#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCB9	23457	genome.wustl.edu	37	12	123419951	123419951	+	Silent	SNP	G	G	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr12:123419951G>A	ENST00000542678.1	-	10	4609	c.1771C>T	c.(1771-1773)Ctg>Ttg	p.L591L	ABCB9_ENST00000346530.5_Silent_p.L548L|ABCB9_ENST00000280560.8_Silent_p.L591L|ABCB9_ENST00000344275.7_Silent_p.L591L|ABCB9_ENST00000540285.1_Silent_p.L528L|ABCB9_ENST00000442028.2_Silent_p.L591L|ABCB9_ENST00000442833.2_Silent_p.L591L|ABCB9_ENST00000392439.3_Silent_p.L591L			Q9NP78	ABCB9_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 9	591	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				peptide transport (GO:0015833)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)	integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|peptide-transporting ATPase activity (GO:0015440)|protein homodimerization activity (GO:0042803)|substrate-specific transmembrane transporter activity (GO:0022891)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)|skin(1)	18	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.84e-05)|Epithelial(86;0.000152)|BRCA - Breast invasive adenocarcinoma(302;0.111)		CGGGCGAACAGCACGGGCTCC	0.622																																					Ovarian(49;786 1333 9175 38236)	dbGAP											0													76.0	63.0	68.0					12																	123419951		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U66676	CCDS9241.1, CCDS58286.1, CCDS58287.1, CCDS58288.1	12q24	2012-03-14			ENSG00000150967	ENSG00000150967		"""ATP binding cassette transporters / subfamily B"""	50	protein-coding gene	gene with protein product		605453				8894702	Standard	NM_019625		Approved	EST122234	uc001udm.4	Q9NP78		ENST00000542678.1:c.1771C>T	12.37:g.123419951G>A			B4E2J0|Q5W9G7|Q769F3|Q769F4|Q96AB1|Q9P208	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.L591	ENST00000542678.1	37	c.1771	CCDS9241.1	12																																																																																			ABCB9	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000150967		0.622	ABCB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB9	HGNC	protein_coding	OTTHUMT00000400956.1	40	0.00	0	G	NM_019624		123419951	123419951	-1	no_errors	ENST00000442028	ensembl	human	known	69_37n	silent	21	16.00	4	SNP	1.000	A
ACCS	84680	genome.wustl.edu	37	11	44102768	44102768	+	Missense_Mutation	SNP	A	A	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr11:44102768A>G	ENST00000263776.8	+	12	1443	c.1009A>G	c.(1009-1011)Aca>Gca	p.T337A		NM_001127219.1|NM_032592.3	NP_001120691.1|NP_115981.1	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)	337					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(4)|endometrium(3)|large_intestine(11)|lung(15)|ovary(1)|skin(1)	35						CACGCTGTACACAGAAAACCA	0.632																																					Esophageal Squamous(158;148 1889 8077 23160 41213)	dbGAP											0													83.0	79.0	80.0					11																	44102768		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY026508	CCDS7907.1	11p11	2008-03-12	2008-01-28		ENSG00000110455	ENSG00000110455			23989	protein-coding gene	gene with protein product		608405				11470512	Standard	NM_032592		Approved	PHACS, ACS	uc009yks.1	Q96QU6	OTTHUMG00000166427	ENST00000263776.8:c.1009A>G	11.37:g.44102768A>G	ENSP00000263776:p.Thr337Ala		B4E219|Q8WUL4|Q96LX5	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom,prints_ACC_synthase	p.T337A	ENST00000263776.8	37	c.1009	CCDS7907.1	11	.	.	.	.	.	.	.	.	.	.	A	13.68	2.309842	0.40895	.	.	ENSG00000110455	ENST00000263776	D	0.89343	-2.5	5.31	5.31	0.75309	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.111786	0.64402	D	0.000013	D	0.92792	0.7708	M	0.74546	2.27	0.80722	D	1	D	0.60575	0.988	D	0.65323	0.934	D	0.93157	0.6554	10	0.72032	D	0.01	-7.041	10.2184	0.43182	0.8518:0.0:0.0:0.1482	.	337	Q96QU6	1A1L1_HUMAN	A	337	ENSP00000263776:T337A	ENSP00000263776:T337A	T	+	1	0	ACCS	44059344	1.000000	0.71417	1.000000	0.80357	0.029000	0.11900	3.172000	0.50832	2.019000	0.59389	0.533000	0.62120	ACA	ACCS	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom,prints_ACC_synthase	ENSG00000110455		0.632	ACCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACCS	HGNC	protein_coding	OTTHUMT00000389721.1	43	0.00	0	A	NM_032592		44102768	44102768	+1	no_errors	ENST00000263776	ensembl	human	known	69_37n	missense	10	47.37	9	SNP	1.000	G
ABCG4	64137	genome.wustl.edu	37	11	119027390	119027390	+	Splice_Site	SNP	T	T	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr11:119027390T>A	ENST00000449422.2	+	8	1113		c.e8+2		ABCG4_ENST00000307417.3_Splice_Site|ABCG4_ENST00000531739.1_Splice_Site	NM_001142505.1	NP_001135977.1	Q9H172	ABCG4_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 4						cholesterol efflux (GO:0033344)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(28)|ovary(2)|prostate(1)|skin(1)	44	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		CTGACTTCAGTGAGTGGGGGT	0.587																																						dbGAP											0													63.0	60.0	61.0					11																	119027390		2200	4295	6495	-	-	-	SO:0001630	splice_region_variant	0			AJ300465	CCDS8415.1	11q23	2012-03-14			ENSG00000172350	ENSG00000172350		"""ATP binding cassette transporters / subfamily G"""	13884	protein-coding gene	gene with protein product	"""putative ABC transporter"", ""ATP-binding cassette, subfamily G, member 4"""	607784				11435397	Standard	NM_022169		Approved	WHITE2	uc001pvs.3	Q9H172	OTTHUMG00000166169	ENST00000449422.2:c.925+2T>A	11.37:g.119027390T>A			A8K1B5|Q8WWH0|Q8WWH1|Q8WWH2	Splice_Site	SNP	-	e7+2	ENST00000449422.2	37	c.925+2	CCDS8415.1	11	.	.	.	.	.	.	.	.	.	.	T	24.6	4.546128	0.86022	.	.	ENSG00000172350	ENST00000307417;ENST00000449422;ENST00000531739	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0441	0.80707	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ABCG4	118532600	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.691000	0.84191	2.177000	0.69029	0.533000	0.62120	.	ABCG4	-	-	ENSG00000172350		0.587	ABCG4-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ABCG4	HGNC	protein_coding	OTTHUMT00000388215.1	27	0.00	0	T	NM_022169	Intron	119027390	119027390	+1	no_errors	ENST00000307417	ensembl	human	known	69_37n	splice_site	21	30.00	9	SNP	1.000	A
ACVR1C	130399	genome.wustl.edu	37	2	158412843	158412843	+	Splice_Site	SNP	T	T	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr2:158412843T>G	ENST00000243349.8	-	3	666	c.306A>C	c.(304-306)gcA>gcC	p.A102A	ACVR1C_ENST00000348328.5_Intron|ACVR1C_ENST00000409680.3_Splice_Site_p.A52A|ACVR1C_ENST00000335450.7_Intron	NM_001111032.1|NM_145259.2	NP_001104502.1|NP_660302.2			activin A receptor, type IC											NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	42						CATTTGGTGATGCTACAGTTT	0.398																																						dbGAP											0													91.0	80.0	83.0					2																	158412843		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC022530	CCDS2205.1, CCDS46432.1, CCDS46433.1, CCDS46434.1	2q24.2	2008-02-05			ENSG00000123612	ENSG00000123612			18123	protein-coding gene	gene with protein product		608981					Standard	NM_145259		Approved	ALK7, ACVRLK7	uc002tzk.4	Q8NER5	OTTHUMG00000131964	ENST00000243349.8:c.305-1A>C	2.37:g.158412843T>G				Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.A102	ENST00000243349.8	37	c.306	CCDS2205.1	2																																																																																			ACVR1C	-	NULL	ENSG00000123612		0.398	ACVR1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVR1C	HGNC	protein_coding	OTTHUMT00000254924.2	38	0.00	0	T	NM_145259	Silent	158412843	158412843	-1	no_errors	ENST00000243349	ensembl	human	known	69_37n	silent	31	38.00	19	SNP	0.457	G
ADCY1	107	genome.wustl.edu	37	7	45703971	45703971	+	Intron	SNP	G	G	A	rs1042009	byFrequency	TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr7:45703971G>A	ENST00000297323.7	+	8	1627				ADCY1_ENST00000432715.1_Silent_p.T338T	NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)						activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GACTGTGCACGTAGCTTCAGG	0.592													G|||	2367	0.472644	0.1619	0.6282	5008	,	,		16672	0.3343		0.6849	False		,,,				2504	0.7065					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.1605+2158G>A	7.37:g.45703971G>A			A4D2L8|Q75MI1	Silent	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.T338	ENST00000297323.7	37	c.1014	CCDS34631.1	7																																																																																			ADCY1	-	NULL	ENSG00000164742		0.592	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY1	HGNC	protein_coding	OTTHUMT00000340055.2	43	0.00	0	G	NM_021116		45703971	45703971	+1	no_errors	ENST00000432715	ensembl	human	putative	69_37n	silent	23	14.29	4	SNP	0.000	A
ADCY1	107	genome.wustl.edu	37	7	45725735	45725735	+	Missense_Mutation	SNP	T	T	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr7:45725735T>G	ENST00000297323.7	+	13	2270	c.2248T>G	c.(2248-2250)Ttg>Gtg	p.L750V		NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	750					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GGTGTCCTCCTTGCCAAAAAT	0.602																																						dbGAP											0													90.0	80.0	83.0					7																	45725735		2203	4300	6503	-	-	-	SO:0001583	missense	0			L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.2248T>G	7.37:g.45725735T>G	ENSP00000297323:p.Leu750Val		A4D2L8|Q75MI1	Missense_Mutation	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.L750V	ENST00000297323.7	37	c.2248	CCDS34631.1	7	.	.	.	.	.	.	.	.	.	.	T	14.57	2.575123	0.45902	.	.	ENSG00000164742	ENST00000297323;ENST00000545300	T	0.80214	-1.35	4.25	1.88	0.25563	.	0.285511	0.29355	N	0.012384	T	0.72236	0.3435	M	0.64997	1.995	0.32593	N	0.526879	B	0.24368	0.102	B	0.19148	0.024	T	0.66101	-0.6007	10	0.27785	T	0.31	.	6.6896	0.23163	0.0:0.2053:0.0:0.7947	.	750	Q08828	ADCY1_HUMAN	V	750	ENSP00000297323:L750V	ENSP00000297323:L750V	L	+	1	2	ADCY1	45692260	1.000000	0.71417	0.999000	0.59377	0.975000	0.68041	0.861000	0.27885	0.210000	0.20664	0.379000	0.24179	TTG	ADCY1	-	NULL	ENSG00000164742		0.602	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY1	HGNC	protein_coding	OTTHUMT00000340055.2	75	0.00	0	T	NM_021116		45725735	45725735	+1	no_errors	ENST00000297323	ensembl	human	known	69_37n	missense	43	20.37	11	SNP	1.000	G
ADRA1A	148	genome.wustl.edu	37	8	26722177	26722177	+	Missense_Mutation	SNP	C	C	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr8:26722177C>A	ENST00000519229.1	-	1	316	c.310G>T	c.(310-312)Gca>Tca	p.A104S	ADRA1A_ENST00000358857.5_Missense_Mutation_p.A104S|ADRA1A_ENST00000380582.3_Missense_Mutation_p.A104S|ADRA1A_ENST00000380573.3_Missense_Mutation_p.A104S|ADRA1A_ENST00000276393.4_Missense_Mutation_p.A104S|ADRA1A_ENST00000380581.2_Missense_Mutation_p.A104S|ADRA1A_ENST00000380587.1_Missense_Mutation_p.A104S|ADRA1A_ENST00000380586.1_Missense_Mutation_p.A104S|ADRA1A_ENST00000380572.3_Missense_Mutation_p.A104S|ADRA1A_ENST00000354550.4_Missense_Mutation_p.A104S			P25100	ADA1D_HUMAN	adrenoceptor alpha 1A	174					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)			breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|skin(1)	36		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	ACATCCACTGCCGCCCAGATG	0.632																																						dbGAP											0													104.0	97.0	99.0					8																	26722177		2203	4300	6503	-	-	-	SO:0001583	missense	0			L31774	CCDS6052.1, CCDS6053.1, CCDS6054.1, CCDS34869.1	8p21.2	2012-08-08	2012-05-09		ENSG00000120907	ENSG00000120907		"""GPCR / Class A : Adrenoceptors : alpha"""	277	protein-coding gene	gene with protein product		104221	"""adrenergic, alpha-1A-, receptor"""	ADRA1C			Standard	NM_033303		Approved	ADRA1L1	uc003xfh.1	P35348	OTTHUMG00000099459	ENST00000519229.1:c.310G>T	8.37:g.26722177C>A	ENSP00000430793:p.Ala104Ser		Q9NPY0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Adrene_rcpt_A1Cs,prints_7TM_GPCR_Rhodpsn,prints_Adrnrgc_rcpt	p.A104S	ENST00000519229.1	37	c.310		8	.	.	.	.	.	.	.	.	.	.	C	20.5	3.994774	0.74703	.	.	ENSG00000120907	ENST00000380586;ENST00000380587;ENST00000380582;ENST00000380581;ENST00000519229;ENST00000354550;ENST00000276393;ENST00000380573;ENST00000380572;ENST00000358857	T;T;T;T;T;T;T;T;T;T	0.36878	1.23;1.23;1.23;1.23;1.23;1.23;1.23;1.23;1.23;1.23	4.83	4.83	0.62350	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.50650	0.1628	L	0.38733	1.17	0.80722	D	1	D;D;D;D;D;D	0.89917	0.997;0.997;0.998;0.997;1.0;0.973	D;D;D;D;D;D	0.85130	0.966;0.966;0.992;0.986;0.997;0.953	T	0.42682	-0.9437	10	0.33141	T	0.24	.	17.898	0.88895	0.0:1.0:0.0:0.0	.	104;104;104;104;104;104	P35348-9;P35348-8;P35348;P35348-4;P35348-3;B0ZBD3	.;.;ADA1A_HUMAN;.;.;.	S	104	ENSP00000369960:A104S;ENSP00000369961:A104S;ENSP00000369956:A104S;ENSP00000369955:A104S;ENSP00000430793:A104S;ENSP00000346557:A104S;ENSP00000276393:A104S;ENSP00000369947:A104S;ENSP00000369946:A104S;ENSP00000351725:A104S	ENSP00000276393:A104S	A	-	1	0	ADRA1A	26778094	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.771000	0.85420	2.365000	0.80145	0.563000	0.77884	GCA	ADRA1A	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000120907		0.632	ADRA1A-009	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	ADRA1A	HGNC	protein_coding	OTTHUMT00000376207.1	39	0.00	0	C	NM_033303		26722177	26722177	-1	no_errors	ENST00000380586	ensembl	human	known	69_37n	missense	6	68.42	13	SNP	1.000	A
AGTR1	185	genome.wustl.edu	37	3	148459738	148459738	+	Missense_Mutation	SNP	G	G	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr3:148459738G>T	ENST00000497524.1	+	2	1307	c.916G>T	c.(916-918)Ggg>Tgg	p.G306W	AGTR1_ENST00000542281.1_Missense_Mutation_p.G306W|AGTR1_ENST00000418473.2_Missense_Mutation_p.G306W|AGTR1_ENST00000349243.3_Missense_Mutation_p.G306W|AGTR1_ENST00000402260.1_Missense_Mutation_p.G306W|AGTR1_ENST00000474935.1_Missense_Mutation_p.G306W|AGTR1_ENST00000404754.2_Missense_Mutation_p.G306W|AGTR1_ENST00000461609.1_Missense_Mutation_p.G306W|AGTR1_ENST00000475347.1_Missense_Mutation_p.G306W	NM_009585.3	NP_033611.1	P30556	AGTR1_HUMAN	angiotensin II receptor, type 1	306					angiotensin-activated signaling pathway (GO:0038166)|calcium-mediated signaling (GO:0019722)|cell chemotaxis (GO:0060326)|G-protein coupled receptor signaling pathway (GO:0007186)|kidney development (GO:0001822)|low-density lipoprotein particle remodeling (GO:0034374)|phospholipase C-activating angiotensin-activated signaling pathway (GO:0086097)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NAD(P)H oxidase activity (GO:0033864)|positive regulation of phospholipase A2 activity (GO:0032430)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of inflammatory response (GO:0050727)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)|renin-angiotensin regulation of aldosterone production (GO:0002018)|Rho protein signal transduction (GO:0007266)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	angiotensin type I receptor activity (GO:0001596)|angiotensin type II receptor activity (GO:0004945)|bradykinin receptor binding (GO:0031711)|protein heterodimerization activity (GO:0046982)			breast(4)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30			LUSC - Lung squamous cell carcinoma(72;0.127)|Lung(72;0.152)		Azilsartan medoxomil(DB08822)|Candesartan(DB00796)|Eprosartan(DB00876)|Forasartan(DB01342)|Irbesartan(DB01029)|Losartan(DB00678)|Olmesartan(DB00275)|Saprisartan(DB01347)|Tasosartan(DB01349)|Telmisartan(DB00966)|Valsartan(DB00177)	TGGCTTTCTGGGGAAAAAATT	0.363																																						dbGAP											0													56.0	53.0	54.0					3																	148459738		2203	4300	6503	-	-	-	SO:0001583	missense	0			M87290	CCDS3137.1	3q24	2012-08-08	2002-02-20		ENSG00000144891	ENSG00000144891		"""GPCR / Class A : Angiotensin receptors"""	336	protein-coding gene	gene with protein product		106165	"""angiotensin receptor 1B"""	AGTR1B		1550596	Standard	NM_009585		Approved	AT1, AT2R1, AGTR1A, AT2R1A, HAT1R, AG2S, AT2R1B, AT1B	uc003ewh.4	P30556	OTTHUMG00000159503	ENST00000497524.1:c.916G>T	3.37:g.148459738G>T	ENSP00000419422:p.Gly306Trp		Q13725|Q8TBK4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_ATII_AT1_rcpt,prints_ATII_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Frt_met_rcpt,prints_Brdyknn_rcpt,prints_P2_purnocptor	p.G306W	ENST00000497524.1	37	c.916	CCDS3137.1	3	.	.	.	.	.	.	.	.	.	.	G	20.9	4.062500	0.76187	.	.	ENSG00000144891	ENST00000497524;ENST00000349243;ENST00000542281;ENST00000418473;ENST00000404754;ENST00000475347;ENST00000474935;ENST00000461609;ENST00000402260	T;T;T;T;T;T;T;T;T	0.28666	1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6;1.6	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.56321	0.1977	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.56920	-0.7899	10	0.87932	D	0	-8.104	19.6978	0.96034	0.0:0.0:1.0:0.0	.	306	P30556	AGTR1_HUMAN	W	306	ENSP00000419422:G306W;ENSP00000273430:G306W;ENSP00000443186:G306W;ENSP00000398832:G306W;ENSP00000385612:G306W;ENSP00000419783:G306W;ENSP00000418084:G306W;ENSP00000418851:G306W;ENSP00000385641:G306W	ENSP00000273430:G306W	G	+	1	0	AGTR1	149942428	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.649000	0.89929	0.650000	0.86243	GGG	AGTR1	-	prints_ATII_AT1_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Brdyknn_rcpt	ENSG00000144891		0.363	AGTR1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AGTR1	HGNC	protein_coding	OTTHUMT00000355807.1	22	0.00	0	G			148459738	148459738	+1	no_errors	ENST00000349243	ensembl	human	known	69_37n	missense	20	42.86	15	SNP	1.000	T
AKAP8L	26993	genome.wustl.edu	37	19	15512205	15512205	+	Missense_Mutation	SNP	C	C	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr19:15512205C>G	ENST00000397410.5	-	5	702	c.572G>C	c.(571-573)cGg>cCg	p.R191P	AKAP8L_ENST00000595465.2_Missense_Mutation_p.R130P|AKAP8L_ENST00000595879.1_5'Flank	NM_014371.2	NP_055186.2	Q9ULX6	AKP8L_HUMAN	A kinase (PRKA) anchor protein 8-like	191						cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(4)|kidney(2)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	11						GGCCATTGGCCGGCCGCTCCG	0.692																																						dbGAP											0													25.0	29.0	28.0					19																	15512205		1905	4124	6029	-	-	-	SO:0001583	missense	0			BC000713	CCDS46005.1	19p13.12	2013-10-16			ENSG00000011243	ENSG00000011243			29857	protein-coding gene	gene with protein product	"""neighbor of A kinase anchoring protein 95"""	609475				10748171, 10761695	Standard	XM_005259854		Approved	NAKAP95, HAP95	uc002naw.1	Q9ULX6	OTTHUMG00000182446	ENST00000397410.5:c.572G>C	19.37:g.15512205C>G	ENSP00000380557:p.Arg191Pro		B4DJ74|B5BU90|O94792|Q96J58|Q9NRQ0|Q9UGM0	Missense_Mutation	SNP	pfam_AKAP95	p.R191P	ENST00000397410.5	37	c.572	CCDS46005.1	19	.	.	.	.	.	.	.	.	.	.	C	16.75	3.209058	0.58343	.	.	ENSG00000011243	ENST00000397410	T	0.50001	0.76	4.86	3.81	0.43845	.	0.540197	0.17505	N	0.171835	T	0.43545	0.1252	N	0.22421	0.69	0.33890	D	0.6372	P;D;P	0.58268	0.929;0.982;0.929	B;P;B	0.52672	0.418;0.706;0.418	T	0.55457	-0.8138	10	0.48119	T	0.1	-15.4894	10.8191	0.46593	0.0:0.9066:0.0:0.0934	.	130;191;191	B4DJ74;B3KMD4;Q9ULX6	.;.;AKP8L_HUMAN	P	191	ENSP00000380557:R191P	ENSP00000380557:R191P	R	-	2	0	AKAP8L	15373205	1.000000	0.71417	0.995000	0.50966	0.761000	0.43186	3.052000	0.49893	2.255000	0.74692	0.655000	0.94253	CGG	AKAP8L	-	NULL	ENSG00000011243		0.692	AKAP8L-004	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP8L	HGNC	protein_coding	OTTHUMT00000461301.2	55	0.00	0	C	NM_014371		15512205	15512205	-1	no_errors	ENST00000397410	ensembl	human	known	69_37n	missense	43	33.33	22	SNP	0.992	G
ALK	238	genome.wustl.edu	37	2	29420462	29420462	+	Missense_Mutation	SNP	T	T	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr2:29420462T>A	ENST00000389048.3	-	27	4925	c.4019A>T	c.(4018-4020)gAg>gTg	p.E1340V	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	1340	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	GGTGACAAACTCCAGAACTTC	0.498			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																													dbGAP	yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	0													91.0	94.0	93.0					2																	29420462		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.4019A>T	2.37:g.29420462T>A	ENSP00000373700:p.Glu1340Val		Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_MAM_dom,superfamily_Kinase-like_dom,superfamily_ConA-like_lec_gl,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_MAM_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E1340V	ENST00000389048.3	37	c.4019	CCDS33172.1	2	.	.	.	.	.	.	.	.	.	.	T	29.9	5.043940	0.93685	.	.	ENSG00000171094	ENST00000389048	D	0.83837	-1.77	5.8	5.8	0.92144	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.47455	U	0.000230	D	0.89385	0.6700	M	0.62266	1.93	0.80722	D	1	D	0.63046	0.992	D	0.71414	0.973	D	0.88884	0.3341	9	.	.	.	.	16.138	0.81502	0.0:0.0:0.0:1.0	.	1340	Q9UM73	ALK_HUMAN	V	1340	ENSP00000373700:E1340V	.	E	-	2	0	ALK	29273966	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.040000	0.89188	2.203000	0.70933	0.459000	0.35465	GAG	ALK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000171094		0.498	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALK	HGNC	protein_coding	OTTHUMT00000324994.1	45	0.00	0	T	NM_004304		29420462	29420462	-1	no_errors	ENST00000389048	ensembl	human	known	69_37n	missense	39	14.89	7	SNP	1.000	A
ALS2CR11	151254	genome.wustl.edu	37	2	202357128	202357128	+	Intron	SNP	A	A	C			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr2:202357128A>C	ENST00000286195.3	-	14	1626				ALS2CR11_ENST00000439140.1_Missense_Mutation_p.N1312K|ALS2CR11_ENST00000439802.1_Intron|ALS2CR11_ENST00000482942.1_Intron	NM_152525.5	NP_689738.3	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11											NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(11)|ovary(1)|skin(5)|urinary_tract(3)	33						GTAATAATTCATTTTCTGATA	0.284																																						dbGAP											0													12.0	10.0	11.0					2																	202357128		686	1539	2225	-	-	-	SO:0001627	intron_variant	0			AB053313	CCDS2349.1, CCDS54430.1, CCDS54428.1, CCDS54429.1	2q33	2007-12-07			ENSG00000155754	ENSG00000155754			14438	protein-coding gene	gene with protein product						11586298	Standard	NM_152525		Approved	FLJ25351	uc002uyf.3	Q53TS8	OTTHUMG00000132830	ENST00000286195.3:c.1581+3489T>G	2.37:g.202357128A>C			C9IZH7|E9PGG4|Q8NCN6|Q96LN4	Missense_Mutation	SNP	superfamily_C2_Ca/lipid-bd_dom_CaLB	p.N1312K	ENST00000286195.3	37	c.3936	CCDS2349.1	2	.	.	.	.	.	.	.	.	.	.	A	16.03	3.007555	0.54361	.	.	ENSG00000155754	ENST00000439140	T	0.54071	0.59	5.67	1.85	0.25348	.	.	.	.	.	T	0.35799	0.0944	L	0.34521	1.04	0.80722	D	1	P	0.41041	0.736	B	0.41440	0.357	T	0.14615	-1.0466	9	0.39692	T	0.17	.	1.3038	0.02084	0.5513:0.1532:0.1475:0.148	.	1312	E9PGG4	.	K	1312	ENSP00000409937:N1312K	ENSP00000409937:N1312K	N	-	3	2	ALS2CR11	202065373	0.999000	0.42202	0.990000	0.47175	0.941000	0.58515	1.110000	0.31147	0.451000	0.26802	0.455000	0.32223	AAT	ALS2CR11	-	NULL	ENSG00000155754		0.284	ALS2CR11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ALS2CR11	HGNC	protein_coding	OTTHUMT00000256296.2	19	0.00	0	A	NM_152525		202357128	202357128	-1	no_errors	ENST00000439140	ensembl	human	novel	69_37n	missense	19	36.67	11	SNP	0.944	C
AMPH	273	genome.wustl.edu	37	7	38467842	38467842	+	Intron	SNP	A	A	G	rs1544636	byFrequency	TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr7:38467842A>G	ENST00000356264.2	-	15	1398				AMPH_ENST00000428293.2_Intron|AMPH_ENST00000471913.1_5'UTR|AMPH_ENST00000325590.5_Intron	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin						endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						GCTGAATCCAAGCTTGGCTGC	0.418													A|||	3864	0.771565	0.6067	0.8588	5008	,	,		20857	0.7877		0.8618	False		,,,				2504	0.8231					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.1183-1256T>C	7.37:g.38467842A>G			A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	RNA	SNP	-	NULL	ENST00000356264.2	37	NULL	CCDS5456.1	7																																																																																			AMPH	-	-	ENSG00000078053		0.418	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMPH	HGNC	protein_coding	OTTHUMT00000226953.2	58	0.00	0	A	NM_001635		38467842	38467842	-1	no_errors	ENST00000471913	ensembl	human	known	69_37n	rna	52	11.86	7	SNP	1.000	G
AMPH	273	genome.wustl.edu	37	7	38468463	38468463	+	Intron	SNP	C	C	T	rs2267808	byFrequency	TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr7:38468463C>T	ENST00000356264.2	-	14	1398				AMPH_ENST00000428293.2_Intron|AMPH_ENST00000471913.1_5'UTR|AMPH_ENST00000325590.5_Intron	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin						endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						TTTTCATTGGCGTTTGTACTT	0.353													T|||	3864	0.771565	0.6074	0.8588	5008	,	,		20460	0.7877		0.8608	False		,,,				2504	0.8231					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.1182+978G>A	7.37:g.38468463C>T			A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	RNA	SNP	-	NULL	ENST00000356264.2	37	NULL	CCDS5456.1	7																																																																																			AMPH	-	-	ENSG00000078053		0.353	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMPH	HGNC	protein_coding	OTTHUMT00000226953.2	38	0.00	0	C	NM_001635		38468463	38468463	-1	no_errors	ENST00000467580	ensembl	human	known	69_37n	rna	30	11.43	4	SNP	0.000	T
ANKRD36	375248	genome.wustl.edu	37	2	97860487	97860487	+	Missense_Mutation	SNP	T	T	C	rs59466168	byFrequency	TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr2:97860487T>C	ENST00000461153.2	+	39	2718	c.2474T>C	c.(2473-2475)tTg>tCg	p.L825S	ANKRD36_ENST00000420699.2_Missense_Mutation_p.L825S			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	825								p.L825S(1)		endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						AAACCAGCCTTGAAGGTAATG	0.338																																						dbGAP											1	Substitution - Missense(1)	stomach(1)																																								-	-	-	SO:0001583	missense	0			BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	ENST00000461153.2:c.2474T>C	2.37:g.97860487T>C	ENSP00000419530:p.Leu825Ser		B4E3I8|Q6UX02|Q86X62|Q9HCD1	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L825S	ENST00000461153.2	37	c.2474	CCDS54379.1	2	.	.	.	.	.	.	.	.	.	.	.	6.237	0.411823	0.11812	.	.	ENSG00000135976	ENST00000461153;ENST00000420699;ENST00000461694	D;D	0.82255	-1.59;-1.59	0.649	-1.05	0.10036	.	.	.	.	.	T	0.66446	0.2790	L	0.34521	1.04	0.58432	P	1.0000000000287557E-6	B	0.31893	0.345	B	0.18871	0.023	T	0.56032	-0.8046	7	0.25751	T	0.34	.	.	.	.	rs59466168;rs62154812	825	A6QL64	AN36A_HUMAN	S	825;825;187	ENSP00000419530:L825S;ENSP00000391950:L825S	ENSP00000391950:L825S	L	+	2	0	ANKRD36	97224214	0.001000	0.12720	0.048000	0.18961	0.004000	0.04260	-0.718000	0.04980	-0.323000	0.08602	-1.634000	0.00779	TTG	ANKRD36	-	NULL	ENSG00000135976		0.338	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD36	HGNC	protein_coding	OTTHUMT00000339154.5	120	0.00	0	T			97860487	97860487	+1	no_errors	ENST00000420699	ensembl	human	known	69_37n	missense	112	10.40	13	SNP	0.064	C
ANO4	121601	genome.wustl.edu	37	12	101133704	101133704	+	Frame_Shift_Del	DEL	C	C	-			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr12:101133704delC	ENST00000538618.1	+	3	179	c.179delC	c.(178-180)accfs	p.T60fs				Q32M45	ANO4_HUMAN	anoctamin 4	0					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						GGCAGACCAACCCTCCCATCA	0.527										HNSCC(74;0.22)																												dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000538618.1:c.179delC	12.37:g.101133704delC	ENSP00000443751:p.Thr60fs		Q8NAJ0|Q8NB39|Q8NB53	Frame_Shift_Del	DEL	NULL	p.L61fs	ENST00000538618.1	37	c.179		12																																																																																			ANO4	-	NULL	ENSG00000151572		0.527	ANO4-202	KNOWN	basic	protein_coding	ANO4	HGNC	protein_coding		82	0.00	0	C	NM_178826		101133704	101133704	+1	no_errors	ENST00000538618	ensembl	human	known	69_37n	frame_shift_del	31	11.43	4	DEL	0.959	-
ANO4	121601	genome.wustl.edu	37	12	101133706	101133706	+	Missense_Mutation	SNP	C	C	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr12:101133706C>A	ENST00000538618.1	+	3	181	c.181C>A	c.(181-183)Ctc>Atc	p.L61I				Q32M45	ANO4_HUMAN	anoctamin 4	0					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						CAGACCAACCCTCCCATCAGA	0.527										HNSCC(74;0.22)																												dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000538618.1:c.181C>A	12.37:g.101133706C>A	ENSP00000443751:p.Leu61Ile		Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	NULL	p.L61I	ENST00000538618.1	37	c.181		12	.	.	.	.	.	.	.	.	.	.	C	17.08	3.297951	0.60086	.	.	ENSG00000151572	ENST00000538618	T	0.77877	-1.13	5.67	5.67	0.87782	.	.	.	.	.	T	0.78065	0.4225	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73065	-0.4100	6	0.22109	T	0.4	.	13.7569	0.62942	0.1532:0.8468:0.0:0.0	.	.	.	.	I	61	ENSP00000443751:L61I	ENSP00000443751:L61I	L	+	1	0	ANO4	99657837	0.660000	0.27420	1.000000	0.80357	0.977000	0.68977	2.897000	0.48664	2.676000	0.91093	0.655000	0.94253	CTC	ANO4	-	NULL	ENSG00000151572		0.527	ANO4-202	KNOWN	basic	protein_coding	ANO4	HGNC	protein_coding		91	0.00	0	C	NM_178826		101133706	101133706	+1	no_errors	ENST00000538618	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	0.997	A
ARHGAP21	57584	genome.wustl.edu	37	10	24874322	24874322	+	Silent	SNP	A	A	C			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr10:24874322A>C	ENST00000396432.2	-	26	5382	c.4896T>G	c.(4894-4896)ccT>ccG	p.P1632P		NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	1631	Interaction with CTNNA1.				establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						CGGTTTCCACAGGCCGCCCTT	0.572																																						dbGAP											0													79.0	82.0	81.0					10																	24874322		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.4896T>G	10.37:g.24874322A>C			Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Silent	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_PDZ,superfamily_Rho_GTPase_activation_prot,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.P1632	ENST00000396432.2	37	c.4896	CCDS7144.2	10																																																																																			ARHGAP21	-	NULL	ENSG00000107863		0.572	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP21	HGNC	protein_coding	OTTHUMT00000047229.4	118	0.00	0	A	NM_020824		24874322	24874322	-1	no_errors	ENST00000396432	ensembl	human	known	69_37n	silent	115	22.67	34	SNP	0.000	C
ARHGAP6	395	genome.wustl.edu	37	X	11162204	11162204	+	Missense_Mutation	SNP	C	C	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chrX:11162204C>A	ENST00000337414.4	-	11	2944	c.2072G>T	c.(2071-2073)gGg>gTg	p.G691V	ARHGAP6_ENST00000303025.6_Missense_Mutation_p.G488V|ARHGAP6_ENST00000534860.1_Missense_Mutation_p.G516V|ARHGAP6_ENST00000380718.1_Missense_Mutation_p.G691V|ARHGAP6_ENST00000380736.1_Missense_Mutation_p.G488V|ARHGAP6_ENST00000413512.3_3'UTR	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	691					actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						CTCCGAGCCCCCCGGGGCCGC	0.592											OREG0019666	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													68.0	69.0	68.0					X																	11162204		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.2072G>T	X.37:g.11162204C>A	ENSP00000338967:p.Gly691Val	670	B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.G691V	ENST00000337414.4	37	c.2072	CCDS14140.1	X	.	.	.	.	.	.	.	.	.	.	C	17.48	3.401130	0.62288	.	.	ENSG00000047648	ENST00000534860;ENST00000380736;ENST00000303025;ENST00000337414;ENST00000380717;ENST00000380718	T;T;T;T;T;T	0.28454	1.73;1.72;1.72;1.67;1.63;1.61	5.51	5.51	0.81932	.	0.115379	0.38720	N	0.001598	T	0.49389	0.1554	M	0.63428	1.95	0.80722	D	1	D;D;D;D	0.76494	0.989;0.999;0.999;0.998	D;D;D;D	0.70016	0.92;0.967;0.96;0.928	T	0.39418	-0.9615	10	0.10111	T	0.7	.	16.7419	0.85461	0.0:1.0:0.0:0.0	.	488;691;691;691	O43182-5;O43182-2;O43182;A8KAL3	.;.;RHG06_HUMAN;.	V	516;488;488;691;527;691	ENSP00000438135:G516V;ENSP00000370112:G488V;ENSP00000302312:G488V;ENSP00000338967:G691V;ENSP00000370093:G527V;ENSP00000370094:G691V	ENSP00000302312:G488V	G	-	2	0	ARHGAP6	11072125	0.923000	0.31300	1.000000	0.80357	0.464000	0.32679	0.273000	0.18662	2.329000	0.79093	0.506000	0.49869	GGG	ARHGAP6	-	NULL	ENSG00000047648		0.592	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP6	HGNC	protein_coding	OTTHUMT00000055760.2	49	0.00	0	C	NM_013427		11162204	11162204	-1	no_errors	ENST00000337414	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	1.000	A
ARHGEF15	22899	genome.wustl.edu	37	17	8221893	8221893	+	Silent	SNP	C	C	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr17:8221893C>T	ENST00000361926.3	+	11	1895	c.1785C>T	c.(1783-1785)atC>atT	p.I595I	AC135178.7_ENST00000458568.1_RNA|ARHGEF15_ENST00000421050.1_Silent_p.I595I	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	595	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.I595I(2)		breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						CCTAGATCATCGAGCGTTGCA	0.597																																						dbGAP											2	Substitution - coding silent(2)	lung(2)											59.0	59.0	59.0					17																	8221893		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.1785C>T	17.37:g.8221893C>T			A8K6G1|Q8N449|Q9H8B4	Silent	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	p.I595	ENST00000361926.3	37	c.1785	CCDS11139.1	17																																																																																			ARHGEF15	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000198844		0.597	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF15	HGNC	protein_coding	OTTHUMT00000226993.2	28	0.00	0	C	NM_173728		8221893	8221893	+1	no_errors	ENST00000361926	ensembl	human	known	69_37n	silent	7	56.25	9	SNP	0.933	T
ARSA	410	genome.wustl.edu	37	22	51065410	51065410	+	Missense_Mutation	SNP	A	A	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr22:51065410A>T	ENST00000547307.1	-	3	935	c.530T>A	c.(529-531)gTc>gAc	p.V177D	ARSA_ENST00000216124.5_Missense_Mutation_p.V179D|ARSA_ENST00000395619.3_Missense_Mutation_p.V179D|ARSA_ENST00000547805.1_Missense_Mutation_p.V177D|ARSA_ENST00000395621.3_Missense_Mutation_p.V179D|ARSA_ENST00000356098.5_Missense_Mutation_p.V179D|ARSA_ENST00000453344.2_Missense_Mutation_p.V93D			P15289	ARSA_HUMAN	arylsulfatase A	177					autophagy (GO:0006914)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|central nervous system development (GO:0007417)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to methylmercury (GO:0051597)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum lumen (GO:0005788)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|cerebroside-sulfatase activity (GO:0004098)|sulfuric ester hydrolase activity (GO:0008484)			endometrium(1)|large_intestine(1)|lung(5)|pancreas(1)|skin(1)	9		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)	Micafungin(DB01141)|Suramin(DB04786)	TGGGATGGGGACCAGGCCCTG	0.701																																						dbGAP											0													31.0	38.0	36.0					22																	51065410		2200	4298	6498	-	-	-	SO:0001583	missense	0			X52150	CCDS14100.1, CCDS46736.1, CCDS14100.2	22q13.33	2013-09-19			ENSG00000100299	ENSG00000100299	3.1.6.8	"""Arylsulfatase family"""	713	protein-coding gene	gene with protein product	"""metachromatic leucodystrophy"""	607574				15772092	Standard	NM_000487		Approved		uc003bmz.5	P15289	OTTHUMG00000150180	ENST00000547307.1:c.530T>A	22.37:g.51065410A>T	ENSP00000448440:p.Val177Asp		B2RCA6|B7XD04|F8WCC8|Q6ICI5|Q96CJ0	Missense_Mutation	SNP	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.V179D	ENST00000547307.1	37	c.536		22	.	.	.	.	.	.	.	.	.	.	A	19.32	3.804080	0.70682	.	.	ENSG00000100299	ENST00000356098;ENST00000216124;ENST00000547307;ENST00000547805;ENST00000395621;ENST00000453344;ENST00000395619	D;D;D;D;D;D;D	0.95554	-3.74;-3.74;-3.74;-3.74;-3.74;-3.74;-3.74	5.51	5.51	0.81932	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.229226	0.44902	D	0.000406	D	0.94414	0.8203	N	0.24115	0.695	0.80722	D	1	D	0.89917	1.0	D	0.71656	0.974	D	0.93048	0.6463	10	0.38643	T	0.18	.	8.1826	0.31319	0.911:0.0:0.089:0.0	.	177	P15289	ARSA_HUMAN	D	179;179;177;177;179;93;179	ENSP00000348406:V179D;ENSP00000216124:V179D;ENSP00000448440:V177D;ENSP00000448932:V177D;ENSP00000378983:V179D;ENSP00000412542:V93D;ENSP00000378981:V179D	ENSP00000216124:V179D	V	-	2	0	ARSA	49412276	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	4.610000	0.61155	2.103000	0.63969	0.491000	0.48974	GTC	ARSA	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	ENSG00000100299		0.701	ARSA-201	KNOWN	basic|appris_candidate	protein_coding	ARSA	HGNC	protein_coding		12	0.00	0	A	NM_000487		51065410	51065410	-1	no_errors	ENST00000216124	ensembl	human	known	69_37n	missense	17	29.17	7	SNP	0.998	T
ATP6V0B	533	genome.wustl.edu	37	1	44440642	44440642	+	5'UTR	SNP	A	A	G	rs72890650	byFrequency	TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr1:44440642A>G	ENST00000472174.2	+	0	323				ATP6V0B_ENST00000498664.1_5'Flank|ATP6V0B_ENST00000236067.4_5'UTR|ATP6V0B_ENST00000532642.1_5'UTR|ATP6V0B_ENST00000472277.1_3'UTR|ATP6V0B_ENST00000471859.2_5'UTR	NM_004047.3	NP_004038.1	Q99437	VATO_HUMAN	ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b						ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)|vacuole (GO:0005773)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)			breast(2)|kidney(1)|large_intestine(3)|lung(3)	9	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)				AGACTGCGGGACGGACGGTGG	0.746													g|||	205	0.0409345	0.1452	0.0144	5008	,	,		9882	0.001		0.0	False		,,,				2504	0.002					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			BC000423	CCDS505.1, CCDS41315.1, CCDS72772.1	1p32.3	2010-04-21	2006-01-20	2002-05-10	ENSG00000117410	ENSG00000117410		"""ATPases / V-type"""	861	protein-coding gene	gene with protein product		603717	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 21kD"", ""ATPase, H+ transporting, lysosomal 21kDa, V0 subunit c''"""	ATP6F		9653649	Standard	XM_005270944		Approved	VMA16, HATPL	uc001cld.3	Q99437	OTTHUMG00000008298	ENST00000472174.2:c.-71A>G	1.37:g.44440642A>G			D3DPY5|Q6IB32	RNA	SNP	-	NULL	ENST00000472174.2	37	NULL	CCDS505.1	1																																																																																			ATP6V0B	-	-	ENSG00000117410		0.746	ATP6V0B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V0B	HGNC	protein_coding	OTTHUMT00000022854.2	8	0.00	0	A	NM_004047		44440642	44440642	+1	no_errors	ENST00000472277	ensembl	human	known	69_37n	rna	2	66.67	4	SNP	0.363	G
