#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA13	154664	genome.wustl.edu	37	7	48556398	48556398	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr7:48556398C>T	ENST00000435803.1	+	52	13742	c.13718C>T	c.(13717-13719)tCa>tTa	p.S4573L	ABCA13_ENST00000544596.1_Missense_Mutation_p.S303L	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4573					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TCCTATGTCTCACTAAACTTC	0.418																																						dbGAP											0													261.0	257.0	258.0					7																	48556398		1941	4146	6087	-	-	-	SO:0001583	missense	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.13718C>T	7.37:g.48556398C>T	ENSP00000411096:p.Ser4573Leu		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S4573L	ENST00000435803.1	37	c.13718	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	C	19.47	3.833593	0.71258	.	.	ENSG00000179869	ENST00000435803;ENST00000411975;ENST00000544596	T;T;T	0.78246	-1.16;-1.16;-1.16	5.35	5.35	0.76521	.	0.000000	0.45867	D	0.000324	D	0.88104	0.6347	M	0.78049	2.395	0.45733	D	0.998639	D;D;D	0.89917	0.984;0.995;1.0	P;D;D	0.87578	0.888;0.958;0.998	D	0.89443	0.3725	10	0.87932	D	0	.	16.2253	0.82286	0.0:1.0:0.0:0.0	.	303;2275;4573	F5H7B7;Q86UQ4-3;Q86UQ4	.;.;ABCAD_HUMAN	L	4573;346;303	ENSP00000411096:S4573L;ENSP00000391042:S346L;ENSP00000442634:S303L	ENSP00000391042:S346L	S	+	2	0	ABCA13	48526944	0.994000	0.37717	0.941000	0.38009	0.915000	0.54546	3.387000	0.52501	2.478000	0.83669	0.655000	0.94253	TCA	ABCA13	-	NULL	ENSG00000179869		0.418	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	117	0.00	0	C	NM_152701		48556398	48556398	+1	no_errors	ENST00000435803	ensembl	human	known	69_37n	missense	84	20.00	21	SNP	0.989	T
ABCG8	64241	genome.wustl.edu	37	2	44102320	44102320	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:44102320C>T	ENST00000272286.2	+	11	1614	c.1524C>T	c.(1522-1524)atC>atT	p.I508I		NM_022437.2	NP_071882.1	Q9H221	ABCG8_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 8	508	ABC transmembrane type-2.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|phospholipid transport (GO:0015914)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein heterodimerization activity (GO:0046982)|sterol transporter activity (GO:0015248)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(21)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	GTGCCTACATCATCATCTACG	0.552																																						dbGAP											0													85.0	79.0	81.0					2																	44102320		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF320294	CCDS1815.1	2p21	2012-03-14	2008-07-31		ENSG00000143921	ENSG00000143921		"""ATP binding cassette transporters / subfamily G"""	13887	protein-coding gene	gene with protein product	"""gallbladder disease 4"", ""sterolin 2"""	605460	"""ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)"""			11099417, 17626266	Standard	NM_022437		Approved	GBD4	uc002rtq.3	Q9H221	OTTHUMG00000128756	ENST00000272286.2:c.1524C>T	2.37:g.44102320C>T			Q53QN8	Silent	SNP	pfam_ABC_2_trans,pfam_ABC_transporter-like,pfscan_ABC_transporter-like	p.I508	ENST00000272286.2	37	c.1524	CCDS1815.1	2																																																																																			ABCG8	-	pfam_ABC_2_trans	ENSG00000143921		0.552	ABCG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCG8	HGNC	protein_coding	OTTHUMT00000250671.1	37	0.00	0	C	NM_022437		44102320	44102320	+1	no_errors	ENST00000272286	ensembl	human	known	69_37n	silent	30	33.33	15	SNP	0.025	T
ABCG8	64241	genome.wustl.edu	37	2	44102524	44102524	+	Missense_Mutation	SNP	C	C	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:44102524C>A	ENST00000272286.2	+	11	1818	c.1728C>A	c.(1726-1728)ttC>ttA	p.F576L		NM_022437.2	NP_071882.1	Q9H221	ABCG8_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 8	576	ABC transmembrane type-2.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|phospholipid transport (GO:0015914)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein heterodimerization activity (GO:0046982)|sterol transporter activity (GO:0015248)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(21)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	CCGGGGGCTTCATGATAAACT	0.597																																						dbGAP											0													36.0	40.0	39.0					2																	44102524		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF320294	CCDS1815.1	2p21	2012-03-14	2008-07-31		ENSG00000143921	ENSG00000143921		"""ATP binding cassette transporters / subfamily G"""	13887	protein-coding gene	gene with protein product	"""gallbladder disease 4"", ""sterolin 2"""	605460	"""ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)"""			11099417, 17626266	Standard	NM_022437		Approved	GBD4	uc002rtq.3	Q9H221	OTTHUMG00000128756	ENST00000272286.2:c.1728C>A	2.37:g.44102524C>A	ENSP00000272286:p.Phe576Leu		Q53QN8	Missense_Mutation	SNP	pfam_ABC_2_trans,pfam_ABC_transporter-like,pfscan_ABC_transporter-like	p.F576L	ENST00000272286.2	37	c.1728	CCDS1815.1	2	.	.	.	.	.	.	.	.	.	.	C	10.76	1.440412	0.25900	.	.	ENSG00000143921	ENST00000272286	T	0.73897	-0.79	4.57	2.71	0.32032	ABC-2 type transporter (1);	0.050270	0.85682	D	0.000000	T	0.80336	0.4604	M	0.75447	2.3	0.48452	D	0.999653	D;D	0.69078	0.996;0.997	P;D	0.66351	0.906;0.943	T	0.75459	-0.3310	10	0.37606	T	0.19	.	4.62	0.12445	0.3199:0.5186:0.0:0.1616	.	575;576	Q9H221-2;Q9H221	.;ABCG8_HUMAN	L	576	ENSP00000272286:F576L	ENSP00000272286:F576L	F	+	3	2	ABCG8	43956028	1.000000	0.71417	0.113000	0.21522	0.001000	0.01503	1.162000	0.31786	0.343000	0.23821	-0.521000	0.04368	TTC	ABCG8	-	pfam_ABC_2_trans	ENSG00000143921		0.597	ABCG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCG8	HGNC	protein_coding	OTTHUMT00000250671.1	47	0.00	0	C	NM_022437		44102524	44102524	+1	no_errors	ENST00000272286	ensembl	human	known	69_37n	missense	23	28.12	9	SNP	1.000	A
ACACA	31	genome.wustl.edu	37	17	35605519	35605519	+	Nonsense_Mutation	SNP	T	T	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr17:35605519T>A	ENST00000394406.2	-	17	2240	c.2050A>T	c.(2050-2052)Aag>Tag	p.K684*	ACACA_ENST00000360679.3_Nonsense_Mutation_p.K626*|ACACA_ENST00000353139.5_Nonsense_Mutation_p.K721*|ACACA_ENST00000335166.5_Nonsense_Mutation_p.K606*	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	684					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	CTGCATACCTTAAGTACATAC	0.418																																					Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)	dbGAP											0													111.0	97.0	102.0					17																	35605519		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.2050A>T	17.37:g.35605519T>A	ENSP00000377928:p.Lys684*		B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Nonsense_Mutation	SNP	pfam_AcCoA_COase_cen,pfam_Carboxyl_trans,pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,pfam_ATP-grasp_carboxylate-amine,superfamily_PreATP-grasp_fold,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_COA_CT_N,pfscan_COA_CT_C,pfscan_Biotin_lipoyl	p.K721*	ENST00000394406.2	37	c.2161	CCDS11317.1	17	.	.	.	.	.	.	.	.	.	.	T	44	11.075599	0.99512	.	.	ENSG00000132142	ENST00000353139;ENST00000360679;ENST00000394406;ENST00000452074;ENST00000335166	.	.	.	5.79	5.79	0.91817	.	0.098186	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	-21.3488	15.3166	0.74085	0.0:0.0:0.0:1.0	.	.	.	.	X	721;626;684;708;606	.	ENSP00000335323:K606X	K	-	1	0	ACACA	32679632	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.709000	0.61867	2.207000	0.71202	0.533000	0.62120	AAG	ACACA	-	NULL	ENSG00000132142		0.418	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACA	HGNC	protein_coding	OTTHUMT00000256696.1	46	0.00	0	T	NM_198836		35605519	35605519	-1	no_errors	ENST00000353139	ensembl	human	known	69_37n	nonsense	26	51.85	28	SNP	1.000	A
ACSM5	54988	genome.wustl.edu	37	16	20429440	20429440	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr16:20429440C>T	ENST00000331849.4	+	3	411	c.264C>T	c.(262-264)atC>atT	p.I88I	ACSM5_ENST00000575584.1_Silent_p.I88I	NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	88					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						GAGCAGAGATCAAGTGGAGCT	0.557																																						dbGAP											0													58.0	50.0	53.0					16																	20429440		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.264C>T	16.37:g.20429440C>T			Q96AV1|Q96CX8|Q9NWV3	Silent	SNP	pfam_AMP-dep_Synth/Lig	p.I88	ENST00000331849.4	37	c.264	CCDS10585.1	16																																																																																			ACSM5	-	NULL	ENSG00000183549		0.557	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM5	HGNC	protein_coding	OTTHUMT00000254413.1	32	0.00	0	C	NM_017888		20429440	20429440	+1	no_errors	ENST00000331849	ensembl	human	known	69_37n	silent	33	19.51	8	SNP	0.994	T
ACTL7A	10881	genome.wustl.edu	37	9	111625619	111625619	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr9:111625619C>T	ENST00000333999.3	+	1	1017	c.1017C>T	c.(1015-1017)acC>acT	p.T339T		NM_006687.2	NP_006678.1	Q9Y615	ACL7A_HUMAN	actin-like 7A	339						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|male germ cell nucleus (GO:0001673)|motile cilium (GO:0031514)|nucleus (GO:0005634)|protein complex (GO:0043234)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|endometrium(2)|large_intestine(4)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						ACACCCAAACCGTGTCCTGCC	0.572																																					Esophageal Squamous(177;1480 3591 17554)	dbGAP											0													142.0	128.0	133.0					9																	111625619		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC014610	CCDS6772.1	9q31	2008-02-05			ENSG00000187003	ENSG00000187003			161	protein-coding gene	gene with protein product		604303				10373328	Standard	NM_006687		Approved		uc004bdj.1	Q9Y615	OTTHUMG00000020461	ENST00000333999.3:c.1017C>T	9.37:g.111625619C>T			B2RC83|Q5JSV0	Silent	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.T339	ENST00000333999.3	37	c.1017	CCDS6772.1	9																																																																																			ACTL7A	-	pfam_Actin-like,smart_Actin-like	ENSG00000187003		0.572	ACTL7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL7A	HGNC	protein_coding	OTTHUMT00000053570.1	27	0.00	0	C	NM_006687		111625619	111625619	+1	no_errors	ENST00000333999	ensembl	human	known	69_37n	silent	20	28.57	8	SNP	0.001	T
ADRA2A	150	genome.wustl.edu	37	10	112838987	112838987	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr10:112838987C>T	ENST00000280155.2	+	1	2198	c.1233C>T	c.(1231-1233)ctC>ctT	p.L411L		NM_000681.3	NP_000672.3	P08913	ADA2A_HUMAN	adrenoceptor alpha 2A	396					actin cytoskeleton organization (GO:0030036)|activation of MAPK activity by adrenergic receptor signaling pathway (GO:0071883)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|acute inflammatory response (GO:0002526)|adenylate cyclase-inhibiting adrenergic receptor signaling pathway (GO:0071881)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|DNA replication (GO:0006260)|energy reserve metabolic process (GO:0006112)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|fear response (GO:0042596)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|intestinal absorption (GO:0050892)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of adrenergic receptor signaling pathway (GO:0071878)|negative regulation of calcium ion transmembrane transporter activity (GO:1901020)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of insulin secretion (GO:0046676)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of norepinephrine secretion (GO:0010700)|negative regulation of uterine smooth muscle contraction (GO:0070473)|phospholipase C-activating adrenergic receptor signaling pathway (GO:0071882)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine production (GO:0001819)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of vasodilation (GO:0045909)|positive regulation of wound healing (GO:0090303)|Ras protein signal transduction (GO:0007265)|regulation of insulin secretion (GO:0050796)|regulation of vasoconstriction (GO:0019229)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|thermoception (GO:0050955)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	alpha-1B adrenergic receptor binding (GO:0031692)|alpha-2C adrenergic receptor binding (GO:0031696)|alpha2-adrenergic receptor activity (GO:0004938)|epinephrine binding (GO:0051379)|heterotrimeric G-protein binding (GO:0032795)|norepinephrine binding (GO:0051380)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|thioesterase binding (GO:0031996)			breast(1)|cervix(3)|endometrium(6)|large_intestine(3)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(234;0.0735)|Lung NSC(174;0.238)		Epithelial(162;0.000316)|all cancers(201;0.00501)|BRCA - Breast invasive adenocarcinoma(275;0.118)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Apraclonidine(DB00964)|Aripiprazole(DB01238)|Asenapine(DB06216)|Benzphetamine(DB00865)|Bethanidine(DB00217)|Brimonidine(DB00484)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Desipramine(DB01151)|Dexmedetomidine(DB00633)|Dihydroergotamine(DB00320)|Dipivefrin(DB00449)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinastine(DB00751)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Flupirtine(DB06623)|Guanabenz(DB00629)|Guanfacine(DB01018)|Lisuride(DB00589)|Lofexidine(DB04948)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Methyldopa(DB00968)|Mianserin(DB06148)|Mirtazapine(DB00370)|Naphazoline(DB06711)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phentolamine(DB00692)|Phenylpropanolamine(DB00397)|Pramipexole(DB00413)|Prazosin(DB00457)|Propericiazine(DB01608)|Pseudoephedrine(DB00852)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Tizanidine(DB00697)|Tolazoline(DB00797)|Trazodone(DB00656)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Yohimbine(DB01392)|Ziprasidone(DB00246)	CCTACACGCTCACGGCCGTCG	0.592																																					Esophageal Squamous(173;605 2658 7278 49362)	dbGAP											0													168.0	137.0	148.0					10																	112838987		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF284095	CCDS7569.2	10q25.2	2012-08-08	2012-05-09		ENSG00000150594	ENSG00000150594		"""GPCR / Class A : Adrenoceptors : alpha"""	281	protein-coding gene	gene with protein product	"""alpha-2AAR subtype C10"", "" alpha-2A-adrenergic receptor"""	104210	"""adrenergic, alpha-2A-, receptor"""	ADRA2, ADRA2R			Standard	NM_000681		Approved	ADRAR	uc001kzo.3	P08913	OTTHUMG00000019050	ENST00000280155.2:c.1233C>T	10.37:g.112838987C>T			B0LPF6|Q2I8G2|Q2XN99|Q86TH8|Q9BZK1	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Adren_rcpt_A2A,prints_7TM_GPCR_Rhodpsn,prints_Adrnrgc_rcpt,prints_Musac_rcpt	p.L411	ENST00000280155.2	37	c.1233	CCDS7569.2	10																																																																																			ADRA2A	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000150594		0.592	ADRA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADRA2A	HGNC	protein_coding	OTTHUMT00000050372.2	52	0.00	0	C	NM_000681		112838987	112838987	+1	no_errors	ENST00000280155	ensembl	human	known	69_37n	silent	34	26.09	12	SNP	0.963	T
AHCYL1	10768	genome.wustl.edu	37	1	110563430	110563430	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:110563430C>T	ENST00000369799.5	+	16	1910	c.1543C>T	c.(1543-1545)Ctg>Ttg	p.L515L	AHCYL1_ENST00000393614.4_Silent_p.L468L|AHCYL1_ENST00000359172.3_Silent_p.L468L	NM_001242673.1|NM_001242674.1|NM_006621.5	NP_001229602.1|NP_001229603.1|NP_006612.2	O43865	SAHH2_HUMAN	adenosylhomocysteinase-like 1	515					mRNA polyadenylation (GO:0006378)|one-carbon metabolic process (GO:0006730)|positive regulation of sodium ion transport (GO:0010765)|protein export from nucleus (GO:0006611)|regulation of anion transport (GO:0044070)|regulation of ion transmembrane transporter activity (GO:0032412)|regulation of mRNA 3'-end processing (GO:0031440)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	adenosylhomocysteinase activity (GO:0004013)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)	18		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0259)|Colorectal(144;0.123)|all cancers(265;0.134)|Epithelial(280;0.141)|LUSC - Lung squamous cell carcinoma(189;0.143)		AGCAAAATATCTGGGACTCAA	0.443																																						dbGAP											0													128.0	131.0	130.0					1																	110563430		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U82761	CCDS818.1, CCDS55620.1	1p13	2014-06-12	2009-06-12		ENSG00000168710	ENSG00000168710			344	protein-coding gene	gene with protein product	"""inositol 1,4,5-trisphosphate receptor-binding protein"", ""protein phosphatase 1, regulatory subunit 78"""	607826	"""S-adenosylhomocysteine hydrolase-like 1"""			11904675, 16754674, 12525476	Standard	NM_006621		Approved	XPVKONA, IRBIT, PPP1R78	uc001dyx.3	O43865	OTTHUMG00000011652	ENST00000369799.5:c.1543C>T	1.37:g.110563430C>T			B4E168|Q2TAJ6|Q502W8|Q5VSM0|Q6P171|Q96PK4|Q9UG84	Silent	SNP	pfam_Adenosylhomocysteinase,pfam_Ado_hCys_hydrolase_NAD-bd,pfam_D-isomer_2_OHA_DH_NAD-bd,pfam_IlvN,pirsf_Adenosylhomocysteinase,tigrfam_Adenosylhomocysteinase	p.L515	ENST00000369799.5	37	c.1543	CCDS818.1	1																																																																																			AHCYL1	-	pfam_Adenosylhomocysteinase,pirsf_Adenosylhomocysteinase,tigrfam_Adenosylhomocysteinase	ENSG00000168710		0.443	AHCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AHCYL1	HGNC	protein_coding	OTTHUMT00000032243.1	62	0.00	0	C			110563430	110563430	+1	no_errors	ENST00000369799	ensembl	human	known	69_37n	silent	41	31.67	19	SNP	1.000	T
AHNAK	79026	genome.wustl.edu	37	11	62300602	62300602	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr11:62300602C>T	ENST00000378024.4	-	5	1561	c.1287G>A	c.(1285-1287)ctG>ctA	p.L429L	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	429					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TGGGCACATTCAGTTTGCTCC	0.537																																						dbGAP											0													78.0	80.0	79.0					11																	62300602		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.1287G>A	11.37:g.62300602C>T			A1A586	Silent	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L429	ENST00000378024.4	37	c.1287	CCDS31584.1	11																																																																																			AHNAK	-	NULL	ENSG00000124942		0.537	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	HGNC	protein_coding	OTTHUMT00000395572.1	64	0.00	0	C	NM_024060		62300602	62300602	-1	no_errors	ENST00000378024	ensembl	human	known	69_37n	silent	41	31.15	19	SNP	0.853	T
AHSP	51327	genome.wustl.edu	37	16	31539850	31539850	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr16:31539850C>G	ENST00000302312.4	+	3	250	c.147C>G	c.(145-147)atC>atG	p.I49M	AHSP_ENST00000569954.1_3'UTR	NM_016633.2	NP_057717.1	Q9NZD4	AHSP_HUMAN	alpha hemoglobin stabilizing protein	49					hemoglobin metabolic process (GO:0020027)|hemopoiesis (GO:0030097)|protein folding (GO:0006457)|protein stabilization (GO:0050821)	hemoglobin complex (GO:0005833)	hemoglobin binding (GO:0030492)|unfolded protein binding (GO:0051082)			lung(2)	2						ACTTCTACATCAACTATTACA	0.552																																						dbGAP											0													80.0	74.0	76.0					16																	31539850		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF208865	CCDS10716.1	16p11.1	2009-10-07	2009-10-07	2009-10-07	ENSG00000169877	ENSG00000169877			18075	protein-coding gene	gene with protein product	"""alpha hemoglobin stabilising protein"""	605821	"""erythroid associated factor"""	ERAF		11231637, 12066189	Standard	XM_005255352		Approved	EDRF	uc002ecj.3	Q9NZD4	OTTHUMG00000132461	ENST00000302312.4:c.147C>G	16.37:g.31539850C>G	ENSP00000307199:p.Ile49Met		Q8TD01	Missense_Mutation	SNP	pfam_A_Hb_stabilising_prot,superfamily_A_Hb_stabilising_prot	p.I49M	ENST00000302312.4	37	c.147	CCDS10716.1	16	.	.	.	.	.	.	.	.	.	.	C	16.38	3.107090	0.56291	.	.	ENSG00000169877	ENST00000302312	T	0.70399	-0.48	5.88	2.52	0.30459	.	0.625163	0.14812	N	0.297001	T	0.61286	0.2335	L	0.32530	0.975	0.26587	N	0.973276	B	0.26318	0.146	B	0.38755	0.281	T	0.58312	-0.7658	10	0.72032	D	0.01	.	3.6987	0.08374	0.0:0.5497:0.2075:0.2429	.	49	Q9NZD4	AHSP_HUMAN	M	49	ENSP00000307199:I49M	ENSP00000307199:I49M	I	+	3	3	AHSP	31447351	0.192000	0.23301	1.000000	0.80357	0.718000	0.41266	0.099000	0.15210	0.804000	0.34136	-0.176000	0.13171	ATC	AHSP	-	pfam_A_Hb_stabilising_prot,superfamily_A_Hb_stabilising_prot	ENSG00000169877		0.552	AHSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AHSP	HGNC	protein_coding	OTTHUMT00000255624.1	30	0.00	0	C	NM_016633		31539850	31539850	+1	no_errors	ENST00000302312	ensembl	human	known	69_37n	missense	30	30.23	13	SNP	0.997	G
AIM2	9447	genome.wustl.edu	37	1	159043091	159043091	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:159043091G>C	ENST00000368130.4	-	2	487	c.199C>G	c.(199-201)Cgt>Ggt	p.R67G	AIM2_ENST00000411768.1_5'UTR	NM_004833.1	NP_004824.1	O14862	AIM2_HUMAN	absent in melanoma 2	67	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				activation of innate immune response (GO:0002218)|apoptotic process (GO:0006915)|cellular response to drug (GO:0035690)|cellular response to interferon-beta (GO:0035458)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein oligomerization (GO:0032461)|pyroptosis (GO:0070269)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)			breast(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(1)	16	all_hematologic(112;0.0429)					TGAAAAATACGAATGGTCTTC	0.428																																						dbGAP											0													86.0	87.0	87.0					1																	159043091		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF024714	CCDS1181.1	1q22	2008-07-18			ENSG00000163568	ENSG00000163568			357	protein-coding gene	gene with protein product		604578				9242382	Standard	NM_004833		Approved	PYHIN4	uc001ftj.1	O14862	OTTHUMG00000037183	ENST00000368130.4:c.199C>G	1.37:g.159043091G>C	ENSP00000357112:p.Arg67Gly		A8K7M7|Q5T3V9|Q96FG9	Missense_Mutation	SNP	pfam_HIN200/IF120x,pfam_DAPIN,superfamily_DEATH-like,superfamily_NA-bd_OB-fold-like,pfscan_DAPIN,pfscan_HIN200/IF120x	p.R67G	ENST00000368130.4	37	c.199	CCDS1181.1	1	.	.	.	.	.	.	.	.	.	.	G	4.756	0.140561	0.09083	.	.	ENSG00000163568	ENST00000368130;ENST00000411768	T;T	0.43294	0.95;0.95	3.43	-6.85	0.01681	Pyrin (2);DEATH-like (2);	.	.	.	.	T	0.06508	0.0167	N	0.14661	0.345	0.09310	N	1	B	0.14438	0.01	B	0.12837	0.008	T	0.25502	-1.0130	9	0.49607	T	0.09	4.8736	3.8303	0.08871	0.1339:0.1414:0.5634:0.1613	.	67	O14862	AIM2_HUMAN	G	67	ENSP00000357112:R67G;ENSP00000405197:R67G	ENSP00000357112:R67G	R	-	1	0	AIM2	157309715	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-4.056000	0.00304	-2.124000	0.00822	-1.108000	0.02087	CGT	AIM2	-	pfam_DAPIN,superfamily_DEATH-like,pfscan_DAPIN	ENSG00000163568		0.428	AIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIM2	HGNC	protein_coding	OTTHUMT00000090341.1	60	0.00	0	G	NM_004833		159043091	159043091	-1	no_errors	ENST00000368130	ensembl	human	known	69_37n	missense	66	12.00	9	SNP	0.000	C
AKAP6	9472	genome.wustl.edu	37	14	33242956	33242956	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr14:33242956G>C	ENST00000280979.4	+	12	3615	c.3445G>C	c.(3445-3447)Gat>Cat	p.D1149H	AKAP6_ENST00000557272.1_Missense_Mutation_p.D1149H	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1149					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		GCATCTTTTGGATGACCGGGA	0.488																																					Melanoma(49;821 1200 7288 13647 42351)	dbGAP											0													135.0	123.0	127.0					14																	33242956		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.3445G>C	14.37:g.33242956G>C	ENSP00000280979:p.Asp1149His		A7E242|A7E2D4|O15028	Missense_Mutation	SNP	smart_Spectrin/alpha-actinin	p.D1149H	ENST00000280979.4	37	c.3445	CCDS9644.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.92|19.92	3.916742|3.916742	0.73098|0.73098	.|.	.|.	ENSG00000151320|ENSG00000151320	ENST00000280979;ENST00000557272|ENST00000554740	T;T|.	0.36340|.	1.26;1.26|.	5.28|5.28	5.28|5.28	0.74379|0.74379	.|.	0.068367|.	0.64402|.	D|.	0.000012|.	T|T	0.38108|0.38108	0.1028|0.1028	N|N	0.10782|0.10782	0.045|0.045	0.45979|0.45979	D|D	0.998792|0.998792	D|.	0.89917|.	1.0|.	D|.	0.87578|.	0.998|.	T|T	0.22591|0.22591	-1.0212|-1.0212	10|5	0.54805|.	T|.	0.06|.	-18.6075|-18.6075	12.6082|12.6082	0.56535|0.56535	0.0763:0.0:0.9237:0.0|0.0763:0.0:0.9237:0.0	.|.	1149|.	Q13023|.	AKAP6_HUMAN|.	H|C	1149|35	ENSP00000280979:D1149H;ENSP00000451247:D1149H|.	ENSP00000280979:D1149H|.	D|W	+|+	1|3	0|0	AKAP6|AKAP6	32312707|32312707	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.899000|0.899000	0.52679|0.52679	5.761000|5.761000	0.68801|0.68801	2.639000|2.639000	0.89480|0.89480	0.591000|0.591000	0.81541|0.81541	GAT|TGG	AKAP6	-	smart_Spectrin/alpha-actinin	ENSG00000151320		0.488	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP6	HGNC	protein_coding	OTTHUMT00000276617.2	51	0.00	0	G	NM_004274		33242956	33242956	+1	no_errors	ENST00000280979	ensembl	human	known	69_37n	missense	34	27.66	13	SNP	1.000	C
ANK1	286	genome.wustl.edu	37	8	41553930	41553930	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr8:41553930G>A	ENST00000347528.4	-	26	2994	c.2911C>T	c.(2911-2913)Ctg>Ttg	p.L971L	ANK1_ENST00000396942.1_Silent_p.L971L|ANK1_ENST00000265709.8_Silent_p.L1012L|ANK1_ENST00000396945.1_Silent_p.L971L|ANK1_ENST00000379758.2_Silent_p.L971L|ANK1_ENST00000352337.4_Silent_p.L971L|ANK1_ENST00000289734.7_Silent_p.L971L	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	971	ZU5 1. {ECO:0000255|PROSITE- ProRule:PRU00485}.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CTGCTGGCCAGGCCCTCCTCC	0.711																																						dbGAP											0													34.0	38.0	37.0					8																	41553930		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.2911C>T	8.37:g.41553930G>A			A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	pfam_ZU5,pfam_Ankyrin_rpt,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.P292L	ENST00000347528.4	37	c.875	CCDS6119.1	8	.	.	.	.	.	.	.	.	.	.	G	10.60	1.395490	0.25205	.	.	ENSG00000029534	ENST00000520299	.	.	.	5.53	4.65	0.58169	.	.	.	.	.	T	0.69878	0.3160	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68973	-0.5268	4	.	.	.	.	14.1935	0.65654	0.072:0.0:0.9279:0.0	.	.	.	.	L	292	.	.	P	-	2	0	ANK1	41673087	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.795000	0.75140	1.335000	0.45486	0.561000	0.74099	CCT	ANK1	-	pfam_ZU5,smart_ZU5,pfscan_ZU5	ENSG00000029534		0.711	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANK1	HGNC	protein_coding	OTTHUMT00000317297.1	14	0.00	0	G	NM_020475		41553930	41553930	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000520299	ensembl	human	putative	69_37n	missense	20	23.08	6	SNP	1.000	A
ANKRD27	84079	genome.wustl.edu	37	19	33092966	33092966	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr19:33092966C>T	ENST00000306065.4	-	26	2880	c.2722G>A	c.(2722-2724)Gaa>Aaa	p.E908K		NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	908					early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					CGGTCAGTTTCAGCCACATCA	0.373																																						dbGAP											0													171.0	157.0	161.0					19																	33092966		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.2722G>A	19.37:g.33092966C>T	ENSP00000304292:p.Glu908Lys		Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_VPS9,superfamily_Ankyrin_rpt-contain_dom,smart_VPS9_subgr,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_VPS9,prints_Ankyrin_rpt	p.E908K	ENST00000306065.4	37	c.2722	CCDS32986.1	19	.	.	.	.	.	.	.	.	.	.	C	10.41	1.343328	0.24339	.	.	ENSG00000105186	ENST00000306065	T	0.62498	0.02	5.97	3.84	0.44239	Ankyrin repeat-containing domain (1);	0.091149	0.47093	D	0.000241	T	0.49830	0.1580	M	0.63843	1.955	0.18873	N	0.999986	P	0.39060	0.657	B	0.35182	0.197	T	0.36261	-0.9755	10	0.11485	T	0.65	-9.6114	6.5017	0.22172	0.0:0.6928:0.15:0.1571	.	908	Q96NW4	ANR27_HUMAN	K	908	ENSP00000304292:E908K	ENSP00000304292:E908K	E	-	1	0	ANKRD27	37784806	0.165000	0.22948	0.001000	0.08648	0.001000	0.01503	1.150000	0.31639	0.852000	0.35287	0.650000	0.86243	GAA	ANKRD27	-	pfscan_Ankyrin_rpt-contain_dom	ENSG00000105186		0.373	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD27	HGNC	protein_coding	OTTHUMT00000450329.1	80	0.00	0	C	NM_032139		33092966	33092966	-1	no_errors	ENST00000306065	ensembl	human	known	69_37n	missense	59	10.61	7	SNP	0.006	T
ANKRD54	129138	genome.wustl.edu	37	22	38227992	38227992	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr22:38227992G>A	ENST00000215941.4	-	8	1053	c.861C>T	c.(859-861)ttC>ttT	p.F287F	ANKRD54_ENST00000498417.1_5'UTR|ANKRD54_ENST00000406423.1_Silent_p.F167F|ANKRD54_ENST00000609454.1_Silent_p.F94F|ANKRD54_ENST00000411961.2_Silent_p.F271F	NM_138797.2	NP_620152.1	Q6NXT1	ANR54_HUMAN	ankyrin repeat domain 54	287	Nuclear export signal (NES). {ECO:0000250}.				nucleocytoplasmic transport (GO:0006913)|positive regulation of erythrocyte differentiation (GO:0045648)|regulation of intracellular signal transduction (GO:1902531)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)	protein kinase regulator activity (GO:0019887)			lung(1)	1	Melanoma(58;0.045)					TGAGGGAGGTGAAGCTGGCCA	0.607																																						dbGAP											0													80.0	59.0	66.0					22																	38227992		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC014641	CCDS13959.1	22q13.1	2013-01-10			ENSG00000100124	ENSG00000100124		"""Ankyrin repeat domain containing"""	25185	protein-coding gene	gene with protein product		613383				15461802	Standard	NM_138797		Approved	LIAR	uc003auc.3	Q6NXT1	OTTHUMG00000150663	ENST00000215941.4:c.861C>T	22.37:g.38227992G>A			Q6ZSB1|Q9UGV1	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S203L	ENST00000215941.4	37	c.608	CCDS13959.1	22	.	.	.	.	.	.	.	.	.	.	G	10.39	1.336151	0.24253	.	.	ENSG00000100124	ENST00000458278	.	.	.	5.97	2.61	0.31194	.	.	.	.	.	T	0.56140	0.1965	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50294	-0.8845	4	.	.	.	-18.5831	7.8843	0.29640	0.1948:0.1168:0.6884:0.0	.	.	.	.	L	203	.	.	S	-	2	0	ANKRD54	36557938	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.755000	0.47540	0.848000	0.35191	0.655000	0.94253	TCA	ANKRD54	-	NULL	ENSG00000100124		0.607	ANKRD54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD54	HGNC	protein_coding	OTTHUMT00000319490.1	48	0.00	0	G	NM_138797		38227992	38227992	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000458278	ensembl	human	known	69_37n	missense	31	27.91	12	SNP	1.000	A
ANLN	54443	genome.wustl.edu	37	7	36446159	36446159	+	Nonsense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr7:36446159C>G	ENST00000265748.2	+	4	1078	c.857C>G	c.(856-858)tCa>tGa	p.S286*	ANLN_ENST00000396068.2_Nonsense_Mutation_p.S286*	NM_018685.2	NP_061155.2	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	286	Interaction with F-actin.				hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|regulation of exit from mitosis (GO:0007096)|septin ring assembly (GO:0000921)	actin cytoskeleton (GO:0015629)|actomyosin contractile ring (GO:0005826)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	actin binding (GO:0003779)			breast(2)|endometrium(5)|kidney(5)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(2)	45						GTTAATGCCTCAATTTCCAGC	0.423																																						dbGAP											0													235.0	226.0	229.0					7																	36446159		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF273437	CCDS5447.1, CCDS64628.1	7p15-p14	2013-01-10	2006-08-22		ENSG00000011426	ENSG00000011426		"""Pleckstrin homology (PH) domain containing"""	14082	protein-coding gene	gene with protein product			"""anillin (Drosophila Scraps homolog), actin binding protein"", ""anillin, actin binding protein (scraps homolog, Drosophila)"""			10931866	Standard	NM_001284301		Approved	ANILLIN, Scraps, scra	uc003tff.3	Q9NQW6	OTTHUMG00000023143	ENST00000265748.2:c.857C>G	7.37:g.36446159C>G	ENSP00000265748:p.Ser286*		Q5CZ78|Q6NSK5|Q9H8Y4|Q9NVN9|Q9NVP0	Nonsense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S286*	ENST00000265748.2	37	c.857	CCDS5447.1	7	.	.	.	.	.	.	.	.	.	.	C	40	8.485198	0.98832	.	.	ENSG00000011426	ENST00000265748;ENST00000396068	.	.	.	3.93	3.93	0.45458	.	1.364500	0.04719	N	0.419039	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-8.15	14.2627	0.66094	0.0:1.0:0.0:0.0	.	.	.	.	X	286	.	ENSP00000265748:S286X	S	+	2	0	ANLN	36412684	0.001000	0.12720	0.009000	0.14445	0.968000	0.65278	0.257000	0.18369	2.485000	0.83878	0.650000	0.86243	TCA	ANLN	-	NULL	ENSG00000011426		0.423	ANLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANLN	HGNC	protein_coding	OTTHUMT00000218582.3	76	0.00	0	C	NM_018685		36446159	36446159	+1	no_errors	ENST00000265748	ensembl	human	known	69_37n	nonsense	61	29.07	25	SNP	0.013	G
ANXA9	8416	genome.wustl.edu	37	1	150958868	150958868	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:150958868G>A	ENST00000368947.4	+	8	1005	c.529G>A	c.(529-531)Gac>Aac	p.D177N		NM_003568.2	NP_003559.2	O76027	ANXA9_HUMAN	annexin A9	177					single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	acetylcholine receptor activity (GO:0015464)|calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylserine binding (GO:0001786)|phospholipid binding (GO:0005543)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(1)|lung(4)|skin(2)	8	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CATCTTGCAGGACCTGCTGTT	0.577																																						dbGAP											0													74.0	62.0	66.0					1																	150958868		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ009985	CCDS975.2	1q21.2	2008-02-05			ENSG00000143412	ENSG00000143412		"""Annexins"""	547	protein-coding gene	gene with protein product		603319		ANX31		9742942, 9931420	Standard	NM_003568		Approved		uc001ewa.2	O76027	OTTHUMG00000035063	ENST00000368947.4:c.529G>A	1.37:g.150958868G>A	ENSP00000357943:p.Asp177Asn		Q5SZF1|Q6FI55|Q9BS00|Q9HBJ6	Missense_Mutation	SNP	pfam_Annexin_repeat,superfamily_Annexin,smart_Annexin_repeat,prints_Annexin,prints_AnnexinXXXI	p.D177N	ENST00000368947.4	37	c.529	CCDS975.2	1	.	.	.	.	.	.	.	.	.	.	G	9.260	1.043059	0.19748	.	.	ENSG00000143412	ENST00000368947	T	0.03607	3.87	4.95	4.95	0.65309	.	0.251240	0.39834	N	0.001260	T	0.03564	0.0102	L	0.39898	1.24	0.37897	D	0.9309	P	0.35468	0.503	P	0.44921	0.464	T	0.37056	-0.9722	10	0.87932	D	0	.	14.0204	0.64550	0.0:0.0:1.0:0.0	.	177	O76027	ANXA9_HUMAN	N	177	ENSP00000357943:D177N	ENSP00000357943:D177N	D	+	1	0	ANXA9	149225492	0.999000	0.42202	0.992000	0.48379	0.045000	0.14185	3.838000	0.55828	2.457000	0.83068	0.462000	0.41574	GAC	ANXA9	-	pfam_Annexin_repeat,superfamily_Annexin,smart_Annexin_repeat	ENSG00000143412		0.577	ANXA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA9	HGNC	protein_coding	OTTHUMT00000084895.2	49	0.00	0	G	NM_003568		150958868	150958868	+1	no_errors	ENST00000368947	ensembl	human	known	69_37n	missense	66	27.47	25	SNP	0.994	A
AP2M1	1173	genome.wustl.edu	37	3	183898502	183898502	+	Intron	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr3:183898502G>C	ENST00000292807.5	+	5	577				AP2M1_ENST00000439647.1_Intron|AP2M1_ENST00000382456.3_Intron|EIF2B5_ENST00000444495.1_Intron|AP2M1_ENST00000461733.1_Intron|AP2M1_ENST00000411763.2_Intron	NM_004068.3	NP_004059.2	Q96CW1	AP2M1_HUMAN	adaptor-related protein complex 2, mu 1 subunit						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of protein localization to plasma membrane (GO:1903077)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	18	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.92e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CCTGCCCTTTGGGGCTTATAG	0.557																																						dbGAP											0													59.0	52.0	54.0					3																	183898502		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			U36188	CCDS43177.1, CCDS43178.1	3q28	2008-07-18			ENSG00000161203	ENSG00000161203			564	protein-coding gene	gene with protein product	"""clathrin-associated/assembly/adaptor protein, medium 1"", ""plasma membrane adaptor AP-2 50kDA protein"", ""clathrin coat adaptor protein AP50"", ""clathrin adaptor complex AP2, mu subunit"", ""HA2 50 kDA subunit"", ""clathrin assembly protein complex 2 medium chain"", ""AP-2 mu 2 chain"""	601024		CLAPM1		8595912	Standard	NM_004068		Approved	AP50, mu2	uc003fmw.3	Q96CW1	OTTHUMG00000156822	ENST00000292807.5:c.429+64G>C	3.37:g.183898502G>C			A6NE12|D3DNT1|P20172|P53679	Missense_Mutation	SNP	pfam_AP_mu_sigma_su,superfamily_Longin-like_dom,prints_Clathrin_mu	p.G165R	ENST00000292807.5	37	c.493	CCDS43177.1	3	.	.	.	.	.	.	.	.	.	.	G	9.071	0.996820	0.19043	.	.	ENSG00000161203	ENST00000431779	.	.	.	4.75	0.611	0.17586	.	.	.	.	.	T	0.22044	0.0531	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23226	-1.0194	4	.	.	.	.	2.8341	0.05508	0.0916:0.1565:0.4298:0.3221	.	.	.	.	R	165	.	.	G	+	1	0	AP2M1	185381196	0.000000	0.05858	0.000000	0.03702	0.297000	0.27493	-0.219000	0.09228	0.207000	0.20607	0.561000	0.74099	GGG	AP2M1	-	NULL	ENSG00000161203		0.557	AP2M1-003	KNOWN	basic|CCDS	protein_coding	AP2M1	HGNC	protein_coding	OTTHUMT00000346013.1	95	0.00	0	G	NM_004068		183898502	183898502	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000431779	ensembl	human	novel	69_37n	missense	77	22.22	22	SNP	0.000	C
ARHGEF11	9826	genome.wustl.edu	37	1	156917130	156917130	+	Silent	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:156917130G>C	ENST00000361409.2	-	25	3076	c.2334C>G	c.(2332-2334)ctC>ctG	p.L778L	ARHGEF11_ENST00000368194.3_Silent_p.L818L|ARHGEF11_ENST00000315174.8_Silent_p.L194L|ARHGEF11_ENST00000487682.1_5'Flank	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	778	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GGTTCGGGAAGAGCCGGGCCA	0.587																																						dbGAP											0													58.0	71.0	66.0					1																	156917130		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.2334C>G	1.37:g.156917130G>C			D3DVD0|Q5VY40|Q6PFW2	Silent	SNP	pfam_Regulat_G_prot_signal-like,pfam_DH-domain,pfam_PDZ,pfam_Regulat_G_prot_signal,superfamily_DH-domain,superfamily_Regulat_G_prot_signal_superfam,superfamily_PDZ,smart_PDZ,smart_Regulat_G_prot_signal,smart_DH-domain,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Regulat_G_prot_signal,pfscan_DH-domain	p.L818	ENST00000361409.2	37	c.2454	CCDS1162.1	1																																																																																			ARHGEF11	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000132694		0.587	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF11	HGNC	protein_coding	OTTHUMT00000098931.1	49	0.00	0	G	NM_198236		156917130	156917130	-1	no_errors	ENST00000368194	ensembl	human	known	69_37n	silent	69	21.59	19	SNP	1.000	C
ARHGEF11	9826	genome.wustl.edu	37	1	156917199	156917199	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:156917199G>A	ENST00000361409.2	-	25	3007	c.2265C>T	c.(2263-2265)gtC>gtT	p.V755V	ARHGEF11_ENST00000368194.3_Silent_p.V795V|ARHGEF11_ENST00000315174.8_Silent_p.V171V|ARHGEF11_ENST00000487682.1_5'Flank	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	755	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TCAGGTCCAGGACCCGGAGTG	0.567																																						dbGAP											0													42.0	46.0	45.0					1																	156917199		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.2265C>T	1.37:g.156917199G>A			D3DVD0|Q5VY40|Q6PFW2	Silent	SNP	pfam_Regulat_G_prot_signal-like,pfam_DH-domain,pfam_PDZ,pfam_Regulat_G_prot_signal,superfamily_DH-domain,superfamily_Regulat_G_prot_signal_superfam,superfamily_PDZ,smart_PDZ,smart_Regulat_G_prot_signal,smart_DH-domain,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Regulat_G_prot_signal,pfscan_DH-domain	p.V795	ENST00000361409.2	37	c.2385	CCDS1162.1	1																																																																																			ARHGEF11	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000132694		0.567	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF11	HGNC	protein_coding	OTTHUMT00000098931.1	46	0.00	0	G	NM_198236		156917199	156917199	-1	no_errors	ENST00000368194	ensembl	human	known	69_37n	silent	51	13.56	8	SNP	0.995	A
ARHGEF38	54848	genome.wustl.edu	37	4	106510538	106510538	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr4:106510538C>T	ENST00000420470.2	+	2	474	c.330C>T	c.(328-330)ctC>ctT	p.L110L	ARHGEF38_ENST00000265154.2_Silent_p.L110L	NM_001242729.1	NP_001229658.1	Q9NXL2	ARH38_HUMAN	Rho guanine nucleotide exchange factor (GEF) 38	110	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.					cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(3)	11						AGGATTATCTCAATGATCTAG	0.378																																						dbGAP											0													126.0	131.0	129.0					4																	106510538		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK000191	CCDS3670.1, CCDS56338.1	4q24	2012-07-24			ENSG00000236699	ENSG00000236699		"""Rho guanine nucleotide exchange factors"""	25968	protein-coding gene	gene with protein product							Standard	NM_001242729		Approved	FLJ20184	uc003hxv.2	Q9NXL2	OTTHUMG00000154752	ENST00000420470.2:c.330C>T	4.37:g.106510538C>T			C9JIB4	Silent	SNP	pfam_DH-domain,superfamily_DH-domain,pfscan_DH-domain	p.L110	ENST00000420470.2	37	c.330	CCDS56338.1	4																																																																																			ARHGEF38	-	pfam_DH-domain,superfamily_DH-domain,pfscan_DH-domain	ENSG00000236699		0.378	ARHGEF38-001	PUTATIVE	basic|appris_principal|readthrough_transcript|exp_conf|CCDS	protein_coding	ARHGEF38	HGNC	protein_coding	OTTHUMT00000336934.3	43	0.00	0	C	NM_017700		106510538	106510538	+1	no_errors	ENST00000265154	ensembl	human	known	69_37n	silent	42	15.69	8	SNP	0.996	T
ASPG	374569	genome.wustl.edu	37	14	104578858	104578858	+	Intron	SNP	C	C	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr14:104578858C>A	ENST00000551177.1	+	16	1793				ASPG_ENST00000455920.2_Missense_Mutation_p.Q573K|ASPG_ENST00000546892.2_Intron	NM_001080464.2	NP_001073933.2	Q86U10	LPP60_HUMAN	asparaginase						asparagine metabolic process (GO:0006528)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)		1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)|asparaginase activity (GO:0004067)|lysophospholipase activity (GO:0004622)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	11						ctcatgttttcaggaagtgct	0.597																																						dbGAP											0													100.0	107.0	105.0					14																	104578858		2052	4205	6257	-	-	-	SO:0001627	intron_variant	0				CCDS45170.1, CCDS45170.2	14q32.33	2014-03-14	2014-03-14	2008-11-06	ENSG00000166183	ENSG00000166183	3.1.1.5, 3.5.1.1	"""Ankyrin repeat domain containing"""	20123	protein-coding gene	gene with protein product	"""60-kDa-lysophospholipase"""		"""chromosome 14 open reading frame 76"", ""asparaginase homolog (S. cerevisiae)"""	C14orf76			Standard	NM_001080464		Approved		uc001yoq.2	Q86U10		ENST00000551177.1:c.1702-3C>A	14.37:g.104578858C>A			B9EGQ2|Q8IV80	Missense_Mutation	SNP	pfam_Asparaginase/glutaminase,pfam_Ankyrin_rpt,superfamily_Asparaginase/glutaminase,superfamily_Ankyrin_rpt-contain_dom,smart_Asparaginase/glutaminase,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Asparaginase/glutaminase,prints_Ankyrin_rpt,tigrfam_AsnASEI	p.Q573K	ENST00000551177.1	37	c.1717	CCDS45170.2	14	.	.	.	.	.	.	.	.	.	.	C	12.03	1.816753	0.32145	.	.	ENSG00000166183	ENST00000455920;ENST00000550583	T;T	0.35605	1.3;1.96	2.12	1.17	0.20885	.	.	.	.	.	T	0.19644	0.0472	.	.	.	0.09310	N	1	B	0.26744	0.158	B	0.32090	0.14	T	0.33394	-0.9870	8	0.14656	T	0.56	.	5.1102	0.14806	0.0:0.8186:0.0:0.1814	.	573	Q86U10-3	.	K	573;134	ENSP00000389003:Q573K;ENSP00000446856:Q134K	ENSP00000389003:Q573K	Q	+	1	0	ASPG	103648611	0.451000	0.25705	0.218000	0.23776	0.495000	0.33615	1.079000	0.30766	0.425000	0.26087	0.462000	0.41574	CAG	ASPG	-	NULL	ENSG00000166183		0.597	ASPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPG	HGNC	protein_coding	OTTHUMT00000407005.1	84	0.00	0	C	NM_001080464		104578858	104578858	+1	no_errors	ENST00000455920	ensembl	human	known	69_37n	missense	73	20.65	19	SNP	0.519	A
ASTN1	460	genome.wustl.edu	37	1	176833446	176833446	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:176833446C>T	ENST00000367654.3	-	23	4094	c.3883G>A	c.(3883-3885)Gac>Aac	p.D1295N	ASTN1_ENST00000361833.2_Missense_Mutation_p.D1287N|ASTN1_ENST00000367657.3_Intron	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	1295					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						TCCCCATAGTCGTTGTAGGGG	0.562																																						dbGAP											0													135.0	130.0	132.0					1																	176833446		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.3883G>A	1.37:g.176833446C>T	ENSP00000356626:p.Asp1295Asn		A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_EGF-like,smart_MACPF,pfscan_Fibronectin_type3	p.D1295N	ENST00000367654.3	37	c.3883		1	.	.	.	.	.	.	.	.	.	.	C	14.78	2.637756	0.47049	.	.	ENSG00000152092	ENST00000361833;ENST00000367654	T;T	0.10099	2.91;2.91	4.61	2.71	0.32032	.	0.090291	0.85682	N	0.000000	T	0.05868	0.0153	N	0.14661	0.345	0.80722	D	1	B	0.15719	0.014	B	0.08055	0.003	T	0.34950	-0.9808	10	0.18710	T	0.47	-23.0144	10.3604	0.43989	0.0:0.8367:0.0:0.1633	.	1287	O14525-2	.	N	1287;1295	ENSP00000354536:D1287N;ENSP00000356626:D1295N	ENSP00000354536:D1287N	D	-	1	0	ASTN1	175100069	0.999000	0.42202	0.999000	0.59377	0.948000	0.59901	4.292000	0.59031	1.083000	0.41159	-0.234000	0.12200	GAC	ASTN1	-	NULL	ENSG00000152092		0.562	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	HGNC	protein_coding		67	0.00	0	C	NM_004319		176833446	176833446	-1	no_errors	ENST00000367654	ensembl	human	known	69_37n	missense	79	14.13	13	SNP	1.000	T
ATAD2	29028	genome.wustl.edu	37	8	124358470	124358470	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr8:124358470C>T	ENST00000287394.5	-	18	2495	c.2388G>A	c.(2386-2388)ttG>ttA	p.L796L	MIR548AA1_ENST00000384971.2_RNA|ATAD2_ENST00000521903.1_Silent_p.L114L	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	796					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			CTCCTACTATCAATATTCTTG	0.358																																						dbGAP											0													80.0	78.0	78.0					8																	124358470		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.2388G>A	8.37:g.124358470C>T			Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Silent	SNP	pfam_ATPase_AAA_core,pfam_Bromodomain,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.L796	ENST00000287394.5	37	c.2388	CCDS6343.1	8																																																																																			ATAD2	-	NULL	ENSG00000156802		0.358	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD2	HGNC	protein_coding	OTTHUMT00000381766.2	42	0.00	0	C	NM_014109		124358470	124358470	-1	no_errors	ENST00000287394	ensembl	human	known	69_37n	silent	33	19.51	8	SNP	0.996	T
ATAD5	79915	genome.wustl.edu	37	17	29182316	29182316	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr17:29182316G>A	ENST00000321990.4	+	7	2984	c.2606G>A	c.(2605-2607)aGa>aAa	p.R869K	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	869					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				AGTTTCCAGAGAGTCGTACAT	0.383																																						dbGAP											0													85.0	73.0	77.0					17																	29182316		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.2606G>A	17.37:g.29182316G>A	ENSP00000313171:p.Arg869Lys		Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.R869K	ENST00000321990.4	37	c.2606	CCDS11260.1	17	.	.	.	.	.	.	.	.	.	.	G	9.238	1.037610	0.19669	.	.	ENSG00000176208	ENST00000321990	D	0.87887	-2.31	5.6	0.986	0.19784	.	0.306680	0.34223	N	0.004160	T	0.80618	0.4657	M	0.63428	1.95	0.23524	N	0.997498	B;B	0.32467	0.372;0.255	B;B	0.24394	0.053;0.024	T	0.64601	-0.6369	10	0.14656	T	0.56	.	11.9116	0.52743	0.0842:0.6482:0.2676:0.0	.	869;869	Q96QE3-2;Q96QE3	.;ATAD5_HUMAN	K	869	ENSP00000313171:R869K	ENSP00000313171:R869K	R	+	2	0	ATAD5	26206442	0.251000	0.23961	0.850000	0.33497	0.123000	0.20343	0.566000	0.23593	0.274000	0.22072	0.514000	0.50259	AGA	ATAD5	-	NULL	ENSG00000176208		0.383	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD5	HGNC	protein_coding	OTTHUMT00000256206.2	26	0.00	0	G	NM_024857		29182316	29182316	+1	no_errors	ENST00000321990	ensembl	human	known	69_37n	missense	25	13.79	4	SNP	0.914	A
ATF6	22926	genome.wustl.edu	37	1	161823031	161823031	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:161823031G>A	ENST00000367942.3	+	12	1518	c.1451G>A	c.(1450-1452)cGa>cAa	p.R484Q	ATF6_ENST00000476437.1_3'UTR	NM_007348.3	NP_031374.2	P18850	ATF6A_HUMAN	activating transcription factor 6	484	Interaction with THBS4.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response (GO:0006990)|protein folding (GO:0006457)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to stress (GO:0006950)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(14)|ovary(3)|skin(1)|stomach(1)	34	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)		Pseudoephedrine(DB00852)	CATGAACTTCGAGGATGGGTT	0.313																																						dbGAP											0													60.0	60.0	60.0					1																	161823031		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB015856	CCDS1235.1	1q22-q23	2013-01-10			ENSG00000118217	ENSG00000118217		"""basic leucine zipper proteins"""	791	protein-coding gene	gene with protein product	"""activating transcription factor 6 alpha"""	605537				9837962, 9271374, 11256944	Standard	NM_007348		Approved	ATF6A	uc001gbs.3	P18850	OTTHUMG00000023961	ENST00000367942.3:c.1451G>A	1.37:g.161823031G>A	ENSP00000356919:p.Arg484Gln		O15139|Q5VW62|Q6IPB5|Q9UEC9	Missense_Mutation	SNP	pfam_bZIP_1,pfam_bZIP_2,smart_bZIP,pfscan_bZIP	p.R484Q	ENST00000367942.3	37	c.1451	CCDS1235.1	1	.	.	.	.	.	.	.	.	.	.	G	32	5.148461	0.94603	.	.	ENSG00000118217	ENST00000367942	T	0.18810	2.19	5.77	5.77	0.91146	.	0.052976	0.85682	D	0.000000	T	0.28962	0.0719	M	0.72894	2.215	0.50313	D	0.999865	D;D	0.71674	0.998;0.986	P;P	0.52598	0.703;0.47	T	0.03394	-1.1041	9	0.54805	T	0.06	-6.9092	17.4774	0.87662	0.0:0.0:1.0:0.0	.	484;485	P18850;Q59H30	ATF6A_HUMAN;.	Q	484	ENSP00000356919:R484Q	ENSP00000356919:R484Q	R	+	2	0	ATF6	160089655	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.343000	0.79319	2.726000	0.93360	0.655000	0.94253	CGA	ATF6	-	NULL	ENSG00000118217		0.313	ATF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATF6	HGNC	protein_coding	OTTHUMT00000060304.2	40	0.00	0	G	NM_007348		161823031	161823031	+1	no_errors	ENST00000367942	ensembl	human	known	69_37n	missense	57	10.94	7	SNP	1.000	A
ATP10A	57194	genome.wustl.edu	37	15	25932865	25932865	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr15:25932865G>A	ENST00000356865.6	-	16	3387	c.3276C>T	c.(3274-3276)ttC>ttT	p.F1092F		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1092					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		TTTTGTAGAAGAAGTACAGCA	0.498																																						dbGAP											0													151.0	143.0	146.0					15																	25932865		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.3276C>T	15.37:g.25932865G>A			Q4G0S9|Q969I4	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.F1092	ENST00000356865.6	37	c.3276	CCDS32178.1	15																																																																																			ATP10A	-	tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000206190		0.498	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10A	HGNC	protein_coding	OTTHUMT00000414830.1	68	0.00	0	G	NM_024490		25932865	25932865	-1	no_errors	ENST00000356865	ensembl	human	known	69_37n	silent	47	18.97	11	SNP	1.000	A
ATP6V0A1	535	genome.wustl.edu	37	17	40652837	40652837	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr17:40652837G>T	ENST00000343619.4	+	16	1915	c.1792G>T	c.(1792-1794)Gat>Tat	p.D598Y	ATP6V0A1_ENST00000537728.1_Missense_Mutation_p.D555Y|ATP6V0A1_ENST00000544137.1_Missense_Mutation_p.D244Y|ATP6V0A1_ENST00000393829.2_Missense_Mutation_p.D598Y|ATP6V0A1_ENST00000585525.1_Missense_Mutation_p.D555Y|ATP6V0A1_ENST00000546249.1_Missense_Mutation_p.D598Y|ATP6V0A1_ENST00000264649.6_Missense_Mutation_p.D605Y	NM_001130021.1	NP_001123493.1	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1	598					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|urinary_tract(3)	26		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		GACGGCCTATGATGCTCATAC	0.388																																						dbGAP											0													210.0	191.0	197.0					17																	40652837		2203	4300	6503	-	-	-	SO:0001583	missense	0			U73006	CCDS11426.1, CCDS45683.1, CCDS45684.1	17q21	2010-04-21	2006-01-20	2002-05-10	ENSG00000033627	ENSG00000033627		"""ATPases / V-type"""	865	protein-coding gene	gene with protein product		192130	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1A (110/116kD)"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 1"", ""ATPase, H+ transporting, lysosomal V0 subunit A1"""	VPP1, ATP6N1, ATP6N1A		7774924	Standard	NM_001130020		Approved	a1, Vph1, Stv1	uc002hzs.3	Q93050		ENST00000343619.4:c.1792G>T	17.37:g.40652837G>T	ENSP00000342951:p.Asp598Tyr		B7Z3B7|Q8N5G7|Q9NSX0	Missense_Mutation	SNP	pfam_ATPase_V0/A0_a	p.D605Y	ENST00000343619.4	37	c.1813	CCDS45684.1	17	.	.	.	.	.	.	.	.	.	.	G	13.05	2.122242	0.37436	.	.	ENSG00000033627	ENST00000343619;ENST00000546249;ENST00000393829;ENST00000264649;ENST00000537728;ENST00000544137	D;D;D;D;D;D	0.85339	-1.97;-1.97;-1.97;-1.97;-1.97;-1.97	4.91	0.709	0.18150	.	0.275088	0.45867	D	0.000326	D	0.84179	0.5415	L	0.52364	1.645	0.52099	D	0.999944	B;B;B;P;D	0.62365	0.091;0.0;0.0;0.942;0.991	B;B;B;P;P	0.60609	0.126;0.014;0.005;0.724;0.877	T	0.79969	-0.1579	10	0.06625	T	0.88	-7.8785	9.7013	0.40189	0.2822:0.0:0.7178:0.0	.	555;555;605;598;598	B7Z641;B7Z2A9;B7Z3B7;Q93050;Q93050-1	.;.;.;VPP1_HUMAN;.	Y	598;598;598;605;555;244	ENSP00000342951:D598Y;ENSP00000444676:D598Y;ENSP00000377415:D598Y;ENSP00000264649:D605Y;ENSP00000443991:D555Y;ENSP00000446377:D244Y	ENSP00000264649:D605Y	D	+	1	0	ATP6V0A1	37906363	1.000000	0.71417	0.853000	0.33588	0.990000	0.78478	2.740000	0.47418	0.098000	0.17522	-0.258000	0.10820	GAT	ATP6V0A1	-	pfam_ATPase_V0/A0_a	ENSG00000033627		0.388	ATP6V0A1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATP6V0A1	HGNC	protein_coding	OTTHUMT00000450364.1	132	0.75	1	G	NM_001130020		40652837	40652837	+1	no_errors	ENST00000264649	ensembl	human	known	69_37n	missense	102	24.44	33	SNP	1.000	T
ATRNL1	26033	genome.wustl.edu	37	10	117093823	117093823	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr10:117093823C>G	ENST00000355044.3	+	19	3195	c.3069C>G	c.(3067-3069)atC>atG	p.I1023M	ATRNL1_ENST00000423111.2_Intron|ATRNL1_ENST00000303745.7_Intron	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	1023	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		GCACTTGCATCAATAATAATG	0.353																																						dbGAP											0													118.0	104.0	109.0					10																	117093823		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.3069C>G	10.37:g.117093823C>G	ENSP00000347152:p.Ile1023Met		O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_Plexin_repeat,pfam_CUB,pfam_EGF_extracell,superfamily_C-type_lectin_fold,superfamily_CUB,superfamily_Plexin-like_fold,smart_EGF-like,smart_CUB,smart_Plexin-like,smart_C-type_lectin,smart_EGF_laminin,pfscan_CUB,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_C-type_lectin	p.I1023M	ENST00000355044.3	37	c.3069	CCDS7592.1	10	.	.	.	.	.	.	.	.	.	.	C	12.26	1.885642	0.33255	.	.	ENSG00000107518	ENST00000355044	T	0.63417	-0.04	5.45	4.51	0.55191	EGF-like, laminin (2);	0.109676	0.64402	D	0.000005	T	0.51329	0.1668	N	0.25485	0.75	0.80722	D	1	B	0.34015	0.435	B	0.39465	0.3	T	0.51872	-0.8650	10	0.44086	T	0.13	-8.4134	10.2113	0.43143	0.1459:0.783:0.0:0.0711	.	1023	Q5VV63	ATRN1_HUMAN	M	1023	ENSP00000347152:I1023M	ENSP00000347152:I1023M	I	+	3	3	ATRNL1	117083813	0.984000	0.35163	1.000000	0.80357	0.998000	0.95712	0.213000	0.17521	1.343000	0.45638	0.591000	0.81541	ATC	ATRNL1	-	smart_EGF-like,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000107518		0.353	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATRNL1	HGNC	protein_coding	OTTHUMT00000050507.3	69	0.00	0	C	XM_049349		117093823	117093823	+1	no_errors	ENST00000355044	ensembl	human	known	69_37n	missense	59	24.36	19	SNP	1.000	G
BEST1	7439	genome.wustl.edu	37	11	61730178	61730178	+	Missense_Mutation	SNP	G	G	A	rs370835731		TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr11:61730178G>A	ENST00000378043.4	+	10	2195	c.1552G>A	c.(1552-1554)Gag>Aag	p.E518K	FTH1_ENST00000529191.1_Intron|BEST1_ENST00000378042.3_Missense_Mutation_p.E431K|BEST1_ENST00000449131.2_Missense_Mutation_p.E458K|BEST1_ENST00000534553.1_3'UTR|BEST1_ENST00000301774.9_Missense_Mutation_p.E146K|FTH1_ENST00000529631.1_Intron	NM_004183.3	NP_004174.1	O76090	BEST1_HUMAN	bestrophin 1	518					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|detection of light stimulus involved in visual perception (GO:0050908)|ion transmembrane transport (GO:0034220)|regulation of calcium ion transport (GO:0051924)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	basolateral plasma membrane (GO:0016323)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|skin(2)|urinary_tract(2)	25						ATTGCTCTCAGAGAGCGATGG	0.478																																						dbGAP											0													77.0	72.0	74.0					11																	61730178		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF057170	CCDS31580.1, CCDS44623.1	11q12	2013-02-14	2006-10-18	2006-10-18	ENSG00000167995	ENSG00000167995		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	12703	protein-coding gene	gene with protein product	"""Best disease"""	607854	"""vitelliform macular dystrophy 2"""	VMD2		1302019, 17003041	Standard	NM_004183		Approved	BMD, BEST, RP50	uc001nsr.2	O76090	OTTHUMG00000167469	ENST00000378043.4:c.1552G>A	11.37:g.61730178G>A	ENSP00000367282:p.Glu518Lys		A8K0W6|B7Z3J8|B7Z736|O75904|Q53YQ9|Q8IUR9|Q8IZ80	Missense_Mutation	SNP	pfam_Bestrophin/UPF0187	p.E458K	ENST00000378043.4	37	c.1372	CCDS31580.1	11	.	.	.	.	.	.	.	.	.	.	G	12.71	2.018410	0.35606	.	.	ENSG00000167995	ENST00000378043;ENST00000378042;ENST00000301774;ENST00000449131	D;D;T;D	0.97575	-4.37;-4.23;-0.63;-4.44	5.07	0.886	0.19194	.	2.624430	0.01412	N	0.014029	D	0.93805	0.8019	L	0.27053	0.805	0.09310	N	0.999991	B;B;B	0.11235	0.002;0.001;0.004	B;B;B	0.10450	0.003;0.001;0.005	D	0.85099	0.0956	10	0.54805	T	0.06	0.0167	7.0292	0.24956	0.1515:0.2663:0.5822:0.0	.	431;518;458	O76090-4;O76090;O76090-3	.;BEST1_HUMAN;.	K	518;431;146;458	ENSP00000367282:E518K;ENSP00000367281:E431K;ENSP00000301774:E146K;ENSP00000399709:E458K	ENSP00000301774:E146K	E	+	1	0	BEST1	61486754	0.006000	0.16342	0.000000	0.03702	0.005000	0.04900	1.158000	0.31737	-0.012000	0.14223	-0.136000	0.14681	GAG	BEST1	-	NULL	ENSG00000167995		0.478	BEST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEST1	HGNC	protein_coding	OTTHUMT00000394715.1	46	0.00	0	G	NM_004183		61730178	61730178	+1	no_errors	ENST00000449131	ensembl	human	known	69_37n	missense	31	29.55	13	SNP	0.000	A
BICC1	80114	genome.wustl.edu	37	10	60560726	60560726	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr10:60560726G>C	ENST00000373886.3	+	14	1939	c.1935G>C	c.(1933-1935)caG>caC	p.Q645H	BICC1_ENST00000263103.1_Missense_Mutation_p.Q271H	NM_001080512.1	NP_001073981.1	Q9H694	BICC1_HUMAN	BicC family RNA binding protein 1	645					multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	44						ACTTGAAACAGATGATGTGTC	0.418																																						dbGAP											0													153.0	140.0	144.0					10																	60560726		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026129	CCDS31206.1	10q21.3	2014-09-17	2014-02-03		ENSG00000122870	ENSG00000122870		"""Sterile alpha motif (SAM) domain containing"""	19351	protein-coding gene	gene with protein product		614295	"""bicaudal C homolog 1 (Drosophila)"""				Standard	XM_005270166		Approved		uc001jki.1	Q9H694	OTTHUMG00000018271	ENST00000373886.3:c.1935G>C	10.37:g.60560726G>C	ENSP00000362993:p.Gln645His			Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_KH_dom,smart_SAM,pfscan_SAM,pfscan_KH_dom_type_1	p.Q645H	ENST00000373886.3	37	c.1935	CCDS31206.1	10	.	.	.	.	.	.	.	.	.	.	G	18.82	3.704366	0.68615	.	.	ENSG00000122870	ENST00000373886;ENST00000263103	T;T	0.51817	1.55;0.69	6.04	3.12	0.35913	.	0.000000	0.85682	D	0.000000	T	0.61085	0.2319	M	0.63843	1.955	0.49213	D	0.999767	D;D	0.71674	0.998;0.996	D;D	0.79784	0.993;0.986	T	0.55982	-0.8054	10	0.36615	T	0.2	-10.2103	10.0696	0.42325	0.2673:0.0:0.7327:0.0	.	565;645	E7EU62;Q9H694	.;BICC1_HUMAN	H	645;271	ENSP00000362993:Q645H;ENSP00000263103:Q271H	ENSP00000263103:Q271H	Q	+	3	2	BICC1	60230732	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	2.917000	0.48821	0.404000	0.25506	-0.254000	0.11334	CAG	BICC1	-	NULL	ENSG00000122870		0.418	BICC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BICC1	HGNC	protein_coding	OTTHUMT00000048150.2	41	0.00	0	G	NM_025044		60560726	60560726	+1	no_errors	ENST00000373886	ensembl	human	known	69_37n	missense	59	10.61	7	SNP	1.000	C
BLOC1S1	2647	genome.wustl.edu	37	12	56112992	56112992	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:56112992C>T	ENST00000548925.1	+	3	351	c.336C>T	c.(334-336)ttC>ttT	p.F112F	RP11-644F5.10_ENST00000549424.1_Silent_p.F34F|RDH5_ENST00000257895.5_5'Flank|RP11-644F5.10_ENST00000550412.1_Silent_p.F112F|BLOC1S1_ENST00000257899.2_Silent_p.F84F|BLOC1S1_ENST00000549147.1_Silent_p.F112F|BLOC1S1_ENST00000548556.1_Silent_p.F34F|BLOC1S1_ENST00000551926.1_Silent_p.F34F|RDH5_ENST00000547072.1_5'Flank|BLOC1S1_ENST00000547076.1_Silent_p.F34F|RDH5_ENST00000548082.1_5'Flank			P78537	BL1S1_HUMAN	biogenesis of lysosomal organelles complex-1, subunit 1	112					aerobic respiration (GO:0009060)|anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|neuron projection development (GO:0031175)|peptidyl-lysine acetylation (GO:0018394)|platelet dense granule organization (GO:0060155)|post-Golgi vesicle-mediated transport (GO:0006892)	BLOC-1 complex (GO:0031083)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)				breast(1)|endometrium(1)|large_intestine(1)|prostate(1)	4						TGGAGAACTTCAACCAGGCAC	0.562																																					Colon(112;1254 2715 13015)	dbGAP											0													91.0	76.0	81.0					12																	56112992		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			S82447	CCDS8889.1, CCDS8889.2	12q13-q14	2012-08-01	2008-08-11	2004-05-26		ENSG00000135441		"""Biogenesis of lysosomal organelles complex-1 subunits"""	4200	protein-coding gene	gene with protein product	"""GCN5 (general control of amino-acid synthesis, yeast, homolog)-like 1"", ""BLOC-1 Subunit 1"", ""Biogenesis of Lysosome-related Organelles complex-1 Subunit 1"""	601444	"""GCN5 general control of amino-acid synthesis 5-like 1 (yeast)"""	GCN5L1		8646881, 15102850	Standard	NM_001487		Approved	BLOS1	uc001shi.4	P78537		ENST00000548925.1:c.336C>T	12.37:g.56112992C>T			A1L4Q9|Q6NZ45	Silent	SNP	pfam_GCN5L1	p.F112	ENST00000548925.1	37	c.336	CCDS8889.2	12																																																																																			BLOC1S1	-	pfam_GCN5L1	ENSG00000135441		0.562	BLOC1S1-001	KNOWN	downstream_ATG|basic|CCDS	protein_coding	BLOC1S1	HGNC	protein_coding	OTTHUMT00000406681.1	37	0.00	0	C	NM_001487		56112992	56112992	+1	no_errors	ENST00000548925	ensembl	human	known	69_37n	silent	38	15.56	7	SNP	1.000	T
BLVRA	644	genome.wustl.edu	37	7	43846647	43846647	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr7:43846647C>G	ENST00000402924.1	+	9	867	c.704C>G	c.(703-705)tCt>tGt	p.S235C	BLVRA_ENST00000265523.4_Missense_Mutation_p.S235C	NM_001253823.1	NP_001240752.1	P53004	BIEA_HUMAN	biliverdin reductase A	235					heme catabolic process (GO:0042167)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	biliverdin reductase activity (GO:0004074)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(4)|lung(4)|ovary(1)|stomach(2)	12						CATTTCAAGTCTGGGTCCTTG	0.378																																						dbGAP											0													64.0	64.0	64.0					7																	43846647		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008456	CCDS5472.1	7p13	2012-10-02			ENSG00000106605	ENSG00000106605	1.3.1.24		1062	protein-coding gene	gene with protein product		109750		BLVR			Standard	NM_001253823		Approved		uc003tir.3	P53004	OTTHUMG00000128953	ENST00000402924.1:c.704C>G	7.37:g.43846647C>G	ENSP00000385757:p.Ser235Cys		A8K747|O95019|Q86UX0|Q96QL4|Q9BRW8	Missense_Mutation	SNP	pfam_Biliverdin_Rdtase_cat,pfam_Oxidoreductase_N,pirsf_Biliverdin_Rdtase_A	p.S235C	ENST00000402924.1	37	c.704	CCDS5472.1	7	.	.	.	.	.	.	.	.	.	.	C	16.63	3.177272	0.57692	.	.	ENSG00000106605	ENST00000265523;ENST00000402924	T;T	0.27256	1.68;1.68	4.25	4.25	0.50352	Biliverdin reductase, catalytic (2);	0.433423	0.26776	N	0.022552	T	0.44498	0.1296	L	0.50333	1.59	0.38013	D	0.9346	D	0.89917	1.0	D	0.80764	0.994	T	0.50931	-0.8769	10	0.62326	D	0.03	.	14.5225	0.67859	0.0:1.0:0.0:0.0	.	235	P53004	BIEA_HUMAN	C	235	ENSP00000265523:S235C;ENSP00000385757:S235C	ENSP00000265523:S235C	S	+	2	0	BLVRA	43813172	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.430000	0.44766	2.076000	0.62316	0.462000	0.41574	TCT	BLVRA	-	pfam_Biliverdin_Rdtase_cat,pirsf_Biliverdin_Rdtase_A	ENSG00000106605		0.378	BLVRA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BLVRA	HGNC	protein_coding	OTTHUMT00000339006.1	25	0.00	0	C	NM_000712		43846647	43846647	+1	no_errors	ENST00000265523	ensembl	human	known	69_37n	missense	42	23.64	13	SNP	1.000	G
