N	REPS1_ENST00000367663.4_Missense_Mutation_p.D463N|REPS1_ENST00000258062.5_Missense_Mutation_p.D490N|REPS1_ENST00000409812.2_Missense_Mutation_p.D463N|REPS1_ENST00000415951.2_Missense_Mutation_p.D463N			Q96D71	REPS1_HUMAN	RALBP1 associated Eps domain containing 1	490					receptor-mediated endocytosis (GO:0006898)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|SH3 domain binding (GO:0017124)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(2)	19				GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)		TCTAAAAGGTCAGATGGTTTC	0.313																																						dbGAP											0													149.0	154.0	152.0					6																	139241412		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS5193.2, CCDS47488.1, CCDS69212.1, CCDS69213.1	6q24.1	2013-01-10			ENSG00000135597	ENSG00000135597		"""EF-hand domain containing"""	15578	protein-coding gene	gene with protein product		614825					Standard	XM_005267177		Approved		uc011edr.2	Q96D71	OTTHUMG00000015685	ENST00000450536.2:c.1468G>A	6.37:g.139241412C>T	ENSP00000392065:p.Asp490Asn		B7ZBZ8|B7ZBZ9|B7ZC00|J3KP76|Q5JWJ5|Q5JWJ6|Q5JWJ7|Q8NDR7|Q8WU62|Q9BXY9	Missense_Mutation	SNP	smart_EPS15_homology,pfscan_EF_HAND_2,pfscan_EPS15_homology	p.D490N	ENST00000450536.2	37	c.1468		6	.	.	.	.	.	.	.	.	.	.	C	26.2	4.712296	0.89112	.	.	ENSG00000135597	ENST00000450536;ENST00000367663;ENST00000529597;ENST00000409812;ENST00000258062;ENST00000415951;ENST00000367668;ENST00000530255	T;T;T;T;T;T	0.34072	1.38;1.49;1.49;1.51;1.43;1.51	5.93	5.93	0.95920	.	0.100217	0.64402	D	0.000001	T	0.27933	0.0688	L	0.29908	0.895	0.51767	D	0.999931	P;P;P;P;P	0.52316	0.804;0.839;0.827;0.835;0.952	P;B;P;B;P	0.49477	0.485;0.367;0.52;0.363;0.612	T	0.00726	-1.1592	10	0.27082	T	0.32	-11.9846	20.3465	0.98790	0.0:1.0:0.0:0.0	.	490;438;463;490;463	Q96D71-3;B2R7D3;Q96D71-2;Q96D71;E9PMG1	.;.;.;REPS1_HUMAN;.	N	490;463;449;463;490;463;438;77	ENSP00000392065:D490N;ENSP00000356635:D463N;ENSP00000434251:D449N;ENSP00000386699:D463N;ENSP00000258062:D490N;ENSP00000397941:D463N	ENSP00000258062:D490N	D	-	1	0	REPS1	139283105	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.524000	0.73791	2.798000	0.96311	0.655000	0.94253	GAC	REPS1	-	NULL	ENSG00000135597		0.313	REPS1-001	KNOWN	basic|appris_candidate_longest	protein_coding	REPS1	HGNC	protein_coding	OTTHUMT00000042447.3	64	0.00	0	C			139241412	139241412	-1	no_errors	ENST00000450536	ensembl	human	known	69_37n	missense	97	20.49	25	SNP	1.000	T
SDK1	221935	genome.wustl.edu	37	7	4277291	4277291	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr7:4277291C>T	ENST00000404826.2	+	42	6144	c.6005C>T	c.(6004-6006)gCc>gTc	p.A2002V	SDK1_ENST00000389531.3_Missense_Mutation_p.A1982V|SDK1_ENST00000466611.1_3'UTR	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	2002					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CAAGTGGAAGCCCCATTCTAC	0.597																																						dbGAP											0													216.0	175.0	189.0					7																	4277291		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.6005C>T	7.37:g.4277291C>T	ENSP00000385899:p.Ala2002Val		Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.A2002V	ENST00000404826.2	37	c.6005	CCDS34590.1	7	.	.	.	.	.	.	.	.	.	.	C	12.50	1.957540	0.34565	.	.	ENSG00000146555	ENST00000404826;ENST00000446104;ENST00000389531	T;T	0.61274	0.12;0.15	5.27	5.27	0.74061	Fibronectin, type III (1);	0.168326	0.37483	N	0.002076	T	0.49626	0.1568	L	0.40543	1.245	0.09310	N	0.999997	B;B;B;B	0.29805	0.257;0.204;0.167;0.075	B;B;B;B	0.30401	0.096;0.115;0.071;0.05	T	0.48115	-0.9063	10	0.41790	T	0.15	.	13.8412	0.63439	0.1527:0.8473:0.0:0.0	.	1982;62;489;2002	F8W6X9;Q7Z5N4-2;F2Z3E9;Q7Z5N4	.;.;.;SDK1_HUMAN	V	2002;250;1982	ENSP00000385899:A2002V;ENSP00000374182:A1982V	ENSP00000374182:A1982V	A	+	2	0	SDK1	4243817	0.016000	0.18221	0.023000	0.16930	0.871000	0.50021	2.674000	0.46867	2.457000	0.83068	0.609000	0.83330	GCC	SDK1	-	superfamily_Fibronectin_type3	ENSG00000146555		0.597	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	HGNC	protein_coding	OTTHUMT00000323702.1	55	0.00	0	C	NM_152744		4277291	4277291	+1	no_errors	ENST00000404826	ensembl	human	known	69_37n	missense	67	21.18	18	SNP	0.293	T
SEMA4F	10505	genome.wustl.edu	37	2	74901797	74901797	+	Missense_Mutation	SNP	C	C	T	rs546288150		TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr2:74901797C>T	ENST00000357877.2	+	8	1144	c.995C>T	c.(994-996)tCc>tTc	p.S332F	SEMA4F_ENST00000339773.5_Missense_Mutation_p.S177F	NM_004263.3	NP_004254.2	O95754	SEM4F_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F	332	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|negative regulation of axon extension (GO:0030517)|nervous system development (GO:0007399)|retinal ganglion cell axon guidance (GO:0031290)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)			biliary_tract(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	45						ATCTTTTCTTCCCAGTGGTGA	0.577													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19832	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													135.0	131.0	132.0					2																	74901797		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF038652	CCDS1955.1, CCDS62942.1, CCDS74529.1	2p13.1	2008-05-21			ENSG00000135622	ENSG00000135622		"""Semaphorins"""	10734	protein-coding gene	gene with protein product	"""m-Sema M"""	603706		SEMAM		10051670	Standard	NM_004263		Approved	SEMAW	uc002sna.2	O95754	OTTHUMG00000129952	ENST00000357877.2:c.995C>T	2.37:g.74901797C>T	ENSP00000350547:p.Ser332Phe		Q542Y7|Q9NS35	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,pfscan_Semaphorin/CD100_Ag	p.S332F	ENST00000357877.2	37	c.995	CCDS1955.1	2	.	.	.	.	.	.	.	.	.	.	C	19.81	3.896610	0.72639	.	.	ENSG00000135622	ENST00000357877;ENST00000339773;ENST00000453930	T;T;T	0.11930	2.73;2.73;2.73	5.33	4.46	0.54185	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.072793	0.56097	N	0.000033	T	0.23806	0.0576	M	0.81112	2.525	0.46437	D	0.999049	B;B	0.29481	0.245;0.203	B;B	0.36335	0.222;0.164	T	0.03566	-1.1024	10	0.87932	D	0	.	11.7519	0.51853	0.0:0.9136:0.0:0.0863	.	177;332	O95754-2;O95754	.;SEM4F_HUMAN	F	332;177;177	ENSP00000350547:S332F;ENSP00000342675:S177F;ENSP00000409141:S177F	ENSP00000342675:S177F	S	+	2	0	SEMA4F	74755305	0.957000	0.32711	1.000000	0.80357	0.970000	0.65996	4.597000	0.61062	1.261000	0.44149	0.289000	0.19496	TCC	SEMA4F	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000135622		0.577	SEMA4F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA4F	HGNC	protein_coding	OTTHUMT00000252214.2	56	0.00	0	C	NM_004263		74901797	74901797	+1	no_errors	ENST00000357877	ensembl	human	known	69_37n	missense	56	30.00	24	SNP	1.000	T