ASTN1	460	genome.wustl.edu	37	1	176852105	176852105	+	Missense_Mutation	SNP	G	G	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr1:176852105G>T	ENST00000367654.3	-	20	3487	c.3276C>A	c.(3274-3276)gaC>gaA	p.D1092E	ASTN1_ENST00000424564.2_Missense_Mutation_p.D1084E|ASTN1_ENST00000367657.3_Missense_Mutation_p.D1084E|ASTN1_ENST00000361833.2_Missense_Mutation_p.D1084E	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	1092	Fibronectin type-III 1.				locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						CAGAGATGATGTCGTCCACAA	0.502																																						dbGAP											0													151.0	134.0	140.0					1																	176852105		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.3276C>A	1.37:g.176852105G>T	ENSP00000356626:p.Asp1092Glu		A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_EGF-like,smart_MACPF,pfscan_Fibronectin_type3	p.D1092E	ENST00000367654.3	37	c.3276		1	.	.	.	.	.	.	.	.	.	.	G	19.75	3.884928	0.72410	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.27256	1.68;2.09;2.09;1.69	5.66	1.69	0.24217	.	0.000000	0.85682	D	0.000000	T	0.42449	0.1203	L	0.58101	1.795	0.58432	D	0.999992	D;D	0.61697	0.99;0.99	D;D	0.73380	0.98;0.98	T	0.25328	-1.0135	10	0.87932	D	0	-34.6939	10.2982	0.43637	0.2728:0.0:0.7272:0.0	.	1084;1084	O14525-2;B1AJS1	.;.	E	1084;1084;1092;1084;1084	ENSP00000356629:D1084E;ENSP00000354536:D1084E;ENSP00000356626:D1092E;ENSP00000395041:D1084E	ENSP00000354536:D1084E	D	-	3	2	ASTN1	175118728	1.000000	0.71417	0.997000	0.53966	0.739000	0.42172	1.663000	0.37429	0.341000	0.23771	0.467000	0.42956	GAC	ASTN1	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000152092		0.502	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	HGNC	protein_coding		62	0.00	0	G	NM_004319		176852105	176852105	-1	no_errors	ENST00000367654	ensembl	human	known	69_37n	missense	33	17.50	7	SNP	1.000	T
ATXN7L1	222255	genome.wustl.edu	37	7	105254755	105254755	+	Nonsense_Mutation	SNP	T	T	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr7:105254755T>A	ENST00000419735.3	-	10	2071	c.2026A>T	c.(2026-2028)Aag>Tag	p.K676*	ATXN7L1_ENST00000477775.1_Nonsense_Mutation_p.K552*|ATXN7L1_ENST00000388807.4_Nonsense_Mutation_p.K336*	NM_020725.1	NP_065776.1	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1	676	Ser-rich.									endometrium(1)|large_intestine(4)|lung(5)	10						ACACAGTTCTTTTTGTGAGGC	0.522																																						dbGAP											0													90.0	71.0	77.0					7																	105254755		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			AB033044	CCDS34727.1, CCDS47682.1, CCDS47683.1	7q22.1	2007-11-13			ENSG00000146776	ENSG00000146776			22210	protein-coding gene	gene with protein product			"""ataxin 7-like 4"""	ATXN7L4		15115762	Standard	NM_152749		Approved	KIAA1218, MGC33190	uc003vde.2	Q9ULK2	OTTHUMG00000157521	ENST00000419735.3:c.2026A>T	7.37:g.105254755T>A	ENSP00000410759:p.Lys676*		A4D0Q2|B4DTS1|Q8N2T0	Nonsense_Mutation	SNP	pfam_SCA7_dom	p.K676*	ENST00000419735.3	37	c.2026	CCDS47682.1	7	.	.	.	.	.	.	.	.	.	.	T	38	6.813767	0.97857	.	.	ENSG00000146776	ENST00000419735;ENST00000477775;ENST00000484475;ENST00000388807;ENST00000472195	.	.	.	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.4532	0.75294	0.0:0.0:0.0:1.0	.	.	.	.	X	676;552;377;336;552	.	ENSP00000373459:K336X	K	-	1	0	ATXN7L1	105041991	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.632000	0.61311	2.042000	0.60477	0.533000	0.62120	AAG	ATXN7L1	-	NULL	ENSG00000146776		0.522	ATXN7L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN7L1	HGNC	protein_coding	OTTHUMT00000349037.2	39	0.00	0	T			105254755	105254755	-1	no_errors	ENST00000419735	ensembl	human	known	69_37n	nonsense	32	11.11	4	SNP	1.000	A
BRSK1	84446	genome.wustl.edu	37	19	55820028	55820028	+	Missense_Mutation	SNP	G	G	C			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr19:55820028G>C	ENST00000309383.1	+	18	2388	c.2111G>C	c.(2110-2112)cGa>cCa	p.R704P	BRSK1_ENST00000326848.7_Missense_Mutation_p.R399P|BRSK1_ENST00000590333.1_Missense_Mutation_p.R720P	NM_032430.1	NP_115806.1	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	704					axonogenesis (GO:0007409)|cellular response to DNA damage stimulus (GO:0006974)|centrosome duplication (GO:0051298)|establishment of cell polarity (GO:0030010)|G2 DNA damage checkpoint (GO:0031572)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(15)|ovary(2)|prostate(2)|skin(6)|stomach(1)	48		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		CGGTTCAAGCGAGTGGTGGAG	0.677																																						dbGAP											0													48.0	42.0	44.0					19																	55820028		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058714	CCDS12921.1	19q13.4	2008-02-05				ENSG00000160469			18994	protein-coding gene	gene with protein product		609235				14976552	Standard	NM_032430		Approved	KIAA1811	uc002qkg.3	Q8TDC3		ENST00000309383.1:c.2111G>C	19.37:g.55820028G>C	ENSP00000310649:p.Arg704Pro		F1DG44|Q5J5B5|Q8NDD0|Q8NDR4|Q8TDC2|Q96AV4|Q96JL4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom	p.R720P	ENST00000309383.1	37	c.2159	CCDS12921.1	19	.	.	.	.	.	.	.	.	.	.	.	18.24	3.579406	0.65878	.	.	ENSG00000160469	ENST00000309383;ENST00000543410;ENST00000326848	D;T	0.81821	-1.54;1.05	4.93	4.93	0.64822	.	0.082832	0.46758	D	0.000266	D	0.85652	0.5746	L	0.45228	1.405	0.41786	D	0.989848	D;D	0.76494	0.998;0.999	P;D	0.66351	0.827;0.943	D	0.87496	0.2430	10	0.87932	D	0	.	17.3573	0.87340	0.0:0.0:1.0:0.0	.	704;720	Q8TDC3;Q8TDC3-2	BRSK1_HUMAN;.	P	704;399;399	ENSP00000310649:R704P;ENSP00000320853:R399P	ENSP00000310649:R704P	R	+	2	0	BRSK1	60511840	1.000000	0.71417	0.968000	0.41197	0.994000	0.84299	7.461000	0.80834	2.471000	0.83476	0.544000	0.68410	CGA	BRSK1	-	NULL	ENSG00000160469		0.677	BRSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRSK1	HGNC	protein_coding	OTTHUMT00000452787.1	82	0.00	0	G	NM_032430		55820028	55820028	+1	no_errors	ENST00000590333	ensembl	human	known	69_37n	missense	39	13.33	6	SNP	0.997	C
MALRD1	340895	genome.wustl.edu	37	10	19678226	19678226	+	Missense_Mutation	SNP	C	C	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr10:19678226C>T	ENST00000454679.2	+	13	2690	c.2690C>T	c.(2689-2691)gCg>gTg	p.A897V				Q5VYJ5	MALR1_HUMAN		897	MAM 5. {ECO:0000255|PROSITE- ProRule:PRU00128}.				cholesterol homeostasis (GO:0042632)|negative regulation of bile acid biosynthetic process (GO:0070858)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				breast(1)|lung(2)	3						AAGCTAGAGGCGAGGCTATTA	0.388																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0																														ENST00000454679.2:c.2690C>T	10.37:g.19678226C>T	ENSP00000412763:p.Ala897Val		B7ZBP2	Missense_Mutation	SNP	pfam_MAM_dom,pfam_LDrepeatLR_classA_rpt,superfamily_ConA-like_lec_gl,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_MAM_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,prints_MAM_dom	p.A897V	ENST00000454679.2	37	c.2690		10	.	.	.	.	.	.	.	.	.	.	C	0.747	-0.774176	0.02951	.	.	ENSG00000204740	ENST00000377266;ENST00000454679	D;D	0.87334	-2.24;-1.88	5.32	0.103	0.14526	.	.	.	.	.	T	0.77198	0.4095	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.63175	-0.6696	5	.	.	.	.	2.2615	0.04068	0.1404:0.3853:0.3089:0.1654	.	.	.	.	V	910;897	ENSP00000366477:A910V;ENSP00000412763:A897V	.	A	+	2	0	C10orf112	19718232	0.043000	0.20138	0.000000	0.03702	0.000000	0.00434	-0.005000	0.12855	-0.125000	0.11703	-0.813000	0.03139	GCG	C10orf112	-	superfamily_ConA-like_lec_gl	ENSG00000204740		0.388	C10orf112-201	KNOWN	basic|appris_principal	protein_coding	C10orf112	HGNC	protein_coding		32	0.00	0	C			19678226	19678226	+1	no_errors	ENST00000454679	ensembl	human	known	69_37n	missense	36	21.74	10	SNP	0.000	T
SMCO3	440087	genome.wustl.edu	37	12	14959605	14959606	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	TT	TT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr12:14959605_14959606delTT	ENST00000316048.2	-	2	81_82	c.9_10delAA	c.(7-12)caaagtfs	p.S4fs	C12orf60_ENST00000527783.1_Intron|C12orf60_ENST00000330828.2_Intron	NM_001013698.2	NP_001013720.2	A2RU48	SMCO3_HUMAN	single-pass membrane protein with coiled-coil domains 3	4						integral component of membrane (GO:0016021)											AGGAAGTCACTTTGGGCCATAT	0.386																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS41759.1	12p12.3	2013-03-11	2013-03-11	2013-03-11	ENSG00000179256	ENSG00000179256			34401	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 69"""	C12orf69			Standard	NM_001013698		Approved	LOC440087	uc001rck.1	A2RU48	OTTHUMG00000167474	ENST00000316048.2:c.9_10delAA	12.37:g.14959605_14959606delTT	ENSP00000381895:p.Ser4fs		Q8NAI5	Frame_Shift_Del	DEL	NULL	p.S4fs	ENST00000316048.2	37	c.10_9	CCDS41759.1	12																																																																																			C12orf69	-	NULL	ENSG00000179256		0.386	SMCO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf69	HGNC	protein_coding	OTTHUMT00000394738.1	21	0.00	0	TT	NM_001013698		14959605	14959606	-1	no_errors	ENST00000316048	ensembl	human	known	69_37n	frame_shift_del	39	17.02	8	DEL	0.998:0.961	-
C1orf127	148345	genome.wustl.edu	37	1	11014110	11014110	+	Silent	SNP	G	G	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr1:11014110G>A	ENST00000377008.4	-	9	1010	c.564C>T	c.(562-564)gtC>gtT	p.V188V	C1orf127_ENST00000377004.4_Silent_p.V355V			Q8N9H9	CA127_HUMAN	chromosome 1 open reading frame 127	188										NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(5)	32	Ovarian(185;0.249)	Lung NSC(185;0.000226)|all_lung(284;0.000302)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.71e-07)|COAD - Colon adenocarcinoma(227;7.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000305)|Kidney(185;0.000785)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|READ - Rectum adenocarcinoma(331;0.0509)		CTGTCCAGAGGACCGGGGCAG	0.572																																						dbGAP											0													128.0	128.0	128.0					1																	11014110		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK094437	CCDS53267.1	1p36.22	2008-02-05			ENSG00000175262	ENSG00000175262			26730	protein-coding gene	gene with protein product						14702039	Standard	NM_001170754		Approved	FLJ37118	uc010oao.2	Q8N9H9	OTTHUMG00000002032	ENST00000377008.4:c.564C>T	1.37:g.11014110G>A			A0AVG8|A6NKM7|Q5VXJ2	Missense_Mutation	SNP	superfamily_DNA-bd_dom_put	p.S333F	ENST00000377008.4	37	c.998		1	.	.	.	.	.	.	.	.	.	.	G	5.244	0.230465	0.09969	.	.	ENSG00000175262	ENST00000418570;ENST00000520253	.	.	.	5.07	0.116	0.14647	.	.	.	.	.	T	0.21718	0.0523	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23976	-1.0173	4	.	.	.	-3.6998	2.8511	0.05558	0.1594:0.3824:0.322:0.1362	.	.	.	.	F	190;333	.	.	S	-	2	0	C1orf127	10936697	0.001000	0.12720	0.001000	0.08648	0.734000	0.41952	0.162000	0.16501	-0.262000	0.09392	0.655000	0.94253	TCC	C1orf127	-	NULL	ENSG00000175262		0.572	C1orf127-202	KNOWN	basic	protein_coding	C1orf127	HGNC	protein_coding		49	0.00	0	G	NM_173507		11014110	11014110	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000520253	ensembl	human	putative	69_37n	missense	18	41.94	13	SNP	0.000	A
C2orf27A	29798	genome.wustl.edu	37	2	132494182	132494182	+	Intron	SNP	G	G	C	rs11690978	byFrequency	TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr2:132494182G>C	ENST00000355171.4	+	1	274					NM_013310.3	NP_037442.3	Q580R0	CB027_HUMAN	chromosome 2 open reading frame 27A											kidney(1)	1						TGGTCAACTTGGTGCCGTGTA	0.353													.|||	1278	0.255192	0.0703	0.3631	5008	,	,		13462	0.1319		0.4414	False		,,,				2504	0.364					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF038169	CCDS2168.1	2q21.2	2010-05-11	2009-04-02	2009-04-02	ENSG00000197927	ENSG00000197927			25077	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 27"""	C2orf27		9110174, 8619474	Standard	NM_013310		Approved		uc002ttf.1	Q580R0	OTTHUMG00000131666	ENST00000355171.4:c.-248+13961G>C	2.37:g.132494182G>C			O43575|Q2M1X0|Q52M10|Q86XG2	RNA	SNP	-	NULL	ENST00000355171.4	37	NULL	CCDS2168.1	2																																																																																			C2orf27A	-	-	ENSG00000197927		0.353	C2orf27A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf27A	HGNC	protein_coding	OTTHUMT00000254569.4	61	0.00	0	G	NM_013310		132494182	132494182	+1	no_errors	ENST00000466372	ensembl	human	putative	69_37n	rna	54	10.00	6	SNP	1.000	C
C7	730	genome.wustl.edu	37	5	40981594	40981594	+	Missense_Mutation	SNP	G	G	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr5:40981594G>T	ENST00000313164.9	+	18	2810	c.2451G>T	c.(2449-2451)gaG>gaT	p.E817D		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	817	Factor I module (FIM) 2.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)							Ovarian(839;0.0112)				CGATGTCTGAGTGTGAGGCGG	0.572																																						dbGAP											0													62.0	66.0	65.0					5																	40981594		2117	4240	6357	-	-	-	SO:0001583	missense	0			J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.2451G>T	5.37:g.40981594G>T	ENSP00000322061:p.Glu817Asp		Q6P3T5|Q92489	Missense_Mutation	SNP	pfam_MACPF,pfam_Sushi_SCR_CCP,pfam_LDrepeatLR_classA_rpt,pfam_Thrombospondin_1_rpt,superfamily_Complement_control_module,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,smart_Sushi_SCR_CCP,smart_FacI_MAC,pfscan_LDrepeatLR_classA_rpt,pfscan_Sushi_SCR_CCP,pfscan_Thrombospondin_1_rpt,prints_MAC_perforin	p.E817D	ENST00000313164.9	37	c.2451	CCDS47201.1	5	.	.	.	.	.	.	.	.	.	.	G	15.03	2.713198	0.48517	.	.	ENSG00000112936	ENST00000313164	T	0.64618	-0.11	5.83	1.54	0.23209	Factor I / membrane attack complex (1);	0.000000	0.85682	D	0.000000	T	0.76033	0.3931	M	0.81497	2.545	0.43608	D	0.995977	D	0.60575	0.988	D	0.72625	0.978	T	0.75918	-0.3148	10	0.59425	D	0.04	-23.6757	10.3193	0.43756	0.4228:0.0:0.5772:0.0	.	817	P10643	CO7_HUMAN	D	817	ENSP00000322061:E817D	ENSP00000322061:E817D	E	+	3	2	C7	41017351	1.000000	0.71417	0.982000	0.44146	0.153000	0.21895	1.795000	0.38784	0.381000	0.24851	-0.251000	0.11542	GAG	C7	-	smart_FacI_MAC	ENSG00000112936		0.572	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7	HGNC	protein_coding	OTTHUMT00000317680.1	41	0.00	0	G			40981594	40981594	+1	no_errors	ENST00000313164	ensembl	human	known	69_37n	missense	33	19.51	8	SNP	0.997	T
SLC13A4	26266	genome.wustl.edu	37	7	135377238	135377238	+	Intron	SNP	T	T	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr7:135377238T>G	ENST00000354042.4	-	11	1808				C7orf73_ENST00000422968.1_3'UTR	NM_012450.2	NP_036582.2	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 4						sodium ion transmembrane transport (GO:0035725)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	24						TTCACTTTGCTTCTGGAAGCT	0.398																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF169301	CCDS5840.1	7q33	2013-07-18	2013-07-18		ENSG00000164707	ENSG00000164707		"""Solute carriers"""	15827	protein-coding gene	gene with protein product	"""sulphate transporter 1"""	604309	"""solute carrier family 13 (sodium/sulphate symporters), member 4"""			10535998	Standard	NM_012450		Approved	SUT-1, SUT1	uc003vta.3	Q9UKG4	OTTHUMG00000155539	ENST00000354042.4:c.1119-66A>C	7.37:g.135377238T>G			A4D1Q4|Q8N631	RNA	SNP	-	NULL	ENST00000354042.4	37	NULL	CCDS5840.1	7																																																																																			C7orf73	-	-	ENSG00000243317		0.398	SLC13A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf73	HGNC	protein_coding	OTTHUMT00000340558.1	13	0.00	0	T	NM_012450		135377238	135377238	+1	no_errors	ENST00000422968	ensembl	human	known	69_37n	rna	10	28.57	4	SNP	0.001	G
C8orf76	84933	genome.wustl.edu	37	8	124232476	124232476	+	Missense_Mutation	SNP	A	A	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr8:124232476A>G	ENST00000276704.4	-	6	1061	c.1010T>C	c.(1009-1011)gTt>gCt	p.V337A		NM_032847.2	NP_116236.1	Q96K31	CH076_HUMAN	chromosome 8 open reading frame 76	337										NS(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(4)	17	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			TACGGAGCCAACACACTTCAC	0.393																																						dbGAP											0													95.0	82.0	86.0					8																	124232476		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027731	CCDS6341.1	8q24.13	2012-06-27			ENSG00000189376	ENSG00000189376			25924	protein-coding gene	gene with protein product							Standard	NM_032847		Approved	FLJ14825	uc003yqc.2	Q96K31	OTTHUMG00000172562	ENST00000276704.4:c.1010T>C	8.37:g.124232476A>G	ENSP00000276704:p.Val337Ala		Q53HC1	Missense_Mutation	SNP	NULL	p.V337A	ENST00000276704.4	37	c.1010	CCDS6341.1	8	.	.	.	.	.	.	.	.	.	.	A	16.42	3.118310	0.56505	.	.	ENSG00000189376	ENST00000276704	.	.	.	5.8	5.8	0.92144	.	0.308009	0.27886	N	0.017456	T	0.53045	0.1772	M	0.63428	1.95	0.29771	N	0.834769	P	0.49559	0.925	P	0.47162	0.54	T	0.61633	-0.7023	9	0.87932	D	0	-17.4993	13.6745	0.62445	1.0:0.0:0.0:0.0	.	337	Q96K31	CH076_HUMAN	A	337	.	ENSP00000276704:V337A	V	-	2	0	C8orf76	124301657	0.051000	0.20477	0.735000	0.30896	0.213000	0.24496	2.649000	0.46656	2.222000	0.72286	0.533000	0.62120	GTT	C8orf76	-	NULL	ENSG00000189376		0.393	C8orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C8orf76	HGNC	protein_coding	OTTHUMT00000381748.1	33	0.00	0	A	NM_032847		124232476	124232476	-1	no_errors	ENST00000276704	ensembl	human	known	69_37n	missense	62	12.68	9	SNP	0.922	G
C9orf171	389799	genome.wustl.edu	37	9	135374986	135374986	+	Splice_Site	SNP	C	C	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr9:135374986C>T	ENST00000343036.2	+	4	679	c.631C>T	c.(631-633)Cgg>Tgg	p.R211W	C9orf171_ENST00000393216.2_Splice_Site_p.R175W|C9orf171_ENST00000393215.3_Splice_Site_p.R175*	NM_207417.1	NP_997300.1	Q6ZQR2	CI171_HUMAN	chromosome 9 open reading frame 171	211										large_intestine(7)|lung(9)|ovary(4)|prostate(3)	23						GATCCGGGCACGGTAAGGTGG	0.597																																						dbGAP											0													44.0	44.0	44.0					9																	135374986		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK128819	CCDS6949.1, CCDS65167.1	9q34.13	2012-04-03			ENSG00000188523	ENSG00000188523			33776	protein-coding gene	gene with protein product							Standard	NM_207417		Approved	FLJ46082	uc004cbn.3	Q6ZQR2	OTTHUMG00000131684	ENST00000343036.2:c.632+1C>T	9.37:g.135374986C>T			Q147X1	Nonsense_Mutation	SNP	NULL	p.R175*	ENST00000343036.2	37	c.523	CCDS6949.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.395674|5.395674	0.96009|0.96009	.|.	.|.	ENSG00000188523|ENSG00000188523	ENST00000343036;ENST00000393216|ENST00000393215	T;T|.	0.28069|.	1.63;1.63|.	4.89|4.89	4.89|4.89	0.63831|0.63831	.|.	0.070422|0.070422	0.52532|0.52532	D|D	0.000066|0.000066	T|.	0.57814|.	0.2079|.	M|M	0.65498|0.65498	2.005|2.005	0.44871|0.44871	D|D	0.997885|0.997885	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	0.998;1.0|.	T|.	0.54768|.	-0.8244|.	10|.	0.87932|0.02654	D|T	0|1	.|.	12.5011|12.5011	0.55955|0.55955	0.1669:0.8331:0.0:0.0|0.1669:0.8331:0.0:0.0	.|.	175;211|.	Q6ZQR2-2;Q6ZQR2|.	.;CI171_HUMAN|.	W|X	211;175|175	ENSP00000343290:R211W;ENSP00000376909:R175W|.	ENSP00000343290:R211W|ENSP00000376908:R175X	R|R	+|+	1|1	2|2	C9orf171|C9orf171	134364807|134364807	0.999000|0.999000	0.42202|0.42202	0.986000|0.986000	0.45419|0.45419	0.525000|0.525000	0.34531|0.34531	3.492000|3.492000	0.53259|0.53259	2.410000|2.410000	0.81850|0.81850	0.561000|0.561000	0.74099|0.74099	CGG|CGA	C9orf171	-	NULL	ENSG00000188523		0.597	C9orf171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C9orf171	HGNC	protein_coding	OTTHUMT00000254589.1	37	0.00	0	C	NM_207417	Missense_Mutation	135374986	135374986	+1	no_errors	ENST00000393215	ensembl	human	putative	69_37n	nonsense	9	55.00	11	SNP	1.000	T
CD53	963	genome.wustl.edu	37	1	111440293	111440293	+	Intron	SNP	C	C	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr1:111440293C>G	ENST00000271324.5	+	7	616				CD53_ENST00000497404.1_Intron|CD53_ENST00000429072.2_Intron	NM_000560.3|NM_001040033.1	NP_000551.1|NP_001035122.1	P19397	CD53_HUMAN	CD53 molecule						positive regulation of myoblast fusion (GO:1901741)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)	17		all_cancers(81;1.06e-05)|all_epithelial(167;1.95e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0264)|Colorectal(144;0.0375)|all cancers(265;0.11)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.141)|LUSC - Lung squamous cell carcinoma(189;0.144)		TTCATTCACGCAAAGAAAATA	0.338																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC040693	CCDS829.1	1p13	2013-02-14	2006-03-28		ENSG00000143119	ENSG00000143119		"""CD molecules"", ""Tetraspanins"""	1686	protein-coding gene	gene with protein product		151525	"""CD53 antigen"""	MOX44		8319976	Standard	XM_006711053		Approved	TSPAN25	uc001dzw.3	P19397	OTTHUMG00000048020	ENST00000271324.5:c.505-138C>G	1.37:g.111440293C>G			B2R905|Q5U0D6	RNA	SNP	-	NULL	ENST00000271324.5	37	NULL	CCDS829.1	1																																																																																			CD53	-	-	ENSG00000143119		0.338	CD53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD53	HGNC	protein_coding	OTTHUMT00000032931.1	15	0.00	0	C	NM_000560		111440293	111440293	+1	no_errors	ENST00000464329	ensembl	human	known	69_37n	rna	11	31.25	5	SNP	0.000	G
CD7	924	genome.wustl.edu	37	17	80274097	80274097	+	Missense_Mutation	SNP	C	C	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr17:80274097C>A	ENST00000312648.3	-	3	692	c.586G>T	c.(586-588)Gtg>Ttg	p.V196L	CD7_ENST00000583376.1_Missense_Mutation_p.V96L|CD7_ENST00000584284.1_Missense_Mutation_p.V196L|CD7_ENST00000578509.1_Missense_Mutation_p.V96L	NM_006137.6	NP_006128.1	P09564	CD7_HUMAN	CD7 molecule	196					homeostasis of number of cells within a tissue (GO:0048873)|immune response (GO:0006955)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0667)			ACACACGCCACCCCCAGGCCC	0.692																																					Pancreas(45;804 1068 19702 28207 28798)	dbGAP											0													11.0	12.0	11.0					17																	80274097		2157	4250	6407	-	-	-	SO:0001583	missense	0			X06180	CCDS11807.1	17q25.2-q25.3	2013-01-11	2006-03-28			ENSG00000173762		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1695	protein-coding gene	gene with protein product	"""p41 protein"", ""T-cell antigen CD7"", ""T-cell leukemia antigen"""	186820	"""CD7 antigen (p41)"""			1695199, 3501369	Standard	NM_006137		Approved	GP40, LEU-9, TP41, Tp40	uc002kel.1	P09564		ENST00000312648.3:c.586G>T	17.37:g.80274097C>A	ENSP00000312027:p.Val196Leu			Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.V196L	ENST00000312648.3	37	c.586	CCDS11807.1	17	.	.	.	.	.	.	.	.	.	.	C	4.628	0.116823	0.08881	.	.	ENSG00000173762	ENST00000312648	T	0.24151	1.87	3.14	-0.148	0.13424	.	1.144610	0.06664	N	0.764977	T	0.14013	0.0339	N	0.14661	0.345	0.09310	N	1	B;B	0.14438	0.01;0.01	B;B	0.12156	0.007;0.007	T	0.32666	-0.9898	10	0.62326	D	0.03	-10.9673	3.264	0.06859	0.0:0.5082:0.2252:0.2666	.	196;196	Q29VG3;P09564	.;CD7_HUMAN	L	196	ENSP00000312027:V196L	ENSP00000312027:V196L	V	-	1	0	CD7	77867386	0.000000	0.05858	0.005000	0.12908	0.226000	0.24999	-0.604000	0.05667	0.029000	0.15352	0.306000	0.20318	GTG	CD7	-	NULL	ENSG00000173762		0.692	CD7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD7	HGNC	protein_coding	OTTHUMT00000442826.1	41	0.00	0	C	NM_006137		80274097	80274097	-1	no_errors	ENST00000312648	ensembl	human	known	69_37n	missense	41	21.15	11	SNP	0.124	A
CENPE	1062	genome.wustl.edu	37	4	104079587	104079587	+	Missense_Mutation	SNP	T	T	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr4:104079587T>G	ENST00000265148.3	-	24	2992	c.2903A>C	c.(2902-2904)aAt>aCt	p.N968T	CENPE_ENST00000380026.3_Missense_Mutation_p.N943T	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	968					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		CTCAAGAGCATTTCGTAATTG	0.274																																						dbGAP											0													42.0	40.0	41.0					4																	104079587		2201	4290	6491	-	-	-	SO:0001583	missense	0			Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.2903A>C	4.37:g.104079587T>G	ENSP00000265148:p.Asn968Thr		A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_STAT_TF_coiled-coil,superfamily_Signal_recog_particl_SRP54_hlx,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.N968T	ENST00000265148.3	37	c.2903	CCDS34042.1	4	.	.	.	.	.	.	.	.	.	.	T	9.929	1.214269	0.22289	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026;ENST00000503705	D;D;D	0.94537	-3.45;-3.45;-3.45	4.82	2.34	0.29019	.	.	.	.	.	D	0.95175	0.8436	L	0.60455	1.87	0.27825	N	0.941672	P;D	0.76494	0.869;0.999	P;D	0.64144	0.558;0.922	D	0.88483	0.3070	9	0.62326	D	0.03	.	7.3503	0.26686	0.0:0.1801:0.0:0.8199	.	943;968	Q02224-3;Q02224	.;CENPE_HUMAN	T	968;968;943;968	ENSP00000265148:N968T;ENSP00000369365:N943T;ENSP00000423981:N968T	ENSP00000265148:N968T	N	-	2	0	CENPE	104299036	1.000000	0.71417	0.997000	0.53966	0.772000	0.43724	1.378000	0.34328	0.280000	0.22209	-0.297000	0.09499	AAT	CENPE	-	NULL	ENSG00000138778		0.274	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPE	HGNC	protein_coding		16	0.00	0	T			104079587	104079587	-1	no_errors	ENST00000265148	ensembl	human	known	69_37n	missense	19	20.83	5	SNP	0.997	G
CENPI	2491	genome.wustl.edu	37	X	100387395	100387395	+	Missense_Mutation	SNP	C	C	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chrX:100387395C>A	ENST00000372927.1	+	14	1697	c.1420C>A	c.(1420-1422)Ctt>Att	p.L474I	CENPI_ENST00000218507.5_Missense_Mutation_p.L474I|CENPI_ENST00000423383.1_Missense_Mutation_p.L474I|CENPI_ENST00000372926.1_Missense_Mutation_p.L474I	NM_006733.2	NP_006724.2	Q92674	CENPI_HUMAN	centromere protein I	474					CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)|sex differentiation (GO:0007548)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)		p.L474F(1)		breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(19)|prostate(1)|skin(2)	30						GAAACCACTTCTTTTTGACCA	0.313																																						dbGAP											1	Substitution - Missense(1)	skin(1)											117.0	108.0	111.0					X																	100387395		2203	4300	6503	-	-	-	SO:0001583	missense	0			X97249	CCDS14479.1	Xq22.1	2013-11-05	2006-06-15	2006-06-15	ENSG00000102384	ENSG00000102384			3968	protein-coding gene	gene with protein product		300065	"""FSH primary response (LRPR1, rat) homolog 1"", ""FSH primary response (LRPR1 homolog, rat) 1"""	FSHPRH1		16622420	Standard	NM_006733		Approved	LRPR1, CENP-I, Mis6	uc004egx.3	Q92674	OTTHUMG00000022018	ENST00000372927.1:c.1420C>A	X.37:g.100387395C>A	ENSP00000362018:p.Leu474Ile		Q5JWZ9|Q96ED0	Missense_Mutation	SNP	pfam_Centromere_CenpI	p.L474I	ENST00000372927.1	37	c.1420	CCDS14479.1	X	.	.	.	.	.	.	.	.	.	.	c	12.79	2.044308	0.36085	.	.	ENSG00000102384	ENST00000423383;ENST00000218507;ENST00000372926;ENST00000372927	.	.	.	5.32	1.12	0.20585	.	0.311359	0.35646	N	0.003074	T	0.57917	0.2086	M	0.72894	2.215	0.43047	D	0.994646	B;B	0.18610	0.029;0.029	B;B	0.25987	0.052;0.065	T	0.48234	-0.9053	9	0.27082	T	0.32	-1.9559	10.284	0.43556	0.4123:0.4693:0.1184:0.0	.	474;474	B4DZL4;Q92674	.;CENPI_HUMAN	I	474	.	ENSP00000218507:L474I	L	+	1	0	CENPI	100274051	0.687000	0.27671	0.963000	0.40424	0.788000	0.44548	0.015000	0.13355	-0.245000	0.09625	0.506000	0.49869	CTT	CENPI	-	pfam_Centromere_CenpI	ENSG00000102384		0.313	CENPI-004	KNOWN	basic|CCDS	protein_coding	CENPI	HGNC	protein_coding	OTTHUMT00000057519.1	32	0.00	0	C	NM_006733		100387395	100387395	+1	no_errors	ENST00000372927	ensembl	human	known	69_37n	missense	45	15.09	8	SNP	0.995	A
CLEC3B	7123	genome.wustl.edu	37	3	45072372	45072372	+	Missense_Mutation	SNP	G	G	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr3:45072372G>T	ENST00000296130.4	+	2	343	c.163G>T	c.(163-165)Gcc>Tcc	p.A55S	CLEC3B_ENST00000490386.1_3'UTR|CLEC3B_ENST00000428034.1_Missense_Mutation_p.A13S	NM_003278.2	NP_003269.2	P05452	TETN_HUMAN	C-type lectin domain family 3, member B	55			A -> S. {ECO:0000269|PubMed:3427041}.		bone mineralization (GO:0030282)|cellular response to organic substance (GO:0071310)|cellular response to transforming growth factor beta stimulus (GO:0071560)|ossification (GO:0001503)|positive regulation of plasminogen activation (GO:0010756)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|granular component (GO:0001652)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|heparin binding (GO:0008201)|kringle domain binding (GO:0036143)			endometrium(1)|lung(3)	4				BRCA - Breast invasive adenocarcinoma(193;0.00863)|KIRC - Kidney renal clear cell carcinoma(197;0.0475)|Kidney(197;0.0595)	Tenecteplase(DB00031)	GGACACCCTGGCCCAGGAGGT	0.607																																					GBM(139;1487 3263 30871)	dbGAP											0													40.0	36.0	37.0					3																	45072372		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS2726.1	3p22-p21.3	2010-04-27	2005-02-09	2005-02-09	ENSG00000163815	ENSG00000163815		"""C-type lectin domain containing"""	11891	protein-coding gene	gene with protein product		187520	"""tetranectin (plasminogen binding protein)"""	TNA			Standard	NM_003278		Approved	TN	uc003cok.4	P05452	OTTHUMG00000133087	ENST00000296130.4:c.163G>T	3.37:g.45072372G>T	ENSP00000296130:p.Ala55Ser		Q6FGX6	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_Pancreatis_ac	p.A55S	ENST00000296130.4	37	c.163	CCDS2726.1	3	.	.	.	.	.	.	.	.	.	.	G	15.49	2.849503	0.51270	.	.	ENSG00000163815	ENST00000296130;ENST00000428034	T;T	0.29917	1.55;1.55	5.3	4.42	0.53409	.	0.381193	0.22790	N	0.055604	T	0.20170	0.0485	L	0.38838	1.175	0.33443	D	0.582631	B	0.18863	0.031	B	0.11329	0.006	T	0.15235	-1.0444	10	0.09338	T	0.73	-26.1751	9.2795	0.37720	0.079:0.0:0.7448:0.1762	.	55	P05452	TETN_HUMAN	S	55;13	ENSP00000296130:A55S;ENSP00000396013:A13S	ENSP00000296130:A55S	A	+	1	0	CLEC3B	45047376	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.154000	0.42291	2.485000	0.83878	0.563000	0.77884	GCC	CLEC3B	-	NULL	ENSG00000163815		0.607	CLEC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC3B	HGNC	protein_coding	OTTHUMT00000256745.1	47	0.00	0	G	NM_003278		45072372	45072372	+1	no_errors	ENST00000296130	ensembl	human	known	69_37n	missense	10	41.18	7	SNP	1.000	T
CXADR	1525	genome.wustl.edu	37	21	18933747	18933747	+	Silent	SNP	A	A	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr21:18933747A>G	ENST00000284878.7	+	6	1534	c.786A>G	c.(784-786)aaA>aaG	p.K262K	CXADR_ENST00000400166.1_Intron|CXADR_ENST00000356275.6_Intron|CXADR_ENST00000400165.1_Intron|CXADR_ENST00000400169.1_Silent_p.K262K|CXADR_ENST00000306618.10_Silent_p.K221K	NM_001338.4	NP_001329.1	P78310	CXAR_HUMAN	coxsackie virus and adenovirus receptor	262					actin cytoskeleton reorganization (GO:0031532)|AV node cell to bundle of His cell communication (GO:0086067)|blood coagulation (GO:0007596)|cardiac muscle fiber development (GO:0048739)|cell-cell junction organization (GO:0045216)|defense response to virus (GO:0051607)|epithelial structure maintenance (GO:0010669)|gamma-delta T cell activation (GO:0046629)|germ cell migration (GO:0008354)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|homotypic cell-cell adhesion (GO:0034109)|leukocyte migration (GO:0050900)|mitochondrion organization (GO:0007005)|neutrophil chemotaxis (GO:0030593)|regulation of immune response (GO:0050776)|transepithelial transport (GO:0070633)|viral process (GO:0016032)	acrosomal vesicle (GO:0001669)|adherens junction (GO:0005912)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|filopodium (GO:0030175)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|cell adhesion molecule binding (GO:0050839)|connexin binding (GO:0071253)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|PDZ domain binding (GO:0030165)|receptor binding (GO:0005102)|virus receptor activity (GO:0001618)			endometrium(2)|large_intestine(5)|lung(1)|ovary(1)|prostate(2)	11				Epithelial(23;0.000206)|all cancers(11;0.000302)|OV - Ovarian serous cystadenocarcinoma(11;0.0194)|Lung(58;0.0233)|COAD - Colon adenocarcinoma(22;0.0389)|Colorectal(24;0.0483)|LUSC - Lung squamous cell carcinoma(23;0.0782)		GCTGTCGTAAAAAGCGCAGAG	0.358																																						dbGAP											0													56.0	56.0	56.0					21																	18933747		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			Y07593	CCDS33519.1, CCDS56204.1, CCDS56205.1, CCDS56206.1, CCDS56207.1	21q21.1	2013-01-29			ENSG00000154639	ENSG00000154639		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	2559	protein-coding gene	gene with protein product		602621				9036860, 9096397	Standard	NM_001338		Approved	CAR	uc002yki.3	P78310	OTTHUMG00000074508	ENST00000284878.7:c.786A>G	21.37:g.18933747A>G			B2R8V8|B7WPI3|D3YHP0|O00694|Q8WWT6|Q8WWT7|Q8WWT8|Q9UKV4	Silent	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.K262	ENST00000284878.7	37	c.786	CCDS33519.1	21																																																																																			CXADR	-	NULL	ENSG00000154639		0.358	CXADR-001	KNOWN	basic|CCDS	protein_coding	CXADR	HGNC	protein_coding	OTTHUMT00000158209.1	36	0.00	0	A			18933747	18933747	+1	no_errors	ENST00000284878	ensembl	human	known	69_37n	silent	21	41.67	15	SNP	0.993	G
COL6A2	1292	genome.wustl.edu	37	21	47545705	47545705	+	Missense_Mutation	SNP	G	G	A	rs558005986		TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr21:47545705G>A	ENST00000300527.4	+	26	2080	c.1976G>A	c.(1975-1977)cGt>cAt	p.R659H	COL6A2_ENST00000397763.1_Missense_Mutation_p.R659H|COL6A2_ENST00000409416.1_Missense_Mutation_p.R659H|COL6A2_ENST00000310645.5_Missense_Mutation_p.R659H|COL6A2_ENST00000357838.4_Missense_Mutation_p.R659H	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	659	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		GCAGGGACGCGTGTGGGCGTG	0.652													G|||	1	0.000199681	0.0	0.0014	5008	,	,		13754	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													45.0	38.0	40.0					21																	47545705		2203	4300	6503	-	-	-	SO:0001583	missense	0			M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.1976G>A	21.37:g.47545705G>A	ENSP00000300527:p.Arg659His		Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.R659H	ENST00000300527.4	37	c.1976	CCDS13728.1	21	.	.	.	.	.	.	.	.	.	.	G	14.19	2.462092	0.43736	.	.	ENSG00000142173	ENST00000300527;ENST00000357838;ENST00000310645;ENST00000409416;ENST00000397763;ENST00000413758	D;D;D;D;D;D	0.86164	-2.08;-2.08;-2.08;-2.08;-2.08;-2.08	4.39	4.39	0.52855	von Willebrand factor, type A (3);	0.057572	0.64402	D	0.000002	D	0.92341	0.7570	M	0.65677	2.01	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.998	D	0.92160	0.5735	10	0.41790	T	0.15	-10.0362	16.9535	0.86252	0.0:0.0:1.0:0.0	.	659;659;659	P12110;P12110-2;P12110-3	CO6A2_HUMAN;.;.	H	659;659;659;659;659;216	ENSP00000300527:R659H;ENSP00000350497:R659H;ENSP00000312529:R659H;ENSP00000387115:R659H;ENSP00000380870:R659H;ENSP00000395751:R216H	ENSP00000300527:R659H	R	+	2	0	COL6A2	46370133	1.000000	0.71417	0.222000	0.23844	0.070000	0.16714	9.334000	0.96470	1.989000	0.58080	0.478000	0.44815	CGT	COL6A2	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000142173		0.652	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A2	HGNC	protein_coding	OTTHUMT00000206971.1	104	0.00	0	G			47545705	47545705	+1	no_errors	ENST00000300527	ensembl	human	known	69_37n	missense	111	14.62	19	SNP	0.995	A
CYP51A1	1595	genome.wustl.edu	37	7	91743114	91743114	+	Missense_Mutation	SNP	A	A	C			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr7:91743114A>C	ENST00000003100.8	-	10	1560	c.1395T>G	c.(1393-1395)atT>atG	p.I465M	LRRD1_ENST00000422722.1_5'UTR|CYP51A1_ENST00000450723.1_Missense_Mutation_p.I360M	NM_000786.3	NP_000777.1	Q16850	CP51A_HUMAN	cytochrome P450, family 51, subfamily A, polypeptide 1	459					cholesterol biosynthetic process (GO:0006695)|cholesterol biosynthetic process via 24,25-dihydrolanosterol (GO:0033488)|demethylation (GO:0070988)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|sterol 14-demethylase activity (GO:0008398)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|skin(1)	10	all_cancers(62;2.16e-09)|all_epithelial(64;3.86e-08)|Breast(17;0.00206)|all_lung(186;0.169)|all_hematologic(106;0.215)|Lung NSC(181;0.227)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		Itraconazole(DB01167)|Ketoconazole(DB01026)|Sertaconazole(DB01153)|Tioconazole(DB01007)	AAATTGTCTTAATTTGAACAT	0.323																																					GBM(70;1100 1190 11592 25836 51397)	dbGAP											0													84.0	85.0	85.0					7																	91743114		2203	4300	6503	-	-	-	SO:0001583	missense	0			U51685	CCDS5623.1, CCDS55123.1	7q21.2	2012-10-10	2003-02-14	2003-02-28	ENSG00000001630	ENSG00000001630		"""Cytochrome P450s"""	2649	protein-coding gene	gene with protein product		601637	"""cytochrome P450, 51 (lanosterol 14-alpha-demethylase)"""	CYP51		8975714	Standard	NM_000786		Approved	CP51, CYPL1, P450L1, LDM, P450-14DM	uc003ulm.4	Q16850	OTTHUMG00000131131	ENST00000003100.8:c.1395T>G	7.37:g.91743114A>C	ENSP00000003100:p.Ile465Met		A4D1F8|B2RAI4|B4DJ55|O00770|O00772|Q16784|Q8N1A8|Q99868	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_B	p.I465M	ENST00000003100.8	37	c.1395	CCDS5623.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.01|17.01	3.280303|3.280303	0.59758|0.59758	.|.	.|.	ENSG00000001630|ENSG00000001630	ENST00000003100;ENST00000496998;ENST00000450723|ENST00000422867	T;T|.	0.64991|.	-0.13;-0.13|.	5.1|5.1	-2.7|-2.7	0.06004|0.06004	.|.	0.094754|.	0.64402|.	D|.	0.000001|.	T|.	0.49029|.	0.1533|.	L|L	0.38175|0.38175	1.15|1.15	0.80722|0.80722	D|D	1|1	D;D|.	0.67145|.	0.988;0.996|.	D;D|.	0.67231|.	0.91;0.95|.	T|.	0.40979|.	-0.9534|.	10|.	0.54805|.	T|.	0.06|.	.|.	9.9871|9.9871	0.41847|0.41847	0.7385:0.0:0.1649:0.0967|0.7385:0.0:0.1649:0.0967	.|.	405;459|.	B3KRC6;Q16850|.	.;CP51A_HUMAN|.	M|E	465;405;360|178	ENSP00000003100:I465M;ENSP00000406757:I360M|.	ENSP00000003100:I465M|.	I|X	-|-	3|1	3|0	CYP51A1|CYP51A1	91581050|91581050	0.924000|0.924000	0.31332|0.31332	0.984000|0.984000	0.44739|0.44739	0.991000|0.991000	0.79684|0.79684	0.034000|0.034000	0.13776|0.13776	-0.392000|-0.392000	0.07751|0.07751	0.482000|0.482000	0.46254|0.46254	ATT|TAA	CYP51A1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_B	ENSG00000001630		0.323	CYP51A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP51A1	HGNC	protein_coding	OTTHUMT00000253812.4	25	0.00	0	A			91743114	91743114	-1	no_errors	ENST00000003100	ensembl	human	known	69_37n	missense	21	25.00	7	SNP	0.801	C