BTBD6	90135	genome.wustl.edu	37	14	105716582	105716582	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr14:105716582C>T	ENST00000392554.3	+	4	1328	c.1031C>T	c.(1030-1032)tCt>tTt	p.S344F	BTBD6_ENST00000536364.1_Missense_Mutation_p.S344F|BRF1_ENST00000379937.2_Intron|BRF1_ENST00000392557.4_5'Flank|BRF1_ENST00000446501.2_5'Flank|BTBD6_ENST00000463376.2_Missense_Mutation_p.S269F|BRF1_ENST00000327359.3_Intron|BRF1_ENST00000546474.1_Intron|BTBD6_ENST00000327471.3_Missense_Mutation_p.S269F|BRF1_ENST00000440513.3_Intron			Q96KE9	BTBD6_HUMAN	BTB (POZ) domain containing 6	344						cytoplasm (GO:0005737)				endometrium(1)|lung(3)	4		Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.0163)|Epithelial(46;0.0391)	Epithelial(152;0.18)		TTCCAGTCTTCTGCCTACCGC	0.617																																						dbGAP											0													34.0	39.0	37.0					14																	105716582		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF353674	CCDS10002.1, CCDS10002.2	14q32.33	2013-01-08			ENSG00000184887	ENSG00000184887		"""BTB/POZ domain containing"""	19897	protein-coding gene	gene with protein product							Standard	NM_033271		Approved	BDPL	uc010tyq.2	Q96KE9	OTTHUMG00000029887	ENST00000392554.3:c.1031C>T	14.37:g.105716582C>T	ENSP00000376337:p.Ser344Phe		Q8IVQ7|Q9BR94	Missense_Mutation	SNP	pfam_PHR,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.S344F	ENST00000392554.3	37	c.1031	CCDS10002.2	14	.	.	.	.	.	.	.	.	.	.	C	20.9	4.062967	0.76187	.	.	ENSG00000184887	ENST00000536364;ENST00000537513;ENST00000392554;ENST00000327471	T;T;T;T	0.74209	-0.8;-0.82;-0.8;-0.7	5.03	5.03	0.67393	PHR (1);	0.000000	0.85682	D	0.000000	T	0.80281	0.4594	L	0.43152	1.355	0.80722	D	1	D	0.63880	0.993	D	0.65323	0.934	T	0.79286	-0.1866	10	0.38643	T	0.18	-22.2665	15.8743	0.79151	0.0:1.0:0.0:0.0	.	344	Q96KE9	BTBD6_HUMAN	F	344;344;344;269	ENSP00000443091:S344F;ENSP00000446223:S344F;ENSP00000376337:S344F;ENSP00000329361:S269F	ENSP00000329361:S269F	S	+	2	0	BTBD6	104787627	0.992000	0.36948	0.883000	0.34634	0.996000	0.88848	3.161000	0.50747	2.322000	0.78497	0.563000	0.77884	TCT	BTBD6	-	pfam_PHR	ENSG00000184887		0.617	BTBD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BTBD6	HGNC	protein_coding	OTTHUMT00000074556.4	15	0.00	0	C			105716582	105716582	+1	no_errors	ENST00000392554	ensembl	human	known	69_37n	missense	11	35.29	6	SNP	0.994	T
BTK	695	genome.wustl.edu	37	X	100617649	100617649	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chrX:100617649C>T	ENST00000308731.7	-	6	583	c.420G>A	c.(418-420)caG>caA	p.Q140Q	BTK_ENST00000372880.1_Silent_p.Q140Q	NM_000061.2	NP_000052.1	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	140					adaptive immune response (GO:0002250)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|Fc-epsilon receptor signaling pathway (GO:0038095)|histamine secretion by mast cell (GO:0002553)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell cytokine production (GO:0002721)|response to organic substance (GO:0010033)|response to reactive oxygen species (GO:0000302)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein tyrosine kinase activity (GO:0004713)			breast(4)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(25)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						GGTGATATTTCTGAACCAGAT	0.453									Agammaglobulinemia, X-linked																													dbGAP											0													168.0	156.0	160.0					X																	100617649		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Bruton Type Agammaglobulinemia	AK057105	CCDS14482.1, CCDS76002.1, CCDS76003.1	Xq21.33-q22	2014-09-17			ENSG00000010671	ENSG00000010671	2.7.10.1	"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1133	protein-coding gene	gene with protein product		300300		AGMX1, IMD1		8380905	Standard	NM_000061		Approved	ATK, XLA, PSCTK1	uc004ehg.2	Q06187	OTTHUMG00000022022	ENST00000308731.7:c.420G>A	X.37:g.100617649C>T			B2RAW1|Q32ML5	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_Znf_Btk_motif,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,prints_SH2,prints_Znf_Btk_motif	p.Q140	ENST00000308731.7	37	c.420	CCDS14482.1	X																																																																																			BTK	-	pfam_Znf_Btk_motif,smart_Znf_Btk_motif,pfscan_Znf_Btk_motif,prints_Znf_Btk_motif	ENSG00000010671		0.453	BTK-006	KNOWN	basic|appris_principal|CCDS	protein_coding	BTK	HGNC	protein_coding	OTTHUMT00000057532.2	68	0.00	0	C	NM_000061		100617649	100617649	-1	no_errors	ENST00000308731	ensembl	human	known	69_37n	silent	50	20.31	13	SNP	1.000	T
C16orf45	89927	genome.wustl.edu	37	16	15675102	15675102	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr16:15675102G>A	ENST00000300006.4	+	4	692	c.333G>A	c.(331-333)caG>caA	p.Q111Q	C16orf45_ENST00000452191.2_Silent_p.Q94Q|C16orf45_ENST00000561692.1_Silent_p.Q63Q|C16orf45_ENST00000566490.1_Silent_p.Q111Q|C16orf45_ENST00000565913.1_3'UTR	NM_033201.2	NP_149978.1	Q96MC5	CP045_HUMAN	chromosome 16 open reading frame 45	111										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)	11						TGCAGAAGCAGAGAGAGGATG	0.502																																						dbGAP											0													87.0	76.0	80.0					16																	15675102		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AK057180	CCDS10561.1, CCDS45422.1	16p13.2	2012-10-09			ENSG00000166780	ENSG00000166780			19213	protein-coding gene	gene with protein product							Standard	NM_033201		Approved	FLJ32618	uc002ddo.3	Q96MC5	OTTHUMG00000129883	ENST00000300006.4:c.333G>A	16.37:g.15675102G>A			O00223|O75769|Q8IZ36|Q96H25	Missense_Mutation	SNP	pfam_DUF3585	p.R76K	ENST00000300006.4	37	c.227	CCDS10561.1	16																																																																																			C16orf45	-	pfam_DUF3585	ENSG00000166780		0.502	C16orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf45	HGNC	protein_coding	OTTHUMT00000252130.2	54	0.00	0	G	NM_033201		15675102	15675102	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000564389	ensembl	human	putative	69_37n	missense	40	18.37	9	SNP	1.000	A
C1orf74	148304	genome.wustl.edu	37	1	209956721	209956721	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:209956721C>T	ENST00000294811.1	-	2	515	c.259G>A	c.(259-261)Gag>Aag	p.E87K		NM_152485.2	NP_689698.1	Q96LT6	CA074_HUMAN	chromosome 1 open reading frame 74	87										endometrium(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)	15				OV - Ovarian serous cystadenocarcinoma(81;0.0328)		TCTCCAATCTCAAGGATGTGA	0.507																																						dbGAP											0													57.0	56.0	56.0					1																	209956721		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057807	CCDS1491.1	1q32.2	2008-02-05			ENSG00000162757	ENSG00000162757			26319	protein-coding gene	gene with protein product						12477932	Standard	NM_152485		Approved	FLJ25078	uc001hhp.1	Q96LT6	OTTHUMG00000036483	ENST00000294811.1:c.259G>A	1.37:g.209956721C>T	ENSP00000294811:p.Glu87Lys			Missense_Mutation	SNP	NULL	p.E87K	ENST00000294811.1	37	c.259	CCDS1491.1	1	.	.	.	.	.	.	.	.	.	.	C	12.71	2.020877	0.35606	.	.	ENSG00000162757	ENST00000294811	T	0.43294	0.95	5.61	5.61	0.85477	.	0.399011	0.27092	N	0.020971	T	0.34629	0.0904	M	0.63428	1.95	0.33891	D	0.637376	P	0.41848	0.763	B	0.36845	0.234	T	0.43294	-0.9400	10	0.12103	T	0.63	-26.0809	9.8528	0.41068	0.0:0.8476:0.0:0.1524	.	87	Q96LT6	CA074_HUMAN	K	87	ENSP00000294811:E87K	ENSP00000294811:E87K	E	-	1	0	C1orf74	208023344	0.004000	0.15560	0.996000	0.52242	0.996000	0.88848	1.367000	0.34204	2.652000	0.90054	0.655000	0.94253	GAG	C1orf74	-	NULL	ENSG00000162757		0.507	C1orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf74	HGNC	protein_coding	OTTHUMT00000088745.1	44	0.00	0	C	NM_152485		209956721	209956721	-1	no_errors	ENST00000294811	ensembl	human	known	69_37n	missense	72	11.11	9	SNP	0.983	T
C2CD2	25966	genome.wustl.edu	37	21	43342090	43342090	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr21:43342090G>A	ENST00000380486.3	-	3	724	c.483C>T	c.(481-483)ttC>ttT	p.F161F	C2CD2_ENST00000329623.7_Silent_p.F6F	NM_015500.1	NP_056315.1	Q9Y426	CU025_HUMAN	C2 calcium-dependent domain containing 2	161						cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|ovary(3)|prostate(1)|stomach(1)	15						CCTGTAAATGGAAAGGGGAGA	0.527																																						dbGAP											0													65.0	59.0	61.0					21																	43342090		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB047784	CCDS13677.1, CCDS42933.1	21q22.3	2008-11-24	2007-10-17	2007-10-17	ENSG00000157617	ENSG00000157617			1266	protein-coding gene	gene with protein product	"""TMEM24-like"""		"""chromosome 21 open reading frame 25"""	C21orf25		15289880	Standard	NM_015500		Approved	TMEM24L, DKFZP586F0422, C21orf258	uc002yzw.3	Q9Y426	OTTHUMG00000086779	ENST00000380486.3:c.483C>T	21.37:g.43342090G>A			Q5R2V7|Q6AHX8|Q9NSE6	Silent	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB	p.F161	ENST00000380486.3	37	c.483	CCDS42933.1	21																																																																																			C2CD2	-	NULL	ENSG00000157617		0.527	C2CD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2CD2	HGNC	protein_coding	OTTHUMT00000195228.2	44	0.00	0	G	NM_015500		43342090	43342090	-1	no_errors	ENST00000380486	ensembl	human	known	69_37n	silent	29	32.56	14	SNP	0.000	A
C2CD3	26005	genome.wustl.edu	37	11	73789504	73789504	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr11:73789504C>T	ENST00000334126.7	-	23	4485	c.4259G>A	c.(4258-4260)tGt>tAt	p.C1420Y	C2CD3_ENST00000313663.7_Missense_Mutation_p.C1420Y			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	1420					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					AAGCAGCACACAATGGATGGG	0.488																																						dbGAP											0													64.0	60.0	61.0					11																	73789504		2200	4293	6493	-	-	-	SO:0001583	missense	0			BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.4259G>A	11.37:g.73789504C>T	ENSP00000334379:p.Cys1420Tyr		C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep	p.C1420Y	ENST00000334126.7	37	c.4259		11	.	.	.	.	.	.	.	.	.	.	C	21.0	4.080357	0.76528	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681;ENST00000414160	T;T;T	0.16073	2.69;2.75;2.37	5.3	5.3	0.74995	.	0.045398	0.85682	D	0.000000	T	0.42630	0.1211	M	0.66939	2.045	0.49798	D	0.999825	D	0.76494	0.999	D	0.80764	0.994	T	0.27773	-1.0064	10	0.62326	D	0.03	-5.0948	18.5433	0.91037	0.0:1.0:0.0:0.0	.	1420	Q4AC94-1	.	Y	1420;1420;1401;228	ENSP00000334379:C1420Y;ENSP00000323339:C1420Y;ENSP00000388750:C228Y	ENSP00000323339:C1420Y	C	-	2	0	C2CD3	73467152	1.000000	0.71417	0.776000	0.31678	0.783000	0.44284	7.474000	0.81024	2.472000	0.83506	0.655000	0.94253	TGT	C2CD3	-	NULL	ENSG00000168014		0.488	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	C2CD3	HGNC	protein_coding		45	0.00	0	C	NM_015531		73789504	73789504	-1	no_errors	ENST00000334126	ensembl	human	known	69_37n	missense	43	23.21	13	SNP	1.000	T
C5orf42	65250	genome.wustl.edu	37	5	37125442	37125442	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr5:37125442C>T	ENST00000508244.1	-	45	8793	c.8700G>A	c.(8698-8700)atG>atA	p.M2900I	C5orf42_ENST00000425232.2_Missense_Mutation_p.M2900I|C5orf42_ENST00000274258.7_Missense_Mutation_p.M1798I|C5orf42_ENST00000512288.1_Intron			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	2900						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			GTTTTCTTTTCATCCAGGCTT	0.383																																						dbGAP											0													223.0	204.0	210.0					5																	37125442		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.8700G>A	5.37:g.37125442C>T	ENSP00000421690:p.Met2900Ile		A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	superfamily_Quino_amine_DH_bsu	p.M2900I	ENST00000508244.1	37	c.8700	CCDS34146.2	5	.	.	.	.	.	.	.	.	.	.	C	32	5.158061	0.94686	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429	T;T;T;T	0.53423	0.62;0.62;0.62;0.62	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.70064	0.3181	M	0.78801	2.425	0.41829	D	0.990066	D;D	0.71674	0.998;0.982	D;D	0.78314	0.991;0.961	T	0.72577	-0.4251	10	0.87932	D	0	.	16.1594	0.81686	0.0:1.0:0.0:0.0	.	2900;1798	E9PH94;Q9H799	.;CE042_HUMAN	I	2900;2900;1798;1966	ENSP00000421690:M2900I;ENSP00000389014:M2900I;ENSP00000274258:M1798I;ENSP00000424223:M1966I	ENSP00000274258:M1798I	M	-	3	0	C5orf42	37161199	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	3.754000	0.55189	2.885000	0.99019	0.655000	0.94253	ATG	C5orf42	-	NULL	ENSG00000197603		0.383	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C5orf42	HGNC	protein_coding	OTTHUMT00000360806.1	139	0.00	0	C	NM_023073		37125442	37125442	-1	no_errors	ENST00000425232	ensembl	human	known	69_37n	missense	104	19.38	25	SNP	1.000	T
STKLD1	169436	genome.wustl.edu	37	9	136266896	136266896	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr9:136266896C>T	ENST00000371957.3	+	13	1335	c.1228C>T	c.(1228-1230)Ccc>Tcc	p.P410S	C9orf96_ENST00000371955.1_Intron	NM_153710.3	NP_714921.4	Q8NE28	STKL1_HUMAN		410							ATP binding (GO:0005524)|protein kinase activity (GO:0004672)	p.P410S(1)		autonomic_ganglia(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|stomach(2)	25				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		AGCCAAGGCTCCCTGCAACCA	0.622																																						dbGAP											1	Substitution - Missense(1)	urinary_tract(1)											66.0	58.0	61.0					9																	136266896		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000371957.3:c.1228C>T	9.37:g.136266896C>T	ENSP00000361025:p.Pro410Ser		Q5T8U8|Q6ZMP6|Q6ZMQ5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.P410S	ENST00000371957.3	37	c.1228	CCDS35169.1	9	.	.	.	.	.	.	.	.	.	.	C	8.647	0.897255	0.17686	.	.	ENSG00000198870	ENST00000371957	T	0.47177	0.85	3.97	1.02	0.19986	Armadillo-like helical (1);Armadillo-type fold (1);	0.891569	0.09544	N	0.787882	T	0.39253	0.1071	L	0.56769	1.78	0.09310	N	1	B	0.14438	0.01	B	0.09377	0.004	T	0.32771	-0.9894	10	0.37606	T	0.19	-10.343	4.0409	0.09751	0.0:0.5794:0.1966:0.224	.	410	Q8NE28	SGK71_HUMAN	S	410	ENSP00000361025:P410S	ENSP00000361025:P410S	P	+	1	0	C9orf96	135256717	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.730000	0.26043	0.099000	0.17552	0.491000	0.48974	CCC	C9orf96	-	superfamily_ARM-type_fold	ENSG00000198870		0.622	C9orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf96	HGNC	protein_coding	OTTHUMT00000054855.1	35	0.00	0	C			136266896	136266896	+1	no_errors	ENST00000371957	ensembl	human	known	69_37n	missense	30	18.92	7	SNP	0.000	T
CACNA1A	773	genome.wustl.edu	37	19	13370461	13370461	+	Nonsense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr19:13370461C>T	ENST00000360228.5	-	27	4304	c.4305G>A	c.(4303-4305)tgG>tgA	p.W1435*	CACNA1A_ENST00000573710.2_Nonsense_Mutation_p.W1436*	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1436					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	CATACTTCTTCCACTCCCGGT	0.552																																						dbGAP											0													59.0	63.0	62.0					19																	13370461		1993	4150	6143	-	-	-	SO:0001587	stop_gained	0			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.4305G>A	19.37:g.13370461C>T	ENSP00000353362:p.Trp1435*		J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Nonsense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.W1435*	ENST00000360228.5	37	c.4305	CCDS45998.1	19	.	.	.	.	.	.	.	.	.	.	C	46	12.754570	0.99693	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084;ENST00000445042	.	.	.	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.8346	0.85954	0.0:1.0:0.0:0.0	.	.	.	.	X	1435;1439;1436;1436;52	.	ENSP00000317661:W1436X	W	-	3	0	CACNA1A	13231461	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	7.818000	0.86416	2.265000	0.75225	0.561000	0.74099	TGG	CACNA1A	-	pfam_Ion_trans_dom	ENSG00000141837		0.552	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	HGNC	protein_coding	OTTHUMT00000104062.2	61	0.00	0	C	NM_000068		13370461	13370461	-1	no_errors	ENST00000360228	ensembl	human	known	69_37n	nonsense	56	24.32	18	SNP	1.000	T
CACNB2	783	genome.wustl.edu	37	10	18690014	18690014	+	Intron	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr10:18690014G>A	ENST00000324631.7	+	3	273				CACNB2_ENST00000377329.4_Intron|CACNB2_ENST00000377319.3_Intron|CACNB2_ENST00000377328.1_Intron|CACNB2_ENST00000396576.2_Intron|CACNB2_ENST00000377315.4_Silent_p.K18K|CACNB2_ENST00000352115.6_Intron|CACNB2_ENST00000377331.2_Intron|CACNB2_ENST00000282343.8_Intron	NM_201593.2|NM_201596.2	NP_963887.2|NP_963890.2	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2 subunit						axon guidance (GO:0007411)|calcium ion import (GO:0070509)|neuromuscular junction development (GO:0007528)|positive regulation of calcium ion transport (GO:0051928)|synaptic transmission (GO:0007268)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|voltage-gated calcium channel complex (GO:0005891)	calcium channel activity (GO:0005262)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|stomach(2)	31					Amlodipine(DB00381)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GAAGGCTGAAGAATTCTGATA	0.532																																						dbGAP											0													126.0	125.0	125.0					10																	18690014		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			U95019	CCDS7125.1, CCDS7126.1, CCDS7127.1, CCDS7128.1, CCDS7129.1, CCDS41493.1, CCDS41494.1	10p12	2014-09-17			ENSG00000165995	ENSG00000165995		"""Calcium channel subunits"""	1402	protein-coding gene	gene with protein product		600003		MYSB, CACNLB2		9254841, 8494331	Standard	NM_201596		Approved		uc001ipr.2	Q08289	OTTHUMG00000017764	ENST00000324631.7:c.214-839G>A	10.37:g.18690014G>A			A6PVM5|A6PVM7|A6PVM8|O00304|Q5QJ99|Q5QJA0|Q5VVG9|Q5VVH0|Q5VWV6|Q6TME1|Q6TME2|Q6TME3|Q8WX81|Q96NZ3|Q96NZ4|Q96NZ5|Q9BWU2|Q9HD32|Q9Y340|Q9Y341	Silent	SNP	pfam_Guanylate_kin,pfam_VDCC_L_bsu,superfamily_SH3_domain,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_SH3_domain,prints_VDCC_L_bsu,prints_VDCC_L_b2su	p.K18	ENST00000324631.7	37	c.54	CCDS7125.1	10																																																																																			CACNB2	-	NULL	ENSG00000165995		0.532	CACNB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CACNB2	HGNC	protein_coding	OTTHUMT00000047072.2	88	0.00	0	G	NM_000724		18690014	18690014	+1	no_errors	ENST00000377315	ensembl	human	known	69_37n	silent	73	20.65	19	SNP	1.000	A
CALCA	796	genome.wustl.edu	37	11	14989397	14989397	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr11:14989397G>A	ENST00000486207.1	-	3	239	c.231C>T	c.(229-231)atC>atT	p.I77I	CALCA_ENST00000361010.3_Silent_p.I77I|CALCB_ENST00000523376.1_Intron|CALCA_ENST00000359642.3_Missense_Mutation_p.H135Y			P06881	CALCA_HUMAN	calcitonin-related polypeptide alpha	77					activation of adenylate cyclase activity (GO:0007190)|cell-cell signaling (GO:0007267)|cytosolic calcium ion homeostasis (GO:0051480)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|G-protein coupled receptor internalization (GO:0002031)|leukocyte cell-cell adhesion (GO:0007159)|negative regulation of blood pressure (GO:0045776)|negative regulation of bone resorption (GO:0045779)|negative regulation of calcium ion transport into cytosol (GO:0010523)|negative regulation of osteoclast differentiation (GO:0045671)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of vasodilation (GO:0045909)|protein phosphorylation (GO:0006468)|receptor internalization (GO:0031623)|regulation of blood pressure (GO:0008217)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	protein complex binding (GO:0032403)|receptor binding (GO:0005102)			central_nervous_system(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	8						TCTGGGCAATGATTCTGATTT	0.532																																						dbGAP											0													69.0	67.0	67.0					11																	14989397		2200	4294	6494	-	-	-	SO:0001819	synonymous_variant	0			X00356, M64486	CCDS7819.1, CCDS31432.1	11p15.2	2014-09-17	2008-02-20		ENSG00000110680	ENSG00000110680		"""Endogenous ligands"""	1437	protein-coding gene	gene with protein product	"""calcitonin"""	114130	"""calcitonin 1"""	CALC1		6546550	Standard	NM_001033953		Approved		uc001mlw.1	P01258	OTTHUMG00000159731	ENST00000486207.1:c.231C>T	11.37:g.14989397G>A			Q93048|Q9UCP0	Missense_Mutation	SNP	pfam_Procalcitonin/adrenomedullin,smart_Calcitonin_peptide-like,prints_Procalcitonin_A-typ	p.H135Y	ENST00000486207.1	37	c.403	CCDS31432.1	11	.	.	.	.	.	.	.	.	.	.	G	10.34	1.322934	0.23994	.	.	ENSG00000110680	ENST00000359642	T	0.09723	2.95	4.59	4.59	0.56863	.	1.878540	0.02019	N	0.047662	T	0.12860	0.0312	.	.	.	0.27517	N	0.951526	.	.	.	.	.	.	T	0.30475	-0.9977	7	0.72032	D	0.01	-18.6481	3.7658	0.08622	0.0879:0.1512:0.5812:0.1797	.	.	.	.	Y	135	ENSP00000352663:H135Y	ENSP00000352663:H135Y	H	-	1	0	CALCA	14945973	1.000000	0.71417	0.987000	0.45799	0.279000	0.26890	1.584000	0.36589	2.838000	0.97847	0.655000	0.94253	CAT	CALCA	-	NULL	ENSG00000110680		0.532	CALCA-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CALCA	HGNC	protein_coding	OTTHUMT00000357068.1	48	0.00	0	G	NM_001741		14989397	14989397	-1	no_errors	ENST00000359642	ensembl	human	known	69_37n	missense	41	19.61	10	SNP	1.000	A
CBFA2T2	9139	genome.wustl.edu	37	20	32217579	32217579	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr20:32217579C>G	ENST00000346541.3	+	9	1651	c.1114C>G	c.(1114-1116)Ctg>Gtg	p.L372V	CBFA2T2_ENST00000397800.1_Missense_Mutation_p.L343V|CBFA2T2_ENST00000375279.2_Missense_Mutation_p.L372V|CBFA2T2_ENST00000491618.1_3'UTR|CBFA2T2_ENST00000359606.3_Missense_Mutation_p.L382V|CBFA2T2_ENST00000342704.6_Missense_Mutation_p.L363V|CBFA2T2_ENST00000492345.1_Missense_Mutation_p.L343V	NM_005093.3	NP_005084.1	O43439	MTG8R_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 2	372					epithelial cell differentiation (GO:0030855)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)	20						TATGGCAGTTCTGCGGCGCTG	0.488																																					Esophageal Squamous(174;142 1955 14837 21276 28041)	dbGAP											0													92.0	94.0	93.0					20																	32217579		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF052210	CCDS13221.1, CCDS46590.1	20q11	2007-01-29			ENSG00000078699	ENSG00000078699		"""Zinc fingers, MYND-type"""	1536	protein-coding gene	gene with protein product		603672				9790752	Standard	XM_006723886		Approved	MTGR1, ZMYND3	uc002wze.1	O43439	OTTHUMG00000032261	ENST00000346541.3:c.1114C>G	20.37:g.32217579C>G	ENSP00000262653:p.Leu372Val		B2RAE6|F8W6D7|Q5TGE4|Q5TGE5|Q5TGE6|Q5TGE7|Q8IWF3|Q96B06|Q96L00|Q9H436|Q9UJP8|Q9UJP9|Q9UP24	Missense_Mutation	SNP	pfam_NHR2,pfam_TAFH_NHR1,pfam_Znf_MYND,smart_TAFH_NHR1,pfscan_TAFH_NHR1,pfscan_Znf_MYND,prints_ETO,prints_MTGR1	p.L372V	ENST00000346541.3	37	c.1114	CCDS13221.1	20	.	.	.	.	.	.	.	.	.	.	C	21.9	4.215958	0.79352	.	.	ENSG00000078699	ENST00000397803;ENST00000375279;ENST00000342704;ENST00000346541;ENST00000397800;ENST00000359606	T;T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13;-0.13	5.27	5.27	0.74061	NHR2-like (1);	0.000000	0.64402	D	0.000001	T	0.77370	0.4120	M	0.74881	2.28	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.80764	0.994;0.99	T	0.79577	-0.1746	10	0.87932	D	0	-21.0703	12.5946	0.56461	0.0:0.9233:0.0:0.0767	.	372;363	O43439;F8W6D7	MTG8R_HUMAN;.	V	146;372;363;372;343;382	ENSP00000364428:L372V;ENSP00000345810:L363V;ENSP00000262653:L372V;ENSP00000380902:L343V;ENSP00000352622:L382V	ENSP00000345810:L363V	L	+	1	2	CBFA2T2	31681240	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.752000	0.55172	2.615000	0.88500	0.563000	0.77884	CTG	CBFA2T2	-	pfam_NHR2	ENSG00000078699		0.488	CBFA2T2-201	KNOWN	basic|CCDS	protein_coding	CBFA2T2	HGNC	protein_coding	OTTHUMT00000078708.2	44	0.00	0	C	NM_001032999		32217579	32217579	+1	no_errors	ENST00000346541	ensembl	human	known	69_37n	missense	45	19.64	11	SNP	1.000	G
CBFB	865	genome.wustl.edu	37	16	67100669	67100669	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr16:67100669G>T	ENST00000290858.6	+	4	628	c.367G>T	c.(367-369)Ggc>Tgc	p.G123C	CBFB_ENST00000412916.2_Missense_Mutation_p.G123C|CBFB_ENST00000561924.2_Missense_Mutation_p.G23C	NM_001755.2|NM_022845.2	NP_001746.1|NP_074036.1	Q13951	PEBB_HUMAN	core-binding factor, beta subunit	123					cell maturation (GO:0048469)|definitive hemopoiesis (GO:0060216)|lymphocyte differentiation (GO:0030098)|myeloid cell differentiation (GO:0030099)|osteoblast differentiation (GO:0001649)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(3)|large_intestine(1)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00189)|Epithelial(162;0.00755)|all cancers(182;0.066)		GGATGGTATGGGCTGTCTGGA	0.478			T	MYH11	AML																																	dbGAP		Dom	yes		16	16q22	865	"""core-binding factor, beta subunit"""		L	0													145.0	123.0	130.0					16																	67100669		2200	4300	6500	-	-	-	SO:0001583	missense	0			BC018509	CCDS10827.1, CCDS45508.1	16q22.1	2008-02-05			ENSG00000067955	ENSG00000067955			1539	protein-coding gene	gene with protein product		121360				8351518, 7587111	Standard	NM_001755		Approved	PEBP2B	uc002erb.3	Q13951	OTTHUMG00000137520	ENST00000290858.6:c.367G>T	16.37:g.67100669G>T	ENSP00000290858:p.Gly123Cys		A8K347|Q13124|Q9HCT2	Missense_Mutation	SNP	pfam_CBF_beta,superfamily_CBF_beta	p.G123C	ENST00000290858.6	37	c.367	CCDS10827.1	16	.	.	.	.	.	.	.	.	.	.	G	16.39	3.110831	0.56398	.	.	ENSG00000067955	ENST00000290858;ENST00000412916	.	.	.	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.79953	0.4535	M	0.75615	2.305	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.81662	-0.0831	9	0.87932	D	0	-2.4949	18.1601	0.89705	0.0:0.0:1.0:0.0	.	123;123	Q13951-2;Q13951	.;PEBB_HUMAN	C	123	.	ENSP00000290858:G123C	G	+	1	0	CBFB	65658170	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.578000	0.98200	2.648000	0.89879	0.561000	0.74099	GGC	CBFB	-	pfam_CBF_beta,superfamily_CBF_beta	ENSG00000067955		0.478	CBFB-001	KNOWN	basic|CCDS	protein_coding	CBFB	HGNC	protein_coding	OTTHUMT00000268843.2	139	0.00	0	G	NM_001755		67100669	67100669	+1	no_errors	ENST00000290858	ensembl	human	known	69_37n	missense	36	60.87	56	SNP	1.000	T
CCDC171	203238	genome.wustl.edu	37	9	15591381	15591381	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr9:15591381C>G	ENST00000380701.3	+	5	698	c.370C>G	c.(370-372)Caa>Gaa	p.Q124E	CCDC171_ENST00000535968.1_Missense_Mutation_p.Q124E|CCDC171_ENST00000297641.3_Missense_Mutation_p.Q124E	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	124	Glu-rich.																TTCAGAACTTCAAGCAAAGAC	0.353																																						dbGAP											0													52.0	52.0	52.0					9																	15591381		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.370C>G	9.37:g.15591381C>G	ENSP00000370077:p.Gln124Glu		B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Missense_Mutation	SNP	superfamily_STAT_TF_coiled-coil	p.Q124E	ENST00000380701.3	37	c.370	CCDS6481.1	9	.	.	.	.	.	.	.	.	.	.	C	13.72	2.321001	0.41096	.	.	ENSG00000164989	ENST00000535968;ENST00000297641;ENST00000380701	T;T;T	0.69685	-0.42;-0.42;-0.42	5.58	5.58	0.84498	.	0.120859	0.64402	D	0.000018	T	0.70736	0.3258	L	0.32530	0.975	0.29285	N	0.869761	D;D;D;P	0.56035	0.974;0.974;0.974;0.835	D;D;D;B	0.70487	0.969;0.969;0.969;0.352	T	0.61387	-0.7073	10	0.08381	T	0.77	-6.3098	16.5357	0.84372	0.0:1.0:0.0:0.0	.	124;124;124;124	B7ZM22;Q6TFL3-3;Q6TFL3;Q7Z3F8	.;.;CI093_HUMAN;.	E	124	ENSP00000438838:Q124E;ENSP00000297641:Q124E;ENSP00000370077:Q124E	ENSP00000297641:Q124E	Q	+	1	0	C9orf93	15581381	1.000000	0.71417	1.000000	0.80357	0.685000	0.39939	4.596000	0.61055	2.639000	0.89480	0.549000	0.68633	CAA	CCDC171	-	NULL	ENSG00000164989		0.353	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC171	HGNC	protein_coding	OTTHUMT00000051768.4	47	0.00	0	C	NM_173550		15591381	15591381	+1	no_errors	ENST00000380701	ensembl	human	known	69_37n	missense	18	18.18	4	SNP	1.000	G
CCDC7	79741	genome.wustl.edu	37	10	32745230	32745230	+	Nonsense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr10:32745230C>T	ENST00000362006.5	+	4	967	c.424C>T	c.(424-426)Cag>Tag	p.Q142*	CCDC7_ENST00000535327.1_Nonsense_Mutation_p.Q142*|CCDC7_ENST00000539197.1_Nonsense_Mutation_p.Q142*|CCDC7_ENST00000537047.1_Nonsense_Mutation_p.Q142*|CCDC7_ENST00000545067.1_Nonsense_Mutation_p.Q142*|CCDC7_ENST00000277657.6_Nonsense_Mutation_p.Q142*	NM_145023.4	NP_659460.3	Q96M83	CCDC7_HUMAN	coiled-coil domain containing 7	142										NS(1)|breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(2)	14		Breast(68;0.000207)|Prostate(175;0.0107)				ATTTGCAGCTCAGCTAGAAGA	0.289																																						dbGAP											0													95.0	92.0	93.0					10																	32745230		2202	4296	6498	-	-	-	SO:0001587	stop_gained	0			BC022020	CCDS7173.1	10p11.23	2013-12-13			ENSG00000216937	ENSG00000216937			26533	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 68"""	C10orf68		12477932	Standard	NM_024688		Approved	FLJ32762, FLJ13031	uc001iwk.3	Q96M83	OTTHUMG00000150517	ENST00000362006.5:c.424C>T	10.37:g.32745230C>T	ENSP00000355078:p.Gln142*		Q5VW55|Q8IVQ0|Q8NEQ0	Nonsense_Mutation	SNP	NULL	p.Q142*	ENST00000362006.5	37	c.424	CCDS7173.1	10	.	.	.	.	.	.	.	.	.	.	C	26.2	4.710194	0.89018	.	.	ENSG00000216937	ENST00000324147;ENST00000277657;ENST00000362006;ENST00000545067;ENST00000539197;ENST00000537047;ENST00000535327	.	.	.	4.94	4.94	0.65067	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-5.0997	13.6599	0.62361	0.0:1.0:0.0:0.0	.	.	.	.	X	142	.	ENSP00000277657:Q142X	Q	+	1	0	CCDC7	32785236	0.956000	0.32656	0.939000	0.37840	0.011000	0.07611	1.640000	0.37186	2.280000	0.76307	0.655000	0.94253	CAG	CCDC7	-	NULL	ENSG00000216937		0.289	CCDC7-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	CCDC7	HGNC	protein_coding	OTTHUMT00000047490.1	49	0.00	0	C	NM_145023		32745230	32745230	+1	no_errors	ENST00000277657	ensembl	human	known	69_37n	nonsense	57	24.00	18	SNP	0.969	T
CCL13	6357	genome.wustl.edu	37	17	32685048	32685048	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr17:32685048C>T	ENST00000225844.2	+	3	270	c.195C>T	c.(193-195)ttC>ttT	p.F65F		NM_005408.2	NP_005399.1	Q99616	CCL13_HUMAN	chemokine (C-C motif) ligand 13	65					cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|cytoskeleton organization (GO:0007010)|eosinophil chemotaxis (GO:0048245)|immune response (GO:0006955)|inflammatory response (GO:0006954)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	chemokine activity (GO:0008009)|receptor binding (GO:0005102)			large_intestine(1)|prostate(1)	2		Ovarian(249;0.0443)|Breast(31;0.151)				TCCACAGCTTCAGAACCAAAC	0.512																																						dbGAP											0													60.0	58.0	59.0					17																	32685048		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ001634	CCDS11281.1	17q11.2	2013-02-25	2002-08-22	2002-08-23	ENSG00000181374	ENSG00000181374		"""Chemokine ligands"", ""Endogenous ligands"""	10611	protein-coding gene	gene with protein product		601391	"""small inducible cytokine subfamily A (Cys-Cys), member 13"""	SCYA13		8661057	Standard	NM_005408		Approved	MCP-4, NCC-1, SCYL1, CKb10, MGC17134	uc002hic.3	Q99616	OTTHUMG00000132890	ENST00000225844.2:c.195C>T	17.37:g.32685048C>T			O95689|Q6ICQ6	Nonsense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	p.Q30*	ENST00000225844.2	37	c.88	CCDS11281.1	17																																																																																			CCL13	-	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	ENSG00000181374		0.512	CCL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCL13	HGNC	protein_coding	OTTHUMT00000256389.1	37	0.00	0	C	NM_005408		32685048	32685048	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000577681	ensembl	human	novel	69_37n	nonsense	21	22.22	6	SNP	0.017	T
CD163L1	283316	genome.wustl.edu	37	12	7527987	7527987	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:7527987C>T	ENST00000313599.3	-	11	2948	c.2891G>A	c.(2890-2892)gGa>gAa	p.G964E	CD163L1_ENST00000396630.1_Missense_Mutation_p.G964E|CD163L1_ENST00000544331.1_5'Flank|CD163L1_ENST00000416109.2_Missense_Mutation_p.G974E			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	964	SRCR 9. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						AAACCTGTGTCCCCACACACG	0.473																																						dbGAP											0													100.0	87.0	91.0					12																	7527987		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.2891G>A	12.37:g.7527987C>T	ENSP00000315945:p.Gly964Glu		B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt,prints_Srcr_rcpt	p.G964E	ENST00000313599.3	37	c.2891	CCDS8577.1	12	.	.	.	.	.	.	.	.	.	.	C	10.76	1.442507	0.25987	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	T;T;T	0.34667	1.35;1.35;1.35	2.29	0.252	0.15545	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.977349	0.08322	U	0.963697	T	0.41743	0.1172	L	0.33485	1.01	0.09310	N	1	P;D	0.64830	0.947;0.994	P;D	0.67725	0.524;0.953	T	0.27938	-1.0059	10	0.45353	T	0.12	.	4.4728	0.11720	0.0:0.388:0.4603:0.1517	.	974;964	E7EVK4;Q9NR16	.;C163B_HUMAN	E	964;974;964	ENSP00000315945:G964E;ENSP00000393474:G974E;ENSP00000379871:G964E	ENSP00000315945:G964E	G	-	2	0	CD163L1	7419254	0.000000	0.05858	0.000000	0.03702	0.150000	0.21749	-0.124000	0.10595	0.046000	0.15833	0.455000	0.32223	GGA	CD163L1	-	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt	ENSG00000177675		0.473	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD163L1	HGNC	protein_coding	OTTHUMT00000399329.1	49	0.00	0	C	NM_174941		7527987	7527987	-1	no_errors	ENST00000313599	ensembl	human	known	69_37n	missense	28	36.96	17	SNP	0.000	T
CD46	4179	genome.wustl.edu	37	1	207930399	207930399	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:207930399C>T	ENST00000358170.2	+	2	294	c.138C>T	c.(136-138)ctC>ctT	p.L46L	CD46_ENST00000361067.1_Silent_p.L46L|CD46_ENST00000441839.2_Silent_p.L46L|CD46_ENST00000322875.4_Silent_p.L46L|CD46_ENST00000480003.1_Silent_p.L46L|CD46_ENST00000354848.1_Silent_p.L46L|CD46_ENST00000360212.2_Silent_p.L46L|CD46_ENST00000367042.1_Silent_p.L46L|CD46_ENST00000367047.1_Intron|CD46_ENST00000357714.1_Silent_p.L46L|CD46_ENST00000322918.5_Silent_p.L46L|CD46_ENST00000367041.1_Silent_p.L46L|CD46_ENST00000469535.1_3'UTR	NM_002389.4	NP_002380.3	P15529	MCP_HUMAN	CD46 molecule, complement regulatory protein	46	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adaptive immune response (GO:0002250)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|interleukin-10 production (GO:0032613)|negative regulation of complement activation (GO:0045916)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transforming growth factor beta production (GO:0071636)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)|regulation of Notch signaling pathway (GO:0008593)|sequestering of extracellular ligand from receptor (GO:0035581)|single fertilization (GO:0007338)|T cell mediated immunity (GO:0002456)|viral process (GO:0016032)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|inner acrosomal membrane (GO:0002079)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cadherin binding (GO:0045296)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	19						CTATGGAGCTCATTGGTAAAC	0.393																																						dbGAP											0													87.0	86.0	86.0					1																	207930399		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC030594	CCDS1479.1, CCDS1480.1, CCDS1481.1, CCDS1482.1, CCDS1484.1, CCDS1485.1, CCDS31008.1, CCDS31009.1	1q32	2014-09-17	2006-03-28	2006-02-09	ENSG00000117335	ENSG00000117335		"""CD molecules"", ""Complement system"""	6953	protein-coding gene	gene with protein product		120920	"""antigen identified by monoclonal antibody TRA-2-10"", ""membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen)"", ""CD46 antigen, complement regulatory protein"""	MIC10, MCP		7929741	Standard	NM_002389		Approved	TRA2.10, MGC26544, TLX	uc001hgj.3	P15529	OTTHUMG00000036397	ENST00000358170.2:c.138C>T	1.37:g.207930399C>T			A0T1T0|A0T1T1|A0T1T2|Q15429|Q53GV9|Q5HY94|Q5VWS6|Q5VWS7|Q5VWS8|Q5VWS9|Q5VWT0|Q5VWT1|Q5VWT2|Q6N0A1|Q7Z3R5|Q9NNW2|Q9NNW3|Q9NNW4|Q9UCJ4	Silent	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pirsf_M_CF_CD46,pfscan_Sushi_SCR_CCP	p.L46	ENST00000358170.2	37	c.138	CCDS1485.1	1																																																																																			CD46	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pirsf_M_CF_CD46,pfscan_Sushi_SCR_CCP	ENSG00000117335		0.393	CD46-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD46	HGNC	protein_coding	OTTHUMT00000088588.3	43	0.00	0	C	NM_172361		207930399	207930399	+1	no_errors	ENST00000322875	ensembl	human	known	69_37n	silent	71	11.25	9	SNP	0.000	T
CDC42BPB	9578	genome.wustl.edu	37	14	103412947	103412947	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr14:103412947C>G	ENST00000361246.2	-	28	3894	c.3606G>C	c.(3604-3606)aaG>aaC	p.K1202N		NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)											NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		CCCACTTCCTCTTTTCATTCT	0.488																																						dbGAP											0													105.0	95.0	98.0					14																	103412947		2202	4297	6499	-	-	-	SO:0001583	missense	0			AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.3606G>C	14.37:g.103412947C>G	ENSP00000355237:p.Lys1202Asn			Missense_Mutation	SNP	pfam_Citron,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,smart_PAK_box_Rho-bd,prints_DAG/PE-bd,pfscan_PAK_box_Rho-bd,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.K1202N	ENST00000361246.2	37	c.3606	CCDS9978.1	14	.	.	.	.	.	.	.	.	.	.	C	24.5	4.542997	0.86022	.	.	ENSG00000198752	ENST00000361246;ENST00000541396	T	0.44881	0.91	5.28	5.28	0.74379	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.68155	0.2970	M	0.81942	2.565	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.72982	0.979;0.951	T	0.72398	-0.4306	10	0.87932	D	0	.	19.2744	0.94026	0.0:1.0:0.0:0.0	.	1202;1202	A9JR72;Q9Y5S2	.;MRCKB_HUMAN	N	1202;313	ENSP00000355237:K1202N	ENSP00000355237:K1202N	K	-	3	2	CDC42BPB	102482700	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.311000	0.51919	2.638000	0.89438	0.563000	0.77884	AAG	CDC42BPB	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000198752		0.488	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPB	HGNC	protein_coding	OTTHUMT00000415711.1	44	0.00	0	C	NM_006035		103412947	103412947	-1	no_errors	ENST00000361246	ensembl	human	known	69_37n	missense	37	24.49	12	SNP	1.000	G
CDH22	64405	genome.wustl.edu	37	20	44815342	44815342	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr20:44815342G>A	ENST00000372262.3	-	9	1948	c.1548C>T	c.(1546-1548)ctC>ctT	p.L516L	CDH22_ENST00000537909.1_Silent_p.L516L	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	516	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				TGGTCTGGATGAGCTGAAGGG	0.607																																						dbGAP											0													75.0	71.0	72.0					20																	44815342		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.1548C>T	20.37:g.44815342G>A			B9EGK7|O43205	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,superfamily_MFS_dom_general_subst_transpt,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L516	ENST00000372262.3	37	c.1548	CCDS13395.1	20																																																																																			CDH22	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000149654		0.607	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH22	HGNC	protein_coding	OTTHUMT00000080491.1	78	0.00	0	G	NM_021248		44815342	44815342	-1	no_errors	ENST00000372262	ensembl	human	known	69_37n	silent	59	23.38	18	SNP	0.989	A
CDH8	1006	genome.wustl.edu	37	16	62055071	62055071	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr16:62055071C>T	ENST00000577390.1	-	2	1191	c.237G>A	c.(235-237)ccG>ccA	p.P79P	CDH8_ENST00000299345.6_Silent_p.P79P|CDH8_ENST00000584337.1_Silent_p.P79P|CDH8_ENST00000577730.1_Silent_p.P79P	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	79	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		CAACAAGAATCGGTTCAGGTC	0.408																																						dbGAP											0													56.0	55.0	55.0					16																	62055071		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.237G>A	16.37:g.62055071C>T			B3KWC1|Q14DC6|Q9ULB2	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.P79	ENST00000577390.1	37	c.237	CCDS10802.1	16																																																																																			CDH8	-	pfam_Cadherin,superfamily_Cadherin-like	ENSG00000150394		0.408	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH8	HGNC	protein_coding	OTTHUMT00000268754.3	33	0.00	0	C	NM_001796		62055071	62055071	-1	no_errors	ENST00000577390	ensembl	human	known	69_37n	silent	23	34.29	12	SNP	1.000	T
CDK12	51755	genome.wustl.edu	37	17	37627609	37627609	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr17:37627609G>A	ENST00000447079.4	+	2	1557	c.1524G>A	c.(1522-1524)ctG>ctA	p.L508L	CDK12_ENST00000430627.2_Silent_p.L508L	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	508					mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						CCATAGCACTGAAAGAGGAGA	0.453			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																												dbGAP		Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	0													116.0	127.0	123.0					17																	37627609		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.1524G>A	17.37:g.37627609G>A			A7E2B2|B4DYX4|B9EIQ6|O94978	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L508	ENST00000447079.4	37	c.1524	CCDS11337.1	17																																																																																			CDK12	-	NULL	ENSG00000167258		0.453	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK12	HGNC	protein_coding	OTTHUMT00000256941.4	50	0.00	0	G	NM_016507		37627609	37627609	+1	no_errors	ENST00000447079	ensembl	human	known	69_37n	silent	47	17.54	10	SNP	0.732	A
CEP135	9662	genome.wustl.edu	37	4	56883842	56883842	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr4:56883842C>G	ENST00000257287.4	+	22	2955	c.2831C>G	c.(2830-2832)tCt>tGt	p.S944C		NM_025009.4	NP_079285.2	Q66GS9	CP135_HUMAN	centrosomal protein 135kDa	944					centriole replication (GO:0007099)|centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)	protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(26)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	50	Glioma(25;0.08)|all_neural(26;0.101)					GCTTATGAATCTCAGATCTCA	0.328																																						dbGAP											0													45.0	45.0	45.0					4																	56883842		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014535	CCDS33986.1	4q12	2014-02-20	2005-12-02	2005-12-02	ENSG00000174799	ENSG00000174799			29086	protein-coding gene	gene with protein product		611423	"""KIAA0635"", ""centrosomal protein 4"""	KIAA0635, CEP4		9734811, 14654843	Standard	NM_025009		Approved	FLJ13621	uc003hbi.4	Q66GS9	OTTHUMG00000160748	ENST00000257287.4:c.2831C>G	4.37:g.56883842C>G	ENSP00000257287:p.Ser944Cys		B2RMY0|O75130|Q58F25|Q9H8H7	Missense_Mutation	SNP	superfamily_Prefoldin	p.S944C	ENST00000257287.4	37	c.2831	CCDS33986.1	4	.	.	.	.	.	.	.	.	.	.	C	19.95	3.921577	0.73213	.	.	ENSG00000174799	ENST00000257287	T	0.15372	2.43	5.39	5.39	0.77823	.	0.189337	0.46145	D	0.000319	T	0.42337	0.1198	M	0.74258	2.255	0.37806	D	0.92788	D	0.76494	0.999	P	0.62560	0.904	T	0.45891	-0.9230	10	0.62326	D	0.03	.	19.1841	0.93635	0.0:1.0:0.0:0.0	.	944	Q66GS9	CP135_HUMAN	C	944	ENSP00000257287:S944C	ENSP00000257287:S944C	S	+	2	0	CEP135	56578599	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.450000	0.60041	2.537000	0.85549	0.655000	0.94253	TCT	CEP135	-	superfamily_Prefoldin	ENSG00000174799		0.328	CEP135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP135	HGNC	protein_coding	OTTHUMT00000362092.2	22	0.00	0	C	NM_025009		56883842	56883842	+1	no_errors	ENST00000257287	ensembl	human	known	69_37n	missense	17	37.04	10	SNP	1.000	G
CEP350	9857	genome.wustl.edu	37	1	180062597	180062597	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:180062597G>C	ENST00000367607.3	+	34	7775	c.7357G>C	c.(7357-7359)Gac>Cac	p.D2453H	CEP350_ENST00000490141.1_3'UTR	NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	2453					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						TGTTCATTCTGACAGGCTGTT	0.468																																						dbGAP											0													44.0	34.0	38.0					1																	180062597		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.7357G>C	1.37:g.180062597G>C	ENSP00000356579:p.Asp2453His		O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	p.D2453H	ENST00000367607.3	37	c.7357	CCDS1336.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.81|13.81	2.346908|2.346908	0.41599|0.41599	.|.	.|.	ENSG00000135837|ENSG00000135837	ENST00000367607|ENST00000429851	T|.	0.56941|.	0.43|.	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	0.441437|.	0.18723|.	N|.	0.132955|.	T|.	0.53610|.	0.1807|.	N|N	0.19112|0.19112	0.55|0.55	0.43555|0.43555	D|D	0.995863|0.995863	B;B|.	0.33448|.	0.412;0.303|.	B;B|.	0.34722|.	0.188;0.072|.	T|.	0.47156|.	-0.9139|.	9|.	.|.	.|.	.|.	.|.	18.1938|18.1938	0.89814|0.89814	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	2453;2453|.	E7EU22;Q5VT06|.	.;CE350_HUMAN|.	H|S	2453|627	ENSP00000356579:D2453H|.	.|.	D|X	+|+	1|2	0|2	CEP350|CEP350	178329220|178329220	1.000000|1.000000	0.71417|0.71417	0.951000|0.951000	0.38953|0.38953	0.161000|0.161000	0.22273|0.22273	8.815000|8.815000	0.91973|0.91973	2.708000|2.708000	0.92522|0.92522	0.650000|0.650000	0.86243|0.86243	GAC|TGA	CEP350	-	NULL	ENSG00000135837		0.468	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP350	HGNC	protein_coding	OTTHUMT00000085315.2	30	0.00	0	G	NM_014810		180062597	180062597	+1	no_errors	ENST00000367607	ensembl	human	known	69_37n	missense	36	20.00	9	SNP	0.967	C
CEP350	9857	genome.wustl.edu	37	1	180062700	180062700	+	Nonsense_Mutation	SNP	C	C	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:180062700C>A	ENST00000367607.3	+	34	7878	c.7460C>A	c.(7459-7461)tCa>tAa	p.S2487*	CEP350_ENST00000490141.1_3'UTR	NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	2487					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						TCCTTGGCTTCAGTTCCTACT	0.453																																						dbGAP											0													81.0	64.0	70.0					1																	180062700		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.7460C>A	1.37:g.180062700C>A	ENSP00000356579:p.Ser2487*		O75068|Q8TDK3|Q8WY20	Nonsense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	p.S2487*	ENST00000367607.3	37	c.7460	CCDS1336.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.7|22.7	4.320061|4.320061	0.81469|0.81469	.|.	.|.	ENSG00000135837|ENSG00000135837	ENST00000429851|ENST00000367607	.|.	.|.	.|.	5.8|5.8	4.86|4.86	0.63082|0.63082	.|.	.|0.388929	.|0.18788	.|N	.|0.131150	T|.	0.67711|.	0.2922|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.71642|.	-0.4531|.	3|.	.|.	.|.	.|.	.|.	15.9831|15.9831	0.80127|0.80127	0.1358:0.8642:0.0:0.0|0.1358:0.8642:0.0:0.0	.|.	.|.	.|.	.|.	L|X	661|2487	.|.	.|.	F|S	+|+	3|2	2|0	CEP350|CEP350	178329323|178329323	0.018000|0.018000	0.18449|0.18449	0.053000|0.053000	0.19242|0.19242	0.060000|0.060000	0.15804|0.15804	2.754000|2.754000	0.47532|0.47532	1.365000|1.365000	0.46057|0.46057	0.655000|0.655000	0.94253|0.94253	TTC|TCA	CEP350	-	superfamily_CAP-Gly_domain	ENSG00000135837		0.453	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP350	HGNC	protein_coding	OTTHUMT00000085315.2	33	0.00	0	C	NM_014810		180062700	180062700	+1	no_errors	ENST00000367607	ensembl	human	known	69_37n	nonsense	53	10.17	6	SNP	0.268	A
CHD4	1108	genome.wustl.edu	37	12	6692483	6692483	+	Nonsense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:6692483C>T	ENST00000357008.2	-	26	4104	c.3941G>A	c.(3940-3942)tGg>tAg	p.W1314*	SCARNA11_ENST00000516089.1_RNA|CHD4_ENST00000540960.1_5'UTR|CHD4_ENST00000309577.6_Nonsense_Mutation_p.W1314*|CHD4_ENST00000544040.1_Nonsense_Mutation_p.W1307*|RP5-940J5.6_ENST00000501075.2_RNA|CHD4_ENST00000544484.1_Nonsense_Mutation_p.W1311*	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1314					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						CAATTTCTCCCAGTAGTCAGG	0.488																																					Colon(32;586 792 4568 16848 45314)	dbGAP											0													233.0	224.0	227.0					12																	6692483		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.3941G>A	12.37:g.6692483C>T	ENSP00000349508:p.Trp1314*		Q8IXZ5	Nonsense_Mutation	SNP	pfam_CHD_C2,pfam_DUF1086,pfam_SNF2_N,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,superfamily_Homeodomain-like,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.W1314*	ENST00000357008.2	37	c.3941	CCDS8552.1	12	.	.	.	.	.	.	.	.	.	.	C	44	10.772315	0.99465	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	.	.	.	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.1392	20.422	0.99049	0.0:1.0:0.0:0.0	.	.	.	.	X	1311;1307;1314;1314;1288	.	ENSP00000312419:W1314X	W	-	2	0	CHD4	6562744	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.792000	0.85828	2.832000	0.97577	0.655000	0.94253	TGG	CHD4	-	pfam_DUF1087	ENSG00000111642		0.488	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD4	HGNC	protein_coding		93	0.00	0	C	NM_001273		6692483	6692483	-1	no_errors	ENST00000309577	ensembl	human	known	69_37n	nonsense	90	12.62	13	SNP	1.000	T
CHD5	26038	genome.wustl.edu	37	1	6172263	6172263	+	Missense_Mutation	SNP	T	T	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:6172263T>C	ENST00000262450.3	-	35	5176	c.5077A>G	c.(5077-5079)Aag>Gag	p.K1693E	CHD5_ENST00000378021.1_Missense_Mutation_p.K550E	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		TCCTCCTTCTTCCCCTCGTCA	0.527																																						dbGAP											0													276.0	216.0	236.0					1																	6172263		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.5077A>G	1.37:g.6172263T>C	ENSP00000262450:p.Lys1693Glu		A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.K1693E	ENST00000262450.3	37	c.5077	CCDS57.1	1	.	.	.	.	.	.	.	.	.	.	t	9.986	1.229468	0.22542	.	.	ENSG00000116254	ENST00000262450;ENST00000378021;ENST00000377999	D;T	0.90324	-2.65;2.29	4.3	0.432	0.16529	.	0.457386	0.18481	N	0.139922	T	0.78130	0.4235	L	0.27053	0.805	0.34401	D	0.695306	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.66598	-0.5883	10	0.02654	T	1	-22.4946	6.5845	0.22612	0.0:0.0797:0.2955:0.6247	.	1693;550	Q8TDI0;Q5TG85	CHD5_HUMAN;.	E	1693;550;550	ENSP00000262450:K1693E;ENSP00000367260:K550E	ENSP00000262450:K1693E	K	-	1	0	CHD5	6094850	0.998000	0.40836	0.997000	0.53966	0.852000	0.48524	1.885000	0.39678	0.127000	0.18452	-0.435000	0.05868	AAG	CHD5	-	NULL	ENSG00000116254		0.527	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD5	HGNC	protein_coding	OTTHUMT00000002823.2	108	0.00	0	T	NM_015557		6172263	6172263	-1	no_errors	ENST00000262450	ensembl	human	known	69_37n	missense	56	42.27	41	SNP	1.000	C
FANCD2	2177	genome.wustl.edu	37	3	10065390	10065390	+	5'Flank	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr3:10065390C>T	ENST00000419585.1	+	0	0				CIDECP_ENST00000432401.1_RNA|FANCD2_ENST00000383807.1_5'Flank|FANCD2_ENST00000383806.1_5'Flank|FANCD2_ENST00000287647.3_5'Flank			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2						DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		CATCAATCTTCTTGGCAGGCT	0.498			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP	yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	0																																										-	-	-	SO:0001631	upstream_gene_variant	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670		3.37:g.10065390C>T	Exception_encountered		Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	RNA	SNP	-	NULL	ENST00000419585.1	37	NULL	CCDS33696.1	3																																																																																			CIDECP	-	-	ENSG00000186162		0.498	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CIDECP	HGNC	protein_coding	OTTHUMT00000339873.1	58	0.00	0	C			10065390	10065390	-1	no_errors	ENST00000335507	ensembl	human	known	69_37n	rna	35	27.08	13	SNP	1.000	T
CLCN6	1185	genome.wustl.edu	37	1	11900279	11900279	+	Nonstop_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:11900279G>C	ENST00000346436.6	+	23	2661	c.2609G>C	c.(2608-2610)tGa>tCa	p.*870S	CLCN6_ENST00000312413.6_3'UTR|CLCN6_ENST00000376487.3_Nonstop_Mutation_p.*848S|NPPA-AS1_ENST00000446542.1_RNA	NM_001286.3	NP_001277	P51797	CLCN6_HUMAN	chloride channel, voltage-sensitive 6	0					cell volume homeostasis (GO:0006884)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|response to mechanical stimulus (GO:0009612)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|voltage-gated chloride channel activity (GO:0005247)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(4)	36	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		CAGACCATCTGACAGCCCAGC	0.612																																						dbGAP											0													90.0	85.0	87.0					1																	11900279		2203	4300	6503	-	-	-	SO:0001578	stop_lost	0			X83378	CCDS138.1, CCDS57972.1	1p36	2012-09-26	2012-02-23		ENSG00000011021	ENSG00000011021		"""Ion channels / Chloride channels : Voltage-sensitive"""	2024	protein-coding gene	gene with protein product		602726	"""chloride channel 6"""			8543009	Standard	NM_001286		Approved	CLC-6, KIAA0046, ClC-6	uc001ate.5	P51797	OTTHUMG00000002299	ENST00000346436.6:c.2609G>C	1.37:g.11900279G>C	ENSP00000234488:p.*870Serext*58		A8K1T4|B4DGT7|F8W9R3|O60818|O60819|O60820|O60821|P78520|P78521|Q17R81|Q5SNW2|Q5SNW3|Q5SNX1|Q5SNX2|Q5SNX3|Q99427|Q99428|Q99429	Nonstop_Mutation	SNP	pfam_Cl-channel_volt-gated,pfam_Cysta_beta_synth_core,superfamily_Cl-channel_core,smart_Cysta_beta_synth_core,prints_Cl-channel_volt-gated,prints_Cl_channel-6	p.*870S	ENST00000346436.6	37	c.2609	CCDS138.1	1	.	.	.	.	.	.	.	.	.	.	G	6.057	0.378776	0.11466	.	.	ENSG00000011021	ENST00000346436;ENST00000376487	.	.	.	5.31	3.44	0.39384	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.1981	0.48726	0.1488:0.0:0.8512:0.0	.	.	.	.	S	870;848	.	.	X	+	2	2	CLCN6	11822866	1.000000	0.71417	0.940000	0.37924	0.111000	0.19643	8.961000	0.93122	0.627000	0.30340	-0.291000	0.09656	TGA	CLCN6	-	NULL	ENSG00000011021		0.612	CLCN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN6	HGNC	protein_coding	OTTHUMT00000006639.2	43	0.00	0	G	NM_001286		11900279	11900279	+1	no_errors	ENST00000346436	ensembl	human	known	69_37n	nonstop	34	20.93	9	SNP	1.000	C
CLCNKB	1188	genome.wustl.edu	37	1	16377454	16377454	+	Nonsense_Mutation	SNP	G	G	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:16377454G>T	ENST00000375679.4	+	12	1249	c.1138G>T	c.(1138-1140)Gag>Tag	p.E380*	CLCNKB_ENST00000375667.3_Nonsense_Mutation_p.E211*	NM_000085.4	NP_000076.2	P51801	CLCKB_HUMAN	chloride channel, voltage-sensitive Kb	380					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|skin(6)|stomach(2)|urinary_tract(1)	21		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		ACCCTGGCCCGAGGAGCTCGA	0.627																																						dbGAP											0													77.0	82.0	80.0					1																	16377454		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK098217	CCDS168.1, CCDS57974.1	1p36	2012-09-26	2012-02-23		ENSG00000184908	ENSG00000184908		"""Ion channels / Chloride channels : Voltage-sensitive"""	2027	protein-coding gene	gene with protein product		602023	"""chloride channel Kb"""				Standard	NM_000085		Approved	hClC-Kb		P51801	OTTHUMG00000009530	ENST00000375679.4:c.1138G>T	1.37:g.16377454G>T	ENSP00000364831:p.Glu380*		B3KUY3|Q5T5Q7|Q5T5Q8	Nonsense_Mutation	SNP	pfam_Cl-channel_volt-gated,pfam_Cysta_beta_synth_core,superfamily_Cl-channel_core,smart_Cysta_beta_synth_core,prints_Cl-channel_volt-gated,prints_Cl_channel-K	p.E380*	ENST00000375679.4	37	c.1138	CCDS168.1	1	.	.	.	.	.	.	.	.	.	.	g	14.18	2.457392	0.43634	.	.	ENSG00000184908	ENST00000375679;ENST00000331579;ENST00000375667	.	.	.	4.59	-9.17	0.00691	.	1.973700	0.03159	N	0.169049	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	0.6764	0.00867	0.3694:0.264:0.1587:0.2079	.	.	.	.	X	380;252;211	.	ENSP00000332055:E252X	E	+	1	0	CLCNKB	16250041	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-1.028000	0.03589	-1.679000	0.01452	-0.367000	0.07326	GAG	CLCNKB	-	pfam_Cl-channel_volt-gated,superfamily_Cl-channel_core	ENSG00000184908		0.627	CLCNKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCNKB	HGNC	protein_coding	OTTHUMT00000026331.1	67	0.00	0	G	NM_000085		16377454	16377454	+1	no_errors	ENST00000375679	ensembl	human	known	69_37n	nonsense	53	17.19	11	SNP	0.000	T
CLEC17A	388512	genome.wustl.edu	37	19	14706106	14706106	+	Missense_Mutation	SNP	C	C	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr19:14706106C>A	ENST00000417570.1	+	8	462	c.424C>A	c.(424-426)Cca>Aca	p.P142T	CLEC17A_ENST00000547437.1_Missense_Mutation_p.P142T|CLEC17A_ENST00000397439.2_Missense_Mutation_p.P125T	NM_001204118.1	NP_001191047.1	Q6ZS10	CL17A_HUMAN	C-type lectin domain family 17, member A	142						cell surface (GO:0009986)|integral component of membrane (GO:0016021)	fucose binding (GO:0042806)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)										TGAGCCTTCTCCATTGCAGCC	0.498																																						dbGAP											0													261.0	247.0	252.0					19																	14706106		1964	4145	6109	-	-	-	SO:0001583	missense	0			AK127809	CCDS46002.1, CCDS46002.2, CCDS56087.1	19p13.12	2009-06-26			ENSG00000187912	ENSG00000187912		"""C-type lectin domain containing"""	34520	protein-coding gene	gene with protein product	"""prolectin"""					19419970	Standard	NM_207390		Approved	FLJ45910	uc010dzn.2	Q6ZS10		ENST00000417570.1:c.424C>A	19.37:g.14706106C>A	ENSP00000393719:p.Pro142Thr		A8MX68|B2RTX0|B7ZMM4	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.P142T	ENST00000417570.1	37	c.424	CCDS56087.1	19	.	.	.	.	.	.	.	.	.	.	-	11.24	1.579131	0.28180	.	.	ENSG00000187912	ENST00000547437;ENST00000397439;ENST00000417570	T;T;T	0.61980	0.06;0.06;0.06	2.59	0.327	0.15913	.	0.772167	0.10640	N	0.651125	T	0.56396	0.1982	L	0.29908	0.895	0.09310	N	1	D;D;P;D	0.63046	0.965;0.992;0.941;0.965	P;P;P;P	0.55345	0.706;0.774;0.589;0.629	T	0.46162	-0.9211	10	0.59425	D	0.04	-8.3617	3.7683	0.08632	0.0:0.5913:0.2571:0.1516	.	142;142;142;142	Q6ZS10-2;Q6ZS10-3;Q6ZS10;F8W1T8	.;.;CL17A_HUMAN;.	T	142;125;142	ENSP00000450065:P142T;ENSP00000380581:P125T;ENSP00000393719:P142T	ENSP00000341620:P142T	P	+	1	0	CLEC17A	14567106	0.001000	0.12720	0.004000	0.12327	0.017000	0.09413	-0.288000	0.08377	0.178000	0.19917	0.492000	0.49549	CCA	CLEC17A	-	NULL	ENSG00000187912		0.498	CLEC17A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC17A	HGNC	protein_coding	OTTHUMT00000403400.1	134	0.00	0	C	NM_207390		14706106	14706106	+1	no_errors	ENST00000417570	ensembl	human	known	69_37n	missense	118	29.34	49	SNP	0.004	A
CLEC17A	388512	genome.wustl.edu	37	19	14720887	14720887	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr19:14720887C>T	ENST00000417570.1	+	14	1054	c.1016C>T	c.(1015-1017)cCa>cTa	p.P339L	CLEC17A_ENST00000547437.1_Silent_p.A302A|CLEC17A_ENST00000397439.2_Silent_p.A285A	NM_001204118.1	NP_001191047.1	Q6ZS10	CL17A_HUMAN	C-type lectin domain family 17, member A	339	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					cell surface (GO:0009986)|integral component of membrane (GO:0016021)	fucose binding (GO:0042806)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)										ttctgggagccaGAGGAACCC	0.458																																						dbGAP											0													100.0	94.0	96.0					19																	14720887		1917	4145	6062	-	-	-	SO:0001583	missense	0			AK127809	CCDS46002.1, CCDS46002.2, CCDS56087.1	19p13.12	2009-06-26			ENSG00000187912	ENSG00000187912		"""C-type lectin domain containing"""	34520	protein-coding gene	gene with protein product	"""prolectin"""					19419970	Standard	NM_207390		Approved	FLJ45910	uc010dzn.2	Q6ZS10		ENST00000417570.1:c.1016C>T	19.37:g.14720887C>T	ENSP00000393719:p.Pro339Leu		A8MX68|B2RTX0|B7ZMM4	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.P339L	ENST00000417570.1	37	c.1016	CCDS56087.1	19	.	.	.	.	.	.	.	.	.	.	C	6.433	0.448093	0.12223	.	.	ENSG00000187912	ENST00000417570	T	0.20069	2.1	3.88	1.52	0.23074	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	.	.	.	.	T	0.17704	0.0425	L	0.50919	1.6	0.09310	N	1	B	0.14438	0.01	B	0.20955	0.032	T	0.24368	-1.0162	9	0.45353	T	0.12	.	4.3453	0.11129	0.0:0.6346:0.0:0.3654	.	339	Q6ZS10	CL17A_HUMAN	L	339	ENSP00000393719:P339L	ENSP00000393719:P339L	P	+	2	0	CLEC17A	14581887	0.000000	0.05858	0.018000	0.16275	0.210000	0.24377	-0.043000	0.12043	0.777000	0.33496	0.655000	0.94253	CCA	CLEC17A	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000187912		0.458	CLEC17A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC17A	HGNC	protein_coding	OTTHUMT00000403400.1	95	0.00	0	C	NM_207390		14720887	14720887	+1	no_errors	ENST00000417570	ensembl	human	known	69_37n	missense	64	24.71	21	SNP	0.001	T
CLSPN	63967	genome.wustl.edu	37	1	36225955	36225955	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:36225955C>T	ENST00000318121.3	-	8	1624	c.1567G>A	c.(1567-1569)Gaa>Aaa	p.E523K	CLSPN_ENST00000520551.1_Missense_Mutation_p.E523K|CLSPN_ENST00000373220.3_Missense_Mutation_p.E523K|CLSPN_ENST00000251195.5_Missense_Mutation_p.E523K	NM_022111.3	NP_071394.2	Q9HAW4	CLSPN_HUMAN	claspin	523					activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|mitotic DNA replication checkpoint (GO:0033314)|peptidyl-serine phosphorylation (GO:0018105)	nucleoplasm (GO:0005654)	anaphase-promoting complex binding (GO:0010997)|DNA binding (GO:0003677)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CTGTTGGTTTCAGGTTCAAGT	0.443																																						dbGAP											0													92.0	86.0	88.0					1																	36225955		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF297866	CCDS396.1, CCDS53297.1	1p34.3	2010-06-24	2010-06-24		ENSG00000092853	ENSG00000092853			19715	protein-coding gene	gene with protein product		605434	"""claspin homolog (Xenopus laevis)"""			11090622, 12766152	Standard	NM_022111		Approved		uc001bzi.3	Q9HAW4	OTTHUMG00000004168	ENST00000318121.3:c.1567G>A	1.37:g.36225955C>T	ENSP00000312995:p.Glu523Lys		A6NFL4|Q1RMC6|Q2KHM3|Q5VYG0|Q6P6H5|Q8IWI1	Missense_Mutation	SNP	NULL	p.E523K	ENST00000318121.3	37	c.1567	CCDS396.1	1	.	.	.	.	.	.	.	.	.	.	C	16.41	3.115636	0.56505	.	.	ENSG00000092853	ENST00000251195;ENST00000318121;ENST00000373220;ENST00000520551;ENST00000544356	T;T;T;T	0.24350	1.89;1.89;1.86;1.88	5.08	4.14	0.48551	.	0.285609	0.38837	N	0.001556	T	0.22666	0.0547	L	0.29908	0.895	0.33149	D	0.545405	B;P	0.46784	0.008;0.884	B;P	0.50270	0.011;0.636	T	0.10706	-1.0618	10	0.08837	T	0.75	-11.5149	9.6311	0.39780	0.0:0.8351:0.0:0.1649	.	523;523	Q9HAW4-2;Q9HAW4	.;CLSPN_HUMAN	K	523	ENSP00000251195:E523K;ENSP00000312995:E523K;ENSP00000362317:E523K;ENSP00000428848:E523K	ENSP00000251195:E523K	E	-	1	0	CLSPN	35998542	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.316000	0.33620	1.093000	0.41377	0.591000	0.81541	GAA	CLSPN	-	NULL	ENSG00000092853		0.443	CLSPN-005	KNOWN	basic|appris_principal|CCDS	protein_coding	CLSPN	HGNC	protein_coding	OTTHUMT00000377857.1	74	0.00	0	C	NM_022111		36225955	36225955	-1	no_errors	ENST00000318121	ensembl	human	known	69_37n	missense	50	24.24	16	SNP	1.000	T
CNGA1	1259	genome.wustl.edu	37	4	47938695	47938695	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr4:47938695C>G	ENST00000514170.1	-	11	2135	c.1816G>C	c.(1816-1818)Gat>Cat	p.D606H	CNGA1_ENST00000402813.3_Missense_Mutation_p.D675H|CNGA1_ENST00000358519.4_Missense_Mutation_p.D606H|CNGA1_ENST00000544810.1_Missense_Mutation_p.D606H|CNGA1_ENST00000420489.2_Missense_Mutation_p.D606H			P29973	CNGA1_HUMAN	cyclic nucleotide gated channel alpha 1	606					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|urinary_tract(1)	28						AGTAGACCATCTTTCATTAAA	0.438																																						dbGAP											0													172.0	166.0	168.0					4																	47938695		1916	4134	6050	-	-	-	SO:0001583	missense	0			M84741	CCDS43226.1, CCDS47050.1	4p12	2013-02-14				ENSG00000198515		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2148	protein-coding gene	gene with protein product		123825		CNCG1, CNCG		7683629, 16382102	Standard	NM_000087		Approved	RCNC1, RCNCa, CNG1, RP49	uc003gxu.3	P29973		ENST00000514170.1:c.1816G>C	4.37:g.47938695C>G	ENSP00000426862:p.Asp606His		A8K7K6|J3KPZ2|Q16279|Q16485|Q4W5E3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.D675H	ENST00000514170.1	37	c.2023	CCDS43226.1	4	.	.	.	.	.	.	.	.	.	.	C	13.63	2.294393	0.40594	.	.	ENSG00000198515	ENST00000402813;ENST00000514170;ENST00000544810;ENST00000358519;ENST00000420489	D;D;D;D;D	0.97328	-4.22;-4.34;-4.34;-4.34;-4.34	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	D	0.98337	0.9448	M	0.85777	2.775	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.63381	0.914;0.914	D	0.98863	1.0763	10	0.52906	T	0.07	.	18.1811	0.89779	0.0:1.0:0.0:0.0	.	606;606	Q4W5E3;P29973	.;CNGA1_HUMAN	H	675;606;606;606;606	ENSP00000384264:D675H;ENSP00000426862:D606H;ENSP00000443401:D606H;ENSP00000351320:D606H;ENSP00000389881:D606H	ENSP00000351320:D606H	D	-	1	0	CNGA1	47633452	1.000000	0.71417	0.993000	0.49108	0.375000	0.29983	7.445000	0.80570	2.352000	0.79861	0.491000	0.48974	GAT	CNGA1	-	NULL	ENSG00000198515		0.438	CNGA1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	CNGA1	HGNC	protein_coding	OTTHUMT00000372070.2	43	0.00	0	C	NM_000087		47938695	47938695	-1	no_errors	ENST00000402813	ensembl	human	known	69_37n	missense	30	14.29	5	SNP	1.000	G