SGIP1	84251	genome.wustl.edu	37	1	67138977	67138977	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr1:67138977G>A	ENST00000371037.4	+	12	651	c.574G>A	c.(574-576)Gat>Aat	p.D192N	AL139147.1_ENST00000502413.2_Intron|SGIP1_ENST00000371036.3_Missense_Mutation_p.D159N|SGIP1_ENST00000468286.1_3'UTR|SGIP1_ENST00000371035.3_Missense_Mutation_p.D149N|SGIP1_ENST00000237247.6_Missense_Mutation_p.D196N|SGIP1_ENST00000371039.1_Missense_Mutation_p.D160N	NM_032291.2	NP_115667.2	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting protein 1	192	Pro-rich.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of feeding behavior (GO:2000253)|positive regulation of receptor-mediated endocytosis (GO:0048260)|response to dietary excess (GO:0002021)	AP-2 adaptor complex (GO:0030122)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phospholipid binding (GO:0005543)|SH3 domain binding (GO:0017124)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(43)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	71						AAAGCCTCCAGATGACACTAC	0.378																																						dbGAP											0													193.0	200.0	198.0					1																	67138977		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136561	CCDS30744.1	1p31.3	2008-02-05			ENSG00000118473	ENSG00000118473			25412	protein-coding gene	gene with protein product		611540				11230166	Standard	NM_032291		Approved	DKFZp761D221	uc001dcr.3	Q9BQI5	OTTHUMG00000009161	ENST00000371037.4:c.574G>A	1.37:g.67138977G>A	ENSP00000360076:p.Asp192Asn		A6NL81|A6NLD1|Q4LE32|Q5VYE2|Q5VYE3|Q5VYE4|Q68D76|Q6MZY6|Q8IWC2	Missense_Mutation	SNP	pfam_Muniscin_C-term_mu_dom,pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C	p.D196N	ENST00000371037.4	37	c.586	CCDS30744.1	1	.	.	.	.	.	.	.	.	.	.	G	9.731	1.162368	0.21538	.	.	ENSG00000118473	ENST00000237247;ENST00000371039;ENST00000424320;ENST00000371035;ENST00000371038;ENST00000407289;ENST00000371036;ENST00000371037	T;T;T;T;T;T	0.03181	4.02;4.02;4.02;4.02;4.02;4.02	5.73	5.73	0.89815	.	0.344015	0.34268	N	0.004111	T	0.00967	0.0032	N	0.08118	0	0.31984	N	0.605488	B	0.29531	0.247	B	0.28139	0.086	T	0.52426	-0.8577	10	0.14252	T	0.57	-8.9405	16.6175	0.84920	0.0:0.0:1.0:0.0	.	192	Q9BQI5	SGIP1_HUMAN	N	196;160;184;149;195;195;159;192	ENSP00000237247:D196N;ENSP00000360078:D160N;ENSP00000410439:D184N;ENSP00000360074:D149N;ENSP00000360075:D159N;ENSP00000360076:D192N	ENSP00000237247:D196N	D	+	1	0	SGIP1	66911565	1.000000	0.71417	0.990000	0.47175	0.031000	0.12232	7.064000	0.76721	2.718000	0.92993	0.650000	0.86243	GAT	SGIP1	-	NULL	ENSG00000118473		0.378	SGIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SGIP1	HGNC	protein_coding	OTTHUMT00000025395.4	92	0.00	0	G	NM_032291		67138977	67138977	+1	no_errors	ENST00000237247	ensembl	human	known	69_37n	missense	87	26.89	32	SNP	0.998	A
SLC29A4	222962	genome.wustl.edu	37	7	5338962	5338962	+	Silent	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr7:5338962C>T	ENST00000396872.3	+	9	1274	c.1113C>T	c.(1111-1113)ttC>ttT	p.F371F	SLC29A4_ENST00000297195.4_Silent_p.F371F|SLC29A4_ENST00000439491.2_3'UTR|SLC29A4_ENST00000406453.3_Silent_p.F357F			Q7RTT9	S29A4_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 4	371					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)			breast(1)|cervix(2)|kidney(7)|large_intestine(1)|liver(1)|lung(7)|urinary_tract(1)	20		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)	Metformin(DB00331)	TGTGCCTGTTCCCCGGCCTCG	0.622																																						dbGAP											0													79.0	52.0	62.0					7																	5338962		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK075422	CCDS5340.1, CCDS75561.1	7p22.2	2013-07-17	2013-07-17		ENSG00000164638	ENSG00000164638		"""Solute carriers"""	23097	protein-coding gene	gene with protein product		609149	"""solute carrier family 29 (nucleoside transporters), member 4"""			12838422	Standard	NM_153247		Approved	FLJ34923, ENT4	uc003soc.3	Q7RTT9	OTTHUMG00000023797	ENST00000396872.3:c.1113C>T	7.37:g.5338962C>T			Q6PJ08|Q86WY8|Q8NAR3|Q8NBM2	Silent	SNP	pfam_Eqnu_transpt,superfamily_MFS_dom_general_subst_transpt,prints_Eqnu_transpt	p.F371	ENST00000396872.3	37	c.1113	CCDS5340.1	7																																																																																			SLC29A4	-	pfam_Eqnu_transpt,superfamily_MFS_dom_general_subst_transpt	ENSG00000164638		0.622	SLC29A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC29A4	HGNC	protein_coding	OTTHUMT00000060118.6	28	0.00	0	C	NM_153247		5338962	5338962	+1	no_errors	ENST00000297195	ensembl	human	known	69_37n	silent	21	22.22	6	SNP	1.000	T
SRL	6345	genome.wustl.edu	37	16	4247812	4247812	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr16:4247812G>A	ENST00000399609.3	-	4	376	c.364C>T	c.(364-366)Cag>Tag	p.Q122*	SRL_ENST00000537996.1_Nonsense_Mutation_p.Q80*	NM_001098814.1	NP_001092284.1	Q86TD4	SRCA_HUMAN	sarcalumenin	581	Acidic domain, probably binds calcium. {ECO:0000250}.					sarcoplasmic reticulum (GO:0016529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(3)	21						GTATAGAGCTGATAGCGAGTA	0.408																																						dbGAP											0													107.0	102.0	104.0					16																	4247812		1866	4095	5961	-	-	-	SO:0001587	stop_gained	0			AK056588	CCDS42113.1	16p13.3	2008-02-05				ENSG00000185739			11295	protein-coding gene	gene with protein product		604992				2762314	Standard	NM_001098814		Approved		uc002cvz.4	Q86TD4		ENST00000399609.3:c.364C>T	16.37:g.4247812G>A	ENSP00000382518:p.Gln122*			Nonsense_Mutation	SNP	pfam_Dynamin_GTPase,pfam_GTP_binding_domain	p.Q122*	ENST00000399609.3	37	c.364	CCDS42113.1	16	.	.	.	.	.	.	.	.	.	.	G	28.4	4.913165	0.92178	.	.	ENSG00000185739	ENST00000399609;ENST00000330063;ENST00000537996	.	.	.	5.02	5.02	0.67125	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-17.4497	18.7116	0.91659	0.0:0.0:1.0:0.0	.	.	.	.	X	122;580;80	.	ENSP00000333285:Q580X	Q	-	1	0	SRL	4187813	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	8.009000	0.88606	2.487000	0.83934	0.591000	0.81541	CAG	SRL	-	pfam_Dynamin_GTPase,pfam_GTP_binding_domain	ENSG00000185739		0.408	SRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRL	HGNC	protein_coding	OTTHUMT00000438087.1	33	0.00	0	G	XM_064152		4247812	4247812	-1	no_errors	ENST00000399609	ensembl	human	known	69_37n	nonsense	37	33.93	19	SNP	1.000	A