DAAM1	23002	genome.wustl.edu	37	14	59835650	59835650	+	3'UTR	SNP	G	G	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr14:59835650G>A	ENST00000395125.1	+	0	3333				DAAM1_ENST00000553966.1_3'UTR|DAAM1_ENST00000360909.3_3'UTR|DAAM1_ENST00000351081.1_3'UTR	NM_014992.2	NP_055807.1	Q9Y4D1	DAAM1_HUMAN	dishevelled associated activator of morphogenesis 1						actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	identical protein binding (GO:0042802)			breast(3)|cervix(3)|endometrium(5)|kidney(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.165)		TCATTACACTGCCTTGCAATC	0.323																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB014566	CCDS9737.1, CCDS58323.1	14q22.3	2008-08-11			ENSG00000100592	ENSG00000100592			18142	protein-coding gene	gene with protein product		606626				11779461, 18162551	Standard	NM_014992		Approved	KIAA0666	uc031qou.1	Q9Y4D1	OTTHUMG00000140326	ENST00000395125.1:c.*73G>A	14.37:g.59835650G>A			Q86U34|Q8N1Z8|Q8TB39	RNA	SNP	-	NULL	ENST00000395125.1	37	NULL	CCDS9737.1	14																																																																																			DAAM1	-	-	ENSG00000100592		0.323	DAAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DAAM1	HGNC	protein_coding	OTTHUMT00000276942.2	52	0.00	0	G	NM_014992		59835650	59835650	+1	no_errors	ENST00000553966	ensembl	human	known	69_37n	rna	40	18.37	9	SNP	1.000	A
DCHS1	8642	genome.wustl.edu	37	11	6652952	6652952	+	Silent	SNP	G	G	C			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr11:6652952G>C	ENST00000299441.3	-	7	3981	c.3570C>G	c.(3568-3570)ccC>ccG	p.P1190P	RP11-732A19.6_ENST00000526633.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	1190	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGGTGCTGCGGGGTGGGCTCC	0.617																																						dbGAP											0													62.0	53.0	56.0					11																	6652952		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.3570C>G	11.37:g.6652952G>C			O15098	Silent	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.P1190	ENST00000299441.3	37	c.3570	CCDS7771.1	11																																																																																			DCHS1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000166341		0.617	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS1	HGNC	protein_coding	OTTHUMT00000257258.1	28	0.00	0	G	NM_003737		6652952	6652952	-1	no_errors	ENST00000299441	ensembl	human	known	69_37n	silent	7	68.18	15	SNP	0.988	C
DDX53	168400	genome.wustl.edu	37	X	23018405	23018405	+	Silent	SNP	G	G	C			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chrX:23018405G>C	ENST00000327968.5	+	1	319	c.231G>C	c.(229-231)tcG>tcC	p.S77S	RP11-40F8.2_ENST00000455399.1_lincRNA	NM_182699.3	NP_874358.2	Q86TM3	DDX53_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 53	77	KH. {ECO:0000255|PROSITE- ProRule:PRU00117}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|RNA binding (GO:0003723)			breast(2)|endometrium(5)|kidney(4)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	35						TACAACATTCGACAAACACTA	0.383																																						dbGAP											0													68.0	72.0	70.0					X																	23018405		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY039237	CCDS35214.1	Xp22.13	2009-03-25			ENSG00000184735	ENSG00000184735		"""DEAD-boxes"""	20083	protein-coding gene	gene with protein product	"""cancer associated gene"", ""cancer/testis antigen 26"""						Standard	NM_182699		Approved	CAGE, CT26	uc004daj.3	Q86TM3	OTTHUMG00000021248	ENST00000327968.5:c.231G>C	X.37:g.23018405G>C			Q0D2N2|Q6NVV4	Silent	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_KH_dom_type_1,smart_KH_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_KH_dom_type_1,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S77	ENST00000327968.5	37	c.231	CCDS35214.1	X																																																																																			DDX53	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	ENSG00000184735		0.383	DDX53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX53	HGNC	protein_coding	OTTHUMT00000056043.1	51	0.00	0	G	NM_182699		23018405	23018405	+1	no_errors	ENST00000327968	ensembl	human	known	69_37n	silent	14	51.72	15	SNP	0.000	C
DNAJC7	7266	genome.wustl.edu	37	17	40148414	40148414	+	Missense_Mutation	SNP	A	A	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr17:40148414A>G	ENST00000457167.4	-	4	556	c.320T>C	c.(319-321)cTc>cCc	p.L107P	DNAJC7_ENST00000426588.3_Missense_Mutation_p.L51P|DNAJC7_ENST00000316603.7_Missense_Mutation_p.L51P	NM_003315.3	NP_003306.3	Q99615	DNJC7_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 7	107					chaperone cofactor-dependent protein refolding (GO:0070389)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	heat shock protein binding (GO:0031072)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)	9		all_cancers(22;0.00273)|Breast(137;0.00104)|all_epithelial(22;0.0305)				CCCCAGAGAGAGGTGGCACTT	0.498																																					Colon(63;618 1117 8600 10857 19751)	dbGAP											0													76.0	69.0	71.0					17																	40148414		1917	4146	6063	-	-	-	SO:0001583	missense	0			U46571	CCDS45677.1, CCDS45678.1	17q11.2	2013-01-10				ENSG00000168259		"""Heat shock proteins / DNAJ (HSP40)"", ""Tetratricopeptide (TTC) repeat domain containing"""	12392	protein-coding gene	gene with protein product		601964		TTC2		8836031, 11147971	Standard	NR_029431		Approved	TPR2	uc002hyo.3	Q99615		ENST00000457167.4:c.320T>C	17.37:g.40148414A>G	ENSP00000406463:p.Leu107Pro		Q7Z784	Missense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,pfam_DnaJ_N,superfamily_DnaJ_N,smart_TPR_repeat,smart_DnaJ_N,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.L107P	ENST00000457167.4	37	c.320	CCDS45677.1	17	.	.	.	.	.	.	.	.	.	.	A	25.2	4.618120	0.87359	.	.	ENSG00000168259	ENST00000457167;ENST00000426588;ENST00000316603	T;T;T	0.77489	0.94;-1.1;-1.1	5.62	5.62	0.85841	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.88074	0.6339	M	0.78801	2.425	0.80722	D	1	D;D;D	0.76494	0.994;0.999;0.999	D;D;D	0.80764	0.921;0.994;0.961	D	0.89521	0.3778	10	0.87932	D	0	-0.7495	16.1172	0.81314	1.0:0.0:0.0:0.0	.	96;51;107	Q59EH7;Q7Z784;Q99615	.;.;DNJC7_HUMAN	P	107;51;51	ENSP00000406463:L107P;ENSP00000394327:L51P;ENSP00000313311:L51P	ENSP00000313311:L51P	L	-	2	0	DNAJC7	37401940	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.932000	0.92897	2.266000	0.75297	0.533000	0.62120	CTC	DNAJC7	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000168259		0.498	DNAJC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC7	HGNC	protein_coding	OTTHUMT00000453366.2	51	0.00	0	A			40148414	40148414	-1	no_errors	ENST00000457167	ensembl	human	known	69_37n	missense	16	54.29	19	SNP	1.000	G
DUSP16	80824	genome.wustl.edu	37	12	12673999	12673999	+	Missense_Mutation	SNP	T	T	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr12:12673999T>A	ENST00000228862.2	-	2	665	c.34A>T	c.(34-36)Act>Tct	p.T12S	DUSP16_ENST00000298573.4_Missense_Mutation_p.T12S	NM_030640.2	NP_085143.1	Q9BY84	DUS16_HUMAN	dual specificity phosphatase 16	12					dephosphorylation (GO:0016311)|inactivation of MAPK activity (GO:0000188)|MAPK export from nucleus (GO:0045204)|MAPK phosphatase export from nucleus, leptomycin B sensitive (GO:0045209)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(7)|kidney(2)|large_intestine(6)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(3)	26		Prostate(47;0.0687)		BRCA - Breast invasive adenocarcinoma(232;0.0203)		AACCTCTCAGTAACAATTTGA	0.443																																					Ovarian(158;443 1896 15437 36069 46477)	dbGAP											0													130.0	112.0	118.0					12																	12673999		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB052156	CCDS8650.1	12p13	2011-06-09				ENSG00000111266		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	17909	protein-coding gene	gene with protein product	"""MAPK phosphatase-7"""	607175				11359773, 11489891, 15888437	Standard	NM_030640		Approved	MKP-7, KIAA1700, MKP7	uc001rao.2	Q9BY84		ENST00000228862.2:c.34A>T	12.37:g.12673999T>A	ENSP00000228862:p.Thr12Ser		Q547C7|Q96QS2|Q9C0G3	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP	p.T12S	ENST00000228862.2	37	c.34	CCDS8650.1	12	.	.	.	.	.	.	.	.	.	.	T	10.79	1.448316	0.26074	.	.	ENSG00000111266	ENST00000228862;ENST00000298573;ENST00000539940	T;T;T	0.74421	0.98;0.98;-0.84	5.64	4.48	0.54585	Rhodanese-like (3);	0.069164	0.64402	D	0.000008	T	0.56819	0.2011	N	0.14661	0.345	0.37348	D	0.910691	B	0.21225	0.053	B	0.32393	0.145	T	0.53563	-0.8421	10	0.35671	T	0.21	.	5.176	0.15135	0.1566:0.1057:0.0:0.7377	.	12	Q9BY84	DUS16_HUMAN	S	12	ENSP00000228862:T12S;ENSP00000298573:T12S;ENSP00000443039:T12S	ENSP00000228862:T12S	T	-	1	0	DUSP16	12565266	0.967000	0.33354	1.000000	0.80357	0.999000	0.98932	0.712000	0.25779	0.944000	0.37579	0.533000	0.62120	ACT	DUSP16	-	superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom	ENSG00000111266		0.443	DUSP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP16	HGNC	protein_coding	OTTHUMT00000400311.1	82	0.00	0	T	NM_030640		12673999	12673999	-1	no_errors	ENST00000228862	ensembl	human	known	69_37n	missense	111	25.00	37	SNP	1.000	A
EIF2D	1939	genome.wustl.edu	37	1	206769147	206769147	+	Missense_Mutation	SNP	G	G	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr1:206769147G>A	ENST00000271764.2	-	13	1637	c.1429C>T	c.(1429-1431)Ccc>Tcc	p.P477S	EIF2D_ENST00000367114.3_Missense_Mutation_p.P353S|EIF2D_ENST00000472709.2_5'UTR	NM_006893.2	NP_008824.2	P41214	EIF2D_HUMAN	eukaryotic translation initiation factor 2D	477					formation of translation preinitiation complex (GO:0001731)|intracellular protein transport (GO:0006886)|IRES-dependent translational initiation (GO:0002192)|ribosome disassembly (GO:0032790)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor activity (GO:0004872)|translation initiation factor activity (GO:0003743)			autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						TCTTGTCCGGGAAGGGTCACT	0.408																																						dbGAP											0													157.0	150.0	152.0					1																	206769147		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC001585	CCDS1465.1, CCDS55680.1	1q32.1	2014-05-06	2011-01-19	2011-01-19	ENSG00000143486	ENSG00000143486			6583	protein-coding gene	gene with protein product		613709				20566627	Standard	NM_001201478		Approved	LGTN	uc001heh.2	P41214	OTTHUMG00000184619	ENST00000271764.2:c.1429C>T	1.37:g.206769147G>A	ENSP00000271764:p.Pro477Ser		Q5SY40|Q8IXV3|Q96DG3|Q96TG7|Q9NR27|Q9NSN0|Q9NV18|Q9NZ21	Missense_Mutation	SNP	pfam_TIF_SUI1,superfamily_TIF_SUI1,superfamily_SWIB_MDM2_domain,superfamily_PUA-like_domain,smart_PUA,pfscan_PUA,pfscan_TIF_SUI1	p.P477S	ENST00000271764.2	37	c.1429	CCDS1465.1	1	.	.	.	.	.	.	.	.	.	.	G	7.035	0.561400	0.13498	.	.	ENSG00000143486	ENST00000367114;ENST00000271764	T;T	0.48522	0.81;1.42	5.82	2.86	0.33363	Translation initiation factor SUI1 (1);	0.300767	0.41712	D	0.000824	T	0.43942	0.1270	M	0.73962	2.25	0.48571	D	0.999679	B;B	0.30281	0.005;0.275	B;B	0.31245	0.013;0.126	T	0.38457	-0.9660	10	0.33940	T	0.23	-9.4294	7.263	0.26214	0.1443:0.1646:0.6911:0.0	.	353;477	P41214-2;P41214	.;EIF2D_HUMAN	S	353;477	ENSP00000356081:P353S;ENSP00000271764:P477S	ENSP00000271764:P477S	P	-	1	0	EIF2D	204835770	1.000000	0.71417	0.997000	0.53966	0.984000	0.73092	1.835000	0.39181	1.421000	0.47157	0.655000	0.94253	CCC	EIF2D	-	superfamily_TIF_SUI1	ENSG00000143486		0.408	EIF2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2D	HGNC	protein_coding	OTTHUMT00000088475.1	53	0.00	0	G	NM_006893		206769147	206769147	-1	no_errors	ENST00000271764	ensembl	human	known	69_37n	missense	37	28.85	15	SNP	0.987	A
EIF4A2	1974	genome.wustl.edu	37	3	186504432	186504432	+	Missense_Mutation	SNP	G	G	C			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr3:186504432G>C	ENST00000323963.5	+	7	833	c.769G>C	c.(769-771)Gag>Cag	p.E257Q	SNORA81_ENST00000408493.2_RNA|SNORD2_ENST00000459163.1_RNA|SNORA63_ENST00000363548.1_RNA|RP11-573D15.9_ENST00000577781.1_RNA|SNORA4_ENST00000584302.1_RNA|SNORA63_ENST00000363450.1_RNA|EIF4A2_ENST00000440191.2_Missense_Mutation_p.E258Q|EIF4A2_ENST00000356531.5_Missense_Mutation_p.E162Q			Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	257	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|urinary_tract(1)	28	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		TGTTGAGAGAGAGGTAACTGT	0.348			T	BCL6	NHL																																	dbGAP		Dom	yes		3	3q27.3	1974	"""eukaryotic translation initiation factor 4A, isoform 2"""		L	0													101.0	106.0	104.0					3																	186504432		2203	4300	6503	-	-	-	SO:0001583	missense	0			D30655	CCDS3282.1	3q28	2012-02-23	2010-02-10		ENSG00000156976	ENSG00000156976	3.6.1.1	"""DEAD-boxes"""	3284	protein-coding gene	gene with protein product		601102	"""eukaryotic translation initiation factor 4A, isoform 2"""	EIF4F		8521730	Standard	NM_001967		Approved	DDX2B, EIF4A, BM-010	uc003fqs.3	Q14240	OTTHUMG00000156564	ENST00000323963.5:c.769G>C	3.37:g.186504432G>C	ENSP00000326381:p.Glu257Gln		D3DNU9|Q53XJ6|Q96B90|Q96EA8	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.E258Q	ENST00000323963.5	37	c.772	CCDS3282.1	3	.	.	.	.	.	.	.	.	.	.	G	19.19	3.779352	0.70107	.	.	ENSG00000156976	ENST00000323963;ENST00000440191;ENST00000356531	T;T;T	0.05319	3.46;3.46;3.46	4.93	4.93	0.64822	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.14227	0.0344	L	0.60455	1.87	0.80722	D	1	D;P;P;P	0.59767	0.986;0.671;0.826;0.733	P;B;P;B	0.50352	0.637;0.291;0.638;0.435	T	0.00174	-1.1956	10	0.87932	D	0	-20.1675	16.0345	0.80612	0.0:0.0:1.0:0.0	.	113;162;258;257	B4DJX6;Q9NZE6;Q14240-2;Q14240	.;.;.;IF4A2_HUMAN	Q	257;258;162	ENSP00000326381:E257Q;ENSP00000398370:E258Q;ENSP00000348925:E162Q	ENSP00000326381:E257Q	E	+	1	0	EIF4A2	187987126	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	8.958000	0.93099	2.724000	0.93272	0.557000	0.71058	GAG	EIF4A2	-	pfscan_Helicase_C	ENSG00000156976		0.348	EIF4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4A2	HGNC	protein_coding	OTTHUMT00000344609.1	48	0.00	0	G	NM_001967		186504432	186504432	+1	no_errors	ENST00000440191	ensembl	human	known	69_37n	missense	61	10.29	7	SNP	1.000	C
EPB41L4A	64097	genome.wustl.edu	37	5	111481600	111481600	+	5'UTR	SNP	A	A	T	rs56071312	byFrequency	TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr5:111481600A>T	ENST00000507810.1	-	0	1089							Q9HCS5	E41LA_HUMAN	erythrocyte membrane protein band 4.1 like 4A							cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(2)|skin(1)	34		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		atatcacttcatccagaagtg	0.388													A|||	850	0.169728	0.3283	0.0778	5008	,	,		20069	0.0575		0.1412	False		,,,				2504	0.1656					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AB030240	CCDS43350.1	5q21.3	2008-02-05			ENSG00000129595	ENSG00000129595			13278	protein-coding gene	gene with protein product		612141				10874211	Standard	XM_005272043		Approved	NBL4	uc003kpv.1	Q9HCS5	OTTHUMG00000162902	ENST00000507810.1:c.-1463T>A	5.37:g.111481600A>T			A4FUI6	RNA	SNP	-	NULL	ENST00000507810.1	37	NULL		5																																																																																			EPB41L4A	-	-	ENSG00000129595		0.388	EPB41L4A-007	KNOWN	basic	processed_transcript	EPB41L4A	HGNC	protein_coding	OTTHUMT00000370975.1	62	0.00	0	A			111481600	111481600	-1	no_errors	ENST00000507810	ensembl	human	known	69_37n	rna	32	13.51	5	SNP	0.003	T
EYS	346007	genome.wustl.edu	37	6	64436412	64436412	+	Splice_Site	SNP	C	C	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr6:64436412C>G	ENST00000370621.3	-	43	8822	c.8296G>C	c.(8296-8298)Ggt>Cgt	p.G2766R	EYS_ENST00000370616.2_Splice_Site_p.G2766R|EYS_ENST00000503581.1_Splice_Site_p.G2745R			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	2766	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						CCAATCTTACCTGATTGGGCT	0.353																																						dbGAP											0													85.0	70.0	75.0					6																	64436412		692	1591	2283	-	-	-	SO:0001630	splice_region_variant	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.8296+1G>C	6.37:g.64436412C>G			A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF-like_dom,superfamily_ConA-like_lec_gl,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.G2766R	ENST00000370621.3	37	c.8296		6	.	.	.	.	.	.	.	.	.	.	C	18.91	3.724036	0.68959	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	T;T;T	0.80480	-1.38;-0.43;-0.43	3.55	3.55	0.40652	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	.	.	.	.	T	0.77398	0.4124	L	0.28400	0.85	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.76937	-0.2774	8	.	.	.	.	13.3044	0.60345	0.0:1.0:0.0:0.0	.	2745;2766	Q5T1H1-1;Q5T1H1	.;EYS_HUMAN	R	2745;2766;2766	ENSP00000424243:G2745R;ENSP00000359655:G2766R;ENSP00000359650:G2766R	.	G	-	1	0	EYS	64494371	1.000000	0.71417	1.000000	0.80357	0.752000	0.42762	6.365000	0.73090	1.543000	0.49345	0.491000	0.48974	GGT	EYS	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000188107		0.353	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	36	0.00	0	C	XM_294050	Missense_Mutation	64436412	64436412	-1	no_errors	ENST00000370616	ensembl	human	known	69_37n	missense	27	15.62	5	SNP	1.000	G
FAM20C	56975	genome.wustl.edu	37	7	195732	195735	+	Splice_Site	DEL	GGTA	GGTA	-			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	GGTA	GGTA					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr7:195732_195735delGGTA	ENST00000313766.5	+	2	1015	c.784delGGTA	c.(784-786)ggt>gt	p.G262fs	AC093627.12_ENST00000467050.1_RNA|FAM20C_ENST00000471328.1_3'UTR	NM_020223.3	NP_064608.2	Q8IXL6	DMP4_HUMAN	family with sequence similarity 20, member C	262					dentinogenesis (GO:0097187)|enamel mineralization (GO:0070166)|odontoblast differentiation (GO:0071895)|osteoclast maturation (GO:0036179)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|protein phosphorylation (GO:0006468)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of phosphorus metabolic process (GO:0051174)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(2)|urinary_tract(1)	4		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.57e-17)|Epithelial(4;1.26e-16)|all cancers(6;4.79e-14)		CACCAGCGTGGGTAGGTGTCCTTG	0.618																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			BC040074	CCDS47522.1	7p22.3	2012-11-29			ENSG00000177706	ENSG00000177706			22140	protein-coding gene	gene with protein product	"""dentin matrix protein 4"""	611061				17369251, 17924334	Standard	NM_020223		Approved	IMAGE:4942737, DKFZp547D065, DMP4	uc003sip.3	Q8IXL6	OTTHUMG00000151401	ENST00000313766.5:c.784+1GGTA>-	7.37:g.195732_195735delGGTA			A4D2Q5|L8B5W8|Q5I0W9|Q7Z4I0|Q9NPT2	Frame_Shift_Del	DEL	pfam_DUF1193	p.A262fs	ENST00000313766.5	37	c.784	CCDS47522.1	7																																																																																			FAM20C	-	NULL	ENSG00000177706		0.618	FAM20C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM20C	HGNC	protein_coding	OTTHUMT00000322476.2	43	0.00	0	GGTA	NM_020223	Frame_Shift_Del	195732	195735	+1	no_errors	ENST00000313766	ensembl	human	known	69_37n	frame_shift_del	30	11.43	4	DEL	1.000	-
FAM3A	60343	genome.wustl.edu	37	X	153736153	153736153	+	Missense_Mutation	SNP	A	A	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chrX:153736153A>T	ENST00000447601.2	-	6	840	c.374T>A	c.(373-375)aTg>aAg	p.M125K	FAM3A_ENST00000393572.1_Missense_Mutation_p.M87K|FAM3A_ENST00000369641.3_Missense_Mutation_p.M132K|FAM3A_ENST00000434658.2_Intron|FAM3A_ENST00000492763.1_5'Flank|FAM3A_ENST00000359889.5_Missense_Mutation_p.M125K|FAM3A_ENST00000369643.1_Missense_Mutation_p.M125K	NM_021806.2	NP_068578.2	P98173	FAM3A_HUMAN	family with sequence similarity 3, member A	125						extracellular region (GO:0005576)				kidney(2)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TCCGGCCCACATGTCAAAGGC	0.632																																						dbGAP											0													15.0	12.0	13.0					X																	153736153		2182	4285	6467	-	-	-	SO:0001583	missense	0			X74610	CCDS35453.1, CCDS55542.1, CCDS55543.1, CCDS76060.1	Xq28	2008-07-29			ENSG00000071889	ENSG00000071889			13749	protein-coding gene	gene with protein product		300492				8733135, 8281148	Standard	NM_021806		Approved	DXS560S, 2-19, XAP-7	uc004fls.2	P98173	OTTHUMG00000013418	ENST00000447601.2:c.374T>A	X.37:g.153736153A>T	ENSP00000416146:p.Met125Lys		A6QRH6|B2RBI7|B4DFI8|D3DWX4|Q5HY76|Q96H51	Missense_Mutation	SNP	NULL	p.M125K	ENST00000447601.2	37	c.374	CCDS35453.1	X	.	.	.	.	.	.	.	.	.	.	A	26.1	4.706201	0.89018	.	.	ENSG00000071889	ENST00000359889;ENST00000369643;ENST00000447601;ENST00000369641;ENST00000393572;ENST00000426266	T;T;T;T;T;T	0.60424	0.47;0.47;0.47;2.03;0.19;1.51	5.19	5.19	0.71726	.	0.040193	0.85682	D	0.000000	T	0.78188	0.4244	M	0.88704	2.975	0.80722	D	1	D;D	0.69078	0.997;0.995	D;D	0.69142	0.962;0.962	T	0.82760	-0.0298	10	0.87932	D	0	-15.5971	13.0689	0.59048	1.0:0.0:0.0:0.0	.	139;125	D3DWX8;P98173	.;FAM3A_HUMAN	K	125;125;125;132;87;132	ENSP00000352955:M125K;ENSP00000358657:M125K;ENSP00000416146:M125K;ENSP00000358655:M132K;ENSP00000377202:M87K;ENSP00000396845:M132K	ENSP00000352955:M125K	M	-	2	0	FAM3A	153389347	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.702000	0.91338	1.726000	0.51525	0.430000	0.28490	ATG	FAM3A	-	NULL	ENSG00000071889		0.632	FAM3A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM3A	HGNC	protein_coding	OTTHUMT00000037362.2	57	0.00	0	A			153736153	153736153	-1	no_errors	ENST00000359889	ensembl	human	known	69_37n	missense	36	14.29	6	SNP	1.000	T
FAM86HP	729375	genome.wustl.edu	37	3	129822633	129822633	+	RNA	SNP	C	C	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr3:129822633C>A	ENST00000500074.2	-	0	389									family with sequence similarity 86, member H, pseudogene																		GATGGACCGTCGCTACATCCC	0.572																																						dbGAP											0																																										-	-	-			0					3q22.1	2011-07-01			ENSG00000253540	ENSG00000253540			42359	pseudogene	pseudogene							Standard	NR_024252		Approved		uc011ble.1		OTTHUMG00000159796		3.37:g.129822633C>A				RNA	SNP	-	NULL	ENST00000500074.2	37	NULL		3																																																																																			FAM86HP	-	-	ENSG00000253540		0.572	FAM86HP-002	PUTATIVE	basic	processed_transcript	FAM86HP	HGNC	pseudogene	OTTHUMT00000358348.1	160	0.62	1	C			129822633	129822633	-1	no_errors	ENST00000506448	ensembl	human	putative	69_37n	rna	56	44.66	46	SNP	0.045	A
FCHSD1	89848	genome.wustl.edu	37	5	141025453	141025453	+	Missense_Mutation	SNP	G	G	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr5:141025453G>A	ENST00000435817.2	-	13	1246	c.1196C>T	c.(1195-1197)gCt>gTt	p.A399V	FCHSD1_ENST00000522126.1_Missense_Mutation_p.A323V|FCHSD1_ENST00000522783.1_Intron|FCHSD1_ENST00000523856.1_5'UTR	NM_033449.2	NP_258260.1	Q86WN1	FCSD1_HUMAN	FCH and double SH3 domains 1	399									FCHSD1/BRAF(2)	central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCTAAGCCAGCCCCCTGCAG	0.652																																						dbGAP											0													10.0	12.0	12.0					5																	141025453		1946	4127	6073	-	-	-	SO:0001583	missense	0			AK027281	CCDS47295.1	5q31.3	2008-02-05			ENSG00000197948	ENSG00000197948			25463	protein-coding gene	gene with protein product						11214971, 15067381	Standard	NM_033449		Approved	FLJ00007	uc003llk.3	Q86WN1	OTTHUMG00000163762	ENST00000435817.2:c.1196C>T	5.37:g.141025453G>A	ENSP00000399259:p.Ala399Val		Q6UX75|Q86Y77|Q9NXX8	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_FCH,superfamily_SH3_domain,smart_FCH,smart_SH3_domain,pfscan_FCH,pfscan_SH3_domain	p.A399V	ENST00000435817.2	37	c.1196	CCDS47295.1	5	.	.	.	.	.	.	.	.	.	.	G	1.635	-0.518079	0.04171	.	.	ENSG00000197948	ENST00000435817;ENST00000522126;ENST00000518499	T;T	0.42900	1.76;0.96	5.71	3.94	0.45596	.	0.427611	0.25447	N	0.030605	T	0.39145	0.1067	N	0.16743	0.435	0.80722	D	1	D;B	0.71674	0.998;0.22	D;B	0.80764	0.994;0.052	T	0.35549	-0.9784	10	0.02654	T	1	-19.3356	9.4751	0.38867	0.2181:0.0:0.7819:0.0	.	79;399	Q86WN1-2;Q86WN1	.;FCSD1_HUMAN	V	399;323;82	ENSP00000399259:A399V;ENSP00000427796:A323V	ENSP00000399259:A399V	A	-	2	0	FCHSD1	141005637	0.982000	0.34865	0.997000	0.53966	0.196000	0.23810	3.128000	0.50492	0.771000	0.33359	0.557000	0.71058	GCT	FCHSD1	-	NULL	ENSG00000197948		0.652	FCHSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCHSD1	HGNC	protein_coding	OTTHUMT00000375282.2	65	0.00	0	G	NM_033449		141025453	141025453	-1	no_errors	ENST00000435817	ensembl	human	known	69_37n	missense	14	58.82	20	SNP	0.997	A
GALNS	2588	genome.wustl.edu	37	16	88904078	88904080	+	In_Frame_Del	DEL	TTG	TTG	-	rs367557149		TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	TTG	TTG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr16:88904078_88904080delTTG	ENST00000268695.5	-	5	604_606	c.516_518delCAA	c.(514-519)aacaag>aag	p.N172del	GALNS_ENST00000542788.1_In_Frame_Del_p.N97del|GALNS_ENST00000565364.1_5'Flank	NM_000512.4	NP_000503.1	P34059	GALNS_HUMAN	galactosamine (N-acetyl)-6-sulfatase	172	Catalytic domain.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	metal ion binding (GO:0046872)|N-acetylgalactosamine-4-sulfatase activity (GO:0003943)|N-acetylgalactosamine-6-sulfatase activity (GO:0043890)|sulfuric ester hydrolase activity (GO:0008484)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(8)	22				BRCA - Breast invasive adenocarcinoma(80;0.0496)		GGGCCTGGCCTTGTTGTCATAAG	0.591																																					GBM(129;1929 2344 25209 33204)	dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			D17629	CCDS10970.1	16q24.3	2014-07-03	2014-07-03		ENSG00000141012	ENSG00000141012	3.1.6.4	"""Arylsulfatase family"""	4122	protein-coding gene	gene with protein product	"""Morquio syndrome"", ""mucopolysaccharidosis type IVA"""	612222	"""galactosamine (N-acetyl)-6-sulfate sulfatase"""			1755850	Standard	NM_000512		Approved	GAS, GALNAC6S	uc002fly.4	P34059	OTTHUMG00000137862	ENST00000268695.5:c.516_518delCAA	16.37:g.88904081_88904083delTTG	ENSP00000268695:p.Asn172del		Q86VK3	In_Frame_Del	DEL	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.N172in_frame_del	ENST00000268695.5	37	c.518_516	CCDS10970.1	16																																																																																			GALNS	-	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000141012		0.591	GALNS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNS	HGNC	protein_coding	OTTHUMT00000269543.1	83	0.00	0	TTG			88904078	88904080	-1	no_errors	ENST00000268695	ensembl	human	known	69_37n	in_frame_del	41	10.64	5	DEL	0.581:0.999:1.000	-
GAS2L3	283431	genome.wustl.edu	37	12	100994202	100994202	+	Silent	SNP	C	C	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr12:100994202C>T	ENST00000539410.1	+	3	447	c.61C>T	c.(61-63)Ctg>Ttg	p.L21L	GAS2L3_ENST00000547754.1_Silent_p.L21L|GAS2L3_ENST00000537247.1_5'UTR|GAS2L3_ENST00000266754.5_Silent_p.L21L			Q86XJ1	GA2L3_HUMAN	growth arrest-specific 2 like 3	21					actin cytoskeleton organization (GO:0030036)|cell cycle arrest (GO:0007050)|microtubule cytoskeleton organization (GO:0000226)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	actin binding (GO:0003779)|microtubule binding (GO:0008017)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(15)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35						TCGGAGTCCTCTGACTCCCAG	0.423																																						dbGAP											0													146.0	135.0	139.0					12																	100994202		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK095594	CCDS9079.1	12q23.1	2014-09-11			ENSG00000139354	ENSG00000139354			27475	protein-coding gene	gene with protein product							Standard	NM_174942		Approved		uc001thu.3	Q86XJ1	OTTHUMG00000170439	ENST00000539410.1:c.61C>T	12.37:g.100994202C>T			B2RCN2	Silent	SNP	pfam_GAS2_dom,pfam_CH-domain,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_GAS2_dom,pfscan_CH-domain	p.L21	ENST00000539410.1	37	c.61	CCDS9079.1	12																																																																																			GAS2L3	-	NULL	ENSG00000139354		0.423	GAS2L3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GAS2L3	HGNC	protein_coding	OTTHUMT00000409143.1	35	0.00	0	C	NM_174942		100994202	100994202	+1	no_errors	ENST00000266754	ensembl	human	known	69_37n	silent	13	43.48	10	SNP	1.000	T
GOLGA6L2	283685	genome.wustl.edu	37	15	23692290	23692290	+	Missense_Mutation	SNP	C	C	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr15:23692290C>T	ENST00000567107.1	-	1	91	c.39G>A	c.(37-39)atG>atA	p.M13I	GOLGA6L2_ENST00000345070.5_5'UTR|GOLGA6L2_ENST00000312015.5_Missense_Mutation_p.M13I			Q8N9W4	GG6L2_HUMAN	golgin A6 family-like 2	13										breast(1)|endometrium(7)	8						TTTTTTCTGACATCATGGGGT	0.567																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK093463		15q11.2	2012-10-05	2010-02-12		ENSG00000174450	ENSG00000174450			26695	protein-coding gene	gene with protein product	"""cancer/testis antigen 105"""		"""golgi autoantigen, golgin subfamily a, 6-like 2"""				Standard	XM_002343322		Approved	CT105, FLJ36144	uc021sfy.1	Q8N9W4	OTTHUMG00000176417	ENST00000567107.1:c.39G>A	15.37:g.23692290C>T	ENSP00000454407:p.Met13Ile		A1L301	Missense_Mutation	SNP	NULL	p.M13I	ENST00000567107.1	37	c.39		15	.	.	.	.	.	.	.	.	.	.	-	5.465	0.270924	0.10349	.	.	ENSG00000174450	ENST00000312015	T	0.25579	1.79	.	.	.	.	.	.	.	.	T	0.18130	0.0435	.	.	.	0.09310	N	0.999993	B	0.14805	0.011	B	0.23018	0.043	T	0.29397	-1.0013	6	0.66056	D	0.02	.	.	.	.	.	13	Q8N9W4	GG6L2_HUMAN	I	13	ENSP00000307928:M13I	ENSP00000307928:M13I	M	-	3	0	GOLGA6L2	21243383	0.401000	0.25303	0.090000	0.20809	0.091000	0.18340	0.876000	0.28092	0.161000	0.19458	0.163000	0.16589	ATG	GOLGA6L2	-	NULL	ENSG00000174450		0.567	GOLGA6L2-002	PUTATIVE	basic|appris_candidate_longest	protein_coding	GOLGA6L2	HGNC	protein_coding	OTTHUMT00000431937.1	67	0.00	0	C	NM_182561		23692290	23692290	-1	no_errors	ENST00000566571	ensembl	human	known	69_37n	missense	12	25.00	4	SNP	0.099	T
GPR133	283383	genome.wustl.edu	37	12	131590371	131590371	+	Missense_Mutation	SNP	G	G	T	rs149693576	byFrequency	TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr12:131590371G>T	ENST00000261654.5	+	17	2407	c.1848G>T	c.(1846-1848)caG>caT	p.Q616H	GPR133_ENST00000376682.4_Missense_Mutation_p.Q302H|GPR133_ENST00000535015.1_Missense_Mutation_p.Q648H|GPR133_ENST00000543617.1_Missense_Mutation_p.Q135H	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	616					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		TGGTGGCCCAGGTCCTGCTGC	0.652																																						dbGAP											0													154.0	101.0	119.0					12																	131590371		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.1848G>T	12.37:g.131590371G>T	ENSP00000261654:p.Gln616His		B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.Q616H	ENST00000261654.5	37	c.1848	CCDS9272.1	12	.	.	.	.	.	.	.	.	.	.	G	23.0	4.362863	0.82353	.	.	ENSG00000111452	ENST00000261654;ENST00000535015;ENST00000376682;ENST00000543617	T;T;T;T	0.37058	1.23;1.29;1.22;1.22	4.45	3.55	0.40652	GPCR, family 2-like (1);	0.156843	0.43747	D	0.000540	T	0.47116	0.1428	L	0.41710	1.295	0.49130	D	0.999759	D;D;D	0.65815	0.995;0.984;0.994	D;P;D	0.71870	0.975;0.881;0.942	T	0.31586	-0.9938	10	0.40728	T	0.16	.	11.5629	0.50788	0.0881:0.0:0.9119:0.0	.	648;135;616	B7ZLF7;Q6QNK2-3;Q6QNK2	.;.;GP133_HUMAN	H	616;648;302;135	ENSP00000261654:Q616H;ENSP00000444425:Q648H;ENSP00000365872:Q302H;ENSP00000438021:Q135H	ENSP00000261654:Q616H	Q	+	3	2	GPR133	130156324	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	4.754000	0.62191	0.867000	0.35654	0.561000	0.74099	CAG	GPR133	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	ENSG00000111452		0.652	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR133	HGNC	protein_coding	OTTHUMT00000399356.1	61	0.00	0	G	NM_198827		131590371	131590371	+1	no_errors	ENST00000261654	ensembl	human	known	69_37n	missense	7	70.83	17	SNP	1.000	T
GRIK3	2899	genome.wustl.edu	37	1	37356521	37356521	+	Splice_Site	SNP	C	C	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr1:37356521C>A	ENST00000373091.3	-	2	308	c.292G>T	c.(292-294)Gcc>Tcc	p.A98S	GRIK3_ENST00000373093.4_Splice_Site_p.A98S	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	98					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)			breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				GCACACTCACCCTTTTTGGTC	0.537																																						dbGAP											0													192.0	144.0	160.0					1																	37356521		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.292+1G>T	1.37:g.37356521C>A			A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.A98S	ENST00000373091.3	37	c.292	CCDS416.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.384816	0.95967	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.28454	1.61;1.61	5.83	5.83	0.93111	Extracellular ligand-binding receptor (1);	0.064392	0.64402	D	0.000009	T	0.58708	0.2141	M	0.79258	2.445	0.80722	D	1	B;B	0.30709	0.291;0.139	P;P	0.52881	0.712;0.712	T	0.51434	-0.8706	9	.	.	.	.	20.1224	0.97967	0.0:1.0:0.0:0.0	.	98;98	A9Z1Z8;Q13003	.;GRIK3_HUMAN	S	98	ENSP00000362183:A98S;ENSP00000362185:A98S	.	A	-	1	0	GRIK3	37129108	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.811000	0.86092	2.749000	0.94314	0.650000	0.86243	GCC	GRIK3	-	pfam_ANF_lig-bd_rcpt	ENSG00000163873		0.537	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK3	HGNC	protein_coding	OTTHUMT00000012053.1	95	0.00	0	C	NM_000831	Missense_Mutation	37356521	37356521	-1	no_errors	ENST00000373091	ensembl	human	known	69_37n	missense	53	14.52	9	SNP	1.000	A
GSDMA	284110	genome.wustl.edu	37	17	38132225	38132225	+	Missense_Mutation	SNP	A	A	C			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr17:38132225A>C	ENST00000301659.4	+	11	1188	c.1070A>C	c.(1069-1071)aAg>aCg	p.K357T		NM_178171.4	NP_835465.2	Q96QA5	GSDMA_HUMAN	gasdermin A	357					apoptotic process (GO:0006915)	perinuclear region of cytoplasm (GO:0048471)				NS(1)|endometrium(2)|large_intestine(3)|lung(1)	7						ATGGAGAAAAAGATCCTACCC	0.507																																						dbGAP											0													53.0	54.0	54.0					17																	38132225		1909	4142	6051	-	-	-	SO:0001583	missense	0			AB093591	CCDS45669.1	17q21.2	2008-07-31	2008-07-31	2008-07-31		ENSG00000167914			13311	protein-coding gene	gene with protein product		611218	"""gasdermin"", ""gasdermin 1"""	GSDM, GSDM1		12883658, 15010812, 17350798	Standard	NM_178171		Approved	FLJ39120	uc002htl.1	Q96QA5		ENST00000301659.4:c.1070A>C	17.37:g.38132225A>C	ENSP00000301659:p.Lys357Thr		Q32MC5|Q86VE7|Q8N1M6	Missense_Mutation	SNP	pfam_Gasdermin	p.K357T	ENST00000301659.4	37	c.1070	CCDS45669.1	17	.	.	.	.	.	.	.	.	.	.	A	17.03	3.283964	0.59867	.	.	ENSG00000167914	ENST00000301659	T	0.22336	1.96	5.96	5.96	0.96718	.	0.232346	0.38436	N	0.001686	T	0.30386	0.0763	L	0.46741	1.465	0.34249	D	0.678532	P	0.41748	0.761	P	0.48368	0.575	T	0.42155	-0.9468	10	0.62326	D	0.03	-13.2594	15.0195	0.71617	1.0:0.0:0.0:0.0	.	357	Q96QA5	GSDMA_HUMAN	T	357	ENSP00000301659:K357T	ENSP00000301659:K357T	K	+	2	0	GSDMA	35385751	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	5.496000	0.66918	2.285000	0.76669	0.533000	0.62120	AAG	GSDMA	-	pfam_Gasdermin	ENSG00000167914		0.507	GSDMA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSDMA	HGNC	protein_coding	OTTHUMT00000446847.1	43	0.00	0	A	NM_178171		38132225	38132225	+1	no_errors	ENST00000301659	ensembl	human	known	69_37n	missense	14	22.22	4	SNP	1.000	C