COL4A6	1288	genome.wustl.edu	37	X	107400447	107400447	+	Nonsense_Mutation	SNP	G	G	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chrX:107400447G>T	ENST00000372216.4	-	45	4959	c.4859C>A	c.(4858-4860)tCa>tAa	p.S1620*	COL4A6_ENST00000545689.1_Nonsense_Mutation_p.S1595*|COL4A6_ENST00000334504.7_Nonsense_Mutation_p.S1619*|COL4A6_ENST00000538570.1_Nonsense_Mutation_p.S1562*|COL4A6_ENST00000418180.1_Nonsense_Mutation_p.S154*|COL4A6_ENST00000394872.2_Nonsense_Mutation_p.S1620*	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	1620	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						GGAGCCAGGTGAGACCAGGGA	0.582									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)	dbGAP											0													63.0	59.0	60.0					X																	107400447		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database		U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.4859C>A	X.37:g.107400447G>T	ENSP00000361290:p.Ser1620*		Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Nonsense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.S1620*	ENST00000372216.4	37	c.4859	CCDS14541.1	X	.	.	.	.	.	.	.	.	.	.	G	46	12.361297	0.99660	.	.	ENSG00000197565	ENST00000418180;ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	.	.	.	5.03	5.03	0.67393	.	0.000000	0.31976	N	0.006779	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.139	0.89633	0.0:0.0:1.0:0.0	.	.	.	.	X	154;1620;1619;1620;1607;1595;1562	.	ENSP00000334733:S1619X	S	-	2	0	COL4A6	107287103	1.000000	0.71417	0.963000	0.40424	0.993000	0.82548	9.766000	0.98957	2.415000	0.81967	0.513000	0.50165	TCA	COL4A6	-	pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	ENSG00000197565		0.582	COL4A6-001	KNOWN	basic|CCDS	protein_coding	COL4A6	HGNC	protein_coding	OTTHUMT00000057875.2	24	0.00	0	G			107400447	107400447	-1	no_errors	ENST00000372216	ensembl	human	known	69_37n	nonsense	21	16.00	4	SNP	1.000	T
COL4A5	1287	genome.wustl.edu	37	X	107840778	107840778	+	Missense_Mutation	SNP	C	C	T	rs281874678		TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chrX:107840778C>T	ENST00000361603.2	+	24	2003	c.1759C>T	c.(1759-1761)Cct>Tct	p.P587S	COL4A5_ENST00000328300.6_Missense_Mutation_p.P587S	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	587	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						GCCAGGGCTTCCTGGCCCGAA	0.468									Alport syndrome with Diffuse Leiomyomatosis																													dbGAP											0													49.0	42.0	44.0					X																	107840778		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.1759C>T	X.37:g.107840778C>T	ENSP00000354505:p.Pro587Ser		Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.P587S	ENST00000361603.2	37	c.1759	CCDS14543.1	X	.	.	.	.	.	.	.	.	.	.	c	19.61	3.860287	0.71834	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.92911	-3.13;-3.13	5.58	5.58	0.84498	.	0.124700	0.56097	N	0.000038	D	0.95847	0.8648	M	0.71920	2.185	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.96118	0.9082	10	0.72032	D	0.01	.	18.6347	0.91372	0.0:1.0:0.0:0.0	.	587;195;587	E7EVY4;Q49AM6;P29400	.;.;CO4A5_HUMAN	S	587	ENSP00000331902:P587S;ENSP00000354505:P587S	ENSP00000331902:P587S	P	+	1	0	COL4A5	107727434	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.786000	0.85741	2.344000	0.79699	0.597000	0.82753	CCT	COL4A5	-	pfam_Collagen	ENSG00000188153		0.468	COL4A5-001	KNOWN	basic|CCDS	protein_coding	COL4A5	HGNC	protein_coding	OTTHUMT00000057880.2	33	0.00	0	C			107840778	107840778	+1	no_errors	ENST00000328300	ensembl	human	known	69_37n	missense	26	35.00	14	SNP	1.000	T
COL6A3	1293	genome.wustl.edu	37	2	238280436	238280436	+	Silent	SNP	G	G	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:238280436G>T	ENST00000295550.4	-	9	4676	c.4224C>A	c.(4222-4224)atC>atA	p.I1408I	COL6A3_ENST00000346358.4_Silent_p.I1208I|COL6A3_ENST00000353578.4_Silent_p.I1202I|COL6A3_ENST00000392004.3_Silent_p.I1202I|COL6A3_ENST00000472056.1_Silent_p.I801I|COL6A3_ENST00000347401.3_Silent_p.I1207I|COL6A3_ENST00000409809.1_Silent_p.I1202I|COL6A3_ENST00000392003.2_Silent_p.I1001I	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1408	Nonhelical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TCAGGGTCGTGATGGGCGTCA	0.587																																						dbGAP											0													77.0	77.0	77.0					2																	238280436		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.4224C>A	2.37:g.238280436G>T			A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	pfam_VWF_A,pfam_Collagen,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.I1408	ENST00000295550.4	37	c.4224	CCDS33412.1	2																																																																																			COL6A3	-	smart_VWF_A	ENSG00000163359		0.587	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	HGNC	protein_coding	OTTHUMT00000315790.2	34	0.00	0	G	NM_004369		238280436	238280436	-1	no_errors	ENST00000295550	ensembl	human	known	69_37n	silent	20	20.00	5	SNP	0.988	T
COX10	1352	genome.wustl.edu	37	17	13972944	13972944	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr17:13972944C>T	ENST00000261643.3	+	1	99	c.22C>T	c.(22-24)Ctc>Ttc	p.L8F	COX10_ENST00000537334.1_5'UTR|COX10-AS1_ENST00000602539.1_RNA|COX10_ENST00000429152.2_Missense_Mutation_p.L8F|COX10-AS1_ENST00000602743.1_RNA|COX10_ENST00000536205.1_5'UTR|COX10-AS1_ENST00000449363.1_RNA	NM_001303.3	NP_001294.2	Q12887	COX10_HUMAN	cytochrome c oxidase assembly homolog 10 (yeast)	8					aerobic respiration (GO:0009060)|cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|heme O biosynthetic process (GO:0048034)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|mitochondrial fission (GO:0000266)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	farnesyltranstransferase activity (GO:0004311)|protoheme IX farnesyltransferase activity (GO:0008495)			cervix(1)|endometrium(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		all_lung(20;0.06)|Lung SC(565;0.168)		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)		TCCGCACACTCTCTCCTCACG	0.622																																						dbGAP											0													62.0	55.0	57.0					17																	13972944		2203	4300	6503	-	-	-	SO:0001583	missense	0			U09466	CCDS11166.1	17p12	2013-05-24	2012-10-15		ENSG00000006695	ENSG00000006695		"""Mitochondrial respiratory chain complex assembly factors"""	2260	protein-coding gene	gene with protein product	"""heme A: farnesyltransferase"", ""protoheme IX farnesyltransferase, mitochondrial"", ""heme O synthase"""	602125	"""COX10 (yeast) homolog, cytochrome c oxidase assembly protein (heme A: farnesyltransferase)"", ""COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)"""			9177788, 12928484	Standard	NM_001303		Approved		uc002gof.4	Q12887	OTTHUMG00000058814	ENST00000261643.3:c.22C>T	17.37:g.13972944C>T	ENSP00000261643:p.Leu8Phe		B2R6U5|B4DJ50|O15334|Q969F7	Missense_Mutation	SNP	pfam_UbiA_prenyltransferase,pirsf_Protohaem_IX_farnesylTrfase_mt,tigrfam_Protohaem_IX_farnesylTrfase	p.L8F	ENST00000261643.3	37	c.22	CCDS11166.1	17	.	.	.	.	.	.	.	.	.	.	C	7.309	0.614509	0.14129	.	.	ENSG00000006695	ENST00000261643	T	0.48201	0.82	4.32	-2.81	0.05805	.	0.918277	0.09389	N	0.808761	T	0.35248	0.0925	L	0.57536	1.79	0.22213	N	0.999284	B	0.06786	0.001	B	0.04013	0.001	T	0.40365	-0.9567	10	0.52906	T	0.07	-3.2653	0.8238	0.01116	0.2653:0.3661:0.1295:0.2391	.	8	Q12887	COX10_HUMAN	F	8	ENSP00000261643:L8F	ENSP00000261643:L8F	L	+	1	0	COX10	13913669	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.681000	0.05191	-0.431000	0.07307	-0.175000	0.13238	CTC	COX10	-	pirsf_Protohaem_IX_farnesylTrfase_mt	ENSG00000006695		0.622	COX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX10	HGNC	protein_coding	OTTHUMT00000130003.1	33	0.00	0	C	NM_001303		13972944	13972944	+1	no_errors	ENST00000261643	ensembl	human	known	69_37n	missense	17	50.00	17	SNP	0.001	T
F2RL3	9002	genome.wustl.edu	37	19	17003994	17003994	+	IGR	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr19:17003994G>C	ENST00000248076.3	+	0	3473				CPAMD8_ENST00000597335.1_5'Flank|CPAMD8_ENST00000443236.1_Silent_p.V1908V	NM_003950.2	NP_003941.2	Q96RI0	PAR4_HUMAN	coagulation factor II (thrombin) receptor-like 3						blood coagulation (GO:0007596)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thrombin receptor activity (GO:0015057)			cervix(1)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	7						TGTAGACGAAGACAGGGCTCA	0.602																																						dbGAP											0													35.0	35.0	35.0					19																	17003994		1895	4105	6000	-	-	-	SO:0001628	intergenic_variant	0			AF055917	CCDS12350.1	19p12	2012-08-08						"""GPCR / Class A : Protease activated receptors"""	3540	protein-coding gene	gene with protein product	"""proteinase-activated receptor-4"""	602779				9618465	Standard	XM_005260139		Approved	PAR4	uc002nfa.3	Q96RI0			19.37:g.17003994G>C			O76067|Q6DK42	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Methyltransf_FA,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,smart_Prot_inh_Kazal	p.S1919C	ENST00000248076.3	37	c.5756	CCDS12350.1	19	.	.	.	.	.	.	.	.	.	.	G	2.415	-0.334440	0.05278	.	.	ENSG00000160111	ENST00000443236	.	.	.	1.65	1.65	0.23941	.	.	.	.	.	T	0.32285	0.0824	.	.	.	0.22017	N	0.999415	.	.	.	.	.	.	T	0.21008	-1.0258	4	.	.	.	.	6.7735	0.23607	0.0:0.0:1.0:0.0	.	.	.	.	C	1919	.	.	S	-	2	0	CPAMD8	16864994	0.001000	0.12720	0.001000	0.08648	0.047000	0.14425	0.529000	0.23019	1.242000	0.43836	0.491000	0.48974	TCT	CPAMD8	-	NULL	ENSG00000160111		0.602	F2RL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPAMD8	HGNC	protein_coding	OTTHUMT00000462875.1	32	0.00	0	G			17003994	17003994	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000443236	ensembl	human	known	69_37n	missense	37	17.78	8	SNP	0.001	C
CPED1	79974	genome.wustl.edu	37	7	120884363	120884363	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr7:120884363C>G	ENST00000310396.5	+	18	2748	c.2281C>G	c.(2281-2283)Caa>Gaa	p.Q761E	CPED1_ENST00000450913.2_Missense_Mutation_p.Q761E|CPED1_ENST00000423795.1_Missense_Mutation_p.Q541E	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	761						endoplasmic reticulum (GO:0005783)											AACTAAGCCTCAACTCCAGCA	0.483																																						dbGAP											0													111.0	100.0	104.0					7																	120884363		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.2281C>G	7.37:g.120884363C>G	ENSP00000309772:p.Gln761Glu		A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Missense_Mutation	SNP	NULL	p.Q761E	ENST00000310396.5	37	c.2281	CCDS34739.1	7	.	.	.	.	.	.	.	.	.	.	C	6.304	0.424187	0.11928	.	.	ENSG00000106034	ENST00000310396;ENST00000450913;ENST00000423795	T;T;T	0.20332	2.45;2.08;2.09	5.3	4.4	0.53042	.	0.475237	0.21595	N	0.072038	T	0.10252	0.0251	N	0.08118	0	0.80722	D	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.10450	0.003;0.003;0.005	T	0.08452	-1.0721	10	0.05525	T	0.97	.	14.4953	0.67683	0.0:0.5191:0.4809:0.0	.	541;761;761	G5E9U2;A4D0V7-2;A4D0V7	.;.;CG058_HUMAN	E	761;761;541	ENSP00000309772:Q761E;ENSP00000406122:Q761E;ENSP00000415573:Q541E	ENSP00000309772:Q761E	Q	+	1	0	C7orf58	120671599	1.000000	0.71417	0.955000	0.39395	0.977000	0.68977	3.360000	0.52299	1.183000	0.42943	0.460000	0.39030	CAA	CPED1	-	NULL	ENSG00000106034		0.483	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPED1	HGNC	protein_coding	OTTHUMT00000346959.1	61	0.00	0	C	NM_024913		120884363	120884363	+1	no_errors	ENST00000310396	ensembl	human	known	69_37n	missense	37	13.95	6	SNP	0.997	G
CPSF6	11052	genome.wustl.edu	37	12	69653949	69653949	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:69653949G>C	ENST00000435070.2	+	8	1551	c.1441G>C	c.(1441-1443)Gag>Cag	p.E481Q	CPSF6_ENST00000551516.1_Intron|CPSF6_ENST00000456847.3_Missense_Mutation_p.E408Q|CPSF6_ENST00000266679.8_Missense_Mutation_p.E518Q	NM_007007.2	NP_008938.2	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6, 68kDa	481					mRNA polyadenylation (GO:0006378)|mRNA processing (GO:0006397)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.E481K(2)		endometrium(1)|large_intestine(7)|lung(8)	16	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)			tcatggaattgagtccaagtc	0.328																																						dbGAP											2	Substitution - Missense(2)	large_intestine(2)											111.0	103.0	106.0					12																	69653949		2203	4300	6503	-	-	-	SO:0001583	missense	0			X67336	CCDS8988.1, CCDS73494.1	12q15	2013-06-18	2002-08-29			ENSG00000111605		"""RNA binding motif (RRM) containing"""	13871	protein-coding gene	gene with protein product	"""cleavage factor Im complex 68 kDa subunit"""	604979	"""cleavage and polyadenylation specific factor 6, 68kD subunit"""			9659921, 17267687	Standard	NM_007007		Approved	CFIM, HPBRII-4, HPBRII-7, CFIM68	uc001sut.4	Q16630		ENST00000435070.2:c.1441G>C	12.37:g.69653949G>C	ENSP00000391774:p.Glu481Gln		A8K7K9|Q53ES1|Q9BSJ7|Q9BW18	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E518Q	ENST00000435070.2	37	c.1552	CCDS8988.1	12	.	.	.	.	.	.	.	.	.	.	G	27.1	4.797146	0.90538	.	.	ENSG00000111605	ENST00000435070;ENST00000456847;ENST00000266679	T;T;T	0.30182	1.54;1.54;1.54	5.72	5.72	0.89469	.	0.086169	0.85682	D	0.000000	T	0.52757	0.1754	L	0.55990	1.75	0.80722	D	1	P;D;D	0.63880	0.801;0.961;0.993	P;P;D	0.70227	0.539;0.78;0.968	T	0.33574	-0.9863	9	.	.	.	-13.1332	20.2626	0.98452	0.0:0.0:1.0:0.0	.	229;518;481	B4DSU9;Q16630-2;Q16630	.;.;CPSF6_HUMAN	Q	481;408;518	ENSP00000391774:E481Q;ENSP00000391437:E408Q;ENSP00000266679:E518Q	.	E	+	1	0	CPSF6	67940216	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.873000	0.98535	0.563000	0.77884	GAG	CPSF6	-	NULL	ENSG00000111605		0.328	CPSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF6	HGNC	protein_coding	OTTHUMT00000403609.1	100	0.00	0	G	NM_007007		69653949	69653949	+1	no_errors	ENST00000266679	ensembl	human	known	69_37n	missense	185	13.15	28	SNP	1.000	C
CRAMP1L	57585	genome.wustl.edu	37	16	1705223	1705223	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr16:1705223G>T	ENST00000397412.3	+	9	1140	c.1041G>T	c.(1039-1041)atG>atT	p.M347I	LA16c-431H6.6_ENST00000454337.1_3'UTR|CRAMP1L_ENST00000262317.4_5'Flank|CRAMP1L_ENST00000436138.3_Missense_Mutation_p.M344I|CRAMP1L_ENST00000293925.5_Missense_Mutation_p.M347I			Q96RY5	CRML_HUMAN	Crm, cramped-like (Drosophila)	347						nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(6)|pancreas(1)	22						TCCGTAGGATGATCGTGGAGC	0.522																																						dbGAP											0													99.0	99.0	99.0					16																	1705223		1992	4159	6151	-	-	-	SO:0001583	missense	0			AB037847	CCDS10440.2	16p13.3	2008-07-30	2001-11-28		ENSG00000007545	ENSG00000007545			14122	protein-coding gene	gene with protein product			"""Crm (Cramped Drosophila)-like"""				Standard	NM_020825		Approved	KIAA1426	uc010uvh.2	Q96RY5	OTTHUMG00000074087	ENST00000397412.3:c.1041G>T	16.37:g.1705223G>T	ENSP00000380559:p.Met347Ile		A8MZL1|B1AJY1|Q8NDN1|Q9P2C1	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_SANT/Myb	p.M347I	ENST00000397412.3	37	c.1041	CCDS10440.2	16	.	.	.	.	.	.	.	.	.	.	G	17.55	3.418599	0.62622	.	.	ENSG00000007545	ENST00000397412;ENST00000293925;ENST00000436138	.	.	.	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.57917	0.2086	N	0.10782	0.045	0.80722	D	1	D	0.62365	0.991	D	0.66716	0.946	T	0.53746	-0.8395	9	0.12766	T	0.61	-30.6207	20.0893	0.97812	0.0:0.0:1.0:0.0	.	347	Q96RY5	CRML_HUMAN	I	347;347;344	.	ENSP00000293925:M347I	M	+	3	0	CRAMP1L	1645224	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	9.747000	0.98863	2.761000	0.94854	0.655000	0.94253	ATG	CRAMP1L	-	NULL	ENSG00000007545		0.522	CRAMP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRAMP1L	HGNC	protein_coding	OTTHUMT00000157297.4	68	0.00	0	G			1705223	1705223	+1	no_errors	ENST00000293925	ensembl	human	known	69_37n	missense	59	18.06	13	SNP	1.000	T
CRELD2	79174	genome.wustl.edu	37	22	50316065	50316065	+	Intron	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr22:50316065G>A	ENST00000328268.4	+	6	666				CRELD2_ENST00000403427.3_Intron|CRELD2_ENST00000407217.3_Intron|CRELD2_ENST00000404488.3_Missense_Mutation_p.R238K|CRELD2_ENST00000444954.1_Intron	NM_024324.3	NP_077300.3	Q6UXH1	CREL2_HUMAN	cysteine-rich with EGF-like domains 2							endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|stomach(3)	9		all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.198)|LUAD - Lung adenocarcinoma(64;0.247)		TACAGCTCCAGAGTATGGATA	0.522																																						dbGAP											0													28.0	30.0	29.0					22																	50316065		1562	3575	5137	-	-	-	SO:0001627	intron_variant	0			BC050675	CCDS14082.1, CCDS46730.1, CCDS63515.1, CCDS63516.1	22q13.33	2005-12-08			ENSG00000184164	ENSG00000184164			28150	protein-coding gene	gene with protein product		607171				12137942	Standard	XM_005261737		Approved	MGC11256	uc010hal.2	Q6UXH1	OTTHUMG00000150292	ENST00000328268.4:c.593-195G>A	22.37:g.50316065G>A			A5GZA2|A5GZA3|A5GZA4|A5GZA5|A5GZA6|Q4W0V0|Q86UC0|Q9BU47	Missense_Mutation	SNP	pfam_DUF3456,pfam_EGF-like_Ca-bd,superfamily_Growth_fac_rcpt,smart_EGF-like,smart_Furin_repeat,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.R238K	ENST00000328268.4	37	c.713	CCDS14082.1	22	.	.	.	.	.	.	.	.	.	.	G	0.880	-0.729086	0.03135	.	.	ENSG00000184164	ENST00000404488	T	0.52983	0.64	1.32	0.115	0.14643	.	.	.	.	.	T	0.23210	0.0561	.	.	.	0.09310	N	1	B	0.32573	0.376	B	0.21151	0.033	T	0.12630	-1.0540	8	0.20519	T	0.43	.	5.0274	0.14393	0.0:0.3855:0.6145:0.0	.	238	Q6UXH1-5	.	K	238	ENSP00000383938:R238K	ENSP00000383938:R238K	R	+	2	0	CRELD2	48702069	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.070000	0.14573	0.083000	0.17047	0.655000	0.94253	AGA	CRELD2	-	superfamily_Growth_fac_rcpt	ENSG00000184164		0.522	CRELD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CRELD2	HGNC	protein_coding	OTTHUMT00000317409.1	29	0.00	0	G	NM_024324		50316065	50316065	+1	no_errors	ENST00000404488	ensembl	human	known	69_37n	missense	24	19.35	6	SNP	0.001	A
CTNNAL1	8727	genome.wustl.edu	37	9	111727666	111727666	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr9:111727666C>T	ENST00000325551.4	-	11	1669	c.1583G>A	c.(1582-1584)gGa>gAa	p.G528E	CTNNAL1_ENST00000374595.4_Missense_Mutation_p.G528E|CTNNAL1_ENST00000374594.1_5'Flank|CTNNAL1_ENST00000325580.6_Missense_Mutation_p.G444E	NM_003798.2	NP_003789.1	Q9UBT7	CTNL1_HUMAN	catenin (cadherin-associated protein), alpha-like 1	528					cell adhesion (GO:0007155)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(4)|urinary_tract(2)	25				STAD - Stomach adenocarcinoma(157;0.0768)		ACCTCGTCTTCCTTCAAACAC	0.333																																						dbGAP											0													170.0	156.0	160.0					9																	111727666		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF030233	CCDS6775.1, CCDS69638.1	9q31.2	2008-07-21			ENSG00000119326	ENSG00000119326			2512	protein-coding gene	gene with protein product	"""alpha-catulin"", ""alpha2-catulin"""	604785				9806841	Standard	XM_005252291		Approved	CLLP, alpha-CATU	uc004bdo.1	Q9UBT7	OTTHUMG00000020466	ENST00000325551.4:c.1583G>A	9.37:g.111727666C>T	ENSP00000320434:p.Gly528Glu		B5BU47|O76084|Q53FQ2|Q5JTQ7|Q5JTQ8|Q9Y401	Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin	p.G528E	ENST00000325551.4	37	c.1583	CCDS6775.1	9	.	.	.	.	.	.	.	.	.	.	C	25.4	4.629665	0.87660	.	.	ENSG00000119326	ENST00000374595;ENST00000325551;ENST00000325580	T;T;T	0.32272	1.56;1.69;1.46	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.56499	0.1989	M	0.80847	2.515	0.41412	D	0.98774	D;D;D;D;D	0.89917	0.999;1.0;0.999;0.995;0.999	D;D;D;D;D	0.97110	0.941;1.0;0.941;0.954;0.941	T	0.51779	-0.8662	10	0.12103	T	0.63	-20.4379	17.7923	0.88558	0.0:1.0:0.0:0.0	.	528;444;528;528;528	B2RBI4;Q9UBT7-3;B3KMX6;Q9UBT7-2;Q9UBT7	.;.;.;.;CTNL1_HUMAN	E	528;528;444	ENSP00000363723:G528E;ENSP00000320434:G528E;ENSP00000323351:G444E	ENSP00000320434:G528E	G	-	2	0	CTNNAL1	110767487	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.792000	0.85828	2.793000	0.96121	0.655000	0.94253	GGA	CTNNAL1	-	NULL	ENSG00000119326		0.333	CTNNAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CTNNAL1	HGNC	protein_coding	OTTHUMT00000053577.1	104	0.00	0	C	NM_003798		111727666	111727666	-1	no_errors	ENST00000325551	ensembl	human	known	69_37n	missense	93	15.45	17	SNP	1.000	T
CYFIP1	23191	genome.wustl.edu	37	15	22963843	22963843	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr15:22963843G>A	ENST00000313077.7	+	21	2482	c.2357G>A	c.(2356-2358)cGa>cAa	p.R786Q	CYFIP1_ENST00000560848.1_Missense_Mutation_p.R786Q|CYFIP1_ENST00000435939.2_Missense_Mutation_p.R355Q	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1									p.R786Q(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		GCGATTGGACGATTTGAAAGT	0.443																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											136.0	126.0	129.0					15																	22963843		2203	4300	6503	-	-	-	SO:0001583	missense	0			D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.2357G>A	15.37:g.22963843G>A	ENSP00000324549:p.Arg786Gln			Missense_Mutation	SNP	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	p.R786Q	ENST00000313077.7	37	c.2357	CCDS10009.1	15	.	.	.	.	.	.	.	.	.	.	G	30	5.056361	0.93793	.	.	ENSG00000068793	ENST00000313077;ENST00000412127;ENST00000435939	T;T	0.23950	1.88;1.88	5.73	5.73	0.89815	.	0.000000	0.64402	D	0.000018	T	0.58623	0.2135	M	0.84433	2.695	0.80722	D	1	D;D;P	0.76494	0.999;0.973;0.952	D;B;P	0.75484	0.986;0.209;0.647	T	0.62704	-0.6798	10	0.66056	D	0.02	-12.9138	19.9036	0.96999	0.0:0.0:1.0:0.0	.	814;355;786	E7EQ04;Q7L576-2;Q7L576	.;.;CYFP1_HUMAN	Q	786;814;355	ENSP00000324549:R786Q;ENSP00000405956:R355Q	ENSP00000324549:R786Q	R	+	2	0	CYFIP1	20515284	1.000000	0.71417	0.843000	0.33291	0.799000	0.45148	9.622000	0.98378	2.706000	0.92434	0.655000	0.94253	CGA	CYFIP1	-	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub	ENSG00000068793		0.443	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYFIP1	HGNC	protein_coding	OTTHUMT00000251136.2	48	0.00	0	G	NM_014608		22963843	22963843	+1	no_errors	ENST00000313077	ensembl	human	known	69_37n	missense	59	10.61	7	SNP	1.000	A
CYP11B1	1584	genome.wustl.edu	37	8	143958628	143958628	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr8:143958628C>G	ENST00000292427.4	-	3	438	c.406G>C	c.(406-408)Gaa>Caa	p.E136Q	CYP11B1_ENST00000377675.3_Missense_Mutation_p.E207Q|CYP11B1_ENST00000517471.1_Missense_Mutation_p.E136Q	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	136					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	AAGCGCCATTCAGGCCCATTC	0.612									Familial Hyperaldosteronism type I																													dbGAP											0													42.0	32.0	36.0					8																	143958628		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.406G>C	8.37:g.143958628C>G	ENSP00000292427:p.Glu136Gln		Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_mitochondrial,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B,prints_Cyt_P450	p.E136Q	ENST00000292427.4	37	c.406	CCDS6392.1	8	.	.	.	.	.	.	.	.	.	.	.	21.7	4.189311	0.78789	.	.	ENSG00000160882	ENST00000292427;ENST00000517471;ENST00000377675	T;T;T	0.68903	-0.36;-0.36;-0.36	3.74	1.76	0.24704	.	0.366855	0.23153	N	0.051335	T	0.63331	0.2502	L	0.35644	1.08	0.43275	D	0.995233	P;P;B	0.41041	0.736;0.482;0.426	P;P;B	0.50754	0.649;0.612;0.284	T	0.55774	-0.8088	10	0.31617	T	0.26	.	10.0111	0.41986	0.0:0.5987:0.4013:0.0	.	207;136;136	Q4VAR0;Q4VAQ9;P15538	.;.;C11B1_HUMAN	Q	136;136;207	ENSP00000292427:E136Q;ENSP00000428043:E136Q;ENSP00000366903:E207Q	ENSP00000292427:E136Q	E	-	1	0	CYP11B1	143955630	0.860000	0.29831	0.888000	0.34837	0.812000	0.45895	2.157000	0.42320	0.270000	0.21984	0.555000	0.69702	GAA	CYP11B1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000160882		0.612	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11B1	HGNC	protein_coding	OTTHUMT00000379475.2	36	0.00	0	C			143958628	143958628	-1	no_errors	ENST00000292427	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	0.995	G
CYP11B2	1585	genome.wustl.edu	37	8	143994090	143994090	+	Silent	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr8:143994090C>G	ENST00000323110.2	-	8	1256	c.1254G>C	c.(1252-1254)ccG>ccC	p.P418P		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	418					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	GCTCAGGCCTCGGGAACAAGG	0.617									Familial Hyperaldosteronism type I																													dbGAP											0													89.0	91.0	91.0					8																	143994090		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.1254G>C	8.37:g.143994090C>G			B0ZBE4|Q16726	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_mitochondrial,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_B	p.P418	ENST00000323110.2	37	c.1254	CCDS6393.1	8																																																																																			CYP11B2	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	ENSG00000179142		0.617	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11B2	HGNC	protein_coding	OTTHUMT00000359904.1	65	0.00	0	C			143994090	143994090	-1	no_errors	ENST00000323110	ensembl	human	known	69_37n	silent	54	10.00	6	SNP	0.000	G
CYYR1	116159	genome.wustl.edu	37	21	27945194	27945194	+	Silent	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr21:27945194G>C	ENST00000299340.4	-	1	409	c.66C>G	c.(64-66)gtC>gtG	p.V22V	CYYR1_ENST00000435845.2_Silent_p.V130V|CYYR1_ENST00000400043.3_Silent_p.V22V	NM_052954.2	NP_443186.1	Q96J86	CYYR1_HUMAN	cysteine/tyrosine-rich 1	22						integral component of membrane (GO:0016021)				large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	15						GACCTGCGTAGACAAAGAGCA	0.667																																						dbGAP											0													64.0	63.0	64.0					21																	27945194		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY061853	CCDS13578.1	21q21.2	2014-07-04	2005-07-24		ENSG00000166265	ENSG00000166265			16274	protein-coding gene	gene with protein product			"""cysteine and tyrosine-rich 1"""	C21orf95		12036297, 12062809, 24981926	Standard	NM_052954		Approved		uc002ymd.3	Q96J86	OTTHUMG00000078689	ENST00000299340.4:c.66C>G	21.37:g.27945194G>C			A0A059TD09|A8MTU9|B2R845|Q53ER3|Q5JPD0|Q96NV7|R9QAJ4|W8CQB3	Silent	SNP	pfam_CYYR1	p.V130	ENST00000299340.4	37	c.390	CCDS13578.1	21																																																																																			CYYR1	-	pfam_CYYR1	ENSG00000166265		0.667	CYYR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYYR1	HGNC	protein_coding	OTTHUMT00000171654.2	21	0.00	0	G	NM_052954		27945194	27945194	-1	no_errors	ENST00000435845	ensembl	human	known	69_37n	silent	13	27.78	5	SNP	0.896	C
DAB1	1600	genome.wustl.edu	37	1	57480804	57480804	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:57480804G>A	ENST00000371231.1	-	13	1329	c.1295C>T	c.(1294-1296)tCa>tTa	p.S432L	DAB1_ENST00000371236.2_Missense_Mutation_p.S399L|DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000371234.4_Missense_Mutation_p.S399L|DAB1_ENST00000414851.2_Missense_Mutation_p.S381L|DAB1_ENST00000420954.2_Missense_Mutation_p.S397L|DAB1_ENST00000439789.2_Missense_Mutation_p.S313L			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	432					adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						CTGTGGACTTGACCTGGTGGA	0.587																																						dbGAP											0													77.0	72.0	73.0					1																	57480804		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.1295C>T	1.37:g.57480804G>A	ENSP00000360275:p.Ser432Leu		A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,smart_PTyr_interaction_dom,pfscan_PTyr_interaction_dom	p.S432L	ENST00000371231.1	37	c.1295		1	.	.	.	.	.	.	.	.	.	.	G	17.27	3.345969	0.61073	.	.	ENSG00000173406	ENST00000371236;ENST00000371233;ENST00000371234;ENST00000420954;ENST00000414851;ENST00000439789;ENST00000371231	T;T;T;T;T;T	0.40756	1.12;1.12;1.07;1.02;2.08;1.11	5.54	5.54	0.83059	.	0.247077	0.42821	D	0.000652	T	0.58337	0.2115	L	0.54323	1.7	0.80722	D	1	B;B;D;D;B	0.54964	0.057;0.026;0.967;0.969;0.076	B;B;P;P;B	0.59424	0.068;0.089;0.857;0.611;0.144	T	0.52155	-0.8613	10	0.42905	T	0.14	-24.875	19.6787	0.95950	0.0:0.0:1.0:0.0	.	381;432;399;313;397	O75553-4;O75553;O75553-6;O75553-3;O75553-5	.;DAB1_HUMAN;.;.;.	L	399;399;399;397;381;313;432	ENSP00000360280:S399L;ENSP00000360278:S399L;ENSP00000395296:S397L;ENSP00000387581:S381L;ENSP00000409328:S313L;ENSP00000360275:S432L	ENSP00000360275:S432L	S	-	2	0	DAB1	57253392	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.144000	0.94629	2.890000	0.99128	0.650000	0.86243	TCA	DAB1	-	NULL	ENSG00000173406		0.587	DAB1-010	KNOWN	basic	protein_coding	DAB1	HGNC	protein_coding	OTTHUMT00000027962.1	74	0.00	0	G	NM_021080		57480804	57480804	-1	no_errors	ENST00000371231	ensembl	human	known	69_37n	missense	56	15.15	10	SNP	1.000	A
DDB2	1643	genome.wustl.edu	37	11	47256321	47256321	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr11:47256321G>A	ENST00000256996.4	+	6	911	c.716G>A	c.(715-717)aGa>aAa	p.R239K	DDB2_ENST00000378603.3_Missense_Mutation_p.R175K|DDB2_ENST00000378601.3_Intron|DDB2_ENST00000378600.3_Intron	NM_000107.2	NP_000098.1	Q92466	DDB2_HUMAN	damage-specific DNA binding protein 2, 48kDa	239					DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|protein autoubiquitination (GO:0051865)|protein polyubiquitination (GO:0000209)|pyrimidine dimer repair (GO:0006290)|response to UV (GO:0009411)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|nucleoplasm (GO:0005654)|protein complex (GO:0043234)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(1)	17						TGGAATCTCAGAATGCACAAA	0.547			"""Mis, N"""			"""skin basal cell, skin squamous cell, melanoma"""		Direct reversal of damage;Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													dbGAP	yes	Rec		Xeroderma pigmentosum (E)	11	11p12	1643	damage-specific DNA binding protein 2		E	0													60.0	57.0	58.0					11																	47256321		2201	4298	6499	-	-	-	SO:0001583	missense	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV		CCDS7927.1, CCDS73284.1	11p12-p11	2014-09-17	2002-08-29			ENSG00000134574		"""WD repeat domain containing"""	2718	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group E protein"", ""UV-damaged DNA-binding protein 2"", ""DDB p48 subunit"""	600811	"""damage-specific DNA binding protein 2 (48kD)"""			8407967, 8530102	Standard	NM_000107		Approved	DDBB, UV-DDB2, FLJ34321	uc001neb.2	Q92466		ENST00000256996.4:c.716G>A	11.37:g.47256321G>A	ENSP00000256996:p.Arg239Lys		B2R875|Q76E54|Q76E55|Q76E56|Q76E57	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R239K	ENST00000256996.4	37	c.716	CCDS7927.1	11	.	.	.	.	.	.	.	.	.	.	G	12.65	2.000186	0.35320	.	.	ENSG00000134574	ENST00000256996;ENST00000378603	T;T	0.59906	0.23;0.23	5.68	3.81	0.43845	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.158102	0.64402	N	0.000010	T	0.26231	0.0640	N	0.03224	-0.385	0.80722	D	1	B;B	0.18166	0.01;0.026	B;B	0.20955	0.013;0.032	T	0.20638	-1.0269	10	0.02654	T	1	-2.7925	7.5829	0.27976	0.277:0.0:0.723:0.0	.	175;239	Q92466-4;Q92466	.;DDB2_HUMAN	K	239;175	ENSP00000256996:R239K;ENSP00000367866:R175K	ENSP00000256996:R239K	R	+	2	0	DDB2	47212897	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.942000	0.56614	1.400000	0.46741	0.563000	0.77884	AGA	DDB2	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000134574		0.547	DDB2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DDB2	HGNC	protein_coding		32	0.00	0	G	NM_000107		47256321	47256321	+1	no_errors	ENST00000256996	ensembl	human	known	69_37n	missense	29	27.50	11	SNP	1.000	A
DENND2C	163259	genome.wustl.edu	37	1	115137127	115137127	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:115137127C>G	ENST00000393274.1	-	18	3023	c.2398G>C	c.(2398-2400)Gaa>Caa	p.E800Q	DENND2C_ENST00000393277.1_Missense_Mutation_p.E688Q|DENND2C_ENST00000393276.3_Missense_Mutation_p.E743Q|DENND2C_ENST00000481894.1_5'UTR	NM_001256404.1	NP_001243333.1	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	800					positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|skin(3)	37	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTCAAGATTTCATTTCGTTCT	0.368																																						dbGAP											0													149.0	144.0	146.0					1																	115137127		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS875.1, CCDS58018.1	1p13.2-p13.1	2012-10-03			ENSG00000175984	ENSG00000175984		"""DENN/MADD domain containing"""	24748	protein-coding gene	gene with protein product							Standard	NM_198459		Approved	FLJ37099, DKFZp686G0351, DKFZp779P1149, dJ1156J9.1, RP5-1156J9.1	uc001efd.1	Q68D51	OTTHUMG00000011893	ENST00000393274.1:c.2398G>C	1.37:g.115137127C>G	ENSP00000376955:p.Glu800Gln		B1AL26|Q5TCX6|Q6P3R3	Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.E800Q	ENST00000393274.1	37	c.2398	CCDS58018.1	1	.	.	.	.	.	.	.	.	.	.	C	17.97	3.519152	0.64634	.	.	ENSG00000175984	ENST00000393276;ENST00000393274;ENST00000369540;ENST00000393277	T;T;T	0.09630	3.63;3.59;2.96	5.91	5.91	0.95273	.	0.264727	0.41396	D	0.000882	T	0.15739	0.0379	M	0.63843	1.955	0.31692	N	0.641788	D;B	0.60160	0.987;0.081	P;B	0.55455	0.776;0.281	T	0.00561	-1.1670	10	0.56958	D	0.05	.	15.7982	0.78428	0.0:0.8647:0.1353:0.0	.	800;743	Q68D51;Q68D51-3	DEN2C_HUMAN;.	Q	743;800;800;688	ENSP00000376957:E743Q;ENSP00000376955:E800Q;ENSP00000376958:E688Q	ENSP00000358553:E800Q	E	-	1	0	DENND2C	114938650	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.357000	0.66058	2.822000	0.97130	0.558000	0.71614	GAA	DENND2C	-	NULL	ENSG00000175984		0.368	DENND2C-005	KNOWN	basic|CCDS	protein_coding	DENND2C	HGNC	protein_coding	OTTHUMT00000314822.1	115	0.00	0	C	NM_198459		115137127	115137127	-1	no_errors	ENST00000393274	ensembl	human	known	69_37n	missense	83	20.95	22	SNP	1.000	G
DFNB59	494513	genome.wustl.edu	37	2	179319227	179319227	+	Nonsense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:179319227C>G	ENST00000409117.3	+	3	736	c.380C>G	c.(379-381)tCa>tGa	p.S127*	DFNB59_ENST00000375129.4_Nonsense_Mutation_p.S127*|PRKRA_ENST00000470200.1_5'Flank	NM_001042702.3	NP_001036167.1	Q0ZLH3	PJVK_HUMAN	deafness, autosomal recessive 59	127					sensory perception of sound (GO:0007605)	neuronal cell body (GO:0043025)				breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)			GTGGAAGTATCAACATTACTC	0.308																																						dbGAP											0													65.0	61.0	62.0					2																	179319227		1866	4100	5966	-	-	-	SO:0001587	stop_gained	0			BC020859, BQ887979	CCDS42787.1	2q31.2	2011-07-01			ENSG00000204311	ENSG00000204311			29502	protein-coding gene	gene with protein product		610219				16804542	Standard	NM_001042702		Approved	pejvakin	uc002umi.4	Q0ZLH3	OTTHUMG00000154425	ENST00000409117.3:c.380C>G	2.37:g.179319227C>G	ENSP00000386647:p.Ser127*		A0PK14|B9EJE2	Nonsense_Mutation	SNP	pfam_Gasdermin	p.S127*	ENST00000409117.3	37	c.380	CCDS42787.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.309636|5.309636	0.95629|0.95629	.|.	.|.	ENSG00000204311|ENSG00000204311	ENST00000442710|ENST00000409117;ENST00000375129	.|.	.|.	.|.	5.97|5.97	5.97|5.97	0.96955|0.96955	.|.	.|173.074000	.|0.02254	.|U	.|0.066882	T|.	0.73666|.	0.3616|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.64672|.	-0.6352|.	3|.	.|0.46703	.|T	.|0.11	-0.4836|-0.4836	20.4388|20.4388	0.99107|0.99107	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	M|X	74|127	.|.	.|ENSP00000364271:S127X	I|S	+|+	3|2	3|0	DFNB59|DFNB59	179027473|179027473	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.487000|7.487000	0.81328|0.81328	2.836000|2.836000	0.97738|0.97738	0.655000|0.655000	0.94253|0.94253	ATC|TCA	DFNB59	-	pfam_Gasdermin	ENSG00000204311		0.308	DFNB59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DFNB59	HGNC	protein_coding	OTTHUMT00000335160.1	29	0.00	0	C			179319227	179319227	+1	no_errors	ENST00000375129	ensembl	human	known	69_37n	nonsense	24	31.43	11	SNP	1.000	G
DFNB59	494513	genome.wustl.edu	37	2	179320818	179320818	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:179320818C>G	ENST00000409117.3	+	4	845	c.489C>G	c.(487-489)atC>atG	p.I163M	DFNB59_ENST00000605419.1_3'UTR|DFNB59_ENST00000375129.4_Missense_Mutation_p.I163M	NM_001042702.3	NP_001036167.1	Q0ZLH3	PJVK_HUMAN	deafness, autosomal recessive 59	163					sensory perception of sound (GO:0007605)	neuronal cell body (GO:0043025)				breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)			TGGAGAGCATCCGAACCACAC	0.443																																						dbGAP											0													58.0	59.0	59.0					2																	179320818		2031	4190	6221	-	-	-	SO:0001583	missense	0			BC020859, BQ887979	CCDS42787.1	2q31.2	2011-07-01			ENSG00000204311	ENSG00000204311			29502	protein-coding gene	gene with protein product		610219				16804542	Standard	NM_001042702		Approved	pejvakin	uc002umi.4	Q0ZLH3	OTTHUMG00000154425	ENST00000409117.3:c.489C>G	2.37:g.179320818C>G	ENSP00000386647:p.Ile163Met		A0PK14|B9EJE2	Missense_Mutation	SNP	pfam_Gasdermin	p.I163M	ENST00000409117.3	37	c.489	CCDS42787.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.10|17.10	3.302902|3.302902	0.60195|0.60195	.|.	.|.	ENSG00000204311|ENSG00000204311	ENST00000409117;ENST00000375129|ENST00000442710	T;T|.	0.27402|.	1.67;1.67|.	5.25|5.25	1.46|1.46	0.22682|0.22682	.|.	0.000000|.	0.33591|.	U|.	0.004759|.	T|T	0.61274|0.61274	0.2334|0.2334	M|M	0.68317|0.68317	2.08|2.08	0.42362|0.42362	D|D	0.992417|0.992417	D|.	0.76494|.	0.999|.	D|.	0.75484|.	0.986|.	T|T	0.56171|0.56171	-0.8023|-0.8023	10|5	0.72032|.	D|.	0.01|.	-10.5072|-10.5072	8.1906|8.1906	0.31366|0.31366	0.0:0.3426:0.0:0.6574|0.0:0.3426:0.0:0.6574	.|.	163|.	Q0ZLH3|.	PJVK_HUMAN|.	M|A	163|111	ENSP00000386647:I163M;ENSP00000364271:I163M|.	ENSP00000364271:I163M|.	I|P	+|+	3|1	3|0	DFNB59|DFNB59	179029064|179029064	0.991000|0.991000	0.36638|0.36638	0.998000|0.998000	0.56505|0.56505	0.994000|0.994000	0.84299|0.84299	0.270000|0.270000	0.18607|0.18607	0.154000|0.154000	0.19237|0.19237	-0.302000|-0.302000	0.09304|0.09304	ATC|CCG	DFNB59	-	pfam_Gasdermin	ENSG00000204311		0.443	DFNB59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DFNB59	HGNC	protein_coding	OTTHUMT00000335160.1	23	0.00	0	C			179320818	179320818	+1	no_errors	ENST00000375129	ensembl	human	known	69_37n	missense	17	34.62	9	SNP	0.998	G
DGKH	160851	genome.wustl.edu	37	13	42780232	42780232	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr13:42780232C>G	ENST00000337343.4	+	21	2572	c.2551C>G	c.(2551-2553)Ccc>Gcc	p.P851A	DGKH_ENST00000498255.2_3'UTR|DGKH_ENST00000538674.1_Missense_Mutation_p.P606A|DGKH_ENST00000261491.5_Missense_Mutation_p.P851A|DGKH_ENST00000540693.1_Missense_Mutation_p.P851A|DGKH_ENST00000536612.1_Missense_Mutation_p.P715A|DGKH_ENST00000379274.2_Missense_Mutation_p.P715A	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	851					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		GTTGAACATTCCCAGCTATGC	0.363																																						dbGAP											0													108.0	104.0	105.0					13																	42780232		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	ENST00000337343.4:c.2551C>G	13.37:g.42780232C>G	ENSP00000337572:p.Pro851Ala		A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_SAM_2,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_SAM_type1,superfamily_SAM/pointed,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_SAM,pfscan_Pleckstrin_homology,pfscan_SAM,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.P851A	ENST00000337343.4	37	c.2551	CCDS9381.1	13	.	.	.	.	.	.	.	.	.	.	C	22.1	4.246012	0.80024	.	.	ENSG00000102780	ENST00000540693;ENST00000337343;ENST00000261491;ENST00000379274;ENST00000536612;ENST00000538674	T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86	5.43	5.43	0.79202	Diacylglycerol kinase, accessory domain (2);	0.000000	0.85682	D	0.000000	T	0.73697	0.3620	M	0.85299	2.745	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.999;0.997	D;D;D;D	0.81914	0.992;0.995;0.995;0.992	T	0.77330	-0.2628	10	0.72032	D	0.01	.	19.5914	0.95514	0.0:1.0:0.0:0.0	.	606;715;851;851	F5GYP2;Q86XP1-3;Q86XP1-2;Q86XP1	.;.;.;DGKH_HUMAN	A	851;851;851;715;715;606	ENSP00000440823:P851A;ENSP00000337572:P851A;ENSP00000261491:P851A;ENSP00000368576:P715A;ENSP00000445114:P715A;ENSP00000441308:P606A	ENSP00000261491:P851A	P	+	1	0	DGKH	41678232	1.000000	0.71417	0.990000	0.47175	0.908000	0.53690	4.938000	0.63519	2.720000	0.93068	0.591000	0.81541	CCC	DGKH	-	pfam_Diacylglycerol_kin_accessory,smart_Diacylglycerol_kin_accessory	ENSG00000102780		0.363	DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DGKH	HGNC	protein_coding	OTTHUMT00000044699.2	68	0.00	0	C	NM_178009		42780232	42780232	+1	no_errors	ENST00000337343	ensembl	human	known	69_37n	missense	56	17.65	12	SNP	1.000	G
DHRS7	51635	genome.wustl.edu	37	14	60616170	60616170	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr14:60616170G>A	ENST00000216500.5	-	7	1328	c.873C>T	c.(871-873)ttC>ttT	p.F291F	DHRS7_ENST00000553986.1_5'Flank|DHRS7_ENST00000536410.2_Silent_p.F241F|PCNXL4_ENST00000553898.1_Intron|PCNXL4_ENST00000406949.1_Intron|DHRS7_ENST00000557185.1_Silent_p.F291F			Q9Y394	DHRS7_HUMAN	dehydrogenase/reductase (SDR family) member 7	291						membrane (GO:0016020)	oxidoreductase activity (GO:0016491)			endometrium(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	5				OV - Ovarian serous cystadenocarcinoma(108;0.121)		TTACTAACAAGAAAGGTTGTT	0.443																																						dbGAP											0													127.0	126.0	126.0					14																	60616170		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF151844	CCDS9743.1	14q23.1	2011-09-20			ENSG00000100612	ENSG00000100612		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	21524	protein-coding gene	gene with protein product	"""retinal short-chain dehydrogenase/reductase 4"", ""short chain dehydrogenase/reductase family 34C, member 1"""	612833				10800688, 10810093, 19027726	Standard	NM_016029		Approved	retDSR4, SDR34C1	uc001xes.3	Q9Y394	OTTHUMG00000140331	ENST00000216500.5:c.873C>T	14.37:g.60616170G>A			B2R896|Q9UKU2	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.S286F	ENST00000216500.5	37	c.857	CCDS9743.1	14	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.570718	0.00895	.	.	ENSG00000100612	ENST00000557751;ENST00000554101	.	.	.	5.7	-6.47	0.01902	.	.	.	.	.	T	0.15825	0.0381	.	.	.	0.20975	N	0.999811	.	.	.	.	.	.	T	0.27434	-1.0074	4	.	.	.	.	1.3626	0.02194	0.254:0.2038:0.3412:0.201	.	.	.	.	F	159;286	.	.	S	-	2	0	DHRS7	59685923	0.968000	0.33430	0.001000	0.08648	0.005000	0.04900	0.289000	0.18957	-0.770000	0.04614	-0.302000	0.09304	TCT	DHRS7	-	NULL	ENSG00000100612		0.443	DHRS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHRS7	HGNC	protein_coding	OTTHUMT00000276947.2	71	0.00	0	G	NM_016029		60616170	60616170	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000554101	ensembl	human	putative	69_37n	missense	32	56.76	42	SNP	0.111	A
DHX29	54505	genome.wustl.edu	37	5	54579457	54579457	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr5:54579457C>G	ENST00000251636.5	-	11	1687	c.1539G>C	c.(1537-1539)aaG>aaC	p.K513N	RP11-506H20.1_ENST00000506435.1_RNA	NM_019030.2	NP_061903.2	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	513						eukaryotic 43S preinitiation complex (GO:0016282)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation initiation factor activity (GO:0003743)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|lung(6)|ovary(4)|prostate(1)|skin(3)|urinary_tract(2)	46		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				AGTTTTCTCTCTTATTTTCAG	0.378																																						dbGAP											0													140.0	135.0	137.0					5																	54579457		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY036974	CCDS34158.1	5q11.2	2008-02-05	2003-06-13	2003-06-20	ENSG00000067248	ENSG00000067248		"""DEAH-boxes"""	15815	protein-coding gene	gene with protein product		612720	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 29"""	DDX29			Standard	XM_005248544		Approved		uc003jpx.3	Q7Z478	OTTHUMG00000162313	ENST00000251636.5:c.1539G>C	5.37:g.54579457C>G	ENSP00000251636:p.Lys513Asn		O75549|Q63HN0|Q63HN3|Q8IWW2|Q8N3A1|Q9UMH2	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.K513N	ENST00000251636.5	37	c.1539	CCDS34158.1	5	.	.	.	.	.	.	.	.	.	.	C	7.804	0.714217	0.15306	.	.	ENSG00000067248	ENST00000251636	T	0.11385	2.78	5.41	1.0	0.19881	.	0.454293	0.25159	N	0.032693	T	0.06188	0.0160	N	0.19112	0.55	0.09310	N	1	B	0.18610	0.029	B	0.18263	0.021	T	0.40794	-0.9544	10	0.20519	T	0.43	.	9.3013	0.37847	0.0:0.6297:0.0:0.3702	.	513	Q7Z478	DHX29_HUMAN	N	513	ENSP00000251636:K513N	ENSP00000251636:K513N	K	-	3	2	DHX29	54615214	0.001000	0.12720	0.903000	0.35520	0.965000	0.64279	0.042000	0.13949	0.266000	0.21894	0.591000	0.81541	AAG	DHX29	-	NULL	ENSG00000067248		0.378	DHX29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX29	HGNC	protein_coding	OTTHUMT00000368532.1	153	0.00	0	C	NM_019030		54579457	54579457	-1	no_errors	ENST00000251636	ensembl	human	known	69_37n	missense	131	22.94	39	SNP	0.018	G
DNMBP	23268	genome.wustl.edu	37	10	101646291	101646291	+	Silent	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr10:101646291G>C	ENST00000324109.4	-	13	3475	c.3384C>G	c.(3382-3384)ctC>ctG	p.L1128L	DNMBP_ENST00000342239.3_Silent_p.L1152L|DNMBP_ENST00000540316.1_Silent_p.L64L|DNMBP_ENST00000543621.1_Silent_p.L374L|DNMBP_ENST00000472036.1_5'UTR	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	1128	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		AGAAGTCCAGGAGCTTGTCAA	0.507																																						dbGAP											0													126.0	128.0	128.0					10																	101646291		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.3384C>G	10.37:g.101646291G>C			Q8IVY3|Q9Y2L3	Silent	SNP	pfam_BAR_dom,pfam_SH3_domain,pfam_SH3_2,pfam_DH-domain,superfamily_DH-domain,superfamily_SH3_domain,smart_SH3_domain,smart_DH-domain,smart_BAR_dom,prints_p67phox,prints_Spectrin_alpha_SH3,pfscan_BAR_dom,pfscan_SH3_domain,pfscan_DH-domain	p.L1152	ENST00000324109.4	37	c.3456	CCDS7485.1	10																																																																																			DNMBP	-	pfam_BAR_dom,smart_BAR_dom,pfscan_BAR_dom	ENSG00000107554		0.507	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNMBP	HGNC	protein_coding	OTTHUMT00000049832.2	33	0.00	0	G	NM_015221		101646291	101646291	-1	no_errors	ENST00000342239	ensembl	human	known	69_37n	silent	46	19.30	11	SNP	0.579	C
DOCK11	139818	genome.wustl.edu	37	X	117770339	117770339	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chrX:117770339C>T	ENST00000276202.7	+	36	3980	c.3917C>T	c.(3916-3918)tCa>tTa	p.S1306L	DOCK11_ENST00000276204.6_Missense_Mutation_p.S1306L	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1306					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						AATAAAGTATCACCTCAGGAG	0.303																																						dbGAP											0													84.0	73.0	76.0					X																	117770339		2200	4298	6498	-	-	-	SO:0001583	missense	0			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.3917C>T	X.37:g.117770339C>T	ENSP00000276202:p.Ser1306Leu		A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S1306L	ENST00000276202.7	37	c.3917	CCDS35373.1	X	.	.	.	.	.	.	.	.	.	.	C	15.41	2.824034	0.50739	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.19669	2.13;2.13	5.39	5.39	0.77823	.	0.113746	0.56097	D	0.000025	T	0.27832	0.0685	M	0.68593	2.085	0.37260	D	0.906952	P;P	0.47409	0.895;0.895	B;B	0.39904	0.313;0.313	T	0.36841	-0.9731	10	0.66056	D	0.02	-4.3106	18.4314	0.90627	0.0:1.0:0.0:0.0	.	1306;1306	A6NIW2;Q5JSL3	.;DOC11_HUMAN	L	1306	ENSP00000276204:S1306L;ENSP00000276202:S1306L	ENSP00000276202:S1306L	S	+	2	0	DOCK11	117654367	0.618000	0.27051	1.000000	0.80357	0.954000	0.61252	2.406000	0.44557	2.380000	0.81148	0.600000	0.82982	TCA	DOCK11	-	NULL	ENSG00000147251		0.303	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DOCK11	HGNC	protein_coding	OTTHUMT00000356002.1	81	0.00	0	C	NM_144658		117770339	117770339	+1	no_errors	ENST00000276202	ensembl	human	known	69_37n	missense	57	14.93	10	SNP	0.990	T
DOCK3	1795	genome.wustl.edu	37	3	51392451	51392451	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr3:51392451C>G	ENST00000266037.9	+	41	4269	c.4246C>G	c.(4246-4248)Cag>Gag	p.Q1416E		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1416	DHR-2.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		GTGCGATGCCCAGTGTATCCT	0.597																																						dbGAP											0													52.0	55.0	54.0					3																	51392451		2083	4209	6292	-	-	-	SO:0001583	missense	0			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.4246C>G	3.37:g.51392451C>G	ENSP00000266037:p.Gln1416Glu		O15017	Missense_Mutation	SNP	pfam_DOCK,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.Q1416E	ENST00000266037.9	37	c.4246	CCDS46835.1	3	.	.	.	.	.	.	.	.	.	.	C	21.0	4.086065	0.76642	.	.	ENSG00000088538	ENST00000266037;ENST00000402669	T	0.07444	3.19	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.19446	0.0467	M	0.85630	2.765	0.80722	D	1	B	0.12630	0.006	B	0.14023	0.01	T	0.02893	-1.1097	10	0.72032	D	0.01	.	19.8677	0.96824	0.0:1.0:0.0:0.0	.	1416	Q8IZD9	DOCK3_HUMAN	E	1416;212	ENSP00000266037:Q1416E	ENSP00000266037:Q1416E	Q	+	1	0	DOCK3	51367491	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.811000	0.86092	2.709000	0.92574	0.655000	0.94253	CAG	DOCK3	-	NULL	ENSG00000088538		0.597	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK3	HGNC	protein_coding	OTTHUMT00000346478.5	49	0.00	0	C	NM_004947		51392451	51392451	+1	no_errors	ENST00000266037	ensembl	human	known	69_37n	missense	28	22.22	8	SNP	1.000	G
DOCK7	85440	genome.wustl.edu	37	1	62979159	62979159	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:62979159C>T	ENST00000340370.5	-	32	4162	c.4145G>A	c.(4144-4146)cGa>cAa	p.R1382Q	DOCK7_ENST00000251157.5_Missense_Mutation_p.R1413Q	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1413					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						TCCTCGGCTTCGCCGTACCAT	0.423																																						dbGAP											0													103.0	101.0	102.0					1																	62979159		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.4145G>A	1.37:g.62979159C>T	ENSP00000340742:p.Arg1382Gln		Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,superfamily_ARM-type_fold	p.R1413Q	ENST00000340370.5	37	c.4238	CCDS30734.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.639558	0.96693	.	.	ENSG00000116641	ENST00000371140;ENST00000251157;ENST00000340370;ENST00000395441	T;T	0.01981	4.52;4.52	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.12689	0.0308	M	0.80616	2.505	0.80722	D	1	P;D;P;P;D;D	0.60160	0.948;0.983;0.873;0.927;0.958;0.987	P;P;P;P;P;P	0.59115	0.509;0.704;0.49;0.49;0.704;0.852	T	0.00084	-1.2099	10	0.72032	D	0.01	.	19.6914	0.96002	0.0:1.0:0.0:0.0	.	1413;1413;1382;1382;1382;1413	Q96N67;Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3;Q96N67-6	DOCK7_HUMAN;.;.;.;.;.	Q	1413;1413;1382;152	ENSP00000251157:R1413Q;ENSP00000340742:R1382Q	ENSP00000251157:R1413Q	R	-	2	0	DOCK7	62751747	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.786000	0.85741	2.644000	0.89710	0.563000	0.77884	CGA	DOCK7	-	NULL	ENSG00000116641		0.423	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK7	HGNC	protein_coding	OTTHUMT00000036806.1	87	0.00	0	C	NM_033407		62979159	62979159	-1	no_errors	ENST00000251157	ensembl	human	known	69_37n	missense	65	32.99	32	SNP	1.000	T
DONSON	29980	genome.wustl.edu	37	21	34955797	34955797	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr21:34955797C>T	ENST00000303071.5	-	5	1027	c.961G>A	c.(961-963)Gaa>Aaa	p.E321K	DONSON_ENST00000303113.6_Missense_Mutation_p.E307K|DONSON_ENST00000453626.1_Missense_Mutation_p.E321K|DONSON_ENST00000432378.1_Missense_Mutation_p.E321K	NM_017613.3	NP_060083.1	Q9NYP3	DONS_HUMAN	downstream neighbor of SON	321					multicellular organismal development (GO:0007275)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(1)|ovary(1)	11						CTTTTACCTTCATTTCTCATA	0.348																																						dbGAP											0													69.0	68.0	68.0					21																	34955797		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF000002	CCDS13632.1	21q22.1	2008-07-31			ENSG00000159147	ENSG00000159147			2993	protein-coding gene	gene with protein product		611428		C21orf60		10773462, 10950926	Standard	NM_017613		Approved	B17, C2TA, DKFZP434M035	uc002ysk.4	Q9NYP3	OTTHUMG00000065904	ENST00000303071.5:c.961G>A	21.37:g.34955797C>T	ENSP00000307143:p.Glu321Lys		Q8NC53|Q9NSR9|Q9NVZ5|Q9NYP1|Q9NYP2	Missense_Mutation	SNP	NULL	p.E321K	ENST00000303071.5	37	c.961	CCDS13632.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.724025|5.724025	0.96847|0.96847	.|.	.|.	ENSG00000159147|ENSG00000159147	ENST00000303113;ENST00000453626;ENST00000303071;ENST00000432378|ENST00000437395	.|.	.|.	.|.	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	0.045201|.	0.85682|.	D|.	0.000000|.	D|D	0.84817|0.84817	0.5556|0.5556	M|M	0.87682|0.87682	2.9|2.9	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.79784|.	0.993;0.993|.	D|D	0.84986|0.84986	0.0891|0.0891	9|5	0.54805|.	T|.	0.06|.	.|.	20.4745|20.4745	0.99168|0.99168	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	307;321|.	F8W8A5;Q9NYP3|.	.;DONS_HUMAN|.	K|I	307;321;321;321|291	.|.	ENSP00000307143:E321K|.	E|M	-|-	1|3	0|0	DONSON|DONSON	33877667|33877667	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	7.086000|7.086000	0.76885|0.76885	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GAA|ATG	DONSON	-	NULL	ENSG00000159147		0.348	DONSON-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DONSON	HGNC	protein_coding	OTTHUMT00000141184.1	46	0.00	0	C	NM_017613		34955797	34955797	-1	no_errors	ENST00000303071	ensembl	human	known	69_37n	missense	43	28.33	17	SNP	1.000	T
DOT1L	84444	genome.wustl.edu	37	19	2223463	2223463	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr19:2223463G>A	ENST00000398665.3	+	25	3610	c.3574G>A	c.(3574-3576)Gag>Aag	p.E1192K		NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	1192					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCAGGCTCTGAGGACGAGCC	0.692																																						dbGAP											0													28.0	31.0	30.0					19																	2223463		1913	4102	6015	-	-	-	SO:0001583	missense	0			AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.3574G>A	19.37:g.2223463G>A	ENSP00000381657:p.Glu1192Lys		O60379|Q96JL1	Missense_Mutation	SNP	pfam_DOT1,pirsf_Histone_H3-K79_MeTrfase_met	p.E1192K	ENST00000398665.3	37	c.3574	CCDS42460.1	19	.	.	.	.	.	.	.	.	.	.	G	26.0	4.692344	0.88735	.	.	ENSG00000104885	ENST00000398665;ENST00000221482;ENST00000457590	T;T	0.37058	1.64;1.22	4.91	4.91	0.64330	.	0.113431	0.64402	D	0.000014	T	0.59432	0.2193	M	0.66939	2.045	0.41573	D	0.988694	D;D	0.71674	0.99;0.998	P;D	0.78314	0.824;0.991	T	0.64635	-0.6361	10	0.87932	D	0	-35.7109	17.0688	0.86567	0.0:0.0:1.0:0.0	.	1192;1192	Q8TEK3;Q8TEK3-2	DOT1L_HUMAN;.	K	1192;1192;72	ENSP00000381657:E1192K;ENSP00000407411:E72K	ENSP00000221482:E1192K	E	+	1	0	DOT1L	2174463	1.000000	0.71417	0.995000	0.50966	0.414000	0.31173	8.585000	0.90802	2.284000	0.76573	0.561000	0.74099	GAG	DOT1L	-	pirsf_Histone_H3-K79_MeTrfase_met	ENSG00000104885		0.692	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOT1L	HGNC	protein_coding	OTTHUMT00000318066.1	24	0.00	0	G	NM_032482		2223463	2223463	+1	no_errors	ENST00000398665	ensembl	human	known	69_37n	missense	11	47.62	10	SNP	1.000	A
DPM1	8813	genome.wustl.edu	37	20	49558613	49558613	+	Missense_Mutation	SNP	C	C	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr20:49558613C>A	ENST00000371588.5	-	6	475	c.449G>T	c.(448-450)gGa>gTa	p.G150V	DPM1_ENST00000371583.5_Intron|DPM1_ENST00000466152.1_5'UTR|DPM1_ENST00000371582.4_Missense_Mutation_p.G150V|RP5-914P20.5_ENST00000558899.2_RNA	NM_003859.1	NP_003850.1	O60762	DPM1_HUMAN	dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit	150					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|dolichol metabolic process (GO:0019348)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose metabolic process (GO:0019673)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|protein mannosylation (GO:0035268)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked mannosylation (GO:0035269)	dolichol-phosphate-mannose synthase complex (GO:0033185)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nucleus (GO:0005634)	alcohol binding (GO:0043178)|dolichyl-phosphate beta-D-mannosyltransferase activity (GO:0004582)|dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|mannose binding (GO:0005537)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	7						ACCTCCATTTCCTTTGTAGCG	0.343																																						dbGAP											0													202.0	193.0	196.0					20																	49558613		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF007875	CCDS13434.1	20q13.1	2013-02-26			ENSG00000000419	ENSG00000000419	2.4.1.83	"""Glycosyltransferase family 2 domain containing"""	3005	protein-coding gene	gene with protein product	"""DPM synthase complex, catalytic subunit"""	603503				9223280, 9535917	Standard	NM_003859		Approved	MPDS, CDGIE	uc002xvw.1	O60762	OTTHUMG00000032742	ENST00000371588.5:c.449G>T	20.37:g.49558613C>A	ENSP00000360644:p.Gly150Val		O15157|Q6IB78|Q96HK0	Missense_Mutation	SNP	pfam_Glyco_trans_2	p.G150V	ENST00000371588.5	37	c.449	CCDS13434.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.14|18.14	3.558581|3.558581	0.65538|0.65538	.|.	.|.	ENSG00000000419|ENSG00000000419	ENST00000371588;ENST00000371582;ENST00000449701|ENST00000371584	T;T|.	0.57273|.	0.41;0.41|.	5.04|5.04	5.04|5.04	0.67666|0.67666	Glycosyl transferase, family 2 (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.84615|0.84615	0.5511|0.5511	M|M	0.89601|0.89601	3.045|3.045	0.80722|0.80722	D|D	1|1	B;B|.	0.28760|.	0.089;0.221|.	B;B|.	0.32090|.	0.057;0.14|.	D|D	0.87323|0.87323	0.2319|0.2319	9|5	.|.	.|.	.|.	-13.763|-13.763	18.1623|18.1623	0.89712|0.89712	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	150;150|.	O60762;E9PBD4|.	DPM1_HUMAN;.|.	V|S	150|149	ENSP00000360644:G150V;ENSP00000360638:G150V|.	.|.	G|R	-|-	2|3	0|2	DPM1|DPM1	48992020|48992020	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.135000|7.135000	0.77276|0.77276	2.619000|2.619000	0.88677|0.88677	0.585000|0.585000	0.79938|0.79938	GGA|AGG	DPM1	-	pfam_Glyco_trans_2	ENSG00000000419		0.343	DPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPM1	HGNC	protein_coding	OTTHUMT00000079716.1	150	0.00	0	C	NM_003859		49558613	49558613	-1	no_errors	ENST00000371582	ensembl	human	known	69_37n	missense	149	26.60	54	SNP	1.000	A
DROSHA	29102	genome.wustl.edu	37	5	31526841	31526841	+	Missense_Mutation	SNP	G	G	A	rs35342496	byFrequency	TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr5:31526841G>A	ENST00000511367.2	-	4	443	c.199C>T	c.(199-201)Cca>Tca	p.P67S	DROSHA_ENST00000344624.3_Missense_Mutation_p.P67S|DROSHA_ENST00000442743.1_Missense_Mutation_p.P67S|DROSHA_ENST00000504361.1_5'Flank|DROSHA_ENST00000513349.1_Missense_Mutation_p.P67S	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	67	Pro-rich.		P -> T (in dbSNP:rs35342496).		defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						TTGGGGGCTGGAGAGTTTGAG	0.572																																						dbGAP											0													40.0	46.0	44.0					5																	31526841		1952	4133	6085	-	-	-	SO:0001583	missense	0			AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.199C>T	5.37:g.31526841G>A	ENSP00000425979:p.Pro67Ser		E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Missense_Mutation	SNP	pfam_RNase_III_dom,pfam_Ds-RNA-bd,superfamily_RNase_III_dom,smart_RNase_III_dom,smart_Ds-RNA-bd,pfscan_Ds-RNA-bd,pfscan_RNase_III_dom	p.P67S	ENST00000511367.2	37	c.199	CCDS47195.1	5	.	.	.	.	.	.	.	.	.	.	G	8.415	0.844978	0.16963	.	.	ENSG00000113360	ENST00000511367;ENST00000344624;ENST00000442743;ENST00000513349;ENST00000265075;ENST00000382188;ENST00000507438	T;T;T;T;T	0.42513	1.62;1.62;0.97;0.97;1.0	5.04	5.04	0.67666	.	0.585459	0.17388	N	0.176033	T	0.22551	0.0544	N	0.04508	-0.205	0.25412	N	0.988343	B;B;B	0.12013	0.001;0.005;0.005	B;B;B	0.06405	0.001;0.002;0.002	T	0.09509	-1.0671	10	0.25106	T	0.35	-3.6024	13.7742	0.63044	0.0761:0.0:0.9238:0.0	.	67;67;67	Q9NRR4-2;E7EMP9;Q9NRR4	.;.;RNC_HUMAN	S	67;67;67;67;60;60;67	ENSP00000425979:P67S;ENSP00000339845:P67S;ENSP00000409335:P67S;ENSP00000424161:P67S;ENSP00000430921:P67S	ENSP00000265075:P60S	P	-	1	0	DROSHA	31562598	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.049000	0.49869	2.349000	0.79799	0.563000	0.77884	CCA	DROSHA	-	NULL	ENSG00000113360		0.572	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DROSHA	HGNC	protein_coding	OTTHUMT00000366561.3	38	0.00	0	G	NM_013235		31526841	31526841	-1	no_errors	ENST00000344624	ensembl	human	known	69_37n	missense	25	13.79	4	SNP	1.000	A
DUSP12	11266	genome.wustl.edu	37	1	161721745	161721745	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:161721745G>A	ENST00000367943.4	+	3	580	c.548G>A	c.(547-549)cGt>cAt	p.R183H		NM_007240.1	NP_009171.1	Q9UNI6	DUS12_HUMAN	dual specificity phosphatase 12	183					cellular protein modification process (GO:0006464)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of glucokinase activity (GO:0033133)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|lung(1)	5	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)			AAGCAATATCGTTTACAAAAG	0.363																																						dbGAP											0													102.0	106.0	104.0					1																	161721745		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF119226	CCDS1234.1	1q21-q22	2011-06-09			ENSG00000081721	ENSG00000081721		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	3067	protein-coding gene	gene with protein product	"""serine/threonine specific protein phosphatase"", ""YVH1 protein-tyrosine phosphatase (S. cerevisiae) ortholog"""	604835				10446167	Standard	XM_005244862		Approved	YVH1, DUSP1	uc001gbo.3	Q9UNI6	OTTHUMG00000034540	ENST00000367943.4:c.548G>A	1.37:g.161721745G>A	ENSP00000356920:p.Arg183His		Q5VXA8	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pirsf_DUSP12,pfscan_Znf_C2H2,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.R183H	ENST00000367943.4	37	c.548	CCDS1234.1	1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.484975	0.84854	.	.	ENSG00000081721	ENST00000367943	T	0.04194	3.68	4.99	4.99	0.66335	.	0.000000	0.64402	D	0.000006	T	0.09905	0.0243	M	0.70787	2.145	0.53688	D	0.999978	D	0.89917	1.0	D	0.65987	0.94	T	0.33033	-0.9884	9	0.15066	T	0.55	.	15.8159	0.78599	0.0:0.0:1.0:0.0	.	183	Q9UNI6	DUS12_HUMAN	H	183	ENSP00000356920:R183H	ENSP00000356920:R183H	R	+	2	0	DUSP12	159988369	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.222000	0.72249	2.596000	0.87737	0.484000	0.47621	CGT	DUSP12	-	pirsf_DUSP12	ENSG00000081721		0.363	DUSP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP12	HGNC	protein_coding	OTTHUMT00000083588.1	59	0.00	0	G	NM_007240		161721745	161721745	+1	no_errors	ENST00000367943	ensembl	human	known	69_37n	missense	117	12.69	17	SNP	1.000	A
DUSP8	1850	genome.wustl.edu	37	11	1580209	1580209	+	Silent	SNP	G	G	A	rs555826663		TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr11:1580209G>A	ENST00000397374.3	-	4	574	c.447C>T	c.(445-447)ctC>ctT	p.L149L	DUSP8_ENST00000331588.4_Silent_p.L149L|DUSP8_ENST00000528778.1_5'UTR	NM_004420.2	NP_004411.2	Q13202	DUS8_HUMAN	dual specificity phosphatase 8	149					inactivation of MAPK activity (GO:0000188)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|lung(2)|prostate(1)|urinary_tract(1)	5		all_epithelial(84;0.000134)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000621)|Lung(200;0.0687)|LUSC - Lung squamous cell carcinoma(625;0.0825)		AGGGCTGGGAGAGGCTCATGG	0.662													g|||	1	0.000199681	0.0	0.0	5008	,	,		17275	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													62.0	52.0	55.0					11																	1580209		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0				CCDS7724.1	11p15.5	2011-06-09			ENSG00000184545	ENSG00000184545		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3074	protein-coding gene	gene with protein product	"""serine/threonine specific protein phosphatase"", ""H1 phosphatase, vaccinia virus homolog"""	602038	"""chromosome 11 open reading frame 81"""	C11orf81		7561881, 9192849	Standard	NM_004420		Approved	HVH-5, HB5, FLJ42958	uc001lts.2	Q13202	OTTHUMG00000133348	ENST00000397374.3:c.447C>T	11.37:g.1580209G>A			Q86SS8	Silent	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP	p.L149	ENST00000397374.3	37	c.447	CCDS7724.1	11																																																																																			DUSP8	-	NULL	ENSG00000184545		0.662	DUSP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP8	HGNC	protein_coding	OTTHUMT00000257178.3	52	0.00	0	G	NM_004420		1580209	1580209	-1	no_errors	ENST00000331588	ensembl	human	known	69_37n	silent	35	23.91	11	SNP	1.000	A