SMG1	23049	genome.wustl.edu	37	16	18865076	18865076	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr16:18865076G>A	ENST00000446231.2	-	31	5009	c.4597C>T	c.(4597-4599)Cag>Tag	p.Q1533*	SMG1_ENST00000389467.3_Nonsense_Mutation_p.Q1533*			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	1533	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.|Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						CATTCTGCCTGGATCCATTTA	0.403																																						dbGAP											0													113.0	100.0	104.0					16																	18865076		1886	4116	6002	-	-	-	SO:0001587	stop_gained	0			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.4597C>T	16.37:g.18865076G>A	ENSP00000402515:p.Gln1533*		O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Nonsense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.Q1533*	ENST00000446231.2	37	c.4597	CCDS45430.1	16	.	.	.	.	.	.	.	.	.	.	G	47	12.996538	0.99712	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	.	.	.	5.24	5.24	0.73138	.	0.000000	0.52532	D	0.000061	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	19.1806	0.93622	0.0:0.0:1.0:0.0	.	.	.	.	X	1533	.	ENSP00000374118:Q1533X	Q	-	1	0	SMG1	18772577	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.489000	0.60309	2.611000	0.88343	0.561000	0.74099	CAG	SMG1	-	superfamily_ARM-type_fold,pfscan_PIK_FAT	ENSG00000157106		0.403	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	HGNC	protein_coding	OTTHUMT00000391817.1	40	0.00	0	G	NM_015092		18865076	18865076	-1	no_errors	ENST00000389467	ensembl	human	known	69_37n	nonsense	81	11.96	11	SNP	1.000	A
SUPV3L1	6832	genome.wustl.edu	37	10	70960164	70960164	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr10:70960164C>T	ENST00000359655.4	+	11	1487	c.1427C>T	c.(1426-1428)tCa>tTa	p.S476L		NM_003171.3	NP_003162.2	Q8IYB8	SUV3_HUMAN	suppressor of var1, 3-like 1 (S. cerevisiae)	476	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|chromatin maintenance (GO:0070827)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA surveillance (GO:0035946)|mitochondrial ncRNA surveillance (GO:0035945)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA surveillance (GO:2000827)|mitochondrion morphogenesis (GO:0070584)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|RNA catabolic process (GO:0006401)	mitochondrial degradosome (GO:0045025)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3'-5' RNA helicase activity (GO:0034458)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						AGATTCAGCTCACGGTTTAAA	0.423																																						dbGAP											0													95.0	94.0	94.0					10																	70960164		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF042169	CCDS7287.1	10q22.1	2008-08-01	2001-11-28		ENSG00000156502	ENSG00000156502			11471	protein-coding gene	gene with protein product		605122	"""suppressor of var1 (S.cerevisiae) 3-like 1"""			9925937, 16176273	Standard	XM_005270068		Approved	SUV3	uc001jpe.1	Q8IYB8	OTTHUMG00000018375	ENST00000359655.4:c.1427C>T	10.37:g.70960164C>T	ENSP00000352678:p.Ser476Leu		A8K301|O43630	Missense_Mutation	SNP	pfam_SUV3_C,pfam_Helicase_C,smart_Helicase_C,pfscan_Helicase_C	p.S476L	ENST00000359655.4	37	c.1427	CCDS7287.1	10	.	.	.	.	.	.	.	.	.	.	C	13.90	2.374477	0.42105	.	.	ENSG00000156502	ENST00000359655	T	0.39787	1.06	5.61	3.71	0.42584	Helicase, C-terminal (1);	0.261050	0.38959	N	0.001519	T	0.29749	0.0743	L	0.31664	0.95	0.58432	D	0.999997	B	0.25441	0.126	B	0.22601	0.04	T	0.16100	-1.0414	10	0.87932	D	0	-3.1042	9.289	0.37775	0.0:0.6505:0.277:0.0726	.	476	Q8IYB8	SUV3_HUMAN	L	476	ENSP00000352678:S476L	ENSP00000352678:S476L	S	+	2	0	SUPV3L1	70630170	0.991000	0.36638	0.816000	0.32577	0.232000	0.25224	2.950000	0.49081	1.330000	0.45394	0.557000	0.71058	TCA	SUPV3L1	-	pfscan_Helicase_C	ENSG00000156502		0.423	SUPV3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUPV3L1	HGNC	protein_coding	OTTHUMT00000048396.2	35	0.00	0	C	NM_003171		70960164	70960164	+1	no_errors	ENST00000359655	ensembl	human	known	69_37n	missense	19	59.57	28	SNP	0.986	T
SYBU	55638	genome.wustl.edu	37	8	110598367	110598367	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr8:110598367G>A	ENST00000422135.1	-	5	967	c.452C>T	c.(451-453)tCg>tTg	p.S151L	SYBU_ENST00000399066.3_Missense_Mutation_p.S148L|SYBU_ENST00000529690.1_Missense_Mutation_p.S21L|SYBU_ENST00000419099.1_Missense_Mutation_p.S150L|SYBU_ENST00000433638.1_Missense_Mutation_p.S151L|SYBU_ENST00000424158.2_Missense_Mutation_p.S156L|SYBU_ENST00000532779.1_Missense_Mutation_p.S83L|SYBU_ENST00000440310.1_Missense_Mutation_p.S151L|SYBU_ENST00000446070.2_Missense_Mutation_p.S150L|SYBU_ENST00000533895.1_Missense_Mutation_p.S150L|SYBU_ENST00000408889.3_Missense_Mutation_p.S32L|SYBU_ENST00000528647.1_Missense_Mutation_p.S150L|SYBU_ENST00000276646.9_Missense_Mutation_p.S151L|SYBU_ENST00000528331.1_Missense_Mutation_p.S32L|SYBU_ENST00000408908.2_Missense_Mutation_p.S151L|SYBU_ENST00000533171.1_Missense_Mutation_p.S151L|SYBU_ENST00000533065.1_Missense_Mutation_p.S32L	NM_001099744.1	NP_001093214.1	Q9NX95	SYBU_HUMAN	syntabulin (syntaxin-interacting)	151	Ser-rich.|Sufficient for interaction with KIF5B.				regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|dense body (GO:0097433)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	30						TGTGCTGCTCGAGGAGCTAAA	0.527																																						dbGAP											0													57.0	57.0	57.0					8																	110598367		1980	4168	6148	-	-	-	SO:0001583	missense	0			AB040905	CCDS43763.1, CCDS43764.1, CCDS47912.1, CCDS55271.1	8q23.2	2010-08-27				ENSG00000147642			26011	protein-coding gene	gene with protein product	"""syntaphilin-like"""	611568				17611281, 16750881, 16157705, 15656992, 15459722	Standard	NM_001099743		Approved	FLJ20366, GOLSYN, KIAA1472, OCSYN, SNPHL	uc003ynj.4	Q9NX95		ENST00000422135.1:c.452C>T	8.37:g.110598367G>A	ENSP00000407118:p.Ser151Leu		A8K354|B3KQX3|B3KU61|Q5R1T1|Q5R1T2|Q5R1T3|Q5Y2M6|Q8ND49|Q8TCR6|Q96D80|Q9P256	Missense_Mutation	SNP	NULL	p.S151L	ENST00000422135.1	37	c.452	CCDS47912.1	8	.	.	.	.	.	.	.	.	.	.	G	36	5.606678	0.96626	.	.	ENSG00000147642	ENST00000533895;ENST00000424158;ENST00000532779;ENST00000399066;ENST00000446070;ENST00000528331;ENST00000276646;ENST00000528647;ENST00000422135;ENST00000419099;ENST00000433638;ENST00000408908;ENST00000440310;ENST00000408889;ENST00000533065;ENST00000529690;ENST00000533171;ENST00000528045;ENST00000529190;ENST00000528569;ENST00000532189;ENST00000533821;ENST00000530841;ENST00000531230;ENST00000534501	.	.	.	5.75	5.75	0.90469	.	0.113408	0.64402	D	0.000006	T	0.79764	0.4502	M	0.70275	2.135	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.986	D;D;D;D;P	0.87578	0.998;0.997;0.997;0.997;0.636	T	0.80118	-0.1516	9	0.72032	D	0.01	-12.9263	19.3148	0.94207	0.0:0.0:1.0:0.0	.	21;83;150;151;148	B7Z4D2;Q9NX95-2;Q9NX95-3;Q9NX95;Q9NX95-4	.;.;.;SYBU_HUMAN;.	L	150;156;83;148;150;32;151;150;151;150;151;151;151;32;32;21;151;32;150;32;32;150;32;32;151	.	ENSP00000276646:S151L	S	-	2	0	SYBU	110667543	1.000000	0.71417	0.995000	0.50966	0.998000	0.95712	7.752000	0.85141	2.885000	0.99019	0.655000	0.94253	TCG	SYBU	-	NULL	ENSG00000147642		0.527	SYBU-204	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYBU	HGNC	protein_coding	OTTHUMT00000385501.1	25	0.00	0	G	NM_017786		110598367	110598367	-1	no_errors	ENST00000276646	ensembl	human	known	69_37n	missense	27	22.86	8	SNP	1.000	A