GSPT1	2935	genome.wustl.edu	37	16	11979099	11979099	+	Missense_Mutation	SNP	A	A	C			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr16:11979099A>C	ENST00000563468.1	-	8	898	c.872T>G	c.(871-873)tTg>tGg	p.L291W	RP11-166B2.8_ENST00000574364.1_RNA|GSPT1_ENST00000564790.1_5'UTR|GSPT1_ENST00000434724.2_Missense_Mutation_p.L429W|RP11-166B2.3_ENST00000568144.1_RNA|GSPT1_ENST00000439887.2_Missense_Mutation_p.L428W|GSPT1_ENST00000420576.2_Missense_Mutation_p.L291W			P15170	ERF3A_HUMAN	G1 to S phase transition 1	291	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				G1/S transition of mitotic cell cycle (GO:0000082)|GTP catabolic process (GO:0006184)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein methylation (GO:0006479)|translational termination (GO:0006415)	intracellular (GO:0005622)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation release factor activity (GO:0003747)			breast(1)|central_nervous_system(1)|kidney(4)|lung(4)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	14						GAAGTTCGGCAAATTATCCAG	0.368																																						dbGAP											0													73.0	66.0	68.0					16																	11979099		1894	4167	6061	-	-	-	SO:0001583	missense	0			BC008391	CCDS45412.1, CCDS45413.1, CCDS45414.1	16p13.1	2008-08-01							4621	protein-coding gene	gene with protein product		139259				2511002, 17700517	Standard	NM_002094		Approved	GST1, ETF3A, eRF3a	uc002dbt.3	P15170		ENST00000563468.1:c.872T>G	16.37:g.11979099A>C	ENSP00000454351:p.Leu291Trp		J3KQG6|Q96GF2	Missense_Mutation	SNP	pfam_ProtSyn_GTP-bd,pfam_Transl_elong_EFTu/EF1A_C,pfam_Transl_elong_EFTu/EF1A_2,pfam_Ataxin-2_C,superfamily_Transl_elong_EF1A/Init_IF2_C,superfamily_Transl_elong_init/rib_B-barrel,prints_ProtSyn_GTP-bd	p.L429W	ENST00000563468.1	37	c.1286	CCDS45414.1	16	.	.	.	.	.	.	.	.	.	.	A	24.3	4.521738	0.85600	.	.	ENSG00000103342	ENST00000434724;ENST00000439887;ENST00000420576	T;T;T	0.53423	1.14;1.14;0.62	5.23	5.23	0.72850	.	0.000000	0.64402	U	0.000002	T	0.75925	0.3916	M	0.93550	3.43	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.85130	0.997;0.997;0.994	T	0.82886	-0.0235	10	0.87932	D	0	-7.7885	13.9695	0.64230	1.0:0.0:0.0:0.0	.	428;425;291	E7EQZ3;Q96GF2;P15170	.;.;ERF3A_HUMAN	W	429;428;291	ENSP00000398131:L429W;ENSP00000408399:L428W;ENSP00000399539:L291W	ENSP00000399539:L291W	L	-	2	0	GSPT1	11886600	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.962000	0.93254	1.987000	0.57996	0.459000	0.35465	TTG	GSPT1	-	NULL	ENSG00000103342		0.368	GSPT1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	GSPT1	HGNC	protein_coding	OTTHUMT00000421513.1	36	0.00	0	A	NM_002094		11979099	11979099	-1	no_errors	ENST00000434724	ensembl	human	known	69_37n	missense	37	17.78	8	SNP	1.000	C
H19	283120	genome.wustl.edu	37	11	2018168	2018168	+	RNA	SNP	C	C	T	rs2067051	byFrequency	TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr11:2018168C>T	ENST00000390168.4	-	0	0					NR_030533.1				H19, imprinted maternally expressed transcript (non-protein coding)																		CTCCTGGTGACGTCCTGCTGC	0.721									Beckwith-Wiedemann syndrome		OREG0003762|OREG0003763	type=REGULATORY REGION|Gene=AF118081|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay|type=REGULATORY REGION|Gene=H19|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	c|||	1434	0.286342	0.0567	0.4063	5008	,	,		14074	0.3036		0.508	False		,,,				2504	0.2658					dbGAP											0																																										-	-	-			0	Familial Cancer Database	BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AF087017		11p15.5	2012-10-19	2008-06-04		ENSG00000130600	ENSG00000130600		"""Long non-coding RNAs"", ""-"""	4713	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 8"", ""long intergenic non-protein coding RNA 8"""	103280	"""H19, imprinted maternally expressed untranslated mRNA"""			2595451, 1688465	Standard	NR_002196		Approved	D11S813E, ASM, ASM1, NCRNA00008, LINC00008	uc021qby.1		OTTHUMG00000012477		11.37:g.2018168C>T		600		RNA	SNP	-	NULL	ENST00000390168.4	37	NULL		11																																																																																			H19	-	-	ENSG00000130600		0.721	H19-201	KNOWN	basic	miRNA	H19	HGNC	processed_transcript		56	0.00	0	C	NR_002196		2018168	2018168	-1	no_errors	ENST00000411754	ensembl	human	known	69_37n	rna	43	10.42	5	SNP	0.000	T
HERC2	8924	genome.wustl.edu	37	15	28386674	28386674	+	Silent	SNP	G	G	T	rs191221988		TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr15:28386674G>T	ENST00000261609.7	-	78	12027	c.11919C>A	c.(11917-11919)gtC>gtA	p.V3973V		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2									p.V3973V(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TGGGAACTTTGACTTTTGCGC	0.542																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											94.0	91.0	92.0					15																	28386674		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.11919C>A	15.37:g.28386674G>T				Silent	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5,superfamily_UBA-like,superfamily_CUB,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5,prints_Reg_chr_condens	p.V3973	ENST00000261609.7	37	c.11919	CCDS10021.1	15																																																																																			HERC2	-	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,smart_Beta-propeller_rpt_TECPR,pfscan_Reg_chr_condens	ENSG00000128731		0.542	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	77	0.00	0	G	NM_004667		28386674	28386674	-1	no_errors	ENST00000261609	ensembl	human	known	69_37n	silent	22	37.14	13	SNP	0.101	T
HIVEP2	3097	genome.wustl.edu	37	6	143092672	143092672	+	Silent	SNP	C	C	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr6:143092672C>G	ENST00000367604.1	-	4	3843	c.3204G>C	c.(3202-3204)acG>acC	p.T1068T	HIVEP2_ENST00000012134.2_Silent_p.T1068T|HIVEP2_ENST00000367603.2_Silent_p.T1068T			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1068					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		ACGGTGATACCGTGGAGGCTG	0.557																																					Esophageal Squamous(107;843 1510 13293 16805 42198)	dbGAP											0													34.0	36.0	36.0					6																	143092672		2009	4167	6176	-	-	-	SO:0001819	synonymous_variant	0			M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.3204G>C	6.37:g.143092672C>G			Q02646|Q5THT5|Q9NS05	Silent	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T1068	ENST00000367604.1	37	c.3204	CCDS43510.1	6																																																																																			HIVEP2	-	NULL	ENSG00000010818		0.557	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP2	HGNC	protein_coding	OTTHUMT00000042495.1	49	0.00	0	C			143092672	143092672	-1	no_errors	ENST00000012134	ensembl	human	known	69_37n	silent	19	47.37	18	SNP	0.000	G
ICAM2	3384	genome.wustl.edu	37	17	62083991	62083991	+	Splice_Site	SNP	C	C	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr17:62083991C>A	ENST00000412356.1	-	3	415	c.61G>T	c.(61-63)Gga>Tga	p.G21*	ICAM2_ENST00000578379.1_De_novo_Start_OutOfFrame|ICAM2_ENST00000579788.1_Splice_Site_p.G21*|ICAM2_ENST00000418105.1_Splice_Site_p.G21*|ICAM2_ENST00000581417.1_5'UTR|ICAM2_ENST00000578892.1_Splice_Site_p.G21*|ICAM2_ENST00000579687.1_Splice_Site_p.G21*|ICAM2_ENST00000449662.2_Splice_Site_p.G21*	NM_001099786.1	NP_001093256.1	P13598	ICAM2_HUMAN	intercellular adhesion molecule 2	21					extracellular matrix organization (GO:0030198)|regulation of immune response (GO:0050776)|single organismal cell-cell adhesion (GO:0016337)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|uropod (GO:0001931)	integrin binding (GO:0005178)			large_intestine(1)|lung(2)|ovary(1)|skin(2)	6						ACTGGCTTACCTGGACAGCAG	0.597																																						dbGAP											0													63.0	55.0	58.0					17																	62083991		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS11657.1	17q23.3	2014-01-30			ENSG00000108622	ENSG00000108622		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	5345	protein-coding gene	gene with protein product		146630				1769660	Standard	NM_001099786		Approved	CD102	uc002jdx.4	P13598		ENST00000412356.1:c.61+1G>T	17.37:g.62083991C>A			Q14600	Nonsense_Mutation	SNP	pfam_ICAM_N,prints_ICAM_VCAM_N,prints_ICAM	p.G21*	ENST00000412356.1	37	c.61	CCDS11657.1	17	.	.	.	.	.	.	.	.	.	.	C	25.1	4.605502	0.87157	.	.	ENSG00000108622	ENST00000412356;ENST00000418105;ENST00000449662	.	.	.	4.11	4.11	0.48088	.	0.300926	0.27109	N	0.020883	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-36.4515	12.0426	0.53462	0.0:1.0:0.0:0.0	.	.	.	.	X	21	.	.	G	-	1	0	ICAM2	59437723	1.000000	0.71417	0.999000	0.59377	0.030000	0.12068	3.269000	0.51592	2.279000	0.76181	0.555000	0.69702	GGA	ICAM2	-	pfam_ICAM_N	ENSG00000108622		0.597	ICAM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ICAM2	HGNC	protein_coding	OTTHUMT00000443687.1	32	0.00	0	C		Nonsense_Mutation	62083991	62083991	-1	no_errors	ENST00000412356	ensembl	human	known	69_37n	nonsense	6	70.00	14	SNP	0.999	A
IGLV11-55	28770	genome.wustl.edu	37	22	22556320	22556320	+	RNA	SNP	G	G	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr22:22556320G>T	ENST00000390286.2	+	0	146									immunoglobulin lambda variable 11-55 (non-functional)																		ACCCTGAGCAGTGACCTCAGT	0.577											OREG0026354	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													50.0	56.0	54.0					22																	22556320		2012	4196	6208	-	-	-			0			D86996		22q11.2	2012-02-08	2008-09-15		ENSG00000211641	ENSG00000211641		"""Immunoglobulins / IGL locus"""	5886	other	immunoglobulin gene			"""immunoglobulin lambda variable 11-55"""				Standard	NG_000002		Approved				OTTHUMG00000150995		22.37:g.22556320G>T		757		Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.S45I	ENST00000390286.2	37	c.134		22																																																																																			IGLV11-55	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211641		0.577	IGLV11-55-001	KNOWN	basic|appris_principal	IG_V_gene	IGLV11-55	HGNC	IG_V_gene	OTTHUMT00000320860.3	27	0.00	0	G	NG_000002		22556320	22556320	+1	no_errors	ENST00000390286	ensembl	human	known	69_37n	missense	12	60.00	18	SNP	0.650	T
IGSF10	285313	genome.wustl.edu	37	3	151164277	151164277	+	Silent	SNP	A	A	C			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr3:151164277A>C	ENST00000282466.3	-	4	3491	c.3492T>G	c.(3490-3492)cgT>cgG	p.R1164R		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1164					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TGCTAGACACACGTGGGTAAC	0.428																																						dbGAP											0													310.0	291.0	298.0					3																	151164277		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.3492T>G	3.37:g.151164277A>C			Q86YJ9|Q8N772|Q8NA84	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.R1164	ENST00000282466.3	37	c.3492	CCDS3160.1	3																																																																																			IGSF10	-	NULL	ENSG00000152580		0.428	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF10	HGNC	protein_coding	OTTHUMT00000357782.1	123	0.00	0	A	NM_178822		151164277	151164277	-1	no_errors	ENST00000282466	ensembl	human	known	69_37n	silent	82	43.15	63	SNP	0.000	C
INMT	11185	genome.wustl.edu	37	7	30795547	30795547	+	3'UTR	SNP	A	A	G	rs6970396	byFrequency	TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr7:30795547A>G	ENST00000013222.5	+	0	888				INMT-FAM188B_ENST00000458257.1_Intron|INMT_ENST00000484180.1_3'UTR	NM_001199219.1|NM_006774.4	NP_001186148.1|NP_006765.4	O95050	INMT_HUMAN	indolethylamine N-methyltransferase						amine metabolic process (GO:0009308)|methylation (GO:0032259)|response to toxic substance (GO:0009636)	cytosol (GO:0005829)	amine N-methyltransferase activity (GO:0030748)|thioether S-methyltransferase activity (GO:0004790)			kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|stomach(1)	23						aggaatggatactgtctaaca	0.478													A|||	3855	0.769768	0.5393	0.8948	5008	,	,		21653	0.8423		0.8986	False		,,,				2504	0.7853					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS5430.1, CCDS56479.1	7p14.3	2011-08-30			ENSG00000241644	ENSG00000241644	2.1.1.49		6069	protein-coding gene	gene with protein product		604854				10552930	Standard	NM_001199219		Approved		uc003tbs.1	O95050	OTTHUMG00000167163	ENST00000013222.5:c.*80A>G	7.37:g.30795547A>G			B8ZZ69|Q3KP49|Q9P1Y2|Q9UBY4|Q9UHQ0	RNA	SNP	-	NULL	ENST00000013222.5	37	NULL	CCDS5430.1	7																																																																																			INMT	-	-	ENSG00000241644		0.478	INMT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INMT	HGNC	protein_coding	OTTHUMT00000214993.3	9	0.00	0	A	NM_006774		30795547	30795547	+1	no_errors	ENST00000484180	ensembl	human	known	69_37n	rna	7	41.67	5	SNP	0.002	G
IQGAP3	128239	genome.wustl.edu	37	1	156536205	156536205	+	Missense_Mutation	SNP	C	C	T	rs148959897		TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr1:156536205C>T	ENST00000361170.2	-	3	269	c.259G>A	c.(259-261)Gat>Aat	p.D87N		NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	87	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TGCTCCACATCGTAGATCTTC	0.567																																						dbGAP											0													63.0	57.0	59.0					1																	156536205		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.259G>A	1.37:g.156536205C>T	ENSP00000354451:p.Asp87Asn		Q5T3H8	Missense_Mutation	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_RasGAP	p.D87N	ENST00000361170.2	37	c.259	CCDS1144.1	1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.794412	0.90453	.	.	ENSG00000183856	ENST00000361170	T	0.03212	4.01	5.43	4.52	0.55395	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	T	0.08626	0.0214	L	0.58101	1.795	0.53688	D	0.999978	D	0.89917	1.0	D	0.79784	0.993	T	0.02437	-1.1159	10	0.72032	D	0.01	-8.9847	14.4222	0.67190	0.1486:0.8513:0.0:0.0	.	87	Q86VI3	IQGA3_HUMAN	N	87	ENSP00000354451:D87N	ENSP00000354451:D87N	D	-	1	0	IQGAP3	154802829	1.000000	0.71417	0.308000	0.25141	0.931000	0.56810	4.864000	0.62990	1.277000	0.44412	0.563000	0.77884	GAT	IQGAP3	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000183856		0.567	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP3	HGNC	protein_coding	OTTHUMT00000080657.1	25	0.00	0	C	NM_178229		156536205	156536205	-1	no_errors	ENST00000361170	ensembl	human	known	69_37n	missense	18	40.00	12	SNP	1.000	T
KCNJ3	3760	genome.wustl.edu	37	2	155711382	155711382	+	Missense_Mutation	SNP	C	C	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr2:155711382C>A	ENST00000295101.2	+	3	1540	c.1063C>A	c.(1063-1065)Cct>Act	p.P355T	KCNJ3_ENST00000544049.1_3'UTR|KCNJ3_ENST00000493505.1_3'UTR	NM_001260509.1|NM_002239.3	NP_001247438.1|NP_002230.1	P48549	KCNJ3_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 3	355					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to electrical stimulus (GO:0051602)|synaptic transmission (GO:0007268)	external side of plasma membrane (GO:0009897)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)			breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(30)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	54					Halothane(DB01159)	CCCCACCCCACCTTACAGTGT	0.418																																						dbGAP											0													111.0	111.0	111.0					2																	155711382		2203	4300	6503	-	-	-	SO:0001583	missense	0			U50964	CCDS2200.1, CCDS58733.1	2q24.1	2011-07-05			ENSG00000162989	ENSG00000162989		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6264	protein-coding gene	gene with protein product		601534				8088798, 16382105	Standard	NM_002239		Approved	Kir3.1, GIRK1, KGA	uc002tyv.2	P48549	OTTHUMG00000131937	ENST00000295101.2:c.1063C>A	2.37:g.155711382C>A	ENSP00000295101:p.Pro355Thr		B4DEW7|Q8TBI0	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir3.1,prints_K_chnl_inward-rec_Kir_Cr2	p.P355T	ENST00000295101.2	37	c.1063	CCDS2200.1	2	.	.	.	.	.	.	.	.	.	.	C	14.16	2.453508	0.43531	.	.	ENSG00000162989	ENST00000295101	D	0.93426	-3.22	5.7	5.7	0.88788	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.85579	0.5729	N	0.04705	-0.18	0.80722	D	1	B	0.18741	0.03	B	0.21151	0.033	T	0.80743	-0.1246	10	0.14252	T	0.57	.	18.8359	0.92162	0.0:1.0:0.0:0.0	.	355	P48549	IRK3_HUMAN	T	355	ENSP00000295101:P355T	ENSP00000295101:P355T	P	+	1	0	KCNJ3	155419628	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.704000	0.92352	0.650000	0.86243	CCT	KCNJ3	-	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir	ENSG00000162989		0.418	KCNJ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ3	HGNC	protein_coding	OTTHUMT00000254890.2	69	0.00	0	C	NM_002239		155711382	155711382	+1	no_errors	ENST00000295101	ensembl	human	known	69_37n	missense	52	13.33	8	SNP	1.000	A
KIAA0430	9665	genome.wustl.edu	37	16	15696471	15696472	+	Intron	INS	-	-	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr16:15696471_15696472insG	ENST00000396368.3	-	23	4620				KIAA0430_ENST00000547936.1_Intron|KIAA0430_ENST00000548025.1_Intron|KIAA0430_ENST00000602337.1_Intron|KIAA0430_ENST00000344181.3_Frame_Shift_Ins_p.P1116fs|KIAA0430_ENST00000551742.1_Intron|KIAA0430_ENST00000540441.2_Intron	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430						double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						agaagaaaggaggaggaggaag	0.416																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.4414-411->C	16.37:g.15696473_15696473dupG			A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Frame_Shift_Ins	INS	pfam_Limkain_b1_cons_dom,pfam_NYN_limkain-b1,smart_RRM_dom,pfscan_RRM_dom	p.P1117fs	ENST00000396368.3	37	c.3348_3347	CCDS10562.2	16																																																																																			KIAA0430	-	NULL	ENSG00000166783		0.416	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0430	HGNC	protein_coding	OTTHUMT00000252131.2	14	0.00	0	-	NM_014647		15696471	15696472	-1	no_errors	ENST00000344181	ensembl	human	known	69_37n	frame_shift_ins	13	27.78	5	INS	0.008:0.011	G
LGALS3BP	3959	genome.wustl.edu	37	17	76972047	76972047	+	Splice_Site	SNP	C	C	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr17:76972047C>G	ENST00000262776.3	-	3	552	c.244G>C	c.(244-246)Gga>Cga	p.G82R	LGALS3BP_ENST00000591778.1_Splice_Site_p.G82R|LGALS3BP_ENST00000585407.1_Splice_Site_p.G82R	NM_005567.3	NP_005558.1	Q08380	LG3BP_HUMAN	lectin, galactoside-binding, soluble, 3 binding protein	82	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.				cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|central_nervous_system(5)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17			BRCA - Breast invasive adenocarcinoma(99;0.0677)|OV - Ovarian serous cystadenocarcinoma(97;0.139)			CAGGCCCTACCTTGCCCGAAG	0.622																																					GBM(89;1105 1755 18102 21513)	dbGAP											0													30.0	25.0	27.0					17																	76972047		2202	4300	6502	-	-	-	SO:0001630	splice_region_variant	0			L13210	CCDS11759.1	17q25	2014-07-09				ENSG00000108679		"""BTB/POZ domain containing"", ""Endogenous ligands"""	6564	protein-coding gene	gene with protein product	"""L3 antigen"", ""Mac-2-binding protein"", ""serum protein 90K"", ""transport and golgi organization 10 homolog B (Drosophila)"""	600626				7698018, 8034587, 8390986	Standard	NM_005567		Approved	MAC-2-BP, 90K, BTBD17B, TANGO10B, M2BP, gp90, CyCAP	uc002jwh.3	Q08380		ENST00000262776.3:c.244+1G>C	17.37:g.76972047C>G			Q7M4S0|Q9UCH8|Q9UCH9|Q9UCI0	Missense_Mutation	SNP	pfam_Srcr_rcpt,pfam_BACK,superfamily_Srcr_rcpt-rel,superfamily_BTB/POZ_fold,smart_Srcr_rcpt-rel,smart_BACK,prints_Srcr_rcpt,pfscan_BTB/POZ-like,pfscan_Srcr_rcpt	p.G82R	ENST00000262776.3	37	c.244	CCDS11759.1	17	.	.	.	.	.	.	.	.	.	.	C	16.13	3.035877	0.54896	.	.	ENSG00000108679	ENST00000262776;ENST00000536190	T	0.72167	-0.63	3.54	3.54	0.40534	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.000000	0.35124	N	0.003438	D	0.87325	0.6149	H	0.94658	3.565	0.53688	D	0.999979	D	0.89917	1.0	D	0.97110	1.0	D	0.90536	0.4499	9	.	.	.	-15.0428	13.4159	0.60968	0.0:1.0:0.0:0.0	.	82	Q08380	LG3BP_HUMAN	R	82	ENSP00000262776:G82R	.	G	-	1	0	LGALS3BP	74483642	1.000000	0.71417	0.980000	0.43619	0.011000	0.07611	6.284000	0.72652	2.290000	0.77057	0.655000	0.94253	GGA	LGALS3BP	-	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt	ENSG00000108679		0.622	LGALS3BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGALS3BP	HGNC	protein_coding	OTTHUMT00000437785.3	37	0.00	0	C	NM_005567	Missense_Mutation	76972047	76972047	-1	no_errors	ENST00000262776	ensembl	human	known	69_37n	missense	39	20.41	10	SNP	1.000	G
LGR5	8549	genome.wustl.edu	37	12	71965338	71965338	+	Missense_Mutation	SNP	T	T	C			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr12:71965338T>C	ENST00000266674.5	+	12	1426	c.1115T>C	c.(1114-1116)gTc>gCc	p.V372A	LGR5_ENST00000540815.2_Missense_Mutation_p.V348A|LGR5_ENST00000536515.1_Missense_Mutation_p.V300A			O75473	LGR5_HUMAN	leucine-rich repeat containing G protein-coupled receptor 5	372					G-protein coupled receptor signaling pathway (GO:0007186)|inner ear development (GO:0048839)|positive regulation of canonical Wnt signaling pathway (GO:0090263)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)		NUP107/LGR5(2)	endometrium(2)|kidney(3)|large_intestine(2)|lung(24)|ovary(1)|pancreas(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	48						AGTTTTTCAGTCTGCCAAAAG	0.338																																						dbGAP											0													100.0	96.0	98.0					12																	71965338		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF062006	CCDS9000.1, CCDS61194.1, CCDS61195.1	12q22-q23	2012-08-21	2011-01-25	2004-11-12				"""GPCR / Class A : Orphans"""	4504	protein-coding gene	gene with protein product		606667	"""G protein-coupled receptor 49"", ""leucine-rich repeat-containing G protein-coupled receptor 5"""	GPR67, GPR49		9642114	Standard	NM_003667		Approved	HG38, FEX	uc001swl.4	O75473	OTTHUMG00000169543	ENST00000266674.5:c.1115T>C	12.37:g.71965338T>C	ENSP00000266674:p.Val372Ala		D8MCT0|Q4VAM0|Q4VAM2|Q9UP75	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_7TM_GPCR_Rhodpsn,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,pfscan_GPCR_Rhodpsn_supfam,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn	p.V372A	ENST00000266674.5	37	c.1115	CCDS9000.1	12	.	.	.	.	.	.	.	.	.	.	T	8.400	0.841741	0.16963	.	.	ENSG00000139292	ENST00000266674;ENST00000451585;ENST00000536515;ENST00000540815	T;T;T	0.39592	1.07;1.07;1.07	5.67	-0.364	0.12553	.	0.968389	0.08505	N	0.935845	T	0.15349	0.0370	N	0.02539	-0.55	0.21802	N	0.999532	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.29212	-1.0019	10	0.12766	T	0.61	.	6.0316	0.19683	0.0:0.2817:0.4543:0.264	.	348;372	O75473-2;O75473	.;LGR5_HUMAN	A	372;372;300;348	ENSP00000266674:V372A;ENSP00000443033:V300A;ENSP00000441035:V348A	ENSP00000266674:V372A	V	+	2	0	LGR5	70251605	0.693000	0.27728	0.991000	0.47740	0.981000	0.71138	0.205000	0.17356	-0.050000	0.13356	0.533000	0.62120	GTC	LGR5	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000139292		0.338	LGR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGR5	HGNC	protein_coding	OTTHUMT00000404744.1	37	0.00	0	T	NM_003667		71965338	71965338	+1	no_errors	ENST00000266674	ensembl	human	known	69_37n	missense	30	31.11	14	SNP	0.977	C
LINC00087	644596	genome.wustl.edu	37	X	134232581	134232581	+	lincRNA	SNP	G	G	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chrX:134232581G>T	ENST00000433425.2	-	0	83					NR_024493.1				long intergenic non-protein coding RNA 87																		GCCTCGGGCCGCCGCCGAGCG	0.736																																						dbGAP											0																																										-	-	-			0					Xq26.3	2012-10-12	2011-08-11	2011-08-11	ENSG00000196972	ENSG00000196972		"""Long non-coding RNAs"""	34500	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 87"""	NCRNA00087			Standard	NR_024493		Approved	RP11-85L21.2	uc004eyh.2		OTTHUMG00000022468		X.37:g.134232581G>T				RNA	SNP	-	NULL	ENST00000433425.2	37	NULL		X																																																																																			LINC00087	-	-	ENSG00000196972		0.736	LINC00087-002	KNOWN	basic	lincRNA	LINC00087	HGNC	lincRNA	OTTHUMT00000058396.2	70	0.00	0	G			134232581	134232581	-1	no_errors	ENST00000433425	ensembl	human	known	69_37n	rna	13	27.78	5	SNP	0.219	T
LINGO2	158038	genome.wustl.edu	37	9	27949115	27949115	+	Missense_Mutation	SNP	T	T	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr9:27949115T>A	ENST00000379992.2	-	6	2004	c.1555A>T	c.(1555-1557)Acc>Tcc	p.T519S	LINGO2_ENST00000308675.3_Missense_Mutation_p.T519S	NM_152570.2	NP_689783.1	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	519						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	44	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		TTGGAGTCGGTCATGTACATA	0.448																																						dbGAP											0													173.0	164.0	167.0					9																	27949115		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL353746	CCDS6524.1	9p21.2	2013-01-11	2007-02-01	2007-02-01	ENSG00000174482	ENSG00000174482		"""Immunoglobulin superfamily / I-set domain containing"""	21207	protein-coding gene	gene with protein product		609793	"""leucine rich repeat neuronal 6C"""	LRRN6C		14686891	Standard	NM_152570		Approved	LERN3	uc003zqu.2	Q7L985	OTTHUMG00000019721	ENST00000379992.2:c.1555A>T	9.37:g.27949115T>A	ENSP00000369328:p.Thr519Ser		A8K4K7|B2RPM5|Q6ZMD0	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Ig_V-set,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.T519S	ENST00000379992.2	37	c.1555	CCDS6524.1	9	.	.	.	.	.	.	.	.	.	.	T	0.147	-1.095307	0.01858	.	.	ENSG00000174482	ENST00000379992;ENST00000308675	T;T	0.56611	0.45;0.45	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.30572	0.0769	N	0.08118	0	0.58432	D	0.99999	B	0.13145	0.007	B	0.12837	0.008	T	0.19516	-1.0303	9	.	.	.	.	11.3047	0.49327	0.1358:0.0:0.0:0.8642	.	519	Q7L985	LIGO2_HUMAN	S	519	ENSP00000369328:T519S;ENSP00000310126:T519S	.	T	-	1	0	LINGO2	27939115	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.639000	0.46570	2.235000	0.73313	0.533000	0.62120	ACC	LINGO2	-	NULL	ENSG00000174482		0.448	LINGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO2	HGNC	protein_coding	OTTHUMT00000051978.2	74	0.00	0	T	NM_152570		27949115	27949115	-1	no_errors	ENST00000308675	ensembl	human	known	69_37n	missense	19	32.14	9	SNP	1.000	A
LPIN3	64900	genome.wustl.edu	37	20	39977740	39977740	+	Nonsense_Mutation	SNP	T	T	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr20:39977740T>A	ENST00000373257.3	+	5	657	c.566T>A	c.(565-567)tTg>tAg	p.L189*		NM_022896.1	NP_075047.1	Q9BQK8	LPIN3_HUMAN	lipin 3	189					fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(7)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Myeloproliferative disorder(115;0.000739)				AGTGTCCAGTTGGAAGAGAAG	0.592																																						dbGAP											0													112.0	110.0	111.0					20																	39977740		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AL132654	CCDS33469.1	20q11.2-q12	2006-04-04	2002-05-23		ENSG00000132793	ENSG00000132793			14451	protein-coding gene	gene with protein product		605520	"""lipin 3-like"""	LIPN3L		11138012	Standard	XM_005260515		Approved	SMP2	uc002xjx.3	Q9BQK8	OTTHUMG00000033056	ENST00000373257.3:c.566T>A	20.37:g.39977740T>A	ENSP00000362354:p.Leu189*		B2RTT5|Q5TDB9|Q9NPY8|Q9UJE5	Nonsense_Mutation	SNP	pfam_LNS2,pfam_Lipin_N,superfamily_HAD-like_dom,smart_LNS2	p.L189*	ENST00000373257.3	37	c.566	CCDS33469.1	20	.	.	.	.	.	.	.	.	.	.	T	17.51	3.407782	0.62399	.	.	ENSG00000132793	ENST00000373257	.	.	.	4.98	-2.94	0.05581	.	2.496360	0.01159	N	0.006580	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	1.6915	4.5212	0.11960	0.2458:0.3757:0.0:0.3785	.	.	.	.	X	189	.	.	L	+	2	0	LPIN3	39411154	0.000000	0.05858	0.000000	0.03702	0.630000	0.37929	-1.588000	0.02106	-0.563000	0.06078	0.533000	0.62120	TTG	LPIN3	-	NULL	ENSG00000132793		0.592	LPIN3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LPIN3	HGNC	protein_coding	OTTHUMT00000080393.1	59	0.00	0	T	NM_022896		39977740	39977740	+1	no_errors	ENST00000373257	ensembl	human	known	69_37n	nonsense	32	21.95	9	SNP	0.000	A
LRP1	4035	genome.wustl.edu	37	12	57590002	57590002	+	Missense_Mutation	SNP	T	T	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr12:57590002T>A	ENST00000243077.3	+	55	9300	c.8834T>A	c.(8833-8835)cTc>cAc	p.L2945H	MIR1228_ENST00000408438.1_RNA	NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	2945	EGF-like 11. {ECO:0000255|PROSITE- ProRule:PRU00076}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	AATGAGTGTCTCAGCCGCAAG	0.627																																						dbGAP											0													44.0	38.0	40.0					12																	57590002		2202	4299	6501	-	-	-	SO:0001583	missense	0			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.8834T>A	12.37:g.57590002T>A	ENSP00000243077:p.Leu2945His		Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.L2945H	ENST00000243077.3	37	c.8834	CCDS8932.1	12	.	.	.	.	.	.	.	.	.	.	T	16.84	3.234663	0.58886	.	.	ENSG00000123384	ENST00000243077	D	0.90900	-2.75	5.02	5.02	0.67125	Growth factor, receptor (1);EGF-like calcium-binding (1);	0.000000	0.56097	D	0.000021	D	0.92064	0.7485	L	0.35723	1.085	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.91362	0.5112	10	0.37606	T	0.19	.	13.8562	0.63529	0.0:0.0:0.0:1.0	.	2945	Q07954	LRP1_HUMAN	H	2945	ENSP00000243077:L2945H	ENSP00000243077:L2945H	L	+	2	0	LRP1	55876269	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	6.040000	0.70980	2.093000	0.63338	0.533000	0.62120	CTC	LRP1	-	superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EGF-like	ENSG00000123384		0.627	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	HGNC	protein_coding	OTTHUMT00000412772.2	96	0.00	0	T	NM_002332		57590002	57590002	+1	no_errors	ENST00000243077	ensembl	human	known	69_37n	missense	63	27.59	24	SNP	1.000	A
LRP1B	53353	genome.wustl.edu	37	2	141032147	141032147	+	Missense_Mutation	SNP	C	C	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr2:141032147C>A	ENST00000389484.3	-	85	13959	c.12988G>T	c.(12988-12990)Gtg>Ttg	p.V4330L		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4330	EGF-like 20. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TCAGAATTCACACAATAGTGG	0.388										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	dbGAP											0													122.0	97.0	105.0					2																	141032147		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.12988G>T	2.37:g.141032147C>A	ENSP00000374135:p.Val4330Leu		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_dom,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.V4330L	ENST00000389484.3	37	c.12988	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	C	13.32	2.203256	0.38905	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.88201	-2.35	5.36	5.36	0.76844	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	U	0.000005	D	0.91436	0.7297	L	0.44542	1.39	0.48087	D	0.99958	D	0.58970	0.984	D	0.68192	0.956	D	0.88789	0.3276	10	0.21014	T	0.42	.	17.2537	0.87049	0.0:1.0:0.0:0.0	.	4330	Q9NZR2	LRP1B_HUMAN	L	4330;4268	ENSP00000374135:V4330L	ENSP00000374135:V4330L	V	-	1	0	LRP1B	140748617	1.000000	0.71417	1.000000	0.80357	0.770000	0.43624	6.057000	0.71119	2.499000	0.84300	0.655000	0.94253	GTG	LRP1B	-	smart_EGF-like,pfscan_EG-like_dom	ENSG00000168702		0.388	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	59	0.00	0	C	NM_018557		141032147	141032147	-1	no_errors	ENST00000389484	ensembl	human	known	69_37n	missense	45	16.67	9	SNP	1.000	A
LY75	4065	genome.wustl.edu	37	2	160714973	160714973	+	Silent	SNP	T	T	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr2:160714973T>A	ENST00000263636.4	-	16	2310	c.2283A>T	c.(2281-2283)ccA>ccT	p.P761P	LY75_ENST00000553424.1_Silent_p.P761P|LY75-CD302_ENST00000504764.1_Silent_p.P761P|LY75-CD302_ENST00000505052.1_Silent_p.P761P|LY75_ENST00000554112.1_Silent_p.P761P	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	761	C-type lectin 4. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		CTCTTCGCCATGGCCTATGAA	0.363																																						dbGAP											0													70.0	70.0	70.0					2																	160714973		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.2283A>T	2.37:g.160714973T>A			O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Silent	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin	p.P761	ENST00000263636.4	37	c.2283	CCDS2211.1	2																																																																																			LY75	-	superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000054219		0.363	LY75-001	KNOWN	basic|CCDS	protein_coding	LY75	HGNC	protein_coding	OTTHUMT00000255035.1	37	0.00	0	T			160714973	160714973	-1	no_errors	ENST00000554112	ensembl	human	known	69_37n	silent	21	38.24	13	SNP	0.123	A
LYZL1	84569	genome.wustl.edu	37	10	29578111	29578111	+	Missense_Mutation	SNP	C	C	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr10:29578111C>T	ENST00000375500.3	+	1	122	c.65C>T	c.(64-66)tCa>tTa	p.S22L		NM_032517.4	NP_115906.3	Q6UWQ5	LYZL1_HUMAN	lysozyme-like 1	0					cell wall macromolecule catabolic process (GO:0016998)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)			central_nervous_system(1)|cervix(2)|large_intestine(2)|lung(5)|skin(1)	11		Breast(68;0.203)				TCCGCAGACTCAACTGAGAAG	0.527																																						dbGAP											0													47.0	42.0	44.0					10																	29578111		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31174.1	10p12.1	2004-08-02			ENSG00000120563	ENSG00000120563	3.2.1.1		30502	protein-coding gene	gene with protein product						12477932	Standard	XM_005252627		Approved	MGC33408, LYC2	uc001iul.3	Q6UWQ5	OTTHUMG00000017880	ENST00000375500.3:c.65C>T	10.37:g.29578111C>T	ENSP00000364650:p.Ser22Leu		Q5T921|Q8WW16	Missense_Mutation	SNP	pfam_Glyco_hydro_22,superfamily_Lysozyme-like_dom,smart_Glyco_hydro_22,prints_Glyco_hydro_22,prints_Glyco_hydro_22_lys	p.S22L	ENST00000375500.3	37	c.65	CCDS31174.1	10	.	.	.	.	.	.	.	.	.	.	C	15.12	2.739300	0.49045	.	.	ENSG00000120563	ENST00000375500	T	0.69040	-0.37	4.04	2.2	0.27929	.	1.806120	0.03518	N	0.220515	T	0.57213	0.2038	.	.	.	0.09310	N	1	B	0.16396	0.017	B	0.14578	0.011	T	0.47749	-0.9093	9	0.66056	D	0.02	-5.9885	6.1977	0.20559	0.0:0.7742:0.0:0.2258	.	22	Q6UWQ5-2	.	L	22	ENSP00000364650:S22L	ENSP00000364650:S22L	S	+	2	0	LYZL1	29618117	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.047000	0.11963	0.675000	0.31264	0.561000	0.74099	TCA	LYZL1	-	NULL	ENSG00000120563		0.527	LYZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYZL1	HGNC	protein_coding	OTTHUMT00000047381.1	56	0.00	0	C	NM_032517		29578111	29578111	+1	no_errors	ENST00000375500	ensembl	human	known	69_37n	missense	40	11.11	5	SNP	0.001	T
MACF1	23499	genome.wustl.edu	37	1	39793021	39793021	+	Missense_Mutation	SNP	A	A	C			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr1:39793021A>C	ENST00000372915.3	+	35	4712	c.4625A>C	c.(4624-4626)cAa>cCa	p.Q1542P	MACF1_ENST00000361689.2_Missense_Mutation_p.Q1542P|MACF1_ENST00000564288.1_Missense_Mutation_p.Q1537P|MACF1_ENST00000545844.1_Missense_Mutation_p.Q1542P|MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000317713.7_Missense_Mutation_p.Q1542P|MACF1_ENST00000539005.1_Missense_Mutation_p.Q1542P|MACF1_ENST00000567887.1_Missense_Mutation_p.Q1574P			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	1542					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CAGACAGAACAAAAGGTACTT	0.428																																						dbGAP											0													80.0	78.0	79.0					1																	39793021		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.4625A>C	1.37:g.39793021A>C	ENSP00000362006:p.Gln1542Pro		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.Q1542P	ENST00000372915.3	37	c.4625		1	.	.	.	.	.	.	.	.	.	.	A	13.07	2.127079	0.37533	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000530262	T;T;T;T;T;D	0.88664	-0.12;-0.26;-0.12;-0.15;0.03;-2.41	5.68	4.56	0.56223	.	.	.	.	.	D	0.87374	0.6161	L	0.50333	1.59	0.80722	D	1	B;B;B	0.32467	0.201;0.372;0.344	B;B;B	0.39465	0.3;0.18;0.3	D	0.85767	0.1353	9	0.59425	D	0.04	.	11.5252	0.50576	0.9293:0.0:0.0707:0.0	.	1542;1542;1507	F8W8Q1;Q9UPN3-2;Q9UPN3-3	.;.;.	P	1542;1542;1542;1542;1542;1691	ENSP00000439537:Q1542P;ENSP00000362006:Q1542P;ENSP00000354573:Q1542P;ENSP00000313438:Q1542P;ENSP00000444364:Q1542P;ENSP00000437059:Q1691P	ENSP00000313438:Q1542P	Q	+	2	0	MACF1	39565608	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.477000	0.66799	1.089000	0.41292	0.528000	0.53228	CAA	MACF1	-	NULL	ENSG00000127603		0.428	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	32	0.00	0	A	NM_033044		39793021	39793021	+1	no_errors	ENST00000317713	ensembl	human	known	69_37n	missense	28	26.32	10	SNP	1.000	C
MALSU1	115416	genome.wustl.edu	37	7	23338986	23338986	+	Silent	SNP	C	C	T	rs575849724		TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr7:23338986C>T	ENST00000466681.1	+	1	168	c.15C>T	c.(13-15)ggC>ggT	p.G5G	MALSU1_ENST00000479974.1_Intron	NM_138446.1	NP_612455.1	Q96EH3	MASU1_HUMAN	mitochondrial assembly of ribosomal large subunit 1	5					negative regulation of mitochondrial translation (GO:0070130)|ribosomal large subunit biogenesis (GO:0042273)	mitochondrion (GO:0005739)											GGCCGGGCGGCCGTGTGGCGC	0.721																																						dbGAP											0													6.0	8.0	7.0					7																	23338986		1914	3990	5904	-	-	-	SO:0001819	synonymous_variant	0			BC012331	CCDS5381.1	7p15.3	2013-05-24	2012-02-20	2012-02-20	ENSG00000156928	ENSG00000156928			21721	protein-coding gene	gene with protein product		614624	"""chromosome 7 open reading frame 30"""	C7orf30		22238376, 22238375	Standard	NM_138446		Approved	mtRsfA	uc003swd.1	Q96EH3	OTTHUMG00000128443	ENST00000466681.1:c.15C>T	7.37:g.23338986C>T			A4D154	Silent	SNP	pfam_Oligomer_dom,tigrfam_Ribosome-assoc_Iojap-like	p.G5	ENST00000466681.1	37	c.15	CCDS5381.1	7																																																																																			MALSU1	-	NULL	ENSG00000156928		0.721	MALSU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MALSU1	HGNC	protein_coding	OTTHUMT00000250241.2	15	0.00	0	C	NM_138446		23338986	23338986	+1	no_errors	ENST00000466681	ensembl	human	known	69_37n	silent	8	46.67	7	SNP	0.000	T