DYRK2	8445	genome.wustl.edu	37	12	68050958	68050958	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:68050958C>G	ENST00000344096.3	+	3	684	c.271C>G	c.(271-273)Caa>Gaa	p.Q91E	RP11-335O4.3_ENST00000425371.2_RNA|DYRK2_ENST00000393555.3_Missense_Mutation_p.Q18E	NM_006482.2	NP_006473.2	Q92630	DYRK2_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2	91					cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of NFAT protein import into nucleus (GO:0051534)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of glycogen biosynthetic process (GO:0045725)|protein phosphorylation (GO:0006468)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|ubiquitin binding (GO:0043130)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30			Lung(24;6.81e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(7;0.000573)		GATCCAGGTTCAACAGTTGTT	0.493																																						dbGAP											0													103.0	89.0	94.0					12																	68050958		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y09216	CCDS8978.1, CCDS8979.1	12q15	2008-07-03				ENSG00000127334			3093	protein-coding gene	gene with protein product		603496				9748265	Standard	NM_003583		Approved		uc001str.4	Q92630		ENST00000344096.3:c.271C>G	12.37:g.68050958C>G	ENSP00000342105:p.Gln91Glu		B2R9V9|Q9BRB5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Q91E	ENST00000344096.3	37	c.271	CCDS8978.1	12	.	.	.	.	.	.	.	.	.	.	C	0.145	-1.097293	0.01843	.	.	ENSG00000127334	ENST00000543747;ENST00000344096;ENST00000393555;ENST00000319833;ENST00000542503	T;T;T;T;T	0.27104	1.69;1.69;1.69;1.69;1.69	5.25	5.25	0.73442	.	0.115754	0.64402	D	0.000012	T	0.16085	0.0387	N	0.11064	0.09	0.58432	D	0.999998	B	0.09022	0.002	B	0.08055	0.003	T	0.09796	-1.0658	9	.	.	.	.	19.2246	0.93814	0.0:1.0:0.0:0.0	.	91	Q92630	DYRK2_HUMAN	E	18;91;18;18;69	ENSP00000440839:Q18E;ENSP00000342105:Q91E;ENSP00000377186:Q18E;ENSP00000324733:Q18E;ENSP00000443314:Q69E	.	Q	+	1	0	DYRK2	66337225	1.000000	0.71417	1.000000	0.80357	0.768000	0.43524	3.335000	0.52105	2.631000	0.89168	0.313000	0.20887	CAA	DYRK2	-	NULL	ENSG00000127334		0.493	DYRK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DYRK2	HGNC	protein_coding	OTTHUMT00000402218.1	55	0.00	0	C			68050958	68050958	+1	no_errors	ENST00000344096	ensembl	human	known	69_37n	missense	114	10.94	14	SNP	1.000	G
C15orf65	145788	genome.wustl.edu	37	15	55710321	55710321	+	Intron	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr15:55710321G>C	ENST00000569691.1	+	2	239				DYX1C1_ENST00000448430.2_Missense_Mutation_p.S353C|DYX1C1_ENST00000380679.1_Missense_Mutation_p.S353C|C15orf65_ENST00000570794.1_Intron|DYX1C1-CCPG1_ENST00000565113.1_RNA	NM_001198784.1	NP_001185713.1	H3BRN8	CO065_HUMAN	chromosome 15 open reading frame 65																		GCCCTCAAGAGAACAGAATTC	0.398																																						dbGAP											0													64.0	62.0	63.0					15																	55710321		2193	4292	6485	-	-	-	SO:0001627	intron_variant	0				CCDS58363.1	15q21.3	2013-06-06			ENSG00000261652	ENSG00000261652			44654	protein-coding gene	gene with protein product							Standard	NM_001198784		Approved	FLJ27352		H3BRN8	OTTHUMG00000172679	ENST00000569691.1:c.19-100G>C	15.37:g.55710321G>C				Missense_Mutation	SNP	pfam_CS_domain,superfamily_HSP20-like_chaperone,pfscan_CS-like_domain	p.S353C	ENST00000569691.1	37	c.1058	CCDS58363.1	15	.	.	.	.	.	.	.	.	.	.	G	10.49	1.364327	0.24684	.	.	ENSG00000256061	ENST00000448430;ENST00000380679	T;T	0.12774	2.65;2.65	3.46	-0.683	0.11335	.	.	.	.	.	T	0.10594	0.0259	.	.	.	0.09310	N	0.999994	P	0.42620	0.785	B	0.41764	0.366	T	0.22312	-1.0220	8	0.87932	D	0	.	2.5027	0.04638	0.2864:0.0:0.4173:0.2963	.	353	Q8WXU2-2	.	C	353	ENSP00000403412:S353C;ENSP00000370054:S353C	ENSP00000370054:S353C	S	-	2	0	DYX1C1	53497613	0.000000	0.05858	0.001000	0.08648	0.017000	0.09413	-0.751000	0.04803	0.095000	0.17434	-0.258000	0.10820	TCT	DYX1C1	-	NULL	ENSG00000256061		0.398	C15orf65-001	NOVEL	basic|appris_principal|CCDS	protein_coding	DYX1C1	HGNC	protein_coding	OTTHUMT00000419859.2	28	0.00	0	G			55710321	55710321	-1	no_errors	ENST00000380679	ensembl	human	known	69_37n	missense	27	25.00	9	SNP	0.001	C
EAPP	55837	genome.wustl.edu	37	14	34985728	34985728	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr14:34985728C>T	ENST00000250454.3	-	6	727	c.646G>A	c.(646-648)Gag>Aag	p.E216K		NM_018453.3	NP_060923.2	Q56P03	EAPP_HUMAN	E2F-associated phosphoprotein	216					negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(2)	12	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00342)|Epithelial(34;0.18)	GBM - Glioblastoma multiforme(112;0.0196)		CTTAGAACCTCCTCTTTGTTA	0.393																																						dbGAP											0													143.0	135.0	138.0					14																	34985728		1833	4081	5914	-	-	-	SO:0001583	missense	0			AF217512	CCDS41941.1	14q13	2007-03-26	2007-03-26	2007-03-26		ENSG00000129518			19312	protein-coding gene	gene with protein product		609486	"""chromosome 14 open reading frame 11"""	C14orf11		15716352	Standard	NM_018453		Approved	BM036, FLJ20578	uc001wsd.1	Q56P03		ENST00000250454.3:c.646G>A	14.37:g.34985728C>T	ENSP00000250454:p.Glu216Lys		Q9BVF4|Q9NWV5|Q9NZ86	Missense_Mutation	SNP	pfam_E2F-assoc_phosphoprotein	p.E216K	ENST00000250454.3	37	c.646	CCDS41941.1	14	.	.	.	.	.	.	.	.	.	.	C	22.6	4.305025	0.81247	.	.	ENSG00000129518	ENST00000250454;ENST00000554792	T;T	0.41400	1.0;1.0	4.92	4.02	0.46733	.	0.047474	0.85682	D	0.000000	T	0.56877	0.2015	L	0.48260	1.515	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.55379	-0.8150	10	0.34782	T	0.22	-19.9421	16.0255	0.80541	0.0:0.865:0.135:0.0	.	216	Q56P03	EAPP_HUMAN	K	216;195	ENSP00000250454:E216K;ENSP00000450908:E195K	ENSP00000250454:E216K	E	-	1	0	EAPP	34055479	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.812000	0.75226	1.374000	0.46228	0.650000	0.86243	GAG	EAPP	-	pfam_E2F-assoc_phosphoprotein	ENSG00000129518		0.393	EAPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EAPP	HGNC	protein_coding	OTTHUMT00000409847.1	82	0.00	0	C	NM_018453		34985728	34985728	-1	no_errors	ENST00000250454	ensembl	human	known	69_37n	missense	66	22.35	19	SNP	1.000	T
EEA1	8411	genome.wustl.edu	37	12	93175878	93175878	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:93175878C>T	ENST00000322349.8	-	23	3448	c.3184G>A	c.(3184-3186)Gac>Aac	p.D1062N		NM_003566.3	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1	1062					early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|synaptic vesicle to endosome fusion (GO:0016189)|vesicle fusion (GO:0006906)	axonal spine (GO:0044308)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|recycling endosome (GO:0055037)|serine-pyruvate aminotransferase complex (GO:0005969)	1-phosphatidylinositol binding (GO:0005545)|calmodulin binding (GO:0005516)|GTP-dependent protein binding (GO:0030742)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(11)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	36						GAAATCAAGTCCTCCTGTGCT	0.328																																						dbGAP											0													85.0	78.0	80.0					12																	93175878		2202	4300	6502	-	-	-	SO:0001583	missense	0			L40157	CCDS31874.1	12q22	2007-02-23	2007-02-23			ENSG00000102189		"""Zinc fingers, FYVE domain containing"""	3185	protein-coding gene	gene with protein product		605070	"""early endosome antigen 1, 162kD"""			7768953, 9697774	Standard	NM_003566		Approved	ZFYVE2	uc001tck.3	Q15075	OTTHUMG00000170110	ENST00000322349.8:c.3184G>A	12.37:g.93175878C>T	ENSP00000317955:p.Asp1062Asn		Q14221	Missense_Mutation	SNP	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_Znf_C2H2	p.D1062N	ENST00000322349.8	37	c.3184	CCDS31874.1	12	.	.	.	.	.	.	.	.	.	.	C	26.7	4.763190	0.89932	.	.	ENSG00000102189	ENST00000322349	T	0.63580	-0.05	5.24	4.35	0.52113	.	0.105878	0.41097	D	0.000958	T	0.56156	0.1966	N	0.24115	0.695	0.41188	D	0.986287	P	0.52316	0.952	P	0.49477	0.612	T	0.58555	-0.7616	10	0.44086	T	0.13	.	14.0796	0.64912	0.0:0.9268:0.0:0.0732	.	1062	Q15075	EEA1_HUMAN	N	1062	ENSP00000317955:D1062N	ENSP00000317955:D1062N	D	-	1	0	EEA1	91700009	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.426000	0.80270	1.191000	0.43056	0.585000	0.79938	GAC	EEA1	-	NULL	ENSG00000102189		0.328	EEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEA1	HGNC	protein_coding	OTTHUMT00000407304.1	52	0.00	0	C	NM_003566		93175878	93175878	-1	no_errors	ENST00000322349	ensembl	human	known	69_37n	missense	25	34.21	13	SNP	1.000	T
EHBP1	23301	genome.wustl.edu	37	2	63085619	63085619	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:63085619C>T	ENST00000263991.5	+	8	1195	c.713C>T	c.(712-714)tCa>tTa	p.S238L	AC007098.1_ENST00000452397.1_RNA|EHBP1_ENST00000405015.3_Intron|EHBP1_ENST00000354487.3_Intron|EHBP1_ENST00000405289.1_Intron|EHBP1_ENST00000431489.1_Intron	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1	238						cytoplasm (GO:0005737)|membrane (GO:0016020)				biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			AATATGCGTTCAGCTAAATCA	0.418																																						dbGAP											0													188.0	172.0	178.0					2																	63085619		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.713C>T	2.37:g.63085619C>T	ENSP00000263991:p.Ser238Leu		O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	Missense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.S238L	ENST00000263991.5	37	c.713	CCDS1872.1	2	.	.	.	.	.	.	.	.	.	.	C	21.5	4.162097	0.78226	.	.	ENSG00000115504	ENST00000263991	T	0.74526	-0.85	5.02	5.02	0.67125	.	0.097482	0.42821	D	0.000655	D	0.82751	0.5105	L	0.51422	1.61	0.80722	D	1	D	0.57899	0.981	D	0.69824	0.966	T	0.81767	-0.0782	9	.	.	.	.	18.3447	0.90317	0.0:1.0:0.0:0.0	.	238	Q8NDI1	EHBP1_HUMAN	L	238	ENSP00000263991:S238L	.	S	+	2	0	EHBP1	62939123	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.803000	0.55560	2.339000	0.79563	0.655000	0.94253	TCA	EHBP1	-	NULL	ENSG00000115504		0.418	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHBP1	HGNC	protein_coding	OTTHUMT00000251616.1	70	0.00	0	C	NM_015252		63085619	63085619	+1	no_errors	ENST00000263991	ensembl	human	known	69_37n	missense	95	14.41	16	SNP	1.000	T
EHD1	10938	genome.wustl.edu	37	11	64627438	64627438	+	Silent	SNP	G	G	A	rs149085797		TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr11:64627438G>A	ENST00000320631.3	-	3	1127	c.873C>T	c.(871-873)ctC>ctT	p.L291L	EHD1_ENST00000359393.2_Silent_p.L291L	NM_001282445.1|NM_006795.2	NP_001269374.1|NP_006786.2	Q9H4M9	EHD1_HUMAN	EH-domain containing 1	291					blood coagulation (GO:0007596)|cellular response to nerve growth factor stimulus (GO:1990090)|cholesterol homeostasis (GO:0042632)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|low-density lipoprotein particle clearance (GO:0034383)|neuron projection development (GO:0031175)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of myoblast fusion (GO:1901741)|protein homooligomerization (GO:0051260)	early endosome membrane (GO:0031901)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	12						TGAGCTTCCTGAGGGCGGCGT	0.637																																						dbGAP											0													46.0	42.0	43.0					11																	64627438		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AF099011	CCDS8084.1, CCDS73315.1	11q13	2013-01-10			ENSG00000110047	ENSG00000110047		"""EF-hand domain containing"""	3242	protein-coding gene	gene with protein product	"""testilin"""	605888		PAST1		10395801, 10673336	Standard	NM_001282444		Approved	H-PAST, HPAST1, FLJ42622, FLJ44618	uc001obu.1	Q9H4M9	OTTHUMG00000066832	ENST00000320631.3:c.873C>T	11.37:g.64627438G>A			O14611|Q2M3Q4|Q9UNR3	Silent	SNP	pfam_Dynamin_GTPase,smart_EPS15_homology,pfscan_EF_HAND_2,pfscan_EPS15_homology	p.L291	ENST00000320631.3	37	c.873	CCDS8084.1	11																																																																																			EHD1	-	NULL	ENSG00000110047		0.637	EHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHD1	HGNC	protein_coding	OTTHUMT00000143229.2	21	0.00	0	G	NM_006795		64627438	64627438	-1	no_errors	ENST00000320631	ensembl	human	known	69_37n	silent	9	30.77	4	SNP	0.995	A
EIF2AK4	440275	genome.wustl.edu	37	15	40259885	40259885	+	Missense_Mutation	SNP	T	T	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr15:40259885T>G	ENST00000263791.5	+	9	1401	c.1358T>G	c.(1357-1359)aTt>aGt	p.I453S	EIF2AK4_ENST00000382727.2_Missense_Mutation_p.I453S|EIF2AK4_ENST00000559624.1_Missense_Mutation_p.I453S	NM_001013703.2	NP_001013725.2	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha kinase 4	453	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to starvation (GO:0009267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of translation (GO:0017148)|protein phosphorylation (GO:0006468)|regulation of translational initiation (GO:0006446)|regulation of translational initiation in response to stress (GO:0043558)	cytosolic ribosome (GO:0022626)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)	40		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		CTCGCAGACATTTGCAAGGAG	0.473																																						dbGAP											0													120.0	115.0	116.0					15																	40259885		1974	4162	6136	-	-	-	SO:0001583	missense	0			AB037759	CCDS42016.1	15q13.3	2008-08-18				ENSG00000128829			19687	protein-coding gene	gene with protein product		609280				10504407	Standard	XM_005254392		Approved	GCN2, KIAA1338	uc001zkm.1	Q9P2K8		ENST00000263791.5:c.1358T>G	15.37:g.40259885T>G	ENSP00000263791:p.Ile453Ser		C9JEC4|Q69YL7|Q6DC97|Q96GN6|Q9H5K1|Q9NSQ3|Q9NSZ5|Q9UJ56	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RWD-domain,superfamily_Kinase-like_dom,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Anticodon-bd,smart_RWD-domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ser/Thr_kinase_GCN2,pfscan_RWD-domain,pfscan_Prot_kinase_cat_dom	p.I453S	ENST00000263791.5	37	c.1358	CCDS42016.1	15	.	.	.	.	.	.	.	.	.	.	T	24.1	4.498409	0.85069	.	.	ENSG00000128829	ENST00000263791;ENST00000382727	T;T	0.63096	-0.02;-0.02	5.63	5.63	0.86233	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.051455	0.85682	D	0.000000	T	0.69548	0.3123	L	0.31804	0.96	0.53005	D	0.999968	D;D	0.89917	0.996;1.0	D;D	0.68765	0.92;0.96	T	0.73382	-0.4000	10	0.87932	D	0	-16.9235	16.1412	0.81522	0.0:0.0:0.0:1.0	.	453;453	Q9P2K8;Q9P2K8-3	E2AK4_HUMAN;.	S	453	ENSP00000263791:I453S;ENSP00000372174:I453S	ENSP00000263791:I453S	I	+	2	0	EIF2AK4	38047177	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.249000	0.72427	2.265000	0.75225	0.533000	0.62120	ATT	EIF2AK4	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pirsf_Ser/Thr_kinase_GCN2,pfscan_Prot_kinase_cat_dom	ENSG00000128829		0.473	EIF2AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2AK4	HGNC	protein_coding	OTTHUMT00000418395.1	57	0.00	0	T			40259885	40259885	+1	no_errors	ENST00000263791	ensembl	human	known	69_37n	missense	38	35.59	21	SNP	1.000	G
EIF4B	1975	genome.wustl.edu	37	12	53421804	53421804	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:53421804G>A	ENST00000262056.9	+	8	1137	c.811G>A	c.(811-813)Gat>Aat	p.D271N	RP11-983P16.4_ENST00000552905.1_RNA|EIF4B_ENST00000416762.3_Missense_Mutation_p.D232N|EIF4B_ENST00000420463.3_Missense_Mutation_p.D271N	NM_001417.4	NP_001408.2	P23588	IF4B_HUMAN	eukaryotic translation initiation factor 4B	271	Arg-rich.|Asp-rich.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation initiation factor activity (GO:0003743)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)	22						TACAGGCTATGATTCCCGGAT	0.448																																						dbGAP											0													95.0	96.0	95.0					12																	53421804		1865	4111	5976	-	-	-	SO:0001583	missense	0			X55733	CCDS41788.1, CCDS73474.1	12q13.13	2013-02-12			ENSG00000063046	ENSG00000063046		"""RNA binding motif (RRM) containing"""	3285	protein-coding gene	gene with protein product		603928					Standard	XM_005268709		Approved		uc001sbh.4	P23588	OTTHUMG00000169570	ENST00000262056.9:c.811G>A	12.37:g.53421804G>A	ENSP00000262056:p.Asp271Asn		Q4G0E3|Q53HQ2|Q6GPH5|Q6IB46|Q8WYK5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.D271N	ENST00000262056.9	37	c.811	CCDS41788.1	12	.	.	.	.	.	.	.	.	.	.	G	13.67	2.307952	0.40895	.	.	ENSG00000063046	ENST00000262056;ENST00000420463;ENST00000430205;ENST00000416762;ENST00000549481;ENST00000552490	T;T;T;T	0.49720	0.79;0.77;0.77;0.83	4.48	4.48	0.54585	.	0.052392	0.64402	D	0.000001	T	0.62792	0.2457	M	0.69823	2.125	0.80722	D	1	D;D;D;D	0.64830	0.994;0.99;0.99;0.99	P;P;P;P	0.60173	0.87;0.746;0.813;0.665	T	0.60136	-0.7322	10	0.23891	T	0.37	.	16.6135	0.84900	0.0:0.0:1.0:0.0	.	232;271;247;271	B4DS13;E7EX17;E7EPC9;P23588	.;.;.;IF4B_HUMAN	N	271;271;247;232;226;225	ENSP00000262056:D271N;ENSP00000388806:D271N;ENSP00000449746:D226N;ENSP00000450324:D225N	ENSP00000262056:D271N	D	+	1	0	EIF4B	51708071	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	8.824000	0.92023	2.409000	0.81822	0.655000	0.94253	GAT	EIF4B	-	NULL	ENSG00000063046		0.448	EIF4B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	EIF4B	HGNC	protein_coding	OTTHUMT00000404852.2	67	0.00	0	G	NM_001417		53421804	53421804	+1	no_errors	ENST00000262056	ensembl	human	known	69_37n	missense	73	21.51	20	SNP	1.000	A
EMC9	51016	genome.wustl.edu	37	14	24608639	24608639	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr14:24608639G>A	ENST00000419198.2	-	4	650	c.370C>T	c.(370-372)Cag>Tag	p.Q124*	RP11-468E2.5_ENST00000558478.1_lincRNA|EMC9_ENST00000560403.1_Nonsense_Mutation_p.Q50*|EMC9_ENST00000558200.1_5'Flank|EMC9_ENST00000216799.4_Nonsense_Mutation_p.Q124*			Q9Y3B6	EMC9_HUMAN	ER membrane protein complex subunit 9	124						cytoplasm (GO:0005737)|ER membrane protein complex (GO:0072546)											ACACGAGGCTGAGGCACCAGT	0.547																																						dbGAP											0													82.0	91.0	88.0					14																	24608639		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BF346999	CCDS9613.1	14q12	2012-05-30	2012-05-30	2012-05-30	ENSG00000100908	ENSG00000100908			20273	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 122"", ""family with sequence similarity 158, member A"""	C14orf122, FAM158A		22119785	Standard	NM_016049		Approved	CGI-112	uc001wmi.3	Q9Y3B6	OTTHUMG00000028796	ENST00000419198.2:c.370C>T	14.37:g.24608639G>A	ENSP00000403210:p.Gln124*		D3DS60|Q9BUM3	Nonsense_Mutation	SNP	pfam_UPF0172	p.Q124*	ENST00000419198.2	37	c.370	CCDS9613.1	14	.	.	.	.	.	.	.	.	.	.	g	33	5.249166	0.95305	.	.	ENSG00000100908	ENST00000419198;ENST00000216799	.	.	.	5.54	4.64	0.57946	.	0.526712	0.21912	N	0.067298	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	-19.4984	10.5569	0.45123	0.0876:0.0:0.9124:0.0	.	.	.	.	X	124	.	ENSP00000216799:Q124X	Q	-	1	0	FAM158A	23678479	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.286000	0.51724	1.549000	0.49425	0.655000	0.94253	CAG	EMC9	-	pfam_UPF0172	ENSG00000100908		0.547	EMC9-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	EMC9	HGNC	protein_coding	OTTHUMT00000071917.4	24	0.00	0	G	NM_016049		24608639	24608639	-1	no_errors	ENST00000216799	ensembl	human	known	69_37n	nonsense	42	20.75	11	SNP	1.000	A
NUP188	23511	genome.wustl.edu	37	9	131711513	131711513	+	Silent	SNP	G	G	C	rs112594279		TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr9:131711513G>C	ENST00000372577.2	+	2	99	c.78G>C	c.(76-78)ctG>ctC	p.L26L	RP11-101E3.5_ENST00000482796.1_Nonstop_Mutation_p.*47S|DOLK_ENST00000372586.3_5'Flank|NUP188_ENST00000550219.1_3'UTR	NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	26					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						GGTCAGCTCTGAGAGAGCTGG	0.398																																						dbGAP											0													159.0	155.0	156.0					9																	131711513		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.78G>C	9.37:g.131711513G>C			Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Nonstop_Mutation	SNP	pfam_Nucleoporin_Nup188	p.*47S	ENST00000372577.2	37	c.140	CCDS35156.1	9	.	.	.	.	.	.	.	.	.	.	G	8.731	0.916559	0.17907	.	.	ENSG00000251184	ENST00000482796	.	.	.	5.5	1.45	0.22620	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-0.1198	2.1606	0.03824	0.2171:0.1376:0.4951:0.1502	.	.	.	.	S	47	.	.	X	+	2	2	RP11-101E3.5	130751334	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	1.728000	0.38105	0.238000	0.21222	0.467000	0.42956	TGA	RP11-101E3.5	-	NULL	ENSG00000251184		0.398	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000251184	Clone_based_vega_gene	protein_coding	OTTHUMT00000054529.2	149	0.67	1	G			131711513	131711513	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000482796	ensembl	human	putative	69_37n	nonstop	136	28.42	54	SNP	1.000	C
EPB41	2035	genome.wustl.edu	37	1	29314067	29314067	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:29314067C>G	ENST00000343067.4	+	2	245	c.118C>G	c.(118-120)Caa>Gaa	p.Q40E	EPB41_ENST00000349460.4_5'UTR|EPB41_ENST00000373798.1_Missense_Mutation_p.Q40E|EPB41_ENST00000373797.1_Missense_Mutation_p.Q40E|EPB41_ENST00000373800.3_5'UTR|EPB41_ENST00000398863.2_Missense_Mutation_p.Q40E|EPB41_ENST00000356093.2_Missense_Mutation_p.Q40E|Y_RNA_ENST00000383977.1_RNA|EPB41_ENST00000347529.3_Missense_Mutation_p.Q40E	NM_001166005.1	NP_001159477.1	P11171	41_HUMAN	erythrocyte membrane protein band 4.1	40					actin cytoskeleton organization (GO:0030036)|blood circulation (GO:0008015)|cortical actin cytoskeleton organization (GO:0030866)|positive regulation of protein binding (GO:0032092)	cortical cytoskeleton (GO:0030863)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	1-phosphatidylinositol binding (GO:0005545)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(1)	14		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		GGAATCTTGTCAAACAGCAGC	0.468																																						dbGAP											0													175.0	177.0	176.0					1																	29314067		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC039079	CCDS330.1, CCDS331.1, CCDS332.1, CCDS53288.1, CCDS53289.1	1p33-p32	2014-05-09	2014-05-09		ENSG00000159023	ENSG00000159023			3377	protein-coding gene	gene with protein product		130500	"""elliptocytosis 1, RH-linked"""	EL1			Standard	NM_001166005		Approved	4.1R	uc001brm.2	P11171	OTTHUMG00000003644	ENST00000343067.4:c.118C>G	1.37:g.29314067C>G	ENSP00000345259:p.Gln40Glu		B1ALH8|B1ALH9|D3DPM9|D3DPN0|P11176|Q14245|Q5TB35|Q5VXN8|Q8IXV9|Q9Y578|Q9Y579	Missense_Mutation	SNP	pirsf_Band_41_protein,pfam_Band_4.1_C,pfam_SAB,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,prints_Band_41_fam,prints_Ez/rad/moesin,pfscan_FERM_domain	p.Q40E	ENST00000343067.4	37	c.118	CCDS53288.1	1	.	.	.	.	.	.	.	.	.	.	C	1.695	-0.502985	0.04261	.	.	ENSG00000159023	ENST00000358989;ENST00000343067;ENST00000356093;ENST00000398863;ENST00000398861;ENST00000398865;ENST00000347529;ENST00000373798;ENST00000373797	D;D;D;T;D;D	0.83335	-1.71;-1.7;-1.53;-1.4;-1.71;-1.69	5.6	3.73	0.42828	.	1.143540	0.06541	N	0.743223	T	0.70868	0.3273	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.27498	0.034;0.005;0.012;0.18;0.041	B;B;B;B;B	0.26310	0.031;0.013;0.029;0.068;0.029	T	0.59526	-0.7438	10	0.45353	T	0.12	.	11.6314	0.51178	0.14:0.7255:0.1345:0.0	.	40;40;40;40;40	C9JTS2;P11171;P11171-2;P11171-7;P11171-5	.;41_HUMAN;.;.;.	E	57;40;40;40;40;40;40;40;40	ENSP00000345259:Q40E;ENSP00000348397:Q40E;ENSP00000381839:Q40E;ENSP00000290100:Q40E;ENSP00000362904:Q40E;ENSP00000362903:Q40E	ENSP00000345259:Q40E	Q	+	1	0	EPB41	29186654	0.028000	0.19301	0.223000	0.23860	0.048000	0.14542	1.526000	0.35964	0.723000	0.32274	-0.885000	0.02943	CAA	EPB41	-	pirsf_Band_41_protein	ENSG00000159023		0.468	EPB41-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB41	HGNC	protein_coding	OTTHUMT00000010312.1	52	0.00	0	C	NM_203342		29314067	29314067	+1	no_errors	ENST00000343067	ensembl	human	known	69_37n	missense	50	19.35	12	SNP	0.115	G
EPB41L2	2037	genome.wustl.edu	37	6	131188606	131188606	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr6:131188606G>C	ENST00000337057.3	-	16	2904	c.2723C>G	c.(2722-2724)tCt>tGt	p.S908C	EPB41L2_ENST00000525271.1_Intron|EPB41L2_ENST00000527659.1_Intron|EPB41L2_ENST00000530481.1_Missense_Mutation_p.S755C|EPB41L2_ENST00000525193.1_Intron|EPB41L2_ENST00000531410.1_Intron|EPB41L2_ENST00000445890.2_Missense_Mutation_p.S650C|EPB41L2_ENST00000368128.2_Missense_Mutation_p.S908C|EPB41L2_ENST00000528282.1_Missense_Mutation_p.S650C|EPB41L2_ENST00000524581.1_Missense_Mutation_p.S286C|EPB41L2_ENST00000529208.1_Missense_Mutation_p.S838C|EPB41L2_ENST00000527411.1_Missense_Mutation_p.S838C|EPB41L2_ENST00000392427.3_Intron|EPB41L2_ENST00000530757.1_Missense_Mutation_p.S137C	NM_001431.3	NP_001422.1	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	908	C-terminal (CTD).				cortical actin cytoskeleton organization (GO:0030866)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|spectrin (GO:0008091)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(23)|prostate(1)|skin(2)	44	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		TACCTGTGGAGACTCATATGT	0.403																																						dbGAP											0													254.0	231.0	239.0					6																	131188606		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF027299	CCDS5141.1, CCDS47474.1, CCDS56450.1, CCDS59037.1	6q23	2008-08-29			ENSG00000079819	ENSG00000079819			3379	protein-coding gene	gene with protein product		603237				9598318, 9828140	Standard	NM_001431		Approved	4.1-G	uc003qch.2	O43491	OTTHUMG00000015560	ENST00000337057.3:c.2723C>G	6.37:g.131188606G>C	ENSP00000338481:p.Ser908Cys		B4DHI8|E9PPD9|Q5T4F0|Q68DV2	Missense_Mutation	SNP	pirsf_Band_41_protein,pfam_Band_4.1_C,pfam_SAB,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,prints_Band_41_fam,prints_Ez/rad/moesin,pfscan_FERM_domain	p.S908C	ENST00000337057.3	37	c.2723	CCDS5141.1	6	.	.	.	.	.	.	.	.	.	.	G	28.3	4.908124	0.92107	.	.	ENSG00000079819	ENST00000528282;ENST00000530481;ENST00000445890;ENST00000337057;ENST00000530757;ENST00000368128;ENST00000527411;ENST00000524581;ENST00000529208;ENST00000527017	T;T;T;T;T;T;T;T;T;T	0.78707	-1.1;-1.1;-1.1;-1.1;-1.2;-1.1;-1.1;-1.1;-1.1;-1.1	6.06	6.06	0.98353	Band 4.1, C-terminal (1);	2.178250	0.02110	N	0.054763	D	0.87888	0.6291	M	0.65975	2.015	0.54753	D	0.999982	P;D;B;D;B	0.60160	0.563;0.973;0.202;0.987;0.183	P;P;B;D;B	0.66084	0.512;0.894;0.215;0.941;0.208	T	0.75752	-0.3207	10	0.87932	D	0	.	20.6208	0.99490	0.0:0.0:1.0:0.0	.	755;908;650;286;75	E9PPD9;O43491;Q68DV2;Q6R5J7;Q9UG62	.;E41L2_HUMAN;.;.;.	C	650;755;650;908;137;908;838;286;838;172	ENSP00000434308:S650C;ENSP00000434576:S755C;ENSP00000402041:S650C;ENSP00000338481:S908C;ENSP00000436349:S137C;ENSP00000357110:S908C;ENSP00000436348:S838C;ENSP00000437207:S286C;ENSP00000436641:S838C;ENSP00000432949:S172C	ENSP00000338481:S908C	S	-	2	0	EPB41L2	131230299	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.882000	0.98803	0.655000	0.94253	TCT	EPB41L2	-	pirsf_Band_41_protein,pfam_Band_4.1_C	ENSG00000079819		0.403	EPB41L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB41L2	HGNC	protein_coding	OTTHUMT00000042204.3	149	0.00	0	G			131188606	131188606	-1	no_errors	ENST00000337057	ensembl	human	known	69_37n	missense	151	24.50	49	SNP	1.000	C
ERBB2IP	55914	genome.wustl.edu	37	5	65310496	65310496	+	Splice_Site	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr5:65310496G>C	ENST00000284037.5	+	7	865		c.e7-1		ERBB2IP_ENST00000416865.2_Splice_Site|ERBB2IP_ENST00000506030.1_Splice_Site|ERBB2IP_ENST00000380938.2_Splice_Site|ERBB2IP_ENST00000380935.1_Splice_Site|ERBB2IP_ENST00000380943.2_Splice_Site|ERBB2IP_ENST00000380939.2_Splice_Site|ERBB2IP_ENST00000511297.1_Splice_Site|ERBB2IP_ENST00000380936.1_Splice_Site|ERBB2IP_ENST00000508515.1_Splice_Site	NM_001253697.1	NP_001240626.1	Q96RT1	LAP2_HUMAN	erbb2 interacting protein						basal protein localization (GO:0045175)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell growth (GO:0016049)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|signal transduction (GO:0007165)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|hemidesmosome (GO:0030056)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ErbB-2 class receptor binding (GO:0005176)|integrin binding (GO:0005178)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|skin(2)	36		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		TTGTATTGCAGATTAACTAAA	0.229																																						dbGAP											0													22.0	23.0	23.0					5																	65310496		2140	4210	6350	-	-	-	SO:0001630	splice_region_variant	0				CCDS3990.1, CCDS34172.1, CCDS58951.1, CCDS58952.1, CCDS58953.1, CCDS58954.1	5p14.3-q12.3	2008-07-18	2001-11-29		ENSG00000112851	ENSG00000112851			15842	protein-coding gene	gene with protein product	"""densin-180-like protein"", ""ERBB2-interacting protein"""	606944	"""erbb2-interacting protein"""			10574462, 10878805	Standard	NM_001253697		Approved	ERBIN, LAP2	uc011cqx.2	Q96RT1	OTTHUMG00000097808	ENST00000284037.5:c.477-1G>C	5.37:g.65310496G>C			A0AVR1|B4E3F1|B7ZLV9|E7EQW9|E9PCR8|Q1RMD0|Q86W38|Q9NR18|Q9NW48|Q9ULJ5	Splice_Site	SNP	-	e5-1	ENST00000284037.5	37	c.477-1	CCDS58953.1	5	.	.	.	.	.	.	.	.	.	.	G	22.4	4.279410	0.80692	.	.	ENSG00000112851	ENST00000284037;ENST00000380943;ENST00000416865;ENST00000380939;ENST00000380936;ENST00000380935;ENST00000380938;ENST00000511297;ENST00000506030;ENST00000508515	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6673	0.95898	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ERBB2IP	65346252	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	8.627000	0.90974	2.721000	0.93114	0.650000	0.86243	.	ERBB2IP	-	-	ENSG00000112851		0.229	ERBB2IP-002	KNOWN	basic|CCDS	protein_coding	ERBB2IP	HGNC	protein_coding	OTTHUMT00000215070.1	41	0.00	0	G	NM_018695	Intron	65310496	65310496	+1	no_errors	ENST00000284037	ensembl	human	known	69_37n	splice_site	38	20.83	10	SNP	1.000	C
ETV6	2120	genome.wustl.edu	37	12	12037418	12037418	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:12037418C>T	ENST00000396373.4	+	6	1323	c.1049C>T	c.(1048-1050)tCt>tTt	p.S350F		NM_001987.4	NP_001978.1	P41212	ETV6_HUMAN	ets variant 6	350					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		ETV6/JAK2(11)|ETV6/ITPR2(2)|ETV6/NTRK3(238)	breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(15)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				CAGTTGCTTTCTGACAGCCGG	0.458			T	"""NTRK3, RUNX1, PDGFRB, ABL1, MN1, ABL2, FACL6, CHIC2, ARNT, JAK2, EVI1, CDX2, STL, HLXB9, MDS2, PER1, SYK, TTL, FGFR3, PAX5"""	"""congenital fibrosarcoma, multiple leukemia and lymphoma,  secretory breast, MDS, ALL"""																																	dbGAP		Dom	yes		12	12p13	2120	ets variant gene 6 (TEL oncogene)		"""L, E, M"""	0													170.0	151.0	158.0					12																	12037418		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC043399	CCDS8643.1	12p13	2014-09-17	2008-09-12		ENSG00000139083	ENSG00000139083			3495	protein-coding gene	gene with protein product	"""TEL oncogene"""	600618	"""ets variant gene 6 (TEL oncogene)"""			7731705	Standard	NM_001987		Approved	TEL	uc001qzz.3	P41212	OTTHUMG00000168538	ENST00000396373.4:c.1049C>T	12.37:g.12037418C>T	ENSP00000379658:p.Ser350Phe		A3QVP6|A8K076|Q9UMF6|Q9UMF7|Q9UMG0	Missense_Mutation	SNP	pfam_Ets,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets,pfscan_Ets,prints_Ets	p.S350F	ENST00000396373.4	37	c.1049	CCDS8643.1	12	.	.	.	.	.	.	.	.	.	.	C	24.2	4.500611	0.85176	.	.	ENSG00000139083	ENST00000396373	T	0.23950	1.88	5.77	4.85	0.62838	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.000000	0.85682	D	0.000000	T	0.47746	0.1462	L	0.60455	1.87	0.80722	D	1	D	0.69078	0.997	D	0.77004	0.989	T	0.49082	-0.8976	10	0.66056	D	0.02	.	15.4519	0.75279	0.14:0.86:0.0:0.0	.	350	P41212	ETV6_HUMAN	F	350	ENSP00000379658:S350F	ENSP00000379658:S350F	S	+	2	0	ETV6	11928685	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	1.367000	0.46095	0.655000	0.94253	TCT	ETV6	-	pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	ENSG00000139083		0.458	ETV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV6	HGNC	protein_coding	OTTHUMT00000400130.2	86	0.00	0	C	NM_001987		12037418	12037418	+1	no_errors	ENST00000396373	ensembl	human	known	69_37n	missense	57	26.92	21	SNP	1.000	T
ERBB3	2065	genome.wustl.edu	37	12	56488300	56488300	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:56488300C>G	ENST00000267101.3	+	15	2259	c.1819C>G	c.(1819-1821)Cag>Gag	p.Q607E	ERBB3_ENST00000415288.2_Missense_Mutation_p.Q548E|ERBB3_ENST00000450146.2_5'UTR|ERBB3_ENST00000553131.1_5'Flank	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	607					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			CCCAGATGTTCAGAATGAATG	0.552																																						dbGAP											0													65.0	65.0	65.0					12																	56488300		2203	4300	6503	-	-	-	SO:0001583	missense	0			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.1819C>G	12.37:g.56488300C>G	ENSP00000267101:p.Gln607Glu		A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Furin-like_Cys-rich_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Q607E	ENST00000267101.3	37	c.1819	CCDS31833.1	12	.	.	.	.	.	.	.	.	.	.	C	12.74	2.028830	0.35797	.	.	ENSG00000065361	ENST00000267101;ENST00000415288	T;T	0.39787	1.06;1.06	5.36	5.36	0.76844	Growth factor, receptor (1);	0.538213	0.18181	N	0.149129	T	0.19927	0.0479	N	0.05534	-0.03	0.52501	D	0.999951	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.08638	-1.0712	10	0.05436	T	0.98	.	11.3891	0.49804	0.2799:0.7201:0.0:0.0	.	548;607	P21860-4;P21860	.;ERBB3_HUMAN	E	607;548	ENSP00000267101:Q607E;ENSP00000408340:Q548E	ENSP00000267101:Q607E	Q	+	1	0	ERBB3	54774567	0.006000	0.16342	0.991000	0.47740	0.985000	0.73830	0.886000	0.28241	2.797000	0.96272	0.561000	0.74099	CAG	ERBB3	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,superfamily_Growth_fac_rcpt,smart_Furin_repeat	ENSG00000065361		0.552	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB3	HGNC	protein_coding	OTTHUMT00000407619.3	21	0.00	0	C			56488300	56488300	+1	no_errors	ENST00000267101	ensembl	human	known	69_37n	missense	22	33.33	11	SNP	0.694	G
EXOC2	55770	genome.wustl.edu	37	6	572591	572591	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr6:572591G>A	ENST00000230449.4	-	13	1507	c.1372C>T	c.(1372-1374)Ctc>Ttc	p.L458F	EXOC2_ENST00000448181.3_Missense_Mutation_p.L53F	NM_018303.5	NP_060773.3	Q96KP1	EXOC2_HUMAN	exocyst complex component 2	458					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|liver(1)|lung(16)|ovary(4)|pancreas(1)|prostate(2)	46	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		CTCAAGACGAGTTTTGTCAAT	0.448																																						dbGAP											0													98.0	93.0	95.0					6																	572591		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ420556	CCDS34327.1	6p25.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000112685	ENSG00000112685			24968	protein-coding gene	gene with protein product		615329	"""SEC5-like 1 (S. cerevisiae)"""	SEC5L1		12575951, 12459492	Standard	NM_018303		Approved	FLJ11026, Sec5p	uc003mtd.4	Q96KP1	OTTHUMG00000137437	ENST00000230449.4:c.1372C>T	6.37:g.572591G>A	ENSP00000230449:p.Leu458Phe		B2RBE6|Q5JPC8|Q96AN6|Q9NUZ8|Q9UJM7	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,superfamily_Ig_E-set,superfamily_Cullin_repeat-like_dom	p.L458F	ENST00000230449.4	37	c.1372	CCDS34327.1	6	.	.	.	.	.	.	.	.	.	.	G	15.84	2.953104	0.53293	.	.	ENSG00000112685	ENST00000230449;ENST00000448181	T	0.51071	0.72	4.69	4.69	0.59074	.	0.067956	0.64402	D	0.000020	T	0.33818	0.0876	L	0.54323	1.7	0.54753	D	0.999982	P	0.50272	0.933	P	0.48030	0.564	T	0.11767	-1.0574	10	0.12766	T	0.61	-16.9133	13.7149	0.62691	0.0:0.1545:0.8455:0.0	.	458	Q96KP1	EXOC2_HUMAN	F	458;53	ENSP00000230449:L458F	ENSP00000230449:L458F	L	-	1	0	EXOC2	517591	1.000000	0.71417	1.000000	0.80357	0.783000	0.44284	5.318000	0.65829	2.302000	0.77476	0.563000	0.77884	CTC	EXOC2	-	NULL	ENSG00000112685		0.448	EXOC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC2	HGNC	protein_coding	OTTHUMT00000039627.1	62	0.00	0	G	NM_018303		572591	572591	-1	no_errors	ENST00000230449	ensembl	human	known	69_37n	missense	17	41.38	12	SNP	1.000	A
FADS1	3992	genome.wustl.edu	37	11	61580763	61580763	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr11:61580763C>T	ENST00000350997.7	-	2	670	c.438G>A	c.(436-438)ctG>ctA	p.L146L	FADS2_ENST00000257261.6_5'Flank|FADS2_ENST00000574708.1_Intron|FADS1_ENST00000542506.1_Silent_p.L5L|FADS1_ENST00000433932.1_Silent_p.L5L|FADS1_ENST00000541683.1_5'Flank|MIR1908_ENST00000410394.1_RNA	NM_013402.4	NP_037534.3	O60427	FADS1_HUMAN	fatty acid desaturase 1	89					alpha-linolenic acid metabolic process (GO:0036109)|cell-cell signaling (GO:0007267)|cellular lipid metabolic process (GO:0044255)|cellular response to starvation (GO:0009267)|icosanoid biosynthetic process (GO:0046456)|linoleic acid metabolic process (GO:0043651)|phospholipid biosynthetic process (GO:0008654)|regulation of cell differentiation (GO:0045595)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	C-5 sterol desaturase activity (GO:0000248)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)			central_nervous_system(1)|endometrium(1)|lung(1)|urinary_tract(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	GTTCTCCAATCAGGAGAGAGT	0.507																																						dbGAP											0													147.0	154.0	152.0					11																	61580763		2062	4209	6271	-	-	-	SO:0001819	synonymous_variant	0				CCDS8011.2	11q12-q13.1	2013-01-25			ENSG00000149485	ENSG00000149485	1.14.19.3	"""Fatty acid desaturases"""	3574	protein-coding gene	gene with protein product	"""delta-5 desaturase"""	606148		LLCDL1			Standard	NM_013402		Approved	D5D, FADSD5, TU12, FADS6	uc010rlm.2	O60427	OTTHUMG00000157155	ENST00000350997.7:c.438G>A	11.37:g.61580763C>T			A8K0I7|B2RAI0|Q53GM5|Q8N3A6|Q8NCC7|Q8NCG0|Q96I39|Q96SV3|Q96T10|Q9NRP8|Q9NYX1	Missense_Mutation	SNP	pfam_Cyt_B5,superfamily_Cyt_B5,pfscan_Cyt_B5,prints_Cyt_B5	p.D94N	ENST00000350997.7	37	c.280	CCDS8011.2	11																																																																																			FADS1	-	pfam_Cyt_B5,superfamily_Cyt_B5,pfscan_Cyt_B5,prints_Cyt_B5	ENSG00000149485		0.507	FADS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FADS1	HGNC	protein_coding	OTTHUMT00000347648.2	53	0.00	0	C	NM_013402		61580763	61580763	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000424501	ensembl	human	known	69_37n	missense	38	24.00	12	SNP	1.000	T
FAHD2A	51011	genome.wustl.edu	37	2	96071539	96071539	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:96071539C>T	ENST00000233379.4	+	2	386	c.233C>T	c.(232-234)tCa>tTa	p.S78L	FAHD2A_ENST00000447036.1_Missense_Mutation_p.S78L	NM_016044.2	NP_057128.2	Q96GK7	FAH2A_HUMAN	fumarylacetoacetate hydrolase domain containing 2A	78							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(3)|ovary(1)	8						GCCACCCTCTCAGTGGCAAGA	0.597																																						dbGAP											0													42.0	33.0	36.0					2																	96071539		2201	4296	6497	-	-	-	SO:0001583	missense	0			AF151863	CCDS2014.1	2q11.2	2008-02-05			ENSG00000115042	ENSG00000115042			24252	protein-coding gene	gene with protein product							Standard	NM_016044		Approved	CGI-105	uc002sur.3	Q96GK7	OTTHUMG00000130397	ENST00000233379.4:c.233C>T	2.37:g.96071539C>T	ENSP00000233379:p.Ser78Leu		Q9Y3B0	Missense_Mutation	SNP	pfam_Fumarylacetoacetase_C,superfamily_Fumarylacetoacetase_C-rel	p.S78L	ENST00000233379.4	37	c.233	CCDS2014.1	2	.	.	.	.	.	.	.	.	.	.	C	10.70	1.423994	0.25639	.	.	ENSG00000115042	ENST00000445649;ENST00000447036;ENST00000233379;ENST00000418606	T;T	0.31510	1.49;1.49	2.88	2.88	0.33553	.	0.461373	0.21915	N	0.067260	T	0.24624	0.0597	L	0.54323	1.7	0.09310	N	1	P	0.35481	0.504	B	0.33521	0.165	T	0.09907	-1.0653	10	0.33141	T	0.24	.	7.2483	0.26135	0.2639:0.7361:0.0:0.0	.	78	Q96GK7	FAH2A_HUMAN	L	78	ENSP00000406424:S78L;ENSP00000233379:S78L	ENSP00000233379:S78L	S	+	2	0	FAHD2A	95435266	0.020000	0.18652	0.295000	0.24960	0.584000	0.36387	1.820000	0.39032	1.602000	0.50124	0.561000	0.74099	TCA	FAHD2A	-	NULL	ENSG00000115042		0.597	FAHD2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAHD2A	HGNC	protein_coding	OTTHUMT00000252778.1	79	0.00	0	C	NM_016044		96071539	96071539	+1	no_errors	ENST00000233379	ensembl	human	known	69_37n	missense	48	22.58	14	SNP	0.048	T
FAM155B	27112	genome.wustl.edu	37	X	68725797	68725797	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chrX:68725797G>A	ENST00000252338.4	+	1	714	c.672G>A	c.(670-672)ctG>ctA	p.L224L	AL158069.1_ENST00000579664.1_RNA	NM_015686.2	NP_056501.2	O75949	F155B_HUMAN	family with sequence similarity 155, member B	224						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)	16						TGGACACCCTGATGGGGGACC	0.657																																						dbGAP											0													30.0	30.0	30.0					X																	68725797		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF087142	CCDS35317.1	Xq13.1	2008-04-15	2008-04-15	2008-04-15	ENSG00000130054	ENSG00000130054			30701	protein-coding gene	gene with protein product			"""transmembrane protein 28"", ""chromosome X open reading frame 63"""	TMEM28, CXorf63			Standard	NM_015686		Approved	TED	uc004dxk.3	O75949	OTTHUMG00000021756	ENST00000252338.4:c.672G>A	X.37:g.68725797G>A			B1ALV6|B9EGK1|D3DVU1	Silent	SNP	NULL	p.L224	ENST00000252338.4	37	c.672	CCDS35317.1	X																																																																																			FAM155B	-	NULL	ENSG00000130054		0.657	FAM155B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM155B	HGNC	protein_coding	OTTHUMT00000057037.1	22	0.00	0	G	NM_015686		68725797	68725797	+1	no_errors	ENST00000252338	ensembl	human	known	69_37n	silent	20	25.93	7	SNP	1.000	A
FAM127B	26071	genome.wustl.edu	37	X	134185808	134185808	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chrX:134185808C>T	ENST00000370775.2	-	1	397	c.331G>A	c.(331-333)Gag>Aag	p.E111K	FAM127B_ENST00000520964.1_Intron	NM_001078172.1	NP_001071640.1	Q9BWD3	F127B_HUMAN	family with sequence similarity 127, member B	111										breast(3)|endometrium(2)|large_intestine(3)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(192;0.000127)					TAGAAGTCCTCGTCCTCCTCC	0.647																																						dbGAP											0													39.0	41.0	40.0					X																	134185808		2199	4285	6484	-	-	-	SO:0001583	missense	0			AL117556	CCDS43998.1	Xq26.3	2014-05-16			ENSG00000203950	ENSG00000203950			24514	protein-coding gene	gene with protein product						9403077, 15716091	Standard	NM_001078172		Approved	DKFZP564B147, MAR8A, CXX1b	uc004eyf.3	Q9BWD3	OTTHUMG00000022466	ENST00000370775.2:c.331G>A	X.37:g.134185808C>T	ENSP00000375267:p.Glu111Lys		A2A2V9|Q8TBU2	Missense_Mutation	SNP	NULL	p.E111K	ENST00000370775.2	37	c.331	CCDS43998.1	X	.	.	.	.	.	.	.	.	.	.	c	8.412	0.844321	0.16963	.	.	ENSG00000203950	ENST00000370775	T	0.26067	1.76	2.38	1.51	0.23008	.	0.234686	0.20606	U	0.089075	T	0.13457	0.0326	L	0.27053	0.805	0.26518	N	0.974478	B	0.15719	0.014	B	0.09377	0.004	T	0.19745	-1.0296	9	.	.	.	.	4.7206	0.12917	0.0:0.8089:0.0:0.1911	.	111	Q9BWD3	F127B_HUMAN	K	111	ENSP00000375267:E111K	.	E	-	1	0	FAM127B	134013474	1.000000	0.71417	0.998000	0.56505	0.075000	0.17131	0.762000	0.26503	0.432000	0.26286	-0.713000	0.03633	GAG	FAM127B	-	NULL	ENSG00000203950		0.647	FAM127B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM127B	HGNC	protein_coding	OTTHUMT00000058393.2	47	0.00	0	C	NM_001078172		134185808	134185808	-1	no_errors	ENST00000370775	ensembl	human	known	69_37n	missense	29	29.27	12	SNP	0.998	T
FAM186A	121006	genome.wustl.edu	37	12	50757012	50757012	+	Missense_Mutation	SNP	G	G	C	rs192896948	byFrequency	TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:50757012G>C	ENST00000327337.5	-	2	327	c.328C>G	c.(328-330)Ctt>Gtt	p.L110V	FAM186A_ENST00000543111.1_Missense_Mutation_p.L110V	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	110																	ATTTTCTCAAGAAAATTGGTT	0.383																																					NSCLC(138;1796 1887 12511 19463 37884)	dbGAP											0													204.0	175.0	184.0					12																	50757012		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.328C>G	12.37:g.50757012G>C	ENSP00000329995:p.Leu110Val			Missense_Mutation	SNP	NULL	p.L110V	ENST00000327337.5	37	c.328	CCDS44878.1	12	.	.	.	.	.	.	.	.	.	.	G	12.71	2.019369	0.35606	.	.	ENSG00000185958	ENST00000543111;ENST00000327337	T;T	0.27104	1.69;1.69	4.12	-3.01	0.05463	.	.	.	.	.	T	0.26882	0.0658	L	0.52011	1.625	0.09310	N	1	P	0.52061	0.95	P	0.51385	0.668	T	0.20874	-1.0262	9	0.87932	D	0	.	3.8667	0.09019	0.3254:0.0:0.3971:0.2775	.	110	A6NE01	F186A_HUMAN	V	110	ENSP00000441337:L110V;ENSP00000329995:L110V	ENSP00000329995:L110V	L	-	1	0	FAM186A	49043279	0.015000	0.18098	0.005000	0.12908	0.003000	0.03518	-0.079000	0.11357	-0.247000	0.09597	-0.389000	0.06534	CTT	FAM186A	-	NULL	ENSG00000185958		0.383	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM186A	HGNC	protein_coding	OTTHUMT00000396838.1	102	0.00	0	G	XM_001718353		50757012	50757012	-1	no_errors	ENST00000327337	ensembl	human	known	69_37n	missense	111	18.98	26	SNP	0.001	C
FAM214A	56204	genome.wustl.edu	37	15	52901535	52901535	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr15:52901535C>T	ENST00000261844.7	-	6	1728	c.1576G>A	c.(1576-1578)Gaa>Aaa	p.E526K	FAM214A_ENST00000546305.2_Missense_Mutation_p.E533K	NM_019600.2	NP_062546.2	Q32MH5	F214A_HUMAN	family with sequence similarity 214, member A	526																	TTTTTGTCTTCATATGAACTC	0.398																																						dbGAP											0													92.0	88.0	90.0					15																	52901535		1845	4107	5952	-	-	-	SO:0001583	missense	0			AB037791	CCDS45263.1, CCDS66773.1	15q21.2-q21.3	2011-12-01	2011-12-01	2011-12-01	ENSG00000047346	ENSG00000047346			25609	protein-coding gene	gene with protein product			"""KIAA1370"""	KIAA1370		10718198	Standard	XM_005254547		Approved	FLJ10980	uc002acg.4	Q32MH5		ENST00000261844.7:c.1576G>A	15.37:g.52901535C>T	ENSP00000261844:p.Glu526Lys		A8KA52|B4DEP5|B4DF40|F5H8G0|Q32MH6|Q4G0R7|Q5XJ16|Q6PDA3|Q9NV24|Q9P2H7	Missense_Mutation	SNP	NULL	p.E526K	ENST00000261844.7	37	c.1576	CCDS45263.1	15	.	.	.	.	.	.	.	.	.	.	C	20.4	3.992649	0.74703	.	.	ENSG00000047346	ENST00000261844;ENST00000399202;ENST00000534964;ENST00000546305	T;T	0.35605	1.3;1.3	6.17	5.25	0.73442	.	0.545292	0.22228	N	0.062852	T	0.40372	0.1114	L	0.39245	1.2	0.43678	D	0.996116	P;P	0.47545	0.897;0.835	P;B	0.47346	0.544;0.343	T	0.16867	-1.0388	10	0.41790	T	0.15	.	17.8576	0.88771	0.0:0.8786:0.1214:0.0	.	533;526	F5H8G0;Q32MH5	.;K1370_HUMAN	K	526;526;525;533	ENSP00000261844:E526K;ENSP00000443598:E533K	ENSP00000261844:E526K	E	-	1	0	KIAA1370	50688827	1.000000	0.71417	0.978000	0.43139	0.999000	0.98932	2.517000	0.45529	1.601000	0.50113	0.655000	0.94253	GAA	FAM214A	-	NULL	ENSG00000047346		0.398	FAM214A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM214A	HGNC	protein_coding	OTTHUMT00000419914.1	22	0.00	0	C	NM_019600		52901535	52901535	-1	no_errors	ENST00000261844	ensembl	human	known	69_37n	missense	19	32.14	9	SNP	1.000	T
FAM53C	51307	genome.wustl.edu	37	5	137681206	137681206	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr5:137681206G>A	ENST00000239906.5	+	4	1257	c.829G>A	c.(829-831)Gat>Aat	p.D277N	RP11-256P1.1_ENST00000504539.1_RNA|FAM53C_ENST00000434981.2_Missense_Mutation_p.D277N|FAM53C_ENST00000513056.1_Silent_p.V86V	NM_016605.2	NP_057689.1	Q9NYF3	FA53C_HUMAN	family with sequence similarity 53, member C	277										breast(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			ACAGCCTTGTGATCTGGATGC	0.642																																						dbGAP											0													49.0	58.0	55.0					5																	137681206		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF251040	CCDS4204.1	5q31	2008-02-05	2004-11-24	2004-11-26	ENSG00000120709	ENSG00000120709			1336	protein-coding gene	gene with protein product		609372	"""chromosome 5 open reading frame 6"""	C5orf6		11087669, 11161817	Standard	NM_001135647		Approved		uc003lcv.3	Q9NYF3	OTTHUMG00000129201	ENST00000239906.5:c.829G>A	5.37:g.137681206G>A	ENSP00000239906:p.Asp277Asn		B2RDJ5|D3DQB9	Missense_Mutation	SNP	NULL	p.D277N	ENST00000239906.5	37	c.829	CCDS4204.1	5	.	.	.	.	.	.	.	.	.	.	G	20.2	3.943643	0.73672	.	.	ENSG00000120709	ENST00000434981;ENST00000239906	T;T	0.44482	0.92;0.92	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.58850	0.2151	L	0.50333	1.59	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.45011	-0.9290	10	0.21540	T	0.41	-6.0331	18.4386	0.90656	0.0:0.0:1.0:0.0	.	277	Q9NYF3	FA53C_HUMAN	N	277	ENSP00000403705:D277N;ENSP00000239906:D277N	ENSP00000239906:D277N	D	+	1	0	FAM53C	137709105	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.117000	0.94347	2.894000	0.99253	0.655000	0.94253	GAT	FAM53C	-	NULL	ENSG00000120709		0.642	FAM53C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM53C	HGNC	protein_coding	OTTHUMT00000251278.2	16	0.00	0	G	NM_016605		137681206	137681206	+1	no_errors	ENST00000239906	ensembl	human	known	69_37n	missense	19	34.48	10	SNP	1.000	A
FAM71A	149647	genome.wustl.edu	37	1	212798754	212798754	+	Nonsense_Mutation	SNP	G	G	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:212798754G>T	ENST00000294829.3	+	1	966	c.535G>T	c.(535-537)Gag>Tag	p.E179*	RP11-338C15.5_ENST00000427949.1_RNA	NM_153606.3	NP_705834.2	Q8IYT1	FA71A_HUMAN	family with sequence similarity 71, member A	179						nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(12)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)		GCCACCCATGGAGAGTAACAG	0.512																																						dbGAP											0													107.0	112.0	110.0					1																	212798754		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS1507.1	1q32.3	2008-02-05			ENSG00000162771	ENSG00000162771			26541	protein-coding gene	gene with protein product						12477932	Standard	NM_153606		Approved	FLJ32796	uc010pth.1	Q8IYT1	OTTHUMG00000041084	ENST00000294829.3:c.535G>T	1.37:g.212798754G>T	ENSP00000294829:p.Glu179*		Q5VTZ1	Nonsense_Mutation	SNP	pfam_DUF3699	p.E179*	ENST00000294829.3	37	c.535	CCDS1507.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.161239	0.97338	.	.	ENSG00000162771	ENST00000294829	.	.	.	4.54	4.54	0.55810	.	0.349704	0.24158	N	0.041015	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-22.7756	13.0262	0.58817	0.0:0.0:1.0:0.0	.	.	.	.	X	179	.	ENSP00000294829:E179X	E	+	1	0	FAM71A	210865377	0.941000	0.31946	0.853000	0.33588	0.193000	0.23685	4.326000	0.59241	2.526000	0.85167	0.563000	0.77884	GAG	FAM71A	-	pfam_DUF3699	ENSG00000162771		0.512	FAM71A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM71A	HGNC	protein_coding	OTTHUMT00000098529.1	16	0.00	0	G	NM_153606		212798754	212798754	+1	no_errors	ENST00000294829	ensembl	human	known	69_37n	nonsense	21	22.22	6	SNP	0.693	T
FBXW7	55294	genome.wustl.edu	37	4	153251995	153251995	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr4:153251995C>T	ENST00000281708.4	-	7	2240	c.1011G>A	c.(1009-1011)aaG>aaA	p.K337K	FBXW7_ENST00000296555.5_Silent_p.K219K|FBXW7_ENST00000263981.5_Silent_p.K257K|FBXW7_ENST00000393956.3_Silent_p.K161K|FBXW7_ENST00000603841.1_Silent_p.K337K|FBXW7_ENST00000603548.1_Silent_p.K337K	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	337					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				CTTTTCTTCTCTTGATGTGCA	0.358			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																	dbGAP		Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)											244.0	215.0	225.0					4																	153251995		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1011G>A	4.37:g.153251995C>T			B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Silent	SNP	pfam_WD40_repeat,pfam_F-box_dom_cyclin-like,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.K337	ENST00000281708.4	37	c.1011	CCDS3777.1	4																																																																																			FBXW7	-	superfamily_F-box_dom_cyclin-like	ENSG00000109670		0.358	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW7	HGNC	protein_coding	OTTHUMT00000469956.1	145	0.00	0	C			153251995	153251995	-1	no_errors	ENST00000281708	ensembl	human	known	69_37n	silent	166	24.89	55	SNP	1.000	T
FCGBP	8857	genome.wustl.edu	37	19	40433086	40433086	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr19:40433086C>T	ENST00000221347.6	-	2	1190	c.1183G>A	c.(1183-1185)Gaa>Aaa	p.E395K		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	395	IgGFc-binding.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			AGCTCCACTTCAGCATACGAG	0.612																																						dbGAP											0													120.0	93.0	102.0					19																	40433086		2203	4300	6503	-	-	-	SO:0001583	missense	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.1183G>A	19.37:g.40433086C>T	ENSP00000221347:p.Glu395Lys		O95784	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_VWF_C,smart_VWC_out	p.E395K	ENST00000221347.6	37	c.1183	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	C	13.72	2.321961	0.41096	.	.	ENSG00000090920	ENST00000221347	T	0.18657	2.2	4.36	4.36	0.52297	.	0.239972	0.26715	U	0.022864	T	0.31734	0.0806	L	0.52573	1.65	0.25282	N	0.989423	D	0.67145	0.996	P	0.60609	0.877	T	0.06162	-1.0842	10	0.25106	T	0.35	.	10.3718	0.44058	0.0:0.9071:0.0:0.0929	.	395	Q9Y6R7	FCGBP_HUMAN	K	395	ENSP00000221347:E395K	ENSP00000221347:E395K	E	-	1	0	FCGBP	45124926	0.000000	0.05858	0.962000	0.40283	0.150000	0.21749	0.210000	0.17455	2.715000	0.92844	0.655000	0.94253	GAA	FCGBP	-	NULL	ENSG00000090920		0.612	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	63	0.00	0	C	NM_003890		40433086	40433086	-1	no_errors	ENST00000221347	ensembl	human	known	69_37n	missense	42	25.00	14	SNP	0.971	T
FCRLB	127943	genome.wustl.edu	37	1	161695787	161695787	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:161695787G>A	ENST00000367948.2	+	6	699	c.484G>A	c.(484-486)Gac>Aac	p.D162N	FCRLB_ENST00000495397.1_3'UTR|FCRLB_ENST00000367946.3_Missense_Mutation_p.D162N|FCRLB_ENST00000367944.3_Missense_Mutation_p.D155N|FCRLB_ENST00000392158.1_Missense_Mutation_p.D162N|FCRLB_ENST00000367945.1_Missense_Mutation_p.D155N|FCRLB_ENST00000336830.5_Missense_Mutation_p.D162N			Q6BAA4	FCRLB_HUMAN	Fc receptor-like B	162	Ig-like C2-type 2.				negative regulation of immune response (GO:0050777)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|skin(1)	17	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)			GCGTGCCAGCGACAGCGGGCG	0.627											OREG0013944	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													39.0	38.0	38.0					1																	161695787		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY670683	CCDS30927.1, CCDS72962.1, CCDS72963.1, CCDS72964.1, CCDS72965.1	1q23.3	2013-01-11	2006-09-26	2006-09-26	ENSG00000162746	ENSG00000162746		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26431	protein-coding gene	gene with protein product		609251	"""Fc receptor-like and mucin-like 2"""	FCRLM2		15676285	Standard	NM_001288829		Approved	FLJ31052, FCRL2, FREB-2, FCRLY	uc001gbi.3	Q6BAA4	OTTHUMG00000133629	ENST00000367948.2:c.484G>A	1.37:g.161695787G>A	ENSP00000356925:p.Asp162Asn	1818	A2A3J5|A2A3J7|Q5VXA6|Q6BAA0|Q6BAA1|Q6BAA2|Q6BAA3|Q8IXZ7	Missense_Mutation	SNP	smart_Ig_sub,pfscan_Ig-like	p.D162N	ENST00000367948.2	37	c.484	CCDS30927.1	1	.	.	.	.	.	.	.	.	.	.	G	16.86	3.239777	0.58995	.	.	ENSG00000162746	ENST00000367948;ENST00000367946;ENST00000367945;ENST00000336830;ENST00000367944;ENST00000392158	T;T;T;T;T;T	0.01145	5.27;5.27;5.27;5.27;5.27;5.27	4.51	3.52	0.40303	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.460620	0.19095	N	0.122846	T	0.01156	0.0038	L	0.38175	1.15	0.32164	N	0.58257	D;D;D;D;D	0.76494	0.991;0.999;0.993;0.988;0.999	B;P;P;P;D	0.69654	0.43;0.849;0.704;0.464;0.965	T	0.62520	-0.6837	10	0.17369	T	0.5	.	9.6234	0.39734	0.0:0.2137:0.7863:0.0	.	155;155;162;162;162	Q6BAA4-3;Q6BAA4-5;Q6BAA4-2;Q6BAA4-4;Q6BAA4	.;.;.;.;FCRLB_HUMAN	N	162;162;155;162;155;162	ENSP00000356925:D162N;ENSP00000356923:D162N;ENSP00000356922:D155N;ENSP00000338598:D162N;ENSP00000356921:D155N;ENSP00000375999:D162N	ENSP00000338598:D162N	D	+	1	0	FCRLB	159962411	1.000000	0.71417	0.998000	0.56505	0.235000	0.25334	2.906000	0.48735	2.038000	0.60285	0.455000	0.32223	GAC	FCRLB	-	smart_Ig_sub	ENSG00000162746		0.627	FCRLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCRLB	HGNC	protein_coding	OTTHUMT00000083585.1	37	0.00	0	G	NM_152378		161695787	161695787	+1	no_errors	ENST00000367948	ensembl	human	known	69_37n	missense	48	12.73	7	SNP	0.997	A
FES	2242	genome.wustl.edu	37	15	91432751	91432751	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr15:91432751G>A	ENST00000328850.3	+	7	953	c.811G>A	c.(811-813)Gca>Aca	p.A271T	FES_ENST00000444422.2_Missense_Mutation_p.A271T|FES_ENST00000450438.2_Missense_Mutation_p.A213T|FES_ENST00000394300.3_Missense_Mutation_p.A213T|FES_ENST00000414248.2_Missense_Mutation_p.A213T|FES_ENST00000394302.1_Missense_Mutation_p.A213T	NM_002005.3	NP_001996.1	P07332	FES_HUMAN	FES proto-oncogene, tyrosine kinase	271	Important for interaction with membranes containing phosphoinositides.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of neuron projection development (GO:0010976)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of mast cell degranulation (GO:0043304)|regulation of vesicle-mediated transport (GO:0060627)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule cytoskeleton (GO:0015630)	ATP binding (GO:0005524)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol binding (GO:0035091)|protein tyrosine kinase activity (GO:0004713)			lung(2)|ovary(1)	3	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			CCACAGGTCCGCACCTGACGT	0.647																																						dbGAP											0													101.0	96.0	98.0					15																	91432751		2198	4298	6496	-	-	-	SO:0001583	missense	0			X52192	CCDS10365.1, CCDS45349.1, CCDS45350.1, CCDS45351.1	15q26.1	2014-06-26	2014-06-26		ENSG00000182511	ENSG00000182511	2.7.10.1	"""SH2 domain containing"""	3657	protein-coding gene	gene with protein product	"""Oncogene FES, feline sarcoma virus"", ""c-fes/fps protein"""	190030	"""feline sarcoma (Snyder-Theilen) viral (v-fes)/Fujinami avian sarcoma (PRCII) viral (v-fps) oncogene homolog"", ""feline sarcoma oncogene"""			1870997	Standard	NM_002005		Approved	FPS	uc002bpv.3	P07332	OTTHUMG00000044456	ENST00000328850.3:c.811G>A	15.37:g.91432751G>A	ENSP00000331504:p.Ala271Thr		B2R6E6|B4DUD0|E9PC94|E9PC95|Q2VXS7|Q2VXS8|Q2VXT0|Q6GTU5	Missense_Mutation	SNP	pirsf_Tyr_kinase_non-rcpt_Fes_subgr,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_FCH,superfamily_Kinase-like_dom,superfamily_t-SNARE,smart_FCH,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,pfscan_FCH,pfscan_SH2,pfscan_Prot_kinase_cat_dom	p.A271T	ENST00000328850.3	37	c.811	CCDS10365.1	15	.	.	.	.	.	.	.	.	.	.	G	2.032	-0.422137	0.04734	.	.	ENSG00000182511	ENST00000328850;ENST00000414248;ENST00000394302;ENST00000444422;ENST00000394300;ENST00000450438	T;T;T;T;T;T	0.14144	2.53;2.53;2.53;2.53;2.53;2.53	4.97	-6.64	0.01801	.	1.123240	0.06452	N	0.727959	T	0.04318	0.0119	N	0.10874	0.06	0.09310	N	1	B;B;B;B;B;B	0.13594	0.0;0.0;0.002;0.0;0.008;0.0	B;B;B;B;B;B	0.08055	0.0;0.0;0.001;0.001;0.003;0.0	T	0.41662	-0.9496	10	0.02654	T	1	-0.3516	4.5881	0.12294	0.2389:0.076:0.577:0.1082	.	253;213;213;213;271;271	B4DUD9;P07332-2;E7ENM8;P07332-3;P07332-4;P07332	.;.;.;.;.;FES_HUMAN	T	271;213;213;271;213;213	ENSP00000331504:A271T;ENSP00000414629:A213T;ENSP00000377839:A213T;ENSP00000400868:A271T;ENSP00000377837:A213T;ENSP00000409915:A213T	ENSP00000331504:A271T	A	+	1	0	FES	89233755	0.000000	0.05858	0.000000	0.03702	0.546000	0.35178	-1.449000	0.02392	-0.705000	0.05035	0.456000	0.33151	GCA	FES	-	pirsf_Tyr_kinase_non-rcpt_Fes_subgr	ENSG00000182511		0.647	FES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FES	HGNC	protein_coding	OTTHUMT00000313497.1	21	0.00	0	G	NM_002005		91432751	91432751	+1	no_errors	ENST00000328850	ensembl	human	known	69_37n	missense	16	27.27	6	SNP	0.000	A
FLG2	388698	genome.wustl.edu	37	1	152324572	152324572	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:152324572G>A	ENST00000388718.5	-	3	5762	c.5690C>T	c.(5689-5691)tCa>tTa	p.S1897L	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1897					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTGTGTCCTGAATGTGTATG	0.507																																						dbGAP											0													378.0	334.0	349.0					1																	152324572		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.5690C>T	1.37:g.152324572G>A	ENSP00000373370:p.Ser1897Leu		Q9H4U1	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.S1897L	ENST00000388718.5	37	c.5690	CCDS30861.1	1	.	.	.	.	.	.	.	.	.	.	G	16.31	3.087598	0.55968	.	.	ENSG00000143520	ENST00000388718	T	0.06528	3.29	4.26	3.31	0.37934	.	.	.	.	.	T	0.04907	0.0132	L	0.58101	1.795	0.09310	N	1	D	0.54964	0.969	P	0.50231	0.635	T	0.34502	-0.9826	9	0.30078	T	0.28	.	10.1578	0.42833	0.0:0.2032:0.7968:0.0	.	1897	Q5D862	FILA2_HUMAN	L	1897	ENSP00000373370:S1897L	ENSP00000373370:S1897L	S	-	2	0	FLG2	150591196	0.051000	0.20477	0.002000	0.10522	0.059000	0.15707	2.965000	0.49200	1.133000	0.42147	0.549000	0.68633	TCA	FLG2	-	NULL	ENSG00000143520		0.507	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	HGNC	protein_coding	OTTHUMT00000034018.5	231	0.43	1	G	NM_001014342		152324572	152324572	-1	no_errors	ENST00000388718	ensembl	human	known	69_37n	missense	280	18.60	64	SNP	0.010	A
FNDC1	84624	genome.wustl.edu	37	6	159654134	159654134	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr6:159654134C>T	ENST00000297267.9	+	11	2790	c.2590C>T	c.(2590-2592)Cac>Tac	p.H864Y	FNDC1_ENST00000340366.6_Missense_Mutation_p.H801Y	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	864					cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		GGTTCCCTCTCACTCTGATTC	0.617																																						dbGAP											0													25.0	32.0	30.0					6																	159654134		1979	4148	6127	-	-	-	SO:0001583	missense	0			AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.2590C>T	6.37:g.159654134C>T	ENSP00000297267:p.His864Tyr		A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.H864Y	ENST00000297267.9	37	c.2590	CCDS47512.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.29|13.29	2.191895|2.191895	0.38707|0.38707	.|.	.|.	ENSG00000164694|ENSG00000164694	ENST00000297267;ENST00000340366|ENST00000329629	T;T|T	0.07688|0.05513	3.17;4.01|3.43	4.42|4.42	4.42|4.42	0.53409|0.53409	.|.	1.158660|.	0.06155|.	N|.	0.674963|.	T|T	0.03695|0.03695	0.0105|0.0105	L|L	0.27053|0.27053	0.805|0.805	0.09310|0.09310	N|N	1|1	P;P|.	0.46912|.	0.886;0.666|.	B;B|.	0.44044|.	0.439;0.099|.	T|T	0.39522|0.39522	-0.9610|-0.9610	10|7	0.41790|0.49607	T|T	0.15|0.09	-2.0628|-2.0628	14.0378|14.0378	0.64656|0.64656	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	801;864|.	Q4ZHG4-2;Q4ZHG4|.	.;FNDC1_HUMAN|.	Y|L	864;801|759	ENSP00000297267:H864Y;ENSP00000342460:H801Y|ENSP00000333297:S759L	ENSP00000297267:H864Y|ENSP00000333297:S759L	H|S	+|+	1|2	0|0	FNDC1|FNDC1	159574124|159574124	0.032000|0.032000	0.19561|0.19561	0.002000|0.002000	0.10522|0.10522	0.018000|0.018000	0.09664|0.09664	2.725000|2.725000	0.47294|0.47294	2.305000|2.305000	0.77605|0.77605	0.655000|0.655000	0.94253|0.94253	CAC|TCA	FNDC1	-	NULL	ENSG00000164694		0.617	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNDC1	HGNC	protein_coding	OTTHUMT00000042897.3	32	0.00	0	C	NM_032532		159654134	159654134	+1	no_errors	ENST00000297267	ensembl	human	known	69_37n	missense	21	19.23	5	SNP	0.024	T
FRAS1	80144	genome.wustl.edu	37	4	79366729	79366729	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr4:79366729C>G	ENST00000325942.6	+	42	6159	c.5719C>G	c.(5719-5721)Caa>Gaa	p.Q1907E	FRAS1_ENST00000264895.6_Missense_Mutation_p.Q1907E	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	1907					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						ATTTCCTATTCAAGACGTCCT	0.398																																						dbGAP											0													136.0	135.0	135.0					4																	79366729		1906	4127	6033	-	-	-	SO:0001583	missense	0			AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.5719C>G	4.37:g.79366729C>G	ENSP00000326330:p.Gln1907Glu		A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Nonsense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.S135*	ENST00000325942.6	37	c.404	CCDS54772.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.979|7.979	0.750841|0.750841	0.15778|0.15778	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000325942;ENST00000264895|ENST00000510944;ENST00000512123	T;T|.	0.28454|.	1.61;1.61|.	5.96|5.96	5.96|5.96	0.96718|0.96718	.|.	0.117488|.	0.56097|.	D|.	0.000021|.	T|.	0.70527|.	0.3234|.	L|L	0.47190|0.47190	1.495|1.495	0.80722|0.80722	D|D	1|1	B;B|.	0.30021|.	0.265;0.072|.	B;B|.	0.25987|.	0.065;0.061|.	T|.	0.64262|.	-0.6449|.	10|.	0.23891|.	T|.	0.37|.	.|.	20.394|20.394	0.98981|0.98981	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1907;1907|.	E9PHH6;A2RRR8|.	.;.|.	E|X	1907|356;135	ENSP00000326330:Q1907E;ENSP00000264895:Q1907E|.	ENSP00000264895:Q1907E|.	Q|S	+|+	1|2	0|0	FRAS1|FRAS1	79585753|79585753	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.048000|0.048000	0.14542|0.14542	3.399000|3.399000	0.52586|0.52586	2.830000|2.830000	0.97506|0.97506	0.585000|0.585000	0.79938|0.79938	CAA|TCA	FRAS1	-	NULL	ENSG00000138759		0.398	FRAS1-001	NOVEL	basic|CCDS	protein_coding	FRAS1	HGNC	protein_coding	OTTHUMT00000362706.2	76	0.00	0	C			79366729	79366729	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000512123	ensembl	human	novel	69_37n	nonsense	50	19.35	12	SNP	1.000	G