TIPARP	25976	genome.wustl.edu	37	3	156395730	156395730	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr3:156395730G>A	ENST00000461166.1	+	2	832	c.244G>A	c.(244-246)Gag>Aag	p.E82K	TIPARP_ENST00000542783.1_Missense_Mutation_p.E82K|TIPARP_ENST00000295924.7_Missense_Mutation_p.E82K|TIPARP_ENST00000486483.1_Missense_Mutation_p.E82K	NM_001184717.1	NP_001171646.1	Q7Z3E1	PARPT_HUMAN	TCDD-inducible poly(ADP-ribose) polymerase	82					androgen metabolic process (GO:0008209)|cellular response to organic cyclic compound (GO:0071407)|estrogen metabolic process (GO:0008210)|face morphogenesis (GO:0060325)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|kidney development (GO:0001822)|multicellular organismal metabolic process (GO:0044236)|negative regulation of gene expression (GO:0010629)|nitrogen compound metabolic process (GO:0006807)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of protein catabolic process (GO:0045732)|post-embryonic development (GO:0009791)|protein ADP-ribosylation (GO:0006471)|skeletal system morphogenesis (GO:0048705)|smooth muscle tissue development (GO:0048745)|vasculogenesis (GO:0001570)	nucleus (GO:0005634)	enhancer binding (GO:0035326)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			GAGTACAGATGAGAACAGCTT	0.418																																					Ovarian(171;276 1987 3319 6837 11197)	dbGAP											0													109.0	107.0	108.0					3																	156395730		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX537965	CCDS3177.1	3q25.31	2011-06-22			ENSG00000163659	ENSG00000163659		"""Poly (ADP-ribose) polymerases"""	23696	protein-coding gene	gene with protein product		612480				12851707	Standard	NM_001184717		Approved	DKFZP434J214, DKFZp686N0351, DDF1, PARP7, PARP-7, PARP-1, pART14, RM1	uc021xgg.1	Q7Z3E1	OTTHUMG00000158646	ENST00000461166.1:c.244G>A	3.37:g.156395730G>A	ENSP00000420612:p.Glu82Lys		D3DNK6|Q68CY9|Q86VP4|Q9Y4P7	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_WWE-dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.E82K	ENST00000461166.1	37	c.244	CCDS3177.1	3	.	.	.	.	.	.	.	.	.	.	G	13.78	2.339884	0.41398	.	.	ENSG00000163659	ENST00000486483;ENST00000295924;ENST00000461166;ENST00000473702;ENST00000481853;ENST00000542783	T;T;T;T;T;T	0.22539	2.96;2.96;2.96;1.95;2.96;2.96	5.11	5.11	0.69529	.	0.653501	0.15595	N	0.254192	T	0.11110	0.0271	N	0.08118	0	0.33411	D	0.578605	B	0.19706	0.038	B	0.16722	0.016	T	0.06463	-1.0825	10	0.52906	T	0.07	.	7.8629	0.29520	0.0871:0.2183:0.6946:0.0	.	82	Q7Z3E1	PARPT_HUMAN	K	82	ENSP00000418757:E82K;ENSP00000295924:E82K;ENSP00000420612:E82K;ENSP00000419982:E82K;ENSP00000418829:E82K;ENSP00000438345:E82K	ENSP00000295924:E82K	E	+	1	0	TIPARP	157878424	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.327000	0.59247	2.390000	0.81377	0.563000	0.77884	GAG	TIPARP	-	NULL	ENSG00000163659		0.418	TIPARP-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TIPARP	HGNC	protein_coding	OTTHUMT00000351618.1	40	0.00	0	G	NM_015508		156395730	156395730	+1	no_errors	ENST00000295924	ensembl	human	known	69_37n	missense	42	12.50	6	SNP	0.997	A
TRAPPC9	83696	genome.wustl.edu	37	8	141415792	141415792	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr8:141415792G>A	ENST00000438773.2	-	6	1025	c.892C>T	c.(892-894)Ctc>Ttc	p.L298F	TRAPPC9_ENST00000389327.3_Missense_Mutation_p.L289F|TRAPPC9_ENST00000389328.4_Missense_Mutation_p.L396F	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9	298					cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						TTGGTGGTGAGGGCACCTGCA	0.393																																						dbGAP											0													123.0	104.0	110.0					8																	141415792		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187	ENST00000438773.2:c.892C>T	8.37:g.141415792G>A	ENSP00000405060:p.Leu298Phe		Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Missense_Mutation	SNP	pfam_TRAPP_II_complex_Trs120	p.L396F	ENST00000438773.2	37	c.1186	CCDS55278.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.85|19.85	3.904427|3.904427	0.72868|0.72868	.|.	.|.	ENSG00000167632|ENSG00000167632	ENST00000389328;ENST00000389327;ENST00000438773|ENST00000520857	.|.	.|.	.|.	5.57|5.57	4.7|4.7	0.59300|0.59300	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.52996|0.52996	0.1769|0.1769	L|L	0.29908|0.29908	0.895|0.895	0.48571|0.48571	D|D	0.999677|0.999677	D;D;D|.	0.76494|.	0.999;0.994;0.997|.	D;P;D|.	0.73380|.	0.98;0.865;0.954|.	T|T	0.48603|0.48603	-0.9021|-0.9021	9|5	0.13108|.	T|.	0.6|.	.|.	13.4806|13.4806	0.61334|0.61334	0.0769:0.0:0.9231:0.0|0.0769:0.0:0.9231:0.0	.|.	298;289;396|.	Q96Q05;Q96Q05-3;Q96Q05-2|.	TPPC9_HUMAN;.;.|.	F|L	396;289;298|141	.|.	ENSP00000373978:L289F|.	L|P	-|-	1|2	0|0	TRAPPC9|TRAPPC9	141484974|141484974	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.730000|0.730000	0.41778|0.41778	6.868000|6.868000	0.75516|0.75516	1.354000|1.354000	0.45846|0.45846	0.563000|0.563000	0.77884|0.77884	CTC|CCT	TRAPPC9	-	NULL	ENSG00000167632		0.393	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	TRAPPC9	HGNC	protein_coding	OTTHUMT00000377749.1	62	0.00	0	G	NM_031466		141415792	141415792	-1	no_errors	ENST00000389328	ensembl	human	known	69_37n	missense	57	18.57	13	SNP	1.000	A
CENPT	80152	genome.wustl.edu	37	16	67861265	67861265	+	IGR	SNP	C	C	G			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr16:67861265C>G	ENST00000562787.1	-	0	2345				TSNAXIP1_ENST00000388833.3_Nonsense_Mutation_p.S539*|TSNAXIP1_ENST00000415766.3_Nonsense_Mutation_p.S524*|TSNAXIP1_ENST00000561639.1_Nonsense_Mutation_p.S593*	NM_025082.3	NP_079358.3	Q96BT3	CENPT_HUMAN	centromere protein T						chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|lung(6)|urinary_tract(1)	10		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)		AACTACCGCTCACTGTTTATG	0.607																																						dbGAP											0													95.0	103.0	100.0					16																	67861265		2198	4300	6498	-	-	-	SO:0001628	intergenic_variant	0			AK056097	CCDS42182.1	16q22.1	2013-11-05	2006-06-15	2006-06-15		ENSG00000102901			25787	protein-coding gene	gene with protein product		611510	"""chromosome 16 open reading frame 56"""	C16orf56		16622420, 16622419	Standard	NM_025082		Approved	FLJ13111, CENP-T	uc002eun.4	Q96BT3			16.37:g.67861265C>G			Q96I29|Q96IC6|Q96NK9|Q9H901	Nonsense_Mutation	SNP	NULL	p.S539*	ENST00000562787.1	37	c.1616	CCDS42182.1	16	.	.	.	.	.	.	.	.	.	.	C	32	5.143070	0.94560	.	.	ENSG00000102904	ENST00000415766;ENST00000388833;ENST00000431934	.	.	.	6.06	-1.22	0.09494	.	1.635760	0.03272	N	0.184905	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	5.284	8.94	0.35725	0.0:0.3382:0.0:0.6618	.	.	.	.	X	524;539;329	.	ENSP00000373485:S539X	S	+	2	0	TSNAXIP1	66418766	0.000000	0.05858	0.000000	0.03702	0.365000	0.29674	-0.474000	0.06607	-0.058000	0.13177	0.655000	0.94253	TCA	TSNAXIP1	-	NULL	ENSG00000102904		0.607	CENPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSNAXIP1	HGNC	protein_coding	OTTHUMT00000422020.1	30	0.00	0	C	NM_025082		67861265	67861265	+1	no_errors	ENST00000388833	ensembl	human	known	69_37n	nonsense	25	26.47	9	SNP	0.000	G