MAP3K7	6885	genome.wustl.edu	37	6	91226129	91226129	+	3'UTR	SNP	C	C	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr6:91226129C>G	ENST00000369329.3	-	0	2073				MAP3K7_ENST00000369325.3_3'UTR|MAP3K7_ENST00000369327.3_3'UTR|MAP3K7_ENST00000479630.1_5'UTR|MAP3K7_ENST00000369320.1_3'UTR|MAP3K7_ENST00000369332.3_3'UTR	NM_145331.2	NP_663304.1	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7						activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone H3 acetylation (GO:0043966)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of ripoptosome assembly involved in necroptotic process (GO:1902443)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|regulation of reactive oxygen species metabolic process (GO:2000377)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	28		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		CGCCAAAAAGCTAACACTCAT	0.333																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB009356	CCDS5027.1, CCDS5028.1, CCDS5029.1, CCDS5030.1	6q15	2011-06-09			ENSG00000135341	ENSG00000135341		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6859	protein-coding gene	gene with protein product		602614		TAK1		9466656	Standard	NM_003188		Approved	MEKK7	uc003pnz.2	O43318	OTTHUMG00000015217	ENST00000369329.3:c.*91G>C	6.37:g.91226129C>G			B2RE27|E1P523|O43317|O43319|Q5TDN2|Q5TDN3|Q5TDT7|Q9NTR3|Q9NZ70	RNA	SNP	-	NULL	ENST00000369329.3	37	NULL	CCDS5028.1	6																																																																																			MAP3K7	-	-	ENSG00000135341		0.333	MAP3K7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K7	HGNC	protein_coding	OTTHUMT00000041530.1	12	0.00	0	C	NM_145331		91226129	91226129	-1	no_errors	ENST00000479630	ensembl	human	known	69_37n	rna	4	73.33	11	SNP	1.000	G
MAP3K5	4217	genome.wustl.edu	37	6	137018482	137018482	+	Missense_Mutation	SNP	G	G	C			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr6:137018482G>C	ENST00000359015.4	-	5	1210	c.850C>G	c.(850-852)Cgt>Ggt	p.R284G		NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	284					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		TATAAATTACGAGCTTTCCTG	0.368																																						dbGAP											0													122.0	124.0	123.0					6																	137018482		2203	4300	6503	-	-	-	SO:0001583	missense	0			U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.850C>G	6.37:g.137018482G>C	ENSP00000351908:p.Arg284Gly		A6NIA0|B4DGB2|Q5THN3|Q99461	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R284G	ENST00000359015.4	37	c.850	CCDS5179.1	6	.	.	.	.	.	.	.	.	.	.	G	22.1	4.248102	0.80024	.	.	ENSG00000197442	ENST00000359015;ENST00000367768	T	0.15017	2.46	5.32	4.44	0.53790	.	0.102724	0.64402	D	0.000002	T	0.37571	0.1008	M	0.85197	2.74	0.80722	D	1	P;D;D	0.89917	0.606;1.0;0.999	P;D;D	0.91635	0.578;0.999;0.997	T	0.49707	-0.8911	10	0.87932	D	0	.	15.5756	0.76380	0.0:0.0:0.8608:0.1392	.	364;129;284	Q59GL6;B4DF67;Q99683	.;.;M3K5_HUMAN	G	284;364	ENSP00000351908:R284G	ENSP00000351908:R284G	R	-	1	0	MAP3K5	137060175	1.000000	0.71417	0.993000	0.49108	0.997000	0.91878	7.508000	0.81686	1.341000	0.45600	0.591000	0.81541	CGT	MAP3K5	-	NULL	ENSG00000197442		0.368	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K5	HGNC	protein_coding	OTTHUMT00000042383.1	27	0.00	0	G			137018482	137018482	-1	no_errors	ENST00000359015	ensembl	human	known	69_37n	missense	16	44.83	13	SNP	1.000	C
MCF2	4168	genome.wustl.edu	37	X	138680641	138680641	+	Nonsense_Mutation	SNP	A	A	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chrX:138680641A>T	ENST00000370576.4	-	17	2062	c.1853T>A	c.(1852-1854)tTa>tAa	p.L618*	MCF2_ENST00000370578.4_Nonsense_Mutation_p.L763*|MCF2_ENST00000338585.6_Nonsense_Mutation_p.L634*|MCF2_ENST00000520602.1_Nonsense_Mutation_p.L678*|MCF2_ENST00000414978.1_Nonsense_Mutation_p.L678*|MCF2_ENST00000536274.1_Nonsense_Mutation_p.L579*|AL033403.1_ENST00000401295.2_RNA|MCF2_ENST00000519895.1_Nonsense_Mutation_p.L694*|MCF2_ENST00000370573.4_Nonsense_Mutation_p.L618*	NM_001171879.1|NM_005369.4	NP_001165350.1|NP_005360.3	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	618	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|dendrite development (GO:0016358)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(15)|lung(34)|pancreas(1)|pleura(1)|prostate(1)	62	Acute lymphoblastic leukemia(192;0.000127)					TCTGTGTTTTAACTTTCTTTG	0.289																																						dbGAP											0													113.0	99.0	104.0					X																	138680641		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0				CCDS14667.1, CCDS48175.1, CCDS55514.1, CCDS55515.1, CCDS55516.1, CCDS55517.1	Xq26.3-q27.1	2012-07-24			ENSG00000101977	ENSG00000101977		"""Rho guanine nucleotide exchange factors"""	6940	protein-coding gene	gene with protein product	"""Oncogene MCF2 (oncogene DBL)"""	311030				2577874, 1611909	Standard	NM_001099855		Approved	DBL, ARHGEF21	uc011mwo.1	P10911	OTTHUMG00000022537	ENST00000370576.4:c.1853T>A	X.37:g.138680641A>T	ENSP00000359608:p.Leu618*		B7Z3Y5|B7Z869|B7ZAV1|E9PH77|F5H091|P14919|Q5JYJ2|Q5JYJ3|Q5JYJ4|Q8IUF3|Q8IUF4|Q9UJB3	Nonsense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.L763*	ENST00000370576.4	37	c.2288	CCDS14667.1	X	.	.	.	.	.	.	.	.	.	.	a	38	7.149410	0.98096	.	.	ENSG00000101977	ENST00000520602;ENST00000370576;ENST00000536274;ENST00000370578;ENST00000414978;ENST00000446225;ENST00000519895;ENST00000370573;ENST00000338585	.	.	.	5.51	5.51	0.81932	.	0.071589	0.56097	D	0.000025	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.7646	0.62988	1.0:0.0:0.0:0.0	.	.	.	.	X	678;618;579;763;678;221;694;618;634	.	ENSP00000342204:L634X	L	-	2	0	MCF2	138508307	1.000000	0.71417	0.986000	0.45419	0.864000	0.49448	8.871000	0.92346	1.847000	0.53656	0.483000	0.47432	TTA	MCF2	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000101977		0.289	MCF2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MCF2	HGNC	protein_coding	OTTHUMT00000058560.1	44	0.00	0	A	NM_005369		138680641	138680641	-1	no_errors	ENST00000370578	ensembl	human	known	69_37n	nonsense	24	17.24	5	SNP	1.000	T
HILPDA	29923	genome.wustl.edu	37	7	128095923	128095923	+	5'UTR	SNP	C	C	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr7:128095923C>T	ENST00000435296.2	+	0	21				RP11-155G14.6_ENST00000493710.1_RNA|RP11-212P7.3_ENST00000462662.1_RNA|HILPDA_ENST00000257696.4_5'Flank			Q9Y5L2	HLPDA_HUMAN	hypoxia inducible lipid droplet-associated						autocrine signaling (GO:0035425)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine production (GO:0001819)|positive regulation of lipid storage (GO:0010884)|response to stress (GO:0006950)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|secretory granule (GO:0030141)	receptor binding (GO:0005102)										GGCTGGGCGGCGTTGCTCTGC	0.677																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AF144755	CCDS5802.1	7q32.1	2011-11-02	2011-11-02	2011-11-02	ENSG00000135245	ENSG00000135245			28859	protein-coding gene	gene with protein product	"""hypoxia inducible gene 2"""		"""chromosome 7 open reading frame 68"""	C7orf68		10690527, 15930302	Standard	NM_001098786		Approved	FLJ21076, HIG-2, HIG2	uc010lli.3	Q9Y5L2	OTTHUMG00000157712	ENST00000435296.2:c.-109C>T	7.37:g.128095923C>T			A4D0Z5|Q52LY5|Q53HJ7	Silent	SNP	NULL	p.G10	ENST00000435296.2	37	c.30	CCDS5802.1	7																																																																																			METTL2B	-	NULL	ENSG00000165055		0.677	HILPDA-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	METTL2B	HGNC	protein_coding	OTTHUMT00000349453.1	86	0.00	0	C	NM_013332		128095923	128095923	+1	no_start_codon:no_stop_codon:bad_bp_length_for_coding_region	ENST00000462662	ensembl	human	putative	69_37n	silent	35	35.19	19	SNP	0.000	T
MICAL1	64780	genome.wustl.edu	37	6	109767568	109767568	+	Silent	SNP	A	A	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr6:109767568A>G	ENST00000358807.3	-	19	2663	c.2352T>C	c.(2350-2352)acT>acC	p.T784T	MICAL1_ENST00000368952.4_Silent_p.T803T|MICAL1_ENST00000358577.3_Silent_p.T698T	NM_022765.3	NP_073602.3	Q8TDZ2	MICA1_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 1	784					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of protein phosphorylation (GO:0001933)|oxidation-reduction process (GO:0055114)|signal transduction (GO:0007165)|sulfur oxidation (GO:0019417)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		AGGCTGTGGGAGTTGAGAGGC	0.662																																						dbGAP											0													61.0	74.0	70.0					6																	109767568		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AB048948	CCDS5076.1, CCDS55047.1	6q21	2013-03-26	2013-03-26	2005-02-16	ENSG00000135596	ENSG00000135596			20619	protein-coding gene	gene with protein product		607129	"""NEDD9 interacting protein with calponin homology and LIM domains"""	NICAL		11827972	Standard	NM_022765		Approved	MICAL, FLJ11937, DKFZp434B1517, FLJ21739	uc003ptk.3	Q8TDZ2	OTTHUMG00000015350	ENST00000358807.3:c.2352T>C	6.37:g.109767568A>G			B7Z3R5|E1P5F0|Q7Z633|Q8IVS9|Q96G47|Q9H6X6|Q9H7I0|Q9HAA1|Q9UFF7	Silent	SNP	pfam_DUF3585,pfam_CH-domain,pfam_Znf_LIM,pfam_mOase_FAD-bd,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM	p.T803	ENST00000358807.3	37	c.2409	CCDS5076.1	6																																																																																			MICAL1	-	NULL	ENSG00000135596		0.662	MICAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICAL1	HGNC	protein_coding	OTTHUMT00000041759.2	65	0.00	0	A	NM_022765		109767568	109767568	-1	no_errors	ENST00000368952	ensembl	human	known	69_37n	silent	70	11.39	9	SNP	0.000	G
MIR4277	100422966	genome.wustl.edu	37	5	1708983	1708983	+	RNA	SNP	G	G	A	rs12523324	byFrequency	TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr5:1708983G>A	ENST00000578298.1	-	0	0					NR_036240.1				microRNA 4277																		CCTCGACCCAGAGCCAGACAA	0.627													a|||	3108	0.620607	0.6747	0.67	5008	,	,		20437	0.5982		0.6779	False		,,,				2504	0.4765					dbGAP											0																																										-	-	-			0					5	2011-09-12				ENSG00000263746		"""ncRNAs / Micro RNAs"""	38367	non-coding RNA	RNA, micro							Standard	NR_036240		Approved	hsa-mir-4277	uc021xwg.1				5.37:g.1708983G>A				RNA	SNP	-	NULL	ENST00000578298.1	37	NULL		5																																																																																			MIR4277	-	-	ENSG00000263746		0.627	MIR4277-201	KNOWN	basic	miRNA	MIR4277	HGNC	miRNA		39	0.00	0	G	NR_036240		1708983	1708983	-1	no_errors	ENST00000578298	ensembl	human	known	69_37n	rna	39	13.04	6	SNP	0.007	A
MPZL1	9019	genome.wustl.edu	37	1	167757608	167757608	+	3'UTR	SNP	T	T	C	rs41270734	byFrequency	TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr1:167757608T>C	ENST00000359523.2	+	0	1462				MPZL1_ENST00000403379.3_3'UTR|MPZL1_ENST00000392121.3_3'UTR	NM_003953.5|NM_024569.4	NP_003944.1|NP_078845.3	O95297	MPZL1_HUMAN	myelin protein zero-like 1						cell-cell signaling (GO:0007267)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	structural molecule activity (GO:0005198)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(2)	15	all_hematologic(923;0.215)					GATGCTATGATGGAAGCATAC	0.398													T|||	405	0.0808706	0.0098	0.0807	5008	,	,		21371	0.0843		0.1074	False		,,,				2504	0.1462					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF087020	CCDS1264.1, CCDS44273.1, CCDS53425.1	1q24.2	2013-01-11			ENSG00000197965	ENSG00000197965		"""Immunoglobulin superfamily / V-set domain containing"""	7226	protein-coding gene	gene with protein product		604376				9792637	Standard	NM_003953		Approved	PZR, FLJ21047	uc001geo.3	O95297	OTTHUMG00000034571	ENST00000359523.2:c.*450T>C	1.37:g.167757608T>C			B2REB9|B2REC0|Q5R332|Q8IX11|Q9BWZ3|Q9NYK4|Q9UL20	RNA	SNP	-	NULL	ENST00000359523.2	37	NULL	CCDS1264.1	1																																																																																			MPZL1	-	-	ENSG00000197965		0.398	MPZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPZL1	HGNC	protein_coding	OTTHUMT00000083655.2	33	0.00	0	T	NM_024569		167757608	167757608	+1	no_errors	ENST00000403379	ensembl	human	putative	69_37n	rna	31	11.43	4	SNP	0.001	C
MRVI1	10335	genome.wustl.edu	37	11	10615516	10615516	+	Intron	SNP	T	T	C			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr11:10615516T>C	ENST00000436272.1	-	15	2065				MRVI1_ENST00000421747.1_Intron|MRVI1-AS1_ENST00000529979.1_RNA|MRVI1-AS1_ENST00000529829.1_RNA|MRVI1_ENST00000423302.2_Intron|LYVE1_ENST00000531706.1_Intron|MRVI1_ENST00000424001.1_Intron|MRVI1_ENST00000547195.1_Intron|MRVI1_ENST00000552103.1_Intron|MRVI1-AS1_ENST00000525578.1_RNA|MRVI1_ENST00000527509.2_Intron|MRVI1_ENST00000531107.1_Intron|MRVI1_ENST00000545852.1_Intron|MRVI1_ENST00000534266.2_Intron|MRVI1_ENST00000541483.1_Intron|MRVI1_ENST00000558540.1_Intron			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog						blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		AAGGAAACCATGAGCAAGAAA	0.418																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.1986+176A>G	11.37:g.10615516T>C			B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	RNA	SNP	-	NULL	ENST00000436272.1	37	NULL		11																																																																																			MRVI1-AS1	-	-	ENSG00000177112		0.418	MRVI1-203	KNOWN	basic	protein_coding	MRVI1-AS1	HGNC	protein_coding		11	0.00	0	T	NM_001098579		10615516	10615516	+1	no_errors	ENST00000525578	ensembl	human	known	69_37n	rna	3	70.00	7	SNP	0.000	C
MTO1	25821	genome.wustl.edu	37	6	74207461	74207461	+	Missense_Mutation	SNP	A	A	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr6:74207461A>G	ENST00000370300.4	+	12	1924	c.1834A>G	c.(1834-1836)Act>Gct	p.T612A	MTO1_ENST00000370305.1_Missense_Mutation_p.T538A|MTO1_ENST00000415954.2_Missense_Mutation_p.T627A|MTO1_ENST00000498286.1_Missense_Mutation_p.T587A	NM_012123.3|NM_133645.2	NP_036255.2|NP_598400.1	Q9Y2Z2	MTO1_HUMAN	mitochondrial tRNA translation optimization 1	612					mitochondrial tRNA wobble uridine modification (GO:0070899)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)	27						TTGACCAGCCACTTATGAATC	0.333																																						dbGAP											0													78.0	85.0	83.0					6																	74207461		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF132937	CCDS4979.1, CCDS34485.1, CCDS47452.1	6q14.1	2013-05-07	2013-05-07		ENSG00000135297	ENSG00000135297			19261	protein-coding gene	gene with protein product		614667	"""mitochondrial translation optimization 1 homolog (S. cerevisiae)"""			12011058, 22608499	Standard	NM_012123		Approved		uc003pgy.4	Q9Y2Z2	OTTHUMG00000015032	ENST00000370300.4:c.1834A>G	6.37:g.74207461A>G	ENSP00000359323:p.Thr612Ala		B3KQB5|Q5SWL2|Q5SWL3|Q5SWL4|Q8NDN7|Q8WZ57|Q96FE6|Q9BS06	Missense_Mutation	SNP	pfam_GIDA-rel,pfam_FAD_bind_dom,prints_FAD_pyr_nucl-diS_OxRdtase,tigrfam_GidA	p.T627A	ENST00000370300.4	37	c.1879	CCDS4979.1	6	.	.	.	.	.	.	.	.	.	.	A	4.938	0.174200	0.09391	.	.	ENSG00000135297	ENST00000415954;ENST00000498286;ENST00000357845;ENST00000370305;ENST00000370300	.	.	.	5.74	3.24	0.37175	.	0.718603	0.14454	N	0.318620	T	0.07324	0.0185	N	0.13235	0.315	0.21064	N	0.999791	B;B;B;B	0.06786	0.001;0.0;0.0;0.0	B;B;B;B	0.10450	0.005;0.001;0.003;0.005	T	0.30208	-0.9986	9	0.62326	D	0.03	-2.8484	3.6895	0.08340	0.6382:0.0:0.2054:0.1565	.	627;490;587;612	Q9Y2Z2-6;Q9Y2Z2-2;Q9Y2Z2-4;Q9Y2Z2	.;.;.;MTO1_HUMAN	A	627;587;490;538;612	.	ENSP00000350506:T490A	T	+	1	0	MTO1	74264182	0.105000	0.21958	0.988000	0.46212	0.984000	0.73092	0.371000	0.20450	0.391000	0.25143	0.472000	0.43445	ACT	MTO1	-	NULL	ENSG00000135297		0.333	MTO1-003	KNOWN	basic|CCDS	protein_coding	MTO1	HGNC	protein_coding	OTTHUMT00000041215.2	49	0.00	0	A	NM_012123		74207461	74207461	+1	no_errors	ENST00000415954	ensembl	human	known	69_37n	missense	41	25.45	14	SNP	0.921	G
MUC17	140453	genome.wustl.edu	37	7	100680493	100680493	+	Silent	SNP	T	T	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr7:100680493T>A	ENST00000306151.4	+	3	5860	c.5796T>A	c.(5794-5796)ccT>ccA	p.P1932P		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1932	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CAAGTATACCTGTCAGCACCA	0.483																																						dbGAP											0													241.0	240.0	240.0					7																	100680493		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5796T>A	7.37:g.100680493T>A			O14761|Q685J2|Q8TDH7	Silent	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.P1932	ENST00000306151.4	37	c.5796	CCDS34711.1	7																																																																																			MUC17	-	NULL	ENSG00000169876		0.483	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	63	0.00	0	T	NM_001040105		100680493	100680493	+1	no_errors	ENST00000306151	ensembl	human	known	69_37n	silent	45	23.73	14	SNP	0.000	A
MUC17	140453	genome.wustl.edu	37	7	100681460	100681460	+	Missense_Mutation	SNP	A	A	T	rs144955715		TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr7:100681460A>T	ENST00000306151.4	+	3	6827	c.6763A>T	c.(6763-6765)Act>Tct	p.T2255S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2255	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GACCACTTCTACTGAAGCCAC	0.478																																						dbGAP											0													280.0	285.0	283.0					7																	100681460		2203	4297	6500	-	-	-	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.6763A>T	7.37:g.100681460A>T	ENSP00000302716:p.Thr2255Ser		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.T2255S	ENST00000306151.4	37	c.6763	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	A	5.506	0.278400	0.10403	.	.	ENSG00000169876	ENST00000306151	T	0.02323	4.34	1.65	-3.3	0.05003	.	.	.	.	.	T	0.01387	0.0045	N	0.14661	0.345	0.09310	N	1	B	0.14438	0.01	B	0.11329	0.006	T	0.47983	-0.9074	9	0.07990	T	0.79	.	3.6036	0.08034	0.3157:0.0:0.4762:0.208	.	2255	Q685J3	MUC17_HUMAN	S	2255	ENSP00000302716:T2255S	ENSP00000302716:T2255S	T	+	1	0	MUC17	100468180	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-3.385000	0.00489	-1.304000	0.02329	0.113000	0.15668	ACT	MUC17	-	NULL	ENSG00000169876		0.478	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	104	0.94	1	A	NM_001040105		100681460	100681460	+1	no_errors	ENST00000306151	ensembl	human	known	69_37n	missense	52	15.87	10	SNP	0.006	T
MYH2	4620	genome.wustl.edu	37	17	10426683	10426683	+	Missense_Mutation	SNP	G	G	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr17:10426683G>T	ENST00000245503.5	-	38	5903	c.5519C>A	c.(5518-5520)gCt>gAt	p.A1840D	MYH2_ENST00000532183.2_Intron|RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000397183.2_Missense_Mutation_p.A1840D|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1840					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						GACAGCCTCAGCATTACGCTT	0.478																																						dbGAP											0													187.0	165.0	173.0					17																	10426683		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.5519C>A	17.37:g.10426683G>T	ENSP00000245503:p.Ala1840Asp		A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_Ribosomal_L29,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A1840D	ENST00000245503.5	37	c.5519	CCDS11156.1	17	.	.	.	.	.	.	.	.	.	.	G	13.35	2.210604	0.39102	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	T;T	0.76578	-1.03;-1.03	5.5	-11.0	0.00169	Myosin tail (1);	0.428769	0.16597	U	0.207520	D	0.85353	0.5677	M	0.93016	3.37	0.09310	N	1	B	0.23854	0.092	B	0.39562	0.303	T	0.68198	-0.5472	10	0.62326	D	0.03	.	26.337	0.99996	0.1428:0.0:0.8572:0.0	.	1840	Q9UKX2	MYH2_HUMAN	D	1840	ENSP00000245503:A1840D;ENSP00000380367:A1840D	ENSP00000245503:A1840D	A	-	2	0	MYH2	10367408	0.000000	0.05858	0.000000	0.03702	0.975000	0.68041	-0.962000	0.03841	-2.621000	0.00439	-1.105000	0.02106	GCT	MYH2	-	pfam_Myosin_tail	ENSG00000125414		0.478	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH2	HGNC	protein_coding	OTTHUMT00000252726.3	56	0.00	0	G	NM_017534		10426683	10426683	-1	no_errors	ENST00000245503	ensembl	human	known	69_37n	missense	15	64.29	27	SNP	0.000	T
NADSYN1	55191	genome.wustl.edu	37	11	71189512	71189512	+	Silent	SNP	G	G	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr11:71189512G>A	ENST00000319023.2	+	10	1058	c.870G>A	c.(868-870)ctG>ctA	p.L290L	NADSYN1_ENST00000539574.1_Silent_p.L30L|NADSYN1_ENST00000530055.1_5'Flank	NM_018161.4	NP_060631.2	Q6IA69	NADE_HUMAN	NAD synthetase 1	290	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds (GO:0016810)|NAD+ synthase (glutamine-hydrolyzing) activity (GO:0003952)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	25					L-Glutamine(DB00130)	CTCGAAACCTGGCGGTGAGTG	0.587																																					Ovarian(79;763 1781 6490 50276)	dbGAP											0													46.0	42.0	43.0					11																	71189512		2200	4294	6494	-	-	-	SO:0001819	synonymous_variant	0			AB091316	CCDS8201.1	11q13.4	2008-02-05				ENSG00000172890			29832	protein-coding gene	gene with protein product		608285				12547821	Standard	NM_018161		Approved	FLJ10631	uc001oqn.3	Q6IA69		ENST00000319023.2:c.870G>A	11.37:g.71189512G>A			B3KUU4|Q86SN2|Q9HA25|Q9NVM8	Nonsense_Mutation	SNP	NULL	p.W55*	ENST00000319023.2	37	c.164	CCDS8201.1	11																																																																																			NADSYN1	-	NULL	ENSG00000172890		0.587	NADSYN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NADSYN1	HGNC	protein_coding	OTTHUMT00000394356.1	33	0.00	0	G	NM_018161		71189512	71189512	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000527852	ensembl	human	known	69_37n	nonsense	20	25.93	7	SNP	1.000	A
NR6A1	2649	genome.wustl.edu	37	9	127316675	127316675	+	Missense_Mutation	SNP	C	C	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr9:127316675C>T	ENST00000487099.2	-	3	474	c.317G>A	c.(316-318)cGg>cAg	p.R106Q	NR6A1_ENST00000344523.4_Missense_Mutation_p.R106Q|NR6A1_ENST00000373584.3_Missense_Mutation_p.R102Q|NR6A1_ENST00000416460.2_Missense_Mutation_p.R102Q	NM_001278546.1	NP_001265475.1	Q15406	NR6A1_HUMAN	nuclear receptor subfamily 6, group A, member 1	106					cell proliferation (GO:0008283)|gamete generation (GO:0007276)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	17						CCTCTGCTTCCGAGACATGAC	0.542																																					Esophageal Squamous(192;272 2884 6208 20560)	dbGAP											0													175.0	141.0	152.0					9																	127316675		2203	4300	6503	-	-	-	SO:0001583	missense	0			U64876	CCDS35137.1, CCDS55340.1, CCDS65127.1	9q33.3	2014-01-21			ENSG00000148200	ENSG00000148200		"""Nuclear hormone receptors"""	7985	protein-coding gene	gene with protein product		602778		GCNF		9134503, 8982251	Standard	NM_001489		Approved	GCNF1, RTR, CT150	uc004bor.1	Q15406	OTTHUMG00000020661	ENST00000487099.2:c.317G>A	9.37:g.127316675C>T	ENSP00000420267:p.Arg106Gln		O00551|O00603|Q5T6F4|Q8NHQ0|Q92898|Q99802	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.R106Q	ENST00000487099.2	37	c.317	CCDS35137.1	9	.	.	.	.	.	.	.	.	.	.	C	32	5.153072	0.94645	.	.	ENSG00000148200	ENST00000487099;ENST00000373584;ENST00000416460;ENST00000344523;ENST00000475178	D;D;D;D;D	0.97455	-4.39;-4.39;-4.39;-4.39;-4.39	5.51	5.51	0.81932	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (3);	0.000000	0.85682	D	0.000000	D	0.97284	0.9112	L	0.45285	1.41	0.80722	D	1	D;D;D	0.67145	0.996;0.984;0.996	P;P;P	0.61070	0.883;0.845;0.67	D	0.97786	1.0235	10	0.59425	D	0.04	.	18.4123	0.90555	0.0:1.0:0.0:0.0	.	102;106;102	F1DAM1;Q15406;Q15406-5	.;NR6A1_HUMAN;.	Q	106;102;102;106;64	ENSP00000420267:R106Q;ENSP00000362686:R102Q;ENSP00000413701:R102Q;ENSP00000341135:R106Q;ENSP00000420587:R64Q	ENSP00000341135:R106Q	R	-	2	0	NR6A1	126356496	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.967000	0.63722	2.577000	0.86979	0.563000	0.77884	CGG	NR6A1	-	pfam_Znf_hrmn_rcpt,smart_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt	ENSG00000148200		0.542	NR6A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NR6A1	HGNC	protein_coding	OTTHUMT00000054043.4	37	0.00	0	C			127316675	127316675	-1	no_errors	ENST00000487099	ensembl	human	known	69_37n	missense	10	50.00	10	SNP	1.000	T
NUB1	51667	genome.wustl.edu	37	7	151049231	151049231	+	Intron	SNP	C	C	T	rs366355	byFrequency	TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr7:151049231C>T	ENST00000355851.4	+	4	421				NUB1_ENST00000568733.1_Intron|NUB1_ENST00000566856.1_Intron|NUB1_ENST00000413040.2_Intron	NM_001243351.1	NP_001230280.1	Q9Y5A7	NUB1_HUMAN	negative regulator of ubiquitin-like proteins 1						positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein ubiquitination (GO:0016567)|response to interferon-gamma (GO:0034341)|response to tumor necrosis factor (GO:0034612)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				endometrium(1)|large_intestine(7)|lung(3)	11			OV - Ovarian serous cystadenocarcinoma(82;0.00569)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		GCGTAGAAGACCCTGTGGATC	0.498													T|||	3506	0.70008	0.5711	0.7997	5008	,	,		17189	0.874		0.7217	False		,,,				2504	0.6022					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF300717	CCDS47751.1, CCDS47751.2, CCDS59089.1	7q36	2006-07-27			ENSG00000013374	ENSG00000013374			17623	protein-coding gene	gene with protein product	"""NEDD8 ultimate buster-1"""	607981				10508479, 11259415	Standard	NM_001243351		Approved	BS4, NYREN18	uc003wjx.3	Q9Y5A7	OTTHUMG00000157365	ENST00000355851.4:c.344+663C>T	7.37:g.151049231C>T			O95422|Q75MR9|Q8IX22|Q9BXR2	Missense_Mutation	SNP	NULL	p.P133S	ENST00000355851.4	37	c.397		7	1629	0.7458791208791209	275	0.5589430894308943	293	0.8093922651933702	511	0.8933566433566433	550	0.7255936675461742	T	4.377	0.069614	0.08436	.	.	ENSG00000013374	ENST00000490215	.	.	.	2.98	-3.42	0.04825	.	.	.	.	.	.	.	.	.	.	.	0.58432	P	1.0000000000287557E-6	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.1442	0.48422	0.0:0.7001:0.0:0.2999	rs366355;rs61021264	.	.	.	.	-1	.	.	.	+	.	.	NUB1	150680164	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.407000	0.07178	-1.260000	0.02465	-1.206000	0.01644	.	NUB1	-	NULL	ENSG00000013374		0.498	NUB1-201	KNOWN	basic|appris_principal	protein_coding	NUB1	HGNC	protein_coding		78	0.00	0	C	NM_016118		151049231	151049231	+1	no_errors	ENST00000470316	ensembl	human	known	69_37n	missense	45	11.76	6	SNP	0.000	T
OBSCN	84033	genome.wustl.edu	37	1	228496062	228496062	+	Silent	SNP	C	C	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr1:228496062C>T	ENST00000422127.1	+	47	12761	c.12717C>T	c.(12715-12717)tcC>tcT	p.S4239S	OBSCN_ENST00000366707.4_Silent_p.S1873S|OBSCN_ENST00000284548.11_Silent_p.S4239S|OBSCN_ENST00000570156.2_Silent_p.S5196S|OBSCN_ENST00000366709.4_Silent_p.S1358S	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4239	Ig-like 43.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				ACCATGCTTCCTCTGCCCAGC	0.637																																						dbGAP											0													19.0	21.0	20.0					1																	228496062		2107	4213	6320	-	-	-	SO:0001819	synonymous_variant	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.12717C>T	1.37:g.228496062C>T			Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.S4239	ENST00000422127.1	37	c.12717	CCDS58065.1	1																																																																																			OBSCN	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2	ENSG00000154358		0.637	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		66	0.00	0	C	NM_052843		228496062	228496062	+1	no_errors	ENST00000422127	ensembl	human	known	69_37n	silent	72	11.11	9	SNP	0.996	T
TENM1	10178	genome.wustl.edu	37	X	123518527	123518527	+	Missense_Mutation	SNP	C	C	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chrX:123518527C>T	ENST00000371130.3	-	29	6296	c.6233G>A	c.(6232-6234)gGa>gAa	p.G2078E	STAG2_ENST00000469481.1_Intron|TENM1_ENST00000422452.2_Missense_Mutation_p.G2085E	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	2078					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										ACTGAATTTTCCAAACTGCTC	0.378																																						dbGAP											0													146.0	129.0	135.0					X																	123518527		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.6233G>A	X.37:g.123518527C>T	ENSP00000360171:p.Gly2078Glu		B2RTR5|Q5JZ17	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD	p.G2085E	ENST00000371130.3	37	c.6254	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	C	20.2	3.957422	0.73902	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.88586	-2.4;-2.36	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	D	0.93808	0.8020	M	0.61703	1.905	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.94287	0.7525	10	0.87932	D	0	.	18.6434	0.91402	0.0:1.0:0.0:0.0	.	2084;2085;2078	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	E	2078;2085	ENSP00000360171:G2078E;ENSP00000403954:G2085E	ENSP00000360171:G2078E	G	-	2	0	ODZ1	123346208	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.345000	0.79718	0.600000	0.82982	GGA	ODZ1	-	NULL	ENSG00000009694		0.378	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ1	HGNC	protein_coding	OTTHUMT00000058985.1	86	0.00	0	C	NM_014253		123518527	123518527	-1	no_errors	ENST00000422452	ensembl	human	known	69_37n	missense	74	15.91	14	SNP	1.000	T
TENM1	10178	genome.wustl.edu	37	X	123839049	123839049	+	Missense_Mutation	SNP	T	T	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chrX:123839049T>G	ENST00000371130.3	-	5	892	c.829A>C	c.(829-831)Agt>Cgt	p.S277R	TENM1_ENST00000422452.2_Missense_Mutation_p.S277R	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	277	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TAGTTCTGACTGGCTGCACTG	0.493																																						dbGAP											0													116.0	103.0	107.0					X																	123839049		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.829A>C	X.37:g.123839049T>G	ENSP00000360171:p.Ser277Arg		B2RTR5|Q5JZ17	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD	p.S277R	ENST00000371130.3	37	c.829	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	T	17.78	3.472517	0.63737	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	T;T	0.41400	1.0;1.0	5.69	5.69	0.88448	Teneurin intracellular, N-terminal (2);	0.182122	0.47852	D	0.000206	T	0.45994	0.1370	L	0.47190	1.495	0.37157	D	0.902423	P;P;P	0.45827	0.818;0.818;0.867	B;P;P	0.50082	0.398;0.537;0.63	T	0.56667	-0.7941	10	0.72032	D	0.01	.	10.2328	0.43264	0.15:0.0:0.0:0.85	.	277;277;277	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	R	277	ENSP00000360171:S277R;ENSP00000403954:S277R	ENSP00000360171:S277R	S	-	1	0	ODZ1	123666730	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.141000	0.50593	1.905000	0.55150	0.425000	0.28330	AGT	ODZ1	-	pfam_Ten_N	ENSG00000009694		0.493	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ1	HGNC	protein_coding	OTTHUMT00000058985.1	20	0.00	0	T	NM_014253		123839049	123839049	-1	no_errors	ENST00000422452	ensembl	human	known	69_37n	missense	18	25.00	6	SNP	1.000	G
OR11H4	390442	genome.wustl.edu	37	14	20711290	20711290	+	Missense_Mutation	SNP	T	T	C			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr14:20711290T>C	ENST00000315409.2	+	1	393	c.340T>C	c.(340-342)Ttc>Ctc	p.F114L		NM_001004479.1	NP_001004479.1	Q8NGC9	O11H4_HUMAN	olfactory receptor, family 11, subfamily H, member 4	114						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(3)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	29	all_cancers(95;0.000888)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0146)		GTTCTATTTCTTCTTTTCACT	0.468																																						dbGAP											0													102.0	106.0	105.0					14																	20711290		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32034.1	14q11.2	2013-09-24			ENSG00000176198	ENSG00000176198		"""GPCR / Class A : Olfactory receptors"""	15347	protein-coding gene	gene with protein product							Standard	NM_001004479		Approved		uc010tld.2	Q8NGC9	OTTHUMG00000170852	ENST00000315409.2:c.340T>C	14.37:g.20711290T>C	ENSP00000318997:p.Phe114Leu		B2RNQ4|Q6IF07	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.F114L	ENST00000315409.2	37	c.340	CCDS32034.1	14	.	.	.	.	.	.	.	.	.	.	T	18.18	3.567609	0.65651	.	.	ENSG00000176198	ENST00000315409	T	0.02236	4.38	4.75	4.75	0.60458	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000026	T	0.08670	0.0215	M	0.71296	2.17	0.29625	N	0.845904	D	0.64830	0.994	P	0.58620	0.842	T	0.01074	-1.1460	10	0.54805	T	0.06	-19.2452	12.2371	0.54522	0.0:0.0:0.0:1.0	.	114	Q8NGC9	O11H4_HUMAN	L	114	ENSP00000318997:F114L	ENSP00000318997:F114L	F	+	1	0	OR11H4	19781130	0.946000	0.32159	1.000000	0.80357	0.997000	0.91878	2.761000	0.47589	1.993000	0.58246	0.528000	0.53228	TTC	OR11H4	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000176198		0.468	OR11H4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11H4	HGNC	protein_coding	OTTHUMT00000410678.1	63	0.00	0	T			20711290	20711290	+1	no_errors	ENST00000315409	ensembl	human	known	69_37n	missense	56	11.11	7	SNP	1.000	C
P2RY2	5029	genome.wustl.edu	37	11	72946005	72946005	+	Silent	SNP	C	C	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr11:72946005C>G	ENST00000311131.2	+	3	1268	c.801C>G	c.(799-801)ctC>ctG	p.L267L	P2RY2_ENST00000393597.2_Silent_p.L267L|P2RY2_ENST00000393596.2_Silent_p.L267L	NM_002564.2|NM_176072.1	NP_002555|NP_788086	P41231	P2RY2_HUMAN	purinergic receptor P2Y, G-protein coupled, 2	267					cellular ion homeostasis (GO:0006873)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of mucus secretion (GO:0070257)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|receptor activity (GO:0004872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	25					Suramin(DB04786)	CCCGCACCCTCTACTACTCCT	0.642																																						dbGAP											0													110.0	99.0	103.0					11																	72946005		2200	4293	6493	-	-	-	SO:0001819	synonymous_variant	0			U07225	CCDS8219.1	11q13.5-q14.1	2012-08-08				ENSG00000175591		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8541	protein-coding gene	gene with protein product		600041				8159738, 9286708	Standard	NM_002564		Approved	P2U	uc001otj.4	P41231		ENST00000311131.2:c.801C>G	11.37:g.72946005C>G			B2R9W3|Q96EM8	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_P2U_purnocptor,prints_P2_purnocptor,prints_7TM_GPCR_Rhodpsn,prints_P2Y4_purnocptor,pfscan_GPCR_Rhodpsn_supfam	p.L267	ENST00000311131.2	37	c.801	CCDS8219.1	11																																																																																			P2RY2	-	pfam_7TM_GPCR_Rhodpsn,prints_P2_purnocptor,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000175591		0.642	P2RY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY2	HGNC	protein_coding	OTTHUMT00000397336.1	51	0.00	0	C	NM_176072		72946005	72946005	+1	no_errors	ENST00000311131	ensembl	human	known	69_37n	silent	24	35.14	13	SNP	1.000	G
PDXDC2P	283970	genome.wustl.edu	37	16	70065818	70065819	+	RNA	DNP	TC	TC	GA			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T|C	T|C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr16:70065818_70065819TC>GA	ENST00000531894.1	-	0	803_804				MIR1972-2_ENST00000458813.1_RNA	NR_003610.1		Q6P474	PDXD2_HUMAN	pyridoxal-dependent decarboxylase domain containing 2, pseudogene						carboxylic acid metabolic process (GO:0019752)		carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)										GATGCTGGGATCCAAACATAGT	0.465																																						dbGAP											0																																										-	-	-			0					16q22.1	2014-03-20	2010-09-02	2010-09-02	ENSG00000196696	ENSG00000196696			27559	pseudogene	pseudogene			"""pyridoxal-dependent decarboxylase domain containing 2"""	PDXDC2			Standard	NR_003610		Approved	DKFZp761H1120	uc010vlq.1	Q6P474	OTTHUMG00000167595	Exception_encountered	16.37:g.70065818_70065819delinsGA			A8K9Z5	RNA	SNP	-	NULL	ENST00000531894.1	37	NULL		16																																																																																			PDXDC2P	-	-	ENSG00000196696		0.465	PDXDC2P-001	KNOWN	basic|readthrough_transcript	processed_transcript	PDXDC2P	HGNC	processed_transcript	OTTHUMT00000395258.1	100	0.00	0	T|C			70065818|70065819	70065818|70065819	-1	no_errors	ENST00000529089	ensembl	human	known	69_37n	rna	50|49	12.28|10.71	7|6	SNP	1.000	G|A
PEAR1	375033	genome.wustl.edu	37	1	156883526	156883526	+	Missense_Mutation	SNP	A	A	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr1:156883526A>G	ENST00000338302.3	+	22	2912	c.2687A>G	c.(2686-2688)aAt>aGt	p.N896S	PEAR1_ENST00000292357.7_Missense_Mutation_p.N896S			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	896	Pro-rich.				recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					AGCTACAGCAATGGCCCAGGC	0.602																																						dbGAP											0													47.0	48.0	48.0					1																	156883526		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.2687A>G	1.37:g.156883526A>G	ENSP00000344465:p.Asn896Ser		Q8TEK2	Missense_Mutation	SNP	pfam_EGF_laminin,superfamily_Growth_fac_rcpt,smart_EGF-like,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EMI_domain	p.N896S	ENST00000338302.3	37	c.2687	CCDS30892.1	1	.	.	.	.	.	.	.	.	.	.	A	11.39	1.623437	0.28889	.	.	ENSG00000187800	ENST00000338302;ENST00000292357	D;D	0.88124	-2.34;-2.34	5.84	0.506	0.16961	.	0.567495	0.15109	N	0.280092	T	0.28599	0.0708	N	0.00347	-1.61	0.09310	N	1	B	0.23937	0.094	B	0.16722	0.016	T	0.48007	-0.9072	10	0.21014	T	0.42	.	0.7298	0.00955	0.4805:0.1689:0.1879:0.1626	.	896	Q5VY43	PEAR1_HUMAN	S	896	ENSP00000344465:N896S;ENSP00000292357:N896S	ENSP00000292357:N896S	N	+	2	0	PEAR1	155150150	0.000000	0.05858	0.025000	0.17156	0.866000	0.49608	0.715000	0.25822	0.112000	0.17975	0.460000	0.39030	AAT	PEAR1	-	NULL	ENSG00000187800		0.602	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEAR1	HGNC	protein_coding	OTTHUMT00000098937.2	42	0.00	0	A	NM_001080471		156883526	156883526	+1	no_errors	ENST00000292357	ensembl	human	known	69_37n	missense	43	18.87	10	SNP	0.004	G