FREM1	158326	genome.wustl.edu	37	9	14857618	14857618	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr9:14857618G>A	ENST00000380880.3	-	5	1544	c.761C>T	c.(760-762)tCa>tTa	p.S254L	FREM1_ENST00000380881.4_Missense_Mutation_p.S254L|FREM1_ENST00000422223.2_Missense_Mutation_p.S254L			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	254					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		AATGTTGGGTGAAGGGGGATC	0.493																																						dbGAP											0													185.0	179.0	181.0					9																	14857618		1911	4128	6039	-	-	-	SO:0001583	missense	0			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.761C>T	9.37:g.14857618G>A	ENSP00000370262:p.Ser254Leu		B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Calx_beta,superfamily_C-type_lectin_fold,superfamily_Cadherin-like,smart_C-type_lectin,pfscan_C-type_lectin	p.S254L	ENST00000380880.3	37	c.761	CCDS47952.1	9	.	.	.	.	.	.	.	.	.	.	G	27.3	4.821930	0.90873	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.25250	1.81;1.83;1.83	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.62024	0.2394	M	0.89601	3.045	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.67968	-0.5533	10	0.87932	D	0	-16.0714	20.3539	0.98825	0.0:0.0:1.0:0.0	.	254	Q5H8C1	FREM1_HUMAN	L	254	ENSP00000370263:S254L;ENSP00000412940:S254L;ENSP00000370262:S254L	ENSP00000370257:S254L	S	-	2	0	FREM1	14847618	1.000000	0.71417	1.000000	0.80357	0.588000	0.36517	9.230000	0.95299	2.826000	0.97356	0.655000	0.94253	TCA	FREM1	-	NULL	ENSG00000164946		0.493	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FREM1	HGNC	protein_coding	OTTHUMT00000339474.2	83	0.00	0	G	NM_144966		14857618	14857618	-1	no_errors	ENST00000380881	ensembl	human	known	69_37n	missense	71	13.41	11	SNP	1.000	A
FSTL4	23105	genome.wustl.edu	37	5	132535173	132535173	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr5:132535173C>G	ENST00000265342.7	-	16	2392	c.2143G>C	c.(2143-2145)Gag>Cag	p.E715Q	CTB-49A3.2_ENST00000509051.1_RNA	NM_015082.1	NP_055897.1	Q6MZW2	FSTL4_HUMAN	follistatin-like 4	715						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(8)|skin(2)|upper_aerodigestive_tract(1)	23		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ACTGTGATCTCCTGCACGTGC	0.582																																						dbGAP											0													68.0	67.0	67.0					5																	132535173		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028984	CCDS34238.1	5q31.1	2013-01-29			ENSG00000053108	ENSG00000053108		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21389	protein-coding gene	gene with protein product						10470851, 15527507	Standard	NM_015082		Approved	KIAA1061	uc003kyn.1	Q6MZW2	OTTHUMG00000162729	ENST00000265342.7:c.2143G>C	5.37:g.132535173C>G	ENSP00000265342:p.Glu715Gln		Q8TBU0|Q9UPU1	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,smart_Prot_inh_Kazal,smart_Ig_sub,smart_Ig_sub2,pfscan_EF_HAND_2,pfscan_Ig-like	p.E715Q	ENST00000265342.7	37	c.2143	CCDS34238.1	5	.	.	.	.	.	.	.	.	.	.	C	9.244	1.039047	0.19669	.	.	ENSG00000053108	ENST00000265342;ENST00000360575	T	0.28895	1.59	4.64	2.83	0.33086	WD40/YVTN repeat-like-containing domain (1);	0.127819	0.51477	D	0.000087	T	0.30572	0.0769	L	0.52011	1.625	0.24451	N	0.994481	B;P	0.49253	0.363;0.921	B;P	0.49192	0.086;0.602	T	0.07271	-1.0781	10	0.25106	T	0.35	-23.3399	7.1536	0.25624	0.0:0.6469:0.0:0.3531	.	715;364	Q6MZW2;B3KPF3	FSTL4_HUMAN;.	Q	715;546	ENSP00000265342:E715Q	ENSP00000265342:E715Q	E	-	1	0	FSTL4	132563072	1.000000	0.71417	1.000000	0.80357	0.681000	0.39784	1.807000	0.38902	0.945000	0.37605	0.573000	0.79308	GAG	FSTL4	-	NULL	ENSG00000053108		0.582	FSTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSTL4	HGNC	protein_coding	OTTHUMT00000370212.1	49	0.00	0	C	XM_048786		132535173	132535173	-1	no_errors	ENST00000265342	ensembl	human	known	69_37n	missense	45	22.41	13	SNP	0.907	G
FUZ	80199	genome.wustl.edu	37	19	50311871	50311871	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr19:50311871C>T	ENST00000313777.4	-	9	1081	c.918G>A	c.(916-918)ctG>ctA	p.L306L	AC006942.4_ENST00000600669.1_RNA|FUZ_ENST00000445575.2_Silent_p.L306L|FUZ_ENST00000534008.1_5'Flank|FUZ_ENST00000528094.1_Silent_p.L270L|FUZ_ENST00000533418.1_Silent_p.L256L	NM_025129.4	NP_079405.2	Q9BT04	FUZZY_HUMAN	fuzzy planar cell polarity protein	306	Leu-rich.				cilium assembly (GO:0042384)|embryonic body morphogenesis (GO:0010172)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of planar polarity (GO:0001736)|hair follicle development (GO:0001942)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000314)|negative regulation of neural crest formation (GO:0090301)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|positive regulation of cilium assembly (GO:0045724)|protein transport (GO:0015031)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)				endometrium(1)|lung(3)	4		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00793)|GBM - Glioblastoma multiforme(134;0.0116)		GGCAGCGCTTCAGTTCCAGGT	0.657																																						dbGAP											0													50.0	45.0	46.0					19																	50311871		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0			BC016793	CCDS12781.1, CCDS54293.1	19q13.33	2013-03-05	2013-03-05			ENSG00000010361			26219	protein-coding gene	gene with protein product		610622	"""fuzzy homolog (Drosophila)"""			21761479	Standard	NM_001171937		Approved	FLJ22688, Fy	uc002ppq.2	Q9BT04		ENST00000313777.4:c.918G>A	19.37:g.50311871C>T			B2RD86|B5MDH0|Q6PJY0|Q9H613	Silent	SNP	NULL	p.L306	ENST00000313777.4	37	c.918	CCDS12781.1	19																																																																																			FUZ	-	NULL	ENSG00000010361		0.657	FUZ-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FUZ	HGNC	protein_coding	OTTHUMT00000393986.1	44	0.00	0	C	NM_025129		50311871	50311871	-1	no_errors	ENST00000313777	ensembl	human	known	69_37n	silent	68	20.00	17	SNP	0.985	T
GAK	2580	genome.wustl.edu	37	4	870398	870398	+	Splice_Site	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr4:870398C>T	ENST00000314167.4	-	18	2085		c.e18-1		GAK_ENST00000511163.1_Splice_Site	NM_005255.2	NP_005246.2	O14976	GAK_HUMAN	cyclin G associated kinase						cell cycle (GO:0007049)|cell development (GO:0048468)|clathrin coat disassembly (GO:0072318)|clathrin-mediated endocytosis (GO:0072583)|endoplasmic reticulum organization (GO:0007029)|epidermal cell differentiation (GO:0009913)|establishment of skin barrier (GO:0061436)|forebrain morphogenesis (GO:0048853)|Golgi organization (GO:0007030)|intrahepatic bile duct development (GO:0035622)|positive regulation of neural precursor cell proliferation (GO:2000179)	cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(16)|skin(7)|urinary_tract(2)	39				Colorectal(103;0.219)		TGGATGCCATCTGCAAAGAGA	0.537																																						dbGAP											0													149.0	124.0	132.0					4																	870398		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			D88435	CCDS3340.1	4p16	2011-09-07			ENSG00000178950	ENSG00000178950		"""Heat shock proteins / DNAJ (HSP40)"""	4113	protein-coding gene	gene with protein product	"""auxilin-2"""	602052				9299234	Standard	NM_005255		Approved	DNAJC26	uc003gbm.4	O14976	OTTHUMG00000088301	ENST00000314167.4:c.1975-1G>A	4.37:g.870398C>T			Q5U4P5|Q9BVY6	Splice_Site	SNP	-	e18-1	ENST00000314167.4	37	c.1975-1	CCDS3340.1	4	.	.	.	.	.	.	.	.	.	.	C	24.6	4.549096	0.86127	.	.	ENSG00000178950	ENST00000314167;ENST00000511163	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3463	0.83134	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GAK	860398	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	7.553000	0.82203	2.446000	0.82766	0.561000	0.74099	.	GAK	-	-	ENSG00000178950		0.537	GAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAK	HGNC	protein_coding	OTTHUMT00000239188.1	51	0.00	0	C	NM_005255	Intron	870398	870398	-1	no_errors	ENST00000314167	ensembl	human	known	69_37n	splice_site	22	26.67	8	SNP	1.000	T
PAXBP1	94104	genome.wustl.edu	37	21	34133468	34133468	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr21:34133468C>G	ENST00000331923.4	-	5	1066	c.877G>C	c.(877-879)Gag>Cag	p.E293Q	PAXBP1_ENST00000472588.1_5'UTR|PAXBP1_ENST00000290178.4_Missense_Mutation_p.E293Q	NM_016631.3	NP_057715.2	Q9Y5B6	PAXB1_HUMAN	PAX3 and PAX7 binding protein 1	293					muscle organ development (GO:0007517)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of satellite cell proliferation (GO:0014842)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TCACTCCCCTCAATTCCTACA	0.428																																						dbGAP											0													214.0	218.0	217.0					21																	34133468		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF231920	CCDS13619.1, CCDS33541.1	21q22.11	2014-01-23	2013-01-08	2013-01-08	ENSG00000159086	ENSG00000159086			13579	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 105"", ""GC-rich sequence DNA-binding factor candidate"""		"""chromosome 21 open reading frame 66"", ""GC-rich sequence DNA-binding factor 1"""	C21orf66, GCFC1		11707072, 22862948	Standard	NM_016631		Approved	GCFC, fSAP105	uc002yqn.3	Q9Y5B6	OTTHUMG00000064980	ENST00000331923.4:c.877G>C	21.37:g.34133468C>G	ENSP00000328992:p.Glu293Gln		D3DSE7|Q96DU8|Q9NYQ0	Missense_Mutation	SNP	pfam_GCFC_dom	p.E293Q	ENST00000331923.4	37	c.877	CCDS13619.1	21	.	.	.	.	.	.	.	.	.	.	C	31	5.083276	0.94050	.	.	ENSG00000159086	ENST00000331923;ENST00000290178	T;T	0.36157	1.7;1.27	6.08	6.08	0.98989	.	0.098334	0.64402	D	0.000001	T	0.58047	0.2095	L	0.60455	1.87	0.80722	D	1	D;D	0.89917	1.0;0.985	D;P	0.85130	0.997;0.71	T	0.40213	-0.9575	10	0.22706	T	0.39	-25.3999	20.2672	0.98462	0.0:1.0:0.0:0.0	.	293;293	Q9Y5B6-2;Q9Y5B6	.;GCFC1_HUMAN	Q	293	ENSP00000328992:E293Q;ENSP00000290178:E293Q	ENSP00000290178:E293Q	E	-	1	0	GCFC1	33055339	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	7.372000	0.79612	2.894000	0.99253	0.591000	0.81541	GAG	GCFC1	-	NULL	ENSG00000159086		0.428	PAXBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCFC1	HGNC	protein_coding	OTTHUMT00000139563.1	86	0.00	0	C	NM_013329		34133468	34133468	-1	no_errors	ENST00000331923	ensembl	human	known	69_37n	missense	74	29.52	31	SNP	1.000	G
GNA12	2768	genome.wustl.edu	37	7	2770892	2770892	+	Missense_Mutation	SNP	C	C	T	rs200756903		TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr7:2770892C>T	ENST00000275364.3	-	4	1231	c.1069G>A	c.(1069-1071)Gag>Aag	p.E357K	GNA12_ENST00000396960.3_Missense_Mutation_p.E209K|GNA12_ENST00000407653.1_Missense_Mutation_p.E281K|GNA12_ENST00000407904.3_Missense_Mutation_p.E298K|AMZ1_ENST00000489665.1_Intron|GNA12_ENST00000544127.1_Missense_Mutation_p.E264K|GNA12_ENST00000491117.1_5'UTR	NM_007353.2	NP_031379.2	Q03113	GNA12_HUMAN	guanine nucleotide binding protein (G protein) alpha 12	357					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|embryonic digit morphogenesis (GO:0042733)|G-protein coupled receptor signaling pathway (GO:0007186)|in utero embryonic development (GO:0001701)|platelet activation (GO:0030168)|regulation of cell shape (GO:0008360)|regulation of fibroblast migration (GO:0010762)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of TOR signaling (GO:0032006)|response to drug (GO:0042493)|Rho protein signal transduction (GO:0007266)	brush border membrane (GO:0031526)|focal adhesion (GO:0005925)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	D5 dopamine receptor binding (GO:0031752)|G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			endometrium(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.02e-13)		CGGACGTTCTCGGTGTCGATG	0.592																																						dbGAP											0													134.0	133.0	134.0					7																	2770892		2203	4300	6503	-	-	-	SO:0001583	missense	0			L01694	CCDS5335.1, CCDS64584.1, CCDS64583.1	7p22.3	2006-07-08			ENSG00000146535	ENSG00000146535			4380	protein-coding gene	gene with protein product		604394				8423800, 16247467	Standard	NM_007353		Approved	gep	uc003smu.3	Q03113	OTTHUMG00000023064	ENST00000275364.3:c.1069G>A	7.37:g.2770892C>T	ENSP00000275364:p.Glu357Lys		A4D204|B3KXS2|B7Z3F7|Q2T9L1|Q5PPR5|Q86UM8|Q8TD71|Q9UDU9	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha12	p.E357K	ENST00000275364.3	37	c.1069	CCDS5335.1	7	.	.	.	.	.	.	.	.	.	.	C	25.6	4.653618	0.88056	.	.	ENSG00000146535	ENST00000275364;ENST00000407904;ENST00000407653;ENST00000396960;ENST00000544127	D;D;D;D;D	0.88509	-2.39;-2.39;-2.39;-2.39;-2.39	5.93	5.06	0.68205	.	0.150059	0.64402	D	0.000015	D	0.90988	0.7166	L	0.54908	1.71	0.80722	D	1	P;D;B	0.76494	0.563;0.999;0.409	B;D;B	0.71184	0.119;0.972;0.084	D	0.88020	0.2768	10	0.05351	T	0.99	.	15.0977	0.72247	0.0:0.9326:0.0:0.0674	.	357;357;298	Q5PPR5;Q03113;B3KXS2	.;GNA12_HUMAN;.	K	357;298;281;209;264	ENSP00000275364:E357K;ENSP00000385935:E298K;ENSP00000386054:E281K;ENSP00000380160:E209K;ENSP00000437469:E264K	ENSP00000275364:E357K	E	-	1	0	GNA12	2737418	1.000000	0.71417	0.973000	0.42090	0.714000	0.41099	7.693000	0.84214	1.537000	0.49254	-0.136000	0.14681	GAG	GNA12	-	pfam_Gprotein_alpha_su,smart_Gprotein_alpha_su	ENSG00000146535		0.592	GNA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNA12	HGNC	protein_coding	OTTHUMT00000241608.1	57	0.00	0	C	NM_007353		2770892	2770892	-1	no_errors	ENST00000275364	ensembl	human	known	69_37n	missense	38	15.56	7	SNP	1.000	T
GNAS	2778	genome.wustl.edu	37	20	57485827	57485827	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr20:57485827C>G	ENST00000371085.3	+	13	1552	c.1128C>G	c.(1126-1128)ttC>ttG	p.F376L	GNAS_ENST00000371095.3_Missense_Mutation_p.F362L|GNAS_ENST00000265620.7_Missense_Mutation_p.F361L|GNAS_ENST00000371075.3_3'UTR|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000306090.10_Missense_Mutation_p.F362L|GNAS_ENST00000371100.4_Missense_Mutation_p.F1019L|GNAS_ENST00000354359.7_Missense_Mutation_p.F377L|GNAS_ENST00000371102.4_Missense_Mutation_p.F1005L|GNAS_ENST00000313949.7_3'UTR	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus	376					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GCCGTGTGTTCAACGACTGCC	0.517			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)	dbGAP		Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	0													165.0	112.0	130.0					20																	57485827		2203	4300	6503	-	-	-	SO:0001583	missense	0			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371085.3:c.1128C>G	20.37:g.57485827C>G	ENSP00000360126:p.Phe376Leu		A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_S,prints_Gprotein_alpha_su	p.F377L	ENST00000371085.3	37	c.1131	CCDS13472.1	20	.	.	.	.	.	.	.	.	.	.	C	25.5	4.643892	0.87859	.	.	ENSG00000087460	ENST00000371100;ENST00000371102;ENST00000371095;ENST00000371085;ENST00000354359;ENST00000265620;ENST00000306090;ENST00000371082	D;D;D;D;D;D;D	0.89050	-2.46;-2.46;-2.46;-2.46;-2.46;-2.46;-2.46	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	D	0.93739	0.7999	M	0.77406	2.37	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;0.999	D	0.94030	0.7300	10	0.87932	D	0	.	12.3991	0.55402	0.0:0.9219:0.0:0.0781	.	376;377;361;1019	P63092;A6NI00;P63092-3;Q5JWF2	GNAS2_HUMAN;.;.;GNAS1_HUMAN	L	1019;1005;362;376;377;361;362;142	ENSP00000360141:F1019L;ENSP00000360143:F1005L;ENSP00000360136:F362L;ENSP00000360126:F376L;ENSP00000346328:F377L;ENSP00000265620:F361L;ENSP00000304472:F362L	ENSP00000265620:F361L	F	+	3	2	GNAS	56919222	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.717000	0.54911	2.567000	0.86603	0.467000	0.42956	TTC	GNAS	-	pfam_Gprotein_alpha_su,smart_Gprotein_alpha_su	ENSG00000087460		0.517	GNAS-015	KNOWN	basic|CCDS	protein_coding	GNAS	HGNC	protein_coding	OTTHUMT00000080431.2	55	0.00	0	C	NM_000516		57485827	57485827	+1	no_errors	ENST00000354359	ensembl	human	known	69_37n	missense	81	10.99	10	SNP	1.000	G
GON4L	54856	genome.wustl.edu	37	1	155733331	155733331	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:155733331G>A	ENST00000368331.1	-	22	4546	c.4498C>T	c.(4498-4500)Ctg>Ttg	p.L1500L	GON4L_ENST00000437809.1_Silent_p.L1500L|GON4L_ENST00000271883.5_Silent_p.L1500L|GON4L_ENST00000471341.1_5'Flank	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1500	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TCAGATGCCAGCCAAGTCAGT	0.448																																						dbGAP											0													40.0	37.0	38.0					1																	155733331		1677	3718	5395	-	-	-	SO:0001819	synonymous_variant	0			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.4498C>T	1.37:g.155733331G>A			B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Silent	SNP	pfam_PAH,superfamily_PAH,superfamily_Homeodomain-like,pfscan_Myb-like_dom	p.L1500	ENST00000368331.1	37	c.4498		1																																																																																			GON4L	-	NULL	ENSG00000116580		0.448	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	GON4L	HGNC	protein_coding		138	0.00	0	G	NM_032292		155733331	155733331	-1	no_errors	ENST00000368331	ensembl	human	known	69_37n	silent	212	11.25	27	SNP	1.000	A
GPR116	221395	genome.wustl.edu	37	6	46847672	46847672	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr6:46847672C>G	ENST00000283296.7	-	9	1207	c.919G>C	c.(919-921)Gaa>Caa	p.E307Q	GPR116_ENST00000456426.2_Intron|GPR116_ENST00000265417.7_Missense_Mutation_p.E307Q|GPR116_ENST00000362015.4_Missense_Mutation_p.E307Q	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	307	Ig-like 1.				energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			TGCTGTTCTTCATAGCGCCAA	0.443																																					NSCLC(59;410 1274 8751 36715 50546)	dbGAP											0													210.0	176.0	187.0					6																	46847672		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.919G>C	6.37:g.46847672C>G	ENSP00000283296:p.Glu307Gln		O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_SEA,pfam_GPS_dom,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,pfscan_Ig-like,prints_GPCR_2_Ig-hepta_rcpt,prints_GPCR_2_secretin-like	p.E307Q	ENST00000283296.7	37	c.919	CCDS4919.1	6	.	.	.	.	.	.	.	.	.	.	C	3.854	-0.031302	0.07543	.	.	ENSG00000069122	ENST00000452370;ENST00000283296;ENST00000362015;ENST00000265417	T;T;T	0.63744	-0.06;-0.06;-0.06	5.86	-0.855	0.10700	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.259420	0.05617	N	0.579163	T	0.14830	0.0358	N	0.12182	0.205	0.09310	N	1	B;B	0.18741	0.03;0.03	B;B	0.22152	0.038;0.038	T	0.08785	-1.0705	10	0.12766	T	0.61	1.4385	1.9633	0.03390	0.1992:0.4277:0.2203:0.1528	.	307;307	A8K0D8;Q8IZF2	.;GP116_HUMAN	Q	307	ENSP00000283296:E307Q;ENSP00000354563:E307Q;ENSP00000265417:E307Q	ENSP00000265417:E307Q	E	-	1	0	GPR116	46955631	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.034000	0.12225	0.096000	0.17463	-0.948000	0.02665	GAA	GPR116	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000069122		0.443	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR116	HGNC	protein_coding	OTTHUMT00000040806.2	98	0.00	0	C	NM_015234		46847672	46847672	-1	no_errors	ENST00000265417	ensembl	human	known	69_37n	missense	83	18.63	19	SNP	0.000	G
GPR179	440435	genome.wustl.edu	37	17	36482953	36482953	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr17:36482953C>T	ENST00000342292.4	-	11	6519	c.6499G>A	c.(6499-6501)Gaa>Aaa	p.E2167K	GPR179_ENST00000584976.1_Intron	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	2167					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				GAGAAGTGTTCTTCCGTCCCT	0.597																																						dbGAP											0													114.0	116.0	116.0					17																	36482953		2100	4224	6324	-	-	-	SO:0001583	missense	0				CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.6499G>A	17.37:g.36482953C>T	ENSP00000345060:p.Glu2167Lys			Missense_Mutation	SNP	pfam_GPCR_3_C,superfamily_Growth_fac_rcpt,pfscan_GPCR_3_C	p.E2167K	ENST00000342292.4	37	c.6499	CCDS42308.1	17	.	.	.	.	.	.	.	.	.	.	C	12.49	1.955037	0.34471	.	.	ENSG00000188888	ENST00000342292	T	0.50277	0.75	4.55	2.48	0.30137	.	0.000000	0.35838	N	0.002950	T	0.35451	0.0932	L	0.55481	1.735	0.09310	N	1	B	0.26318	0.146	B	0.24974	0.057	T	0.19353	-1.0308	10	0.31617	T	0.26	-3.9221	3.3839	0.07264	0.2054:0.5779:0.0:0.2166	.	2167	Q6PRD1	GP179_HUMAN	K	2167	ENSP00000345060:E2167K	ENSP00000345060:E2167K	E	-	1	0	GPR179	33736479	0.008000	0.16893	0.002000	0.10522	0.004000	0.04260	0.666000	0.25097	0.480000	0.27534	0.460000	0.39030	GAA	GPR179	-	NULL	ENSG00000188888		0.597	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR179	HGNC	protein_coding	OTTHUMT00000255329.2	76	0.00	0	C			36482953	36482953	-1	no_errors	ENST00000342292	ensembl	human	known	69_37n	missense	36	33.33	18	SNP	0.001	T
GRIA3	2892	genome.wustl.edu	37	X	122598762	122598762	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chrX:122598762C>T	ENST00000371251.1	+	13	2175	c.2123C>T	c.(2122-2124)tCa>tTa	p.S708L	GRIA3_ENST00000371256.5_Missense_Mutation_p.S708L|GRIA3_ENST00000542149.1_Missense_Mutation_p.S708L|GRIA3_ENST00000264357.5_Missense_Mutation_p.S708L|AL356213.1_ENST00000577653.1_RNA			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3	708					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)			breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	TACATGAAATCAGCGGAGCCA	0.468																																						dbGAP											0													80.0	75.0	77.0					X																	122598762		2203	4300	6503	-	-	-	SO:0001583	missense	0			U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.2123C>T	X.37:g.122598762C>T	ENSP00000360297:p.Ser708Leu		D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.S708L	ENST00000371251.1	37	c.2123	CCDS14604.1	X	.	.	.	.	.	.	.	.	.	.	C	16.46	3.128370	0.56721	.	.	ENSG00000125675	ENST00000264357;ENST00000542149;ENST00000371256;ENST00000371251	T;T;T;T	0.37235	1.21;1.21;1.21;1.21	5.12	5.12	0.69794	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.53061	0.1773	L	0.45285	1.41	0.80722	D	1	D;D	0.64830	0.994;0.992	D;D	0.75020	0.985;0.974	T	0.56402	-0.7985	10	0.87932	D	0	.	16.5308	0.84357	0.0:1.0:0.0:0.0	.	708;708	P42263;P42263-2	GRIA3_HUMAN;.	L	708	ENSP00000264357:S708L;ENSP00000446146:S708L;ENSP00000360302:S708L;ENSP00000360297:S708L	ENSP00000264357:S708L	S	+	2	0	GRIA3	122426443	1.000000	0.71417	0.997000	0.53966	0.971000	0.66376	5.916000	0.69981	2.104000	0.64026	0.415000	0.27848	TCA	GRIA3	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000125675		0.468	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA3	HGNC	protein_coding	OTTHUMT00000058854.1	28	0.00	0	C	NM_000828		122598762	122598762	+1	no_errors	ENST00000264357	ensembl	human	known	69_37n	missense	31	18.42	7	SNP	1.000	T
GSX2	170825	genome.wustl.edu	37	4	54966574	54966574	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr4:54966574G>A	ENST00000326902.2	+	1	377	c.63G>A	c.(61-63)tcG>tcA	p.S21S	GSX2_ENST00000503800.1_Silent_p.S21S|FIP1L1_ENST00000507166.1_Intron	NM_133267.2	NP_573574.1	Q9BZM3	GSX2_HUMAN	GS homeobox 2	21					forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain morphogenesis (GO:0048853)|hindbrain morphogenesis (GO:0021575)|neuron fate specification (GO:0048665)|olfactory bulb interneuron differentiation (GO:0021889)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of cell migration (GO:0030334)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of transcription, DNA-templated (GO:0006355)|spinal cord association neuron differentiation (GO:0021527)|subpallium neuron fate commitment (GO:0060163)|telencephalon regionalization (GO:0021978)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(2)|lung(2)	6	all_cancers(7;0.00671)|Lung NSC(11;0.0154)|all_neural(26;0.0209)|Glioma(25;0.08)|all_epithelial(27;0.147)		LUSC - Lung squamous cell carcinoma(32;0.00216)			CTGCGCCCTCGCTGCCTGAAC	0.667																																						dbGAP											0													48.0	39.0	42.0					4																	54966574		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3494.1	4q12	2012-03-09			ENSG00000180613	ENSG00000180613		"""Homeoboxes / ANTP class : HOXL subclass"""	24959	protein-coding gene	gene with protein product						11861295, 12205114	Standard	NM_133267		Approved	Gsh2	uc010igp.1	Q9BZM3	OTTHUMG00000128696	ENST00000326902.2:c.63G>A	4.37:g.54966574G>A				Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.S21	ENST00000326902.2	37	c.63	CCDS3494.1	4																																																																																			GSX2	-	NULL	ENSG00000180613		0.667	GSX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSX2	HGNC	protein_coding	OTTHUMT00000250595.1	24	0.00	0	G	NM_133267		54966574	54966574	+1	no_errors	ENST00000326902	ensembl	human	known	69_37n	silent	18	33.33	9	SNP	1.000	A
HDDC3	374659	genome.wustl.edu	37	15	91475126	91475126	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr15:91475126C>T	ENST00000394272.3	-	3	245	c.217G>A	c.(217-219)Gag>Aag	p.E73K	UNC45A_ENST00000394275.2_Intron|AC068831.3_ENST00000438890.1_RNA|HDDC3_ENST00000559898.1_Missense_Mutation_p.E73K|AC068831.3_ENST00000448987.1_RNA|HDDC3_ENST00000330334.3_Missense_Mutation_p.E73K			Q8N4P3	MESH1_HUMAN	HD domain containing 3	73	HD.						guanosine-3',5'-bis(diphosphate) 3'-diphosphatase activity (GO:0008893)|metal ion binding (GO:0046872)			NS(1)|ovary(1)	2	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			AGCTCCACCTCATCCAGGGTG	0.597											OREG0023475	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													82.0	76.0	78.0					15																	91475126		2198	4298	6496	-	-	-	SO:0001583	missense	0			AK057584	CCDS10366.1, CCDS66866.1	15q26.1	2005-08-22			ENSG00000184508	ENSG00000184508			30522	protein-coding gene	gene with protein product						12477932	Standard	NM_001286451		Approved	MGC45386	uc002bqe.4	Q8N4P3	OTTHUMG00000141260	ENST00000394272.3:c.217G>A	15.37:g.91475126C>T	ENSP00000377814:p.Glu73Lys	1282		Missense_Mutation	SNP	pfam_HD_domain,smart_HD/PDEase_dom	p.E73K	ENST00000394272.3	37	c.217		15	.	.	.	.	.	.	.	.	.	.	C	36	5.673776	0.96764	.	.	ENSG00000184508	ENST00000394272;ENST00000330334	.	.	.	4.97	4.97	0.65823	Metal-dependent phosphohydrolase, HD domain (1);Metal-dependent phosphohydrolase, HD subdomain (1);	0.048961	0.85682	D	0.000000	D	0.85186	0.5639	M	0.91612	3.225	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.72075	0.976;0.969	D	0.88180	0.2870	9	0.62326	D	0.03	-4.0646	17.0399	0.86486	0.0:1.0:0.0:0.0	.	73;73	Q8N4P3;Q8N4P3-2	MESH1_HUMAN;.	K	73	.	ENSP00000330721:E73K	E	-	1	0	HDDC3	89276130	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	6.963000	0.76055	2.585000	0.87301	0.555000	0.69702	GAG	HDDC3	-	pfam_HD_domain,smart_HD/PDEase_dom	ENSG00000184508		0.597	HDDC3-002	KNOWN	basic|appris_principal	protein_coding	HDDC3	HGNC	protein_coding	OTTHUMT00000280403.2	54	0.00	0	C	NM_198527		91475126	91475126	-1	no_errors	ENST00000394272	ensembl	human	known	69_37n	missense	50	20.63	13	SNP	1.000	T
HEATR6	63897	genome.wustl.edu	37	17	58156108	58156108	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr17:58156108G>A	ENST00000184956.6	-	1	184	c.168C>T	c.(166-168)ttC>ttT	p.F56F	HEATR6_ENST00000585976.1_Silent_p.F56F|CTD-2319I12.2_ENST00000589740.1_lincRNA|HEATR6_ENST00000585712.1_5'UTR	NM_022070.4	NP_071353.4	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6	56							poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	44	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			TGAGCTGATCGAAGAGCAGGT	0.706																																						dbGAP											0													20.0	16.0	17.0					17																	58156108		2192	4288	6480	-	-	-	SO:0001819	synonymous_variant	0			BX640819	CCDS11623.1	17q23.2	2007-05-01				ENSG00000068097			24076	protein-coding gene	gene with protein product	"""amplified in breast cancer 1"""					12755490	Standard	NM_022070		Approved	ABC1, FLJ22087	uc002iyk.1	Q6AI08		ENST00000184956.6:c.168C>T	17.37:g.58156108G>A			B3KXP3|Q6MZX1|Q6MZY2|Q8TDM9|Q9H6B3|Q9H6M7	Nonsense_Mutation	SNP	superfamily_ARM-type_fold	p.R56*	ENST00000184956.6	37	c.166	CCDS11623.1	17																																																																																			HEATR6	-	superfamily_ARM-type_fold	ENSG00000068097		0.706	HEATR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR6	HGNC	protein_coding	OTTHUMT00000449165.1	8	0.00	0	G	NM_022070		58156108	58156108	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000593228	ensembl	human	novel	69_37n	nonsense	3	62.50	5	SNP	0.999	A
MROH2B	133558	genome.wustl.edu	37	5	41057220	41057220	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr5:41057220G>C	ENST00000399564.4	-	9	1360	c.910C>G	c.(910-912)Ctc>Gtc	p.L304V	MROH2B_ENST00000506092.2_Intron	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	304																	CCTAGAATGAGAAAACAGCTT	0.418																																						dbGAP											0													75.0	69.0	71.0					5																	41057220		1848	4111	5959	-	-	-	SO:0001583	missense	0				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.910C>G	5.37:g.41057220G>C	ENSP00000382476:p.Leu304Val		Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.L304V	ENST00000399564.4	37	c.910	CCDS47202.1	5	.	.	.	.	.	.	.	.	.	.	G	13.03	2.115095	0.37339	.	.	ENSG00000171495	ENST00000296803;ENST00000399564	T	0.07688	3.17	5.09	4.2	0.49525	Armadillo-type fold (1);	0.258314	0.27946	N	0.017215	T	0.18882	0.0453	L	0.45581	1.43	0.29837	N	0.829531	D	0.67145	0.996	D	0.80764	0.994	T	0.02385	-1.1167	10	0.27785	T	0.31	.	10.8949	0.47017	0.0:0.0:0.8125:0.1875	.	304	Q7Z745	HTRB2_HUMAN	V	8;304	ENSP00000382476:L304V	ENSP00000296803:L8V	L	-	1	0	HEATR7B2	41092977	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	4.116000	0.57871	1.470000	0.48102	0.555000	0.69702	CTC	HEATR7B2	-	superfamily_ARM-type_fold	ENSG00000171495		0.418	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR7B2	HGNC	protein_coding	OTTHUMT00000367558.2	64	0.00	0	G	NM_173489		41057220	41057220	-1	no_errors	ENST00000399564	ensembl	human	known	69_37n	missense	40	21.57	11	SNP	1.000	C
MROH7	374977	genome.wustl.edu	37	1	55166888	55166888	+	Nonsense_Mutation	SNP	G	G	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:55166888G>T	ENST00000421030.2	+	19	3463	c.3178G>T	c.(3178-3180)Gaa>Taa	p.E1060*	MROH7_ENST00000409996.1_Nonsense_Mutation_p.E628*|MROH7_ENST00000454855.2_Nonsense_Mutation_p.E578*|MROH7-TTC4_ENST00000414150.2_Nonsense_Mutation_p.E1060*	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	1060						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											GCTGGTGGTGGAAGCGGTCCA	0.597																																						dbGAP											0													81.0	87.0	85.0					1																	55166888		2112	4235	6347	-	-	-	SO:0001587	stop_gained	0			AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.3178G>T	1.37:g.55166888G>T	ENSP00000396622:p.Glu1060*		A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Nonsense_Mutation	SNP	superfamily_ARM-type_fold	p.E1060*	ENST00000421030.2	37	c.3178	CCDS41342.2	1	.	.	.	.	.	.	.	.	.	.	G	40	8.190540	0.98699	.	.	ENSG00000184313	ENST00000421030;ENST00000414867;ENST00000409996;ENST00000454855;ENST00000371287	.	.	.	4.88	4.88	0.63580	.	0.114753	0.38837	N	0.001546	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-20.5151	13.4115	0.60946	0.0:0.0:1.0:0.0	.	.	.	.	X	1060;1089;628;578;129	.	ENSP00000360336:E129X	E	+	1	0	HEATR8	54939476	1.000000	0.71417	1.000000	0.80357	0.505000	0.33919	4.570000	0.60872	2.533000	0.85409	0.313000	0.20887	GAA	HEATR8	-	superfamily_ARM-type_fold	ENSG00000184313		0.597	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR8	HGNC	protein_coding	OTTHUMT00000346978.1	63	0.00	0	G	NM_198547		55166888	55166888	+1	no_errors	ENST00000421030	ensembl	human	known	69_37n	nonsense	48	30.43	21	SNP	1.000	T
HEPACAM2	253012	genome.wustl.edu	37	7	92848495	92848495	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr7:92848495C>T	ENST00000394468.2	-	2	426	c.349G>A	c.(349-351)Gaa>Aaa	p.E117K	HEPACAM2_ENST00000453812.2_Missense_Mutation_p.E140K|HEPACAM2_ENST00000440868.1_Missense_Mutation_p.E105K|HEPACAM2_ENST00000341723.4_Missense_Mutation_p.E105K	NM_001039372.1	NP_001034461.1	A8MVW5	HECA2_HUMAN	HEPACAM family member 2	117					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|midbody (GO:0030496)|spindle (GO:0005819)				breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(4)|skin(1)	28						TAATTGCCTTCATCAGGGAAC	0.463																																						dbGAP											0													145.0	122.0	130.0					7																	92848495		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096002	CCDS5629.1, CCDS43616.1, CCDS75631.1, CCDS75632.1	7q21.3	2013-01-29	2008-07-11		ENSG00000188175	ENSG00000188175		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27364	protein-coding gene	gene with protein product		614133				12975309	Standard	NM_001288804		Approved	FLJ38683	uc003umm.3	A8MVW5	OTTHUMG00000131732	ENST00000394468.2:c.349G>A	7.37:g.92848495C>T	ENSP00000377980:p.Glu117Lys		B3KTT4|B4DPJ1|B9EG93|E9PDV5|Q6UXI0	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.E117K	ENST00000394468.2	37	c.349	CCDS43616.1	7	.	.	.	.	.	.	.	.	.	.	C	32	5.136918	0.94517	.	.	ENSG00000188175	ENST00000394468;ENST00000341723;ENST00000440868;ENST00000453812	T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25	5.72	5.72	0.89469	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.046168	0.85682	D	0.000000	T	0.68063	0.2960	L	0.34521	1.04	0.53005	D	0.99996	D;D;P;P	0.52996	0.957;0.957;0.91;0.89	P;P;P;B	0.54401	0.73;0.751;0.508;0.374	T	0.59225	-0.7494	10	0.12103	T	0.63	-25.9799	20.269	0.98464	0.0:1.0:0.0:0.0	.	140;105;117;105	E9PDV5;C9JN07;A8MVW5;A8MVW5-2	.;.;HECA2_HUMAN;.	K	117;105;105;140	ENSP00000377980:E117K;ENSP00000340532:E105K;ENSP00000389592:E105K;ENSP00000390204:E140K	ENSP00000340532:E105K	E	-	1	0	HEPACAM2	92686431	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	5.881000	0.69706	2.878000	0.98634	0.650000	0.86243	GAA	HEPACAM2	-	pfam_Ig_V-set,smart_Ig_sub	ENSG00000188175		0.463	HEPACAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEPACAM2	HGNC	protein_coding	OTTHUMT00000254651.1	56	0.00	0	C	NM_198151		92848495	92848495	-1	no_errors	ENST00000394468	ensembl	human	known	69_37n	missense	52	24.64	17	SNP	1.000	T
HERC2	8924	genome.wustl.edu	37	15	28441424	28441424	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr15:28441424C>T	ENST00000261609.7	-	52	8305	c.8197G>A	c.(8197-8199)Gaa>Aaa	p.E2733K		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		AAACACGTTTCACAAAAATCA	0.358																																						dbGAP											0													15.0	15.0	15.0					15																	28441424		2075	4177	6252	-	-	-	SO:0001583	missense	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.8197G>A	15.37:g.28441424C>T	ENSP00000261609:p.Glu2733Lys			Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5,superfamily_UBA-like,superfamily_CUB,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5,prints_Reg_chr_condens	p.E2733K	ENST00000261609.7	37	c.8197	CCDS10021.1	15	.	.	.	.	.	.	.	.	.	.	C	32	5.169943	0.94768	.	.	ENSG00000128731	ENST00000261609	D	0.91237	-2.81	5.3	5.3	0.74995	Zinc finger, ZZ-type (4);Galactose-binding domain-like (1);	0.165679	0.52532	D	0.000078	D	0.92880	0.7735	M	0.81802	2.56	0.80722	D	1	P;P	0.43938	0.822;0.503	P;B	0.45753	0.492;0.122	D	0.93564	0.6898	10	0.62326	D	0.03	.	19.3101	0.94184	0.0:1.0:0.0:0.0	.	200;2733	A8KAQ8;O95714	.;HERC2_HUMAN	K	2733	ENSP00000261609:E2733K	ENSP00000261609:E2733K	E	-	1	0	HERC2	26115019	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.075000	0.71261	2.649000	0.89929	0.484000	0.47621	GAA	HERC2	-	pfam_Znf_ZZ,superfamily_Galactose-bd-like,smart_Znf_ZZ,pfscan_Znf_ZZ	ENSG00000128731		0.358	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	40	0.00	0	C	NM_004667		28441424	28441424	-1	no_errors	ENST00000261609	ensembl	human	known	69_37n	missense	41	12.77	6	SNP	1.000	T
HEYL	26508	genome.wustl.edu	37	1	40092629	40092629	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:40092629G>C	ENST00000372852.3	-	5	856	c.537C>G	c.(535-537)ttC>ttG	p.F179L	HEYL_ENST00000535435.1_Missense_Mutation_p.F151L	NM_014571.3	NP_055386	Q9NQ87	HEYL_HUMAN	hes-related family bHLH transcription factor with YRPW motif-like	179	Pro-rich.				atrioventricular valve morphogenesis (GO:0003181)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to BMP stimulus (GO:0071773)|endocardial cushion morphogenesis (GO:0003203)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|glomerulus development (GO:0032835)|mesenchymal cell development (GO:0014031)|negative regulation of androgen receptor activity (GO:2000824)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal tubule development (GO:0072014)|pulmonary valve morphogenesis (GO:0003184)|skeletal muscle cell differentiation (GO:0035914)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-1 domain binding (GO:0050683)|microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	7	Lung NSC(20;3.81e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.1e-18)|Epithelial(16;2.77e-17)|all cancers(16;5.64e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			AGCTATGGAAGAAAGACCAGG	0.642																																						dbGAP											0													61.0	56.0	57.0					1																	40092629		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC006087	CCDS439.1	1p34.3	2013-10-17	2013-10-17		ENSG00000163909	ENSG00000163909		"""Basic helix-loop-helix proteins"""	4882	protein-coding gene	gene with protein product	"""hairy/enhancer-of-split related with YRPW motif 3"""	609034	"""hairy/enhancer-of-split related with YRPW motif-like"""			10415358, 10860664	Standard	NM_014571		Approved	bHLHb33, HEY3, HESR3	uc001cdp.3	Q9NQ87	OTTHUMG00000000458	ENST00000372852.3:c.537C>G	1.37:g.40092629G>C	ENSP00000361943:p.Phe179Leu		Q5TG99	Missense_Mutation	SNP	pfam_HLH_DNA-bd,pfam_Orange,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_Orange_subgr,pfscan_Orange,pfscan_HLH_DNA-bd	p.F179L	ENST00000372852.3	37	c.537	CCDS439.1	1	.	.	.	.	.	.	.	.	.	.	G	18.21	3.572485	0.65765	.	.	ENSG00000163909	ENST00000372852;ENST00000535435	T;T	0.58652	0.32;0.32	5.02	5.02	0.67125	.	0.229124	0.47093	D	0.000254	T	0.55673	0.1935	M	0.63843	1.955	0.40528	D	0.980907	P	0.34462	0.454	B	0.30716	0.119	T	0.60490	-0.7253	10	0.44086	T	0.13	-5.1951	17.3264	0.87249	0.0:0.0:1.0:0.0	.	179	Q9NQ87	HEYL_HUMAN	L	179;151	ENSP00000361943:F179L;ENSP00000439071:F151L	ENSP00000361943:F179L	F	-	3	2	HEYL	39865216	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.114000	0.64648	2.321000	0.78463	0.462000	0.41574	TTC	HEYL	-	NULL	ENSG00000163909		0.642	HEYL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEYL	HGNC	protein_coding	OTTHUMT00000001179.2	37	0.00	0	G	NM_014571		40092629	40092629	-1	no_errors	ENST00000372852	ensembl	human	known	69_37n	missense	16	20.00	4	SNP	1.000	C
HNRNPA2B1	3181	genome.wustl.edu	37	7	26237349	26237349	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr7:26237349C>T	ENST00000354667.4	-	3	214	c.46G>A	c.(46-48)Gaa>Aaa	p.E16K	HNRNPA2B1_ENST00000356674.7_Missense_Mutation_p.E4K	NM_031243.2	NP_112533.1	P22626	ROA2_HUMAN	heterogeneous nuclear ribonucleoprotein A2/B1	16					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA intronic binding (GO:0097157)|RNA binding (GO:0003723)|single-stranded telomeric DNA binding (GO:0043047)		HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22						TGTTCCTTTTCTCTCTGCAAA	0.363			T	ETV1	prostate																																	dbGAP		Dom	yes		7	7p15	3181	heterogeneous nuclear ribonucleoprotein A2/B1		E	0													59.0	57.0	58.0					7																	26237349		2203	4300	6503	-	-	-	SO:0001583	missense	0			D28877	CCDS5397.1, CCDS43557.1	7p15	2013-02-12		2007-08-16	ENSG00000122566	ENSG00000122566		"""RNA binding motif (RRM) containing"""	5033	protein-coding gene	gene with protein product		600124		HNRPA2B1		8029005	Standard	NM_002137		Approved		uc003sxr.4	P22626	OTTHUMG00000023471	ENST00000354667.4:c.46G>A	7.37:g.26237349C>T	ENSP00000346694:p.Glu16Lys		A8K064|P22627|Q9UC98|Q9UDJ2	Missense_Mutation	SNP	pfam_RRM_dom,pfam_HnRNPA1,smart_RRM_dom,pfscan_RRM_dom	p.E16K	ENST00000354667.4	37	c.46	CCDS43557.1	7	.	.	.	.	.	.	.	.	.	.	C	24.4	4.523817	0.85600	.	.	ENSG00000122566	ENST00000354667;ENST00000356674;ENST00000409814	D;D	0.93859	-3.3;-3.3	5.95	5.95	0.96441	.	0.000000	0.64402	D	0.000001	D	0.95626	0.8578	L	0.56124	1.755	0.53688	D	0.999973	D;D	0.64830	0.994;0.961	P;P	0.62014	0.817;0.897	D	0.95239	0.8349	10	0.62326	D	0.03	.	20.3748	0.98911	0.0:1.0:0.0:0.0	.	4;16	P22626-2;P22626	.;ROA2_HUMAN	K	16;4;4	ENSP00000346694:E16K;ENSP00000349101:E4K	ENSP00000346694:E16K	E	-	1	0	HNRNPA2B1	26203874	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.459000	0.66685	2.817000	0.96982	0.563000	0.77884	GAA	HNRNPA2B1	-	NULL	ENSG00000122566		0.363	HNRNPA2B1-001	KNOWN	basic|CCDS	protein_coding	HNRNPA2B1	HGNC	protein_coding	OTTHUMT00000214109.1	63	0.00	0	C	NM_002137		26237349	26237349	-1	no_errors	ENST00000354667	ensembl	human	known	69_37n	missense	53	18.46	12	SNP	1.000	T
HOXC11	3227	genome.wustl.edu	37	12	54369062	54369062	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:54369062G>A	ENST00000546378.1	+	2	896	c.780G>A	c.(778-780)gaG>gaA	p.E260E	HOTAIR_ENST00000455246.1_RNA|HOTAIR_ENST00000424518.1_RNA|HOXC11_ENST00000243082.4_Missense_Mutation_p.E262K			O43248	HXC11_HUMAN	homeobox C11	260					anterior/posterior pattern specification (GO:0009952)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal joint morphogenesis (GO:0060272)|endoderm development (GO:0007492)|metanephros development (GO:0001656)|organ induction (GO:0001759)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			large_intestine(1)|ovary(1)	2						TCAACAAAGAGAAGCGGCTGC	0.507			T	NUP98	AML																																	dbGAP		Dom	yes		12	12q13.3	3227	homeo box C11		L	0													51.0	58.0	56.0					12																	54369062		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS8867.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123388	ENSG00000123388		"""Homeoboxes / ANTP class : HOXL subclass"""	5123	protein-coding gene	gene with protein product		605559	"""homeo box C11"""	HOX3H		1973146, 1358459	Standard	NM_014212		Approved		uc001sem.3	O43248	OTTHUMG00000160011	ENST00000546378.1:c.780G>A	12.37:g.54369062G>A			A8K7D1|Q96DH2	Missense_Mutation	SNP	pfam_DUF3528	p.E262K	ENST00000546378.1	37	c.784	CCDS8867.1	12	.	.	.	.	.	.	.	.	.	.	G	16.74	3.206277	0.58343	.	.	ENSG00000123388	ENST00000243082	T	0.27104	1.69	4.41	2.55	0.30701	.	0.000000	0.85682	D	0.000000	T	0.37999	0.1024	.	.	.	0.38725	D	0.953546	.	.	.	.	.	.	T	0.32268	-0.9913	7	0.87932	D	0	.	9.8881	0.41274	0.1742:0.0:0.8258:0.0	.	.	.	.	K	262	ENSP00000243082:E262K	ENSP00000243082:E262K	E	+	1	0	HOXC11	52655329	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.747000	0.47475	0.422000	0.26005	0.555000	0.69702	GAA	HOXC11	-	NULL	ENSG00000123388		0.507	HOXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXC11	HGNC	protein_coding	OTTHUMT00000358869.2	36	0.00	0	G			54369062	54369062	+1	no_errors	ENST00000243082	ensembl	human	novel	69_37n	missense	42	20.75	11	SNP	1.000	A
HPS6	79803	genome.wustl.edu	37	10	103827284	103827284	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr10:103827284G>C	ENST00000299238.5	+	1	2138	c.2053G>C	c.(2053-2055)Gat>Cat	p.D685H		NM_024747.5	NP_079023.2	Q86YV9	HPS6_HUMAN	Hermansky-Pudlak syndrome 6	685					blood coagulation (GO:0007596)|melanocyte differentiation (GO:0030318)|organelle organization (GO:0006996)|protein localization to membrane (GO:0072657)	BLOC-2 complex (GO:0031084)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|Rab GTPase binding (GO:0017137)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|prostate(1)	11		Colorectal(252;0.122)		Epithelial(162;5.93e-08)|all cancers(201;1.03e-06)		CCGCCGGCTTGATGCTCACCT	0.632									Hermansky-Pudlak syndrome																													dbGAP											0													57.0	64.0	61.0					10																	103827284		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HPS, HPS1-8	BC009258	CCDS7527.1	10q24.32	2014-06-18			ENSG00000166189	ENSG00000166189			18817	protein-coding gene	gene with protein product		607522				12548288	Standard	NM_024747		Approved	FLJ22501	uc001kuj.3	Q86YV9	OTTHUMG00000018945	ENST00000299238.5:c.2053G>C	10.37:g.103827284G>C	ENSP00000299238:p.Asp685His		Q5VV69|Q9H685	Missense_Mutation	SNP	pirsf_BLOC-2_complex_Hps6_subunit	p.D685H	ENST00000299238.5	37	c.2053	CCDS7527.1	10	.	.	.	.	.	.	.	.	.	.	G	19.74	3.884492	0.72410	.	.	ENSG00000166189	ENST00000299238	D	0.84516	-1.86	4.61	4.61	0.57282	.	0.000000	0.85682	U	0.000000	D	0.91496	0.7315	M	0.68952	2.095	0.54753	D	0.999981	D	0.89917	1.0	D	0.97110	1.0	D	0.92456	0.5974	10	0.72032	D	0.01	-9.9826	17.6275	0.88097	0.0:0.0:1.0:0.0	.	685	Q86YV9	HPS6_HUMAN	H	685	ENSP00000299238:D685H	ENSP00000299238:D685H	D	+	1	0	HPS6	103817274	1.000000	0.71417	0.969000	0.41365	0.996000	0.88848	9.499000	0.97975	2.403000	0.81681	0.561000	0.74099	GAT	HPS6	-	pirsf_BLOC-2_complex_Hps6_subunit	ENSG00000166189		0.632	HPS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPS6	HGNC	protein_coding	OTTHUMT00000050018.2	25	0.00	0	G	NM_024747		103827284	103827284	+1	no_errors	ENST00000299238	ensembl	human	known	69_37n	missense	31	18.42	7	SNP	1.000	C
HPX	3263	genome.wustl.edu	37	11	6458804	6458804	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr11:6458804G>A	ENST00000265983.3	-	6	669	c.569C>T	c.(568-570)tCt>tTt	p.S190F	HPX_ENST00000525057.1_5'Flank	NM_000613.2	NP_000604.1	P02790	HEMO_HUMAN	hemopexin	190					cellular iron ion homeostasis (GO:0006879)|heme metabolic process (GO:0042168)|heme transport (GO:0015886)|hemoglobin metabolic process (GO:0020027)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of immunoglobulin production (GO:0002639)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|viral process (GO:0016032)	blood microparticle (GO:0072562)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme transporter activity (GO:0015232)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(11)|prostate(1)	15		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;5.46e-08)|BRCA - Breast invasive adenocarcinoma(625;0.19)		TCTCAGGGCAGAGGAGCAGTT	0.597																																						dbGAP											0													76.0	70.0	72.0					11																	6458804		2201	4296	6497	-	-	-	SO:0001583	missense	0			J03048	CCDS7763.1	11p15.5-p15.4	2012-10-02			ENSG00000110169	ENSG00000110169			5171	protein-coding gene	gene with protein product		142290				2989777, 2842511	Standard	NM_000613		Approved		uc001mdg.2	P02790	OTTHUMG00000133399	ENST00000265983.3:c.569C>T	11.37:g.6458804G>A	ENSP00000265983:p.Ser190Phe		B2R957	Missense_Mutation	SNP	pfam_Hemopexin/matrixin_repeat,superfamily_Hemopexin/matrixin,smart_Hemopexin/matrixin_repeat,pirsf_Hemopexin_chordata	p.S190F	ENST00000265983.3	37	c.569	CCDS7763.1	11	.	.	.	.	.	.	.	.	.	.	G	23.6	4.436854	0.83885	.	.	ENSG00000110169	ENST00000265983;ENST00000537154	T	0.02525	4.26	4.85	4.85	0.62838	Hemopexin/matrixin (2);	0.122427	0.56097	D	0.000027	T	0.14614	0.0353	M	0.79258	2.445	0.47949	D	0.999551	D	0.89917	1.0	D	0.80764	0.994	T	0.01256	-1.1404	10	0.36615	T	0.2	-3.4372	15.4529	0.75290	0.0:0.0:1.0:0.0	.	190	P02790	HEMO_HUMAN	F	190	ENSP00000265983:S190F	ENSP00000265983:S190F	S	-	2	0	HPX	6415380	1.000000	0.71417	0.966000	0.40874	0.841000	0.47740	7.635000	0.83286	2.248000	0.74166	0.455000	0.32223	TCT	HPX	-	pfam_Hemopexin/matrixin_repeat,superfamily_Hemopexin/matrixin,smart_Hemopexin/matrixin_repeat,pirsf_Hemopexin_chordata	ENSG00000110169		0.597	HPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPX	HGNC	protein_coding	OTTHUMT00000257256.1	30	0.00	0	G	NM_000613		6458804	6458804	-1	no_errors	ENST00000265983	ensembl	human	known	69_37n	missense	17	22.73	5	SNP	0.994	A
HS6ST2	90161	genome.wustl.edu	37	X	131762563	131762563	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chrX:131762563C>T	ENST00000370836.2	-	4	1921	c.1506G>A	c.(1504-1506)atG>atA	p.M502I	HS6ST2_ENST00000370833.2_Missense_Mutation_p.M396I|HS6ST2_ENST00000406696.3_Missense_Mutation_p.M228I|HS6ST2_ENST00000521489.1_Missense_Mutation_p.M542I	NM_147175.3	NP_671704.3	Q96MM7	H6ST2_HUMAN	heparan sulfate 6-O-sulfotransferase 2	502					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(2)	9	Acute lymphoblastic leukemia(192;0.000127)					CTTTCTGCCTCATAAACTGAT	0.463																																						dbGAP											0													136.0	135.0	135.0					X																	131762563		1964	4119	6083	-	-	-	SO:0001583	missense	0			AB067776	CCDS48169.1, CCDS48170.1	Xq26.2	2008-02-05			ENSG00000171004	ENSG00000171004		"""Sulfotransferases, membrane-bound"""	19133	protein-coding gene	gene with protein product		300545				10644753	Standard	NM_147175		Approved		uc011mvd.1	Q96MM7	OTTHUMG00000022430	ENST00000370836.2:c.1506G>A	X.37:g.131762563C>T	ENSP00000359873:p.Met502Ile		B9WRT4|B9WRT5|E9PDY5|Q2TB13|Q4VC07|Q6PIC4|Q86SM9|Q8N3T4|Q8NBN4|Q96SJ4	Missense_Mutation	SNP	pfam_Sulfotransferase	p.M542I	ENST00000370836.2	37	c.1626	CCDS48169.1	X	.	.	.	.	.	.	.	.	.	.	C	14.43	2.532613	0.45073	.	.	ENSG00000171004	ENST00000370837;ENST00000370836;ENST00000521489;ENST00000406696;ENST00000370833	T;T;T;T;T	0.77098	-1.04;-0.47;-0.47;-1.07;-1.0	6.02	4.99	0.66335	.	0.172740	0.64402	D	0.000005	T	0.78368	0.4272	N	0.22421	0.69	0.38826	D	0.955733	B;P;B	0.50528	0.329;0.936;0.329	B;P;B	0.61201	0.065;0.885;0.065	T	0.79888	-0.1613	10	0.45353	T	0.12	-0.4733	13.9977	0.64411	0.0:0.9128:0.0:0.0872	.	502;542;228	Q96MM7;E9PDY5;B7Z5H6	H6ST2_HUMAN;.;.	I	356;502;542;228;396	ENSP00000359874:M356I;ENSP00000359873:M502I;ENSP00000429473:M542I;ENSP00000384013:M228I;ENSP00000359870:M396I	ENSP00000359870:M396I	M	-	3	0	HS6ST2	131590244	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.349000	0.33998	2.549000	0.85964	0.600000	0.82982	ATG	HS6ST2	-	NULL	ENSG00000171004		0.463	HS6ST2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	HS6ST2	HGNC	protein_coding	OTTHUMT00000058332.3	58	0.00	0	C	NM_147174		131762563	131762563	-1	no_errors	ENST00000521489	ensembl	human	known	69_37n	missense	60	25.93	21	SNP	1.000	T
HSD17B4	3295	genome.wustl.edu	37	5	118835232	118835232	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr5:118835232C>T	ENST00000256216.6	+	13	1326	c.1193C>T	c.(1192-1194)tCa>tTa	p.S398L	HSD17B4_ENST00000504811.1_Missense_Mutation_p.S423L|HSD17B4_ENST00000414835.2_Missense_Mutation_p.S258L|HSD17B4_ENST00000509514.1_Missense_Mutation_p.S136L|HSD17B4_ENST00000510025.1_Missense_Mutation_p.S374L|HSD17B4_ENST00000515320.1_Missense_Mutation_p.S380L|HSD17B4_ENST00000513628.1_Missense_Mutation_p.S261L	NM_000414.3	NP_000405.1	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4	398	Enoyl-CoA hydratase 2.				alpha-linolenic acid metabolic process (GO:0036109)|androgen metabolic process (GO:0008209)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|estrogen metabolic process (GO:0008210)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|metabolic process (GO:0008152)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|Sertoli cell development (GO:0060009)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)|very long-chain fatty-acyl-CoA metabolic process (GO:0036111)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	17-beta-hydroxysteroid dehydrogenase (NAD+) activity (GO:0044594)|3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity (GO:0033989)|isomerase activity (GO:0016853)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(2)	25		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)		CCTGGACTTTCAATCAACTTT	0.328																																					Colon(35;490 801 34689 41394 43344)	dbGAP											0													115.0	127.0	123.0					5																	118835232		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS4126.1, CCDS56378.1, CCDS56379.1	5q2	2011-09-20			ENSG00000133835	ENSG00000133835	4.2.1.107, 1.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5213	protein-coding gene	gene with protein product	"""17beta-estradiol dehydrogenase type IV"", ""peroxisomal multifunctional protein 2"", ""17-beta-HSD IV"", ""17-beta-hydroxysteroid dehydrogenase 4"", ""D-bifunctional protein, peroxisomal"", ""D-3-hydroxyacyl-CoA dehydratase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase"", ""beta-keto-reductase"", ""beta-hydroxyacyl dehydrogenase"", ""short chain dehydrogenase/reductase family 8C, member 1"""	601860				8938456, 19027726	Standard	NM_000414		Approved	MFE-2, DBP, SDR8C1	uc003ksj.3	P51659	OTTHUMG00000128899	ENST00000256216.6:c.1193C>T	5.37:g.118835232C>T	ENSP00000256216:p.Ser398Leu		B4DNV1|B4DVS5|E9PB82|F5HE57	Missense_Mutation	SNP	pfam_MaoC_deHydtase,pfam_DH_sc/Rdtase_SDR,pfam_SCP2_sterol-bd_dom,pfam_PKS_KR,superfamily_SCP2_sterol-bd_dom,smart_PKS/FAS_KR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR,prints_DHB_DH	p.S398L	ENST00000256216.6	37	c.1193	CCDS4126.1	5	.	.	.	.	.	.	.	.	.	.	C	14.53	2.562151	0.45590	.	.	ENSG00000133835	ENST00000256216;ENST00000515320;ENST00000510025;ENST00000504811;ENST00000414835;ENST00000513628;ENST00000509514	D;D;D;D;D;D;D	0.84730	-1.89;-1.89;-1.89;-1.89;-1.89;-1.89;-1.89	5.49	3.52	0.40303	.	0.438185	0.25146	N	0.032789	D	0.82756	0.5106	M	0.69523	2.12	0.34663	D	0.722919	B;B;B;P;B	0.35780	0.17;0.07;0.047;0.52;0.07	B;B;B;B;B	0.31495	0.042;0.063;0.016;0.131;0.063	D	0.89408	0.3701	10	0.62326	D	0.03	-4.0599	14.3857	0.66942	0.2548:0.7452:0.0:0.0	.	423;380;374;136;398	F5HE57;E9PB82;E7EWE5;E7EPL9;P51659	.;.;.;.;DHB4_HUMAN	L	398;380;374;423;258;261;136	ENSP00000256216:S398L;ENSP00000424613:S380L;ENSP00000424940:S374L;ENSP00000420914:S423L;ENSP00000411960:S258L;ENSP00000425993:S261L;ENSP00000426272:S136L	ENSP00000256216:S398L	S	+	2	0	HSD17B4	118863131	0.758000	0.28405	0.992000	0.48379	0.918000	0.54935	2.985000	0.49362	2.561000	0.86390	0.557000	0.71058	TCA	HSD17B4	-	NULL	ENSG00000133835		0.328	HSD17B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B4	HGNC	protein_coding	OTTHUMT00000250863.3	41	0.00	0	C	NM_000414		118835232	118835232	+1	no_errors	ENST00000256216	ensembl	human	known	69_37n	missense	23	54.00	27	SNP	0.971	T
HSPD1	3329	genome.wustl.edu	37	2	198360068	198360068	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:198360068C>T	ENST00000388968.3	-	4	727	c.460G>A	c.(460-462)Gaa>Aaa	p.E154K	HSPD1_ENST00000345042.2_Missense_Mutation_p.E154K	NM_002156.4	NP_002147.2	P10809	CH60_HUMAN	heat shock 60kDa protein 1 (chaperonin)	154					'de novo' protein folding (GO:0006458)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|ATP catabolic process (GO:0006200)|B cell activation (GO:0042113)|B cell cytokine production (GO:0002368)|B cell proliferation (GO:0042100)|chaperone-mediated protein complex assembly (GO:0051131)|isotype switching to IgG isotypes (GO:0048291)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell mediated immune response to tumor cell (GO:0002842)|protein maturation (GO:0051604)|protein refolding (GO:0042026)|protein stabilization (GO:0050821)|response to unfolded protein (GO:0006986)|T cell activation (GO:0042110)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lipopolysaccharide receptor complex (GO:0046696)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chaperone binding (GO:0051087)|DNA replication origin binding (GO:0003688)|double-stranded RNA binding (GO:0003725)|lipopolysaccharide binding (GO:0001530)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|single-stranded DNA binding (GO:0003697)|unfolded protein binding (GO:0051082)			NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(7)|skin(1)	17			Epithelial(96;0.225)			TTTTTAAGTTCAGCAATTACA	0.343																																						dbGAP											0													107.0	108.0	108.0					2																	198360068		2203	4300	6503	-	-	-	SO:0001583	missense	0			M34664	CCDS33357.1	2q33.1	2011-09-02	2002-08-29		ENSG00000144381	ENSG00000144381		"""Heat Shock Proteins / Chaperonins"""	5261	protein-coding gene	gene with protein product		118190	"""heat shock 60kD protein 1 (chaperonin)"", ""spastic paraplegia 13 (autosomal dominant)"""	SPG13		1980192, 11898127	Standard	NM_002156		Approved	GROEL, HSP60	uc002uui.3	P10809	OTTHUMG00000154463	ENST00000388968.3:c.460G>A	2.37:g.198360068C>T	ENSP00000373620:p.Glu154Lys		B2R5M6|B7Z712|Q38L19|Q9UCR6	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaprnin_Cpn60,prints_Chaperone_TCP-1,tigrfam_Chaprnin_Cpn60	p.E154K	ENST00000388968.3	37	c.460	CCDS33357.1	2	.	.	.	.	.	.	.	.	.	.	C	17.31	3.357779	0.61403	.	.	ENSG00000144381	ENST00000388968;ENST00000345042;ENST00000536745;ENST00000430176;ENST00000452200	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.76054	0.3934	L	0.43152	1.355	0.80722	D	1	B;B;B	0.27853	0.01;0.003;0.191	B;B;B	0.34346	0.051;0.038;0.18	T	0.73040	-0.4108	10	0.45353	T	0.12	-37.0771	19.3726	0.94495	0.0:1.0:0.0:0.0	.	145;154;154	B7Z597;B3GQS7;P10809	.;.;CH60_HUMAN	K	154;154;10;154;154	ENSP00000373620:E154K;ENSP00000340019:E154K;ENSP00000393670:E154K;ENSP00000412717:E154K	ENSP00000340019:E154K	E	-	1	0	HSPD1	198068313	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	7.334000	0.79224	2.648000	0.89879	0.585000	0.79938	GAA	HSPD1	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,tigrfam_Chaprnin_Cpn60	ENSG00000144381		0.343	HSPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPD1	HGNC	protein_coding	OTTHUMT00000335324.2	96	0.00	0	C	NM_002156		198360068	198360068	-1	no_errors	ENST00000345042	ensembl	human	known	69_37n	missense	93	12.26	13	SNP	1.000	T
HTR1B	3351	genome.wustl.edu	37	6	78172587	78172587	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr6:78172587G>C	ENST00000369947.2	-	1	903	c.534C>G	c.(532-534)atC>atG	p.I178M		NM_000863.1	NP_000854.1	P28222	5HT1B_HUMAN	5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled	178					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|bone remodeling (GO:0046849)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to temperature stimulus (GO:0071502)|drinking behavior (GO:0042756)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to mineralocorticoid (GO:0051385)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|prostate(2)|upper_aerodigestive_tract(2)	25		all_cancers(76;0.0867)|Acute lymphoblastic leukemia(125;0.00119)|all_hematologic(105;0.0332)		BRCA - Breast invasive adenocarcinoma(397;0.205)	Almotriptan(DB00918)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Clozapine(DB00363)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Methysergide(DB00247)|Naratriptan(DB00952)|Olanzapine(DB00334)|Ondansetron(DB00904)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Sumatriptan(DB00669)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	GCGAGATAGAGATGGAGAAGA	0.597																																						dbGAP											0													74.0	79.0	77.0					6																	78172587		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC069065	CCDS4986.1	6q13	2012-08-08	2012-02-03		ENSG00000135312	ENSG00000135312		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5287	protein-coding gene	gene with protein product		182131	"""5-hydroxytryptamine (serotonin) receptor 1B"""			1348246, 11247661	Standard	NM_000863		Approved	S12, 5-HT1B, HTR1D2, 5-HT1DB	uc003pil.1	P28222	OTTHUMG00000015066	ENST00000369947.2:c.534C>G	6.37:g.78172587G>C	ENSP00000358963:p.Ile178Met		Q4VAY7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_5HT1B_rcpt,prints_5HT_rcpt,prints_Adrnrgc_rcpt	p.I178M	ENST00000369947.2	37	c.534	CCDS4986.1	6	.	.	.	.	.	.	.	.	.	.	G	15.64	2.894013	0.52121	.	.	ENSG00000135312	ENST00000369947	T	0.39229	1.09	5.09	3.24	0.37175	GPCR, rhodopsin-like superfamily (1);	0.056880	0.64402	D	0.000002	T	0.45597	0.1350	L	0.55017	1.72	0.58432	D	0.999997	D	0.53745	0.962	D	0.65233	0.933	T	0.21861	-1.0233	9	.	.	.	.	12.0208	0.53342	0.0:0.1295:0.7375:0.133	.	178	P28222	5HT1B_HUMAN	M	178	ENSP00000358963:I178M	.	I	-	3	3	HTR1B	78229306	1.000000	0.71417	0.999000	0.59377	0.971000	0.66376	2.472000	0.45136	2.647000	0.89833	0.555000	0.69702	ATC	HTR1B	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000135312		0.597	HTR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1B	HGNC	protein_coding	OTTHUMT00000041292.1	21	0.00	0	G	NM_000863		78172587	78172587	-1	no_errors	ENST00000369947	ensembl	human	known	69_37n	missense	22	29.03	9	SNP	1.000	C
HUWE1	10075	genome.wustl.edu	37	X	53589161	53589161	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chrX:53589161G>C	ENST00000342160.3	-	53	7706	c.7249C>G	c.(7249-7251)Cag>Gag	p.Q2417E	HUWE1_ENST00000262854.6_Missense_Mutation_p.Q2417E			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2417	Glu-rich.				base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TCCTCTTCCTGAGTGTGCTCC	0.498																																						dbGAP											0													156.0	96.0	116.0					X																	53589161		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.7249C>G	X.37:g.53589161G>C	ENSP00000340648:p.Gln2417Glu		O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Nonsense_Mutation	SNP	pfam_HECT,pfam_WWE-dom,pfam_UBA/transl_elong_EF1B_N,superfamily_HECT,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.S1450*	ENST00000342160.3	37	c.4349	CCDS35301.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.532|9.532	1.110979|1.110979	0.20714|0.20714	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000342160;ENST00000262854|ENST00000427052	T;T|.	0.35236|.	1.32;1.32|.	4.93|4.93	4.93|4.93	0.64822|0.64822	.|.	0.070349|.	0.56097|.	D|.	0.000021|.	T|.	0.51329|.	0.1668|.	N|N	0.19112|0.19112	0.55|0.55	0.53688|0.53688	D|D	0.999978|0.999978	P;P|.	0.43578|.	0.713;0.811|.	P;P|.	0.54924|.	0.585;0.764|.	T|.	0.48103|.	-0.9064|.	10|.	0.18276|.	T|.	0.48|.	.|.	16.1977|16.1977	0.82042|0.82042	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	2417;2417|.	Q7Z6Z7;Q7Z6Z7-2|.	HUWE1_HUMAN;.|.	E|X	2417|1450	ENSP00000340648:Q2417E;ENSP00000262854:Q2417E|.	ENSP00000262854:Q2417E|.	Q|S	-|-	1|2	0|0	HUWE1|HUWE1	53605886|53605886	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.452000|8.452000	0.90346|0.90346	2.164000|2.164000	0.68074|0.68074	0.513000|0.513000	0.50165|0.50165	CAG|TCA	HUWE1	-	NULL	ENSG00000086758		0.498	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	85	0.00	0	G	XM_497119		53589161	53589161	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000427052	ensembl	human	known	69_37n	nonsense	80	24.53	26	SNP	1.000	C
IDS	3423	genome.wustl.edu	37	X	148568837	148568837	+	Intron	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chrX:148568837G>A	ENST00000340855.6	-	8	1216				IDS_ENST00000422081.2_Intron|IDS_ENST00000541269.1_Intron|IDS_ENST00000370441.4_Silent_p.L338L|IDS_ENST00000490775.1_5'UTR|IDS_ENST00000537071.1_Intron	NM_000202.5|NM_001166550.1	NP_000193.1|NP_001160022.1	P22304	IDS_HUMAN	iduronate 2-sulfatase						carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	lysosomal lumen (GO:0043202)	iduronate-2-sulfatase activity (GO:0004423)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(5)|large_intestine(2)|lung(8)|prostate(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					TTGTCCTCATGAGGAAACCTT	0.328																																						dbGAP											0													38.0	39.0	39.0					X																	148568837		2202	4295	6497	-	-	-	SO:0001627	intron_variant	0			M58342	CCDS14685.1, CCDS14686.1	Xq27.3-q28	2012-10-02	2008-08-01		ENSG00000010404	ENSG00000010404	3.1.6.13		5389	protein-coding gene	gene with protein product	"""Hunter syndrome"""	300823		SIDS			Standard	NM_006123		Approved		uc011mxe.2	P22304	OTTHUMG00000022615	ENST00000340855.6:c.1007-208C>T	X.37:g.148568837G>A			D3DWT4|Q14604|Q9BRM3	Silent	SNP	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.L338	ENST00000340855.6	37	c.1014	CCDS14685.1	X																																																																																			IDS	-	superfamily_Alkaline_phosphatase_core	ENSG00000010404		0.328	IDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDS	HGNC	protein_coding	OTTHUMT00000058677.3	41	0.00	0	G			148568837	148568837	-1	no_errors	ENST00000370441	ensembl	human	known	69_37n	silent	25	26.47	9	SNP	0.000	A
IGDCC4	57722	genome.wustl.edu	37	15	65676706	65676706	+	Nonsense_Mutation	SNP	C	C	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr15:65676706C>A	ENST00000352385.2	-	20	3603	c.3394G>T	c.(3394-3396)Gaa>Taa	p.E1132*	IGDCC4_ENST00000558048.1_5'UTR	NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	1132						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						ACAATGACTTCAGCCTCCACC	0.542																																						dbGAP											0													102.0	100.0	101.0					15																	65676706		2201	4299	6500	-	-	-	SO:0001587	stop_gained	0				CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.3394G>T	15.37:g.65676706C>A	ENSP00000319623:p.Glu1132*		Q9HCE4	Nonsense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.E1132*	ENST00000352385.2	37	c.3394	CCDS10206.1	15	.	.	.	.	.	.	.	.	.	.	C	44	10.552918	0.99426	.	.	ENSG00000103742	ENST00000352385;ENST00000356152	.	.	.	5.19	5.19	0.71726	.	0.278895	0.25561	N	0.029835	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-8.8029	15.4289	0.75077	0.0:1.0:0.0:0.0	.	.	.	.	X	1132;861	.	ENSP00000319623:E1132X	E	-	1	0	IGDCC4	63463759	1.000000	0.71417	0.777000	0.31699	0.985000	0.73830	6.069000	0.71209	2.423000	0.82170	0.561000	0.74099	GAA	IGDCC4	-	NULL	ENSG00000103742		0.542	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	IGDCC4	HGNC	protein_coding	OTTHUMT00000256825.2	27	0.00	0	C	NM_020962		65676706	65676706	-1	no_errors	ENST00000352385	ensembl	human	novel	69_37n	nonsense	17	26.09	6	SNP	0.978	A