TTN	7273	genome.wustl.edu	37	2	179495587	179495587	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr2:179495587C>T	ENST00000591111.1	-	188	39399	c.39175G>A	c.(39175-39177)Gaa>Aaa	p.E13059K	TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E5827K|TTN_ENST00000359218.5_Missense_Mutation_p.E5760K|TTN_ENST00000460472.2_Missense_Mutation_p.E5635K|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E14700K|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E12132K|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589487.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13059					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATATCATCTTCAGAGATTTCG	0.488																																						dbGAP											0													141.0	137.0	138.0					2																	179495587		1932	4144	6076	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.39175G>A	2.37:g.179495587C>T	ENSP00000465570:p.Glu13059Lys		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E12132K	ENST00000591111.1	37	c.36394		2	.	.	.	.	.	.	.	.	.	.	C	20.5	3.998307	0.74818	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.35048	1.33;1.33;1.33;1.33	6.17	6.17	0.99709	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.45816	0.1361	M	0.81341	2.54	0.80722	D	1	P;P;P;P	0.40050	0.7;0.7;0.7;0.7	B;B;B;B	0.34991	0.193;0.193;0.193;0.193	T	0.53641	-0.8410	9	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	5635;5760;5827;13059	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	12132;5635;5827;5760;5635	ENSP00000343764:E12132K;ENSP00000434586:E5635K;ENSP00000340554:E5827K;ENSP00000352154:E5760K	ENSP00000340554:E5827K	E	-	1	0	TTN	179203832	1.000000	0.71417	0.911000	0.35937	0.996000	0.88848	7.770000	0.85390	2.941000	0.99782	0.655000	0.94253	GAA	TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub	ENSG00000155657		0.488	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	48	0.00	0	C	NM_133378		179495587	179495587	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	67	22.09	19	SNP	1.000	T
TYW3	127253	genome.wustl.edu	37	1	75229688	75229688	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr1:75229688C>T	ENST00000370867.3	+	6	760	c.671C>T	c.(670-672)cCa>cTa	p.P224L	TYW3_ENST00000421739.2_Missense_Mutation_p.P140L|TYW3_ENST00000467646.1_3'UTR|TYW3_ENST00000457880.2_Missense_Mutation_p.P191L|TYW3_ENST00000479111.1_Missense_Mutation_p.P104L	NM_138467.2	NP_612476.1	Q6IPR3	TYW3_HUMAN	tRNA-yW synthesizing protein 3 homolog (S. cerevisiae)	224					tRNA processing (GO:0008033)		methyltransferase activity (GO:0008168)			central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|ovary(2)|prostate(1)|skin(1)	15						AAAAGAAACCCAGAAAAAACA	0.348																																						dbGAP											0													93.0	98.0	96.0					1																	75229688		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX647591	CCDS666.1, CCDS53334.1	1p31.1	2008-02-05	2006-05-25	2006-05-25	ENSG00000162623	ENSG00000162623			24757	protein-coding gene	gene with protein product		611245	"""chromosome 1 open reading frame 171"""	C1orf171		17150819	Standard	NM_138467		Approved	FLJ40918	uc001dgn.3	Q6IPR3	OTTHUMG00000009641	ENST00000370867.3:c.671C>T	1.37:g.75229688C>T	ENSP00000359904:p.Pro224Leu		B4DSP9|E9PGR7|Q5HYJ0|Q8N7L1	Missense_Mutation	SNP	pfam_tRNA_yW-synthesising,superfamily_tRNA_yW-synthesising	p.P224L	ENST00000370867.3	37	c.671	CCDS666.1	1	.	.	.	.	.	.	.	.	.	.	C	10.69	1.420545	0.25639	.	.	ENSG00000162623	ENST00000457880;ENST00000370867;ENST00000421739	T;T	0.41758	0.99;1.59	5.18	0.967	0.19674	.	0.721994	0.14501	N	0.315729	T	0.17109	0.0411	L	0.60455	1.87	0.09310	N	1	B;B;B	0.24823	0.112;0.02;0.049	B;B;B	0.19666	0.016;0.01;0.026	T	0.21759	-1.0236	10	0.41790	T	0.15	-0.0979	8.2247	0.31562	0.4672:0.3902:0.1425:0.0	.	140;191;224	B4DFU6;E9PGR7;Q6IPR3	.;.;TYW3_HUMAN	L	191;224;140	ENSP00000407025:P191L;ENSP00000359904:P224L	ENSP00000359904:P224L	P	+	2	0	TYW3	75002276	0.000000	0.05858	0.002000	0.10522	0.055000	0.15305	-0.625000	0.05534	0.010000	0.14839	-0.152000	0.13540	CCA	TYW3	-	NULL	ENSG00000162623		0.348	TYW3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYW3	HGNC	protein_coding	OTTHUMT00000026573.1	62	0.00	0	C	NM_138467		75229688	75229688	+1	no_errors	ENST00000370867	ensembl	human	known	69_37n	missense	70	18.60	16	SNP	0.002	T
URB2	9816	genome.wustl.edu	37	1	229773010	229773010	+	Missense_Mutation	SNP	A	A	C			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr1:229773010A>C	ENST00000258243.2	+	4	2786	c.2650A>C	c.(2650-2652)Atc>Ctc	p.I884L		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	884						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						TGACTTCCCTATCCAGCTGGA	0.488																																						dbGAP											0													117.0	115.0	116.0					1																	229773010		2203	4300	6503	-	-	-	SO:0001583	missense	0			D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.2650A>C	1.37:g.229773010A>C	ENSP00000258243:p.Ile884Leu		Q5VYC9	Missense_Mutation	SNP	pfam_Urb2/Npa2_C	p.I884L	ENST00000258243.2	37	c.2650	CCDS31052.1	1	.	.	.	.	.	.	.	.	.	.	A	13.05	2.121618	0.37436	.	.	ENSG00000135763	ENST00000258243	T	0.33216	1.42	5.35	1.73	0.24493	.	0.332806	0.30830	N	0.008788	T	0.16257	0.0391	N	0.19112	0.55	0.09310	N	1	B	0.34372	0.451	B	0.31869	0.137	T	0.16630	-1.0396	9	.	.	.	-11.9192	9.0669	0.36469	0.7027:0.0:0.2973:0.0	.	884	Q14146	URB2_HUMAN	L	884	ENSP00000258243:I884L	.	I	+	1	0	URB2	227839633	0.884000	0.30299	0.011000	0.14972	0.901000	0.52897	2.029000	0.41098	0.420000	0.25954	0.477000	0.44152	ATC	URB2	-	NULL	ENSG00000135763		0.488	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URB2	HGNC	protein_coding	OTTHUMT00000095232.1	45	0.00	0	A	NM_014777		229773010	229773010	+1	no_errors	ENST00000258243	ensembl	human	known	69_37n	missense	40	24.53	13	SNP	0.013	C