PIK3R5	23533	genome.wustl.edu	37	17	8794119	8794119	+	Missense_Mutation	SNP	A	A	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr17:8794119A>G	ENST00000447110.1	-	7	717	c.593T>C	c.(592-594)cTg>cCg	p.L198P	PIK3R5_ENST00000584803.1_Missense_Mutation_p.L198P|PIK3R5_ENST00000581552.1_Missense_Mutation_p.L198P	NM_001142633.2|NM_001251851.1|NM_001251852.1|NM_001251853.1|NM_001251855.1	NP_001136105.1|NP_001238780.1|NP_001238781.1|NP_001238782.1|NP_001238784.1	Q8WYR1	PI3R5_HUMAN	phosphoinositide-3-kinase, regulatory subunit 5	198					blood coagulation (GO:0007596)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|G-protein beta/gamma-subunit complex binding (GO:0031683)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(14)|prostate(3)|skin(4)|urinary_tract(1)	34						GAAGGCGTGCAGGAGCAGGGT	0.637																																					NSCLC(18;589 615 7696 20311 50332)	dbGAP											0													125.0	101.0	109.0					17																	8794119		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF128881	CCDS11147.1, CCDS73986.1	17p13.1	2011-10-13	2008-02-04		ENSG00000141506	ENSG00000141506			30035	protein-coding gene	gene with protein product		611317				12507995	Standard	NM_014308		Approved	P101-PI3K, p101	uc002glt.3	Q8WYR1	OTTHUMG00000108197	ENST00000447110.1:c.593T>C	17.37:g.8794119A>G	ENSP00000392812:p.Leu198Pro		B0LPH4|D3DTS3|Q5G936|Q5G938|Q5G939|Q8IZ23|Q9Y2Y2	Missense_Mutation	SNP	pfam_PI3K_1B_gamma_p101_su	p.L198P	ENST00000447110.1	37	c.593	CCDS11147.1	17	.	.	.	.	.	.	.	.	.	.	A	13.24	2.177589	0.38413	.	.	ENSG00000141506	ENST00000269300;ENST00000447110	T	0.77229	-1.08	5.24	4.12	0.48240	.	0.217350	0.38897	N	0.001538	T	0.72269	0.3439	N	0.19112	0.55	0.53688	D	0.999971	P	0.48834	0.916	P	0.56865	0.808	T	0.69273	-0.5188	10	0.30854	T	0.27	-12.9646	7.8655	0.29535	0.5834:0.0:0.0:0.4166	.	198	Q8WYR1	PI3R5_HUMAN	P	198	ENSP00000392812:L198P	ENSP00000269300:L198P	L	-	2	0	PIK3R5	8734844	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.312000	0.51927	1.969000	0.57287	0.454000	0.30748	CTG	PIK3R5	-	pfam_PI3K_1B_gamma_p101_su	ENSG00000141506		0.637	PIK3R5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PIK3R5	HGNC	protein_coding	OTTHUMT00000227003.2	59	0.00	0	A	NM_014308		8794119	8794119	-1	no_errors	ENST00000447110	ensembl	human	known	69_37n	missense	22	38.89	14	SNP	1.000	G
PIWIL3	440822	genome.wustl.edu	37	22	25131764	25131764	+	Silent	SNP	G	G	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr22:25131764G>A	ENST00000332271.5	-	13	1961	c.1545C>T	c.(1543-1545)agC>agT	p.S515S	PIWIL3_ENST00000533313.1_Silent_p.S406S|PIWIL3_ENST00000527701.1_Silent_p.S406S|PIWIL3_ENST00000532537.2_5'UTR	NM_001008496.3|NM_001255975.1	NP_001008496.2|NP_001242904.1	Q7Z3Z3	PIWL3_HUMAN	piwi-like RNA-mediated gene silencing 3	515					cell differentiation (GO:0030154)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	RNA binding (GO:0003723)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(15)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						GACTGCTCCTGCTATAGAGTA	0.438																																						dbGAP											0													208.0	204.0	205.0					22																	25131764		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB079368	CCDS33623.1	22q11.23	2013-02-15	2013-02-15		ENSG00000184571	ENSG00000184571		"""Argonaute/PIWI family"""	18443	protein-coding gene	gene with protein product		610314	"""piwi-like 3 (Drosophila)"""			12906857	Standard	NM_001008496		Approved	HIWI3	uc003abd.2	Q7Z3Z3	OTTHUMG00000150788	ENST00000332271.5:c.1545C>T	22.37:g.25131764G>A				Silent	SNP	pfam_Piwi,pfam_PAZ,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.S515	ENST00000332271.5	37	c.1545	CCDS33623.1	22																																																																																			PIWIL3	-	superfamily_RNaseH-like_dom	ENSG00000184571		0.438	PIWIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIWIL3	HGNC	protein_coding	OTTHUMT00000320084.2	70	0.00	0	G	NM_001008496		25131764	25131764	-1	no_errors	ENST00000332271	ensembl	human	known	69_37n	silent	47	50.00	47	SNP	0.000	A
PKD1L1	168507	genome.wustl.edu	37	7	47835657	47835657	+	Missense_Mutation	SNP	C	C	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr7:47835657C>A	ENST00000289672.2	-	55	8335	c.8285G>T	c.(8284-8286)tGg>tTg	p.W2762L	C7orf69_ENST00000258776.4_Intron|C7orf69_ENST00000418326.2_Intron	NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	2762					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						GACCTTTTCCCACATATAAGC	0.393																																						dbGAP											0													160.0	152.0	154.0					7																	47835657		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.8285G>T	7.37:g.47835657C>A	ENSP00000289672:p.Trp2762Leu		Q6UWK1	Missense_Mutation	SNP	pfam_PKD/REJ-like,pfam_PKD1_2_channel,pfam_PKD_dom,pfam_LipOase_LH2,superfamily_Lipase_LipOase,superfamily_PKD_dom,smart_PKD/Chitinase_dom,smart_LipOase_LH2,pfscan_PKD_dom,pfscan_LipOase_LH2,pfscan_REJ-like	p.W2762L	ENST00000289672.2	37	c.8285	CCDS34633.1	7	.	.	.	.	.	.	.	.	.	.	C	9.423	1.083541	0.20309	.	.	ENSG00000158683	ENST00000289672	T	0.19669	2.13	5.46	3.63	0.41609	.	1.497360	0.04239	N	0.336607	T	0.12475	0.0303	N	0.14661	0.345	0.30675	N	0.752944	P	0.39809	0.689	B	0.38954	0.286	T	0.16129	-1.0413	10	0.07325	T	0.83	-4.1957	6.1545	0.20330	0.1869:0.7198:0.0:0.0933	.	2762	Q8TDX9	PK1L1_HUMAN	L	2762	ENSP00000289672:W2762L	ENSP00000289672:W2762L	W	-	2	0	PKD1L1	47802182	0.013000	0.17824	0.039000	0.18376	0.008000	0.06430	0.653000	0.24902	1.283000	0.44513	0.655000	0.94253	TGG	PKD1L1	-	NULL	ENSG00000158683		0.393	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD1L1	HGNC	protein_coding	OTTHUMT00000340974.1	52	0.00	0	C	NM_138295		47835657	47835657	-1	no_errors	ENST00000289672	ensembl	human	known	69_37n	missense	43	10.42	5	SNP	0.061	A
PLEKHB2	55041	genome.wustl.edu	37	2	131890565	131890565	+	Splice_Site	SNP	G	G	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr2:131890565G>T	ENST00000403716.1	+	6	983		c.e6+1		PLEKHB2_ENST00000404460.1_Splice_Site|PLEKHB2_ENST00000409612.1_Splice_Site|PLEKHB2_ENST00000409158.1_Missense_Mutation_p.V142L|PLEKHB2_ENST00000439822.2_Intron|PLEKHB2_ENST00000234115.6_Splice_Site|PLEKHB2_ENST00000303908.3_Splice_Site|PLEKHB2_ENST00000538982.1_Splice_Site|PLEKHB2_ENST00000438882.2_Splice_Site|PLEKHB2_ENST00000409279.1_Splice_Site	NM_001100623.1|NM_001267062.1|NM_001267063.1|NM_001267064.1|NM_001267065.1|NM_001267066.1|NM_017958.2	NP_001094093.1|NP_001253991.1|NP_001253992.1|NP_001253993.1|NP_001253994.1|NP_001253995.1|NP_060428.2	Q96CS7	PKHB2_HUMAN	pleckstrin homology domain containing, family B (evectins) member 2							endosome (GO:0005768)|membrane (GO:0016020)				large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.0828)		GGCCCCTGAGGTAGGGAGAAC	0.517																																						dbGAP											0													73.0	65.0	68.0					2																	131890565		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS2166.1, CCDS46413.1, CCDS58729.1, CCDS58730.1, CCDS74576.1, CCDS74577.1	2q22.1	2013-01-10			ENSG00000115762	ENSG00000115762		"""Pleckstrin homology (PH) domain containing"""	19236	protein-coding gene	gene with protein product						10200314	Standard	NM_017958		Approved	EVT2, FLJ20783	uc031rpd.1	Q96CS7	OTTHUMG00000131656	ENST00000403716.1:c.423+1G>T	2.37:g.131890565G>T			B4DF08|B4DZ66|B8ZZN1|Q53FF1|Q53TH7|Q86W37|Q9BV75|Q9NWK1	Splice_Site	SNP	-	e5+1	ENST00000403716.1	37	c.423+1	CCDS46413.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|G	13.88|13.88	2.369285|2.369285	0.42003|0.42003	.|.	.|.	ENSG00000115762|ENSG00000115762	ENST00000403716;ENST00000234115;ENST00000438882;ENST00000538982;ENST00000404460;ENST00000409612;ENST00000409279;ENST00000303908|ENST00000409158	.|.	.|.	.|.	4.81|4.81	4.81|4.81	0.61882|0.61882	.|.	.|.	.|.	.|.	.|.	.|T	.|0.64114	.|0.2569	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|D	.|0.58970	.|0.984	.|D	.|0.65443	.|0.935	.|T	.|0.57579	.|-0.7787	.|7	.|0.09084	.|T	.|0.74	.|.	13.7255|13.7255	0.62756|0.62756	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|142	.|B8ZZN1	.|.	.|L	-1|142	.|.	.|ENSP00000386410:V142L	.|V	+|+	.|1	.|0	PLEKHB2|PLEKHB2	131607035|131607035	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.423000|0.423000	0.31445|0.31445	5.070000|5.070000	0.64376|0.64376	2.383000|2.383000	0.81215|0.81215	0.491000|0.491000	0.48974|0.48974	.|GTA	PLEKHB2	-	-	ENSG00000115762		0.517	PLEKHB2-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLEKHB2	HGNC	protein_coding	OTTHUMT00000331304.2	48	0.00	0	G	NM_017958	Intron	131890565	131890565	+1	no_errors	ENST00000303908	ensembl	human	known	69_37n	splice_site	35	10.26	4	SNP	1.000	T
PNPLA1	285848	genome.wustl.edu	37	6	36259244	36259244	+	Missense_Mutation	SNP	G	G	C			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr6:36259244G>C	ENST00000394571.2	+	2	353	c.353G>C	c.(352-354)gGg>gCg	p.G118A	PNPLA1_ENST00000312917.5_Missense_Mutation_p.G23A|PNPLA1_ENST00000388715.3_Missense_Mutation_p.G23A	NM_001145717.1	NP_001139189.2	Q8N8W4	PLPL1_HUMAN	patatin-like phospholipase domain containing 1	118	Patatin.				lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	22						GTCACCACGGGGAAGCTCCAT	0.597																																						dbGAP											0													82.0	73.0	76.0					6																	36259244		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34438.1, CCDS47416.1, CCDS54997.1	6p21.31	2009-01-12			ENSG00000180316	ENSG00000180316		"""Patatin-like phospholipase domain containing"""	21246	protein-coding gene	gene with protein product		612121				16799181, 19029121	Standard	NM_001145717		Approved	FLJ38755, dJ50J22.1	uc010jwf.2	Q8N8W4	OTTHUMG00000014590	ENST00000394571.2:c.353G>C	6.37:g.36259244G>C	ENSP00000378072:p.Gly118Ala		A3RMU3|J3JS20|Q2A6N1|Q3SY95|Q3SY96|Q5R3L2	Missense_Mutation	SNP	pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase	p.G118A	ENST00000394571.2	37	c.353	CCDS54997.1	6	.	.	.	.	.	.	.	.	.	.	G	17.72	3.458373	0.63401	.	.	ENSG00000180316	ENST00000388715;ENST00000312917;ENST00000457797;ENST00000394571	T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09	5.48	3.62	0.41486	Acyl transferase/acyl hydrolase/lysophospholipase (1);	0.000000	0.64402	D	0.000003	D	0.83931	0.5361	M	0.80982	2.52	0.42422	D	0.992645	D;D	0.89917	0.998;1.0	D;D	0.97110	0.924;1.0	D	0.86005	0.1497	10	0.87932	D	0	-21.9806	12.3904	0.55355	0.0:0.0:0.6938:0.3062	.	118;23	Q8N8W4;Q8N8W4-3	PLPL1_HUMAN;.	A	23;23;118;118	ENSP00000373367:G23A;ENSP00000321116:G23A;ENSP00000391868:G118A;ENSP00000378072:G118A	ENSP00000321116:G23A	G	+	2	0	PNPLA1	36367222	1.000000	0.71417	0.429000	0.26710	0.688000	0.40055	8.356000	0.90085	0.606000	0.29965	0.467000	0.42956	GGG	PNPLA1	-	superfamily_Acyl_Trfase/lysoPLipase	ENSG00000180316		0.597	PNPLA1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	PNPLA1	HGNC	protein_coding		48	0.00	0	G	NM_173676		36259244	36259244	+1	no_errors	ENST00000457797	ensembl	human	known	69_37n	missense	44	22.81	13	SNP	0.985	C
PNPLA4	8228	genome.wustl.edu	37	X	7890132	7890132	+	Missense_Mutation	SNP	T	T	C			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chrX:7890132T>C	ENST00000381042.4	-	3	358	c.188A>G	c.(187-189)aAc>aGc	p.N63S	PNPLA4_ENST00000537427.1_5'UTR|PNPLA4_ENST00000444736.1_Missense_Mutation_p.N63S	NM_004650.2	NP_004641.1	P41247	PLPL4_HUMAN	patatin-like phospholipase domain containing 4	63	Patatin.				lipid catabolic process (GO:0016042)		triglyceride lipase activity (GO:0004806)			kidney(1)|large_intestine(3)|lung(2)|prostate(1)	7		Colorectal(8;0.0329)|Medulloblastoma(8;0.232)				GGTAAATTGGTTACATTCCTA	0.403																																						dbGAP											0													56.0	51.0	53.0					X																	7890132		2203	4299	6502	-	-	-	SO:0001583	missense	0			U03886	CCDS14129.1, CCDS55368.1	Xp22.3	2014-03-14			ENSG00000006757	ENSG00000006757	3.1.1.3	"""Patatin-like phospholipase domain containing"""	24887	protein-coding gene	gene with protein product		300102				7806223, 16799181, 19029121	Standard	NM_004650		Approved	DXS1283E, GS2, iPLA2eta	uc011mhr.1	P41247	OTTHUMG00000021103	ENST00000381042.4:c.188A>G	X.37:g.7890132T>C	ENSP00000370430:p.Asn63Ser		A8K1H3|B4E362|Q8WW83	Missense_Mutation	SNP	pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase	p.N63S	ENST00000381042.4	37	c.188	CCDS14129.1	X	.	.	.	.	.	.	.	.	.	.	T	0	-2.833653	0.00069	.	.	ENSG00000006757	ENST00000381042;ENST00000444736;ENST00000442940	T;T;T	0.76578	-1.03;-1.03;-1.03	4.59	-2.33	0.06724	Acyl transferase/acyl hydrolase/lysophospholipase (1);Patatin/Phospholipase A2-related (1);	0.344289	0.31648	N	0.007297	T	0.50103	0.1596	L	0.27053	0.805	0.09310	N	0.999992	B	0.02656	0.0	B	0.04013	0.001	T	0.36407	-0.9749	10	0.07030	T	0.85	-5.4301	0.549	0.00659	0.2681:0.1632:0.1359:0.4328	.	63	P41247	PLPL4_HUMAN	S	63	ENSP00000370430:N63S;ENSP00000415245:N63S;ENSP00000406698:N63S	ENSP00000370430:N63S	N	-	2	0	PNPLA4	7850132	0.400000	0.25295	0.001000	0.08648	0.087000	0.18053	0.635000	0.24629	-0.619000	0.05648	-1.381000	0.01174	AAC	PNPLA4	-	pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase	ENSG00000006757		0.403	PNPLA4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PNPLA4	HGNC	protein_coding	OTTHUMT00000055687.1	59	0.00	0	T	NM_004650		7890132	7890132	-1	no_errors	ENST00000381042	ensembl	human	known	69_37n	missense	26	21.21	7	SNP	0.001	C
PNPLA7	375775	genome.wustl.edu	37	9	140417223	140417223	+	Silent	SNP	T	T	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr9:140417223T>A	ENST00000277531.4	-	8	945	c.759A>T	c.(757-759)ggA>ggT	p.G253G	PNPLA7_ENST00000406427.1_Silent_p.G278G	NM_152286.3	NP_689499.3	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	253					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		TCTCAAAAACTCCATGAAAAG	0.567																																						dbGAP											0													93.0	104.0	101.0					9																	140417223		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK126267	CCDS7045.1, CCDS48070.1	9q34.3	2009-01-12	2006-06-12	2006-06-12	ENSG00000130653	ENSG00000130653		"""Patatin-like phospholipase domain containing"""	24768	protein-coding gene	gene with protein product		612122	"""chromosome 9 open reading frame 111"""	C9orf111		16799181, 12640454, 19029121	Standard	XM_005266082		Approved	FLJ43070, FLJ31318, FLJ44279, RP11-48C7.2, NTEL1, NTE-R1	uc010ncj.1	Q6ZV29	OTTHUMG00000020990	ENST00000277531.4:c.759A>T	9.37:g.140417223T>A			B5MDD3|Q5T364|Q658X0|Q658Y3|Q6ZTS1|Q86YU8|Q8TAY5|Q96N75|Q9H7N5	Silent	SNP	pfam_cNMP-bd_dom,pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.G278	ENST00000277531.4	37	c.834	CCDS7045.1	9																																																																																			PNPLA7	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	ENSG00000130653		0.567	PNPLA7-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	PNPLA7	HGNC	protein_coding	OTTHUMT00000254787.1	14	0.00	0	T	NM_152286		140417223	140417223	-1	no_errors	ENST00000406427	ensembl	human	known	69_37n	silent	7	58.82	10	SNP	0.992	A
POLE	5426	genome.wustl.edu	37	12	133240731	133240731	+	Silent	SNP	C	C	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr12:133240731C>T	ENST00000320574.5	-	23	2608	c.2565G>A	c.(2563-2565)agG>agA	p.R855R	POLE_ENST00000535270.1_Silent_p.R828R	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	855					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	GCTCTAAGGGCCTCCTTCAGA	0.522								DNA polymerases (catalytic subunits)																														dbGAP											0													131.0	129.0	129.0					12																	133240731		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.2565G>A	12.37:g.133240731C>T			Q13533|Q86VH9	Silent	SNP	pfam_DNA_pol_e_suA_C,pfam_DNA-dir_DNA_pol_B_exonuc,pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_3'-5'_exonuclease_PolB-like,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B	p.R866	ENST00000320574.5	37	c.2598	CCDS9278.1	12																																																																																			POLE	-	pfam_DNA-dir_DNA_pol_B_multi_dom,smart_DNA-dir_DNA_pol_B	ENSG00000177084		0.522	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLE	HGNC	protein_coding	OTTHUMT00000397689.2	38	0.00	0	C	NM_006231		133240731	133240731	-1	no_errors	ENST00000455752	ensembl	human	known	69_37n	silent	6	71.43	15	SNP	1.000	T
PPFIA1	8500	genome.wustl.edu	37	11	70229211	70229211	+	3'UTR	SNP	A	A	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr11:70229211A>G	ENST00000253925.7	+	0	3939				AP000487.5_ENST00000524619.1_RNA|PPFIA1_ENST00000530548.1_3'UTR|AP000487.5_ENST00000530690.1_RNA|AP000487.5_ENST00000500185.2_RNA	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1						cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			TACTTGTTATATGGACCCTAA	0.269																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.*115A>G	11.37:g.70229211A>G			A6NLE3|Q13135|Q14567|Q8N4I2	Missense_Mutation	SNP	NULL	p.Y74C	ENST00000253925.7	37	c.221	CCDS31627.1	11	.	.	.	.	.	.	.	.	.	.	A	9.866	1.197590	0.22037	.	.	ENSG00000131626	ENST00000528853	.	.	.	5.62	3.2	0.36748	.	.	.	.	.	T	0.54095	0.1837	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44467	-0.9326	4	.	.	.	.	5.6017	0.17357	0.7356:0.0:0.1384:0.126	.	.	.	.	C	74	.	.	Y	+	2	0	PPFIA1	69906859	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	4.170000	0.58229	0.368000	0.24481	0.533000	0.62120	TAT	PPFIA1	-	NULL	ENSG00000131626		0.269	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPFIA1	HGNC	protein_coding	OTTHUMT00000393905.1	26	0.00	0	A	NM_003626		70229211	70229211	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000528853	ensembl	human	putative	69_37n	missense	33	10.81	4	SNP	1.000	G
PSD	5662	genome.wustl.edu	37	10	104163668	104163668	+	Missense_Mutation	SNP	C	C	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr10:104163668C>A	ENST00000020673.5	-	16	3301	c.2775G>T	c.(2773-2775)caG>caT	p.Q925H	PSD_ENST00000406432.1_Missense_Mutation_p.Q925H	NM_001270966.1|NM_002779.4	NP_001257895.1|NP_002770.3	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	925					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		TCTTGCCCAGCTGGGCGGCCC	0.672																																						dbGAP											0													36.0	30.0	32.0					10																	104163668		2202	4298	6500	-	-	-	SO:0001583	missense	0			X99688	CCDS31272.1, CCDS73187.1	10q24	2013-01-10	2004-04-28		ENSG00000059915	ENSG00000059915		"""Pleckstrin homology (PH) domain containing"""	9507	protein-coding gene	gene with protein product		602327	"""pleckstrin and Sec7 domain protein"""			9417912	Standard	NM_002779		Approved	KIAA2011, TYL, PSD1	uc009xxd.2	A5PKW4	OTTHUMG00000018954	ENST00000020673.5:c.2775G>T	10.37:g.104163668C>A	ENSP00000020673:p.Gln925His		B1AKX7|D3DR87|Q15673|Q8IVG0	Missense_Mutation	SNP	pfam_Sec7,pfam_Pleckstrin_homology,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7,prints_PH_dom-spectrin-type	p.Q925H	ENST00000020673.5	37	c.2775	CCDS31272.1	10	.	.	.	.	.	.	.	.	.	.	C	5.491	0.275512	0.10403	.	.	ENSG00000059915	ENST00000020673;ENST00000541902;ENST00000406432	T;T	0.18338	2.22;2.22	5.12	-10.2	0.00374	.	0.596914	0.16843	N	0.197256	T	0.04907	0.0132	N	0.12182	0.205	0.18873	N	0.999989	B;B;B	0.11235	0.0;0.0;0.004	B;B;B	0.15052	0.001;0.001;0.012	T	0.12682	-1.0538	10	0.40728	T	0.16	.	0.8137	0.01098	0.2855:0.1357:0.3084:0.2704	.	925;828;546	A5PKW4;Q86YI3;A5PKW4-2	PSD1_HUMAN;.;.	H	925;828;925	ENSP00000020673:Q925H;ENSP00000384830:Q925H	ENSP00000020673:Q925H	Q	-	3	2	PSD	104153658	0.000000	0.05858	0.000000	0.03702	0.350000	0.29205	-4.396000	0.00241	-2.697000	0.00400	-0.502000	0.04539	CAG	PSD	-	NULL	ENSG00000059915		0.672	PSD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PSD	HGNC	protein_coding	OTTHUMT00000050041.2	83	0.00	0	C			104163668	104163668	-1	no_errors	ENST00000020673	ensembl	human	known	69_37n	missense	45	15.09	8	SNP	0.000	A
PSD2	84249	genome.wustl.edu	37	5	139193041	139193041	+	Silent	SNP	C	C	T	rs529058855		TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr5:139193041C>T	ENST00000274710.3	+	3	724	c.519C>T	c.(517-519)tgC>tgT	p.C173C		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	173					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGACAGCTGCGTCAGCTTCG	0.647													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16366	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													40.0	43.0	42.0					5																	139193041		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.519C>T	5.37:g.139193041C>T			D3DQD3|Q8N3J8	Silent	SNP	pfam_Sec7,pfam_Pleckstrin_homology,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_Pleckstrin_homology,pfscan_Sec7	p.C173	ENST00000274710.3	37	c.519	CCDS4216.1	5																																																																																			PSD2	-	NULL	ENSG00000146005		0.647	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSD2	HGNC	protein_coding	OTTHUMT00000251339.1	43	0.00	0	C	NM_032289		139193041	139193041	+1	no_errors	ENST00000274710	ensembl	human	known	69_37n	silent	35	14.63	6	SNP	0.704	T
QSOX2	169714	genome.wustl.edu	37	9	139100961	139100961	+	Silent	SNP	C	C	A	rs374752583		TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr9:139100961C>A	ENST00000358701.5	-	12	1747	c.1710G>T	c.(1708-1710)acG>acT	p.T570T		NM_181701.3	NP_859052.3	Q6ZRP7	QSOX2_HUMAN	quiescin Q6 sulfhydryl oxidase 2	570					cell redox homeostasis (GO:0045454)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	thiol oxidase activity (GO:0016972)	p.T570T(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(178;0.0511)		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)		CTGCGGAATACGTGTCTAAGA	0.577																																						dbGAP											1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)											96.0	94.0	94.0					9																	139100961		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ318051	CCDS35178.1	9q34.3	2008-02-05	2007-04-23	2007-04-23	ENSG00000165661	ENSG00000165661			30249	protein-coding gene	gene with protein product		612860	"""quiescin Q6-like 1"""	QSCN6L1		12176051	Standard	NM_181701		Approved	SOXN, DKFZp762A2013	uc010nbi.2	Q6ZRP7	OTTHUMG00000020923	ENST00000358701.5:c.1710G>T	9.37:g.139100961C>A			A2CEE0|A6NLB0|Q5TB37|Q7Z7B6|Q86VV7|Q8N3G2	Silent	SNP	pfam_Evr1_Alr,pfam_Thioredoxin_domain,superfamily_Evr1_Alr,superfamily_Thioredoxin-like_fold	p.T570	ENST00000358701.5	37	c.1710	CCDS35178.1	9																																																																																			QSOX2	-	NULL	ENSG00000165661		0.577	QSOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSOX2	HGNC	protein_coding	OTTHUMT00000055046.2	67	0.00	0	C	NM_181701		139100961	139100961	-1	no_errors	ENST00000358701	ensembl	human	known	69_37n	silent	15	65.12	28	SNP	0.000	A
RAD51AP2	729475	genome.wustl.edu	37	2	17698740	17698740	+	Nonsense_Mutation	SNP	T	T	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr2:17698740T>A	ENST00000399080.2	-	1	966	c.943A>T	c.(943-945)Aaa>Taa	p.K315*		NM_001099218.2	NP_001092688.1	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	315										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(10)|liver(1)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TCTACAGTTTTTTTATCATTC	0.328																																						dbGAP											0													122.0	109.0	113.0					2																	17698740		1805	4066	5871	-	-	-	SO:0001587	stop_gained	0			AK310498	CCDS42656.1	2p24.2	2009-01-13			ENSG00000214842	ENSG00000214842			34417	protein-coding gene	gene with protein product						16990250	Standard	NM_001099218		Approved	FLJ17540	uc002rcl.1	Q09MP3	OTTHUMG00000151761	ENST00000399080.2:c.943A>T	2.37:g.17698740T>A	ENSP00000382030:p.Lys315*			Nonsense_Mutation	SNP	NULL	p.K315*	ENST00000399080.2	37	c.943	CCDS42656.1	2	.	.	.	.	.	.	.	.	.	.	T	33	5.237225	0.95240	.	.	ENSG00000214842	ENST00000399080	.	.	.	4.72	4.72	0.59763	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.148	14.0983	0.65037	0.0:0.0:0.0:1.0	.	.	.	.	X	315	.	ENSP00000382030:K315X	K	-	1	0	RAD51AP2	17562221	0.996000	0.38824	0.713000	0.30519	0.636000	0.38137	3.413000	0.52686	2.065000	0.61736	0.533000	0.62120	AAA	RAD51AP2	-	NULL	ENSG00000214842		0.328	RAD51AP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD51AP2	HGNC	protein_coding	OTTHUMT00000323801.3	81	0.00	0	T	NM_001099218		17698740	17698740	-1	no_errors	ENST00000399080	ensembl	human	known	69_37n	nonsense	98	10.91	12	SNP	0.946	A
RDH11	51109	genome.wustl.edu	37	14	68162412	68162412	+	Missense_Mutation	SNP	C	C	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr14:68162412C>G	ENST00000381346.4	-	1	119	c.9G>C	c.(7-9)gaG>gaC	p.E3D	RDH11_ENST00000428130.2_Missense_Mutation_p.E3D|RDH11_ENST00000553384.1_Missense_Mutation_p.E3D	NM_001252650.1|NM_016026.3	NP_001239579.1|NP_057110.3	Q8TC12	RDH11_HUMAN	retinol dehydrogenase 11 (all-trans/9-cis/11-cis)	3					adaptation of rhodopsin mediated signaling (GO:0016062)|phototransduction, visible light (GO:0007603)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|photoreceptor inner segment (GO:0001917)	NADP-retinol dehydrogenase activity (GO:0052650)|retinol dehydrogenase activity (GO:0004745)			breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(3)|ovary(1)	12				all cancers(60;0.00047)|OV - Ovarian serous cystadenocarcinoma(108;0.00206)|BRCA - Breast invasive adenocarcinoma(234;0.00924)	Vitamin A(DB00162)	GGAACATGAGCTCAACCATCT	0.542																																						dbGAP											0													66.0	57.0	60.0					14																	68162412		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF151840	CCDS32104.1, CCDS58326.1	14q24.1	2013-10-15	2006-05-09		ENSG00000072042	ENSG00000072042	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	17964	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 1"", ""androgen-regulated short-chain dehydrogenase/reductase 1"""	607849	"""retinol dehydrogenase 11 (all-trans and 9-cis)"""			12226107, 8018917, 19027726	Standard	NM_016026		Approved	MDT1, SDR7C1, ARSDR1	uc001xjv.4	Q8TC12	OTTHUMG00000171196	ENST00000381346.4:c.9G>C	14.37:g.68162412C>G	ENSP00000370750:p.Glu3Asp		A6NDK3|A8K062|B2RB26|B4DDW0|Q0QD40|Q6IAH5|Q9NRW0|Q9Y391	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_Epimerase_deHydtase,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.E3D	ENST00000381346.4	37	c.9	CCDS32104.1	14	.	.	.	.	.	.	.	.	.	.	c	8.357	0.832214	0.16820	.	.	ENSG00000072042	ENST00000381346;ENST00000553384;ENST00000428130;ENST00000557273;ENST00000557726	D;T;D;D;D	0.89050	-1.68;-1.37;-1.8;-2.19;-2.46	5.0	-4.44	0.03557	.	1.658090	0.03598	N	0.232946	T	0.74015	0.3661	N	0.14661	0.345	0.09310	N	1	B;B;B	0.16166	0.009;0.016;0.009	B;B;B	0.15484	0.006;0.013;0.006	T	0.62900	-0.6756	10	0.13108	T	0.6	.	2.4191	0.04444	0.3326:0.3569:0.2179:0.0926	.	3;3;3	B4DDW0;Q8TC12-2;Q8TC12	.;.;RDH11_HUMAN	D	3	ENSP00000370750:E3D;ENSP00000452079:E3D;ENSP00000416395:E3D;ENSP00000450651:E3D;ENSP00000450435:E3D	ENSP00000370750:E3D	E	-	3	2	RDH11	67232165	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.077000	0.03416	-1.018000	0.03363	-2.172000	0.00323	GAG	RDH11	-	NULL	ENSG00000072042		0.542	RDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RDH11	HGNC	protein_coding	OTTHUMT00000412257.3	26	0.00	0	C			68162412	68162412	-1	no_errors	ENST00000381346	ensembl	human	known	69_37n	missense	13	27.78	5	SNP	0.000	G
RIF1	55183	genome.wustl.edu	37	2	152266473	152266473	+	5'UTR	SNP	T	T	C	rs2290368	byFrequency	TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr2:152266473T>C	ENST00000243326.5	+	0	19				RIF1_ENST00000430328.2_5'Flank|RIF1_ENST00000433166.2_Intron|RIF1_ENST00000428287.2_Intron|RIF1_ENST00000444746.2_5'UTR|RIF1_ENST00000453091.2_5'UTR			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1						fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		CAGCCGGAGCTGGGAAAGTCG	0.647											OREG0015013	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	2192	0.4377	0.4206	0.4481	5008	,	,		15465	0.4871		0.4026	False		,,,				2504	0.4387					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.-465T>C	2.37:g.152266473T>C		1746	A0AVS0|Q9NS16	Missense_Mutation	SNP	pfam_Rif1_N,superfamily_ARM-type_fold	p.W2R	ENST00000243326.5	37	c.4	CCDS2194.1	2	907	0.4152930402930403	189	0.38414634146341464	141	0.38950276243093923	268	0.46853146853146854	309	0.4076517150395778	C	0.649	-0.810432	0.02798	.	.	ENSG00000080345	ENST00000414861	.	.	.	3.77	-1.98	0.07480	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.45403	P	0.0016169999999999796	.	.	.	.	.	.	T	0.46034	-0.9220	3	.	.	.	.	2.159	0.03820	0.3188:0.404:0.1122:0.1649	rs2290368;rs60101216;rs2290368	.	.	.	R	2	.	.	W	+	1	0	RIF1	151974719	0.000000	0.05858	0.000000	0.03702	0.048000	0.14542	-0.381000	0.07417	-1.468000	0.01892	-3.522000	0.00032	TGG	RIF1	-	NULL	ENSG00000080345		0.647	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RIF1	HGNC	protein_coding	OTTHUMT00000254836.3	41	0.00	0	T			152266473	152266473	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000414861	ensembl	human	novel	69_37n	missense	52	10.34	6	SNP	0.000	C
RNFT2	84900	genome.wustl.edu	37	12	117289613	117289613	+	Intron	SNP	G	G	C	rs903775	byFrequency	TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr12:117289613G>C	ENST00000392549.2	+	12	1604				RNFT2_ENST00000319176.7_Missense_Mutation_p.G277A|RNFT2_ENST00000551251.1_Intron|RNFT2_ENST00000407967.3_Intron	NM_001109903.1	NP_001103373.1	Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2							integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		agaaagaaAGGTCAGCTTTGG	0.468													G|||	2250	0.449281	0.0378	0.7723	5008	,	,		19334	0.4732		0.7286	False		,,,				2504	0.4642					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000392549.2:c.1333-530G>C	12.37:g.117289613G>C			E9PAM7|Q96SU5	Missense_Mutation	SNP	NULL	p.G277A	ENST00000392549.2	37	c.830	CCDS44987.1	12	1155	0.5288461538461539	32	0.06504065040650407	282	0.7790055248618785	285	0.4982517482517482	556	0.7335092348284961	G	9.990	1.230492	0.22542	.	.	ENSG00000135119	ENST00000319176	T	0.65916	-0.18	3.55	0.676	0.17958	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.29397	-1.0013	5	0.62326	D	0.03	.	3.693	0.08353	0.2348:0.2071:0.5581:0.0	rs903775;rs17850810;rs903775	.	.	.	A	277	ENSP00000321405:G277A	ENSP00000321405:G277A	G	+	2	0	RNFT2	115773996	0.000000	0.05858	0.000000	0.03702	0.077000	0.17291	-0.085000	0.11250	0.141000	0.18875	-0.476000	0.04901	GGT	RNFT2	-	NULL	ENSG00000135119		0.468	RNFT2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RNFT2	HGNC	protein_coding		88	0.00	0	G	NM_032814		117289613	117289613	+1	no_errors	ENST00000319176	ensembl	human	putative	69_37n	missense	46	14.81	8	SNP	0.000	C
SEMA3D	223117	genome.wustl.edu	37	7	84644491	84644491	+	Silent	SNP	G	G	C			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr7:84644491G>C	ENST00000284136.6	-	14	1630	c.1587C>G	c.(1585-1587)ctC>ctG	p.L529L	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	529	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						TGTGCAAGGAGAGCTGAACCA	0.453																																					Ovarian(63;442 1191 17318 29975 31528)	dbGAP											0													150.0	139.0	143.0					7																	84644491		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.1587C>G	7.37:g.84644491G>C			A6NK46|Q6UW77|Q8NCQ1	Silent	SNP	pfam_Semaphorin/CD100_Ag,pfam_Ig_V-set,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Ig_sub,pfscan_Semaphorin/CD100_Ag,pfscan_Ig-like	p.L529	ENST00000284136.6	37	c.1587	CCDS34676.1	7																																																																																			SEMA3D	-	superfamily_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000153993		0.453	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3D	HGNC	protein_coding	OTTHUMT00000336084.2	42	0.00	0	G	NM_152754		84644491	84644491	-1	no_errors	ENST00000284136	ensembl	human	known	69_37n	silent	30	18.92	7	SNP	1.000	C
SERPINH1	871	genome.wustl.edu	37	11	75280169	75280169	+	Missense_Mutation	SNP	G	G	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr11:75280169G>A	ENST00000524558.1	+	4	2342	c.907G>A	c.(907-909)Gcc>Acc	p.A303T	SERPINH1_ENST00000533603.1_Missense_Mutation_p.A303T|SERPINH1_ENST00000358171.3_Missense_Mutation_p.A303T|SERPINH1_ENST00000530284.1_Missense_Mutation_p.A303T|SERPINH1_ENST00000525876.1_Missense_Mutation_p.A86T			P50454	SERPH_HUMAN	serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)	303					chondrocyte development involved in endochondral bone morphogenesis (GO:0003433)|collagen biosynthetic process (GO:0032964)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|protein maturation (GO:0051604)|regulation of proteolysis (GO:0030162)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(4)|large_intestine(3)|liver(1)|lung(4)|ovary(2)|stomach(1)	15	Ovarian(111;0.11)					GAAGGCTGTTGCCATCTCCTT	0.607																																						dbGAP											0													65.0	54.0	58.0					11																	75280169		2200	4293	6493	-	-	-	SO:0001583	missense	0			X61598	CCDS8239.1	11q13.5	2014-02-18	2005-08-18		ENSG00000149257	ENSG00000149257		"""Serine (or cysteine) peptidase inhibitors"""	1546	protein-coding gene	gene with protein product		600943	"""serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 2"", ""serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)"""	CBP1, CBP2, SERPINH2		7656593, 9533029, 24172014	Standard	NM_001207014		Approved	HSP47, colligen	uc001owr.3	P50454	OTTHUMG00000165362	ENST00000524558.1:c.907G>A	11.37:g.75280169G>A	ENSP00000434412:p.Ala303Thr		B3KVJ3|P29043|Q5XPB4|Q6NSJ6|Q8IY96|Q9NP88	Missense_Mutation	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	p.A303T	ENST00000524558.1	37	c.907	CCDS8239.1	11	.	.	.	.	.	.	.	.	.	.	G	15.67	2.901731	0.52227	.	.	ENSG00000149257	ENST00000533603;ENST00000358171;ENST00000421448;ENST00000530284;ENST00000524558;ENST00000525876	D;D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76;-1.76	5.54	5.54	0.83059	Serpin domain (3);	0.000000	0.85682	D	0.000000	T	0.81987	0.4939	M	0.72118	2.19	0.80722	D	1	B;B	0.31413	0.254;0.322	B;B	0.32980	0.12;0.156	T	0.78112	-0.2331	10	0.13470	T	0.59	.	16.981	0.86327	0.0:0.0:1.0:0.0	.	303;303	E9PPV6;P50454	.;SERPH_HUMAN	T	303;303;282;303;303;86	ENSP00000434657:A303T;ENSP00000350894:A303T;ENSP00000436305:A303T;ENSP00000434412:A303T;ENSP00000433532:A86T	ENSP00000350894:A303T	A	+	1	0	SERPINH1	74957817	1.000000	0.71417	0.958000	0.39756	0.986000	0.74619	9.745000	0.98856	2.604000	0.88044	0.655000	0.94253	GCC	SERPINH1	-	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	ENSG00000149257		0.607	SERPINH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SERPINH1	HGNC	protein_coding	OTTHUMT00000383610.1	46	0.00	0	G	NM_004353		75280169	75280169	+1	no_errors	ENST00000358171	ensembl	human	known	69_37n	missense	29	12.12	4	SNP	1.000	A
SESTD1	91404	genome.wustl.edu	37	2	180014054	180014054	+	Missense_Mutation	SNP	C	C	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr2:180014054C>T	ENST00000428443.3	-	7	867	c.551G>A	c.(550-552)aGt>aAt	p.S184N		NM_178123.4	NP_835224.3	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	184							phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(3)	30			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			TCCTTTATCACTTCCATTGTT	0.299																																						dbGAP											0													96.0	82.0	87.0					2																	180014054		2201	4297	6498	-	-	-	SO:0001583	missense	0			AK096232	CCDS33338.1	2q31.3	2014-01-28			ENSG00000187231	ENSG00000187231			18379	protein-coding gene	gene with protein product						12837271	Standard	NM_178123		Approved	DKFZp434O0515, Solo	uc002uni.4	Q86VW0	OTTHUMG00000154554	ENST00000428443.3:c.551G>A	2.37:g.180014054C>T	ENSP00000415332:p.Ser184Asn		Q53R38|Q53SP3|Q5GM69|Q8N6M1|Q96LQ2	Missense_Mutation	SNP	superfamily_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	p.S184N	ENST00000428443.3	37	c.551	CCDS33338.1	2	.	.	.	.	.	.	.	.	.	.	C	12.83	2.054968	0.36277	.	.	ENSG00000187231	ENST00000428443	T	0.05382	3.45	5.45	5.45	0.79879	.	0.038886	0.85682	D	0.000000	T	0.04497	0.0123	N	0.08118	0	0.46499	D	0.999079	B	0.06786	0.001	B	0.04013	0.001	T	0.50642	-0.8804	9	.	.	.	-15.852	18.8932	0.92413	0.0:1.0:0.0:0.0	.	184	Q86VW0	SESD1_HUMAN	N	184	ENSP00000415332:S184N	.	S	-	2	0	SESTD1	179722299	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.925000	0.48884	2.546000	0.85860	0.655000	0.94253	AGT	SESTD1	-	NULL	ENSG00000187231		0.299	SESTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SESTD1	HGNC	protein_coding	OTTHUMT00000335916.2	79	0.00	0	C	NM_178123		180014054	180014054	-1	no_errors	ENST00000428443	ensembl	human	known	69_37n	missense	76	30.91	34	SNP	1.000	T
SHBG	6462	genome.wustl.edu	37	17	7534956	7534956	+	Missense_Mutation	SNP	A	A	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr17:7534956A>T	ENST00000380450.4	+	5	636	c.605A>T	c.(604-606)aAa>aTa	p.K202I	SHBG_ENST00000576478.1_Missense_Mutation_p.K90I|SHBG_ENST00000575903.1_Intron|SHBG_ENST00000576728.1_Missense_Mutation_p.K90I|SHBG_ENST00000572182.1_Intron|SHBG_ENST00000441599.2_Missense_Mutation_p.K202I|SHBG_ENST00000572262.1_Missense_Mutation_p.K90I|SHBG_ENST00000575314.1_Missense_Mutation_p.K144I|SHBG_ENST00000416273.3_Missense_Mutation_p.K202I|SHBG_ENST00000574539.1_Missense_Mutation_p.K144I|SHBG_ENST00000570547.1_Missense_Mutation_p.K144I|SHBG_ENST00000340624.5_Missense_Mutation_p.K144I	NM_001040.3	NP_001031.2	P04278	SHBG_HUMAN	sex hormone-binding globulin	202	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				primary spermatocyte growth (GO:0007285)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	androgen binding (GO:0005497)	p.0?(1)|p.?(1)		cervix(1)|endometrium(2)|large_intestine(4)|lung(2)|skin(1)	10		all_cancers(10;0.0867)		READ - Rectum adenocarcinoma(115;0.168)	Danazol(DB01406)|Drostanolone(DB00858)|Estradiol(DB00783)|Estropipate(DB04574)|Fluoxymesterone(DB01185)|Hydrocortisone(DB00741)|Methyltestosterone(DB06710)|Mitotane(DB00648)|Norethindrone(DB00717)|Spironolactone(DB00421)|Testosterone(DB00624)|transdermal testosterone gel(DB05275)	TGGCTGGACAAACAGGCCGAG	0.552																																						dbGAP											2	Unknown(1)|Whole gene deletion(1)	haematopoietic_and_lymphoid_tissue(1)|bone(1)											124.0	132.0	129.0					17																	7534956		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11117.1, CCDS54082.1, CCDS54083.1, CCDS58513.1, CCDS73961.1, CCDS73962.1	17p13.1	2013-09-19			ENSG00000129214	ENSG00000129214			10839	protein-coding gene	gene with protein product	"""androgen binding protein"""	182205				2587256	Standard	NM_001146279		Approved	ABP, TEBG, MGC126834, MGC138391	uc002gie.2	P04278	OTTHUMG00000108153	ENST00000380450.4:c.605A>T	17.37:g.7534956A>T	ENSP00000369816:p.Lys202Ile		B0FWH4|E9PGW1|F5H5Z8|I3L1N7|P14689|Q16616|Q3MIL0|Q6ISD2	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	p.K202I	ENST00000380450.4	37	c.605	CCDS11117.1	17	.	.	.	.	.	.	.	.	.	.	A	9.015	0.983442	0.18889	.	.	ENSG00000129214	ENST00000340624;ENST00000441599;ENST00000416273;ENST00000441313;ENST00000380450	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	4.77	-7.79	0.01218	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.870704	0.10032	N	0.724648	T	0.48995	0.1531	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B;B;B;B	0.30763	0.004;0.294;0.091;0.02;0.091;0.001;0.005;0.002	B;B;B;B;B;B;B;B	0.28305	0.014;0.057;0.024;0.088;0.024;0.023;0.017;0.009	T	0.40590	-0.9555	10	0.40728	T	0.16	0.1243	1.2582	0.01996	0.2646:0.3659:0.1521:0.2174	.	202;121;148;202;121;175;202;144	F5H5Z8;B0FWH6;E9PH59;E9PGW1;B0FWH5;B0FWH4;P04278;B4DYU0	.;.;.;.;.;.;SHBG_HUMAN;.	I	144;202;202;148;202	ENSP00000345675:K144I;ENSP00000393426:K202I;ENSP00000388867:K202I;ENSP00000369816:K202I	ENSP00000345675:K144I	K	+	2	0	SHBG	7475681	0.000000	0.05858	0.000000	0.03702	0.115000	0.19883	-0.696000	0.05104	-1.411000	0.02032	0.460000	0.39030	AAA	SHBG	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000129214		0.552	SHBG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SHBG	HGNC	protein_coding	OTTHUMT00000226957.2	41	0.00	0	A	NM_001040		7534956	7534956	+1	no_errors	ENST00000380450	ensembl	human	known	69_37n	missense	28	19.44	7	SNP	0.000	T