IGF2BP1	10642	genome.wustl.edu	37	17	47118821	47118821	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr17:47118821G>A	ENST00000290341.3	+	8	1234	c.900G>A	c.(898-900)aaG>aaA	p.K300K	IGF2BP1_ENST00000431824.2_Silent_p.K161K	NM_006546.3	NP_006537.3	Q9NZI8	IF2B1_HUMAN	insulin-like growth factor 2 mRNA binding protein 1	300	KH 2. {ECO:0000255|PROSITE- ProRule:PRU00117}.|Necessary for interaction with ELAVL4 and binding to TAU mRNA. {ECO:0000250}.				CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of mRNA stability involved in response to stress (GO:0010610)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						GGAACCTGAAGAAGGTAGAGC	0.512																																					Esophageal Squamous(198;1041 2123 8248 37119 38268)	dbGAP											0													143.0	131.0	135.0					17																	47118821		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF198254	CCDS11543.1, CCDS54138.1	17q21.32	2013-02-12			ENSG00000159217	ENSG00000159217		"""RNA binding motif (RRM) containing"""	28866	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 1"""	608288				9891060, 11992722	Standard	NM_001160423		Approved	IMP-1	uc002iom.3	Q9NZI8	OTTHUMG00000161173	ENST00000290341.3:c.900G>A	17.37:g.47118821G>A			C9JT33	Silent	SNP	pfam_KH_dom_type_1,pfam_RRM_dom,smart_RRM_dom,smart_KH_dom,pfscan_KH_dom_type_1,pfscan_RRM_dom	p.K300	ENST00000290341.3	37	c.900	CCDS11543.1	17																																																																																			IGF2BP1	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	ENSG00000159217		0.512	IGF2BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2BP1	HGNC	protein_coding	OTTHUMT00000364046.1	91	0.00	0	G	NM_006546		47118821	47118821	+1	no_errors	ENST00000290341	ensembl	human	known	69_37n	silent	70	24.73	23	SNP	1.000	A
IGF2BP2	10644	genome.wustl.edu	37	3	185369915	185369915	+	Silent	SNP	G	G	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr3:185369915G>T	ENST00000382199.2	-	13	1523	c.1428C>A	c.(1426-1428)gtC>gtA	p.V476V	IGF2BP2_ENST00000421047.2_Silent_p.V419V|IGF2BP2_ENST00000346192.3_Silent_p.V433V|IGF2BP2_ENST00000494906.1_5'UTR|IGF2BP2_ENST00000457616.2_Silent_p.V482V	NM_006548.4	NP_006539.3	Q9Y6M1	IF2B2_HUMAN	insulin-like growth factor 2 mRNA binding protein 2	476	KH 3. {ECO:0000255|PROSITE- ProRule:PRU00117}.				anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)	20	all_cancers(143;5.84e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			CGGTGATGATGACCATCCTTT	0.602																																						dbGAP											0													94.0	76.0	82.0					3																	185369915		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC021290	CCDS3273.2, CCDS33903.1	3q27.2	2013-02-12			ENSG00000073792	ENSG00000073792		"""RNA binding motif (RRM) containing"""	28867	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 2"""	608289				10190901, 9891060	Standard	NM_001007225		Approved	IMP-2	uc003fpo.3	Q9Y6M1	OTTHUMG00000074025	ENST00000382199.2:c.1428C>A	3.37:g.185369915G>T			A0A4Z0|B3FTN2|B3FTN3|B3FTN4	Silent	SNP	pfam_KH_dom_type_1,pfam_RRM_dom,smart_RRM_dom,smart_KH_dom,pfscan_KH_dom_type_1,pfscan_RRM_dom	p.V476	ENST00000382199.2	37	c.1428	CCDS3273.2	3																																																																																			IGF2BP2	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	ENSG00000073792		0.602	IGF2BP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGF2BP2	HGNC	protein_coding	OTTHUMT00000157087.2	61	0.00	0	G	NM_006548		185369915	185369915	-1	no_errors	ENST00000382199	ensembl	human	known	69_37n	silent	57	25.97	20	SNP	0.997	T
IGKV1D-13	28902	genome.wustl.edu	37	2	90193159	90193159	+	RNA	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:90193159C>G	ENST00000390275.2	+	0	266									immunoglobulin kappa variable 1D-13																		TTGACCCAGTCTCCATCCTCC	0.478																																						dbGAP											0													26.0	26.0	26.0					2																	90193159		1786	4006	5792	-	-	-			0			X17262		2p11.2	2014-05-06			ENSG00000211630	ENSG00000276566		"""Immunoglobulins / IGK locus"""	5747	other	immunoglobulin gene							Standard	NG_000833		Approved				OTTHUMG00000188271		2.37:g.90193159C>G				Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.S29C	ENST00000390275.2	37	c.86		2																																																																																			IGKV1D-13	-	pfam_Ig_V-set,pfam_Ig_I-set,pfscan_Ig-like	ENSG00000211630		0.478	IGKV1D-13-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGKV1D-13	HGNC	IG_V_gene	OTTHUMT00000323146.2	94	0.00	0	C	NG_000833		90193159	90193159	+1	no_stop_codon	ENST00000390275	ensembl	human	known	69_37n	missense	92	14.02	15	SNP	0.954	G
IL2RB	3560	genome.wustl.edu	37	22	37532390	37532390	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr22:37532390C>T	ENST00000216223.5	-	7	779	c.581G>A	c.(580-582)tGc>tAc	p.C194Y	AL022314.1_ENST00000516333.1_RNA	NM_000878.3	NP_000869.1	P14784	IL2RB_HUMAN	interleukin 2 receptor, beta	194	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|interleukin-2-mediated signaling pathway (GO:0038110)|negative regulation of apoptotic process (GO:0043066)|protein complex assembly (GO:0006461)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-2 binding (GO:0019976)|interleukin-2 receptor activity (GO:0004911)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(5)	23					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	CGTCTCCAGGCAGATCCATTC	0.642																																						dbGAP											0													34.0	34.0	34.0					22																	37532390		2203	4300	6503	-	-	-	SO:0001583	missense	0			M26062	CCDS13942.1	22q13	2011-02-15			ENSG00000100385	ENSG00000100385		"""Interleukins and interleukin receptors"", ""CD molecules"""	6009	protein-coding gene	gene with protein product		146710	"""interleukin 15 receptor, beta"""	IL15RB			Standard	NM_000878		Approved	CD122	uc003aqv.1	P14784	OTTHUMG00000150534	ENST00000216223.5:c.581G>A	22.37:g.37532390C>T	ENSP00000216223:p.Cys194Tyr		B2R765	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.C194Y	ENST00000216223.5	37	c.581	CCDS13942.1	22	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.124910	0.00342	.	.	ENSG00000100385	ENST00000216223	D	0.96073	-3.9	4.74	-9.47	0.00594	Fibronectin, type III (3);Immunoglobulin-like fold (1);	1.764150	0.02230	N	0.064840	D	0.87939	0.6304	L	0.43152	1.355	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.80360	-0.1415	10	0.02654	T	1	-3.8112	1.3271	0.02128	0.4125:0.1551:0.2668:0.1656	.	194	P14784	IL2RB_HUMAN	Y	194	ENSP00000216223:C194Y	ENSP00000216223:C194Y	C	-	2	0	IL2RB	35862336	0.000000	0.05858	0.592000	0.28758	0.308000	0.27856	-7.974000	0.00027	-2.885000	0.00317	-0.475000	0.04921	TGC	IL2RB	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000100385		0.642	IL2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL2RB	HGNC	protein_coding	OTTHUMT00000318792.1	23	0.00	0	C			37532390	37532390	-1	no_errors	ENST00000216223	ensembl	human	known	69_37n	missense	20	25.93	7	SNP	0.006	T
INHA	3623	genome.wustl.edu	37	2	220439988	220439988	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:220439988G>A	ENST00000243786.2	+	2	1021	c.841G>A	c.(841-843)Gtg>Atg	p.V281M		NM_002191.3	NP_002182.1	P05111	INHA_HUMAN	inhibin, alpha	281					cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|erythrocyte differentiation (GO:0030218)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|ovarian follicle development (GO:0001541)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|regulation of cell cycle (GO:0051726)|regulation of cell proliferation (GO:0042127)|response to external stimulus (GO:0009605)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|inhibin A complex (GO:0043512)|inhibin-betaglycan-ActRII complex (GO:0034673)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|receptor binding (GO:0005102)			large_intestine(2)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	10		Renal(207;0.0183)		Epithelial(149;4.58e-07)|all cancers(144;4.31e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		ACGGTGGATCGTGTACCCTCC	0.612																																						dbGAP											0													152.0	151.0	151.0					2																	220439988		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2444.1	2q35	2013-09-19			ENSG00000123999	ENSG00000123999			6065	protein-coding gene	gene with protein product		147380				3345731	Standard	NM_002191		Approved		uc002vmk.2	P05111	OTTHUMG00000059237	ENST00000243786.2:c.841G>A	2.37:g.220439988G>A	ENSP00000243786:p.Val281Met		A8K8H5	Missense_Mutation	SNP	pfam_TGF-b_C,smart_TGF-b_C,pirsf_Inhibin_asu_subgr,prints_Inhibin_asu	p.V281M	ENST00000243786.2	37	c.841	CCDS2444.1	2	.	.	.	.	.	.	.	.	.	.	G	20.8	4.042936	0.75732	.	.	ENSG00000123999	ENST00000243786	D	0.89746	-2.56	5.48	4.61	0.57282	Transforming growth factor beta, conserved site (1);Transforming growth factor-beta, C-terminal (3);	0.124714	0.53938	N	0.000059	D	0.94079	0.8102	M	0.82132	2.575	0.58432	D	0.999995	D	0.89917	1.0	D	0.81914	0.995	D	0.94156	0.7410	9	.	.	.	-19.6705	14.3619	0.66779	0.0712:0.0:0.9288:0.0	.	281	P05111	INHA_HUMAN	M	281	ENSP00000243786:V281M	.	V	+	1	0	INHA	220148232	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	6.956000	0.76013	1.309000	0.44985	0.561000	0.74099	GTG	INHA	-	pfam_TGF-b_C,smart_TGF-b_C,pirsf_Inhibin_asu_subgr,prints_Inhibin_asu	ENSG00000123999		0.612	INHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INHA	HGNC	protein_coding	OTTHUMT00000131425.1	82	0.00	0	G			220439988	220439988	+1	no_errors	ENST00000243786	ensembl	human	known	69_37n	missense	57	19.72	14	SNP	1.000	A
INSR	3643	genome.wustl.edu	37	19	7152896	7152896	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr19:7152896G>C	ENST00000302850.5	-	10	2214	c.2072C>G	c.(2071-2073)tCt>tGt	p.S691C	INSR_ENST00000341500.5_Missense_Mutation_p.S691C	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	691	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	AGAATCTTCAGACTCGAATGG	0.537																																						dbGAP											0													105.0	93.0	97.0					19																	7152896		2203	4300	6503	-	-	-	SO:0001583	missense	0			M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.2072C>G	19.37:g.7152896G>C	ENSP00000303830:p.Ser691Cys		Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Missense_Mutation	SNP	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,superfamily_Fibronectin_type3,smart_Furin_repeat,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom	p.S691C	ENST00000302850.5	37	c.2072	CCDS12176.1	19	.	.	.	.	.	.	.	.	.	.	g	5.354	0.250599	0.10130	.	.	ENSG00000171105	ENST00000302850;ENST00000341500	T;T	0.70869	-0.52;-0.52	5.55	4.52	0.55395	Fibronectin, type III (3);	0.552403	0.15195	U	0.275328	T	0.70666	0.3250	L	0.36672	1.1	0.22305	N	0.999214	P;P;B	0.38223	0.489;0.623;0.002	P;P;B	0.50754	0.447;0.649;0.005	T	0.62765	-0.6785	10	0.56958	D	0.05	.	8.5759	0.33598	0.1735:0.0:0.8265:0.0	.	682;691;691	Q86WY9;P06213-2;P06213	.;.;INSR_HUMAN	C	691	ENSP00000303830:S691C;ENSP00000342838:S691C	ENSP00000303830:S691C	S	-	2	0	INSR	7103896	0.980000	0.34600	0.327000	0.25402	0.105000	0.19272	2.042000	0.41222	1.357000	0.45904	0.598000	0.82781	TCT	INSR	-	pirsf_Tyr_kinase_insulin-like_rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000171105		0.537	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INSR	HGNC	protein_coding	OTTHUMT00000458544.1	41	0.00	0	G			7152896	7152896	-1	no_errors	ENST00000302850	ensembl	human	known	69_37n	missense	29	25.64	10	SNP	0.299	C
IQGAP3	128239	genome.wustl.edu	37	1	156531732	156531732	+	Silent	SNP	G	G	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:156531732G>T	ENST00000361170.2	-	10	949	c.939C>A	c.(937-939)ctC>ctA	p.L313L		NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	313					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GAAGGGCCTTGAGCAAGGCTT	0.532																																						dbGAP											0													88.0	78.0	81.0					1																	156531732		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.939C>A	1.37:g.156531732G>T			Q5T3H8	Silent	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_RasGAP	p.L313	ENST00000361170.2	37	c.939	CCDS1144.1	1																																																																																			IQGAP3	-	NULL	ENSG00000183856		0.532	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP3	HGNC	protein_coding	OTTHUMT00000080657.1	63	0.00	0	G	NM_178229		156531732	156531732	-1	no_errors	ENST00000361170	ensembl	human	known	69_37n	silent	70	14.63	12	SNP	0.084	T
ITLN2	142683	genome.wustl.edu	37	1	160924223	160924223	+	Silent	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:160924223G>C	ENST00000368029.3	-	2	90	c.33C>G	c.(31-33)ctC>ctG	p.L11L		NM_080878.2	NP_543154.1	Q8WWU7	ITLN2_HUMAN	intelectin 2	11						extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	19	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			ACAGGAAGCAGAGTCTGGTCA	0.507											OREG0013934	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													129.0	114.0	119.0					1																	160924223		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AY065973	CCDS1212.1	1q22-q23.5	2013-02-06			ENSG00000158764	ENSG00000158764		"""Fibrinogen C domain containing"""	20599	protein-coding gene	gene with protein product		609874				11181563	Standard	NM_080878		Approved	HL-2	uc001fxd.3	Q8WWU7	OTTHUMG00000028605	ENST00000368029.3:c.33C>G	1.37:g.160924223G>C		1812	Q17RR2|Q5VYI0	Silent	SNP	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C	p.L11	ENST00000368029.3	37	c.33	CCDS1212.1	1																																																																																			ITLN2	-	NULL	ENSG00000158764		0.507	ITLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITLN2	HGNC	protein_coding	OTTHUMT00000071465.1	83	0.00	0	G	NM_080878		160924223	160924223	-1	no_errors	ENST00000368029	ensembl	human	known	69_37n	silent	111	11.20	14	SNP	0.000	C
ITPR2	3709	genome.wustl.edu	37	12	26592094	26592094	+	Silent	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:26592094G>C	ENST00000381340.3	-	47	7025	c.6609C>G	c.(6607-6609)ctC>ctG	p.L2203L		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	2203					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	TTTCATTGTAGAGATCTTCTG	0.378																																						dbGAP											0													191.0	184.0	187.0					12																	26592094		1876	4118	5994	-	-	-	SO:0001819	synonymous_variant	0			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.6609C>G	12.37:g.26592094G>C			O94773	Silent	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.L2203	ENST00000381340.3	37	c.6609	CCDS41764.1	12																																																																																			ITPR2	-	NULL	ENSG00000123104		0.378	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	HGNC	protein_coding	OTTHUMT00000402732.1	60	0.00	0	G	NM_002223		26592094	26592094	-1	no_errors	ENST00000381340	ensembl	human	known	69_37n	silent	67	17.28	14	SNP	1.000	C
KCMF1	56888	genome.wustl.edu	37	2	85276734	85276734	+	Nonsense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:85276734C>T	ENST00000409785.4	+	6	1206	c.847C>T	c.(847-849)Cag>Tag	p.Q283*		NM_020122.4	NP_064507.3	Q9P0J7	KCMF1_HUMAN	potassium channel modulatory factor 1	283							ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			ovary(3)	3						AGAAAGCAGTCAGCAGACTCT	0.418																																						dbGAP											0													91.0	101.0	98.0					2																	85276734		2159	4267	6426	-	-	-	SO:0001587	stop_gained	0			AF155652	CCDS46350.1	2p11.2	2010-11-23			ENSG00000176407	ENSG00000176407		"""Zinc fingers, ZZ-type"""	20589	protein-coding gene	gene with protein product		614719					Standard	NM_020122		Approved	DEBT91, PCMF, DKFZP434L1021, ZZZ1	uc002sox.4	Q9P0J7	OTTHUMG00000153004	ENST00000409785.4:c.847C>T	2.37:g.85276734C>T	ENSP00000386738:p.Gln283*		Q4ZG04|Q53SC7|Q9BWK2|Q9H8P5|Q9UFE8	Nonsense_Mutation	SNP	pfam_Znf_ZZ,pfam_Di19_RING_finger_144,smart_Znf_ZZ,smart_Znf_C2H2-like,pfscan_Znf_ZZ,pfscan_Znf_C2H2	p.Q283*	ENST00000409785.4	37	c.847	CCDS46350.1	2	.	.	.	.	.	.	.	.	.	.	C	39	7.562757	0.98361	.	.	ENSG00000176407	ENST00000409785	.	.	.	5.82	5.82	0.92795	.	0.374405	0.30538	N	0.009419	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-4.9459	17.5929	0.88003	0.0:1.0:0.0:0.0	.	.	.	.	X	283	.	ENSP00000386738:Q283X	Q	+	1	0	KCMF1	85130245	1.000000	0.71417	0.999000	0.59377	0.977000	0.68977	4.408000	0.59761	2.752000	0.94435	0.655000	0.94253	CAG	KCMF1	-	NULL	ENSG00000176407		0.418	KCMF1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	KCMF1	HGNC	protein_coding	OTTHUMT00000328942.4	106	0.00	0	C	NM_020122		85276734	85276734	+1	no_errors	ENST00000409785	ensembl	human	known	69_37n	nonsense	101	12.17	14	SNP	1.000	T
KCND3	3752	genome.wustl.edu	37	1	112319680	112319680	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:112319680G>A	ENST00000315987.2	-	7	2213	c.1734C>T	c.(1732-1734)atC>atT	p.I578I	KCND3_ENST00000369697.1_Silent_p.I559I|KCND3_ENST00000302127.4_Silent_p.I559I	NM_004980.4	NP_004971.2	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 3	578					cell death (GO:0008219)|membrane repolarization (GO:0086009)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	49		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	CACTGCCCTGGATGTGGATCG	0.562																																						dbGAP											0													124.0	106.0	112.0					1																	112319680		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF048713	CCDS843.1, CCDS844.1	1p13.2	2014-09-17			ENSG00000171385	ENSG00000171385		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6239	protein-coding gene	gene with protein product		605411	"""spinocerebellar ataxia 22"", ""spinocerebellar ataxia 19"""	SCA22, SCA19		10942109, 16382104, 23280837	Standard	NM_172198		Approved	Kv4.3, KSHIVB	uc001ebu.1	Q9UK17	OTTHUMG00000011989	ENST00000315987.2:c.1734C>T	1.37:g.112319680G>A			O60576|O60577|Q14D71|Q5T0M0|Q9UH85|Q9UH86|Q9UK16	Silent	SNP	pfam_K_chnl_volt-dep_Kv4_C,pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Shal-type,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv4,prints_K_chnl_volt-dep_Kv4.3,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv3	p.I578	ENST00000315987.2	37	c.1734	CCDS843.1	1																																																																																			KCND3	-	NULL	ENSG00000171385		0.562	KCND3-001	KNOWN	basic|CCDS	protein_coding	KCND3	HGNC	protein_coding	OTTHUMT00000033144.1	80	0.00	0	G	NM_172198		112319680	112319680	-1	no_errors	ENST00000315987	ensembl	human	known	69_37n	silent	90	14.29	15	SNP	1.000	A
KCNG4	93107	genome.wustl.edu	37	16	84256443	84256443	+	Nonsense_Mutation	SNP	C	C	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr16:84256443C>A	ENST00000308251.4	-	3	1008	c.940G>T	c.(940-942)Gag>Tag	p.E314*		NM_172347.2	NP_758857.1	Q8TDN1	KCNG4_HUMAN	potassium voltage-gated channel, subfamily G, member 4	314					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	31						GGGGGCTCCTCAGACACCGCC	0.637																																						dbGAP											0													46.0	50.0	49.0					16																	84256443		2200	4300	6500	-	-	-	SO:0001587	stop_gained	0			AF348984	CCDS10945.1	16q24.1	2011-07-05			ENSG00000168418	ENSG00000168418		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19697	protein-coding gene	gene with protein product		607603				12060745, 16382104	Standard	NM_172347		Approved	Kv6.4	uc010voc.2	Q8TDN1	OTTHUMG00000137638	ENST00000308251.4:c.940G>T	16.37:g.84256443C>A	ENSP00000312129:p.Glu314*		Q96H24	Nonsense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,prints_K_chnl,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.E314*	ENST00000308251.4	37	c.940	CCDS10945.1	16	.	.	.	.	.	.	.	.	.	.	C	13.99	2.402249	0.42613	.	.	ENSG00000168418	ENST00000308251	.	.	.	5.61	3.67	0.42095	.	1.269850	0.05090	N	0.485159	.	.	.	.	.	.	0.21416	N	0.999691	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	.	11.0082	0.47646	0.0:0.8516:0.0:0.1484	.	.	.	.	X	314	.	ENSP00000312129:E314X	E	-	1	0	KCNG4	82813944	0.994000	0.37717	0.003000	0.11579	0.068000	0.16541	3.991000	0.56973	0.736000	0.32559	-0.136000	0.14681	GAG	KCNG4	-	pfam_Ion_trans_dom	ENSG00000168418		0.637	KCNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNG4	HGNC	protein_coding	OTTHUMT00000269079.2	43	0.00	0	C	NM_172347		84256443	84256443	-1	no_errors	ENST00000308251	ensembl	human	known	69_37n	nonsense	25	48.98	24	SNP	0.016	A
KCNH4	23415	genome.wustl.edu	37	17	40323836	40323836	+	Nonsense_Mutation	SNP	C	C	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr17:40323836C>A	ENST00000264661.3	-	7	1497	c.1165G>T	c.(1165-1167)Gag>Tag	p.E389*	KCNH4_ENST00000607371.1_Nonsense_Mutation_p.E389*	NM_012285.2	NP_036417.1	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 4	389					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|urinary_tract(1)	32		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TCATTGGCCTCCATCTCCCGG	0.607																																					NSCLC(117;707 1703 2300 21308 31858)	dbGAP											0													81.0	76.0	78.0					17																	40323836		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB022698	CCDS11420.1	17q21	2012-07-05				ENSG00000089558		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6253	protein-coding gene	gene with protein product		604528				10455180, 16382104	Standard	NM_012285		Approved	Kv12.3, elk1	uc002hzb.2	Q9UQ05		ENST00000264661.3:c.1165G>T	17.37:g.40323836C>A	ENSP00000264661:p.Glu389*			Nonsense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Ion_trans_2,pfam_PAS_fold_3,pfam_PAS_fold,pfam_PAS_4,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_PAC,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,tigrfam_PAS	p.E389*	ENST00000264661.3	37	c.1165	CCDS11420.1	17	.	.	.	.	.	.	.	.	.	.	C	41	8.607146	0.98884	.	.	ENSG00000089558	ENST00000264661	.	.	.	4.92	4.92	0.64577	.	0.000000	0.41294	D	0.000911	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	.	11.1291	0.48336	0.0:0.9158:0.0:0.0842	.	.	.	.	X	389	.	ENSP00000264661:E389X	E	-	1	0	KCNH4	37577362	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.715000	0.68430	2.720000	0.93068	0.561000	0.74099	GAG	KCNH4	-	pfam_Ion_trans_dom	ENSG00000089558		0.607	KCNH4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	KCNH4	HGNC	protein_coding	OTTHUMT00000449791.2	22	0.00	0	C	NM_012285		40323836	40323836	-1	no_errors	ENST00000264661	ensembl	human	known	69_37n	nonsense	18	37.93	11	SNP	1.000	A
KCTD4	386618	genome.wustl.edu	37	13	45768346	45768346	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr13:45768346G>A	ENST00000379108.1	-	1	506	c.357C>T	c.(355-357)ctC>ctT	p.L119L	KCTD4_ENST00000405872.1_Silent_p.L119L|GTF2F2_ENST00000340473.6_Intron			Q8WVF5	KCTD4_HUMAN	potassium channel tetramerization domain containing 4	119	BTB.				protein homooligomerization (GO:0051260)					breast(1)|endometrium(1)|large_intestine(2)|lung(4)	8		Lung NSC(96;6.55e-05)|Breast(139;0.00378)|Prostate(109;0.00438)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000249)|BRCA - Breast invasive adenocarcinoma(63;0.207)		CCAGTCCCTTGAGCTGAAAGA	0.443																																						dbGAP											0													104.0	103.0	103.0					13																	45768346		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC018063	CCDS9396.1	13q14.12-q14.13	2013-06-20	2013-06-20		ENSG00000180332	ENSG00000180332			23227	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 4"""				Standard	NM_198404		Approved	bA321C24.3	uc001uzx.4	Q8WVF5	OTTHUMG00000016844	ENST00000379108.1:c.357C>T	13.37:g.45768346G>A			Q5W0P9	Silent	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.L119	ENST00000379108.1	37	c.357	CCDS9396.1	13																																																																																			KCTD4	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	ENSG00000180332		0.443	KCTD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD4	HGNC	protein_coding	OTTHUMT00000044757.1	56	0.00	0	G			45768346	45768346	-1	no_errors	ENST00000379108	ensembl	human	known	69_37n	silent	45	21.05	12	SNP	1.000	A
KDELC2	143888	genome.wustl.edu	37	11	108357153	108357153	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr11:108357153C>G	ENST00000323468.5	-	3	480	c.415G>C	c.(415-417)Gag>Cag	p.E139Q	KDELC2_ENST00000434945.2_Missense_Mutation_p.E83Q|KDELC2_ENST00000375648.1_Missense_Mutation_p.E83Q|KDELC2_ENST00000532730.1_5'Flank	NM_153705.4	NP_714916.3	Q7Z4H8	KDEL2_HUMAN	KDEL (Lys-Asp-Glu-Leu) containing 2	139						endoplasmic reticulum (GO:0005783)				breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13		all_cancers(61;1.38e-11)|all_epithelial(67;3.16e-07)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;6.93e-06)|BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|all cancers(92;0.00016)|OV - Ovarian serous cystadenocarcinoma(223;0.132)|Colorectal(284;0.14)		TCACAGTACTCATGGTACACT	0.488																																						dbGAP											0													80.0	76.0	77.0					11																	108357153		1967	4146	6113	-	-	-	SO:0001583	missense	0			AF533708	CCDS41711.1	11q32	2010-11-18			ENSG00000178202	ENSG00000178202			28496	protein-coding gene	gene with protein product						12975309	Standard	NM_153705		Approved	MGC33424	uc001pkj.2	Q7Z4H8	OTTHUMG00000166535	ENST00000323468.5:c.415G>C	11.37:g.108357153C>G	ENSP00000315386:p.Glu139Gln		Q6UWW2|Q6ZUM9|Q8N7L8|Q8NE24	Missense_Mutation	SNP	pfam_LipoPS_modifying,pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,smart_LipoPS_modifying,pfscan_Filamin/ABP280_repeat-like	p.E139Q	ENST00000323468.5	37	c.415	CCDS41711.1	11	.	.	.	.	.	.	.	.	.	.	C	25.7	4.665122	0.88251	.	.	ENSG00000178202	ENST00000323468;ENST00000434945;ENST00000375648	T;T;T	0.24350	1.86;1.9;2.16	4.68	4.68	0.58851	.	0.000000	0.85682	D	0.000000	T	0.55862	0.1947	M	0.82323	2.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.987;0.994	T	0.59402	-0.7461	10	0.54805	T	0.06	-7.4991	18.9021	0.92446	0.0:1.0:0.0:0.0	.	139;83	Q7Z4H8;Q7Z4H8-2	KDEL2_HUMAN;.	Q	139;83;83	ENSP00000315386:E139Q;ENSP00000413429:E83Q;ENSP00000364799:E83Q	ENSP00000315386:E139Q	E	-	1	0	KDELC2	107862363	1.000000	0.71417	0.992000	0.48379	0.915000	0.54546	5.544000	0.67231	2.871000	0.98454	0.655000	0.94253	GAG	KDELC2	-	NULL	ENSG00000178202		0.488	KDELC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDELC2	HGNC	protein_coding	OTTHUMT00000390273.1	45	0.00	0	C	NM_153705		108357153	108357153	-1	no_errors	ENST00000323468	ensembl	human	known	69_37n	missense	34	12.82	5	SNP	1.000	G
KDM1A	23028	genome.wustl.edu	37	1	23408840	23408840	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:23408840C>G	ENST00000356634.3	+	18	2503	c.2354C>G	c.(2353-2355)tCg>tGg	p.S785W	RP1-184J9.2_ENST00000427154.1_RNA|KDM1A_ENST00000400181.4_Missense_Mutation_p.S809W|KDM1A_ENST00000542151.1_Missense_Mutation_p.S809W	NM_015013.3	NP_055828.2	O60341	KDM1A_HUMAN	lysine (K)-specific demethylase 1A	785	Demethylase activity.				blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|histone H3-K4 demethylation (GO:0034720)|histone H3-K9 demethylation (GO:0033169)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of DNA binding (GO:0043392)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of protein binding (GO:0032091)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein demethylation (GO:0006482)|regulation of primitive erythrocyte differentiation (GO:0010725)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|demethylase activity (GO:0032451)|enzyme binding (GO:0019899)|flavin adenine dinucleotide binding (GO:0050660)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-K4 specific) (GO:0032453)|histone demethylase activity (H3-K9 specific) (GO:0032454)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|MRF binding (GO:0043426)|oxidoreductase activity (GO:0016491)|p53 binding (GO:0002039)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(2)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						CCTGGCCCCTCGATTCCAGGT	0.488																																						dbGAP											0													62.0	62.0	62.0					1																	23408840		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL031428	CCDS30627.1, CCDS53278.1	1p36.12	2011-07-01	2009-09-29	2009-09-29	ENSG00000004487	ENSG00000004487		"""Chromatin-modifying enzymes / K-demethylases"""	29079	protein-coding gene	gene with protein product		609132	"""amine oxidase (flavin containing) domain 2"", ""lysine (K)-specific demethylase 1"""	AOF2, KDM1		9628581, 12493763	Standard	NM_015013		Approved	KIAA0601, BHC110, LSD1	uc001bgj.2	O60341	OTTHUMG00000003220	ENST00000356634.3:c.2354C>G	1.37:g.23408840C>G	ENSP00000349049:p.Ser785Trp		A8MWP9|Q5TH94|Q5TH95|Q86VT7|Q8IXK4|Q8NDP6|Q8TAZ3|Q96AW4	Missense_Mutation	SNP	pfam_Amino_oxidase,pfam_SWIRM,pfam_FAD-dep_OxRdtase,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_FAD_bind_dom,superfamily_Homeodomain-like,pirsf_Hist_Lys-spec_deMease,pfscan_SWIRM	p.S809W	ENST00000356634.3	37	c.2426	CCDS30627.1	1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.061915	0.76187	.	.	ENSG00000004487	ENST00000356634;ENST00000400181;ENST00000542151	T;T;T	0.35605	1.31;1.3;1.3	5.78	4.84	0.62591	Amine oxidase (1);	0.051576	0.85682	D	0.000000	T	0.46964	0.1420	M	0.72894	2.215	0.80722	D	1	D;D	0.61080	0.985;0.989	P;P	0.48334	0.562;0.574	T	0.53844	-0.8381	10	0.72032	D	0.01	-19.9425	16.0459	0.80720	0.0:0.8665:0.1335:0.0	.	809;785	O60341-2;O60341	.;KDM1A_HUMAN	W	785;809;809	ENSP00000349049:S785W;ENSP00000383042:S809W;ENSP00000439072:S809W	ENSP00000349049:S785W	S	+	2	0	KDM1A	23281427	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.818000	0.86416	2.735000	0.93741	0.650000	0.86243	TCG	KDM1A	-	pfam_Amino_oxidase,pirsf_Hist_Lys-spec_deMease	ENSG00000004487		0.488	KDM1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KDM1A	HGNC	protein_coding	OTTHUMT00000008880.3	71	0.00	0	C	NM_015013		23408840	23408840	+1	no_errors	ENST00000542151	ensembl	human	known	69_37n	missense	54	19.40	13	SNP	1.000	G
KDM4C	23081	genome.wustl.edu	37	9	6984402	6984402	+	Missense_Mutation	SNP	C	C	T	rs560944389		TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr9:6984402C>T	ENST00000381309.3	+	10	1917	c.1352C>T	c.(1351-1353)tCa>tTa	p.S451L	KDM4C_ENST00000381306.3_Missense_Mutation_p.S451L|KDM4C_ENST00000442236.2_Missense_Mutation_p.S270L|KDM4C_ENST00000543771.1_Missense_Mutation_p.S451L|KDM4C_ENST00000536108.1_Missense_Mutation_p.S270L|KDM4C_ENST00000535193.1_Missense_Mutation_p.S473L|KDM4C_ENST00000428870.2_Missense_Mutation_p.S138L	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	451					histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						ATCAAACTCTCAGGTGAGAAG	0.413																																						dbGAP											0													112.0	101.0	104.0					9																	6984402		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.1352C>T	9.37:g.6984402C>T	ENSP00000370710:p.Ser451Leu		B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,superfamily_Chorismate_mutase_type_II,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.S451L	ENST00000381309.3	37	c.1352	CCDS6471.1	9	.	.	.	.	.	.	.	.	.	.	C	15.97	2.989306	0.53934	.	.	ENSG00000107077	ENST00000535193;ENST00000543771;ENST00000381309;ENST00000381306;ENST00000442236;ENST00000536108;ENST00000428870	T;T;T;T;T;T;T	0.28069	1.89;1.92;2.13;2.01;2.23;1.63;2.98	5.36	5.36	0.76844	.	7.242560	0.00166	N	0.000002	T	0.34774	0.0909	L	0.29908	0.895	0.43000	D	0.994514	B;B;B;B;B	0.32071	0.041;0.161;0.355;0.004;0.017	B;B;B;B;B	0.30495	0.037;0.116;0.115;0.002;0.005	T	0.24548	-1.0157	10	0.49607	T	0.09	-18.944	19.4448	0.94843	0.0:1.0:0.0:0.0	.	270;451;473;451;451	E7EV17;F5H347;F5H7P0;Q9H3R0;Q9H3R0-2	.;.;.;KDM4C_HUMAN;.	L	473;451;451;451;270;270;138	ENSP00000442382:S473L;ENSP00000445427:S451L;ENSP00000370710:S451L;ENSP00000370707:S451L;ENSP00000409353:S270L;ENSP00000440656:S270L;ENSP00000405739:S138L	ENSP00000370707:S451L	S	+	2	0	KDM4C	6974402	1.000000	0.71417	0.865000	0.33974	0.704000	0.40688	4.014000	0.57145	2.668000	0.90789	0.561000	0.74099	TCA	KDM4C	-	NULL	ENSG00000107077		0.413	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4C	HGNC	protein_coding	OTTHUMT00000051692.1	23	0.00	0	C	NM_015061		6984402	6984402	+1	no_errors	ENST00000381309	ensembl	human	known	69_37n	missense	13	30.00	6	SNP	0.992	T
CLUH	23277	genome.wustl.edu	37	17	2601227	2601227	+	Missense_Mutation	SNP	G	G	T	rs370715380	byFrequency	TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr17:2601227G>T	ENST00000570628.2	-	10	1915	c.1810C>A	c.(1810-1812)Ctg>Atg	p.L604M	CLUH_ENST00000435359.1_Missense_Mutation_p.L604M|CLUH_ENST00000538975.1_Missense_Mutation_p.L604M			O75153	CLU_HUMAN	clustered mitochondria (cluA/CLU1) homolog	604					intracellular distribution of mitochondria (GO:0048312)	cytoplasm (GO:0005737)											TCCTGGCGCAGGCAGCAGAGC	0.751																																						dbGAP											0													7.0	9.0	9.0					17																	2601227		1932	4041	5973	-	-	-	SO:0001583	missense	0			AB014564	CCDS45572.1	17p13.3	2012-12-18	2012-11-30	2012-11-30	ENSG00000132361	ENSG00000132361			29094	protein-coding gene	gene with protein product			"""KIAA0664"""	KIAA0664			Standard	XM_005256567		Approved	CLU1	uc002fuy.1	O75153	OTTHUMG00000177575	ENST00000570628.2:c.1810C>A	17.37:g.2601227G>T	ENSP00000458986:p.Leu604Met		Q6AHY2|Q6P3X7|Q6ZUG8|Q8N4U7|Q9BTA3|Q9H979	Missense_Mutation	SNP	superfamily_GSKIP/TIF31_domain	p.L604M	ENST00000570628.2	37	c.1810	CCDS45572.1	17	.	.	.	.	.	.	.	.	.	.	G	19.95	3.921909	0.73213	.	.	ENSG00000132361	ENST00000435359;ENST00000322335;ENST00000538975	D;D	0.89810	-2.57;-2.57	5.53	4.55	0.56014	.	0.000000	0.85682	D	0.000000	D	0.93822	0.8024	M	0.86028	2.79	0.58432	D	0.999999	D;D	0.67145	0.996;0.996	D;D	0.66847	0.947;0.947	D	0.93863	0.7155	10	0.62326	D	0.03	.	10.8886	0.46981	0.088:0.0:0.912:0.0	.	604;604	O75153;C9J6D7	K0664_HUMAN;.	M	604	ENSP00000388872:L604M;ENSP00000439628:L604M	ENSP00000320468:L604M	L	-	1	2	KIAA0664	2547977	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.524000	0.60552	1.311000	0.45024	0.655000	0.94253	CTG	KIAA0664	-	NULL	ENSG00000132361		0.751	CLUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0664	HGNC	protein_coding	OTTHUMT00000437807.2	9	0.00	0	G	NM_015229		2601227	2601227	-1	no_errors	ENST00000435359	ensembl	human	known	69_37n	missense	10	33.33	5	SNP	1.000	T
KIAA0753	9851	genome.wustl.edu	37	17	6510269	6510269	+	Missense_Mutation	SNP	C	C	G	rs74397983		TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr17:6510269C>G	ENST00000361413.3	-	12	2291	c.1933G>C	c.(1933-1935)Gat>Cat	p.D645H	KIAA0753_ENST00000589033.1_Missense_Mutation_p.D101H|KIAA0753_ENST00000572370.1_Missense_Mutation_p.D346H|KIAA0753_ENST00000575027.1_5'Flank|KIAA0753_ENST00000542606.1_Missense_Mutation_p.D346H	NM_014804.2	NP_055619.2	Q2KHM9	K0753_HUMAN	KIAA0753	645						centrosome (GO:0005813)|cytoplasm (GO:0005737)				endometrium(4)|large_intestine(11)|lung(5)|prostate(4)	24				COAD - Colon adenocarcinoma(228;0.157)		GTTTCAGCATCAAGCCAATCA	0.468																																						dbGAP											0													129.0	121.0	124.0					17																	6510269		1899	4123	6022	-	-	-	SO:0001583	missense	0				CCDS42247.1	17p13.1	2014-04-04			ENSG00000198920	ENSG00000198920			29110	protein-coding gene	gene with protein product						24613305	Standard	NM_014804		Approved		uc002gde.4	Q2KHM9	OTTHUMG00000177928	ENST00000361413.3:c.1933G>C	17.37:g.6510269C>G	ENSP00000355250:p.Asp645His		A8KA11|B7Z479|O94853|Q05D97|Q2KHN0|Q9UG45	Missense_Mutation	SNP	NULL	p.D645H	ENST00000361413.3	37	c.1933	CCDS42247.1	17	.	.	.	.	.	.	.	.	.	.	C	15.43	2.832626	0.50845	.	.	ENSG00000198920	ENST00000361413;ENST00000542606;ENST00000542826	D;D	0.86097	-2.07;-2.07	4.34	4.34	0.51931	.	0.459736	0.24222	N	0.040429	D	0.88691	0.6505	L	0.59436	1.845	0.31980	N	0.60607	D	0.63046	0.992	P	0.60473	0.875	D	0.88980	0.3407	10	0.46703	T	0.11	-6.8456	13.097	0.59197	0.0:1.0:0.0:0.0	.	645	Q2KHM9	K0753_HUMAN	H	645;346;101	ENSP00000355250:D645H;ENSP00000444634:D346H	ENSP00000355250:D645H	D	-	1	0	KIAA0753	6450993	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.078000	0.30754	2.341000	0.79615	0.655000	0.94253	GAT	KIAA0753	-	NULL	ENSG00000198920		0.468	KIAA0753-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0753	HGNC	protein_coding	OTTHUMT00000439769.3	102	0.00	0	C	NM_014804		6510269	6510269	-1	no_errors	ENST00000361413	ensembl	human	known	69_37n	missense	81	18.27	19	SNP	1.000	G
KIAA0753	9851	genome.wustl.edu	37	17	6510571	6510571	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr17:6510571C>T	ENST00000361413.3	-	11	2207	c.1849G>A	c.(1849-1851)Gaa>Aaa	p.E617K	KIAA0753_ENST00000589033.1_Missense_Mutation_p.E73K|KIAA0753_ENST00000572370.1_Missense_Mutation_p.E318K|KIAA0753_ENST00000575027.1_5'Flank|KIAA0753_ENST00000542606.1_Missense_Mutation_p.E318K	NM_014804.2	NP_055619.2	Q2KHM9	K0753_HUMAN	KIAA0753	617						centrosome (GO:0005813)|cytoplasm (GO:0005737)				endometrium(4)|large_intestine(11)|lung(5)|prostate(4)	24				COAD - Colon adenocarcinoma(228;0.157)		TTGGAAGTTTCAGCATCAAGC	0.418																																						dbGAP											0													137.0	133.0	134.0					17																	6510571		1906	4130	6036	-	-	-	SO:0001583	missense	0				CCDS42247.1	17p13.1	2014-04-04			ENSG00000198920	ENSG00000198920			29110	protein-coding gene	gene with protein product						24613305	Standard	NM_014804		Approved		uc002gde.4	Q2KHM9	OTTHUMG00000177928	ENST00000361413.3:c.1849G>A	17.37:g.6510571C>T	ENSP00000355250:p.Glu617Lys		A8KA11|B7Z479|O94853|Q05D97|Q2KHN0|Q9UG45	Missense_Mutation	SNP	NULL	p.E617K	ENST00000361413.3	37	c.1849	CCDS42247.1	17	.	.	.	.	.	.	.	.	.	.	C	15.76	2.929431	0.52759	.	.	ENSG00000198920	ENST00000361413;ENST00000542606;ENST00000542826	D;D	0.86497	-2.13;-2.13	5.31	4.35	0.52113	.	0.377513	0.29198	N	0.012858	D	0.86003	0.5829	M	0.76838	2.35	0.27524	N	0.951312	B	0.19073	0.033	B	0.19946	0.027	T	0.79952	-0.1586	10	0.54805	T	0.06	-17.9994	9.8502	0.41053	0.0:0.9085:0.0:0.0915	.	617	Q2KHM9	K0753_HUMAN	K	617;318;73	ENSP00000355250:E617K;ENSP00000444634:E318K	ENSP00000355250:E617K	E	-	1	0	KIAA0753	6451295	0.867000	0.29959	1.000000	0.80357	0.999000	0.98932	1.340000	0.33896	1.627000	0.50400	0.650000	0.86243	GAA	KIAA0753	-	NULL	ENSG00000198920		0.418	KIAA0753-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0753	HGNC	protein_coding	OTTHUMT00000439769.3	98	0.00	0	C	NM_014804		6510571	6510571	-1	no_errors	ENST00000361413	ensembl	human	known	69_37n	missense	66	35.92	37	SNP	1.000	T
KIAA0100	9703	genome.wustl.edu	37	17	26948468	26948468	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr17:26948468C>G	ENST00000528896.2	-	27	5082	c.5008G>C	c.(5008-5010)Gag>Cag	p.E1670Q	KIAA0100_ENST00000389003.3_Missense_Mutation_p.E1527Q|KIAA0100_ENST00000579924.2_5'Flank|KIAA0100_ENST00000544884.1_Missense_Mutation_p.E1527Q	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	1670						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					TCCATCAGCTCCTGCACAGAG	0.547																																						dbGAP											0													107.0	98.0	101.0					17																	26948468		2203	4300	6503	-	-	-	SO:0001583	missense	0			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.5008G>C	17.37:g.26948468C>G	ENSP00000436773:p.Glu1670Gln		A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	pfam_FMP27_C,pfam_FMP27_N,pfam_FMP27_GFWDK_dom	p.E1670Q	ENST00000528896.2	37	c.5008	CCDS32595.1	17	.	.	.	.	.	.	.	.	.	.	C	21.8	4.206788	0.79127	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.25250	1.81;1.81	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.36717	0.0977	N	0.22421	0.69	0.80722	D	1	D	0.63880	0.993	D	0.72982	0.979	T	0.03184	-1.1063	10	0.20519	T	0.43	.	18.2554	0.90017	0.0:1.0:0.0:0.0	.	1670	Q14667	K0100_HUMAN	Q	1670;1640;1670;1527	ENSP00000436773:E1670Q;ENSP00000446443:E1527Q	ENSP00000005905:E1670Q	E	-	1	0	KIAA0100	23972595	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.277000	0.78572	2.826000	0.97356	0.491000	0.48974	GAG	KIAA0100	-	NULL	ENSG00000007202		0.547	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0100	HGNC	protein_coding	OTTHUMT00000390571.3	38	0.00	0	C	NM_014680		26948468	26948468	-1	no_errors	ENST00000005905	ensembl	human	known	69_37n	missense	19	20.83	5	SNP	1.000	G
KIAA1551	55196	genome.wustl.edu	37	12	32137175	32137175	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:32137175G>A	ENST00000312561.4	+	4	3700	c.3286G>A	c.(3286-3288)Gac>Aac	p.D1096N	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	1096																	AACCAGTTCTGACTCCAAAGA	0.403																																						dbGAP											0													66.0	65.0	65.0					12																	32137175		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.3286G>A	12.37:g.32137175G>A	ENSP00000310338:p.Asp1096Asn		B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	NULL	p.D1096N	ENST00000312561.4	37	c.3286	CCDS8725.2	12	.	.	.	.	.	.	.	.	.	.	G	24.4	4.530682	0.85706	.	.	ENSG00000174718	ENST00000312561	T	0.13538	2.58	5.37	2.42	0.29668	.	0.477197	0.19206	N	0.120045	T	0.13927	0.0337	M	0.62723	1.935	0.09310	N	1	P	0.40332	0.713	B	0.36845	0.234	T	0.08827	-1.0703	9	.	.	.	.	9.4958	0.38986	0.0766:0.4088:0.5146:0.0	.	1096	Q9HCM1	CL035_HUMAN	N	1096	ENSP00000310338:D1096N	.	D	+	1	0	C12orf35	32028442	0.014000	0.17966	0.000000	0.03702	0.896000	0.52359	0.500000	0.22562	0.207000	0.20607	0.563000	0.77884	GAC	KIAA1551	-	NULL	ENSG00000174718		0.403	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1551	HGNC	protein_coding	OTTHUMT00000250307.2	51	0.00	0	G	NM_018169		32137175	32137175	+1	no_errors	ENST00000312561	ensembl	human	known	69_37n	missense	51	12.07	7	SNP	0.002	A
KIAA1804	84451	genome.wustl.edu	37	1	233515233	233515233	+	Silent	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:233515233C>G	ENST00000366624.3	+	9	2742	c.2481C>G	c.(2479-2481)gtC>gtG	p.V827V	MLK4_ENST00000366622.1_Silent_p.V273V	NM_032435.2	NP_115811.2																					GTGCACCTGTCACTTGTGACT	0.542																																						dbGAP											0													89.0	75.0	80.0					1																	233515233		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000366624.3:c.2481C>G	1.37:g.233515233C>G				Silent	SNP	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom	p.V827	ENST00000366624.3	37	c.2481	CCDS1598.1	1																																																																																			RP5-862P8.2	-	pirsf_MAPKKK9/10/11	ENSG00000143674		0.542	MLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1804	Clone_based_vega_gene	protein_coding	OTTHUMT00000092495.1	41	0.00	0	C			233515233	233515233	+1	no_errors	ENST00000366624	ensembl	human	known	69_37n	silent	48	18.64	11	SNP	0.000	G
CCAR2	57805	genome.wustl.edu	37	8	22476366	22476366	+	Frame_Shift_Del	DEL	G	G	-			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr8:22476366delG	ENST00000308511.4	+	19	2608	c.2359delG	c.(2359-2361)gggfs	p.G787fs	BIN3_ENST00000519335.1_5'Flank|CCAR2_ENST00000520861.1_Frame_Shift_Del_p.G462fs|RP11-582J16.5_ENST00000521025.1_RNA|CCAR2_ENST00000389279.3_Frame_Shift_Del_p.G787fs			Q8N163	CCAR2_HUMAN	cell cycle and apoptosis regulator 2	787	Interaction with NR1D1. {ECO:0000269|PubMed:23398316}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mRNA processing (GO:0006397)|negative regulation of catalytic activity (GO:0043086)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage checkpoint (GO:2000003)|regulation of circadian rhythm (GO:0042752)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of protein stability (GO:0031647)|response to UV (GO:0009411)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|DBIRD complex (GO:0044609)|mitochondrial matrix (GO:0005759)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)										GCCCCCTCCTGGGAAAAGCAC	0.607																																						dbGAP											0													79.0	93.0	88.0					8																	22476366		2203	4298	6501	-	-	-	SO:0001589	frameshift_variant	0			AL834351	CCDS34863.1	8p22	2013-08-22	2013-08-22	2013-08-22		ENSG00000158941			23360	protein-coding gene	gene with protein product	"""deleted in breast cancer"""	607359	"""KIAA1967"""	KIAA1967		12370419	Standard	NM_021174		Approved	DBC-1, DBC1, NET35	uc003xci.3	Q8N163		ENST00000308511.4:c.2359delG	8.37:g.22476366delG	ENSP00000310670:p.Gly787fs		A6NL03|B2RB79|D3DSR6|Q6P0Q9|Q8N3G7|Q8N8M1|Q8TF34|Q9H9Q9|Q9HD12|Q9NT55	Frame_Shift_Del	DEL	superfamily_NA-bd_OB-fold-like	p.S789fs	ENST00000308511.4	37	c.2359	CCDS34863.1	8																																																																																			KIAA1967	-	NULL	ENSG00000158941		0.607	CCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1967	HGNC	protein_coding	OTTHUMT00000375865.1	44	0.00	0	G	NM_021174		22476366	22476366	+1	no_errors	ENST00000308511	ensembl	human	known	69_37n	frame_shift_del	25	33.33	13	DEL	0.998	-
KLHDC9	126823	genome.wustl.edu	37	1	161069897	161069897	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:161069897G>A	ENST00000368011.4	+	4	1075	c.933G>A	c.(931-933)ggG>ggA	p.G311G	KLHDC9_ENST00000490724.2_3'UTR|KLHDC9_ENST00000392192.2_3'UTR|PFDN2_ENST00000468311.1_5'Flank	NM_152366.4	NP_689579.3	Q8NEP7	KLDC9_HUMAN	kelch domain containing 9	311										lung(5)|upper_aerodigestive_tract(1)	6	all_cancers(52;1.28e-19)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			CAGATCGTGGGATGAAACGCA	0.537																																						dbGAP											0													233.0	192.0	206.0					1																	161069897		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC022077	CCDS30919.1, CCDS41425.1	1q23.3	2008-02-05			ENSG00000162755	ENSG00000162755			28489	protein-coding gene	gene with protein product	"""kelch/ankyrin repeat containing cyclin A1 interacting protein"""					15159402	Standard	NM_152366		Approved	KARCA1	uc001fxr.3	Q8NEP7	OTTHUMG00000031479	ENST00000368011.4:c.933G>A	1.37:g.161069897G>A			Q5SY56|Q6NXT9|Q6PKN4|Q8N5E1|Q8NA16	Silent	SNP	superfamily_Gal_Oxase/kelch_b-propeller	p.G311	ENST00000368011.4	37	c.933	CCDS30919.1	1																																																																																			KLHDC9	-	superfamily_Gal_Oxase/kelch_b-propeller	ENSG00000162755		0.537	KLHDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC9	HGNC	protein_coding	OTTHUMT00000077092.1	74	0.00	0	G	NM_152366		161069897	161069897	+1	no_errors	ENST00000368011	ensembl	human	known	69_37n	silent	110	21.43	30	SNP	0.001	A
LAMB4	22798	genome.wustl.edu	37	7	107708601	107708601	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr7:107708601C>T	ENST00000388781.3	-	19	2389	c.2306G>A	c.(2305-2307)tGc>tAc	p.C769Y	LAMB4_ENST00000205386.4_Missense_Mutation_p.C769Y|LAMB4_ENST00000388780.3_Missense_Mutation_p.C769Y	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	769	Laminin EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00460}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						GTGACACTTGCAGGCTGCAAG	0.537																																						dbGAP											0													57.0	58.0	58.0					7																	107708601		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.2306G>A	7.37:g.107708601C>T	ENSP00000373433:p.Cys769Tyr		A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.C769Y	ENST00000388781.3	37	c.2306	CCDS34732.1	7	.	.	.	.	.	.	.	.	.	.	C	22.0	4.230640	0.79688	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000388780	D;D;D	0.94330	-3.4;-3.4;-3.4	5.15	4.26	0.50523	EGF-like, laminin (3);	0.000000	0.64402	D	0.000011	D	0.97760	0.9265	H	0.97103	3.94	0.80722	D	1	D	0.76494	0.999	D	0.71414	0.973	D	0.99379	1.0922	10	0.87932	D	0	.	15.6658	0.77227	0.1377:0.8623:0.0:0.0	.	769	A4D0S4	LAMB4_HUMAN	Y	769	ENSP00000205386:C769Y;ENSP00000373433:C769Y;ENSP00000373432:C769Y	ENSP00000205386:C769Y	C	-	2	0	LAMB4	107495837	1.000000	0.71417	0.995000	0.50966	0.993000	0.82548	4.280000	0.58959	1.510000	0.48803	0.655000	0.94253	TGC	LAMB4	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000091128		0.537	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB4	HGNC	protein_coding	OTTHUMT00000337442.1	30	0.00	0	C	XM_209857		107708601	107708601	-1	no_errors	ENST00000205386	ensembl	human	known	69_37n	missense	12	50.00	12	SNP	1.000	T
LAMC2	3918	genome.wustl.edu	37	1	183184715	183184715	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:183184715G>C	ENST00000264144.4	+	3	461	c.396G>C	c.(394-396)caG>caC	p.Q132H	LAMC2_ENST00000493293.1_Missense_Mutation_p.Q132H	NM_005562.2	NP_005553.2	Q13753	LAMC2_HUMAN	laminin, gamma 2	132					cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	cell cortex (GO:0005938)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-2 complex (GO:0005607)|laminin-5 complex (GO:0005610)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	heparin binding (GO:0008201)			breast(2)|endometrium(6)|kidney(8)|large_intestine(11)|lung(18)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55						CCCAAGACCAGAGACTGCTGT	0.522																																						dbGAP											0													120.0	110.0	113.0					1																	183184715		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z15008	CCDS1352.1, CCDS44285.1	1q25-q31	2013-03-01	2002-08-29		ENSG00000058085	ENSG00000058085		"""Laminins"""	6493	protein-coding gene	gene with protein product		150292	"""laminin, gamma 2 (nicein (100kD), kalinin (105kD), BM600 (100kD), Herlitz junctional epidermolysis bullosa))"""	EBR2, LAMB2T, LAMNB2, EBR2A		1383240	Standard	NM_005562		Approved	nicein-100kDa, kalinin-105kDa, BM600-100kDa	uc001gqa.2	Q13753	OTTHUMG00000035520	ENST00000264144.4:c.396G>C	1.37:g.183184715G>C	ENSP00000264144:p.Gln132His		Q02536|Q02537|Q13752|Q14941|Q14DF7|Q2M1N2|Q5VYE8	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_B_type_IV,superfamily_Growth_fac_rcpt,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin	p.Q132H	ENST00000264144.4	37	c.396	CCDS1352.1	1	.	.	.	.	.	.	.	.	.	.	G	12.65	2.000961	0.35320	.	.	ENSG00000058085	ENST00000493293;ENST00000537180;ENST00000264144	T;T	0.18016	2.4;2.24	5.42	1.3	0.21679	Growth factor, receptor (1);	1.719710	0.03492	N	0.216690	T	0.08980	0.0222	N	0.01789	-0.72	0.09310	N	1	P;P	0.37636	0.528;0.603	B;B	0.37267	0.109;0.245	T	0.40831	-0.9542	10	0.38643	T	0.18	.	11.7765	0.51989	0.1995:0.0:0.8005:0.0	.	132;132	Q13753;Q13753-2	LAMC2_HUMAN;.	H	132	ENSP00000432063:Q132H;ENSP00000264144:Q132H	ENSP00000264144:Q132H	Q	+	3	2	LAMC2	181451338	0.011000	0.17503	0.275000	0.24674	0.478000	0.33099	-0.052000	0.11865	0.364000	0.24374	0.655000	0.94253	CAG	LAMC2	-	superfamily_Growth_fac_rcpt	ENSG00000058085		0.522	LAMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC2	HGNC	protein_coding	OTTHUMT00000086258.1	59	0.00	0	G	NM_005562		183184715	183184715	+1	no_errors	ENST00000264144	ensembl	human	known	69_37n	missense	75	14.77	13	SNP	0.048	C
LARP1B	55132	genome.wustl.edu	37	4	129003346	129003346	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr4:129003346C>T	ENST00000326639.6	+	5	455	c.244C>T	c.(244-246)Cac>Tac	p.H82Y	LARP1B_ENST00000264584.5_Intron|LARP1B_ENST00000441387.1_Missense_Mutation_p.H82Y|LARP1B_ENST00000512292.1_Missense_Mutation_p.H82Y|LARP1B_ENST00000354456.3_5'UTR|LARP1B_ENST00000394288.3_Missense_Mutation_p.H82Y|LARP1B_ENST00000427266.1_Missense_Mutation_p.H82Y|LARP1B_ENST00000432347.2_Missense_Mutation_p.H82Y	NM_018078.2	NP_060548.2	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family, member 1B	82						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(11)|ovary(1)|prostate(3)	34						GGTACCACTCCACTTAGATGT	0.383																																						dbGAP											0													94.0	92.0	92.0					4																	129003346		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3738.1, CCDS47133.1, CCDS64057.1	4q28.2	2009-06-09	2009-06-09	2009-06-09	ENSG00000138709	ENSG00000138709		"""La ribonucleoprotein domain containing"""	24704	protein-coding gene	gene with protein product			"""La ribonucleoprotein domain family, member 2"""	LARP2		12045101	Standard	NM_018078		Approved	FLJ10378, DKFZp434K245, DKFZp686E0316	uc003iga.3	Q659C4	OTTHUMG00000133343	ENST00000326639.6:c.244C>T	4.37:g.129003346C>T	ENSP00000321997:p.His82Tyr		Q2YDB6|Q4W599|Q4W5B2|Q659A0|Q6P5X2|Q7Z3F7|Q86VK7|Q8N6F4|Q8N7H4|Q8NAF2|Q9H5E7|Q9NW12	Missense_Mutation	SNP	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,smart_DM15,pfscan_Lupus_La_RNA-bd	p.H82Y	ENST00000326639.6	37	c.244	CCDS3738.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.8|20.8	4.053380|4.053380	0.75960|0.75960	.|.	.|.	ENSG00000138709|ENSG00000138709	ENST00000326639;ENST00000512292;ENST00000394288;ENST00000432347;ENST00000441387;ENST00000427266|ENST00000507377	T;T;T;T;T;T|.	0.44482|.	1.94;1.53;0.94;0.92;1.94;1.52|.	4.49|4.49	4.49|4.49	0.54785|0.54785	.|.	0.077755|.	0.53938|.	D|.	0.000041|.	T|T	0.60856|0.60856	0.2301|0.2301	L|L	0.40543|0.40543	1.245|1.245	0.80722|0.80722	D|D	1|1	D;P;P;P|.	0.55172|.	0.97;0.952;0.952;0.952|.	P;P;P;P|.	0.50352|.	0.521;0.536;0.638;0.638|.	T|T	0.57849|0.57849	-0.7740|-0.7740	10|5	0.54805|.	T|.	0.06|.	.|.	17.3986|17.3986	0.87453|0.87453	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	82;82;82;82|.	Q659C4;G3XAJ5;Q659C4-3;G3V0E9|.	LAR1B_HUMAN;.;.;.|.	Y|L	82|50	ENSP00000321997:H82Y;ENSP00000422850:H82Y;ENSP00000377829:H82Y;ENSP00000390395:H82Y;ENSP00000396521:H82Y;ENSP00000403586:H82Y|.	ENSP00000321997:H82Y|.	H|P	+|+	1|2	0|0	LARP1B|LARP1B	129222796|129222796	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.895000|0.895000	0.52256|0.52256	3.586000|3.586000	0.53950|0.53950	2.346000|2.346000	0.79739|0.79739	0.455000|0.455000	0.32223|0.32223	CAC|CCA	LARP1B	-	NULL	ENSG00000138709		0.383	LARP1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LARP1B	HGNC	protein_coding	OTTHUMT00000257173.2	56	0.00	0	C	NM_018078		129003346	129003346	+1	no_errors	ENST00000326639	ensembl	human	known	69_37n	missense	43	18.87	10	SNP	1.000	T
LDOC1	23641	genome.wustl.edu	37	X	140270786	140270786	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chrX:140270786C>T	ENST00000370526.2	-	1	524	c.421G>A	c.(421-423)Gaa>Aaa	p.E141K	LDOC1_ENST00000460721.1_Intron	NM_012317.2	NP_036449.1	O95751	LDOC1_HUMAN	leucine zipper, down-regulated in cancer 1	141	Asp/Glu-rich (highly acidic).				negative regulation of cell proliferation (GO:0008285)	nucleus (GO:0005634)				endometrium(6)|large_intestine(1)|lung(6)|ovary(1)	14	Acute lymphoblastic leukemia(192;7.65e-05)					TCCTCCTCTTCTtcgtcgtcg	0.637																																						dbGAP											0													70.0	47.0	55.0					X																	140270786		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB019527	CCDS14672.1	Xq27	2008-02-05			ENSG00000182195	ENSG00000182195			6548	protein-coding gene	gene with protein product		300402		BCUR1		10403563, 15716091, 16093683	Standard	NM_012317		Approved	Mar7, Mart7	uc004fbj.3	O95751	OTTHUMG00000022558	ENST00000370526.2:c.421G>A	X.37:g.140270786C>T	ENSP00000359557:p.Glu141Lys		Q6IAR6	Missense_Mutation	SNP	NULL	p.E141K	ENST00000370526.2	37	c.421	CCDS14672.1	X	.	.	.	.	.	.	.	.	.	.	.	11.89	1.773818	0.31411	.	.	ENSG00000182195	ENST00000370526	T	0.33654	1.4	3.52	2.64	0.31445	.	1.246780	0.06300	U	0.700823	T	0.19604	0.0471	N	0.08118	0	0.09310	N	1	B	0.18610	0.029	B	0.11329	0.006	T	0.23726	-1.0180	10	0.22109	T	0.4	-1.4295	7.4342	0.27145	0.2559:0.7441:0.0:0.0	.	141	O95751	LDOC1_HUMAN	K	141	ENSP00000359557:E141K	ENSP00000359557:E141K	E	-	1	0	LDOC1	140098452	0.009000	0.17119	0.033000	0.17914	0.182000	0.23217	-0.163000	0.09997	0.837000	0.34925	0.287000	0.19450	GAA	LDOC1	-	NULL	ENSG00000182195		0.637	LDOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LDOC1	HGNC	protein_coding	OTTHUMT00000058592.1	51	0.00	0	C	NM_012317		140270786	140270786	-1	no_errors	ENST00000370526	ensembl	human	known	69_37n	missense	44	20.00	11	SNP	0.031	T
LETM1	3954	genome.wustl.edu	37	4	1823911	1823911	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr4:1823911C>G	ENST00000302787.2	-	10	1901	c.1605G>C	c.(1603-1605)ttG>ttC	p.L535F		NM_012318.2	NP_036450.1	O95202	LETM1_HUMAN	leucine zipper-EF-hand containing transmembrane protein 1	535					cristae formation (GO:0042407)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(2)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	13			all cancers(2;0.00756)|OV - Ovarian serous cystadenocarcinoma(23;0.00989)|Epithelial(3;0.0141)			TCATTACCTTCAAGCCCTCCA	0.632																																						dbGAP											0													68.0	65.0	66.0					4																	1823911		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF061025	CCDS3355.1	4p16.3	2013-01-10			ENSG00000168924	ENSG00000168924		"""EF-hand domain containing"""	6556	protein-coding gene	gene with protein product	"""Mdm38 homolog (yeast)"""	604407				10486213	Standard	NM_012318		Approved		uc003gdv.3	O95202	OTTHUMG00000121149	ENST00000302787.2:c.1605G>C	4.37:g.1823911C>G	ENSP00000305653:p.Leu535Phe		B4DED2|Q9UF65	Missense_Mutation	SNP	pfam_LETM1,pfscan_EF_HAND_2	p.L535F	ENST00000302787.2	37	c.1605	CCDS3355.1	4	.	.	.	.	.	.	.	.	.	.	C	9.444	1.088805	0.20390	.	.	ENSG00000168924	ENST00000302787	.	.	.	4.48	0.437	0.16555	.	0.587072	0.15485	N	0.259848	T	0.23886	0.0578	L	0.56769	1.78	0.19300	N	0.99997	P	0.39216	0.664	B	0.32289	0.143	T	0.24977	-1.0145	9	0.56958	D	0.05	-0.6249	0.6832	0.00878	0.232:0.3705:0.1293:0.2682	.	535	O95202	LETM1_HUMAN	F	535	.	ENSP00000305653:L535F	L	-	3	2	LETM1	1793709	0.984000	0.35163	0.579000	0.28588	0.636000	0.38137	1.027000	0.30115	0.118000	0.18165	-0.263000	0.10527	TTG	LETM1	-	NULL	ENSG00000168924		0.632	LETM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LETM1	HGNC	protein_coding	OTTHUMT00000241634.1	32	0.00	0	C			1823911	1823911	-1	no_errors	ENST00000302787	ensembl	human	known	69_37n	missense	20	35.48	11	SNP	0.107	G
LILRB1	10859	genome.wustl.edu	37	19	55145475	55145475	+	Intron	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr19:55145475G>A	ENST00000396331.1	+	10	1717				LILRB1_ENST00000396321.2_Intron|LILRB1_ENST00000324602.7_Intron|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000462628.1_Intron|LILRB1_ENST00000396332.4_Intron|LILRB1_ENST00000434867.2_Intron|LILRB1_ENST00000448689.1_Intron|LILRB1_ENST00000427581.2_Intron|LILRB1_ENST00000396315.1_Intron|LILRB1_ENST00000396317.1_Intron|LILRB1_ENST00000396327.3_Intron	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1						cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		CCAGAGTGGTGAGTGACGGGC	0.677										HNSCC(37;0.09)																												dbGAP											0													20.0	24.0	23.0					19																	55145475		2196	4296	6492	-	-	-	SO:0001627	intron_variant	0			AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.1360+3G>A	19.37:g.55145475G>A			A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	RNA	SNP	-	NULL	ENST00000396331.1	37	NULL	CCDS42617.1	19																																																																																			LILRB1	-	-	ENSG00000104972		0.677	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB1	HGNC	protein_coding	OTTHUMT00000140796.4	31	0.00	0	G			55145475	55145475	+1	no_errors	ENST00000473412	ensembl	human	putative	69_37n	rna	54	14.29	9	SNP	0.000	A
LMNA	4000	genome.wustl.edu	37	1	156084959	156084959	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:156084959G>A	ENST00000368300.4	+	1	462	c.250G>A	c.(250-252)Gag>Aag	p.E84K	LMNA_ENST00000361308.4_Missense_Mutation_p.E84K|LMNA_ENST00000368299.3_Missense_Mutation_p.E84K|LMNA_ENST00000368301.2_Missense_Mutation_p.E84K|LMNA_ENST00000347559.2_Missense_Mutation_p.E84K	NM_170707.3	NP_733821.1	P02545	LMNA_HUMAN	lamin A/C	84	Coil 1B.|Interaction with MLIP.|Rod.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to hypoxia (GO:0071456)|endoplasmic reticulum unfolded protein response (GO:0030968)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|muscle organ development (GO:0007517)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|positive regulation of cell aging (GO:0090343)|protein localization to nucleus (GO:0034504)|regulation of cell migration (GO:0030334)|regulation of protein localization to nucleus (GO:1900180)|sterol regulatory element binding protein import into nucleus (GO:0035105)|ventricular cardiac muscle cell development (GO:0055015)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|lamin filament (GO:0005638)|nuclear envelope (GO:0005635)|nuclear lamina (GO:0005652)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|lung(3)|ovary(4)	10	Hepatocellular(266;0.158)					CTACGAGGCCGAGCTCGGGGA	0.637									Werner syndrome;Hutchinson-Gilford Progeria Syndrome																													dbGAP											0													22.0	24.0	23.0					1																	156084959		2202	4300	6502	-	-	-	SO:0001583	missense	0	Familial Cancer Database	WS, Adult Progeria;HGPS, Progeria	BC014507	CCDS1129.1, CCDS1131.1, CCDS58038.1, CCDS72941.1, CCDS72942.1	1q22	2014-09-17			ENSG00000160789	ENSG00000160789		"""Intermediate filaments type V, lamins"""	6636	protein-coding gene	gene with protein product		150330	"""cardiomyopathy, dilated 1A (autosomal dominant)"", ""limb girdle muscular dystrophy 1B (autosomal dominant)"", ""progeria 1 (Hutchinson-Gilford type)"", ""lamin A/C-like 1"""	LMN1, CMD1A, LGMD1B, PRO1, LMNL1		8511676, 8838815, 12702809	Standard	NM_005572		Approved	HGPS	uc001fni.3	P02545	OTTHUMG00000013961	ENST00000368300.4:c.250G>A	1.37:g.156084959G>A	ENSP00000357283:p.Glu84Lys		B4DI32|D3DVB0|D6RAQ3|E7EUI9|P02546|Q5I6Y4|Q5I6Y6|Q5TCJ2|Q5TCJ3|Q6UYC3|Q969I8|Q96JA2	Missense_Mutation	SNP	pfam_F,pfam_Lamin_tail_dom,superfamily_Prefoldin	p.E84K	ENST00000368300.4	37	c.250	CCDS1129.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.462508	0.96240	.	.	ENSG00000160789	ENST00000368301;ENST00000347559;ENST00000361308;ENST00000368300;ENST00000368299;ENST00000292302;ENST00000392355	D;D;D;D;D	0.90004	-1.53;-2.6;-1.53;-1.53;-1.53	4.77	3.87	0.44632	Filament (1);	0.000000	0.64402	D	0.000020	D	0.93298	0.7864	M	0.89414	3.03	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.75484	0.981;0.981;0.986;0.968	D	0.93983	0.7260	10	0.87932	D	0	.	10.829	0.46649	0.0924:0.0:0.9076:0.0	.	84;84;84;84	Q6UYC3;P02545;P02545-3;P02545-2	.;LMNA_HUMAN;.;.	K	84	ENSP00000357284:E84K;ENSP00000292304:E84K;ENSP00000355292:E84K;ENSP00000357283:E84K;ENSP00000357282:E84K	ENSP00000292302:E84K	E	+	1	0	LMNA	154351583	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	9.657000	0.98554	1.244000	0.43870	0.462000	0.41574	GAG	LMNA	-	pfam_F,superfamily_Prefoldin	ENSG00000160789		0.637	LMNA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMNA	HGNC	protein_coding	OTTHUMT00000039200.2	21	0.00	0	G	NM_170707		156084959	156084959	+1	no_errors	ENST00000368300	ensembl	human	known	69_37n	missense	27	22.86	8	SNP	1.000	A
LRP1	4035	genome.wustl.edu	37	12	57599457	57599457	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:57599457G>A	ENST00000243077.3	+	75	12053	c.11587G>A	c.(11587-11589)Gaa>Aaa	p.E3863K		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	3863					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CTGCAAGGCCGAAGGTGCCGG	0.622																																						dbGAP											0													42.0	43.0	43.0					12																	57599457		2203	4300	6503	-	-	-	SO:0001583	missense	0			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.11587G>A	12.37:g.57599457G>A	ENSP00000243077:p.Glu3863Lys		Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.E3863K	ENST00000243077.3	37	c.11587	CCDS8932.1	12	.	.	.	.	.	.	.	.	.	.	G	7.151	0.583715	0.13749	.	.	ENSG00000123384	ENST00000243077	D	0.89681	-2.55	4.42	4.42	0.53409	Growth factor, receptor (1);	0.231858	0.36134	N	0.002773	T	0.71056	0.3295	N	0.12422	0.21	0.80722	D	1	P	0.45078	0.85	B	0.25140	0.058	T	0.77560	-0.2542	10	0.05525	T	0.97	.	16.3033	0.82832	0.0:0.0:1.0:0.0	.	3863	Q07954	LRP1_HUMAN	K	3863	ENSP00000243077:E3863K	ENSP00000243077:E3863K	E	+	1	0	LRP1	55885724	1.000000	0.71417	0.980000	0.43619	0.340000	0.28889	7.652000	0.83633	2.468000	0.83385	0.561000	0.74099	GAA	LRP1	-	superfamily_Growth_fac_rcpt	ENSG00000123384		0.622	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	HGNC	protein_coding	OTTHUMT00000412772.2	36	0.00	0	G	NM_002332		57599457	57599457	+1	no_errors	ENST00000243077	ensembl	human	known	69_37n	missense	40	10.87	5	SNP	0.998	A
LRRC8C	84230	genome.wustl.edu	37	1	90180536	90180536	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:90180536G>C	ENST00000370454.4	+	3	2662	c.2407G>C	c.(2407-2409)Gaa>Caa	p.E803Q	LRRC8C_ENST00000479252.1_Intron|RP11-302M6.4_ENST00000370453.5_Intron	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	803					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		AATGAAAACAGAATAACTTAT	0.383																																						dbGAP											0													42.0	45.0	44.0					1																	90180536		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.2407G>C	1.37:g.90180536G>C	ENSP00000359483:p.Glu803Gln		B3KXS9|Q29RV6|Q9H075	Missense_Mutation	SNP	pfam_LRR_protein-8_N,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.E803Q	ENST00000370454.4	37	c.2407	CCDS725.1	1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.241206	0.79912	.	.	ENSG00000171488	ENST00000370454	T	0.25912	1.77	6.17	6.17	0.99709	.	0.168258	0.53938	D	0.000050	T	0.33904	0.0879	L	0.29908	0.895	0.58432	D	0.999997	D	0.69078	0.997	D	0.66847	0.947	T	0.06499	-1.0823	10	0.72032	D	0.01	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	803	Q8TDW0	LRC8C_HUMAN	Q	803	ENSP00000359483:E803Q	ENSP00000359483:E803Q	E	+	1	0	LRRC8C	89953124	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.845000	0.99498	2.941000	0.99782	0.655000	0.94253	GAA	LRRC8C	-	NULL	ENSG00000171488		0.383	LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC8C	HGNC	protein_coding	OTTHUMT00000028435.2	31	0.00	0	G	NM_032270		90180536	90180536	+1	no_errors	ENST00000370454	ensembl	human	known	69_37n	missense	33	25.00	11	SNP	1.000	C