VPS13A	23230	genome.wustl.edu	37	9	79792653	79792653	+	Silent	SNP	G	G	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr9:79792653G>A	ENST00000360280.3	+	1	293	c.33G>A	c.(31-33)ttG>ttA	p.L11L	VPS13A_ENST00000357409.5_Silent_p.L11L|VPS13A_ENST00000376634.4_Silent_p.L11L|VPS13A_ENST00000376636.3_Silent_p.L11L|VPS13A-AS1_ENST00000415172.1_RNA	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	11					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						TGGACGTGTTGAACCGGTTCT	0.677																																						dbGAP											0													127.0	99.0	108.0					9																	79792653		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.33G>A	9.37:g.79792653G>A			Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Silent	SNP	pfam_VPSAP,pfam_Autophagy-rel_C	p.L11	ENST00000360280.3	37	c.33	CCDS6655.1	9																																																																																			VPS13A	-	NULL	ENSG00000197969		0.677	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13A	HGNC	protein_coding	OTTHUMT00000052753.2	31	0.00	0	G	NM_015186		79792653	79792653	+1	no_errors	ENST00000360280	ensembl	human	known	69_37n	silent	43	15.69	8	SNP	1.000	A
WBSCR28	135886	genome.wustl.edu	37	7	73280136	73280136	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr7:73280136C>T	ENST00000320531.2	+	3	767	c.731C>T	c.(730-732)tCa>tTa	p.S244L		NM_182504.3	NP_872310.2	Q6UE05	WBS28_HUMAN	Williams-Beuren syndrome chromosome region 28	244						integral component of membrane (GO:0016021)				breast(2)|kidney(2)|lung(6)|skin(1)	11		Lung NSC(55;0.159)				TTGCTGCCCTCACTGTCTGCG	0.592																																						dbGAP											0													120.0	129.0	126.0					7																	73280136		2002	4178	6180	-	-	-	SO:0001583	missense	0			BC030643	CCDS43597.1	7q11.23	2006-07-04			ENSG00000175877	ENSG00000175877			23018	protein-coding gene	gene with protein product		612547				8812460	Standard	NM_182504		Approved	MGC26719	uc003tzk.2	Q6UE05	OTTHUMG00000157243	ENST00000320531.2:c.731C>T	7.37:g.73280136C>T	ENSP00000316775:p.Ser244Leu		Q6UE04|Q8NHP4	Missense_Mutation	SNP	NULL	p.S244L	ENST00000320531.2	37	c.731	CCDS43597.1	7	.	.	.	.	.	.	.	.	.	.	C	10.58	1.388930	0.25118	.	.	ENSG00000175877	ENST00000320531	T	0.16897	2.31	3.75	-3.82	0.04281	.	1.558900	0.04235	N	0.335968	T	0.06050	0.0157	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.30179	-0.9987	10	0.15499	T	0.54	1.0057	3.8668	0.09019	0.2882:0.2344:0.0:0.4774	.	244	Q6UE05	WBS28_HUMAN	L	244	ENSP00000316775:S244L	ENSP00000316775:S244L	S	+	2	0	WBSCR28	72918072	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.815000	0.04481	-0.970000	0.03569	-1.340000	0.01251	TCA	WBSCR28	-	NULL	ENSG00000175877		0.592	WBSCR28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBSCR28	HGNC	protein_coding	OTTHUMT00000348130.1	27	0.00	0	C	NM_182504		73280136	73280136	+1	no_errors	ENST00000320531	ensembl	human	known	69_37n	missense	25	21.88	7	SNP	0.000	T
WSCD2	9671	genome.wustl.edu	37	12	108620851	108620851	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr12:108620851G>A	ENST00000332082.4	+	7	1707	c.889G>A	c.(889-891)Gag>Aag	p.E297K	WSCD2_ENST00000261400.3_Missense_Mutation_p.E297K|WSCD2_ENST00000547525.1_Missense_Mutation_p.E297K|WSCD2_ENST00000549903.1_Missense_Mutation_p.E297K			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	297	WSC 2. {ECO:0000255|PROSITE- ProRule:PRU00558}.					integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						CAGAGAGGATGAGCAGCTCTG	0.597																																						dbGAP											0													68.0	71.0	70.0					12																	108620851		1988	4152	6140	-	-	-	SO:0001583	missense	0				CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.889G>A	12.37:g.108620851G>A	ENSP00000331933:p.Glu297Lys		B2RN48|B4DES1|Q8IY35|Q9Y4B7	Missense_Mutation	SNP	pfam_WSC_carb-bd,smart_WSC_carb-bd_subgr,pfscan_WSC_carb-bd	p.E297K	ENST00000332082.4	37	c.889	CCDS41828.1	12	.	.	.	.	.	.	.	.	.	.	G	29.9	5.041965	0.93685	.	.	ENSG00000075035	ENST00000547525;ENST00000261400;ENST00000332082;ENST00000549903	T;T;T;T	0.54866	0.55;0.55;0.55;0.55	5.4	5.4	0.78164	Carbohydrate-binding WSC (2);Carbohydrate-binding WSC, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.69584	0.3127	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.85130	0.997;0.992	T	0.62789	-0.6780	10	0.23891	T	0.37	-34.96	18.3441	0.90315	0.0:0.0:1.0:0.0	.	297;297	Q2TBF2-2;Q2TBF2	.;WSCD2_HUMAN	K	297	ENSP00000448047:E297K;ENSP00000261400:E297K;ENSP00000331933:E297K;ENSP00000447272:E297K	ENSP00000261400:E297K	E	+	1	0	WSCD2	107144981	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	9.072000	0.93986	2.805000	0.96524	0.655000	0.94253	GAG	WSCD2	-	pfam_WSC_carb-bd,smart_WSC_carb-bd_subgr,pfscan_WSC_carb-bd	ENSG00000075035		0.597	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	WSCD2	HGNC	protein_coding	OTTHUMT00000405554.1	23	0.00	0	G	NM_014653		108620851	108620851	+1	no_errors	ENST00000261400	ensembl	human	known	69_37n	missense	22	21.43	6	SNP	1.000	A
XAF1	54739	genome.wustl.edu	37	17	6676441	6676441	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr17:6676441C>T	ENST00000361842.3	+	7	1098	c.859C>T	c.(859-861)Cgg>Tgg	p.R287W	XAF1_ENST00000441631.1_Missense_Mutation_p.R287W|XAF1_ENST00000346752.4_Missense_Mutation_p.R268W	NM_017523.3	NP_059993.2	Q6GPH4	XAF1_HUMAN	XIAP associated factor 1	287					apoptotic process (GO:0006915)|cytokine-mediated signaling pathway (GO:0019221)|negative regulation of protein complex assembly (GO:0031333)|response to interferon-beta (GO:0035456)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			large_intestine(2)|lung(2)|prostate(1)|urinary_tract(1)	6						GGAGAAATGCCGGTGGTTAGC	0.343																																						dbGAP											0													91.0	90.0	90.0					17																	6676441		2203	4300	6503	-	-	-	SO:0001583	missense	0			X99699	CCDS11080.1, CCDS11081.1	17p13.2	2010-03-19			ENSG00000132530	ENSG00000132530			30932	protein-coding gene	gene with protein product		606717				12029096, 11175744	Standard	NM_199139		Approved	BIRC4BP, XIAPAF1, HSXIAPAF1	uc002gdn.3	Q6GPH4		ENST00000361842.3:c.859C>T	17.37:g.6676441C>T	ENSP00000354822:p.Arg287Trp		A2T931|A2T932|A8K2L1|A8K9Y3|D3DTM6|Q6MZE8|Q8N557|Q99982	Missense_Mutation	SNP	superfamily_TRAF-like,pfscan_Znf_TRAF	p.R287W	ENST00000361842.3	37	c.859	CCDS11080.1	17	.	.	.	.	.	.	.	.	.	.	c	15.76	2.928927	0.52759	.	.	ENSG00000132530	ENST00000361842;ENST00000441631;ENST00000346752;ENST00000431790	T;T;T	0.18338	4.22;2.22;2.22	4.98	-9.27	0.00659	.	2.517730	0.01931	N	0.041257	T	0.07638	0.0192	N	0.03608	-0.345	0.25587	N	0.986736	B;B;B;B	0.11235	0.004;0.004;0.001;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.0	T	0.27468	-1.0073	10	0.45353	T	0.12	-19.9607	11.9885	0.53161	0.1014:0.6732:0.0:0.2254	.	287;185;268;287	C9K044;Q6GPH4-6;Q6GPH4-2;Q6GPH4	.;.;.;XAF1_HUMAN	W	287;287;268;185	ENSP00000354822:R287W;ENSP00000413199:R287W;ENSP00000341029:R268W	ENSP00000341029:R268W	R	+	1	2	XAF1	6617165	0.000000	0.05858	0.001000	0.08648	0.817000	0.46193	-1.202000	0.03023	-1.644000	0.01517	-1.128000	0.01989	CGG	XAF1	-	NULL	ENSG00000132530		0.343	XAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XAF1	HGNC	protein_coding	OTTHUMT00000439643.5	59	0.00	0	C	NM_017523		6676441	6676441	+1	no_errors	ENST00000361842	ensembl	human	known	69_37n	missense	37	17.78	8	SNP	0.001	T