SLC13A1	6561	genome.wustl.edu	37	7	122787318	122787318	+	Missense_Mutation	SNP	G	G	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr7:122787318G>A	ENST00000194130.2	-	7	746	c.707C>T	c.(706-708)aCa>aTa	p.T236I	SLC13A1_ENST00000539873.1_3'UTR	NM_022444.3	NP_071889.2	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 1	236					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	45					Succinic acid(DB00139)	AAGTTTACGTGTCACGTGGCC	0.413																																						dbGAP											0													235.0	180.0	199.0					7																	122787318		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5786.1	7q31.32	2013-07-18	2013-07-18		ENSG00000081800	ENSG00000081800		"""Solute carriers"""	10916	protein-coding gene	gene with protein product		606193	"""solute carrier family 13 (sodium/sulphate symporters), member 1"""			11161786	Standard	NM_022444		Approved	NaSi-1, NAS1	uc003vkm.3	Q9BZW2	OTTHUMG00000157087	ENST00000194130.2:c.707C>T	7.37:g.122787318G>A	ENSP00000194130:p.Thr236Ile		Q9H5Z0	Missense_Mutation	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.T236I	ENST00000194130.2	37	c.707	CCDS5786.1	7	.	.	.	.	.	.	.	.	.	.	G	0.308	-0.969532	0.02232	.	.	ENSG00000081800	ENST00000194130	T	0.03441	3.93	5.0	3.84	0.44239	.	0.305851	0.38663	N	0.001615	T	0.01421	0.0046	N	0.02539	-0.55	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.42103	-0.9471	10	0.02654	T	1	-9.3628	8.7861	0.34821	0.9094:0.0:0.0906:0.0	.	236;236	A4D0X1;Q9BZW2	.;S13A1_HUMAN	I	236	ENSP00000194130:T236I	ENSP00000194130:T236I	T	-	2	0	SLC13A1	122574554	1.000000	0.71417	1.000000	0.80357	0.538000	0.34931	6.158000	0.71851	0.777000	0.33496	-0.339000	0.08088	ACA	SLC13A1	-	pfam_Na/sul_symport	ENSG00000081800		0.413	SLC13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A1	HGNC	protein_coding	OTTHUMT00000347404.1	116	0.00	0	G	NM_022444		122787318	122787318	-1	no_errors	ENST00000194130	ensembl	human	known	69_37n	missense	41	28.07	16	SNP	1.000	A
SLC26A9	115019	genome.wustl.edu	37	1	205895727	205895727	+	Missense_Mutation	SNP	A	A	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr1:205895727A>G	ENST00000367135.3	-	12	1438	c.1325T>C	c.(1324-1326)cTc>cCc	p.L442P	SLC26A9_ENST00000367134.2_Missense_Mutation_p.L442P|SLC26A9_ENST00000340781.4_Missense_Mutation_p.L442P	NM_052934.3	NP_443166.1	Q7LBE3	S26A9_HUMAN	solute carrier family 26 (anion exchanger), member 9	442					anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|positive regulation of gene expression (GO:0010628)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|ATPase binding (GO:0051117)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|secondary active sulfate transmembrane transporter activity (GO:0008271)			NS(1)|breast(3)|endometrium(11)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|skin(7)|urinary_tract(5)	52	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			GGAGTTCTTGAGATTGACAGC	0.567																																						dbGAP											0													155.0	141.0	146.0					1																	205895727		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF331525	CCDS30989.1, CCDS30990.1	1q32.1	2013-07-18	2013-07-18		ENSG00000174502	ENSG00000174502		"""Solute carriers"""	14469	protein-coding gene	gene with protein product	"""anion transporter/exchanger-9"""	608481	"""solute carrier family 26, member 9"""			11834742	Standard	NM_134325		Approved		uc001hdp.3	Q7LBE3	OTTHUMG00000036001	ENST00000367135.3:c.1325T>C	1.37:g.205895727A>G	ENSP00000356103:p.Leu442Pro		A7E2V6|B1AVM8|B1AVM9|B7ZKK2|Q96PK9|Q96RN0	Missense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.L442P	ENST00000367135.3	37	c.1325	CCDS30990.1	1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.293177	0.80914	.	.	ENSG00000174502	ENST00000340781;ENST00000367135;ENST00000367134	D;D;D	0.93859	-3.3;-3.3;-3.3	5.12	5.12	0.69794	Sulphate transporter (1);	0.000000	0.64402	D	0.000002	D	0.97256	0.9103	M	0.90870	3.155	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98212	1.0473	10	0.87932	D	0	.	14.8819	0.70540	1.0:0.0:0.0:0.0	.	442;442	Q7LBE3;B1AVM8	S26A9_HUMAN;.	P	442	ENSP00000341682:L442P;ENSP00000356103:L442P;ENSP00000356102:L442P	ENSP00000341682:L442P	L	-	2	0	SLC26A9	204162350	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.514000	0.90545	2.054000	0.61138	0.459000	0.35465	CTC	SLC26A9	-	pfam_Sulph_transpt,tigrfam_SulP_transpt	ENSG00000174502		0.567	SLC26A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A9	HGNC	protein_coding	OTTHUMT00000087742.1	83	0.00	0	A	NM_052934		205895727	205895727	-1	no_errors	ENST00000340781	ensembl	human	known	69_37n	missense	38	40.62	26	SNP	1.000	G
SLC28A2	9153	genome.wustl.edu	37	15	45564673	45564673	+	Intron	SNP	T	T	C			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr15:45564673T>C	ENST00000347644.3	+	16	1812				CTD-2651B20.3_ENST00000560344.1_RNA|SLC28A2_ENST00000560767.1_3'UTR|CTD-2651B20.3_ENST00000561404.1_RNA	NM_004212.3	NP_004203.2	O43868	S28A2_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 2						nucleobase-containing compound metabolic process (GO:0006139)|purine nucleoside transmembrane transport (GO:0015860)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside:sodium symporter activity (GO:0005415)|purine nucleoside transmembrane transporter activity (GO:0015211)			NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(4)|skin(1)	26		all_cancers(109;8.53e-07)|all_epithelial(112;1.39e-05)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.77e-16)|GBM - Glioblastoma multiforme(94;2.71e-06)	Mercaptopurine(DB01033)	AGAATTGTCCTTGAGTACAGG	0.458																																					NSCLC(92;493 1501 26361 28917 47116)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U84392	CCDS10121.1	15q15	2013-07-17	2013-07-17		ENSG00000137860	ENSG00000137860		"""Solute carriers"""	11002	protein-coding gene	gene with protein product		606208	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 2"""			9435697	Standard	NM_004212		Approved	CNT2, SPNT1, HCNT2, HsT17153	uc001zva.2	O43868	OTTHUMG00000131426	ENST00000347644.3:c.1747+82T>C	15.37:g.45564673T>C			A8K7F9|O43239|Q52LZ0	RNA	SNP	-	NULL	ENST00000347644.3	37	NULL	CCDS10121.1	15																																																																																			SLC28A2	-	-	ENSG00000137860		0.458	SLC28A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC28A2	HGNC	protein_coding	OTTHUMT00000254219.2	17	0.00	0	T	NM_004212		45564673	45564673	+1	no_errors	ENST00000560767	ensembl	human	known	69_37n	rna	16	30.43	7	SNP	0.022	C
SLC41A1	254428	genome.wustl.edu	37	1	205760830	205760830	+	Missense_Mutation	SNP	T	T	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr1:205760830T>G	ENST00000367137.3	-	11	2387	c.1373A>C	c.(1372-1374)tAc>tCc	p.Y458S	SLC41A1_ENST00000468057.1_5'UTR	NM_173854.4	NP_776253.3	Q8IVJ1	S41A1_HUMAN	solute carrier family 41 (magnesium transporter), member 1	458					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	17	Breast(84;0.0799)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			GTCTGCGATGTACAGGAGAAT	0.597											OREG0014162	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													39.0	41.0	40.0					1																	205760830		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ514402	CCDS30988.1	1q32.1	2013-07-17	2013-07-17		ENSG00000133065	ENSG00000133065		"""Solute carriers"""	19429	protein-coding gene	gene with protein product		610801				12810078, 18367447	Standard	NM_173854		Approved	MgtE	uc001hdh.1	Q8IVJ1	OTTHUMG00000036000	ENST00000367137.3:c.1373A>C	1.37:g.205760830T>G	ENSP00000356105:p.Tyr458Ser	2154	Q63HJ4|Q658Z5|Q659A4|Q6MZK2	Missense_Mutation	SNP	pfam_MgtE_Mg_transptr_membr	p.Y458S	ENST00000367137.3	37	c.1373	CCDS30988.1	1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.459693	0.84317	.	.	ENSG00000133065	ENST00000367137	T	0.29917	1.55	5.83	5.83	0.93111	MgtE magnesium transporter, integral membrane (1);	0.000000	0.85682	D	0.000000	T	0.38612	0.1047	M	0.79475	2.455	0.80722	D	1	P	0.34815	0.47	B	0.34242	0.178	T	0.27297	-1.0078	10	0.42905	T	0.14	-16.3798	15.8469	0.78899	0.0:0.0:0.0:1.0	.	458	Q8IVJ1	S41A1_HUMAN	S	458	ENSP00000356105:Y458S	ENSP00000356105:Y458S	Y	-	2	0	SLC41A1	204027453	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.033000	0.88852	2.221000	0.72209	0.533000	0.62120	TAC	SLC41A1	-	pfam_MgtE_Mg_transptr_membr	ENSG00000133065		0.597	SLC41A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC41A1	HGNC	protein_coding	OTTHUMT00000087731.1	113	0.88	1	T			205760830	205760830	-1	no_errors	ENST00000367137	ensembl	human	known	69_37n	missense	56	34.12	29	SNP	1.000	G
SLC4A3	6508	genome.wustl.edu	37	2	220495072	220495072	+	Missense_Mutation	SNP	A	A	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr2:220495072A>G	ENST00000358055.3	+	6	1321	c.809A>G	c.(808-810)aAg>aGg	p.K270R	SLC4A3_ENST00000273063.6_Missense_Mutation_p.K297R|SLC4A3_ENST00000497589.1_Intron|SLC4A3_ENST00000317151.3_Missense_Mutation_p.K270R|SLC4A3_ENST00000373762.3_Missense_Mutation_p.K297R|SLC4A3_ENST00000373760.2_Missense_Mutation_p.K270R			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	270					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GACGACATGAAGAGTGAGTGA	0.642																																						dbGAP											0													46.0	51.0	49.0					2																	220495072		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.809A>G	2.37:g.220495072A>G	ENSP00000350756:p.Lys270Arg		A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Anion_exchange_3,prints_Anion_exchange,tigrfam_HCO3_transpt_euk	p.K297R	ENST00000358055.3	37	c.890	CCDS2445.1	2	.	.	.	.	.	.	.	.	.	.	A	27.4	4.824431	0.90955	.	.	ENSG00000114923	ENST00000358055;ENST00000373760;ENST00000273063;ENST00000373762;ENST00000317151	T;T;T;T;T	0.31769	1.48;1.48;1.48;1.48;1.48	4.32	4.32	0.51571	.	0.118961	0.56097	D	0.000035	T	0.46927	0.1418	L	0.53249	1.67	0.58432	D	0.999997	D;D	0.69078	0.996;0.997	P;D	0.70716	0.864;0.97	T	0.36553	-0.9743	10	0.39692	T	0.17	.	11.8815	0.52578	1.0:0.0:0.0:0.0	.	270;297	P48751;P48751-3	B3A3_HUMAN;.	R	270;270;297;297;270	ENSP00000350756:K270R;ENSP00000362865:K270R;ENSP00000273063:K297R;ENSP00000362867:K297R;ENSP00000314006:K270R	ENSP00000273063:K297R	K	+	2	0	SLC4A3	220203316	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	9.077000	0.94016	1.807000	0.52817	0.379000	0.24179	AAG	SLC4A3	-	NULL	ENSG00000114923		0.642	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SLC4A3	HGNC	protein_coding	OTTHUMT00000316472.1	22	0.00	0	A	NM_005070		220495072	220495072	+1	no_errors	ENST00000273063	ensembl	human	known	69_37n	missense	9	25.00	3	SNP	1.000	G
SLC5A5	6528	genome.wustl.edu	37	19	17983256	17983256	+	Missense_Mutation	SNP	G	G	C			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr19:17983256G>C	ENST00000222248.3	+	1	475	c.128G>C	c.(127-129)aGc>aCc	p.S43T		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	43					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)			NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						GGGCAGCGCAGCGCTGAGGAC	0.716																																					Melanoma(65;1008 1708 7910 46650)	dbGAP											0													17.0	19.0	18.0					19																	17983256		2196	4287	6483	-	-	-	SO:0001583	missense	0				CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.128G>C	19.37:g.17983256G>C	ENSP00000222248:p.Ser43Thr		O43702|Q2M335|Q9NYB6	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.S43T	ENST00000222248.3	37	c.128	CCDS12368.1	19	.	.	.	.	.	.	.	.	.	.	G	2.315	-0.357024	0.05138	.	.	ENSG00000105641	ENST00000222248	D	0.84370	-1.84	4.18	3.0	0.34707	.	0.256697	0.43110	D	0.000604	T	0.60958	0.2309	N	0.02985	-0.445	0.33408	D	0.578273	B	0.20459	0.045	B	0.21360	0.034	T	0.61267	-0.7097	10	0.02654	T	1	.	9.8571	0.41092	0.0:0.3905:0.6095:0.0	.	43	Q92911	SC5A5_HUMAN	T	43	ENSP00000222248:S43T	ENSP00000222248:S43T	S	+	2	0	SLC5A5	17844256	0.956000	0.32656	1.000000	0.80357	0.995000	0.86356	2.677000	0.46892	2.079000	0.62486	0.485000	0.47835	AGC	SLC5A5	-	pfscan_Na/solute_symporter	ENSG00000105641		0.716	SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A5	HGNC	protein_coding	OTTHUMT00000466690.1	101	0.00	0	G			17983256	17983256	+1	no_errors	ENST00000222248	ensembl	human	known	69_37n	missense	77	10.47	9	SNP	0.964	C
SNRNP200	23020	genome.wustl.edu	37	2	96952447	96952447	+	Missense_Mutation	SNP	C	C	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr2:96952447C>T	ENST00000323853.5	-	28	3885	c.3808G>A	c.(3808-3810)Gtg>Atg	p.V1270M	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	1270	SEC63 1.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						TCAGACACCACTCGGATGAAG	0.547																																						dbGAP											0													103.0	100.0	101.0					2																	96952447		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.3808G>A	2.37:g.96952447C>T	ENSP00000317123:p.Val1270Met		O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Missense_Mutation	SNP	pfam_Sec63-dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Sec63-dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.V1270M	ENST00000323853.5	37	c.3808	CCDS2020.1	2	.	.	.	.	.	.	.	.	.	.	C	20.8	4.054587	0.75960	.	.	ENSG00000144028	ENST00000323853	T	0.64260	-0.09	4.75	4.75	0.60458	Sec63 domain (3);	0.066929	0.64402	D	0.000018	T	0.76054	0.3934	M	0.86178	2.8	0.80722	D	1	P	0.41978	0.767	P	0.50490	0.642	T	0.80872	-0.1188	10	0.72032	D	0.01	-19.9559	16.6715	0.85268	0.0:1.0:0.0:0.0	.	1270	O75643	U520_HUMAN	M	1270	ENSP00000317123:V1270M	ENSP00000317123:V1270M	V	-	1	0	SNRNP200	96316174	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	4.782000	0.62396	2.477000	0.83638	0.455000	0.32223	GTG	SNRNP200	-	pfam_Sec63-dom,smart_Sec63-dom	ENSG00000144028		0.547	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRNP200	HGNC	protein_coding	OTTHUMT00000252846.2	49	0.00	0	C	NM_014014		96952447	96952447	-1	no_errors	ENST00000323853	ensembl	human	known	69_37n	missense	21	34.38	11	SNP	1.000	T
SNX8	29886	genome.wustl.edu	37	7	2294716	2294716	+	Missense_Mutation	SNP	G	G	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr7:2294716G>A	ENST00000222990.3	-	11	1415	c.1373C>T	c.(1372-1374)cCg>cTg	p.P458L		NM_013321.2	NP_037453.1	Q9Y5X2	SNX8_HUMAN	sorting nexin 8	458					early endosome to Golgi transport (GO:0034498)|intracellular protein transport (GO:0006886)	early endosome membrane (GO:0031901)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			breast(2)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(2)|skin(3)	26		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)		GCCGTCCTCCGGCGGGGAGCA	0.622																																						dbGAP											0													47.0	38.0	41.0					7																	2294716		2184	4286	6470	-	-	-	SO:0001583	missense	0			AF121858	CCDS5331.1	7p22.3	2010-08-05			ENSG00000106266	ENSG00000106266		"""Sorting nexins"""	14972	protein-coding gene	gene with protein product		614905					Standard	NM_013321		Approved	Mvp1	uc003slw.3	Q9Y5X2	OTTHUMG00000151512	ENST00000222990.3:c.1373C>T	7.37:g.2294716G>A	ENSP00000222990:p.Pro458Leu		A4D207|Q96I67	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.P458L	ENST00000222990.3	37	c.1373	CCDS5331.1	7	.	.	.	.	.	.	.	.	.	.	G	8.605	0.887823	0.17540	.	.	ENSG00000106266	ENST00000222990	.	.	.	3.71	-2.66	0.06077	.	0.568748	0.16619	N	0.206574	T	0.15089	0.0364	N	0.22421	0.69	0.20821	N	0.999844	P	0.52692	0.955	B	0.37198	0.243	T	0.17228	-1.0376	9	0.66056	D	0.02	.	9.0671	0.36469	0.0:0.0917:0.5877:0.3206	.	458	Q9Y5X2	SNX8_HUMAN	L	458	.	ENSP00000222990:P458L	P	-	2	0	SNX8	2261242	0.012000	0.17670	0.001000	0.08648	0.363000	0.29612	1.224000	0.32539	-1.061000	0.03185	0.563000	0.77884	CCG	SNX8	-	NULL	ENSG00000106266		0.622	SNX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX8	HGNC	protein_coding	OTTHUMT00000322949.2	133	0.00	0	G			2294716	2294716	-1	no_errors	ENST00000222990	ensembl	human	known	69_37n	missense	53	11.67	7	SNP	0.126	A
SPON1	10418	genome.wustl.edu	37	11	14280846	14280846	+	RNA	SNP	T	T	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr11:14280846T>A	ENST00000310358.7	+	0	2048							Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein						cell adhesion (GO:0007155)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|endometrium(1)|large_intestine(5)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)	21				Epithelial(150;0.00898)		CTGCACCATGTCCGAGTGGAT	0.667																																						dbGAP											0													33.0	35.0	34.0					11																	14280846		2148	4253	6401	-	-	-			0			AB018305	CCDS73262.1	11p15.2	2014-05-06	2004-03-05		ENSG00000152268	ENSG00000262655			11252	protein-coding gene	gene with protein product		604989	"""spondin 1, (f-spondin) extracellular matrix protein"""			9872452	Standard	NM_006108		Approved	KIAA0762, f-spondin	uc001mle.3	Q9HCB6	OTTHUMG00000181576		11.37:g.14280846T>A			A8K6W5|O94862|Q8NCD7|Q8WUR5	RNA	SNP	-	NULL	ENST00000310358.7	37	NULL		11	.	.	.	.	.	.	.	.	.	.	T	40	8.401192	0.98796	.	.	ENSG00000152268	ENST00000310358	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.46347	0.1388	.	.	.	0.45648	D	0.998576	P	0.36354	0.549	B	0.40199	0.322	T	0.54536	-0.8279	7	0.22109	T	0.4	.	14.2209	0.65826	0.0:0.0:0.0:1.0	.	505	Q9HCB6	SPON1_HUMAN	T	504	.	ENSP00000309297:S504T	S	+	1	0	SPON1	14237422	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.682000	0.84083	2.244000	0.73946	0.533000	0.62120	TCC	SPON1	-	-	ENSG00000152268		0.667	SPON1-201	KNOWN	basic	processed_transcript	SPON1	HGNC	processed_transcript		50	0.00	0	T	NM_145584		14280846	14280846	+1	no_errors	ENST00000310358	ensembl	human	known	69_37n	rna	23	28.12	9	SNP	1.000	A
SPRED1	161742	genome.wustl.edu	37	15	38632020	38632020	+	Missense_Mutation	SNP	G	G	C			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr15:38632020G>C	ENST00000299084.4	+	5	1366	c.506G>C	c.(505-507)aGa>aCa	p.R169T		NM_152594.2	NP_689807.1	Q7Z699	SPRE1_HUMAN	sprouty-related, EVH1 domain containing 1	169					inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)|protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)			kidney(6)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(113;2.41e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		GAGCCTTATAGAAGCTCAAAT	0.403									Legius syndrome																												Melanoma(196;2146 2959 7698 16532)	dbGAP											0													104.0	100.0	101.0					15																	38632020		2200	4297	6497	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Neurofibromatosis type 1 - like syndrome, SPRED1 disorder	AK091222	CCDS32193.1	15q14	2014-06-13			ENSG00000166068	ENSG00000166068			20249	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 147"""	609291					Standard	NM_152594		Approved	FLJ33903, PPP1R147	uc001zka.4	Q7Z699		ENST00000299084.4:c.506G>C	15.37:g.38632020G>C	ENSP00000299084:p.Arg169Thr		B2RPJ8|Q05D53|Q8N256	Missense_Mutation	SNP	pfam_Sprouty,pfam_EVH1,smart_EVH1,pfscan_EVH1	p.R169T	ENST00000299084.4	37	c.506	CCDS32193.1	15	.	.	.	.	.	.	.	.	.	.	G	10.32	1.318576	0.23994	.	.	ENSG00000166068	ENST00000299084	T	0.73363	-0.74	4.64	4.64	0.57946	.	0.409391	0.29403	N	0.012257	T	0.59088	0.2168	L	0.34521	1.04	0.30643	N	0.756292	B	0.26318	0.146	B	0.24974	0.057	T	0.53669	-0.8406	10	0.12430	T	0.62	-34.682	9.48	0.38895	0.1519:0.0:0.8481:0.0	.	169	Q7Z699	SPRE1_HUMAN	T	169	ENSP00000299084:R169T	ENSP00000299084:R169T	R	+	2	0	SPRED1	36419312	0.994000	0.37717	1.000000	0.80357	0.987000	0.75469	1.935000	0.40173	2.287000	0.76781	0.585000	0.79938	AGA	SPRED1	-	NULL	ENSG00000166068		0.403	SPRED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRED1	HGNC	protein_coding	OTTHUMT00000418217.1	55	0.00	0	G			38632020	38632020	+1	no_errors	ENST00000299084	ensembl	human	known	69_37n	missense	18	28.00	7	SNP	1.000	C
TBX22	50945	genome.wustl.edu	37	X	79279600	79279600	+	Nonsense_Mutation	SNP	T	T	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chrX:79279600T>A	ENST00000373294.5	+	3	423	c.395T>A	c.(394-396)tTg>tAg	p.L132*	TBX22_ENST00000373296.3_Nonsense_Mutation_p.L132*|TBX22_ENST00000442340.1_Nonsense_Mutation_p.L12*|TBX22_ENST00000373291.1_Nonsense_Mutation_p.L12*	NM_016954.2	NP_058650.1	Q9Y458	TBX22_HUMAN	T-box 22	132					multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(13)|lung(38)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						GTGAAAGGGTTGGATCCAGGG	0.502																																						dbGAP											0													173.0	136.0	148.0					X																	79279600		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AL031000	CCDS14445.1, CCDS43975.1	Xq21.1	2011-02-11			ENSG00000122145	ENSG00000122145		"""T-boxes"""	11600	protein-coding gene	gene with protein product		300307	"""cleft palate and/or ankyloglossia"""	CPX, CLPA		11559848, 14729838	Standard	NM_001109878		Approved		uc004edj.1	Q9Y458	OTTHUMG00000021901	ENST00000373294.5:c.395T>A	X.37:g.79279600T>A	ENSP00000362390:p.Leu132*		Q5JZ06|Q96LC0|Q9HBF1	Nonsense_Mutation	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,prints_TF_T-box,pfscan_TF_T-box	p.L132*	ENST00000373294.5	37	c.395	CCDS14445.1	X	.	.	.	.	.	.	.	.	.	.	T	37	6.495445	0.97612	.	.	ENSG00000122145	ENST00000373296;ENST00000442340;ENST00000373294;ENST00000373291	.	.	.	4.71	4.71	0.59529	.	0.085942	0.48286	D	0.000184	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.1689	0.54146	0.0:0.0:0.0:1.0	.	.	.	.	X	132;12;132;12	.	ENSP00000362388:L12X	L	+	2	0	TBX22	79166256	1.000000	0.71417	0.909000	0.35828	0.638000	0.38207	7.197000	0.77814	1.546000	0.49388	0.481000	0.45027	TTG	TBX22	-	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,prints_TF_T-box,pfscan_TF_T-box	ENSG00000122145		0.502	TBX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX22	HGNC	protein_coding	OTTHUMT00000057334.1	106	0.00	0	T	NM_016954		79279600	79279600	+1	no_errors	ENST00000373294	ensembl	human	known	69_37n	nonsense	56	15.15	10	SNP	1.000	A
TCF20	6942	genome.wustl.edu	37	22	42609249	42609249	+	Missense_Mutation	SNP	G	G	C	rs200310258		TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr22:42609249G>C	ENST00000359486.3	-	1	2199	c.2063C>G	c.(2062-2064)gCg>gGg	p.A688G	TCF20_ENST00000335626.4_Missense_Mutation_p.A688G	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	688					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						ACCAGGGCCCGCTGCAGAGTG	0.522																																						dbGAP											0													117.0	107.0	110.0					22																	42609249		2203	4300	6503	-	-	-	SO:0001583	missense	0			U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.2063C>G	22.37:g.42609249G>C	ENSP00000352463:p.Ala688Gly		A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	smart_Znf_PHD	p.A688G	ENST00000359486.3	37	c.2063	CCDS14033.1	22	.	.	.	.	.	.	.	.	.	.	G	0.007	-2.015395	0.00422	.	.	ENSG00000100207	ENST00000359486;ENST00000335626	T;T	0.58506	0.33;0.33	6.17	-2.3	0.06785	.	0.870444	0.10092	N	0.717086	T	0.30727	0.0774	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.22243	-1.0222	10	0.15499	T	0.54	-1.5214	9.0838	0.36567	0.4383:0.1201:0.4417:0.0	.	688;688	Q9UGU0-2;Q9UGU0	.;TCF20_HUMAN	G	688	ENSP00000352463:A688G;ENSP00000335561:A688G	ENSP00000335561:A688G	A	-	2	0	TCF20	40939193	0.000000	0.05858	0.001000	0.08648	0.105000	0.19272	0.148000	0.16224	-0.536000	0.06298	-1.004000	0.02495	GCG	TCF20	-	NULL	ENSG00000100207		0.522	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF20	HGNC	protein_coding	OTTHUMT00000320531.1	50	0.00	0	G	NM_181492		42609249	42609249	-1	no_errors	ENST00000359486	ensembl	human	known	69_37n	missense	53	17.19	11	SNP	0.000	C
TCP11L2	255394	genome.wustl.edu	37	12	106734742	106734742	+	Silent	SNP	T	T	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr12:106734742T>A	ENST00000299045.3	+	9	1455	c.1281T>A	c.(1279-1281)atT>atA	p.I427I		NM_152772.1	NP_689985.1	Q8N4U5	T11L2_HUMAN	t-complex 11, testis-specific-like 2	427										endometrium(2)|kidney(2)|large_intestine(5)|ovary(3)|prostate(1)|urinary_tract(2)	15						TTTCAAGCATTGAAGAGGAGG	0.368																																						dbGAP											0													180.0	175.0	177.0					12																	106734742		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC033617	CCDS9104.1, CCDS66456.1	12q23.3	2014-08-12	2012-09-20		ENSG00000166046	ENSG00000166046			28627	protein-coding gene	gene with protein product			"""t-complex 11 (mouse) like 2"", ""t-complex 11 (mouse)-like 2"""				Standard	XM_005268769		Approved	MGC40368	uc001tln.3	Q8N4U5	OTTHUMG00000170087	ENST00000299045.3:c.1281T>A	12.37:g.106734742T>A			B2RA65|G3V1Y9	Silent	SNP	pfam_Tcp11	p.I427	ENST00000299045.3	37	c.1281	CCDS9104.1	12																																																																																			TCP11L2	-	pfam_Tcp11	ENSG00000166046		0.368	TCP11L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCP11L2	HGNC	protein_coding	OTTHUMT00000407206.1	39	0.00	0	T	NM_152772		106734742	106734742	+1	no_errors	ENST00000299045	ensembl	human	known	69_37n	silent	29	40.82	20	SNP	0.978	A
THNSL1	79896	genome.wustl.edu	37	10	25314083	25314083	+	Missense_Mutation	SNP	C	C	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr10:25314083C>T	ENST00000524413.1	+	3	2278	c.1931C>T	c.(1930-1932)gCt>gTt	p.A644V	THNSL1_ENST00000376356.4_Missense_Mutation_p.A644V			Q8IYQ7	THNS1_HUMAN	threonine synthase-like 1 (S. cerevisiae)	644						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(5)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28					L-Threonine(DB00156)	CCACACACTGCTGTTGCAAAA	0.453																																						dbGAP											0													91.0	91.0	91.0					10																	25314083		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK025655	CCDS7147.1	10p12.31	2008-02-05	2007-06-20		ENSG00000185875	ENSG00000185875			26160	protein-coding gene	gene with protein product		611260	"""threonine synthase-like 1 (bacterial)"""			12477932	Standard	NM_024838		Approved	FLJ22002	uc001isi.4	Q8IYQ7	OTTHUMG00000017828	ENST00000524413.1:c.1931C>T	10.37:g.25314083C>T	ENSP00000434887:p.Ala644Val		B3KWL1|D3DRV3|Q5VV21	Missense_Mutation	SNP	pfam_Shikimate_kinase,pfam_PyrdxlP-dep_enz_bsu,superfamily_PyrdxlP-dep_enz_bsu,prints_Shikimate_kinase,tigrfam_Thr_synthase	p.A644V	ENST00000524413.1	37	c.1931	CCDS7147.1	10	.	.	.	.	.	.	.	.	.	.	C	18.90	3.721814	0.68959	.	.	ENSG00000185875	ENST00000524413;ENST00000376356	T;T	0.35236	1.32;1.32	5.94	5.94	0.96194	Threonine synthase (1);Pyridoxal phosphate-dependent enzyme, beta subunit (2);	0.056931	0.64402	D	0.000001	T	0.73133	0.3548	H	0.94925	3.6	0.54753	D	0.999988	D	0.89917	1.0	D	0.97110	1.0	T	0.79902	-0.1607	10	0.87932	D	0	-37.0245	20.3633	0.98874	0.0:1.0:0.0:0.0	.	644	Q8IYQ7	THNS1_HUMAN	V	644	ENSP00000434887:A644V;ENSP00000365534:A644V	ENSP00000365534:A644V	A	+	2	0	THNSL1	25354089	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.314000	0.65804	2.826000	0.97356	0.561000	0.74099	GCT	THNSL1	-	pfam_PyrdxlP-dep_enz_bsu,superfamily_PyrdxlP-dep_enz_bsu,tigrfam_Thr_synthase	ENSG00000185875		0.453	THNSL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	THNSL1	HGNC	protein_coding	OTTHUMT00000394913.1	46	0.00	0	C	NM_024838		25314083	25314083	+1	no_errors	ENST00000376356	ensembl	human	known	69_37n	missense	30	44.44	24	SNP	1.000	T
THSD7A	221981	genome.wustl.edu	37	7	11486990	11486990	+	Silent	SNP	T	T	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr7:11486990T>G	ENST00000423059.4	-	12	2918	c.2667A>C	c.(2665-2667)gcA>gcC	p.A889A	AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	889					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		GCACAGGGCCTGCATACTGTA	0.488										HNSCC(18;0.044)																												dbGAP											0													53.0	53.0	53.0					7																	11486990		1922	4122	6044	-	-	-	SO:0001819	synonymous_variant	0				CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.2667A>C	7.37:g.11486990T>G				Silent	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.A889	ENST00000423059.4	37	c.2667	CCDS47543.1	7																																																																																			THSD7A	-	NULL	ENSG00000005108		0.488	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THSD7A	HGNC	protein_coding	OTTHUMT00000325944.4	55	0.00	0	T	XM_928187.2		11486990	11486990	-1	no_errors	ENST00000423059	ensembl	human	known	69_37n	silent	25	24.24	8	SNP	0.804	G
THSD7B	80731	genome.wustl.edu	37	2	137988746	137988746	+	Missense_Mutation	SNP	A	A	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr2:137988746A>G	ENST00000409968.1	+	8	2034	c.1856A>G	c.(1855-1857)aAt>aGt	p.N619S	THSD7B_ENST00000272643.3_Missense_Mutation_p.N619S|THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000413152.2_Missense_Mutation_p.N588S			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	619	TSP type-1 7. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		TCCTGTTCAAATAAAAACTCA	0.502																																						dbGAP											0													52.0	53.0	53.0					2																	137988746		1933	4138	6071	-	-	-	SO:0001583	missense	0					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.1856A>G	2.37:g.137988746A>G	ENSP00000387145:p.Asn619Ser			Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.N619S	ENST00000409968.1	37	c.1856		2	.	.	.	.	.	.	.	.	.	.	A	10.59	1.393371	0.25205	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.51817	0.69;0.69;0.69	5.89	3.57	0.40892	.	0.420094	0.29205	N	0.012831	T	0.17534	0.0421	N	0.01431	-0.87	0.80722	D	1	B;B	0.15930	0.015;0.002	B;B	0.22753	0.041;0.007	T	0.03945	-1.0990	10	0.18710	T	0.47	.	5.4856	0.16747	0.6429:0.0:0.3571:0.0	.	619;588	Q9C0I4;C9JKN6	THS7B_HUMAN;.	S	619;619;588	ENSP00000387145:N619S;ENSP00000272643:N619S;ENSP00000413841:N588S	ENSP00000272643:N619S	N	+	2	0	THSD7B	137705216	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.077000	0.50089	1.067000	0.40740	-0.376000	0.06991	AAT	THSD7B	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000144229		0.502	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	THSD7B	HGNC	protein_coding	OTTHUMT00000331769.2	50	0.00	0	A	XM_046570.9		137988746	137988746	+1	no_errors	ENST00000272643	ensembl	human	known	69_37n	missense	40	11.11	5	SNP	0.989	G
TJP3	27134	genome.wustl.edu	37	19	3735625	3735625	+	Missense_Mutation	SNP	G	G	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr19:3735625G>A	ENST00000541714.2	+	9	1510	c.1048G>A	c.(1048-1050)Gag>Aag	p.E350K	TJP3_ENST00000589378.1_Missense_Mutation_p.E359K|TJP3_ENST00000539908.2_Missense_Mutation_p.E314K|TJP3_ENST00000382008.3_Missense_Mutation_p.E364K|TJP3_ENST00000587686.1_Missense_Mutation_p.E369K|TJP3_ENST00000262968.9_Missense_Mutation_p.E383K	NM_001267560.1	NP_001254489.1	O95049	ZO3_HUMAN	tight junction protein 3	350					regulation of G1/S transition of mitotic cell cycle (GO:2000045)	apical plasma membrane (GO:0016324)|nucleus (GO:0005634)|tight junction (GO:0005923)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAACCAGATGAGCAACGGTC	0.592																																						dbGAP											0													97.0	102.0	101.0					19																	3735625		2203	4300	6503	-	-	-	SO:0001583	missense	0			AC005954	CCDS32873.1, CCDS32873.2, CCDS59332.1	19p13.3	2012-07-12	2012-07-12			ENSG00000105289			11829	protein-coding gene	gene with protein product	"""zona occludens 3"""	612689					Standard	NM_001267560		Approved	ZO-3	uc010xhu.3	O95049		ENST00000541714.2:c.1048G>A	19.37:g.3735625G>A	ENSP00000439278:p.Glu350Lys		A6NFP3|B3KR73|B3KXZ0|B4E2W6|F5H2X0|F5H4S9|K7EK22|Q32N01	Missense_Mutation	SNP	pfam_PDZ,pfam_SH3_2,pfam_Guanylate_kin,superfamily_PDZ,superfamily_SH3_domain,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin,prints_ZonOcculS3,prints_ZonOcculdens	p.E383K	ENST00000541714.2	37	c.1147	CCDS32873.2	19	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.645917	0.00792	.	.	ENSG00000105289	ENST00000541714;ENST00000539908;ENST00000382008;ENST00000262968	T;T;T;T	0.07444	3.19;3.36;3.19;3.3	3.35	2.31	0.28768	.	2.608100	0.01147	N	0.006320	T	0.05547	0.0146	N	0.14661	0.345	0.22096	N	0.99936	B;B;B;B	0.28998	0.058;0.23;0.035;0.034	B;B;B;B	0.31614	0.025;0.133;0.018;0.025	T	0.35649	-0.9780	10	0.02654	T	1	.	6.6276	0.22839	0.1307:0.0:0.8693:0.0	.	369;383;364;350	O95049-3;O95049-2;O95049;F5H2X0	.;.;ZO3_HUMAN;.	K	350;314;364;383	ENSP00000439278:E350K;ENSP00000439991:E314K;ENSP00000371438:E364K;ENSP00000262968:E383K	ENSP00000262968:E383K	E	+	1	0	TJP3	3686625	1.000000	0.71417	0.884000	0.34674	0.015000	0.08874	1.688000	0.37690	0.983000	0.38602	0.511000	0.50034	GAG	TJP3	-	NULL	ENSG00000105289		0.592	TJP3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TJP3	HGNC	protein_coding	OTTHUMT00000453434.1	51	0.00	0	G			3735625	3735625	+1	no_errors	ENST00000262968	ensembl	human	known	69_37n	missense	22	37.14	13	SNP	0.901	A
TMEM38B	55151	genome.wustl.edu	37	9	108536283	108536283	+	Silent	SNP	C	C	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr9:108536283C>T	ENST00000374692.3	+	6	915	c.798C>T	c.(796-798)ggC>ggT	p.G266G	TMEM38B_ENST00000374688.1_Silent_p.G212G	NM_018112.1	NP_060582.1	Q9NVV0	TM38B_HUMAN	transmembrane protein 38B	266						integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum membrane (GO:0033017)	potassium channel activity (GO:0005267)			kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	13						CTTCCAATGGCGTTGGGTCAT	0.408																																						dbGAP											0													95.0	92.0	93.0					9																	108536283		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			BC031938	CCDS6768.1	9q31.3	2013-05-23	2004-12-21	2004-12-22	ENSG00000095209	ENSG00000095209			25535	protein-coding gene	gene with protein product		611236	"""chromosome 9 open reading frame 87"""	C9orf87		17611541, 23316006	Standard	NM_018112		Approved	FLJ10493, bA219P18.1, D4Ertd89e, TRIC-B	uc004bcu.2	Q9NVV0	OTTHUMG00000020429	ENST00000374692.3:c.798C>T	9.37:g.108536283C>T			Q5JR63|Q5SVN5|Q5SVN6|Q5VTE2|Q6IA97	Silent	SNP	pfam_TRIC_channel	p.G266	ENST00000374692.3	37	c.798	CCDS6768.1	9																																																																																			TMEM38B	-	NULL	ENSG00000095209		0.408	TMEM38B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM38B	HGNC	protein_coding	OTTHUMT00000053517.1	50	0.00	0	C	NM_018112		108536283	108536283	+1	no_errors	ENST00000374692	ensembl	human	known	69_37n	silent	15	57.14	20	SNP	0.020	T
TNRC6A	27327	genome.wustl.edu	37	16	24801526	24801526	+	Silent	SNP	A	A	C			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr16:24801526A>C	ENST00000395799.3	+	6	1692	c.1563A>C	c.(1561-1563)acA>acC	p.T521T	TNRC6A_ENST00000315183.7_Silent_p.T521T	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	521	Interaction with argonaute family proteins.|Sufficient for interaction with AGO2.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		ATGGTACTACATGGGGTGCCT	0.473																																						dbGAP											0													119.0	118.0	119.0					16																	24801526		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.1563A>C	16.37:g.24801526A>C			C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Silent	SNP	pfam_Argonaute_hook_dom,superfamily_UBA-like	p.T521	ENST00000395799.3	37	c.1563	CCDS10624.2	16																																																																																			TNRC6A	-	NULL	ENSG00000090905		0.473	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	TNRC6A	HGNC	protein_coding	OTTHUMT00000214081.1	41	0.00	0	A	NM_020847		24801526	24801526	+1	no_errors	ENST00000395799	ensembl	human	known	69_37n	silent	12	52.00	13	SNP	0.272	C