LRTM1	57408	genome.wustl.edu	37	3	54958790	54958790	+	Nonsense_Mutation	SNP	G	G	A	rs200158467		TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr3:54958790G>A	ENST00000273286.5	-	2	622	c.460C>T	c.(460-462)Caa>Taa	p.Q154*	CACNA2D3_ENST00000490478.1_Intron|CACNA2D3_ENST00000415676.2_Intron|LRTM1_ENST00000493075.1_Nonsense_Mutation_p.Q78*|CACNA2D3_ENST00000474759.1_Intron|CACNA2D3_ENST00000288197.5_Intron	NM_020678.2	NP_065729.1	Q9HBL6	LRTM1_HUMAN	leucine-rich repeats and transmembrane domains 1	154						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(4)	21				KIRC - Kidney renal clear cell carcinoma(284;0.00975)|Kidney(284;0.0112)|OV - Ovarian serous cystadenocarcinoma(275;0.0502)		TGGTTTTGTTGAACCGCAAGT	0.493																																						dbGAP											0													103.0	100.0	101.0					3																	54958790		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF225421	CCDS2876.1	3p14.3	2006-01-02			ENSG00000144771	ENSG00000144771			25023	protein-coding gene	gene with protein product						12477932	Standard	NM_020678		Approved	HT017	uc003dhl.3	Q9HBL6	OTTHUMG00000158578	ENST00000273286.5:c.460C>T	3.37:g.54958790G>A	ENSP00000273286:p.Gln154*		Q8IUU2	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.Q154*	ENST00000273286.5	37	c.460	CCDS2876.1	3	.	.	.	.	.	.	.	.	.	.	G	35	5.413434	0.96072	.	.	ENSG00000144771	ENST00000273286;ENST00000493075	.	.	.	5.96	5.96	0.96718	.	0.235838	0.44902	D	0.000416	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	.	15.0426	0.71803	0.0:0.0:0.8248:0.1752	.	.	.	.	X	154;78	.	ENSP00000273286:Q154X	Q	-	1	0	LRTM1	54933830	1.000000	0.71417	0.970000	0.41538	0.661000	0.39034	4.059000	0.57470	2.824000	0.97209	0.655000	0.94253	CAA	LRTM1	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000144771		0.493	LRTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRTM1	HGNC	protein_coding	OTTHUMT00000351399.1	56	0.00	0	G	NM_020678		54958790	54958790	-1	no_errors	ENST00000273286	ensembl	human	known	69_37n	nonsense	39	27.78	15	SNP	0.532	A
MACF1	23499	genome.wustl.edu	37	1	39917982	39917982	+	Missense_Mutation	SNP	C	C	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:39917982C>A	ENST00000372915.3	+	85	20357	c.20270C>A	c.(20269-20271)tCt>tAt	p.S6757Y	MACF1_ENST00000361689.2_Missense_Mutation_p.S4799Y|MACF1_ENST00000539005.1_Missense_Mutation_p.S4669Y|MACF1_ENST00000567887.1_Missense_Mutation_p.S6895Y|MACF1_ENST00000545844.1_Missense_Mutation_p.S4799Y|MACF1_ENST00000564288.1_Missense_Mutation_p.S6858Y|MACF1_ENST00000317713.7_Missense_Mutation_p.S4799Y|MACF1_ENST00000289893.4_Missense_Mutation_p.S5301Y			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	6757					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TGTAAACTCTCTGTTTCCAAA	0.473																																						dbGAP											0													117.0	126.0	123.0					1																	39917982		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.20270C>A	1.37:g.39917982C>A	ENSP00000362006:p.Ser6757Tyr		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.S4799Y	ENST00000372915.3	37	c.14396		1	.	.	.	.	.	.	.	.	.	.	C	33	5.223371	0.95139	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893	T;T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72;0.72	5.72	5.72	0.89469	.	0.000000	0.64402	D	0.000010	T	0.73528	0.3598	M	0.83483	2.645	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.997;1.0	T	0.76534	-0.2924	10	0.87932	D	0	.	19.8753	0.96867	0.0:1.0:0.0:0.0	.	6757;4799	Q9UPN3;F8W8Q1	MACF1_HUMAN;.	Y	4799;6757;4799;4799;4669;5301	ENSP00000439537:S4799Y;ENSP00000362006:S6757Y;ENSP00000354573:S4799Y;ENSP00000313438:S4799Y;ENSP00000444364:S4669Y;ENSP00000289893:S5301Y	ENSP00000289893:S5301Y	S	+	2	0	MACF1	39690569	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	7.815000	0.86186	2.699000	0.92147	0.591000	0.81541	TCT	MACF1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000127603		0.473	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	54	0.00	0	C	NM_033044		39917982	39917982	+1	no_errors	ENST00000317713	ensembl	human	known	69_37n	missense	39	11.36	5	SNP	1.000	A
MAD1L1	8379	genome.wustl.edu	37	7	1855779	1855779	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr7:1855779C>T	ENST00000406869.1	-	19	2641	c.2084G>A	c.(2083-2085)cGg>cAg	p.R695Q	MAD1L1_ENST00000399654.2_Missense_Mutation_p.R695Q|MAD1L1_ENST00000265854.7_Missense_Mutation_p.R695Q|MAD1L1_ENST00000402746.1_Missense_Mutation_p.R603Q			Q9Y6D9	MD1L1_HUMAN	MAD1 mitotic arrest deficient-like 1 (yeast)	695					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|regulation of metaphase plate congression (GO:0090235)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|spindle (GO:0005819)				central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(5)	36		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		GTCCTGGCGCCGCAGGTGCAC	0.662																																						dbGAP											0													49.0	60.0	56.0					7																	1855779		2074	4205	6279	-	-	-	SO:0001583	missense	0			U33822	CCDS43539.1	7p22	2013-01-17	2001-11-28		ENSG00000002822	ENSG00000002822			6762	protein-coding gene	gene with protein product		602686	"""MAD1 (mitotic arrest deficient, yeast, homolog)-like 1"""			10049595, 9546394	Standard	XM_005249876		Approved	HsMAD1, TXBP181, MAD1, PIG9, TP53I9	uc003slg.1	Q9Y6D9	OTTHUMG00000151493	ENST00000406869.1:c.2084G>A	7.37:g.1855779C>T	ENSP00000385334:p.Arg695Gln		B3KR41|Q13312|Q75MI0|Q86UM4|Q9UNH0	Missense_Mutation	SNP	pfam_MAD	p.R695Q	ENST00000406869.1	37	c.2084	CCDS43539.1	7	.	.	.	.	.	.	.	.	.	.	C	9.932	1.215054	0.22373	.	.	ENSG00000002822	ENST00000402746;ENST00000399654;ENST00000406869;ENST00000442131;ENST00000265854;ENST00000450235	T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92	3.98	2.82	0.32997	.	.	.	.	.	T	0.09730	0.0239	N	0.05124	-0.11	0.22961	N	0.998505	P;B	0.40000	0.698;0.066	B;B	0.36092	0.217;0.002	T	0.16129	-1.0413	9	0.12430	T	0.62	-0.1006	5.9608	0.19299	0.6612:0.1804:0.0:0.1584	.	603;695	B3KR41;Q9Y6D9	.;MD1L1_HUMAN	Q	603;695;695;246;695;246	ENSP00000384155:R603Q;ENSP00000382562:R695Q;ENSP00000385334:R695Q;ENSP00000265854:R695Q;ENSP00000394886:R246Q	ENSP00000265854:R695Q	R	-	2	0	MAD1L1	1822305	0.998000	0.40836	0.879000	0.34478	0.837000	0.47467	2.992000	0.49417	0.438000	0.26450	-0.538000	0.04264	CGG	MAD1L1	-	pfam_MAD	ENSG00000002822		0.662	MAD1L1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MAD1L1	HGNC	protein_coding	OTTHUMT00000322871.1	26	0.00	0	C	NM_003550		1855779	1855779	-1	no_errors	ENST00000265854	ensembl	human	known	69_37n	missense	17	19.05	4	SNP	0.958	T
MAP1A	4130	genome.wustl.edu	37	15	43814005	43814005	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr15:43814005G>C	ENST00000300231.5	+	4	784	c.334G>C	c.(334-336)Gag>Cag	p.E112Q	MAP1A_ENST00000399453.1_Missense_Mutation_p.E112Q|MAP1A_ENST00000382031.1_Missense_Mutation_p.E350Q			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	112					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	GCTAGAGGAGGAGCAGTCCCA	0.547																																						dbGAP											0													126.0	130.0	129.0					15																	43814005		2101	4223	6324	-	-	-	SO:0001583	missense	0			U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.334G>C	15.37:g.43814005G>C	ENSP00000300231:p.Glu112Gln		O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	NULL	p.E112Q	ENST00000300231.5	37	c.334	CCDS42031.1	15	.	.	.	.	.	.	.	.	.	.	G	15.28	2.787994	0.49997	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231;ENST00000442025	T;T;T	0.32988	1.43;1.43;1.43	4.9	4.9	0.64082	.	.	.	.	.	T	0.60856	0.2301	M	0.82517	2.595	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.67280	-0.5710	9	0.87932	D	0	-17.6303	18.2645	0.90048	0.0:0.0:1.0:0.0	.	112	P78559	MAP1A_HUMAN	Q	350;112;112;112	ENSP00000371462:E350Q;ENSP00000382380:E112Q;ENSP00000300231:E112Q	ENSP00000300231:E112Q	E	+	1	0	MAP1A	41601297	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.657000	0.98554	2.553000	0.86117	0.561000	0.74099	GAG	MAP1A	-	NULL	ENSG00000166963		0.547	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP1A	HGNC	protein_coding	OTTHUMT00000132894.5	115	0.00	0	G	NM_002373		43814005	43814005	+1	no_errors	ENST00000399453	ensembl	human	known	69_37n	missense	63	26.74	23	SNP	1.000	C
MCM10	55388	genome.wustl.edu	37	10	13228241	13228241	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr10:13228241G>A	ENST00000484800.2	+	9	1282	c.1179G>A	c.(1177-1179)aaG>aaA	p.K393K	MCM10_ENST00000378694.1_Silent_p.K392K|MCM10_ENST00000378714.3_Silent_p.K392K			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	393	Zinc finger-like 1.				cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						GTAAAGCCAAGAAGAAGAATG	0.438																																						dbGAP											0													181.0	168.0	173.0					10																	13228241		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.1179G>A	10.37:g.13228241G>A			A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Silent	SNP	pfam_Rep_factor_Mcm10,pfam_Znf_Mcm10/DnaG	p.K393	ENST00000484800.2	37	c.1179	CCDS7096.1	10																																																																																			MCM10	-	pfam_Znf_Mcm10/DnaG	ENSG00000065328		0.438	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MCM10	HGNC	protein_coding	OTTHUMT00000356853.1	144	0.00	0	G	NM_182751		13228241	13228241	+1	no_errors	ENST00000361282	ensembl	human	known	69_37n	silent	118	11.28	15	SNP	1.000	A
MCM3	4172	genome.wustl.edu	37	6	52133960	52133960	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr6:52133960G>A	ENST00000229854.7	-	13	1968	c.1892C>T	c.(1891-1893)gCc>gTc	p.A631V	MCM3_ENST00000596288.1_Missense_Mutation_p.A676V|MCM3_ENST00000419835.2_Missense_Mutation_p.A585V			P25205	MCM3_HUMAN	minichromosome maintenance complex component 3	631					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	alpha DNA polymerase:primase complex (GO:0005658)|centrosome (GO:0005813)|intracellular membrane-bounded organelle (GO:0043231)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Lung NSC(77;0.0931)					GCTCATGCGGGCCTTCGCATG	0.522																																						dbGAP											0													97.0	95.0	96.0					6																	52133960		2203	4300	6503	-	-	-	SO:0001583	missense	0			X62153	CCDS4940.1, CCDS4940.2, CCDS75468.1	6p12	2008-02-05	2007-04-04		ENSG00000112118	ENSG00000112118			6945	protein-coding gene	gene with protein product		602693	"""minichromosome maintenance deficient (S. cerevisiae) 3"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae)"""			1549468	Standard	NM_002388		Approved		uc011dwu.2	P25205	OTTHUMG00000014844	ENST00000229854.7:c.1892C>T	6.37:g.52133960G>A	ENSP00000229854:p.Ala631Val		B4DWW4|Q92660|Q9BTR3|Q9NUE7	Missense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_DNA-dep_ATPase,prints_MCM_3	p.A631V	ENST00000229854.7	37	c.1892		6	.	.	.	.	.	.	.	.	.	.	G	21.3	4.135987	0.77662	.	.	ENSG00000112118	ENST00000229854;ENST00000340349;ENST00000419835;ENST00000421471	T;T;T	0.05447	3.44;3.44;3.44	5.26	4.38	0.52667	.	0.158993	0.56097	D	0.000027	T	0.01800	0.0057	L	0.36672	1.1	0.80722	D	1	B;B	0.23540	0.02;0.087	B;B	0.33799	0.072;0.17	T	0.25222	-1.0138	10	0.02654	T	1	-16.137	8.7614	0.34676	0.0745:0.0:0.7739:0.1517	.	585;631	B4DUQ9;P25205	.;MCM3_HUMAN	V	631;128;585;126	ENSP00000229854:A631V;ENSP00000388647:A585V;ENSP00000407651:A126V	ENSP00000229854:A631V	A	-	2	0	MCM3	52241919	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	6.265000	0.72534	1.408000	0.46895	0.561000	0.74099	GCC	MCM3	-	pfam_MCM_DNA-dep_ATPase,smart_MCM_DNA-dep_ATPase	ENSG00000112118		0.522	MCM3-006	KNOWN	basic|appris_principal	protein_coding	MCM3	HGNC	protein_coding	OTTHUMT00000470784.1	55	0.00	0	G			52133960	52133960	-1	no_errors	ENST00000229854	ensembl	human	known	69_37n	missense	33	34.00	17	SNP	1.000	A
MCM3	4172	genome.wustl.edu	37	6	52134018	52134018	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr6:52134018G>C	ENST00000229854.7	-	13	1910	c.1834C>G	c.(1834-1836)Cca>Gca	p.P612A	MCM3_ENST00000596288.1_Missense_Mutation_p.P657A|MCM3_ENST00000419835.2_Missense_Mutation_p.P566A			P25205	MCM3_HUMAN	minichromosome maintenance complex component 3	612					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	alpha DNA polymerase:primase complex (GO:0005658)|centrosome (GO:0005813)|intracellular membrane-bounded organelle (GO:0043231)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Lung NSC(77;0.0931)					GCTGTAACTGGAGATGTCTAG	0.512																																						dbGAP											0													88.0	86.0	87.0					6																	52134018		2203	4300	6503	-	-	-	SO:0001583	missense	0			X62153	CCDS4940.1, CCDS4940.2, CCDS75468.1	6p12	2008-02-05	2007-04-04		ENSG00000112118	ENSG00000112118			6945	protein-coding gene	gene with protein product		602693	"""minichromosome maintenance deficient (S. cerevisiae) 3"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae)"""			1549468	Standard	NM_002388		Approved		uc011dwu.2	P25205	OTTHUMG00000014844	ENST00000229854.7:c.1834C>G	6.37:g.52134018G>C	ENSP00000229854:p.Pro612Ala		B4DWW4|Q92660|Q9BTR3|Q9NUE7	Missense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_DNA-dep_ATPase,prints_MCM_3	p.P612A	ENST00000229854.7	37	c.1834		6	.	.	.	.	.	.	.	.	.	.	G	22.8	4.341896	0.81911	.	.	ENSG00000112118	ENST00000229854;ENST00000340349;ENST00000419835;ENST00000421471	T;T;T	0.12774	2.65;2.65;2.65	5.4	4.54	0.55810	.	0.102803	0.64402	D	0.000002	T	0.30324	0.0761	M	0.82630	2.6	0.80722	D	1	P;D	0.89917	0.943;1.0	P;D	0.97110	0.627;1.0	T	0.17410	-1.0370	10	0.56958	D	0.05	-11.7198	14.1011	0.65056	0.0716:0.0:0.9284:0.0	.	566;612	B4DUQ9;P25205	.;MCM3_HUMAN	A	612;109;566;107	ENSP00000229854:P612A;ENSP00000388647:P566A;ENSP00000407651:P107A	ENSP00000229854:P612A	P	-	1	0	MCM3	52241977	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.239000	0.95389	1.509000	0.48786	0.655000	0.94253	CCA	MCM3	-	pfam_MCM_DNA-dep_ATPase,smart_MCM_DNA-dep_ATPase	ENSG00000112118		0.512	MCM3-006	KNOWN	basic|appris_principal	protein_coding	MCM3	HGNC	protein_coding	OTTHUMT00000470784.1	44	0.00	0	G			52134018	52134018	-1	no_errors	ENST00000229854	ensembl	human	known	69_37n	missense	35	29.41	15	SNP	1.000	C
MCTP2	55784	genome.wustl.edu	37	15	95013628	95013628	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr15:95013628C>T	ENST00000357742.4	+	20	2427	c.2427C>T	c.(2425-2427)atC>atT	p.I809I	MCTP2_ENST00000451018.3_Silent_p.I754I	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	809					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			CAGCCACCATCATTTTGTATT	0.413																																						dbGAP											0													183.0	174.0	177.0					15																	95013628		2197	4298	6495	-	-	-	SO:0001819	synonymous_variant	0			AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.2427C>T	15.37:g.95013628C>T			A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Silent	SNP	pfam_C2_Ca-dep,pfam_PRibTrfase_C,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.I809	ENST00000357742.4	37	c.2427	CCDS32338.1	15																																																																																			MCTP2	-	pfam_PRibTrfase_C	ENSG00000140563		0.413	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MCTP2	HGNC	protein_coding	OTTHUMT00000415060.3	169	0.00	0	C	NM_018349		95013628	95013628	+1	no_errors	ENST00000357742	ensembl	human	known	69_37n	silent	139	27.23	52	SNP	0.062	T
MEGF8	1954	genome.wustl.edu	37	19	42880508	42880508	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr19:42880508G>T	ENST00000251268.6	+	42	8119	c.8119G>T	c.(8119-8121)Gac>Tac	p.D2707Y	MEGF8_ENST00000334370.4_Missense_Mutation_p.D2640Y|MEGF8_ENST00000378073.4_Missense_Mutation_p.D301Y	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	2707					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				CTTCCCACCTGACCCTACTGC	0.706																																						dbGAP											0													33.0	32.0	33.0					19																	42880508		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.8119G>T	19.37:g.42880508G>T	ENSP00000251268:p.Asp2707Tyr		A8KAY0|O75097	Missense_Mutation	SNP	pfam_CUB,pfam_EGF_laminin,pfam_Plexin_repeat,superfamily_Gal_Oxase/kelch_b-propeller,superfamily_CUB,superfamily_Plexin-like_fold,smart_CUB,smart_EGF-like,smart_Plexin-like,smart_EGF-like_Ca-bd,smart_EGF_laminin,pfscan_CUB,pfscan_EG-like_dom,pfscan_EGF_laminin	p.D2707Y	ENST00000251268.6	37	c.8119		19	.	.	.	.	.	.	.	.	.	.	G	15.82	2.946071	0.53079	.	.	ENSG00000105429	ENST00000334370;ENST00000251268;ENST00000378073	T;T	0.25579	1.79;1.79	3.9	3.9	0.45041	.	0.076101	0.51477	D	0.000098	T	0.42653	0.1212	L	0.46157	1.445	0.54753	D	0.999981	D;D;D	0.89917	0.963;1.0;0.994	P;D;P	0.68192	0.775;0.956;0.906	T	0.40194	-0.9576	10	0.66056	D	0.02	-29.0439	15.2152	0.73261	0.0:0.0:1.0:0.0	.	301;2707;2640	F5GZG7;Q7Z7M0;Q7Z7M0-2	.;MEGF8_HUMAN;.	Y	2640;2707;301	ENSP00000334219:D2640Y;ENSP00000251268:D2707Y	ENSP00000251268:D2707Y	D	+	1	0	MEGF8	47572348	1.000000	0.71417	0.828000	0.32881	0.439000	0.31926	6.386000	0.73186	2.208000	0.71279	0.462000	0.41574	GAC	MEGF8	-	NULL	ENSG00000105429		0.706	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	MEGF8	HGNC	protein_coding	OTTHUMT00000463854.1	19	0.00	0	G	NM_001410		42880508	42880508	+1	no_errors	ENST00000251268	ensembl	human	known	69_37n	missense	19	24.00	6	SNP	0.999	T
METTL17	64745	genome.wustl.edu	37	14	21463019	21463019	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr14:21463019G>C	ENST00000339374.6	+	9	1068	c.835G>C	c.(835-837)Gag>Cag	p.E279Q	METTL17_ENST00000556670.2_Missense_Mutation_p.E279Q|METTL17_ENST00000382985.4_Missense_Mutation_p.E279Q|RP11-84C10.4_ENST00000557335.1_RNA	NM_001029991.1|NM_022734.2	NP_001025162.1|NP_073571.1	Q9H7H0	MET17_HUMAN	methyltransferase like 17	279					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	copper ion binding (GO:0005507)|methyltransferase activity (GO:0008168)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|skin(2)	20						TGACCGCACTGAGGTAGTTCA	0.448																																						dbGAP											0													153.0	118.0	130.0					14																	21463019		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024512	CCDS9562.1, CCDS41913.1	14q11.2	2011-03-03	2011-03-02	2011-03-02	ENSG00000165792	ENSG00000165792			19280	protein-coding gene	gene with protein product			"""methyltransferase 11 domain containing 1"""	METT11D1		11278769	Standard	XM_006720235		Approved	FLJ20859	uc001vyn.3	Q9H7H0	OTTHUMG00000029610	ENST00000339374.6:c.835G>C	14.37:g.21463019G>C	ENSP00000343041:p.Glu279Gln		Q9BSH1|Q9BZH2|Q9BZH3	Missense_Mutation	SNP	pfam_Ribosomal_Rsm22_bac-type,pfam_Methyltransf_11	p.E279Q	ENST00000339374.6	37	c.835	CCDS9562.1	14	.	.	.	.	.	.	.	.	.	.	G	11.40	1.626538	0.28978	.	.	ENSG00000165792	ENST00000339374;ENST00000382985	T;T	0.42513	0.97;0.97	5.95	5.06	0.68205	.	0.271297	0.40818	N	0.001011	T	0.35998	0.0951	L	0.37697	1.125	0.09310	N	1	P;P;P	0.43633	0.804;0.549;0.813	B;B;P	0.44394	0.44;0.398;0.448	T	0.16070	-1.0415	10	0.23891	T	0.37	.	11.1499	0.48453	0.084:0.0:0.916:0.0	.	279;279;279	Q9H7H0-3;Q9H7H0;Q9H7H0-2	.;MET17_HUMAN;.	Q	279	ENSP00000343041:E279Q;ENSP00000372445:E279Q	ENSP00000343041:E279Q	E	+	1	0	METTL17	20532859	0.730000	0.28100	0.136000	0.22124	0.026000	0.11368	2.731000	0.47343	1.535000	0.49220	-0.140000	0.14226	GAG	METTL17	-	pfam_Ribosomal_Rsm22_bac-type,pfam_Methyltransf_11	ENSG00000165792		0.448	METTL17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL17	HGNC	protein_coding	OTTHUMT00000073804.4	114	0.00	0	G	NM_022734		21463019	21463019	+1	no_errors	ENST00000382985	ensembl	human	known	69_37n	missense	87	24.35	28	SNP	0.111	C
MGAM	8972	genome.wustl.edu	37	7	141773951	141773951	+	Intron	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr7:141773951C>T	ENST00000549489.2	+	38	4713				MGAM_ENST00000475668.2_Silent_p.F1751F	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)						carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GAGAACTTTTCTGGGATGATG	0.453																																						dbGAP											0													52.0	41.0	44.0					7																	141773951		874	1939	2813	-	-	-	SO:0001627	intron_variant	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4618+8683C>T	7.37:g.141773951C>T			Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.F1752	ENST00000549489.2	37	c.5256	CCDS47727.1	7																																																																																			MGAM	-	NULL	ENSG00000257335		0.453	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	47	0.00	0	C			141773951	141773951	+1	no_errors	ENST00000475668	ensembl	human	putative	69_37n	silent	24	22.58	7	SNP	1.000	T
MKI67	4288	genome.wustl.edu	37	10	129911795	129911795	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr10:129911795C>G	ENST00000368654.3	-	8	1927	c.1552G>C	c.(1552-1554)Gat>Cat	p.D518H	MKI67_ENST00000368653.3_Missense_Mutation_p.D158H|MKI67_ENST00000484853.1_5'Flank	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	518					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				AAGTTTTCATCAAATAGTTCA	0.438																																						dbGAP											0													162.0	147.0	152.0					10																	129911795		2203	4300	6503	-	-	-	SO:0001583	missense	0			X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.1552G>C	10.37:g.129911795C>G	ENSP00000357643:p.Asp518His		Q5VWH2	Missense_Mutation	SNP	pfam_K167R,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.D518H	ENST00000368654.3	37	c.1552	CCDS7659.1	10	.	.	.	.	.	.	.	.	.	.	C	18.93	3.728535	0.69074	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609;ENST00000368652	T;T	0.19938	2.11;3.59	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.50684	0.1630	M	0.83118	2.625	0.52099	D	0.999947	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.57388	-0.7820	10	0.87932	D	0	.	16.3392	0.83076	0.0:1.0:0.0:0.0	.	518;158;518	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	H	518;158;518;93	ENSP00000357643:D518H;ENSP00000357642:D158H	ENSP00000357641:D93H	D	-	1	0	MKI67	129801785	1.000000	0.71417	0.994000	0.49952	0.417000	0.31264	6.480000	0.73604	2.518000	0.84900	0.655000	0.94253	GAT	MKI67	-	NULL	ENSG00000148773		0.438	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKI67	HGNC	protein_coding	OTTHUMT00000050999.1	59	0.00	0	C	NM_002417		129911795	129911795	-1	no_errors	ENST00000368654	ensembl	human	known	69_37n	missense	46	31.34	21	SNP	1.000	G
KMT2D	8085	genome.wustl.edu	37	12	49436961	49436961	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:49436961C>T	ENST00000301067.7	-	25	5541	c.5542G>A	c.(5542-5544)Gat>Aat	p.D1848N		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	1848					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										ACGCCCCCATCCTCAGGTCCT	0.582																																						dbGAP											0													59.0	62.0	61.0					12																	49436961		2013	4178	6191	-	-	-	SO:0001583	missense	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.5542G>A	12.37:g.49436961C>T	ENSP00000301067:p.Asp1848Asn		O14687	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.D1848N	ENST00000301067.7	37	c.5542	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	C	14.71	2.617021	0.46736	.	.	ENSG00000167548	ENST00000301067	T	0.80214	-1.35	5.61	5.61	0.85477	.	0.000000	0.37761	N	0.001944	T	0.80385	0.4613	N	0.22421	0.69	0.30811	N	0.738897	D	0.61697	0.99	P	0.57204	0.815	T	0.81272	-0.1008	10	0.87932	D	0	.	15.1384	0.72590	0.0:1.0:0.0:0.0	.	1848	O14686	MLL2_HUMAN	N	1848	ENSP00000301067:D1848N	ENSP00000301067:D1848N	D	-	1	0	MLL2	47723228	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.631000	0.37092	2.631000	0.89168	0.655000	0.94253	GAT	MLL2	-	NULL	ENSG00000167548		0.582	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL2	HGNC	protein_coding	OTTHUMT00000390183.2	33	0.00	0	C			49436961	49436961	-1	no_errors	ENST00000301067	ensembl	human	known	69_37n	missense	32	23.26	10	SNP	1.000	T
MLPH	79083	genome.wustl.edu	37	2	238436082	238436082	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:238436082G>A	ENST00000264605.3	+	8	1237	c.943G>A	c.(943-945)Gat>Aat	p.D315N	MLPH_ENST00000409373.1_Missense_Mutation_p.D275N|MLPH_ENST00000338530.4_Missense_Mutation_p.D315N|MLPH_ENST00000468178.1_3'UTR|MLPH_ENST00000445024.2_Missense_Mutation_p.D315N|MLPH_ENST00000410032.1_Intron	NM_024101.5	NP_077006.1	Q9BV36	MELPH_HUMAN	melanophilin	315					melanocyte differentiation (GO:0030318)|melanosome localization (GO:0032400)|protein targeting (GO:0006605)	cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|microtubule plus-end (GO:0035371)|stress fiber (GO:0001725)	metal ion binding (GO:0046872)	p.D315N(1)		NS(1)|breast(3)|cervix(1)|endometrium(3)|large_intestine(2)|lung(11)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	25		Breast(86;0.000381)|Renal(207;0.000966)|Ovarian(221;0.0695)|all_hematologic(139;0.095)|all_lung(227;0.17)|Melanoma(123;0.203)		Epithelial(121;1.17e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.02e-10)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.15e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000439)|Lung(119;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0316)		GGACACCTCTGATGAGGAAAG	0.557																																						dbGAP											1	Substitution - Missense(1)	breast(1)											96.0	101.0	99.0					2																	238436082		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY358857	CCDS2518.1, CCDS42836.1, CCDS63172.1, CCDS63173.1	2q37.2	2014-09-17			ENSG00000115648	ENSG00000115648			29643	protein-coding gene	gene with protein product		606526				11980908, 11504925	Standard	NM_024101		Approved	l1Rk3, l(1)-3Rk, Slac-2a, ln, exophilin-3	uc002vwt.3	Q9BV36	OTTHUMG00000133298	ENST00000264605.3:c.943G>A	2.37:g.238436082G>A	ENSP00000264605:p.Asp315Asn		B3KSS2|B4DKW7|G5E9G5|Q9HA71	Missense_Mutation	SNP	pfam_Myelin-assoc_OBP,superfamily_Znf_FYVE_PHD,pfscan_Rab-bd_domain	p.D315N	ENST00000264605.3	37	c.943	CCDS2518.1	2	.	.	.	.	.	.	.	.	.	.	G	20.7	4.027461	0.75390	.	.	ENSG00000115648	ENST00000264605;ENST00000445024;ENST00000338530;ENST00000409373	T;T;T;T	0.42900	1.88;1.85;1.32;0.96	4.71	4.71	0.59529	.	1.416630	0.04384	N	0.361270	T	0.64735	0.2625	L	0.58810	1.83	0.31325	N	0.685524	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.997;1.0;1.0	D;D;D;D;D;D	0.76575	0.954;0.965;0.972;0.961;0.988;0.972	T	0.50775	-0.8788	10	0.48119	T	0.1	-16.0617	13.1653	0.59567	0.0:0.0:1.0:0.0	.	315;199;315;275;315;315	B4DKW7;Q6UWC1;A8KA64;B8ZZ97;Q9BV36-2;Q9BV36	.;.;.;.;.;MELPH_HUMAN	N	315;315;315;275	ENSP00000264605:D315N;ENSP00000414849:D315N;ENSP00000341845:D315N;ENSP00000386780:D275N	ENSP00000264605:D315N	D	+	1	0	MLPH	238100821	0.973000	0.33851	0.065000	0.19835	0.059000	0.15707	4.406000	0.59748	2.163000	0.67991	0.561000	0.74099	GAT	MLPH	-	NULL	ENSG00000115648		0.557	MLPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLPH	HGNC	protein_coding	OTTHUMT00000257083.2	65	0.00	0	G	NM_024101		238436082	238436082	+1	no_errors	ENST00000264605	ensembl	human	known	69_37n	missense	21	47.50	19	SNP	0.464	A
MMP9	4318	genome.wustl.edu	37	20	44642428	44642428	+	Missense_Mutation	SNP	C	C	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr20:44642428C>A	ENST00000372330.3	+	10	1762	c.1743C>A	c.(1741-1743)ttC>ttA	p.F581L	RP11-465L10.10_ENST00000535913.1_RNA	NM_004994.2	NP_004985.2	P14780	MMP9_HUMAN	matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)	581					collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|macrophage differentiation (GO:0030225)|negative regulation of cation channel activity (GO:2001258)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of receptor binding (GO:1900122)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|identical protein binding (GO:0042802)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|large_intestine(14)|liver(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	46		Myeloproliferative disorder(115;0.0122)			Captopril(DB01197)|Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)	AGCTTTTCTTCTTCTCTGGTT	0.597											OREG0025990	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													50.0	50.0	50.0					20																	44642428		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13390.1	20q12-q13	2008-01-07	2005-08-08		ENSG00000100985	ENSG00000100985	3.4.24.35		7176	protein-coding gene	gene with protein product		120361	"""matrix metalloproteinase 9 (gelatinase B, 92kD gelatinase, 92kD type IV collagenase)"", ""matrix metalloproteinase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)"""	CLG4B		2158484	Standard	NM_004994		Approved		uc002xqz.3	P14780	OTTHUMG00000033044	ENST00000372330.3:c.1743C>A	20.37:g.44642428C>A	ENSP00000361405:p.Phe581Leu	925	B2R7V9|Q3LR70|Q8N725|Q9H4Z1|Q9UCJ9|Q9UCL1|Q9UDK2	Missense_Mutation	SNP	pfam_Pept_M10_metallopeptidase,pfam_FN_type2_col-bd,pfam_Hemopexin/matrixin_repeat,pfam_PT,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Kringle-like,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_FN_type2_col-bd,smart_Hemopexin/matrixin_repeat,pfscan_FN_type2_col-bd,prints_Pept_M10A_matrixin	p.F581L	ENST00000372330.3	37	c.1743	CCDS13390.1	20	.	.	.	.	.	.	.	.	.	.	C	22.1	4.240666	0.79912	.	.	ENSG00000100985	ENST00000372330;ENST00000545925	T	0.06142	3.34	4.85	3.91	0.45181	Hemopexin/matrixin (2);	0.000000	0.85682	D	0.000000	T	0.21631	0.0521	M	0.82056	2.57	0.80722	D	1	D	0.71674	0.998	P	0.60789	0.879	T	0.01309	-1.1389	10	0.87932	D	0	.	11.8257	0.52265	0.0:0.9144:0.0:0.0856	.	581	P14780	MMP9_HUMAN	L	581;151	ENSP00000361405:F581L	ENSP00000361405:F581L	F	+	3	2	MMP9	44075835	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	4.356000	0.59430	1.248000	0.43934	0.655000	0.94253	TTC	MMP9	-	pfam_Hemopexin/matrixin_repeat,superfamily_Hemopexin/matrixin,smart_Hemopexin/matrixin_repeat	ENSG00000100985		0.597	MMP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP9	HGNC	protein_coding	OTTHUMT00000080337.1	34	0.00	0	C			44642428	44642428	+1	no_errors	ENST00000372330	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	1.000	A
MMS22L	253714	genome.wustl.edu	37	6	97679501	97679501	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr6:97679501G>A	ENST00000275053.4	-	13	1595	c.1330C>T	c.(1330-1332)Cct>Tct	p.P444S	MMS22L_ENST00000369251.2_Missense_Mutation_p.P404S	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	444					double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)				breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						CCTTTAAAAGGAAGCCAAGAA	0.348																																						dbGAP											0													60.0	59.0	59.0					6																	97679501		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.1330C>T	6.37:g.97679501G>A	ENSP00000275053:p.Pro444Ser		D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.P444S	ENST00000275053.4	37	c.1330	CCDS5039.1	6	.	.	.	.	.	.	.	.	.	.	G	11.54	1.670534	0.29693	.	.	ENSG00000146263	ENST00000275053;ENST00000369251	T;T	0.29142	1.58;1.58	4.78	3.88	0.44766	.	0.134840	0.48767	D	0.000162	T	0.13586	0.0329	L	0.47716	1.5	0.28527	N	0.912773	P;B	0.46142	0.873;0.43	B;B	0.42361	0.385;0.213	T	0.05386	-1.0888	10	0.23891	T	0.37	-2.5751	10.7498	0.46203	0.0:0.3814:0.6186:0.0	.	404;444	E2QRD4;Q6ZRQ5	.;MMS22_HUMAN	S	444;404	ENSP00000275053:P444S;ENSP00000358254:P404S	ENSP00000275053:P444S	P	-	1	0	MMS22L	97786222	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.622000	0.61240	2.186000	0.69663	0.655000	0.94253	CCT	MMS22L	-	NULL	ENSG00000146263		0.348	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMS22L	HGNC	protein_coding	OTTHUMT00000041573.3	54	0.00	0	G	NM_198468		97679501	97679501	-1	no_errors	ENST00000275053	ensembl	human	known	69_37n	missense	28	31.71	13	SNP	1.000	A
MORF4L2	9643	genome.wustl.edu	37	X	102931367	102931367	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chrX:102931367G>A	ENST00000441076.2	-	4	893	c.589C>T	c.(589-591)Cag>Tag	p.Q197*	MORF4L2_ENST00000360458.1_Nonsense_Mutation_p.Q197*|MORF4L2_ENST00000422154.2_Nonsense_Mutation_p.Q197*|MORF4L2_ENST00000433176.2_Nonsense_Mutation_p.Q197*|MORF4L2_ENST00000492116.1_5'Flank|MORF4L2_ENST00000451301.1_Nonsense_Mutation_p.Q197*|MORF4L2_ENST00000423833.2_Nonsense_Mutation_p.Q197*	NM_001142419.1|NM_012286.2	NP_001135891.1|NP_036418.1	Q15014	MO4L2_HUMAN	mortality factor 4 like 2	197	MRG. {ECO:0000255|PROSITE- ProRule:PRU00972}.				chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|DNA repair (GO:0006281)|positive regulation of striated muscle cell differentiation (GO:0051155)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)	13						TAGAGCAGCTGAGTGCCCAAC	0.433																																						dbGAP											0													78.0	72.0	74.0					X																	102931367		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF100620	CCDS14512.1	Xq22	2010-11-24			ENSG00000123562	ENSG00000123562			16849	protein-coding gene	gene with protein product	"""MORF-related gene X"""	300409				9891081, 7584026	Standard	NM_012286		Approved	KIAA0026, MRGX	uc011msa.2	Q15014	OTTHUMG00000022104	ENST00000441076.2:c.589C>T	X.37:g.102931367G>A	ENSP00000391969:p.Gln197*		B3KP92|D3DXA5|Q567V0|Q8J026	Nonsense_Mutation	SNP	pfam_MRG,superfamily_Chromodomain-like	p.Q197*	ENST00000441076.2	37	c.589	CCDS14512.1	X	.	.	.	.	.	.	.	.	.	.	G	46	12.519602	0.99675	.	.	ENSG00000123562	ENST00000360458;ENST00000372620;ENST00000433176;ENST00000422154;ENST00000451301;ENST00000372619;ENST00000441076;ENST00000423833	.	.	.	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-1.8951	14.5691	0.68200	0.0:0.0:1.0:0.0	.	.	.	.	X	197;79;197;197;197;179;197;197	.	ENSP00000353643:Q197X	Q	-	1	0	MORF4L2	102818023	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.540000	0.98080	2.618000	0.88619	0.600000	0.82982	CAG	MORF4L2	-	pfam_MRG	ENSG00000123562		0.433	MORF4L2-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MORF4L2	HGNC	protein_coding	OTTHUMT00000057732.1	60	0.00	0	G	NM_012286		102931367	102931367	-1	no_errors	ENST00000360458	ensembl	human	known	69_37n	nonsense	43	14.00	7	SNP	1.000	A
MORN1	79906	genome.wustl.edu	37	1	2252884	2252884	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:2252884C>T	ENST00000378531.3	-	14	1605	c.1432G>A	c.(1432-1434)Gaa>Aaa	p.E478K		NM_024848.1	NP_079124.1	Q5T089	MORN1_HUMAN	MORN repeat containing 1	478										breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(1)|ovary(2)	9	all_cancers(77;0.000194)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.3e-15)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;2.21e-37)|OV - Ovarian serous cystadenocarcinoma(86;5.01e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00137)|BRCA - Breast invasive adenocarcinoma(365;0.00488)|STAD - Stomach adenocarcinoma(132;0.00665)|KIRC - Kidney renal clear cell carcinoma(229;0.0203)|Lung(427;0.212)		CTTGAGGCTTCAGGGCCTTCT	0.701																																						dbGAP											0													20.0	25.0	23.0					1																	2252884		2000	4004	6004	-	-	-	SO:0001583	missense	0			AK024003	CCDS40.1, CCDS72688.1	1p36.33-p36.32	2008-02-05			ENSG00000116151	ENSG00000116151			25852	protein-coding gene	gene with protein product						12477932	Standard	XM_005244798		Approved	FLJ13941	uc001ajb.1	Q5T089	OTTHUMG00000001402	ENST00000378531.3:c.1432G>A	1.37:g.2252884C>T	ENSP00000367792:p.Glu478Lys		A6NKZ6|Q8WW30|Q9H852	Missense_Mutation	SNP	pfam_MORN,smart_MORN	p.E478K	ENST00000378531.3	37	c.1432	CCDS40.1	1	.	.	.	.	.	.	.	.	.	.	C	11.87	1.767219	0.31320	.	.	ENSG00000116151	ENST00000378531	T	0.52057	0.68	3.45	1.58	0.23477	.	3.252420	0.01089	N	0.005145	T	0.30230	0.0758	N	0.12746	0.255	0.09310	N	1	B	0.14438	0.01	B	0.10450	0.005	T	0.14811	-1.0459	10	0.22109	T	0.4	.	5.5368	0.17016	0.0:0.743:0.0:0.257	.	478	Q5T089	MORN1_HUMAN	K	478	ENSP00000367792:E478K	ENSP00000367792:E478K	E	-	1	0	MORN1	2242744	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	0.317000	0.19487	0.458000	0.26988	0.561000	0.74099	GAA	MORN1	-	NULL	ENSG00000116151		0.701	MORN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MORN1	HGNC	protein_coding	OTTHUMT00000004055.1	32	0.00	0	C	NM_024848		2252884	2252884	-1	no_errors	ENST00000378531	ensembl	human	known	69_37n	missense	26	31.58	12	SNP	0.001	T
MPDZ	8777	genome.wustl.edu	37	9	13190232	13190232	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr9:13190232C>G	ENST00000319217.7	-	16	2282	c.2035G>C	c.(2035-2037)Gat>Cat	p.D679H	MPDZ_ENST00000381022.2_Missense_Mutation_p.D679H|MPDZ_ENST00000381015.4_Missense_Mutation_p.D679H|MPDZ_ENST00000447879.1_Missense_Mutation_p.D679H|MPDZ_ENST00000546205.1_Missense_Mutation_p.D679H|MPDZ_ENST00000536827.1_Missense_Mutation_p.D679H|MPDZ_ENST00000541718.1_Missense_Mutation_p.D679H	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	679					cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		TGACCCGCATCAGTCATCGCC	0.507																																						dbGAP											0													79.0	75.0	76.0					9																	13190232		2076	4224	6300	-	-	-	SO:0001583	missense	0			AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.2035G>C	9.37:g.13190232C>G	ENSP00000320006:p.Asp679His		A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Missense_Mutation	SNP	pfam_PDZ,pfam_L27_2,superfamily_PDZ,smart_PDZ,pfscan_L27,pfscan_PDZ	p.D679H	ENST00000319217.7	37	c.2035		9	.	.	.	.	.	.	.	.	.	.	C	11.33	1.606777	0.28623	.	.	ENSG00000107186	ENST00000319217;ENST00000541718;ENST00000381022;ENST00000536827;ENST00000447879;ENST00000381015;ENST00000546205	T;T;T;T;T;T;T	0.12672	2.7;2.66;2.66;2.66;2.7;2.7;2.7	5.83	4.94	0.65067	.	0.000000	0.45126	D	0.000381	T	0.16514	0.0397	L	0.27053	0.805	0.80722	D	1	P;P;P	0.52170	0.836;0.797;0.951	B;P;P	0.50136	0.417;0.549;0.632	T	0.01670	-1.1299	10	0.46703	T	0.11	.	14.7147	0.69259	0.0:0.9299:0.0:0.0701	.	679;679;679	B7ZMI4;O75970-3;O75970-2	.;.;.	H	679	ENSP00000320006:D679H;ENSP00000439807:D679H;ENSP00000370410:D679H;ENSP00000444151:D679H;ENSP00000415208:D679H;ENSP00000370403:D679H;ENSP00000446358:D679H	ENSP00000320006:D679H	D	-	1	0	MPDZ	13180232	0.016000	0.18221	0.129000	0.21949	0.049000	0.14656	2.050000	0.41297	1.483000	0.48342	0.655000	0.94253	GAT	MPDZ	-	superfamily_PDZ	ENSG00000107186		0.507	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	MPDZ	HGNC	protein_coding	OTTHUMT00000055485.2	59	0.00	0	C	NM_003829		13190232	13190232	-1	no_errors	ENST00000319217	ensembl	human	known	69_37n	missense	40	33.33	20	SNP	0.869	G
MPHOSPH9	10198	genome.wustl.edu	37	12	123645757	123645757	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:123645757C>G	ENST00000606320.1	-	22	3513	c.3307G>C	c.(3307-3309)Gaa>Caa	p.E1103Q	MPHOSPH9_ENST00000392425.3_Missense_Mutation_p.E951Q|MPHOSPH9_ENST00000541076.2_Missense_Mutation_p.E1073Q|MPHOSPH9_ENST00000302349.5_Missense_Mutation_p.E951Q			Q99550	MPP9_HUMAN	M-phase phosphoprotein 9	1103						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(18)|prostate(2)|skin(1)	33	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)		GCTGTATATTCAAAATCATTC	0.363																																						dbGAP											0													96.0	92.0	94.0					12																	123645757		2203	4300	6503	-	-	-	SO:0001583	missense	0			X98258	CCDS9243.1, CCDS9243.2	12q24	2008-03-03			ENSG00000051825	ENSG00000051825			7215	protein-coding gene	gene with protein product		605501				8885239	Standard	NM_022782		Approved	MPP9	uc001uel.3	Q99550	OTTHUMG00000168849	ENST00000606320.1:c.3307G>C	12.37:g.123645757C>G	ENSP00000475489:p.Glu1103Gln		A1L486|A6NEE2|B3KR87|Q9H976|U3KQ28	Missense_Mutation	SNP	superfamily_Prefoldin	p.E951Q	ENST00000606320.1	37	c.2851		12	.	.	.	.	.	.	.	.	.	.	C	18.03	3.532628	0.64972	.	.	ENSG00000051825	ENST00000541603;ENST00000302349;ENST00000541076	T;T;T	0.48201	0.82;1.42;1.44	5.58	5.58	0.84498	.	0.166516	0.37669	N	0.001990	T	0.54287	0.1849	L	0.57536	1.79	0.28594	N	0.909512	D	0.63046	0.992	P	0.59948	0.866	T	0.55444	-0.8140	10	0.32370	T	0.25	-24.8714	5.4038	0.16310	0.0:0.6444:0.1718:0.1838	.	951	Q99550	MPP9_HUMAN	Q	129;951;951	ENSP00000446362:E129Q;ENSP00000303597:E951Q;ENSP00000445859:E951Q	ENSP00000303597:E951Q	E	-	1	0	MPHOSPH9	122211710	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.109000	0.41863	2.641000	0.89580	0.563000	0.77884	GAA	MPHOSPH9	-	NULL	ENSG00000051825		0.363	MPHOSPH9-030	NOVEL	basic	protein_coding	MPHOSPH9	HGNC	protein_coding	OTTHUMT00000471390.2	60	0.00	0	C			123645757	123645757	-1	no_errors	ENST00000541076	ensembl	human	known	69_37n	missense	68	16.05	13	SNP	0.996	G
MPP1	4354	genome.wustl.edu	37	X	154012325	154012325	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chrX:154012325C>G	ENST00000369534.3	-	8	990	c.843G>C	c.(841-843)aaG>aaC	p.K281N	MPP1_ENST00000413259.3_Missense_Mutation_p.K251N|MPP1_ENST00000393531.1_Missense_Mutation_p.K261N|MPP1_ENST00000462825.1_5'UTR	NM_001166460.1|NM_001166461.1|NM_002436.3	NP_001159932.1|NP_001159933.1|NP_002427.1	Q00013	EM55_HUMAN	membrane protein, palmitoylated 1, 55kDa	281	Interaction with MPP5.				nucleotide phosphorylation (GO:0046939)|regulation of neutrophil chemotaxis (GO:0090022)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)	p.K281N(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(9)|ovary(2)|prostate(1)	21	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GGGTCTTCCTCTTGAATGCAG	0.473																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											131.0	84.0	100.0					X																	154012325		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14762.1, CCDS55544.1, CCDS55545.1	Xq28	2008-03-04	2002-08-29		ENSG00000130830	ENSG00000130830			7219	protein-coding gene	gene with protein product		305360	"""membrane protein, palmitoylated 1 (55kD)"""	DXS552E		1713685	Standard	NM_002436		Approved	PEMP	uc004fmp.2	Q00013	OTTHUMG00000024244	ENST00000369534.3:c.843G>C	X.37:g.154012325C>G	ENSP00000358547:p.Lys281Asn		B4DZV5|G3XAI1|Q2TSB6|Q5J7V5	Missense_Mutation	SNP	pfam_Guanylate_kin,pfam_PDZ,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_PDZ,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.K281N	ENST00000369534.3	37	c.843	CCDS14762.1	X	.	.	.	.	.	.	.	.	.	.	C	14.04	2.417142	0.42918	.	.	ENSG00000130830	ENST00000369534;ENST00000413259;ENST00000393531;ENST00000453245;ENST00000393529	T;T;T;T;T	0.32515	2.24;2.24;2.24;2.24;1.45	5.32	3.56	0.40772	Guanylate kinase/L-type calcium channel (1);	0.145710	0.64402	D	0.000011	T	0.30417	0.0764	L	0.61218	1.895	0.43342	D	0.995396	B;B;B;B	0.21753	0.035;0.022;0.018;0.06	B;B;B;B	0.26614	0.011;0.071;0.042;0.071	T	0.07443	-1.0772	10	0.54805	T	0.06	.	7.7908	0.29119	0.0:0.7325:0.0:0.2675	.	264;251;261;281	B4E325;B4DZV5;G3XAI1;Q00013	.;.;.;EM55_HUMAN	N	281;251;261;155;235	ENSP00000358547:K281N;ENSP00000400155:K251N;ENSP00000377165:K261N;ENSP00000410888:K155N;ENSP00000377163:K235N	ENSP00000358547:K281N	K	-	3	2	MPP1	153665519	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	0.538000	0.23160	0.471000	0.27319	0.529000	0.55759	AAG	MPP1	-	smart_Guanylate_kin/L-typ_Ca_channel	ENSG00000130830		0.473	MPP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MPP1	HGNC	protein_coding	OTTHUMT00000061191.3	69	0.00	0	C	NM_002436		154012325	154012325	-1	no_errors	ENST00000369534	ensembl	human	known	69_37n	missense	29	30.95	13	SNP	1.000	G
MRPL21	219927	genome.wustl.edu	37	11	68664121	68664121	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr11:68664121C>T	ENST00000362034.2	-	4	267	c.258G>A	c.(256-258)atG>atA	p.M86I	MRPL21_ENST00000567045.1_Start_Codon_SNP_p.M1I|MRPL21_ENST00000450904.2_Start_Codon_SNP_p.M1I	NM_181514.1|NM_181515.1	NP_852615.1|NP_852616.1	Q7Z2W9	RM21_HUMAN	mitochondrial ribosomal protein L21	86					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			large_intestine(1)|lung(6)|prostate(1)	8			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			CCGTGACGATCATCTCATTCA	0.587																																						dbGAP											0													146.0	128.0	134.0					11																	68664121		2200	4294	6494	-	-	-	SO:0001583	missense	0			AK096756	CCDS8186.1, CCDS44662.1	11q13.3	2012-09-13			ENSG00000197345	ENSG00000197345		"""Mitochondrial ribosomal proteins / large subunits"""	14479	protein-coding gene	gene with protein product		611834				11551941	Standard	NM_181514		Approved		uc001ooi.3	Q7Z2W9	OTTHUMG00000167893	ENST00000362034.2:c.258G>A	11.37:g.68664121C>T	ENSP00000354580:p.Met86Ile		A6NKU0|C9JPR2	Missense_Mutation	SNP	pfam_Ribosomal_L21,tigrfam_Ribosomal_L21	p.M86I	ENST00000362034.2	37	c.258	CCDS8186.1	11	.	.	.	.	.	.	.	.	.	.	C	9.807	1.182130	0.21787	.	.	ENSG00000197345	ENST00000450904;ENST00000362034;ENST00000447977	.	.	.	5.41	2.47	0.30058	.	0.350737	0.28214	N	0.016168	T	0.39784	0.1091	N	0.19112	0.55	0.80722	D	1	B;B	0.18863	0.031;0.0	B;B	0.18263	0.021;0.003	T	0.11203	-1.0597	9	0.37606	T	0.19	-8.7369	10.3966	0.44205	0.0:0.517:0.4103:0.0727	.	86;86	B4DXI4;Q7Z2W9	.;RM21_HUMAN	I	1;86;86	.	ENSP00000354580:M86I	M	-	3	0	MRPL21	68420697	0.935000	0.31712	0.990000	0.47175	0.001000	0.01503	0.154000	0.16343	0.240000	0.21263	-0.938000	0.02693	ATG	MRPL21	-	NULL	ENSG00000197345		0.587	MRPL21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL21	HGNC	protein_coding	OTTHUMT00000396856.1	50	0.00	0	C	NM_181512		68664121	68664121	-1	no_errors	ENST00000362034	ensembl	human	known	69_37n	missense	94	12.96	14	SNP	0.996	T
MRPS27	23107	genome.wustl.edu	37	5	71521974	71521974	+	Silent	SNP	C	C	T	rs537312265		TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr5:71521974C>T	ENST00000261413.5	-	9	786	c.747G>A	c.(745-747)ctG>ctA	p.L249L	MRPS27_ENST00000513900.1_Silent_p.L263L|MRPS27_ENST00000457646.4_Silent_p.L193L|MRPS27_ENST00000522562.1_5'UTR	NM_015084.2	NP_055899.2	Q92552	RT27_HUMAN	mitochondrial ribosomal protein S27	249						mitochondrion (GO:0005739)|ribosome (GO:0005840)				breast(1)|endometrium(1)|large_intestine(2)|lung(2)	6		Lung NSC(167;0.00237)|Ovarian(174;0.0175)|Prostate(461;0.141)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.46e-53)		GTTTCCATATCAGAGGCATGT	0.502													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19092	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													114.0	106.0	109.0					5																	71521974		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D87453	CCDS4013.1, CCDS68890.1, CCDS75257.1	5q13.2	2012-09-13			ENSG00000113048	ENSG00000113048		"""Mitochondrial ribosomal proteins / small subunits"""	14512	protein-coding gene	gene with protein product		611989					Standard	NM_015084		Approved	KIAA0264	uc003kbz.4	Q92552	OTTHUMG00000100951	ENST00000261413.5:c.747G>A	5.37:g.71521974C>T			B4DRT2|Q6P1S1	Silent	SNP	pfam_Ribosomal_S27_mit	p.L263	ENST00000261413.5	37	c.789	CCDS4013.1	5																																																																																			MRPS27	-	pfam_Ribosomal_S27_mit	ENSG00000113048		0.502	MRPS27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS27	HGNC	protein_coding	OTTHUMT00000218560.2	88	0.00	0	C	NM_015084		71521974	71521974	-1	no_errors	ENST00000513900	ensembl	human	known	69_37n	silent	47	18.97	11	SNP	0.993	T
MSC	9242	genome.wustl.edu	37	8	72754930	72754930	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr8:72754930G>A	ENST00000325509.4	-	2	876	c.587C>T	c.(586-588)tCc>tTc	p.S196F	RP11-383H13.1_ENST00000524152.1_5'Flank|RP11-383H13.1_ENST00000521467.1_Intron|RP11-383H13.1_ENST00000537896.1_5'Flank|MSC_ENST00000518440.1_5'UTR	NM_005098.3	NP_005089.2	O60682	MUSC_HUMAN	musculin	196					branchiomeric skeletal muscle development (GO:0014707)|diaphragm development (GO:0060539)|palate development (GO:0060021)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(4)|skin(2)	26	Breast(64;0.176)		Epithelial(68;0.137)|BRCA - Breast invasive adenocarcinoma(89;0.203)			GTTGGCTGCGGAAACTTCTTT	0.468																																						dbGAP											0													360.0	360.0	360.0					8																	72754930		1952	4139	6091	-	-	-	SO:0001583	missense	0				CCDS43746.1	8q13.3	2013-06-07	2010-04-28		ENSG00000178860	ENSG00000178860		"""Basic helix-loop-helix proteins"""	7321	protein-coding gene	gene with protein product	"""activated B-cell factor-1"""	603628	"""musculin (activated B-cell factor-1)"""			9584154, 10198176	Standard	NM_005098		Approved	ABF-1, bHLHa22	uc003xyx.1	O60682	OTTHUMG00000164489	ENST00000325509.4:c.587C>T	8.37:g.72754930G>A	ENSP00000321445:p.Ser196Phe		O75946|Q53XZ2|Q9BRE7	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.S196F	ENST00000325509.4	37	c.587	CCDS43746.1	8	.	.	.	.	.	.	.	.	.	.	G	21.7	4.187847	0.78789	.	.	ENSG00000178860	ENST00000325509	D	0.97994	-4.65	4.88	4.88	0.63580	.	4.010640	0.01060	N	0.004626	D	0.96269	0.8783	N	0.12182	0.205	0.46185	D	0.998912	P	0.51933	0.949	P	0.49752	0.621	D	0.86515	0.1812	10	0.18276	T	0.48	.	18.2206	0.89901	0.0:0.0:1.0:0.0	.	196	O60682	MUSC_HUMAN	F	196	ENSP00000321445:S196F	ENSP00000321445:S196F	S	-	2	0	MSC	72917484	0.749000	0.28305	0.875000	0.34327	0.990000	0.78478	2.944000	0.49034	2.559000	0.86315	0.462000	0.41574	TCC	MSC	-	NULL	ENSG00000178860		0.468	MSC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSC	HGNC	protein_coding	OTTHUMT00000378974.1	82	0.00	0	G	NM_005098		72754930	72754930	-1	no_errors	ENST00000325509	ensembl	human	known	69_37n	missense	51	35.44	28	SNP	0.770	A
MUC16	94025	genome.wustl.edu	37	19	8995652	8995652	+	Missense_Mutation	SNP	G	G	C	rs532355737	byFrequency	TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr19:8995652G>C	ENST00000397910.4	-	63	41539	c.41336C>G	c.(41335-41337)tCg>tGg	p.S13779W	MUC16_ENST00000380951.5_Missense_Mutation_p.S420W	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13781				Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GCCAAATATCGAGGCTGGAGT	0.463																																						dbGAP											0													57.0	55.0	56.0					19																	8995652		1914	4123	6037	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.41336C>G	19.37:g.8995652G>C	ENSP00000381008:p.Ser13779Trp		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.S13779W	ENST00000397910.4	37	c.41336	CCDS54212.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	6.706|6.706	0.498924|0.498924	0.12762|0.12762	.|.	.|.	ENSG00000181143|ENSG00000181143	ENST00000542240|ENST00000397910;ENST00000380951	.|T	.|0.02032	.|4.49	1.27|1.27	0.0831|0.0831	0.14432|0.14432	.|.	.|.	.|.	.|.	.|.	T|T	0.08492|0.08492	0.0211|0.0211	M|M	0.76574|0.76574	2.34|2.34	.|.	.|.	.|.	.|D;D	.|0.69078	.|0.997;0.997	.|P;D	.|0.77557	.|0.561;0.99	T|T	0.13926|0.13926	-1.0491|-1.0491	4|8	.|0.87932	.|D	.|0	.|.	4.4168|4.4168	0.11461|0.11461	0.0:0.0:0.6142:0.3858|0.0:0.0:0.6142:0.3858	.|.	.|21424;13779	.|Q8WXI7;B5ME49	.|MUC16_HUMAN;.	G|W	619|13779;420	.|ENSP00000381008:S13779W	.|ENSP00000370338:S420W	R|S	-|-	1|2	2|0	MUC16|MUC16	8856652|8856652	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.003000|0.003000	0.03518|0.03518	0.071000|0.071000	0.14594|0.14594	0.095000|0.095000	0.17434|0.17434	0.436000|0.436000	0.28706|0.28706	CGA|TCG	MUC16	-	NULL	ENSG00000181143		0.463	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	48	0.00	0	G	NM_024690		8995652	8995652	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	44	29.03	18	SNP	0.001	C
MUC4	4585	genome.wustl.edu	37	3	195506620	195506620	+	Nonsense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr3:195506620G>C	ENST00000463781.3	-	2	12290	c.11831C>G	c.(11830-11832)tCa>tGa	p.S3944*	MUC4_ENST00000475231.1_Nonsense_Mutation_p.S3944*|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGTGGATGCTGAGGAAGTGCT	0.582																																						dbGAP											0													14.0	14.0	14.0					3																	195506620		589	1284	1873	-	-	-	SO:0001587	stop_gained	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11831C>G	3.37:g.195506620G>C	ENSP00000417498:p.Ser3944*		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Nonsense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.S3944*	ENST00000463781.3	37	c.11831	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	g	52	18.660823	0.99908	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	X	3944	.	.	S	-	2	0	MUC4	196991399	0.002000	0.14202	0.028000	0.17463	0.019000	0.09904	0.465000	0.22004	0.413000	0.25759	0.064000	0.15345	TCA	MUC4	-	NULL	ENSG00000145113		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	52	0.00	0	G	NM_018406		195506620	195506620	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	nonsense	27	50.00	27	SNP	0.742	C
MXD4	10608	genome.wustl.edu	37	4	2259733	2259733	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr4:2259733G>A	ENST00000337190.2	-	3	483	c.170C>T	c.(169-171)tCa>tTa	p.S57L	MXD4_ENST00000515378.1_5'UTR	NM_006454.2	NP_006445.1	Q14582	MAD4_HUMAN	MAX dimerization protein 4	57	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(1)|kidney(1)|lung(3)	6						CTCGTTGTGTGAAGACCTGTT	0.567																																						dbGAP											0													115.0	103.0	107.0					4																	2259733		2200	4300	6500	-	-	-	SO:0001583	missense	0				CCDS3361.1	4p16.3	2008-08-19			ENSG00000123933	ENSG00000123933		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	13906	protein-coding gene	gene with protein product						8521822	Standard	NM_006454		Approved	MAD4, MSTP149, MST149, bHLHc12	uc003geu.1	Q14582	OTTHUMG00000090243	ENST00000337190.2:c.170C>T	4.37:g.2259733G>A	ENSP00000337889:p.Ser57Leu		A2A335|Q5TZX4	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.S57L	ENST00000337190.2	37	c.170	CCDS3361.1	4	.	.	.	.	.	.	.	.	.	.	G	25.3	4.624377	0.87560	.	.	ENSG00000123933	ENST00000337190	T	0.29917	1.55	4.83	4.83	0.62350	Helix-loop-helix DNA-binding (4);	0.161231	0.44285	D	0.000463	T	0.26159	0.0638	N	0.17082	0.46	0.58432	D	0.999995	B	0.31548	0.328	B	0.37480	0.251	T	0.19160	-1.0314	10	0.87932	D	0	0.0058	16.6602	0.85238	0.0:0.0:1.0:0.0	.	57	Q14582	MAD4_HUMAN	L	57	ENSP00000337889:S57L	ENSP00000337889:S57L	S	-	2	0	MXD4	2229531	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.658000	0.54482	2.502000	0.84385	0.655000	0.94253	TCA	MXD4	-	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,pfscan_HLH_DNA-bd	ENSG00000123933		0.567	MXD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXD4	HGNC	protein_coding	OTTHUMT00000206519.1	50	0.00	0	G	NM_006454		2259733	2259733	-1	no_errors	ENST00000337190	ensembl	human	known	69_37n	missense	54	23.94	17	SNP	1.000	A
MYLK	4638	genome.wustl.edu	37	3	123452940	123452940	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr3:123452940C>T	ENST00000475616.1	-	7	902	c.903G>A	c.(901-903)caG>caA	p.Q301Q	MYLK_ENST00000359169.1_Silent_p.Q301Q|MYLK_ENST00000360304.3_Silent_p.Q301Q|MYLK_ENST00000346322.5_Silent_p.Q301Q|MYLK_ENST00000360772.3_Silent_p.Q301Q			Q15746	MYLK_HUMAN	myosin light chain kinase	301					actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		AGCCACCTCTCTGGGGGCTGG	0.587																																						dbGAP											0													47.0	48.0	47.0					3																	123452940		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.903G>A	3.37:g.123452940C>T			B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Silent	SNP	pfam_Ig_I-set,pfam_Prot_kinase_cat_dom,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.Q301	ENST00000475616.1	37	c.903	CCDS46896.1	3																																																																																			MYLK	-	NULL	ENSG00000065534		0.587	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYLK	HGNC	protein_coding	OTTHUMT00000356464.1	48	0.00	0	C	NM_053025		123452940	123452940	-1	no_errors	ENST00000360304	ensembl	human	known	69_37n	silent	29	34.09	15	SNP	0.017	T
MYO1H	283446	genome.wustl.edu	37	12	109845625	109845625	+	Silent	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:109845625C>G	ENST00000431443.2	+	9	1014	c.1014C>G	c.(1012-1014)ctC>ctG	p.L338L	MYO1H_ENST00000310903.5_Silent_p.L338L|MYO1H_ENST00000542883.1_3'UTR	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	338	Myosin motor.					myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						CACTAGAACTCTCTGTCTACG	0.423																																						dbGAP											0													131.0	119.0	123.0					12																	109845625		1912	4124	6036	-	-	-	SO:0001819	synonymous_variant	0				CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.1014C>G	12.37:g.109845625C>G			F5H3C6	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.L338	ENST00000431443.2	37	c.1014		12																																																																																			MYO1H	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000174527		0.423	MYO1H-201	KNOWN	basic	protein_coding	MYO1H	HGNC	protein_coding		56	0.00	0	C	NM_173597		109845625	109845625	+1	no_errors	ENST00000431443	ensembl	human	known	69_37n	silent	16	50.00	16	SNP	1.000	G
MYO3B	140469	genome.wustl.edu	37	2	171240300	171240300	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:171240300C>T	ENST00000408978.4	+	12	1409	c.1266C>T	c.(1264-1266)tgC>tgT	p.C422C	MYO3B_ENST00000409044.3_Silent_p.C422C|MYO3B_ENST00000334231.6_Silent_p.C431C|MYO3B_ENST00000602629.1_3'UTR	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	422	Myosin motor.				peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						CTTACCAGTGCATGGTTACTC	0.453																																						dbGAP											0													127.0	118.0	121.0					2																	171240300		1980	4154	6134	-	-	-	SO:0001819	synonymous_variant	0				CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.1266C>T	2.37:g.171240300C>T			B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_Prot_kinase_cat_dom,prints_Myosin_head_motor_dom	p.C431	ENST00000408978.4	37	c.1293	CCDS42773.1	2																																																																																			MYO3B	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000071909		0.453	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	MYO3B	HGNC	protein_coding	OTTHUMT00000333410.1	79	0.00	0	C			171240300	171240300	+1	no_errors	ENST00000334231	ensembl	human	known	69_37n	silent	57	24.68	19	SNP	1.000	T
MYOF	26509	genome.wustl.edu	37	10	95129427	95129427	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr10:95129427C>G	ENST00000359263.4	-	25	2563	c.2564G>C	c.(2563-2565)gGa>gCa	p.G855A	MYOF_ENST00000358334.5_Missense_Mutation_p.G842A|MYOF_ENST00000371501.4_Missense_Mutation_p.G855A|MYOF_ENST00000371502.4_Missense_Mutation_p.G855A	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	855					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						GGTGAAAGTTCCTTCTGCGAA	0.448																																						dbGAP											0													118.0	110.0	112.0					10																	95129427		1914	4150	6064	-	-	-	SO:0001583	missense	0			AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.2564G>C	10.37:g.95129427C>G	ENSP00000352208:p.Gly855Ala		B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_Ferlin_B-domain,pfam_FerIin-domain,pfam_Ferlin_A-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_Peroxin/Ferlin,pfscan_C2_membr_targeting	p.G855A	ENST00000359263.4	37	c.2564	CCDS41551.1	10	.	.	.	.	.	.	.	.	.	.	C	29.3	4.996165	0.93167	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	D;D;D;D	0.85088	-1.94;-1.93;-1.92;-1.94	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.91994	0.7464	M	0.68952	2.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.91433	0.5167	10	0.59425	D	0.04	-19.0911	19.9142	0.97043	0.0:1.0:0.0:0.0	.	842;855	Q9NZM1-6;Q9NZM1	.;MYOF_HUMAN	A	842;855;855;855	ENSP00000351094:G842A;ENSP00000352208:G855A;ENSP00000360556:G855A;ENSP00000360557:G855A	ENSP00000351094:G842A	G	-	2	0	MYOF	95119417	1.000000	0.71417	0.991000	0.47740	0.988000	0.76386	7.651000	0.83577	2.941000	0.99782	0.655000	0.94253	GGA	MYOF	-	NULL	ENSG00000138119		0.448	MYOF-005	KNOWN	basic|CCDS	protein_coding	MYOF	HGNC	protein_coding	OTTHUMT00000049423.2	37	0.00	0	C	NM_013451		95129427	95129427	-1	no_errors	ENST00000359263	ensembl	human	known	69_37n	missense	43	24.56	14	SNP	1.000	G
NALCN	259232	genome.wustl.edu	37	13	101735225	101735225	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr13:101735225C>T	ENST00000251127.6	-	33	3781	c.3700G>A	c.(3700-3702)Gag>Aag	p.E1234K		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1234					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					ACCGGGTCCTCGACGTCCCAC	0.522																																						dbGAP											0													117.0	104.0	109.0					13																	101735225		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.3700G>A	13.37:g.101735225C>T	ENSP00000251127:p.Glu1234Lys		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.E1234K	ENST00000251127.6	37	c.3700	CCDS9498.1	13	.	.	.	.	.	.	.	.	.	.	C	14.70	2.613592	0.46631	.	.	ENSG00000102452	ENST00000251127	D	0.97404	-4.37	5.64	5.64	0.86602	.	0.672470	0.15955	N	0.236522	D	0.95156	0.8430	L	0.48642	1.525	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	D	0.91559	0.5263	10	0.40728	T	0.16	.	15.9999	0.80285	0.0:0.8654:0.1346:0.0	.	1234	Q8IZF0	NALCN_HUMAN	K	1234	ENSP00000251127:E1234K	ENSP00000251127:E1234K	E	-	1	0	NALCN	100533226	0.991000	0.36638	0.990000	0.47175	0.996000	0.88848	2.925000	0.48884	2.645000	0.89757	0.650000	0.86243	GAG	NALCN	-	NULL	ENSG00000102452		0.522	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	HGNC	protein_coding	OTTHUMT00000045663.2	40	0.00	0	C	NM_052867		101735225	101735225	-1	no_errors	ENST00000251127	ensembl	human	known	69_37n	missense	26	39.53	17	SNP	0.948	T
NBN	4683	genome.wustl.edu	37	8	90965489	90965489	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr8:90965489C>T	ENST00000265433.3	-	11	1982	c.1828G>A	c.(1828-1830)Gaa>Aaa	p.E610K	NBN_ENST00000409330.1_Missense_Mutation_p.E528K	NM_002485.4	NP_002476.2	O60934	NBN_HUMAN	nibrin	610					blastocyst growth (GO:0001832)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|DNA damage checkpoint (GO:0000077)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intrinsic apoptotic signaling pathway (GO:0097193)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mitotic cell cycle checkpoint (GO:0007093)|mitotic G2 DNA damage checkpoint (GO:0007095)|neuromuscular process controlling balance (GO:0050885)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|telomere maintenance (GO:0000723)	Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nuclear inclusion body (GO:0042405)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|replication fork (GO:0005657)|site of double-strand break (GO:0035861)	damaged DNA binding (GO:0003684)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(2)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(11;0.0344)			TTGCTACTTTCTGGTACTGCT	0.338								Homologous recombination																														dbGAP											0													252.0	244.0	247.0					8																	90965489		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF058696	CCDS6249.1	8q21-q24	2014-09-17	2005-06-02	2005-06-02	ENSG00000104320	ENSG00000104320			7652	protein-coding gene	gene with protein product		602667	"""Nijmegen breakage syndrome 1 (nibrin)"""	NBS, NBS1		9590181, 9590180	Standard	XM_005250923		Approved	ATV, AT-V2, AT-V1	uc003yej.1	O60934	OTTHUMG00000153546	ENST00000265433.3:c.1828G>A	8.37:g.90965489C>T	ENSP00000265433:p.Glu610Lys		B2R626|B2RNC5|O60672|Q32NF7|Q53FM6|Q63HR6|Q7LDM2	Missense_Mutation	SNP	pfam_DNA-repair_Nbs1_C,pfam_FHA_dom,superfamily_SMAD_FHA_domain,superfamily_BRCT_dom,smart_FHA_dom,pirsf_Nibrin_met,pfscan_FHA_dom	p.E610K	ENST00000265433.3	37	c.1828	CCDS6249.1	8	.	.	.	.	.	.	.	.	.	.	C	4.944	0.175451	0.09391	.	.	ENSG00000104320	ENST00000265433;ENST00000409330	T;T	0.60424	1.93;0.19	5.29	4.41	0.53225	.	0.481828	0.24476	N	0.038182	T	0.39118	0.1066	N	0.19112	0.55	0.09310	N	0.999993	B;B	0.20052	0.008;0.041	B;B	0.17098	0.01;0.017	T	0.14952	-1.0454	10	0.34782	T	0.22	-13.3792	8.8725	0.35325	0.0:0.8999:0.0:0.1001	.	610;610	A6H8Y5;O60934	.;NBN_HUMAN	K	610;528	ENSP00000265433:E610K;ENSP00000386924:E528K	ENSP00000265433:E610K	E	-	1	0	NBN	91034665	0.001000	0.12720	0.295000	0.24960	0.134000	0.20937	0.367000	0.20382	2.469000	0.83416	0.650000	0.86243	GAA	NBN	-	pirsf_Nibrin_met	ENSG00000104320		0.338	NBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBN	HGNC	protein_coding	OTTHUMT00000331583.3	189	0.00	0	C	NM_001024688		90965489	90965489	-1	no_errors	ENST00000265433	ensembl	human	known	69_37n	missense	154	23.38	47	SNP	0.245	T
NCOR2	9612	genome.wustl.edu	37	12	124816953	124816953	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:124816953C>T	ENST00000405201.1	-	43	6816	c.6816G>A	c.(6814-6816)ctG>ctA	p.L2272L	NCOR2_ENST00000429285.2_Silent_p.L2262L|NCOR2_ENST00000404621.1_Silent_p.L2262L|NCOR2_ENST00000404121.2_Silent_p.L1833L|NCOR2_ENST00000397355.1_Silent_p.L2263L|NCOR2_ENST00000356219.3_Silent_p.L2279L			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	2283					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		TGCTCTCGGTCAGCTTGCTGA	0.552											OREG0022237	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													131.0	146.0	141.0					12																	124816953		2138	4224	6362	-	-	-	SO:0001819	synonymous_variant	0			U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.6816G>A	12.37:g.124816953C>T		1537	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Silent	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.L2279	ENST00000405201.1	37	c.6837	CCDS41858.2	12																																																																																			NCOR2	-	NULL	ENSG00000196498		0.552	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCOR2	HGNC	protein_coding	OTTHUMT00000318173.2	131	0.00	0	C	NM_006312		124816953	124816953	-1	no_errors	ENST00000356219	ensembl	human	known	69_37n	silent	82	28.70	33	SNP	1.000	T