ZAK	51776	genome.wustl.edu	37	2	174130809	174130809	+	Silent	SNP	G	G	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr2:174130809G>A	ENST00000375213.3	+	20	1812	c.1734G>A	c.(1732-1734)agG>agA	p.R578R	MLK7-AS1_ENST00000422703.1_RNA|MLTK_ENST00000409176.2_Silent_p.R578R|MLK7-AS1_ENST00000423106.2_RNA	NM_016653.2	NP_057737.2	Q9NYL2	MLTK_HUMAN		578					activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell death (GO:0008219)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|DNA damage checkpoint (GO:0000077)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|response to radiation (GO:0009314)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)										ATACTCTGAGGATGCGGCAGA	0.478																																						dbGAP											0													58.0	55.0	56.0					2																	174130809		2007	4179	6186	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000375213.3:c.1734G>A	2.37:g.174130809G>A			B3KPG2|Q53SX1|Q580W8|Q59GY5|Q86YW8|Q9HCC4|Q9HCC5|Q9HDD2|Q9NYE9	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SAM_type1,pfam_SAM_2,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pfscan_SAM,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R578	ENST00000375213.3	37	c.1734	CCDS42777.1	2																																																																																			AC013461.1	-	NULL	ENSG00000091436		0.478	MLTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZAK	Clone_based_vega_gene	protein_coding	OTTHUMT00000255401.1	24	0.00	0	G			174130809	174130809	+1	no_errors	ENST00000375213	ensembl	human	known	69_37n	silent	43	23.21	13	SNP	0.291	A
ZBTB40	9923	genome.wustl.edu	37	1	22828833	22828833	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr1:22828833G>T	ENST00000375647.4	+	5	1273	c.1066G>T	c.(1066-1068)Gaa>Taa	p.E356*	ZBTB40_ENST00000374651.4_Intron|ZBTB40_ENST00000404138.1_Nonsense_Mutation_p.E356*	NM_014870.3	NP_055685.3	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	356					bone mineralization (GO:0030282)|cellular response to DNA damage stimulus (GO:0006974)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(4)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		TCTGTTACTAGAACACAAAGA	0.453																																						dbGAP											0													109.0	92.0	98.0					1																	22828833		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB007947	CCDS224.1	1p36	2013-01-08			ENSG00000184677	ENSG00000184677		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	29045	protein-coding gene	gene with protein product		612106					Standard	NM_014870		Approved	KIAA0478, ZNF923	uc001bfu.2	Q9NUA8	OTTHUMG00000002897	ENST00000375647.4:c.1066G>T	1.37:g.22828833G>T	ENSP00000364798:p.Glu356*		O75066|Q5TFU5|Q8N1R1	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.E356*	ENST00000375647.4	37	c.1066	CCDS224.1	1	.	.	.	.	.	.	.	.	.	.	G	41	9.016147	0.99037	.	.	ENSG00000184677	ENST00000404138;ENST00000375647;ENST00000400239	.	.	.	6.04	5.1	0.69264	.	0.224065	0.31051	N	0.008343	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-2.196	15.8499	0.78921	0.0:0.1361:0.8639:0.0	.	.	.	.	X	356	.	ENSP00000364798:E356X	E	+	1	0	ZBTB40	22701420	1.000000	0.71417	0.761000	0.31378	0.993000	0.82548	2.796000	0.47869	1.506000	0.48736	0.561000	0.74099	GAA	ZBTB40	-	NULL	ENSG00000184677		0.453	ZBTB40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB40	HGNC	protein_coding	OTTHUMT00000008094.1	26	0.00	0	G	NM_014870		22828833	22828833	+1	no_errors	ENST00000375647	ensembl	human	known	69_37n	nonsense	15	21.05	4	SNP	0.987	T
ZNF251	90987	genome.wustl.edu	37	8	145947971	145947971	+	Silent	SNP	G	G	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr8:145947971G>A	ENST00000292562.7	-	5	1349	c.1074C>T	c.(1072-1074)ttC>ttT	p.F358F	ZNF251_ENST00000524394.1_Intron	NM_138367.1	NP_612376.1	Q9BRH9	ZN251_HUMAN	zinc finger protein 251	358					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|kidney(1)|large_intestine(5)|lung(9)|stomach(1)	17	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;7.54e-38)|all cancers(56;6.19e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.198)		AGCTTCGACTGAAGGCCTTCC	0.507																																						dbGAP											0													68.0	75.0	73.0					8																	145947971		2194	4299	6493	-	-	-	SO:0001819	synonymous_variant	0			AK000435	CCDS47944.1	8q24.3	2013-01-08			ENSG00000198169	ENSG00000198169		"""Zinc fingers, C2H2-type"", ""-"""	13045	protein-coding gene	gene with protein product							Standard	NM_138367		Approved		uc003zdv.4	Q9BRH9	OTTHUMG00000165189	ENST00000292562.7:c.1074C>T	8.37:g.145947971G>A			Q2M219	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F358	ENST00000292562.7	37	c.1074	CCDS47944.1	8																																																																																			ZNF251	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198169		0.507	ZNF251-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF251	HGNC	protein_coding	OTTHUMT00000382541.1	41	0.00	0	G	NM_138367		145947971	145947971	-1	no_errors	ENST00000292562	ensembl	human	known	69_37n	silent	31	22.50	9	SNP	0.486	A
ZPR1	8882	genome.wustl.edu	37	11	116657763	116657763	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr11:116657763C>T	ENST00000227322.3	-	3	405	c.346G>A	c.(346-348)Gaa>Aaa	p.E116K		NM_003904.3	NP_003895.1	O75312	ZPR1_HUMAN		116					apoptotic process involved in development (GO:1902742)|axon development (GO:0061564)|Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA endoreduplication (GO:0042023)|inner cell mass cell proliferation (GO:0001833)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of motor neuron apoptotic process (GO:2000672)|positive regulation of gene expression (GO:0010628)|positive regulation of growth (GO:0045927)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of RNA splicing (GO:0033120)|positive regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071931)|pre-mRNA catabolic process (GO:1990261)|regulation of myelination (GO:0031641)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|spinal cord development (GO:0021510)|trophectodermal cell proliferation (GO:0001834)	axon (GO:0030424)|Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|SMN complex (GO:0032797)	translation initiation factor binding (GO:0031369)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	9	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.61e-06)|all cancers(92;0.000139)|OV - Ovarian serous cystadenocarcinoma(223;0.153)		TTCACCACTTCTCTGTTCATG	0.443																																						dbGAP											0													129.0	129.0	129.0					11																	116657763		2201	4296	6497	-	-	-	SO:0001583	missense	0																														ENST00000227322.3:c.346G>A	11.37:g.116657763C>T	ENSP00000227322:p.Glu116Lys		Q2TAA0	Missense_Mutation	SNP	pfam_Znf_ZPR1,smart_Znf_ZPR1,tigrfam_Znf_ZPR1	p.E116K	ENST00000227322.3	37	c.346	CCDS8375.