TOP3B	8940	genome.wustl.edu	37	22	22313983	22313983	+	Missense_Mutation	SNP	G	G	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr22:22313983G>T	ENST00000398793.2	-	15	2214	c.1780C>A	c.(1780-1782)Cac>Aac	p.H594N	TOP3B_ENST00000357179.5_Missense_Mutation_p.H594N|TOP3B_ENST00000413067.2_3'UTR	NM_003935.3	NP_003926.1	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta	594					chromosome segregation (GO:0007059)|DNA topological change (GO:0006265)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase activity (GO:0003916)|DNA topoisomerase type I activity (GO:0003917)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(4)|lung(9)|ovary(1)	26	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		ACAAAGTAGTGGAACTTCCTC	0.617																																						dbGAP											0													147.0	133.0	137.0					22																	22313983		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF017146	CCDS13797.1	22q11.22	2011-05-24			ENSG00000100038	ENSG00000100038			11993	protein-coding gene	gene with protein product		603582				9786842, 9074928	Standard	XM_005261811		Approved		uc002zvs.3	O95985	OTTHUMG00000167438	ENST00000398793.2:c.1780C>A	22.37:g.22313983G>T	ENSP00000381773:p.His594Asn		A0M8Q3|Q9BUP5	Missense_Mutation	SNP	pfam_Topo_IA_cen,pfam_Toprim_domain,superfamily_Topo_IA_core_domain,smart_Toprim_domain,smart_Topo_IA_2,smart_Topo_IA_DNA-bd,prints_Topo_IA	p.H594N	ENST00000398793.2	37	c.1780	CCDS13797.1	22	.	.	.	.	.	.	.	.	.	.	G	15.39	2.820844	0.50633	.	.	ENSG00000100038	ENST00000357179;ENST00000398793	T;T	0.20332	2.08;2.08	5.15	5.15	0.70609	DNA topoisomerase, type IA, core domain (1);DNA topoisomerase, type IA, central region, subdomain 1 (1);	0.047338	0.85682	D	0.000000	T	0.22820	0.0551	L	0.52364	1.645	0.80722	D	1	B;B;B	0.15719	0.014;0.005;0.008	B;B;B	0.18561	0.01;0.01;0.022	T	0.05632	-1.0873	10	0.17369	T	0.5	.	18.8091	0.92050	0.0:0.0:1.0:0.0	.	139;594;594	B3KU89;O95985;O95985-2	.;TOP3B_HUMAN;.	N	594	ENSP00000349705:H594N;ENSP00000381773:H594N	ENSP00000349705:H594N	H	-	1	0	TOP3B	20643983	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.006000	0.93592	2.677000	0.91161	0.563000	0.77884	CAC	TOP3B	-	superfamily_Topo_IA_core_domain	ENSG00000100038		0.617	TOP3B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TOP3B	HGNC	protein_coding	OTTHUMT00000320251.1	42	0.00	0	G	NM_003935		22313983	22313983	-1	no_errors	ENST00000357179	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7578403	7578403	+	Missense_Mutation	SNP	C	C	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr17:7578403C>T	ENST00000269305.4	-	5	716	c.527G>A	c.(526-528)tGc>tAc	p.C176Y	TP53_ENST00000413465.2_Missense_Mutation_p.C176Y|TP53_ENST00000445888.2_Missense_Mutation_p.C176Y|TP53_ENST00000359597.4_Missense_Mutation_p.C176Y|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000455263.2_Missense_Mutation_p.C176Y|TP53_ENST00000420246.2_Missense_Mutation_p.C176Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	176	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:8829627, ECO:0000269|PubMed:9450901}.|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation).|CP -> FS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C176F(129)|p.C176Y(63)|p.C83F(9)|p.C44F(9)|p.C176S(8)|p.0?(8)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.C44Y(3)|p.C83Y(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.C176fs*65(1)|p.C176_P177delCP(1)|p.V173fs*69(1)|p.C176fs*68(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.C176del(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.H178fs*3(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGTGGGGGCAGCGCCTCAC	0.652		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	267	Substitution - Missense(224)|Deletion - Frameshift(18)|Deletion - In frame(13)|Whole gene deletion(8)|Complex - deletion inframe(3)|Insertion - Frameshift(1)	lung(42)|large_intestine(38)|upper_aerodigestive_tract(36)|oesophagus(26)|breast(26)|liver(20)|ovary(19)|haematopoietic_and_lymphoid_tissue(13)|stomach(10)|central_nervous_system(9)|bone(9)|urinary_tract(7)|genital_tract(2)|skin(2)|pancreas(2)|prostate(2)|adrenal_gland(1)|vulva(1)|biliary_tract(1)|endometrium(1)											49.0	49.0	49.0					17																	7578403		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.527G>A	17.37:g.7578403C>T	ENSP00000269305:p.Cys176Tyr		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C176Y	ENST00000269305.4	37	c.527	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	24.1	4.497871	0.85069	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99982	-10.62;-10.62;-10.62;-10.62;-10.62;-10.62;-10.62;-10.62	5.59	4.61	0.57282	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.092184	0.85682	D	0.000000	D	0.99981	0.9994	M	0.92923	3.36	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.996;0.997;0.998;0.998;0.997;0.997	D	0.96187	0.9135	10	0.87932	D	0	-18.1821	13.8336	0.63395	0.1543:0.8457:0.0:0.0	.	137;176;176;83;176;176;176	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	Y	176;176;176;176;176;176;165;83;44;83;44	ENSP00000410739:C176Y;ENSP00000352610:C176Y;ENSP00000269305:C176Y;ENSP00000398846:C176Y;ENSP00000391127:C176Y;ENSP00000391478:C176Y;ENSP00000425104:C44Y;ENSP00000423862:C83Y	ENSP00000269305:C176Y	C	-	2	0	TP53	7519128	1.000000	0.71417	0.999000	0.59377	0.851000	0.48451	7.775000	0.85489	1.472000	0.48140	0.655000	0.94253	TGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	27	0.00	0	C	NM_000546		7578403	7578403	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	7	66.67	14	SNP	1.000	T
TRAJ52	28703	genome.wustl.edu	37	14	22957621	22957621	+	RNA	SNP	A	A	C			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr14:22957621A>C	ENST00000390486.1	+	0	69				TRAJ48_ENST00000390489.1_RNA|TRAJ50_ENST00000390487.1_RNA|TRAJ49_ENST00000390488.1_RNA					T cell receptor alpha joining 52																		GGCCAGGGACAAGCTTATCAG	0.473																																						dbGAP											0													86.0	91.0	89.0					14																	22957621		1983	4166	6149	-	-	-			0			M94081		14q11.2	2012-02-07			ENSG00000211838	ENSG00000211838		"""T cell receptors / TRA locus"""	12084	other	T cell receptor gene						8188290	Standard	NG_001332		Approved				OTTHUMG00000170915		14.37:g.22957621A>C				Missense_Mutation	SNP	NULL	p.Q14P	ENST00000390486.1	37	c.41		14																																																																																			TRAJ50	-	NULL	ENSG00000211839		0.473	TRAJ52-001	KNOWN	mRNA_start_NF|mRNA_end_NF|cds_start_NF|cds_end_NF|basic|appris_principal	TR_J_gene	TRAJ50	HGNC	TR_J_gene	OTTHUMT00000410946.1	66	0.00	0	A	NG_001332		22957621	22957621	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000390487	ensembl	human	known	69_37n	missense	29	30.95	13	SNP	0.153	C
TRIM2	23321	genome.wustl.edu	37	4	154178697	154178697	+	Intron	SNP	A	A	G	rs12643843	byFrequency	TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr4:154178697A>G	ENST00000437508.2	+	2	153				TRIM2_ENST00000494872.1_Intron|TRIM2_ENST00000338700.5_Intron	NM_001130067.1	NP_001123539.1	Q9C040	TRIM2_HUMAN	tripartite motif containing 2						cell death (GO:0008219)|regulation of neuron apoptotic process (GO:0043523)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)	19	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		CTGTGCATGAACTGGCACATC	0.473													A|||	1383	0.276158	0.1475	0.2305	5008	,	,		23106	0.1885		0.4165	False		,,,				2504	0.4284					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF220018	CCDS3781.2, CCDS47147.1	4q31.3	2013-01-09	2011-01-25		ENSG00000109654	ENSG00000109654		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	15974	protein-coding gene	gene with protein product		614141	"""tripartite motif-containing 2"""			9628581, 11331580	Standard	NM_015271		Approved	KIAA0517, RNF86	uc003inh.2	Q9C040	OTTHUMG00000155991	ENST00000437508.2:c.-48-12793A>G	4.37:g.154178697A>G			D3DP09|O60272|Q9BSI9|Q9UFZ1	RNA	SNP	-	NULL	ENST00000437508.2	37	NULL	CCDS47147.1	4																																																																																			TRIM2	-	-	ENSG00000109654		0.473	TRIM2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM2	HGNC	protein_coding	OTTHUMT00000342652.1	75	0.00	0	A			154178697	154178697	+1	no_errors	ENST00000502281	ensembl	human	putative	69_37n	rna	29	17.14	6	SNP	0.156	G
TRIM41	90933	genome.wustl.edu	37	5	180657808	180657808	+	Missense_Mutation	SNP	C	C	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr5:180657808C>G	ENST00000315073.5	+	2	1588	c.878C>G	c.(877-879)gCc>gGc	p.A293G	CTC-338M12.7_ENST00000499096.2_RNA|TRIM41_ENST00000351937.5_Missense_Mutation_p.A293G	NM_033549.4	NP_291027.3	Q8WV44	TRI41_HUMAN	tripartite motif containing 41	293					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(3)|prostate(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;9.17e-06)|all_epithelial(37;1.19e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AAGATGAAAGCCAAGGAGGAG	0.567																																						dbGAP											0													163.0	137.0	146.0					5																	180657808		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF258579	CCDS4465.1, CCDS4466.1	5q35.3	2013-01-09	2011-01-25		ENSG00000146063	ENSG00000146063		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19013	protein-coding gene	gene with protein product	"""RING-finger protein that interacts with C kinase"""	610530	"""tripartite motif-containing 41"""			16022281	Standard	NM_033549		Approved	MGC1127, RINCK	uc003mne.2	Q8WV44	OTTHUMG00000130965	ENST00000315073.5:c.878C>G	5.37:g.180657808C>G	ENSP00000320869:p.Ala293Gly		B3KNJ6|D3DWR9|Q5BKT0|Q7L484|Q96Q10|Q9BSL8	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,pfam_DUF3631,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.A293G	ENST00000315073.5	37	c.878	CCDS4466.1	5	.	.	.	.	.	.	.	.	.	.	c	15.79	2.937773	0.52972	.	.	ENSG00000146063	ENST00000515499;ENST00000351937;ENST00000315073;ENST00000438174	T;T;T	0.55588	1.23;0.97;0.51	5.37	3.6	0.41247	.	0.230722	0.30630	N	0.009215	T	0.50222	0.1603	M	0.67700	2.07	0.29842	N	0.829144	P;D;B;B	0.53151	0.648;0.958;0.241;0.241	B;B;B;B	0.44224	0.303;0.444;0.15;0.179	T	0.55655	-0.8107	10	0.59425	D	0.04	.	8.012	0.30359	0.0:0.8133:0.0:0.1867	.	3;293;293;293	D6REK2;Q8WV44;Q8WV44-2;Q8WV44-4	.;TRI41_HUMAN;.;.	G	3;293;293;3	ENSP00000426803:A3G;ENSP00000336749:A293G;ENSP00000320869:A293G	ENSP00000320869:A293G	A	+	2	0	TRIM41	180590414	0.998000	0.40836	1.000000	0.80357	0.895000	0.52256	1.610000	0.36869	0.649000	0.30751	0.457000	0.33378	GCC	TRIM41	-	pfam_DUF3631	ENSG00000146063		0.567	TRIM41-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM41	HGNC	protein_coding	OTTHUMT00000253574.3	84	0.00	0	C	NM_201627		180657808	180657808	+1	no_errors	ENST00000315073	ensembl	human	known	69_37n	missense	20	56.25	27	SNP	1.000	G
TYMP	1890	genome.wustl.edu	37	22	50967689	50967689	+	Missense_Mutation	SNP	G	G	C			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr22:50967689G>C	ENST00000252029.3	-	3	455	c.293C>G	c.(292-294)tCg>tGg	p.S98W	TYMP_ENST00000395678.3_Missense_Mutation_p.S98W|TYMP_ENST00000395680.1_Missense_Mutation_p.S98W|TYMP_ENST00000395681.1_Missense_Mutation_p.S98W|SCO2_ENST00000543927.1_5'Flank	NM_001113755.2|NM_001113756.2|NM_001257988.1|NM_001257989.1|NM_001953.4	NP_001107227.1|NP_001107228.1|NP_001244917.1|NP_001244918.1|NP_001944.1	P19971	TYPH_HUMAN	thymidine phosphorylase	98					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|chemotaxis (GO:0006935)|DNA replication (GO:0006260)|mitochondrial genome maintenance (GO:0000002)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphorylase activity (GO:0004645)|platelet-derived growth factor receptor binding (GO:0005161)|pyrimidine-nucleoside phosphorylase activity (GO:0016154)|thymidine phosphorylase activity (GO:0009032)|transferase activity, transferring pentosyl groups (GO:0016763)			large_intestine(1)|lung(2)|ovary(1)|prostate(1)	5		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)	Capecitabine(DB01101)|Cidofovir(DB00369)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Trifluridine(DB00432)	CTGCTGTCCCGACTGAGCCAG	0.652																																						dbGAP											0													39.0	39.0	39.0					22																	50967689		2203	4299	6502	-	-	-	SO:0001583	missense	0			M63193	CCDS14096.1, CCDS58811.1	22q13	2014-09-17	2008-01-21	2008-01-21	ENSG00000025708	ENSG00000025708	2.4.2.4		3148	protein-coding gene	gene with protein product	"""gliostatin"""	131222	"""endothelial cell growth factor 1 (platelet-derived)"""	MNGIE, ECGF1		1590793, 11733540	Standard	NM_001113755		Approved		uc003bme.5	P19971	OTTHUMG00000150249	ENST00000252029.3:c.293C>G	22.37:g.50967689G>C	ENSP00000252029:p.Ser98Trp		A8MW15|H9KVA0|Q13390|Q8WVB7	Missense_Mutation	SNP	pfam_Glycosyl_Trfase_fam3,pfam_Glycosyl_Trfase_fam3_N_dom,pfam_PYNP_C,superfamily_Glycosyl_Trfase_fam3,superfamily_PYNP_C,superfamily_Glycosyl_Trfase_fam3_N_dom,smart_PYNP_C,pirsf_Pyrmidine_PPase,tigrfam_Pyrmidine_PPas_bac/euk	p.S98W	ENST00000252029.3	37	c.293	CCDS14096.1	22	.	.	.	.	.	.	.	.	.	.	G	15.35	2.806870	0.50421	.	.	ENSG00000025708	ENST00000395680;ENST00000395681;ENST00000252029;ENST00000395678;ENST00000425169	D;D;D;D;D	0.93488	-3.23;-3.23;-3.23;-3.23;-3.23	5.04	4.02	0.46733	Glycosyl transferase, family 3, N-terminal (2);Glycosyl transferase, family 3, subgroup, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.97309	0.9120	M	0.93283	3.4	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;1.0	D	0.97854	1.0276	10	0.87932	D	0	-13.7191	13.2518	0.60055	0.0:0.161:0.839:0.0	.	98;98;98;98	B4DVR2;B2RBL3;E5KRG5;P19971	.;.;.;TYPH_HUMAN	W	98	ENSP00000379037:S98W;ENSP00000379038:S98W;ENSP00000252029:S98W;ENSP00000379036:S98W;ENSP00000395875:S98W	ENSP00000252029:S98W	S	-	2	0	TYMP	49314555	1.000000	0.71417	0.020000	0.16555	0.090000	0.18270	8.560000	0.90712	1.119000	0.41883	0.462000	0.41574	TCG	TYMP	-	pfam_Glycosyl_Trfase_fam3_N_dom,superfamily_Glycosyl_Trfase_fam3_N_dom,pirsf_Pyrmidine_PPase,tigrfam_Pyrmidine_PPas_bac/euk	ENSG00000025708		0.652	TYMP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TYMP	HGNC	protein_coding	OTTHUMT00000317081.1	60	0.00	0	G	NM_001953		50967689	50967689	-1	no_errors	ENST00000252029	ensembl	human	known	69_37n	missense	74	17.78	16	SNP	0.966	C
UGT1A7	54577	genome.wustl.edu	37	2	234590970	234590970	+	Missense_Mutation	SNP	T	T	G	rs71405712|rs17868323	byFrequency	TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr2:234590970T>G	ENST00000373426.3	+	1	387	c.387T>G	c.(385-387)aaT>aaG	p.N129K	UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A1_ENST00000609637.1_Intron	NM_019077.2	NP_061950.2	Q9HAW7	UD17_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A7	129			N -> K (in allele UGT1A7*2 and allele UGT1A7*3; dbSNP:rs17868323). {ECO:0000269|PubMed:11037804, ECO:0000269|PubMed:11434514, ECO:0000269|PubMed:19204906, ECO:0000269|Ref.3}.		cellular glucuronidation (GO:0052695)|coumarin metabolic process (GO:0009804)|drug metabolic process (GO:0017144)|excretion (GO:0007588)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of fatty acid metabolic process (GO:0045922)|retinoic acid metabolic process (GO:0042573)|xenobiotic glucuronidation (GO:0052697)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	drug binding (GO:0008144)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|retinoic acid binding (GO:0001972)			NS(1)|endometrium(6)|kidney(5)|large_intestine(5)|liver(1)|lung(12)|ovary(1)|prostate(1)|skin(1)	33		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;8.93e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000412)|Lung(119;0.00333)|LUSC - Lung squamous cell carcinoma(224;0.00746)	Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)	GTTTGTTTAATGACCGAAAAT	0.368													G|||	2886	0.576278	0.6097	0.5072	5008	,	,		19279	0.4385		0.6034	False		,,,				2504	0.6943					dbGAP											0			GRCh37	CM024576	UGT1A7	M	rs17868323						70.0	76.0	74.0					2																	234590970		2201	4300	6501	-	-	-	SO:0001583	missense	0			U39570	CCDS2506.1	2q37	2010-03-05	2005-07-20		ENSG00000244122	ENSG00000244122		"""UDP glucuronosyltransferases"""	12539	other	complex locus constituent		606432	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 11434514	Standard	NM_019077		Approved	UGT1G		Q9HAW7	OTTHUMG00000059004	ENST00000373426.3:c.387T>G	2.37:g.234590970T>G	ENSP00000362525:p.Asn129Lys		B8K293|O00473	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.N129K	ENST00000373426.3	37	c.387	CCDS2506.1	2	1095	0.5013736263736264	265	0.5386178861788617	185	0.511049723756906	220	0.38461538461538464	425	0.5606860158311345	G	0.103	-1.149935	0.01714	.	.	ENSG00000244122	ENST00000373426	T	0.05855	3.38	4.51	-9.01	0.00744	.	.	.	.	.	T	0.00012	0.0000	N	0.04994	-0.135	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.42582	-0.9443	8	0.27785	T	0.31	.	8.2035	0.31438	0.0617:0.3453:0.391:0.202	rs17868323	129;129	Q5DSZ7;Q9HAW7	.;UD17_HUMAN	K	129	ENSP00000362525:N129K	ENSP00000362525:N129K	N	+	3	2	UGT1A7	234255709	0.000000	0.05858	0.001000	0.08648	0.037000	0.13140	-13.134000	0.00001	-3.135000	0.00235	-1.473000	0.01005	AAT	UGT1A7	-	pfam_UDP_glucos_trans	ENSG00000244122		0.368	UGT1A7-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	UGT1A7	HGNC	protein_coding	OTTHUMT00000130614.1	56	0.00	0	T	NM_019077		234590970	234590970	+1	no_errors	ENST00000373426	ensembl	human	known	69_37n	missense	42	10.64	5	SNP	0.000	G
UGT1A7	54577	genome.wustl.edu	37	2	234590974	234590975	+	Missense_Mutation	DNP	CG	CG	AA	rs397726009|rs17863778|rs17868324|rs386656364|rs71405712|rs66534818	byFrequency	TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C|G	C|G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr2:234590974_234590975CG>AA	ENST00000373426.3	+	1	391_392	c.391_392CG>AA	c.(391-393)CGa>AAa	p.R131K	UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A1_ENST00000609637.1_Intron	NM_019077.2	NP_061950.2	Q9HAW7	UD17_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A7	131			R -> K (in allele UGT1A7*2 and allele UGT1A7*3). {ECO:0000269|PubMed:11037804, ECO:0000269|PubMed:11434514, ECO:0000269|PubMed:19204906, ECO:0000269|Ref.3}.|R -> Q (in dbSNP:rs17868324).		cellular glucuronidation (GO:0052695)|coumarin metabolic process (GO:0009804)|drug metabolic process (GO:0017144)|excretion (GO:0007588)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of fatty acid metabolic process (GO:0045922)|retinoic acid metabolic process (GO:0042573)|xenobiotic glucuronidation (GO:0052697)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	drug binding (GO:0008144)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|retinoic acid binding (GO:0001972)			NS(1)|endometrium(6)|kidney(5)|large_intestine(5)|liver(1)|lung(12)|ovary(1)|prostate(1)|skin(1)	33		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;8.93e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000412)|Lung(119;0.00333)|LUSC - Lung squamous cell carcinoma(224;0.00746)	Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)	GTTTAATGACCGAAAATTAGTA	0.371																																						dbGAP											0			GRCh37	CP005325	UGT1A7	X	rs17863778																																			-	-	-	SO:0001583	missense	0			U39570	CCDS2506.1	2q37	2010-03-05	2005-07-20		ENSG00000244122	ENSG00000244122		"""UDP glucuronosyltransferases"""	12539	other	complex locus constituent		606432	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 11434514	Standard	NM_019077		Approved	UGT1G		Q9HAW7	OTTHUMG00000059004	Exception_encountered	2.37:g.234590974_234590975delinsAA	ENSP00000362525:p.Arg131Lys		B8K293|O00473	Silent|Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.R131|p.R131Q	ENST00000373426.3	37	c.391|c.392	CCDS2506.1	2																																																																																			UGT1A7	-	pfam_UDP_glucos_trans	ENSG00000244122		0.371	UGT1A7-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	UGT1A7	HGNC	protein_coding	OTTHUMT00000130614.1	56	0.00	0	C|G	NM_019077		234590974|234590975	234590974|234590975	+1	no_errors	ENST00000373426	ensembl	human	known	69_37n	silent|missense	40	11.11	5	SNP	0.000	A
VPS39	23339	genome.wustl.edu	37	15	42459590	42459590	+	Splice_Site	SNP	A	A	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr15:42459590A>G	ENST00000348544.4	-	14	1410		c.e14+1		VPS39_ENST00000318006.5_Splice_Site			Q96JC1	VPS39_HUMAN	vacuolar protein sorting 39 homolog (S. cerevisiae)						intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	small GTPase regulator activity (GO:0005083)			breast(2)|kidney(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(109;6.78e-16)|all_epithelial(112;1.81e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;3.05e-06)		CAGGTAACTCACATGGAGATA	0.517																																						dbGAP											0													229.0	222.0	224.0					15																	42459590		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			AF280814	CCDS10083.1, CCDS73710.1	15q14	2008-02-05	2006-12-19		ENSG00000166887	ENSG00000166887			20593	protein-coding gene	gene with protein product		612188	"""vacuolar protein sorting 39 (yeast)"""			11448994	Standard	XM_005254259		Approved	KIAA0770, VAM6	uc001zpc.3	Q96JC1	OTTHUMG00000130467	ENST00000348544.4:c.1410+1T>C	15.37:g.42459590A>G			O94869|Q71SQ6|Q7Z3V3|Q96B93|Q96RM0	Splice_Site	SNP	-	e14+2	ENST00000348544.4	37	c.1410+2	CCDS10083.1	15	.	.	.	.	.	.	.	.	.	.	A	26.0	4.694252	0.88735	.	.	ENSG00000166887	ENST00000318006;ENST00000348544	.	.	.	6.03	6.03	0.97812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5724	0.84622	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	VPS39	40246882	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.320000	0.96346	2.313000	0.78055	0.455000	0.32223	.	VPS39	-	-	ENSG00000166887		0.517	VPS39-002	KNOWN	basic|CCDS	protein_coding	VPS39	HGNC	protein_coding	OTTHUMT00000420472.1	55	0	0	A	NM_015289	Intron	42459590	42459590	-1	no_errors	ENST00000348544	ensembl	human	known	69_37n	splice_site	11	50	11	SNP	1.000	G
WDR66	144406	genome.wustl.edu	37	12	122437845	122437845	+	Missense_Mutation	SNP	C	C	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr12:122437845C>T	ENST00000288912.4	+	20	4084	c.3230C>T	c.(3229-3231)aCt>aTt	p.T1077I		NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	1077							calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		CTGCTCGTTACTAAAGGTAAG	0.507																																					Esophageal Squamous(85;849 1794 49757 52143)	dbGAP											0													84.0	79.0	80.0					12																	122437845		1906	4130	6036	-	-	-	SO:0001583	missense	0			AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.3230C>T	12.37:g.122437845C>T	ENSP00000288912:p.Thr1077Ile		C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.T1077I	ENST00000288912.4	37	c.3230	CCDS41853.1	12	.	.	.	.	.	.	.	.	.	.	C	11.53	1.665960	0.29604	.	.	ENSG00000158023	ENST00000288912	T	0.80304	-1.36	5.31	5.31	0.75309	.	0.469142	0.23524	N	0.047254	T	0.79257	0.4415	M	0.62723	1.935	0.58432	D	0.999996	B	0.28605	0.217	B	0.31337	0.128	T	0.79100	-0.1942	10	0.66056	D	0.02	.	13.4066	0.60917	0.1578:0.8422:0.0:0.0	.	1077	Q8TBY9	WDR66_HUMAN	I	1077	ENSP00000288912:T1077I	ENSP00000288912:T1077I	T	+	2	0	WDR66	120922228	0.046000	0.20272	0.048000	0.18961	0.596000	0.36781	1.302000	0.33459	2.487000	0.83934	0.655000	0.94253	ACT	WDR66	-	NULL	ENSG00000158023		0.507	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR66	HGNC	protein_coding	OTTHUMT00000401700.1	29	0.00	0	C	NM_144668		122437845	122437845	+1	no_errors	ENST00000288912	ensembl	human	known	69_37n	missense	15	34.78	8	SNP	0.124	T
XYLB	9942	genome.wustl.edu	37	3	38390113	38390113	+	Missense_Mutation	SNP	C	C	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr3:38390113C>A	ENST00000207870.3	+	2	220	c.130C>A	c.(130-132)Cca>Aca	p.P44T	XYLB_ENST00000427323.1_Missense_Mutation_p.P44T|XYLB_ENST00000542835.1_5'UTR	NM_005108.3	NP_005099.2	O75191	XYLB_HUMAN	xylulokinase homolog (H. influenzae)	44					carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|D-xylose metabolic process (GO:0042732)|generation of precursor metabolites and energy (GO:0006091)|xylulose catabolic process (GO:0005998)|xylulose metabolic process (GO:0005997)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|xylulokinase activity (GO:0004856)			endometrium(3)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|prostate(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.00372)|Kidney(284;0.00405)		CAGAGATCTTCCAGAATTTGG	0.433																																						dbGAP											0													180.0	161.0	167.0					3																	38390113		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB015046	CCDS2678.1	3p22-p21.3	2006-12-18	2001-12-04		ENSG00000093217	ENSG00000093217			12839	protein-coding gene	gene with protein product		604049	"""xylulokinase (H. influenzae) homolog"""			9763671	Standard	NM_005108		Approved	FLJ10343, FLJ12539	uc003cic.2	O75191	OTTHUMG00000131294	ENST00000207870.3:c.130C>A	3.37:g.38390113C>A	ENSP00000207870:p.Pro44Thr		B2RAW4|B4DDT2|B9EH64	Missense_Mutation	SNP	pfam_Carb_kinase_FGGY_C,pfam_Carb_kinase_FGGY_N	p.P44T	ENST00000207870.3	37	c.130	CCDS2678.1	3	.	.	.	.	.	.	.	.	.	.	C	14.97	2.694578	0.48202	.	.	ENSG00000093217	ENST00000427323;ENST00000207870	T;T	0.23348	1.91;1.91	5.49	3.63	0.41609	Carbohydrate kinase, FGGY, N-terminal (1);	0.154372	0.64402	D	0.000014	T	0.48572	0.1507	M	0.90870	3.155	0.80722	D	1	B	0.30482	0.281	B	0.43658	0.426	T	0.54397	-0.8300	10	0.72032	D	0.01	.	12.5381	0.56152	0.0:0.6784:0.3216:0.0	.	44	O75191	XYLB_HUMAN	T	44	ENSP00000412282:P44T;ENSP00000207870:P44T	ENSP00000207870:P44T	P	+	1	0	XYLB	38365117	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	1.966000	0.40481	0.751000	0.32900	0.462000	0.41574	CCA	XYLB	-	pfam_Carb_kinase_FGGY_N	ENSG00000093217		0.433	XYLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XYLB	HGNC	protein_coding	OTTHUMT00000254062.2	127	0.00	0	C	NM_005108		38390113	38390113	+1	no_errors	ENST00000207870	ensembl	human	known	69_37n	missense	63	24.10	20	SNP	1.000	A
ZFYVE27	118813	genome.wustl.edu	37	10	99509969	99509969	+	Intron	SNP	T	T	C	rs3750615	byFrequency	TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr10:99509969T>C	ENST00000393677.4	+	7	868				ZFYVE27_ENST00000359980.3_Intron|ZFYVE27_ENST00000337540.7_Intron|ZFYVE27_ENST00000453958.2_Intron|ZFYVE27_ENST00000370610.3_Intron|ZFYVE27_ENST00000357540.4_Intron|ZFYVE27_ENST00000356257.4_Intron|ZFYVE27_ENST00000370613.3_Intron	NM_144588.6	NP_653189.3	Q5T4F4	ZFY27_HUMAN	zinc finger, FYVE domain containing 27						cell death (GO:0008219)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein localization to plasma membrane (GO:0072659)	axon (GO:0030424)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)	metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	8		Colorectal(252;0.0846)		Epithelial(162;7.08e-10)|all cancers(201;5.18e-08)		GTTAGGAGGGTGACTCTTTCC	0.478													C|||	3270	0.652955	0.711	0.5663	5008	,	,		19249	0.495		0.7803	False		,,,				2504	0.6677					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC030621	CCDS31263.1, CCDS31264.1, CCDS53562.1, CCDS53563.1, CCDS53564.1, CCDS53565.1	10q24.2	2013-09-11			ENSG00000155256	ENSG00000155256		"""Zinc fingers, FYVE domain containing"""	26559	protein-coding gene	gene with protein product	"""protrudin"""	610243				14702039	Standard	NM_144588		Approved	FLJ32919, SPG33	uc001kol.2	Q5T4F4	OTTHUMG00000018867	ENST00000393677.4:c.665-119T>C	10.37:g.99509969T>C			B7Z3S0|B7Z404|B7Z626|G8JLC3|G8JLF0|J3KP98|Q5T4F1|Q5T4F2|Q5T4F3|Q8N1K0|Q8N6D6|Q8NCA0|Q8NDE4|Q96M08	RNA	SNP	-	NULL	ENST00000393677.4	37	NULL	CCDS31263.1	10																																																																																			ZFYVE27	-	-	ENSG00000155256		0.478	ZFYVE27-003	KNOWN	basic|CCDS	protein_coding	ZFYVE27	HGNC	protein_coding	OTTHUMT00000049745.2	47	0.00	0	T	NM_144588		99509969	99509969	+1	no_errors	ENST00000481956	ensembl	human	known	69_37n	rna	32	11.11	4	SNP	0.000	C
ZMPSTE24	10269	genome.wustl.edu	37	1	40723983	40723983	+	Missense_Mutation	SNP	C	C	G			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr1:40723983C>G	ENST00000372759.3	+	1	205	c.40C>G	c.(40-42)Ccg>Gcg	p.P14A	ZMPSTE24_ENST00000479131.1_3'UTR|RP1-39G22.7_ENST00000567508.1_RNA	NM_005857.4	NP_005848.2	O75844	FACE1_HUMAN	zinc metallopeptidase STE24	14					CAAX-box protein processing (GO:0071586)|nuclear envelope organization (GO:0006998)|prenylated protein catabolic process (GO:0030327)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metalloexopeptidase activity (GO:0008235)			endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	16	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			GTGGGAGATGCCGGCCGAGAA	0.627																																						dbGAP											0													118.0	103.0	108.0					1																	40723983		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y13834	CCDS449.1	1p34	2014-09-17	2012-12-10		ENSG00000084073	ENSG00000084073	3.4.24.84		12877	protein-coding gene	gene with protein product	"""Hutchinson-Gilford progeria syndrome"", ""CAAX prenyl protease 1 homolog"""	606480	"""zinc metalloproteinase (STE24 homolog, yeast)"", ""zinc metallopeptidase (STE24 homolog, yeast)"", ""zinc metallopeptidase STE24 homolog (S. cerevisiae)"""			10373325, 9700155, 16671095	Standard	NM_005857		Approved	FACE-1, Ste24p, STE24, HGPS, PRO1	uc001cfg.4	O75844	OTTHUMG00000005762	ENST00000372759.3:c.40C>G	1.37:g.40723983C>G	ENSP00000361845:p.Pro14Ala		B3KQI7|D3DPU7|Q8NDZ8|Q9UBQ2	Missense_Mutation	SNP	pfam_Peptidase_M48	p.P14A	ENST00000372759.3	37	c.40	CCDS449.1	1	.	.	.	.	.	.	.	.	.	.	C	15.54	2.863525	0.51482	.	.	ENSG00000084073	ENST00000372759	T	0.00892	5.57	5.35	4.43	0.53597	.	0.109631	0.64402	D	0.000005	T	0.01124	0.0037	L	0.39898	1.24	0.46499	D	0.999076	B	0.23442	0.085	B	0.19666	0.026	T	0.63506	-0.6622	10	0.33141	T	0.24	6.573	10.5728	0.45211	0.0:0.8512:0.0:0.1488	.	14	O75844	FACE1_HUMAN	A	14	ENSP00000361845:P14A	ENSP00000361845:P14A	P	+	1	0	ZMPSTE24	40496570	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	2.515000	0.45512	1.246000	0.43901	0.655000	0.94253	CCG	ZMPSTE24	-	NULL	ENSG00000084073		0.627	ZMPSTE24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMPSTE24	HGNC	protein_coding	OTTHUMT00000015766.1	33	0.00	0	C			40723983	40723983	+1	no_errors	ENST00000372759	ensembl	human	known	69_37n	missense	38	20.83	10	SNP	1.000	G
ZNF169	169841	genome.wustl.edu	37	9	97062923	97062923	+	Silent	SNP	C	C	G	rs187190486		TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr9:97062923C>G	ENST00000395395.2	+	5	1173	c.1083C>G	c.(1081-1083)ctC>ctG	p.L361L	ZNF169_ENST00000340911.4_3'UTR	NM_194320.2	NP_919301.2	Q14929	ZN169_HUMAN	zinc finger protein 169	361					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	24		Acute lymphoblastic leukemia(62;0.136)				AGGCATCACTCCTCCAGCACC	0.582																																						dbGAP											0													75.0	65.0	68.0					9																	97062923		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U28322	CCDS6709.2	9q22.32	2014-07-30			ENSG00000175787	ENSG00000175787		"""Zinc fingers, C2H2-type"", ""-"""	12957	protein-coding gene	gene with protein product		603404				9186526, 9071574	Standard	NM_001301275		Approved	MGC51961	uc004aum.1	Q14929	OTTHUMG00000020264	ENST00000395395.2:c.1083C>G	9.37:g.97062923C>G			A2AGP5|A8K127|Q6PI28	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L361	ENST00000395395.2	37	c.1083	CCDS6709.2	9																																																																																			ZNF169	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000175787		0.582	ZNF169-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF169	HGNC	protein_coding	OTTHUMT00000253714.1	51	0.00	0	C	NM_194320		97062923	97062923	+1	no_errors	ENST00000395395	ensembl	human	known	69_37n	silent	23	23.33	7	SNP	0.042	G
ZNF311	282890	genome.wustl.edu	37	6	28963898	28963898	+	Missense_Mutation	SNP	C	C	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr6:28963898C>T	ENST00000377179.3	-	7	1393	c.881G>A	c.(880-882)cGg>cAg	p.R294Q	ZNF311_ENST00000483450.1_5'UTR	NM_001010877.2	NP_001010877.2	Q5JNZ3	ZN311_HUMAN	zinc finger protein 311	294					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|skin(3)|upper_aerodigestive_tract(2)	28						GTGGATTATCCGGTGCATAGA	0.443																																						dbGAP											0													81.0	88.0	85.0					6																	28963898		1511	2707	4218	-	-	-	SO:0001583	missense	0			AL833166	CCDS34357.1	6p21.33	2013-01-08			ENSG00000197935	ENSG00000197935		"""Zinc fingers, C2H2-type"", ""-"""	13847	protein-coding gene	gene with protein product							Standard	XM_006715067		Approved		uc003nlu.2	Q5JNZ3	OTTHUMG00000031292	ENST00000377179.3:c.881G>A	6.37:g.28963898C>T	ENSP00000366384:p.Arg294Gln		A2BFK5|B0S7Y4|Q92971	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R294Q	ENST00000377179.3	37	c.881	CCDS34357.1	6	.	.	.	.	.	.	.	.	.	.	T	1.237	-0.622456	0.03636	.	.	ENSG00000197935	ENST00000377179;ENST00000535083	T	0.17691	2.26	3.55	-3.62	0.04543	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01870	0.0059	N	0.25789	0.76	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46148	-0.9212	9	0.02654	T	1	-0.0075	6.3348	0.21291	0.1664:0.5455:0.0:0.2882	.	294	Q5JNZ3	ZN311_HUMAN	Q	294;202	ENSP00000366384:R294Q	ENSP00000366384:R294Q	R	-	2	0	ZNF311	29071877	0.000000	0.05858	0.123000	0.21794	0.800000	0.45204	-0.428000	0.06991	-1.061000	0.03185	-0.524000	0.04348	CGG	ZNF311	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197935		0.443	ZNF311-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF311	HGNC	protein_coding	OTTHUMT00000076631.3	90	0.00	0	C	XM_212581		28963898	28963898	-1	no_errors	ENST00000377179	ensembl	human	known	69_37n	missense	65	18.75	15	SNP	0.864	T
ZNF597	146434	genome.wustl.edu	37	16	3486435	3486435	+	Missense_Mutation	SNP	T	T	A			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr16:3486435T>A	ENST00000301744.4	-	4	1499	c.1264A>T	c.(1264-1266)Aac>Tac	p.N422Y		NM_152457.1	NP_689670.1	Q96LX8	ZN597_HUMAN	zinc finger protein 597	422					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	13						TACGTGGTGTTTTTTATGTGA	0.388																																						dbGAP											0													53.0	53.0	53.0					16																	3486435		2197	4300	6497	-	-	-	SO:0001583	missense	0			AK057633	CCDS10505.1	16p13.3	2013-01-08			ENSG00000167981	ENSG00000167981		"""Zinc fingers, C2H2-type"", ""-"""	26573	protein-coding gene	gene with protein product		614685				12477932	Standard	NM_152457		Approved	FLJ33071	uc002cvd.3	Q96LX8	OTTHUMG00000129359	ENST00000301744.4:c.1264A>T	16.37:g.3486435T>A	ENSP00000301744:p.Asn422Tyr			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N422Y	ENST00000301744.4	37	c.1264	CCDS10505.1	16	.	.	.	.	.	.	.	.	.	.	T	13.88	2.370420	0.42003	.	.	ENSG00000167981	ENST00000301744	T	0.08102	3.13	3.95	0.355	0.16069	Zinc finger, C2H2 (1);	1.096770	0.07071	N	0.835535	T	0.07773	0.0195	N	0.17838	0.53	0.09310	N	1	P	0.40266	0.71	P	0.44732	0.459	T	0.37865	-0.9687	10	0.87932	D	0	-1.3432	4.8189	0.13381	0.0:0.1028:0.3779:0.5193	.	422	Q96LX8	ZN597_HUMAN	Y	422	ENSP00000301744:N422Y	ENSP00000301744:N422Y	N	-	1	0	ZNF597	3426436	0.120000	0.22244	0.002000	0.10522	0.032000	0.12392	2.301000	0.43628	0.018000	0.15052	-0.321000	0.08615	AAC	ZNF597	-	pfscan_Znf_C2H2	ENSG00000167981		0.388	ZNF597-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF597	HGNC	protein_coding	OTTHUMT00000251511.2	62	0.00	0	T	NM_152457		3486435	3486435	-1	no_errors	ENST00000301744	ensembl	human	known	69_37n	missense	56	13.85	9	SNP	0.010	A
ZNF93	81931	genome.wustl.edu	37	19	20044531	20044531	+	Missense_Mutation	SNP	C	C	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr19:20044531C>T	ENST00000343769.5	+	4	795	c.767C>T	c.(766-768)cCc>cTc	p.P256L	AC007204.2_ENST00000592245.1_lincRNA	NM_031218.3	NP_112495.2	P35789	ZNF93_HUMAN	zinc finger protein 93	256					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.P256H(1)		endometrium(6)|kidney(2)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	24						GGAAAGAAACCCTACAAGTGT	0.368																																						dbGAP											1	Substitution - Missense(1)	kidney(1)											55.0	53.0	54.0					19																	20044531		2203	4297	6500	-	-	-	SO:0001583	missense	0			M61873	CCDS32973.1	19p12	2014-02-12	2006-05-12		ENSG00000184635	ENSG00000184635		"""Zinc fingers, C2H2-type"", ""-"""	13169	protein-coding gene	gene with protein product		603975	"""zinc finger protein 505"", ""zinc finger protein 93 (HTF34)"""	ZNF505		8467795, 2023909	Standard	NM_031218		Approved	HPF34, TF34, FLJ12488	uc002non.3	P35789	OTTHUMG00000182371	ENST00000343769.5:c.767C>T	19.37:g.20044531C>T	ENSP00000342002:p.Pro256Leu		A6NMY2|B9EGT2|Q8N8Q4|Q9H9X5|Q9Y2N8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P256L	ENST00000343769.5	37	c.767	CCDS32973.1	19	.	.	.	.	.	.	.	.	.	.	c	12.66	2.004524	0.35320	.	.	ENSG00000184635	ENST00000343769;ENST00000427325	T	0.17054	2.3	0.85	-0.442	0.12253	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.26521	0.0648	M	0.69248	2.105	0.41168	D	0.986142	D	0.59357	0.985	P	0.58130	0.833	T	0.13818	-1.0495	9	0.51188	T	0.08	.	4.5089	0.11901	0.0:0.6826:0.0:0.3174	.	256	P35789	ZNF93_HUMAN	L	256	ENSP00000342002:P256L	ENSP00000342002:P256L	P	+	2	0	ZNF93	19905531	0.000000	0.05858	0.100000	0.21137	0.100000	0.18952	0.367000	0.20382	0.192000	0.20272	0.195000	0.17529	CCC	ZNF93	-	pfscan_Znf_C2H2	ENSG00000184635		0.368	ZNF93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF93	HGNC	protein_coding	OTTHUMT00000460808.2	52	0.00	0	C	NM_031218		20044531	20044531	+1	no_errors	ENST00000343769	ensembl	human	known	69_37n	missense	16	48.39	15	SNP	0.945	T
ZZEF1	23140	genome.wustl.edu	37	17	4046260	4046260	+	5'UTR	SNP	C	C	T			TCGA-GI-A2C9-01A-11D-A21Q-09	TCGA-GI-A2C9-11A-22D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	5dbf3203-ce73-41e4-bf9a-32fc856f73f5	e0d54a00-8d0b-4a09-bf35-75183818d3ed	g.chr17:4046260C>T	ENST00000381638.2	-	0	54				CYB5D2_ENST00000575251.1_5'Flank|CYB5D2_ENST00000573984.1_5'Flank|ZZEF1_ENST00000574474.1_5'UTR|CYB5D2_ENST00000301391.3_5'Flank	NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1								calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						TGTCAACCTCCGACAGCAGCT	0.726																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.-71G>A	17.37:g.4046260C>T			A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	RNA	SNP	-	NULL	ENST00000381638.2	37	NULL	CCDS11043.1	17																																																																																			ZZEF1	-	-	ENSG00000074755		0.726	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZEF1	HGNC	protein_coding	OTTHUMT00000207480.1	10	0.00	0	C	NM_015113		4046260	4046260	-1	no_errors	ENST00000574474	ensembl	human	known	69_37n	rna	1	83.33	5	SNP	0.826	T