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.6|26.6	4.748936|4.748936	0.89753|0.89753	.|.	.|.	ENSG00000109917|ENSG00000109917	ENST00000227322|ENST00000429220	T|T	0.41065|0.49139	1.01|0.79	5.74|5.74	4.82|4.82	0.62117|0.62117	Zinc finger, ZPR1-type (3);|.	0.043125|.	0.85682|.	D|.	0.000000|.	T|T	0.64283|0.64283	0.2584|0.2584	M|M	0.73962|0.73962	2.25|2.25	0.80722|0.80722	D|D	1|1	D;P|.	0.57257|.	0.979;0.831|.	P;P|.	0.54544|.	0.755;0.474|.	T|T	0.65788|0.65788	-0.6083|-0.6083	10|6	0.59425|.	D|.	0.04|.	-11.3972|-11.3972	16.8668|16.8668	0.86030|0.86030	0.0:0.8717:0.1283:0.0|0.0:0.8717:0.1283:0.0	.|.	65;116|.	B4DVT8;O75312|.	.;ZPR1_HUMAN|.	K|K	116|58	ENSP00000227322:E116K|ENSP00000394495:R58K	ENSP00000227322:E116K|.	E|R	-|-	1|2	0|0	ZNF259|ZNF259	116162973|116162973	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.964000|0.964000	0.63967|0.63967	4.157000|4.157000	0.58144|0.58144	1.412000|1.412000	0.46977|0.46977	0.555000|0.555000	0.69702|0.69702	GAA|AGA	ZNF259	-	pfam_Znf_ZPR1,smart_Znf_ZPR1,tigrfam_Znf_ZPR1	ENSG00000109917		0.443	ZNF259-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF259	HGNC	protein_coding	OTTHUMT00000106283.2	38	0.00	0	C			116657763	116657763	-1	no_errors	ENST00000227322	ensembl	human	known	69_37n	missense	36	26.53	13	SNP	1.000	T
ZNF500	26048	genome.wustl.edu	37	16	4812753	4812753	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr16:4812753G>A	ENST00000219478.6	-	3	718	c.419C>T	c.(418-420)tCa>tTa	p.S140L	ZNF500_ENST00000545009.1_Missense_Mutation_p.S140L			O60304	ZN500_HUMAN	zinc finger protein 500	140					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	21						AAGCAGCTCTGAGCCCTGCAC	0.607																																						dbGAP											0													68.0	70.0	69.0					16																	4812753		2197	4300	6497	-	-	-	SO:0001583	missense	0			AB011129	CCDS32383.1	16p13.3	2013-01-09				ENSG00000103199		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23716	protein-coding gene	gene with protein product						9628581	Standard	XM_005255243		Approved	ZKSCAN18, KIAA0557, ZSCAN50	uc002cxp.1	O60304		ENST00000219478.6:c.419C>T	16.37:g.4812753G>A	ENSP00000219478:p.Ser140Leu		A8K6X7|B4DNN9|Q0VAL2|Q96CQ8|Q9BTG0	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.S140L	ENST00000219478.6	37	c.419	CCDS32383.1	16	.	.	.	.	.	.	.	.	.	.	G	13.04	2.117868	0.37339	.	.	ENSG00000103199	ENST00000545009;ENST00000219478	T;T	0.06608	3.35;3.28	3.25	-1.76	0.08006	Transcription regulator SCAN (1);	1.359190	0.05626	N	0.580896	T	0.02807	0.0084	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.45071	-0.9286	10	0.28530	T	0.3	.	0.6217	0.00779	0.3864:0.1719:0.2675:0.1742	.	140;140	B4DNN9;O60304	.;ZN500_HUMAN	L	140	ENSP00000445714:S140L;ENSP00000219478:S140L	ENSP00000219478:S140L	S	-	2	0	ZNF500	4752754	0.000000	0.05858	0.030000	0.17652	0.916000	0.54674	-0.852000	0.04308	-0.082000	0.12640	0.655000	0.94253	TCA	ZNF500	-	smart_Tscrpt_reg_SCAN	ENSG00000103199		0.607	ZNF500-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF500	HGNC	protein_coding	OTTHUMT00000432461.1	22	0.00	0	G	XM_085507		4812753	4812753	-1	no_errors	ENST00000219478	ensembl	human	known	69_37n	missense	27	22.86	8	SNP	0.020	A
ZNF536	9745	genome.wustl.edu	37	19	30936548	30936548	+	Silent	SNP	C	C	T			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr19:30936548C>T	ENST00000355537.3	+	2	2226	c.2079C>T	c.(2077-2079)aaC>aaT	p.N693N		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	693					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GCTCCTCTAACGTCACCGAGG	0.697																																						dbGAP											0													18.0	22.0	20.0					19																	30936548		2195	4292	6487	-	-	-	SO:0001819	synonymous_variant	0				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2079C>T	19.37:g.30936548C>T			A2RU18	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N693	ENST00000355537.3	37	c.2079	CCDS32984.1	19																																																																																			ZNF536	-	NULL	ENSG00000198597		0.697	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2	8	0.00	0	C	NM_014717		30936548	30936548	+1	no_errors	ENST00000355537	ensembl	human	known	69_37n	silent	13	27.78	5	SNP	0.926	T
ZNF534	147658	genome.wustl.edu	37	19	52942307	52942307	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1OV-01A-11D-A142-09	TCGA-EW-A1OV-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e27ca8f5-3f76-4531-87ea-ba3a44f6830d	39d05c29-a4bb-4b5f-a818-c94045721134	g.chr19:52942307C>A	ENST00000332323.6	+	4	1694	c.1633C>A	c.(1633-1635)Cgt>Agt	p.R545S	ZNF534_ENST00000433050.1_Missense_Mutation_p.R532S|ZNF534_ENST00000301085.4_Intron|ZNF534_ENST00000432303.2_Intron	NM_001143939.1	NP_001137411.1	Q76KX8	ZN534_HUMAN	zinc finger protein 534	545					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	4						CAAGGTCTTCCGTCGGAATTC	0.443																																						dbGAP											0													84.0	78.0	80.0					19																	52942307		692	1591	2283	-	-	-	SO:0001583	missense	0			AK058073	CCDS46165.1, CCDS46166.1	19q13.41	2013-01-08	2004-02-06	2004-02-11	ENSG00000198633	ENSG00000198633		"""Zinc fingers, C2H2-type"", ""-"""	26337	protein-coding gene	gene with protein product			"""KRAB domain only 3"""	KRBO3			Standard	NM_001143938		Approved	FLJ25344	uc002pzk.3	Q76KX8	OTTHUMG00000156493	ENST00000332323.6:c.1633C>A	19.37:g.52942307C>A	ENSP00000327538:p.Arg545Ser		Q76KX9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R545S	ENST00000332323.6	37	c.1633	CCDS46165.1	19	.	.	.	.	.	.	.	.	.	.	C	0.062	-1.221795	0.01530	.	.	ENSG00000198633	ENST00000332323;ENST00000433050;ENST00000391790	T;T	0.35048	1.33;1.33	1.7	-1.49	0.08718	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09555	0.0235	N	0.01729	-0.75	0.09310	N	0.999999	B;B	0.17268	0.001;0.021	B;B	0.15484	0.002;0.013	T	0.33777	-0.9855	9	0.02654	T	1	.	3.6566	0.08223	0.3205:0.4974:0.1822:0.0	.	532;545	Q76KX8-2;Q76KX8	.;ZN534_HUMAN	S	545;532;544	ENSP00000327538:R545S;ENSP00000391358:R532S	ENSP00000327538:R545S	R	+	1	0	ZNF534	57634119	0.000000	0.05858	0.002000	0.10522	0.006000	0.05464	-3.306000	0.00518	-0.048000	0.13401	-0.984000	0.02558	CGT	ZNF534	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198633		0.443	ZNF534-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF534	HGNC	protein_coding	OTTHUMT00000460877.1	41	0.00	0	C	NM_182512		52942307	52942307	+1	no_errors	ENST00000332323	ensembl	human	known	69_37n	missense	66	28.26	26	SNP	0.058	A