NDC80	10403	genome.wustl.edu	37	18	2575037	2575037	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr18:2575037G>A	ENST00000261597.4	+	3	333	c.151G>A	c.(151-153)Gaa>Aaa	p.E51K		NM_006101.2	NP_006092.1	O14777	NDC80_HUMAN	NDC80 kinetochore complex component	51	Interaction with the N-terminus of CDCA1.|Nuclear localization.				attachment of spindle microtubules to kinetochore (GO:0008608)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				NS(1)|biliary_tract(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)|urinary_tract(2)	22						ACCGACATCTGAAAGAAAAGT	0.303																																						dbGAP											0													44.0	42.0	43.0					18																	2575037		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF017790	CCDS11827.1	18p11.31	2013-01-17	2013-01-17	2007-03-02	ENSG00000080986	ENSG00000080986			16909	protein-coding gene	gene with protein product		607272	"""highly expressed in cancer, rich in leucine heptad repeats (yeast)"", ""kinetochore associated 2"", ""NDC80 kinetochore complex component homolog (S. cerevisiae)"""	KNTC2		9315664, 12351790	Standard	NM_006101		Approved	HEC, HEC1, hsNDC80, TID3	uc002kli.3	O14777	OTTHUMG00000131483	ENST00000261597.4:c.151G>A	18.37:g.2575037G>A	ENSP00000261597:p.Glu51Lys		Q6PJX2	Missense_Mutation	SNP	pfam_Kinetochore_Ndc80,superfamily_t-SNARE	p.E51K	ENST00000261597.4	37	c.151	CCDS11827.1	18	.	.	.	.	.	.	.	.	.	.	G	23.0	4.362419	0.82353	.	.	ENSG00000080986	ENST00000261597;ENST00000543946	T	0.44482	0.92	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.60894	0.2304	M	0.68317	2.08	0.58432	D	0.999997	D	0.67145	0.996	D	0.66602	0.945	T	0.54036	-0.8353	10	0.16896	T	0.51	-16.3492	19.2326	0.93846	0.0:0.0:1.0:0.0	.	51	O14777	NDC80_HUMAN	K	51	ENSP00000261597:E51K	ENSP00000261597:E51K	E	+	1	0	NDC80	2565037	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	6.393000	0.73217	2.538000	0.85594	0.650000	0.86243	GAA	NDC80	-	pfam_Kinetochore_Ndc80	ENSG00000080986		0.303	NDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDC80	HGNC	protein_coding	OTTHUMT00000254327.1	38	0.00	0	G	NM_006101		2575037	2575037	+1	no_errors	ENST00000261597	ensembl	human	known	69_37n	missense	33	15.38	6	SNP	1.000	A
NDUFAF1	51103	genome.wustl.edu	37	15	41687186	41687186	+	Silent	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr15:41687186G>C	ENST00000260361.4	-	3	1011	c.630C>G	c.(628-630)ctC>ctG	p.L210L		NM_016013.3	NP_057097.2	Q9Y375	CIA30_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 1	210					mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|mitochondrial respiratory chain complex I (GO:0005747)	unfolded protein binding (GO:0051082)			endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	12		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;8e-17)|GBM - Glioblastoma multiforme(113;1.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.114)		CACGTACACGGAGATACAGAG	0.428																																						dbGAP											0													135.0	107.0	117.0					15																	41687186		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF151823	CCDS10075.1	15q11.2-q21.3	2012-10-12	2012-05-08		ENSG00000137806	ENSG00000137806		"""Mitochondrial respiratory chain complex assembly factors"""	18828	protein-coding gene	gene with protein product		606934				11935339, 10810093	Standard	NM_016013		Approved	CIA30, CGI-65	uc001znx.3	Q9Y375	OTTHUMG00000130340	ENST00000260361.4:c.630C>G	15.37:g.41687186G>C			Q9BVZ5	Silent	SNP	pfam_NADH-UbQ_OxRdtase-assoc_prot30,superfamily_Galactose-bd-like	p.L210	ENST00000260361.4	37	c.630	CCDS10075.1	15																																																																																			NDUFAF1	-	pfam_NADH-UbQ_OxRdtase-assoc_prot30,superfamily_Galactose-bd-like	ENSG00000137806		0.428	NDUFAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFAF1	HGNC	protein_coding	OTTHUMT00000252692.2	71	0.00	0	G	NM_016013		41687186	41687186	-1	no_errors	ENST00000260361	ensembl	human	known	69_37n	silent	63	11.11	8	SNP	1.000	C
NEK7	140609	genome.wustl.edu	37	1	198222169	198222169	+	Splice_Site	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:198222169G>C	ENST00000367385.4	+	3	399		c.e3-1		NEK7_ENST00000538004.1_Splice_Site|NEK7_ENST00000367383.1_Splice_Site	NM_133494.2	NP_598001.1	Q8TDX7	NEK7_HUMAN	NIMA-related kinase 7						cytokinesis (GO:0000910)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle (GO:0007346)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21						TTTAATTACAGAAGGCCTTAC	0.353																																						dbGAP											0													53.0	58.0	56.0					1																	198222169		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB062450	CCDS1394.1	1q31.3	2012-11-15	2012-11-15		ENSG00000151414	ENSG00000151414			13386	protein-coding gene	gene with protein product		606848	"""NIMA (never in mitosis gene a)-related kinase 7"""			11701951	Standard	NM_133494		Approved		uc001gun.4	Q8TDX7	OTTHUMG00000035658	ENST00000367385.4:c.58-1G>C	1.37:g.198222169G>C			A6NGT8	Splice_Site	SNP	-	e2-1	ENST00000367385.4	37	c.58-1	CCDS1394.1	1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.402008	0.83120	.	.	ENSG00000151414	ENST00000367385;ENST00000442588;ENST00000538004;ENST00000367383;ENST00000544035;ENST00000391974	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2339	0.93850	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NEK7	196488792	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	8.669000	0.91163	2.775000	0.95449	0.650000	0.86243	.	NEK7	-	-	ENSG00000151414		0.353	NEK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEK7	HGNC	protein_coding	OTTHUMT00000086550.2	18	0.00	0	G	NM_133494	Intron	198222169	198222169	+1	no_errors	ENST00000367385	ensembl	human	known	69_37n	splice_site	36	21.74	10	SNP	1.000	C
NEK8	284086	genome.wustl.edu	37	17	27061021	27061021	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr17:27061021G>A	ENST00000268766.6	+	2	102	c.68G>A	c.(67-69)cGa>cAa	p.R23Q	AC010761.6_ENST00000584779.1_RNA|NEK8_ENST00000593261.1_3'UTR	NM_178170.2	NP_835464.1	Q86SG6	NEK8_HUMAN	NIMA-related kinase 8	23	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				organ morphogenesis (GO:0009887)|regulation of hippo signaling (GO:0035330)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|primary cilium (GO:0072372)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Lung NSC(42;0.0158)					CTGTGCCTGCGAAAGGCTGAC	0.567																																					NSCLC(6;19 293 14866 25253 49845)	dbGAP											0													84.0	76.0	79.0					17																	27061021		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY267371	CCDS32597.1	17q11.1	2012-11-15	2012-11-15			ENSG00000160602			13387	protein-coding gene	gene with protein product		609799	"""NIMA (never in mitosis gene a)- related kinase 8"""			18199800	Standard	NM_178170		Approved	NPHP9	uc002hcp.3	Q86SG6		ENST00000268766.6:c.68G>A	17.37:g.27061021G>A	ENSP00000268766:p.Arg23Gln		A6NIC5|Q14CL7|Q2M1S6|Q8NDH1	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Reg_chr_condens,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Reg_csome_cond/b-lactamase_inh,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Reg_chr_condens,pfscan_Prot_kinase_cat_dom,prints_Reg_chr_condens,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R23Q	ENST00000268766.6	37	c.68	CCDS32597.1	17	.	.	.	.	.	.	.	.	.	.	G	27.3	4.822649	0.90873	.	.	ENSG00000160602	ENST00000543014;ENST00000268766	T;T	0.65364	-0.15;-0.15	4.92	4.92	0.64577	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.72095	0.3418	L	0.48877	1.53	0.58432	D	0.999998	D	0.76494	0.999	D	0.62955	0.909	T	0.74191	-0.3745	10	0.54805	T	0.06	.	17.124	0.86710	0.0:0.0:1.0:0.0	.	23	Q86SG6	NEK8_HUMAN	Q	23	ENSP00000465859:R23Q;ENSP00000268766:R23Q	ENSP00000268766:R23Q	R	+	2	0	NEK8	24085148	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	7.539000	0.82063	2.267000	0.75376	0.313000	0.20887	CGA	NEK8	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000160602		0.567	NEK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEK8	HGNC	protein_coding	OTTHUMT00000446467.2	52	0.00	0	G			27061021	27061021	+1	no_errors	ENST00000268766	ensembl	human	known	69_37n	missense	44	22.81	13	SNP	1.000	A
NPHP4	261734	genome.wustl.edu	37	1	5950965	5950965	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:5950965G>A	ENST00000378156.4	-	17	2532	c.2267C>T	c.(2266-2268)tCc>tTc	p.S756F	AL356261.1_ENST00000585151.1_RNA|NPHP4_ENST00000478423.2_5'UTR	NM_015102.3	NP_055917.1	O75161	NPHP4_HUMAN	nephronophthisis 4	756					actin cytoskeleton organization (GO:0030036)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(4)	47	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		GAGCAGCAGGGAGTCTCCGTC	0.632																																						dbGAP											0													30.0	33.0	32.0					1																	5950965		2052	4202	6254	-	-	-	SO:0001583	missense	0			AB014573	CCDS44052.1	1p36	2010-03-26			ENSG00000131697	ENSG00000131697			19104	protein-coding gene	gene with protein product	"""nephroretinin"", ""nephrocystin-4"", ""POC10 centriolar protein homolog (Chlamydomonas)"""	607215				11920287, 12205563	Standard	XR_244787		Approved	SLSN4, KIAA0673, POC10	uc001alq.2	O75161	OTTHUMG00000000701	ENST00000378156.4:c.2267C>T	1.37:g.5950965G>A	ENSP00000367398:p.Ser756Phe		Q8IWC0	Missense_Mutation	SNP	NULL	p.S756F	ENST00000378156.4	37	c.2267	CCDS44052.1	1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.024701	0.75390	.	.	ENSG00000131697	ENST00000378156;ENST00000378160	D	0.96554	-4.05	5.61	5.61	0.85477	.	0.083987	0.49305	D	0.000142	D	0.98058	0.9360	M	0.80183	2.485	0.80722	D	1	D	0.76494	0.999	D	0.68192	0.956	D	0.98779	1.0731	10	0.87932	D	0	.	18.6123	0.91290	0.0:0.0:1.0:0.0	.	756	O75161	NPHP4_HUMAN	F	756;159	ENSP00000367398:S756F	ENSP00000367398:S756F	S	-	2	0	NPHP4	5873552	1.000000	0.71417	0.998000	0.56505	0.287000	0.27160	9.202000	0.95026	2.627000	0.88993	0.591000	0.81541	TCC	NPHP4	-	NULL	ENSG00000131697		0.632	NPHP4-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	NPHP4	HGNC	protein_coding	OTTHUMT00000001715.2	41	0.00	0	G			5950965	5950965	-1	no_errors	ENST00000378156	ensembl	human	known	69_37n	missense	27	20.59	7	SNP	1.000	A
NPHS2	7827	genome.wustl.edu	37	1	179520502	179520502	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:179520502G>C	ENST00000367615.4	-	8	1026	c.958C>G	c.(958-960)Cag>Gag	p.Q320E	RP11-545A16.1_ENST00000569644.1_RNA|NPHS2_ENST00000367616.4_Missense_Mutation_p.Q252E|AXDND1_ENST00000367618.3_Intron	NM_014625.2	NP_055440.1	Q9NP85	PODO_HUMAN	nephrosis 2, idiopathic, steroid-resistant (podocin)	320					actin cytoskeleton reorganization (GO:0031532)|excretion (GO:0007588)|metanephric glomerular visceral epithelial cell development (GO:0072249)	cell-cell junction (GO:0005911)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)				NS(1)|endometrium(1)|large_intestine(3)|lung(10)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	20						TATCGAAGCTGAACGGCAGCA	0.512																																						dbGAP											0													98.0	96.0	96.0					1																	179520502		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ279254	CCDS1331.1, CCDS72988.1	1q25-q31	2014-06-27			ENSG00000116218	ENSG00000116218			13394	protein-coding gene	gene with protein product		604766				8589695, 10742096	Standard	XM_005245483		Approved	SRN1, PDCN	uc001gmq.4	Q9NP85	OTTHUMG00000035252	ENST00000367615.4:c.958C>G	1.37:g.179520502G>C	ENSP00000356587:p.Gln320Glu		B1AM32|B1AM33|Q8N6Q5	Missense_Mutation	SNP	pfam_Band_7,smart_Band_7,prints_Stomatin	p.Q320E	ENST00000367615.4	37	c.958	CCDS1331.1	1	.	.	.	.	.	.	.	.	.	.	G	16.23	3.065695	0.55539	.	.	ENSG00000116218	ENST00000367615;ENST00000367616	D;D	0.99591	-6.24;-6.24	5.7	5.7	0.88788	.	0.068975	0.64402	D	0.000015	D	0.99625	0.9863	M	0.86097	2.795	0.49582	D	0.999806	D;D	0.65815	0.99;0.995	P;D	0.69654	0.875;0.965	D	0.98166	1.0449	10	0.87932	D	0	-21.1549	18.4109	0.90550	0.0:0.0:1.0:0.0	.	252;320	Q9NP85-2;Q9NP85	.;PODO_HUMAN	E	320;252	ENSP00000356587:Q320E;ENSP00000356588:Q252E	ENSP00000356587:Q320E	Q	-	1	0	NPHS2	177787125	1.000000	0.71417	0.968000	0.41197	0.130000	0.20726	7.956000	0.87863	2.688000	0.91661	0.655000	0.94253	CAG	NPHS2	-	prints_Stomatin	ENSG00000116218		0.512	NPHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPHS2	HGNC	protein_coding	OTTHUMT00000085283.1	33	0.00	0	G			179520502	179520502	-1	no_errors	ENST00000367615	ensembl	human	known	69_37n	missense	57	10.94	7	SNP	0.997	C
NID1	4811	genome.wustl.edu	37	1	236211999	236211999	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:236211999C>T	ENST00000264187.6	-	2	598	c.516G>A	c.(514-516)caG>caA	p.Q172Q	NID1_ENST00000366595.3_Silent_p.Q172Q	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	172	NIDO. {ECO:0000255|PROSITE- ProRule:PRU00570}.				basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)			breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	CCTTGCCTTTCTGGTCTGGGT	0.552																																						dbGAP											0													80.0	63.0	69.0					1																	236211999		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.516G>A	1.37:g.236211999C>T			Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Silent	SNP	pfam_G2_nidogen/fibulin_G2F,pfam_LDLR_classB_rpt,pfam_Nidogen_extracell_dom,pfam_Thyroglobulin_1,pfam_EGF-like_Ca-bd,superfamily_Green_fluorescent_prot-like,superfamily_Thyroglobulin_1,smart_Nidogen_extracell_dom,smart_EGF-like_Ca-bd,smart_EGF-like,smart_G2_nidogen/fibulin_G2F,smart_Thyroglobulin_1,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thyroglobulin_1	p.Q172	ENST00000264187.6	37	c.516	CCDS1608.1	1																																																																																			NID1	-	smart_Nidogen_extracell_dom	ENSG00000116962		0.552	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NID1	HGNC	protein_coding	OTTHUMT00000096647.2	45	0.00	0	C	NM_002508		236211999	236211999	-1	no_errors	ENST00000264187	ensembl	human	known	69_37n	silent	55	17.91	12	SNP	0.028	T
NRCAM	4897	genome.wustl.edu	37	7	107823305	107823305	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr7:107823305C>G	ENST00000425651.2	-	20	2363	c.2364G>C	c.(2362-2364)caG>caC	p.Q788H	NRCAM_ENST00000379028.3_Missense_Mutation_p.Q788H|NRCAM_ENST00000379024.4_Missense_Mutation_p.Q769H|NRCAM_ENST00000413765.2_Missense_Mutation_p.Q769H|NRCAM_ENST00000351718.4_Missense_Mutation_p.Q772H|NRCAM_ENST00000379022.4_Missense_Mutation_p.Q788H	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	788	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						CACCATCTTTCTGGCGCCAGC	0.433																																						dbGAP											0													98.0	95.0	96.0					7																	107823305		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.2364G>C	7.37:g.107823305C>G	ENSP00000401244:p.Gln788His		A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.Q788H	ENST00000425651.2	37	c.2364	CCDS47686.1	7	.	.	.	.	.	.	.	.	.	.	C	20.1	3.938764	0.73557	.	.	ENSG00000091129	ENST00000379032;ENST00000379028;ENST00000413765;ENST00000537765;ENST00000351718;ENST00000379024;ENST00000425651;ENST00000379022	T;T;T;T;T;T	0.58506	0.33;0.33;0.33;0.33;0.33;0.33	5.72	3.91	0.45181	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.159548	0.56097	D	0.000023	T	0.70150	0.3191	L	0.60455	1.87	0.58432	D	0.999991	D;D;D;D;P	0.76494	0.997;0.999;0.999;0.998;0.918	D;D;D;D;P	0.77557	0.976;0.99;0.979;0.964;0.704	T	0.69041	-0.5250	10	0.46703	T	0.11	.	12.4397	0.55617	0.0:0.8639:0.0:0.1361	.	788;769;769;772;788	Q92823-5;Q92823-3;E9PDA4;Q92823-4;Q92823	.;.;.;.;NRCAM_HUMAN	H	788;788;769;788;772;769;788;788	ENSP00000368314:Q788H;ENSP00000407858:Q769H;ENSP00000325269:Q772H;ENSP00000368310:Q769H;ENSP00000401244:Q788H;ENSP00000368308:Q788H	ENSP00000325269:Q772H	Q	-	3	2	NRCAM	107610541	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.328000	0.52052	0.745000	0.32763	0.650000	0.86243	CAG	NRCAM	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000091129		0.433	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	NRCAM	HGNC	protein_coding	OTTHUMT00000337942.2	40	0.00	0	C	NM_001037132		107823305	107823305	-1	no_errors	ENST00000379028	ensembl	human	known	69_37n	missense	17	43.33	13	SNP	1.000	G
NSDHL	50814	genome.wustl.edu	37	X	152014897	152014897	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chrX:152014897G>A	ENST00000370274.3	+	2	223	c.29G>A	c.(28-30)aGa>aAa	p.R10K	NSDHL_ENST00000440023.1_Missense_Mutation_p.R10K	NM_015922.2	NP_057006.1	Q15738	NSDHL_HUMAN	NAD(P) dependent steroid dehydrogenase-like	10					cholesterol biosynthetic process (GO:0006695)|hair follicle development (GO:0001942)|labyrinthine layer blood vessel development (GO:0060716)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|sterol-4-alpha-carboxylate 3-dehydrogenase (decarboxylating) activity (GO:0047012)			NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(5)	15	Acute lymphoblastic leukemia(192;6.56e-05)					GAGCCAATGAGAGACCAAGTC	0.413																																						dbGAP											0													127.0	108.0	114.0					X																	152014897		2203	4300	6503	-	-	-	SO:0001583	missense	0			X96621	CCDS14717.1	Xq28	2011-09-14			ENSG00000147383	ENSG00000147383	1.1.1.170	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	13398	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 31E, member 1"""	300275				10710235, 12837764, 19027726	Standard	NM_015922		Approved	XAP104, H105e3, SDR31E1	uc004fgs.1	Q15738	OTTHUMG00000024185	ENST00000370274.3:c.29G>A	X.37:g.152014897G>A	ENSP00000359297:p.Arg10Lys		D3DWT6|O00344	Missense_Mutation	SNP	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_dTDP_dehydrorham_reduct,pfam_Male_sterile_NAD-bd,pfam_Polysac_CapD-like,pfam_NmrA	p.R10K	ENST00000370274.3	37	c.29	CCDS14717.1	X	.	.	.	.	.	.	.	.	.	.	G	9.113	1.007113	0.19199	.	.	ENSG00000147383	ENST00000370274;ENST00000440023;ENST00000432467	D;D;D	0.82526	-1.61;-1.61;-1.62	5.16	-3.13	0.05266	.	1.566610	0.04183	N	0.326934	T	0.62073	0.2398	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46020	-0.9221	10	0.31617	T	0.26	-0.1592	1.7662	0.03002	0.4751:0.1315:0.241:0.1524	.	10	Q15738	NSDHL_HUMAN	K	10	ENSP00000359297:R10K;ENSP00000391854:R10K;ENSP00000396266:R10K	ENSP00000359297:R10K	R	+	2	0	NSDHL	151765553	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.268000	0.08607	-0.440000	0.07211	0.600000	0.82982	AGA	NSDHL	-	NULL	ENSG00000147383		0.413	NSDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSDHL	HGNC	protein_coding	OTTHUMT00000060927.1	54	0.00	0	G	NM_015922		152014897	152014897	+1	no_errors	ENST00000370274	ensembl	human	known	69_37n	missense	32	21.95	9	SNP	0.000	A
NUP160	23279	genome.wustl.edu	37	11	47834942	47834942	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr11:47834942G>A	ENST00000378460.2	-	14	1758	c.1712C>T	c.(1711-1713)tCa>tTa	p.S571L	NUP160_ENST00000531016.1_5'Flank|NUP160_ENST00000530326.1_Missense_Mutation_p.S457L|NUP160_ENST00000528501.1_Missense_Mutation_p.S135L|NUP160_ENST00000528071.1_Missense_Mutation_p.S457L	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	571					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						CACTAAGGATGAGGGAATAAG	0.333																																						dbGAP											0													105.0	104.0	104.0					11																	47834942		2201	4298	6499	-	-	-	SO:0001583	missense	0			D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.1712C>T	11.37:g.47834942G>A	ENSP00000367721:p.Ser571Leu		B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Missense_Mutation	SNP	pfam_Nucleoporin_Nup160	p.S571L	ENST00000378460.2	37	c.1712	CCDS31484.1	11	.	.	.	.	.	.	.	.	.	.	G	9.847	1.192501	0.21954	.	.	ENSG00000030066	ENST00000378460;ENST00000426372;ENST00000530326;ENST00000528071;ENST00000528501	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.19	4.25	0.50352	.	0.111737	0.64402	D	0.000008	T	0.20210	0.0486	N	0.02539	-0.55	0.80722	D	1	B	0.25390	0.125	B	0.32090	0.14	T	0.11842	-1.0571	10	0.20519	T	0.43	.	12.0619	0.53566	0.0:0.4222:0.5778:0.0	.	571	Q12769	NU160_HUMAN	L	571;361;457;457;135	ENSP00000367721:S571L;ENSP00000433590:S457L;ENSP00000432367:S457L;ENSP00000433964:S135L	ENSP00000367721:S571L	S	-	2	0	NUP160	47791518	1.000000	0.71417	0.979000	0.43373	0.156000	0.22039	6.259000	0.72494	2.411000	0.81874	0.650000	0.86243	TCA	NUP160	-	pfam_Nucleoporin_Nup160	ENSG00000030066		0.333	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP160	HGNC	protein_coding	OTTHUMT00000390239.2	50	0.00	0	G	NM_015231		47834942	47834942	-1	no_errors	ENST00000378460	ensembl	human	known	69_37n	missense	70	14.63	12	SNP	0.998	A
NUP188	23511	genome.wustl.edu	37	9	131765659	131765659	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr9:131765659G>A	ENST00000372577.2	+	38	4381	c.4360G>A	c.(4360-4362)Ggt>Agt	p.G1454S	RP11-167N5.5_ENST00000594418.1_lincRNA	NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	1454					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						CCACACCGTGGGTTTTATTCT	0.567																																						dbGAP											0													136.0	127.0	130.0					9																	131765659		2203	4300	6503	-	-	-	SO:0001583	missense	0			D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.4360G>A	9.37:g.131765659G>A	ENSP00000361658:p.Gly1454Ser		Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	pfam_Nucleoporin_Nup188,superfamily_ARM-type_fold	p.G1454S	ENST00000372577.2	37	c.4360	CCDS35156.1	9	.	.	.	.	.	.	.	.	.	.	G	24.5	4.534231	0.85812	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	T	0.33654	1.4	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.57814	0.2079	M	0.63428	1.95	0.80722	D	1	P;D	0.89917	0.63;1.0	B;D	0.87578	0.191;0.998	T	0.45175	-0.9279	10	0.20046	T	0.44	-17.3935	19.0419	0.93004	0.0:0.0:1.0:0.0	.	787;1454	E9PET9;Q5SRE5	.;NU188_HUMAN	S	1343;1454	ENSP00000361658:G1454S	ENSP00000349125:G1343S	G	+	1	0	NUP188	130805480	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.476000	0.97823	2.758000	0.94735	0.561000	0.74099	GGT	NUP188	-	NULL	ENSG00000095319		0.567	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP188	HGNC	protein_coding	OTTHUMT00000054529.2	69	0.00	0	G			131765659	131765659	+1	no_errors	ENST00000372577	ensembl	human	known	69_37n	missense	39	25.00	13	SNP	1.000	A
NUP88	4927	genome.wustl.edu	37	17	5322859	5322859	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr17:5322859C>T	ENST00000573584.1	-	1	621	c.112G>A	c.(112-114)Gaa>Aaa	p.E38K	RPAIN_ENST00000405578.4_5'Flank|RPAIN_ENST00000574003.1_5'Flank|RPAIN_ENST00000381209.3_5'Flank|RPAIN_ENST00000327154.6_5'Flank|RPAIN_ENST00000536255.2_5'Flank|RPAIN_ENST00000381208.5_5'Flank	NM_002532.4	NP_002523.2	Q99567	NUP88_HUMAN	nucleoporin 88kDa	38					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	transporter activity (GO:0005215)			endometrium(4)|kidney(4)|large_intestine(4)|lung(3)	15						TTCTCAGCTTCGGTTGGACTC	0.617																																						dbGAP											0													97.0	93.0	95.0					17																	5322859		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y08612	CCDS11070.1	17p13	2004-02-18	2002-08-29		ENSG00000108559	ENSG00000108559			8067	protein-coding gene	gene with protein product		602552	"""nucleoporin 88kD"""			9049309	Standard	NM_002532		Approved	MGC8530	uc002gbo.2	Q99567	OTTHUMG00000099453	ENST00000573584.1:c.112G>A	17.37:g.5322859C>T	ENSP00000458954:p.Glu38Lys		D3DTM2|Q9BWE5	Missense_Mutation	SNP	pfam_Nucleoporin_Nup88	p.E38K	ENST00000573584.1	37	c.112	CCDS11070.1	17	.	.	.	.	.	.	.	.	.	.	C	27.1	4.802571	0.90623	.	.	ENSG00000108559	ENST00000225696	.	.	.	5.19	4.22	0.49857	.	0.331609	0.32548	N	0.005954	T	0.28267	0.0698	N	0.22421	0.69	0.09310	N	1	B;B	0.10296	0.003;0.003	B;B	0.08055	0.003;0.002	T	0.13255	-1.0516	9	0.29301	T	0.29	-0.6275	11.9402	0.52896	0.0:0.9157:0.0:0.0843	.	38;38	B7Z5I6;Q99567	.;NUP88_HUMAN	K	38	.	ENSP00000225696:E38K	E	-	1	0	NUP88	5263583	0.017000	0.18338	0.034000	0.17996	0.986000	0.74619	1.320000	0.33666	1.559000	0.49555	0.655000	0.94253	GAA	NUP88	-	pfam_Nucleoporin_Nup88	ENSG00000108559		0.617	NUP88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP88	HGNC	protein_coding	OTTHUMT00000216918.3	39	0.00	0	C	NM_002532		5322859	5322859	-1	no_errors	ENST00000573584	ensembl	human	known	69_37n	missense	25	21.88	7	SNP	0.044	T
NXF5	55998	genome.wustl.edu	37	X	101091732	101091732	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chrX:101091732G>A	ENST00000361708.2	-	16	1513	c.1154C>T	c.(1153-1155)tCa>tTa	p.S385L	NXF5_ENST00000537026.1_Intron|NXF5_ENST00000473265.2_Intron			Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5	385					mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|skin(1)	30						AGGTAGTGATGAAGGTCCACA	0.517																																						dbGAP											0													301.0	210.0	241.0					X																	101091732		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ277654	CCDS14491.1, CCDS14491.2	Xq22	2008-07-28			ENSG00000126952	ENSG00000126952			8075	protein-coding gene	gene with protein product		300319				11566096	Standard	NM_032946		Approved		uc011mrk.1	Q9H1B4	OTTHUMG00000022042	ENST00000361708.2:c.1154C>T	X.37:g.101091732G>A	ENSP00000355286:p.Ser385Leu		A2RRM0|B1AV82|B1AV83|B1AV84|B1AV85|Q9H1B0|Q9H1B1|Q9H1B2|Q9H1B3	Missense_Mutation	SNP	pfam_Tap_RNA-bd	p.S385L	ENST00000361708.2	37	c.1154		X	.	.	.	.	.	.	.	.	.	.	.	10.75	1.439204	0.25900	.	.	ENSG00000126952	ENST00000361708	T	0.48836	0.8	2.13	1.24	0.21308	.	0.798569	0.10734	U	0.640296	T	0.43077	0.1231	.	.	.	0.19575	N	0.999964	.	.	.	.	.	.	T	0.42949	-0.9421	7	0.87932	D	0	.	4.3782	0.11281	0.2064:0.0:0.7936:0.0	.	.	.	.	L	385	ENSP00000355286:S385L	ENSP00000263032:S385L	S	-	2	0	NXF5	100978388	1.000000	0.71417	0.048000	0.18961	0.010000	0.07245	2.176000	0.42500	0.360000	0.24265	0.279000	0.19357	TCA	NXF5	-	NULL	ENSG00000126952		0.517	NXF5-201	KNOWN	basic	protein_coding	NXF5	HGNC	protein_coding		115	0.00	0	G			101091732	101091732	-1	no_errors	ENST00000263032	ensembl	human	known	69_37n	missense	60	39.39	39	SNP	0.732	A
OAS3	4940	genome.wustl.edu	37	12	113405314	113405314	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:113405314C>T	ENST00000228928.7	+	13	2960	c.2781C>T	c.(2779-2781)ttC>ttT	p.F927F	RP1-71H24.1_ENST00000552784.1_RNA	NM_006187.2	NP_006178.2	Q9Y6K5	OAS3_HUMAN	2'-5'-oligoadenylate synthetase 3, 100kDa	927	OAS domain 3.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|nucleobase-containing compound metabolic process (GO:0006139)|regulation of ribonuclease activity (GO:0060700)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|skin(2)	27						CCACCTGCTTCACAGAGCTAC	0.577																																						dbGAP											0													60.0	63.0	62.0					12																	113405314		2139	4269	6408	-	-	-	SO:0001819	synonymous_variant	0			AF063613	CCDS44981.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111331			8088	protein-coding gene	gene with protein product		603351	"""2'-5'-oligoadenylate synthetase 3 (100 kD)"""			9790745	Standard	NM_006187		Approved		uc001tug.3	Q9Y6K5	OTTHUMG00000169795	ENST00000228928.7:c.2781C>T	12.37:g.113405314C>T			Q2HJ14|Q9H3P5	Missense_Mutation	SNP	pfam_2-5-oligoAdlate_synth_1_dom2/C	p.S99L	ENST00000228928.7	37	c.296	CCDS44981.1	12	.	.	.	.	.	.	.	.	.	.	C	1.032	-0.681410	0.03353	.	.	ENSG00000111331	ENST00000546973	.	.	.	4.15	4.15	0.48705	.	.	.	.	.	T	0.63271	0.2497	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61652	-0.7019	4	.	.	.	.	12.1472	0.54029	0.0:1.0:0.0:0.0	.	.	.	.	L	99	.	.	S	+	2	0	OAS3	111889697	1.000000	0.71417	1.000000	0.80357	0.053000	0.15095	1.391000	0.34475	2.301000	0.77427	0.558000	0.71614	TCA	OAS3	-	pfam_2-5-oligoAdlate_synth_1_dom2/C	ENSG00000111331		0.577	OAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OAS3	HGNC	protein_coding	OTTHUMT00000405920.1	38	0.00	0	C			113405314	113405314	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000546973	ensembl	human	putative	69_37n	missense	22	17.86	5	SNP	0.991	T
OBFC1	79991	genome.wustl.edu	37	10	105658729	105658729	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr10:105658729G>C	ENST00000224950.3	-	6	654	c.487C>G	c.(487-489)Caa>Gaa	p.Q163E	OBFC1_ENST00000466828.1_5'UTR|OBFC1_ENST00000369764.1_Missense_Mutation_p.Q163E	NM_024928.4	NP_079204.2	Q9H668	STN1_HUMAN	oligonucleotide/oligosaccharide-binding fold containing 1	163					positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromosome, telomeric region (GO:0000784)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)|single-stranded telomeric DNA binding (GO:0043047)			large_intestine(3)|lung(7)|ovary(1)|pancreas(2)	13		Colorectal(252;0.178)		Epithelial(162;3.39e-10)|all cancers(201;1.32e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0151)		CTTGCAATTTGAATGTTCCAC	0.423																																						dbGAP											0													114.0	104.0	108.0					10																	105658729		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC017400	CCDS7552.1	10q25.1	2011-06-14				ENSG00000107960			26200	protein-coding gene	gene with protein product		613128				12477932	Standard	NM_024928		Approved	FLJ22559, bA541N10.2	uc001kxm.3	Q9H668		ENST00000224950.3:c.487C>G	10.37:g.105658729G>C	ENSP00000224950:p.Gln163Glu		D3DR99|Q5TCZ0	Missense_Mutation	SNP	pfam_DUF1879_CST_STN1,pfam_NA-bd_OB_tRNA-helicase,superfamily_NA-bd_OB-fold-like,pirsf_CST_STN1	p.Q163E	ENST00000224950.3	37	c.487	CCDS7552.1	10	.	.	.	.	.	.	.	.	.	.	G	18.83	3.706399	0.68615	.	.	ENSG00000107960	ENST00000224950;ENST00000369764	T;T	0.58210	0.35;0.35	5.89	5.89	0.94794	Nucleic acid-binding, OB-fold-like (1);Domain of unknown function DUF1879, CTS complex STN1 subunit (1);	0.048785	0.85682	D	0.000000	T	0.67961	0.2949	M	0.70595	2.14	0.53688	D	0.999978	D	0.71674	0.998	D	0.71870	0.975	T	0.61888	-0.6970	10	0.10636	T	0.68	-8.8095	15.747	0.77953	0.0:0.0:1.0:0.0	.	163	Q9H668	STN1_HUMAN	E	163	ENSP00000224950:Q163E;ENSP00000358779:Q163E	ENSP00000224950:Q163E	Q	-	1	0	OBFC1	105648719	1.000000	0.71417	0.308000	0.25141	0.990000	0.78478	6.267000	0.72546	2.781000	0.95711	0.555000	0.69702	CAA	OBFC1	-	pfam_DUF1879_CST_STN1,superfamily_NA-bd_OB-fold-like,pirsf_CST_STN1	ENSG00000107960		0.423	OBFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OBFC1	HGNC	protein_coding	OTTHUMT00000050174.1	61	0.00	0	G	NM_024928		105658729	105658729	-1	no_errors	ENST00000224950	ensembl	human	known	69_37n	missense	32	33.33	16	SNP	0.973	C
OBSCN	84033	genome.wustl.edu	37	1	228509242	228509242	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:228509242C>T	ENST00000422127.1	+	55	14744	c.14700C>T	c.(14698-14700)ttC>ttT	p.F4900F	OBSCN_ENST00000366709.4_Silent_p.F2019F|OBSCN_ENST00000284548.11_Silent_p.F4900F|OBSCN_ENST00000570156.2_Silent_p.F5857F|OBSCN_ENST00000366707.4_Silent_p.F2534F	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4900	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.|Ig-like 48.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGCCCATGTTCTCCCACACAT	0.607																																						dbGAP											0													41.0	48.0	46.0					1																	228509242		2156	4239	6395	-	-	-	SO:0001819	synonymous_variant	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.14700C>T	1.37:g.228509242C>T			Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.F4900	ENST00000422127.1	37	c.14700	CCDS58065.1	1																																																																																			OBSCN	-	pfam_Ig_I-set,pfscan_IQ_motif_EF-hand-BS,pfscan_Ig-like	ENSG00000154358		0.607	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		41	0.00	0	C	NM_052843		228509242	228509242	+1	no_errors	ENST00000422127	ensembl	human	known	69_37n	silent	41	22.64	12	SNP	0.090	T
OR10A6	390093	genome.wustl.edu	37	11	7949369	7949369	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr11:7949369G>A	ENST00000309838.2	-	1	840	c.841C>T	c.(841-843)Ctg>Ttg	p.L281L		NM_001004461.1	NP_001004461.1	Q8NH74	O10A6_HUMAN	olfactory receptor, family 10, subfamily A, member 6	281						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AGTGGTGTCAGAAGTGAGTAA	0.423																																						dbGAP											0													177.0	160.0	166.0					11																	7949369		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB065515	CCDS31420.1	11p15.4	2012-08-09			ENSG00000175393	ENSG00000175393		"""GPCR / Class A : Olfactory receptors"""	15132	protein-coding gene	gene with protein product							Standard	NM_001004461		Approved		uc010rbh.2	Q8NH74	OTTHUMG00000165671	ENST00000309838.2:c.841C>T	11.37:g.7949369G>A			Q6IF59	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L281	ENST00000309838.2	37	c.841	CCDS31420.1	11																																																																																			OR10A6	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000175393		0.423	OR10A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10A6	HGNC	protein_coding	OTTHUMT00000385703.1	107	0.00	0	G	NM_001004461		7949369	7949369	-1	no_errors	ENST00000309838	ensembl	human	known	69_37n	silent	63	37.00	37	SNP	0.004	A
OR10J1	26476	genome.wustl.edu	37	1	159410499	159410499	+	Silent	SNP	G	G	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:159410499G>T	ENST00000423932.3	+	1	988	c.951G>T	c.(949-951)ggG>ggT	p.G317G	RP11-550P17.5_ENST00000431862.1_RNA	NM_012351.2	NP_036483.2	P30954	O10J1_HUMAN	olfactory receptor, family 10, subfamily J, member 1	317					G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)|single fertilization (GO:0007338)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G317G(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|stomach(1)	25	all_hematologic(112;0.0429)					CTGTTGGTGGGAAGTTTTCCT	0.488																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											67.0	67.0	67.0					1																	159410499		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X64995	CCDS1185.1	1q23.2	2012-08-09			ENSG00000196184	ENSG00000196184		"""GPCR / Class A : Olfactory receptors"""	8175	protein-coding gene	gene with protein product						1370859	Standard	NM_012351		Approved	HGMP07J, HSHGMP07J	uc010piv.2	P30954	OTTHUMG00000022737	ENST00000423932.3:c.951G>T	1.37:g.159410499G>T			Q2M1M8|Q5VSV1|Q6IET5|Q96R56	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.G317	ENST00000423932.3	37	c.951	CCDS1185.1	1																																																																																			OR10J1	-	NULL	ENSG00000196184		0.488	OR10J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10J1	HGNC	protein_coding	OTTHUMT00000059020.1	21	0.00	0	G	NM_012351		159410499	159410499	+1	no_errors	ENST00000423932	ensembl	human	known	69_37n	silent	29	38.30	18	SNP	0.009	T
OR13J1	392309	genome.wustl.edu	37	9	35870329	35870329	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr9:35870329C>T	ENST00000377981.2	-	1	132	c.70G>A	c.(70-72)Gag>Aag	p.E24K		NM_001004487.1	NP_001004487.1	Q8NGT2	O13J1_HUMAN	olfactory receptor, family 13, subfamily J, member 1	24						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|large_intestine(1)|lung(3)|skin(1)	6	all_epithelial(49;0.169)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00494)|STAD - Stomach adenocarcinoma(86;0.194)			AGCAGATGCTCCAGGGCTGGG	0.557																																						dbGAP											0													78.0	71.0	73.0					9																	35870329		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35011.1	9p13.3	2013-09-24			ENSG00000168828	ENSG00000168828		"""GPCR / Class A : Olfactory receptors"""	15108	protein-coding gene	gene with protein product							Standard	NM_001004487		Approved		uc011lph.2	Q8NGT2	OTTHUMG00000019879	ENST00000377981.2:c.70G>A	9.37:g.35870329C>T	ENSP00000367219:p.Glu24Lys		B2RN66|Q6IF20|Q96R40	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.E24K	ENST00000377981.2	37	c.70	CCDS35011.1	9	.	.	.	.	.	.	.	.	.	.	C	11.44	1.638880	0.29157	.	.	ENSG00000168828	ENST00000377981	T	0.00297	8.23	4.64	3.74	0.42951	.	0.260585	0.27043	N	0.021202	T	0.00412	0.0013	L	0.39514	1.22	0.09310	N	1	D	0.69078	0.997	D	0.73380	0.98	T	0.57551	-0.7792	10	0.72032	D	0.01	.	11.5563	0.50750	0.0:0.6512:0.3488:0.0	.	24	Q8NGT2	O13J1_HUMAN	K	24	ENSP00000367219:E24K	ENSP00000367219:E24K	E	-	1	0	OR13J1	35860329	0.000000	0.05858	0.894000	0.35097	0.042000	0.13812	-0.116000	0.10724	1.549000	0.49425	0.555000	0.69702	GAG	OR13J1	-	NULL	ENSG00000168828		0.557	OR13J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13J1	HGNC	protein_coding	OTTHUMT00000052381.1	33	0.00	0	C			35870329	35870329	-1	no_errors	ENST00000377981	ensembl	human	known	69_37n	missense	32	20.00	8	SNP	0.072	T
OR2L13	284521	genome.wustl.edu	37	1	248263205	248263205	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:248263205C>T	ENST00000358120.2	+	2	673	c.528C>T	c.(526-528)ttC>ttT	p.F176F	OR2L13_ENST00000366478.2_Silent_p.F176F			Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			TTGACCATTTCTTCTGCGATG	0.463																																						dbGAP											0													260.0	228.0	239.0					1																	248263205		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	ENST00000358120.2:c.528C>T	1.37:g.248263205C>T			Q5VUR5	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.F176	ENST00000358120.2	37	c.528	CCDS1637.1	1																																																																																			OR2L13	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196071		0.463	OR2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L13	HGNC	protein_coding	OTTHUMT00000097342.1	130	0.00	0	C	NM_175911		248263205	248263205	+1	no_errors	ENST00000358120	ensembl	human	known	69_37n	silent	169	17.16	35	SNP	0.828	T
OR52K2	119774	genome.wustl.edu	37	11	4471052	4471052	+	Silent	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr11:4471052C>G	ENST00000325719.4	+	1	528	c.483C>G	c.(481-483)ctC>ctG	p.L161L		NM_001005172.2	NP_001005172.2	Q8NGK3	O52K2_HUMAN	olfactory receptor, family 52, subfamily K, member 2	161						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|skin(6)	25		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.48e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0821)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGACTCCACTCCCCTTCCTGC	0.577																																						dbGAP											0													145.0	123.0	130.0					11																	4471052		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB065791	CCDS31351.1	11p15.4	2012-08-09			ENSG00000181963	ENSG00000181963		"""GPCR / Class A : Olfactory receptors"""	15223	protein-coding gene	gene with protein product							Standard	NM_001005172		Approved		uc001lyz.2	Q8NGK3	OTTHUMG00000165703	ENST00000325719.4:c.483C>G	11.37:g.4471052C>G			A8MUY8|B2RP35|Q6IFK4	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L161	ENST00000325719.4	37	c.483	CCDS31351.1	11																																																																																			OR52K2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181963		0.577	OR52K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52K2	HGNC	protein_coding	OTTHUMT00000385844.1	119	0.00	0	C	NM_001005172		4471052	4471052	+1	no_errors	ENST00000325719	ensembl	human	known	69_37n	silent	119	22.22	34	SNP	0.858	G
OR6B1	135946	genome.wustl.edu	37	7	143701864	143701864	+	Nonsense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr7:143701864C>T	ENST00000408922.2	+	1	843	c.775C>T	c.(775-777)Cga>Tga	p.R259*		NM_001005281.1	NP_001005281.1	O95007	OR6B1_HUMAN	olfactory receptor, family 6, subfamily B, member 1	259						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|large_intestine(3)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	27	Melanoma(164;0.0783)					CATGTATGCTCGACCTCGAGT	0.413																																						dbGAP											0													155.0	145.0	148.0					7																	143701864		1982	4167	6149	-	-	-	SO:0001587	stop_gained	0				CCDS43667.1	7q33-q35	2012-08-09			ENSG00000221813	ENSG00000221813		"""GPCR / Class A : Olfactory receptors"""	8354	protein-coding gene	gene with protein product							Standard	NM_001005281		Approved	OR7-3	uc003wdt.1	O95007	OTTHUMG00000157765	ENST00000408922.2:c.775C>T	7.37:g.143701864C>T	ENSP00000386151:p.Arg259*		A4D2G2|B9EH47|Q6IFP6|Q96R38	Nonsense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.R259*	ENST00000408922.2	37	c.775	CCDS43667.1	7	.	.	.	.	.	.	.	.	.	.	C	21.9	4.222617	0.79464	.	.	ENSG00000221813	ENST00000408922	.	.	.	5.26	2.43	0.29744	.	0.000000	0.31624	U	0.007331	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.8235	0.23870	0.477:0.4415:0.0:0.0815	.	.	.	.	X	259	.	ENSP00000386151:R259X	R	+	1	2	OR6B1	143332797	0.000000	0.05858	0.995000	0.50966	0.892000	0.51952	0.030000	0.13688	0.336000	0.23639	0.655000	0.94253	CGA	OR6B1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000221813		0.413	OR6B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6B1	HGNC	protein_coding	OTTHUMT00000349566.1	93	0.00	0	C			143701864	143701864	+1	no_errors	ENST00000408922	ensembl	human	known	69_37n	nonsense	30	38.00	19	SNP	0.016	T
OR7A5	26659	genome.wustl.edu	37	19	14938550	14938550	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr19:14938550G>T	ENST00000322301.3	-	2	591	c.504C>A	c.(502-504)ttC>ttA	p.F168L	OR7A5_ENST00000594432.1_Missense_Mutation_p.F168L|OR7A5_ENST00000601611.1_Intron			Q15622	OR7A5_HUMAN	olfactory receptor, family 7, subfamily A, member 5	168					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	26						AGGCTGTGCAGAAGGACAGCC	0.423																																						dbGAP											0													71.0	67.0	68.0					19																	14938550		2203	4300	6503	-	-	-	SO:0001583	missense	0			X64976	CCDS12318.1	19p13.1	2012-08-09	2003-12-09			ENSG00000188269		"""GPCR / Class A : Olfactory receptors"""	8368	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily A, member 5 pseudogene"""				Standard	XM_006722722		Approved	HTPCR2	uc002mzw.3	Q15622		ENST00000322301.3:c.504C>A	19.37:g.14938550G>T	ENSP00000316955:p.Phe168Leu		B2R682|Q6IFP1|Q96R96	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F168L	ENST00000322301.3	37	c.504	CCDS12318.1	19	.	.	.	.	.	.	.	.	.	.	g	15.97	2.991013	0.54041	.	.	ENSG00000188269	ENST00000322301	T	0.00039	8.85	2.99	1.4	0.22301	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33144	U	0.005230	T	0.00300	0.0009	M	0.87682	2.9	0.09310	N	1	P	0.44877	0.845	P	0.50825	0.651	T	0.31998	-0.9923	10	0.72032	D	0.01	.	5.0377	0.14443	0.4004:0.0:0.5996:0.0	.	168	Q15622	OR7A5_HUMAN	L	168	ENSP00000316955:F168L	ENSP00000316955:F168L	F	-	3	2	OR7A5	14799550	0.987000	0.35691	0.823000	0.32752	0.303000	0.27691	0.455000	0.21843	0.524000	0.28502	0.134000	0.15878	TTC	OR7A5	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000188269		0.423	OR7A5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7A5	HGNC	protein_coding	OTTHUMT00000466518.1	40	0.00	0	G	NM_017506		14938550	14938550	-1	no_errors	ENST00000322301	ensembl	human	known	69_37n	missense	48	28.36	19	SNP	0.001	T
OSBPL10	114884	genome.wustl.edu	37	3	31725491	31725491	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr3:31725491C>G	ENST00000396556.2	-	8	1483	c.1361G>C	c.(1360-1362)aGa>aCa	p.R454T	OSBPL10_ENST00000438237.2_Missense_Mutation_p.R390T	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	454					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		GCAAATGACTCTCTCCTCTGG	0.527																																						dbGAP											0													68.0	70.0	69.0					3																	31725491		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.1361G>C	3.37:g.31725491C>G	ENSP00000379804:p.Arg454Thr		B4E212|Q9BTU5	Missense_Mutation	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R454T	ENST00000396556.2	37	c.1361	CCDS2651.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.163404|5.163404	0.94727|0.94727	.|.	.|.	ENSG00000144645|ENSG00000144645	ENST00000429492|ENST00000396556;ENST00000438237	.|T;T	.|0.61158	.|0.13;0.13	5.68|5.68	5.68|5.68	0.88126|0.88126	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.86176|0.86176	0.5870|0.5870	H|H	0.97983|0.97983	4.12|4.12	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|0.999;1.0;1.0	D|D	0.90583|0.90583	0.4531|0.4531	5|10	.|0.87932	.|D	.|0	-24.0516|-24.0516	20.14|20.14	0.98056|0.98056	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|390;454;222	.|B4E212;Q9BXB5;Q59ED9	.|.;OSB10_HUMAN;.	Q|T	223|454;390	.|ENSP00000379804:R454T;ENSP00000406124:R390T	.|ENSP00000379804:R454T	E|R	-|-	1|2	0|0	OSBPL10|OSBPL10	31700495|31700495	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.989000|0.989000	0.77384|0.77384	7.813000|7.813000	0.86123|0.86123	2.837000|2.837000	0.97791|0.97791	0.591000|0.591000	0.81541|0.81541	GAG|AGA	OSBPL10	-	pfam_Oxysterol-bd	ENSG00000144645		0.527	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OSBPL10	HGNC	protein_coding	OTTHUMT00000253165.2	28	0.00	0	C			31725491	31725491	-1	no_errors	ENST00000396556	ensembl	human	known	69_37n	missense	39	18.75	9	SNP	1.000	G
P2RX4	5025	genome.wustl.edu	37	12	121666825	121666825	+	Silent	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:121666825C>G	ENST00000337233.4	+	8	1115	c.807C>G	c.(805-807)ctC>ctG	p.L269L	P2RX4_ENST00000541532.1_3'UTR|P2RX4_ENST00000359949.7_Silent_p.L285L|P2RX4_ENST00000543171.1_Silent_p.L168L	NM_001261397.1|NM_001261398.1|NM_002560.2	NP_001248326.1|NP_001248327.1|NP_002551.2	Q99571	P2RX4_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 4	269					apoptotic signaling pathway (GO:0097190)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cellular response to ATP (GO:0071318)|endothelial cell activation (GO:0042118)|ion transmembrane transport (GO:0034220)|membrane depolarization (GO:0051899)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|neuronal action potential (GO:0019228)|nitric oxide biosynthetic process (GO:0006809)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of prostaglandin secretion (GO:0032308)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction (GO:0055117)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sodium ion transport (GO:0002028)|relaxation of cardiac muscle (GO:0055119)|response to ATP (GO:0033198)|response to fluid shear stress (GO:0034405)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|tissue homeostasis (GO:0001894)|transport (GO:0006810)|vasodilation (GO:0042311)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|cadherin binding (GO:0045296)|copper ion binding (GO:0005507)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|protein homodimerization activity (GO:0042803)|purinergic nucleotide receptor activity (GO:0001614)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			breast(1)|kidney(4)|large_intestine(4)|lung(7)|prostate(1)	17	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CCGCCTCCCTCTGCTTGCCCA	0.612																																						dbGAP											0													97.0	81.0	86.0					12																	121666825		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y07684	CCDS9214.1, CCDS58282.1	12q24.32	2012-01-17			ENSG00000135124	ENSG00000135124		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8535	protein-coding gene	gene with protein product		600846				9016352	Standard	NM_002560		Approved	P2X4	uc031qjt.1	Q99571	OTTHUMG00000169155	ENST00000337233.4:c.807C>G	12.37:g.121666825C>G			E7EPF7|F6RU17|O00450|O14722|Q5U089|Q5U090|Q8N4N1|Q9UBG9	Silent	SNP	pfam_P2X_purnocptor,prints_P2X4_purnocptor,prints_P2X_purnocptor,prints_P2X1_purnocptor,tigrfam_P2X_purnocptor	p.L269	ENST00000337233.4	37	c.807	CCDS9214.1	12																																																																																			P2RX4	-	pfam_P2X_purnocptor,tigrfam_P2X_purnocptor	ENSG00000135124		0.612	P2RX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RX4	HGNC	protein_coding	OTTHUMT00000402545.1	31	0.00	0	C	NM_175567		121666825	121666825	+1	no_errors	ENST00000337233	ensembl	human	known	69_37n	silent	32	23.81	10	SNP	1.000	G
PADI6	353238	genome.wustl.edu	37	1	17723602	17723602	+	RNA	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:17723602G>A	ENST00000434762.2	+	0	1705							Q6TGC4	PADI6_HUMAN	peptidyl arginine deiminase, type VI						cytoplasm organization (GO:0007028)|cytoskeleton organization (GO:0007010)|protein citrullination (GO:0018101)|regulation of translation by machinery localization (GO:0043143)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(2)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	ACTTCTGGCTGATGAAAGCCT	0.572																																						dbGAP											0													53.0	56.0	55.0					1																	17723602		1964	4143	6107	-	-	-			0			AY422079	CCDS72715.1	1p36.13	2014-07-10			ENSG00000256049	ENSG00000276747	3.5.3.15	"""Peptidyl arginine deiminases"""	20449	protein-coding gene	gene with protein product		610363				15087120	Standard	NM_207421		Approved		uc001bak.1	Q6TGC4	OTTHUMG00000002372		1.37:g.17723602G>A			Q330K5|Q70SX3	RNA	SNP	-	NULL	ENST00000434762.2	37	NULL		1																																																																																			PADI6	-	-	ENSG00000256049		0.572	PADI6-001	KNOWN	basic	processed_transcript	PADI6	HGNC	processed_transcript	OTTHUMT00000006804.4	28	0.00	0	G	NM_207421		17723602	17723602	+1	no_errors	ENST00000358481	ensembl	human	known	69_37n	rna	19	24.00	6	SNP	0.044	A
PALD1	27143	genome.wustl.edu	37	10	72299360	72299360	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr10:72299360C>T	ENST00000263563.6	+	15	2018	c.1750C>T	c.(1750-1752)Cat>Tat	p.H584Y		NM_014431.2	NP_055246.2	Q9ULE6	PALD_HUMAN	phosphatase domain containing, paladin 1	584						cytosol (GO:0005829)											GCTGAAGGCCCATCTAAGCGA	0.662																																						dbGAP											0													45.0	44.0	44.0					10																	72299360		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033100	CCDS31215.1	10q22.2	2012-07-17	2012-07-17	2012-07-17	ENSG00000107719	ENSG00000107719			23530	protein-coding gene	gene with protein product		614656	"""paladin"", ""KIAA1274"""	PALD, KIAA1274			Standard	NM_014431		Approved		uc001jrd.4	Q9ULE6	OTTHUMG00000018411	ENST00000263563.6:c.1750C>T	10.37:g.72299360C>T	ENSP00000263563:p.His584Tyr		B2RMS1|B9EGC6|Q5JTK7|Q5JTK8	Missense_Mutation	SNP	smart_Tyr_Pase_cat	p.H584Y	ENST00000263563.6	37	c.1750	CCDS31215.1	10	.	.	.	.	.	.	.	.	.	.	c	8.789	0.930154	0.18131	.	.	ENSG00000107719	ENST00000263563;ENST00000373214	T	0.22945	1.93	4.59	1.33	0.21861	.	0.346446	0.33005	N	0.005392	T	0.22589	0.0545	M	0.72118	2.19	0.24863	N	0.99233	B	0.13145	0.007	B	0.11329	0.006	T	0.14254	-1.0479	10	0.39692	T	0.17	-15.8012	4.2797	0.10827	0.1422:0.5533:0.2084:0.0962	.	584	Q9ULE6	PALD_HUMAN	Y	584	ENSP00000263563:H584Y	ENSP00000263563:H584Y	H	+	1	0	KIAA1274	71969366	0.982000	0.34865	0.989000	0.46669	0.335000	0.28730	0.584000	0.23864	0.894000	0.36317	0.436000	0.28706	CAT	PALD1	-	NULL	ENSG00000107719		0.662	PALD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PALD1	HGNC	protein_coding	OTTHUMT00000048515.2	23	0.00	0	C	NM_014431		72299360	72299360	+1	no_errors	ENST00000263563	ensembl	human	known	69_37n	missense	17	22.73	5	SNP	0.702	T
PARS2	25973	genome.wustl.edu	37	1	55224384	55224384	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:55224384C>T	ENST00000371279.3	-	2	533	c.451G>A	c.(451-453)Gaa>Aaa	p.E151K		NM_152268.3	NP_689481.2	Q7L3T8	SYPM_HUMAN	prolyl-tRNA synthetase 2, mitochondrial (putative)	151					gene expression (GO:0010467)|prolyl-tRNA aminoacylation (GO:0006433)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|proline-tRNA ligase activity (GO:0004827)			breast(1)|endometrium(3)|kidney(2)|lung(4)|ovary(2)|prostate(2)|skin(1)	15					L-Proline(DB00172)	AAGCAGTATTCCTTGCCATGC	0.542																																						dbGAP											0													249.0	239.0	242.0					1																	55224384		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK025585	CCDS597.1	1p32.2	2011-07-01	2007-02-23		ENSG00000162396	ENSG00000162396	6.1.1.15	"""Aminoacyl tRNA synthetases / Class II"""	30563	protein-coding gene	gene with protein product	"""proline tRNA ligase 2, mitochondrial (putative)"""	612036				15779907	Standard	NM_152268		Approved	DKFZp727A071	uc001cxy.3	Q7L3T8	OTTHUMG00000009915	ENST00000371279.3:c.451G>A	1.37:g.55224384C>T	ENSP00000360327:p.Glu151Lys		A8K0W4|Q9H6S5|Q9UFT1	Missense_Mutation	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,superfamily_Anticodon-bd,pfscan_aa-tRNA-synth_II,prints_Pro-tRNA-synth_IIa	p.E151K	ENST00000371279.3	37	c.451	CCDS597.1	1	.	.	.	.	.	.	.	.	.	.	C	17.68	3.450601	0.63290	.	.	ENSG00000162396	ENST00000371279	T	0.79033	-1.23	4.99	4.99	0.66335	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.125701	0.53938	D	0.000057	T	0.78483	0.4290	M	0.69358	2.11	0.80722	D	1	B	0.27380	0.177	B	0.30029	0.11	T	0.77824	-0.2444	10	0.52906	T	0.07	-8.6986	18.3001	0.90160	0.0:1.0:0.0:0.0	.	151	Q7L3T8	SYPM_HUMAN	K	151	ENSP00000360327:E151K	ENSP00000360327:E151K	E	-	1	0	PARS2	54996972	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.853000	0.69496	2.310000	0.77875	0.563000	0.77884	GAA	PARS2	-	pfam_aa-tRNA-synt_IIb_cons-dom,pfscan_aa-tRNA-synth_II	ENSG00000162396		0.542	PARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARS2	HGNC	protein_coding	OTTHUMT00000027436.1	66	0.00	0	C	NM_152268		55224384	55224384	-1	no_errors	ENST00000371279	ensembl	human	known	69_37n	missense	38	29.63	16	SNP	0.999	T
PCDHGA2	56113	genome.wustl.edu	37	5	140720804	140720804	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr5:140720804G>A	ENST00000394576.2	+	1	2266	c.2266G>A	c.(2266-2268)Gag>Aag	p.E756K	PCDHGA3_ENST00000253812.6_5'Flank|PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	756					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTATTCCCACGAGGTCTCCCT	0.602																																						dbGAP											0													76.0	81.0	79.0					5																	140720804		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.2266G>A	5.37:g.140720804G>A	ENSP00000378077:p.Glu756Lys		Q52LL6|Q9Y5D5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.E756K	ENST00000394576.2	37	c.2266	CCDS47289.1	5	.	.	.	.	.	.	.	.	.	.	.	14.75	2.628089	0.46944	.	.	ENSG00000081853	ENST00000394576	T	0.43294	0.95	5.39	5.39	0.77823	.	0.168179	0.27280	U	0.020084	T	0.49270	0.1547	M	0.83774	2.66	0.26522	N	0.974418	B;P	0.49559	0.423;0.925	B;B	0.44108	0.441;0.271	T	0.56141	-0.8028	10	0.40728	T	0.16	.	12.1649	0.54125	0.0792:0.0:0.9208:0.0	.	756;756	Q9Y5H1-2;Q9Y5H1	.;PCDG2_HUMAN	K	756	ENSP00000378077:E756K	ENSP00000378077:E756K	E	+	1	0	PCDHGA2	140700988	0.977000	0.34250	0.990000	0.47175	0.044000	0.14063	2.329000	0.43876	2.536000	0.85505	0.491000	0.48974	GAG	PCDHGA2	-	NULL	ENSG00000081853		0.602	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA2	HGNC	protein_coding	OTTHUMT00000374738.1	65	0.00	0	G	NM_018915		140720804	140720804	+1	no_errors	ENST00000394576	ensembl	human	known	69_37n	missense	41	26.79	15	SNP	1.000	A
PCDHGC3	5098	genome.wustl.edu	37	5	140856824	140856824	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr5:140856824G>A	ENST00000308177.3	+	1	1245	c.1141G>A	c.(1141-1143)Gct>Act	p.A381T	PCDHGA9_ENST00000573521.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|RN7SL68P_ENST00000488078.2_RNA|PCDHGA6_ENST00000517434.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron	NM_002588.2|NM_032402.1	NP_002579.2|NP_115778.1	Q9UN70	PCDGK_HUMAN	protocadherin gamma subfamily C, 3	381	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(2)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGACCTGGATGCTGGCGAGAA	0.562																																						dbGAP											0													44.0	42.0	43.0					5																	140856824		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152337	CCDS4261.1, CCDS75347.1, CCDS75348.1	5q31	2010-01-26			ENSG00000240184	ENSG00000240184		"""Cadherins / Protocadherins : Clustered"""	8716	other	protocadherin	"""cadherin-like 2"", ""protocadherin 2"", ""protocadherin 43"""	603627		PCDH2		9360932, 8508762	Standard	NM_032402		Approved	PC-43, PC43, PCDH-GAMMA-C3		Q9UN70	OTTHUMG00000129613	ENST00000308177.3:c.1141G>A	5.37:g.140856824G>A	ENSP00000312070:p.Ala381Thr		O60622|Q08192|Q9Y5C4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A381T	ENST00000308177.3	37	c.1141	CCDS4261.1	5	.	.	.	.	.	.	.	.	.	.	G	13.13	2.146509	0.37923	.	.	ENSG00000240184	ENST00000308177	T	0.51325	0.71	5.49	2.53	0.30540	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.28234	0.0697	N	0.11927	0.2	0.29936	N	0.821489	B;B	0.10296	0.001;0.003	B;B	0.09377	0.003;0.004	T	0.21930	-1.0231	9	0.66056	D	0.02	.	7.4269	0.27105	0.0836:0.0:0.414:0.5024	.	381;381	Q9UN70;Q9UN70-2	PCDGK_HUMAN;.	T	381	ENSP00000312070:A381T	ENSP00000312070:A381T	A	+	1	0	PCDHGC3	140837008	0.995000	0.38212	0.995000	0.50966	0.470000	0.32858	2.653000	0.46691	0.878000	0.35920	0.655000	0.94253	GCT	PCDHGC3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000240184		0.562	PCDHGC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGC3	HGNC	protein_coding	OTTHUMT00000251808.2	28	0.00	0	G	NM_002588		140856824	140856824	+1	no_errors	ENST00000308177	ensembl	human	known	69_37n	missense	24	20.00	6	SNP	1.000	A
PCYOX1	51449	genome.wustl.edu	37	2	70502110	70502110	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:70502110C>G	ENST00000433351.2	+	4	542	c.514C>G	c.(514-516)Cat>Gat	p.H172D	PCYOX1_ENST00000545138.1_Missense_Mutation_p.H94D|PCYOX1_ENST00000505044.2_Missense_Mutation_p.H95D|PCYOX1_ENST00000264441.5_Missense_Mutation_p.H172D	NM_016297.3	NP_057381.3	Q9UHG3	PCYOX_HUMAN	prenylcysteine oxidase 1	172					prenylated protein catabolic process (GO:0030327)|prenylcysteine catabolic process (GO:0030328)|prenylcysteine metabolic process (GO:0030329)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	chloride-transporting ATPase activity (GO:0008555)|prenylcysteine oxidase activity (GO:0001735)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)	15						CTACCAGTCTCATGACTATGC	0.408																																						dbGAP											0													126.0	118.0	121.0					2																	70502110		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020715	CCDS1902.1	2p13.3	2008-02-05			ENSG00000116005	ENSG00000116005	1.8.3.5		20588	protein-coding gene	gene with protein product		610995				10585463, 12186880	Standard	NM_016297		Approved	KIAA0908, PCL1	uc002sgn.4	Q9UHG3	OTTHUMG00000129671	ENST00000433351.2:c.514C>G	2.37:g.70502110C>G	ENSP00000387654:p.His172Asp		B2RB14|B7Z9P8|O94982|Q8N4N5|Q96QM8	Missense_Mutation	SNP	pfam_Prenylcys_lyase,pfam_FAD-dep_OxRdtase,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Amino_oxidase,pirsf_Prenylcysteine_Oxase	p.H172D	ENST00000433351.2	37	c.514	CCDS1902.1	2	.	.	.	.	.	.	.	.	.	.	C	13.18	2.159935	0.38119	.	.	ENSG00000116005	ENST00000422380;ENST00000505044;ENST00000414812;ENST00000433351;ENST00000264441;ENST00000451279;ENST00000545138	T;T;T;T;T;T;T	0.15487	2.42;2.42;2.42;2.42;2.42;2.42;2.42	5.4	4.5	0.54988	Prenylcysteine lyase (1);	0.147852	0.64402	D	0.000005	T	0.14527	0.0351	L	0.50333	1.59	0.41124	D	0.985834	B;B	0.33103	0.392;0.397	B;B	0.30401	0.115;0.09	T	0.06534	-1.0821	10	0.33940	T	0.23	-19.1994	7.7518	0.28901	0.164:0.7547:0.0:0.0813	.	154;172	B7Z8A2;Q9UHG3	.;PCYOX_HUMAN	D	95;95;95;172;172;95;94	ENSP00000404327:H95D;ENSP00000441566:H95D;ENSP00000413178:H95D;ENSP00000387654:H172D;ENSP00000264441:H172D;ENSP00000408751:H95D;ENSP00000439916:H94D	ENSP00000264441:H172D	H	+	1	0	PCYOX1	70355614	0.994000	0.37717	0.997000	0.53966	0.992000	0.81027	1.368000	0.34216	1.450000	0.47717	0.555000	0.69702	CAT	PCYOX1	-	pfam_Prenylcys_lyase,pirsf_Prenylcysteine_Oxase	ENSG00000116005		0.408	PCYOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCYOX1	HGNC	protein_coding	OTTHUMT00000251872.3	66	0.00	0	C	NM_016297		70502110	70502110	+1	no_errors	ENST00000433351	ensembl	human	known	69_37n	missense	46	30.30	20	SNP	0.999	G
PDE5A	8654	genome.wustl.edu	37	4	120473721	120473721	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr4:120473721C>T	ENST00000354960.3	-	9	1699	c.1380G>A	c.(1378-1380)aaG>aaA	p.K460K	RP11-33B1.1_ENST00000498873.1_RNA|PDE5A_ENST00000264805.5_Silent_p.K418K|PDE5A_ENST00000394439.1_Silent_p.K408K	NM_001083.3	NP_001074.2	O76074	PDE5A_HUMAN	phosphodiesterase 5A, cGMP-specific	460	GAF 2.				blood coagulation (GO:0007596)|cGMP catabolic process (GO:0046069)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of oocyte development (GO:0060282)|relaxation of cardiac muscle (GO:0055119)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|kidney(3)|large_intestine(8)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	27					Avanafil(DB06237)|Caffeine(DB00201)|Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Udenafil(DB06267)|Vardenafil(DB00862)	CTTTATTCTTCTTTCCATTTT	0.279																																						dbGAP											0													63.0	64.0	64.0					4																	120473721		2178	4268	6446	-	-	-	SO:0001819	synonymous_variant	0			D89094	CCDS3713.1, CCDS34055.1	4q27	2008-05-15			ENSG00000138735	ENSG00000138735	3.1.4.17	"""Phosphodiesterases"""	8784	protein-coding gene	gene with protein product		603310				9714779, 9642111	Standard	NM_033437		Approved		uc003idh.3	O76074	OTTHUMG00000132971	ENST00000354960.3:c.1380G>A	4.37:g.120473721C>T			A0AV69|A8K2C4|O75026|O75887|Q86UI0|Q86V66|Q9Y6Z6	Silent	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.K460	ENST00000354960.3	37	c.1380	CCDS3713.1	4																																																																																			PDE5A	-	pfam_GAF,smart_GAF	ENSG00000138735		0.279	PDE5A-001	KNOWN	basic|CCDS	protein_coding	PDE5A	HGNC	protein_coding	OTTHUMT00000256529.1	107	0.00	0	C	NM_001083		120473721	120473721	-1	no_errors	ENST00000354960	ensembl	human	known	69_37n	silent	86	14.85	15	SNP	1.000	T
PDGFRB	5159	genome.wustl.edu	37	5	149504344	149504344	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr5:149504344G>A	ENST00000261799.4	-	13	2327	c.1858C>T	c.(1858-1860)Cat>Tat	p.H620Y		NM_002609.3	NP_002600.1	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor, beta polypeptide	620	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adrenal gland development (GO:0030325)|aorta morphogenesis (GO:0035909)|cardiac myofibril assembly (GO:0055003)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in coronary angiogenesis (GO:0060981)|cell migration involved in vasculogenesis (GO:0035441)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glycosaminoglycan biosynthetic process (GO:0006024)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerular capillary formation (GO:0072277)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|metanephric mesenchymal cell migration (GO:0035789)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to estradiol (GO:0032355)|response to fluid shear stress (GO:0034405)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to retinoic acid (GO:0032526)|response to toxic substance (GO:0009636)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|smooth muscle cell chemotaxis (GO:0071670)|smooth muscle tissue development (GO:0048745)|tissue homeostasis (GO:0001894)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet activating factor receptor activity (GO:0004992)|platelet-derived growth factor beta-receptor activity (GO:0005019)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|platelet-derived growth factor-activated receptor activity (GO:0005017)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|vascular endothelial growth factor binding (GO:0038085)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(3)|prostate(3)|skin(3)|stomach(6)|urinary_tract(1)	75		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTCAGGCCATGAGCCGTGGCC	0.602			T	"""ETV6, TRIP11, HIP1, RAB5EP, H4, NIN, HCMOGT-1, PDE4DIP"""	"""MPD, AML, CMML, CML"""																																	dbGAP		Dom	yes		5	5q31-q32	5159	"""platelet-derived growth factor receptor, beta polypeptide"""		L	0													44.0	42.0	43.0					5																	149504344		2203	4300	6503	-	-	-	SO:0001583	missense	0			M21616	CCDS4303.1	5q33.1	2013-01-29			ENSG00000113721	ENSG00000113721		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8804	protein-coding gene	gene with protein product		173410		PDGFR			Standard	XM_005268464		Approved	JTK12, CD140b, PDGFR1	uc003lro.3	P09619	OTTHUMG00000130053	ENST00000261799.4:c.1858C>T	5.37:g.149504344G>A	ENSP00000261799:p.His620Tyr		B5A957|Q8N5L4	Missense_Mutation	SNP	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Tyr_kinase_VEGFR_rcpt_N,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.H620Y	ENST00000261799.4	37	c.1858	CCDS4303.1	5	.	.	.	.	.	.	.	.	.	.	G	5.978	0.364319	0.11296	.	.	ENSG00000113721	ENST00000261799;ENST00000544453	D	0.82619	-1.63	4.65	4.65	0.58169	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.51477	D	0.000086	T	0.66287	0.2774	N	0.04203	-0.255	0.46564	D	0.999109	B;B	0.30068	0.009;0.267	B;B	0.35039	0.023;0.194	T	0.65861	-0.6065	10	0.02654	T	1	.	17.73	0.88375	0.0:0.0:1.0:0.0	.	620;620	A8KAM8;P09619	.;PGFRB_HUMAN	Y	620;290	ENSP00000261799:H620Y	ENSP00000261799:H620Y	H	-	1	0	PDGFRB	149484537	1.000000	0.71417	0.953000	0.39169	0.993000	0.82548	4.167000	0.58209	2.412000	0.81896	0.455000	0.32223	CAT	PDGFRB	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000113721		0.602	PDGFRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDGFRB	HGNC	protein_coding	OTTHUMT00000252332.1	16	0.00	0	G	NM_002609		149504344	149504344	-1	no_errors	ENST00000261799	ensembl	human	known	69_37n	missense	16	42.86	12	SNP	0.989	A
PER3	8863	genome.wustl.edu	37	1	7887394	7887394	+	Missense_Mutation	SNP	A	A	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:7887394A>G	ENST00000361923.2	+	17	2556	c.2381A>G	c.(2380-2382)cAg>cGg	p.Q794R	RP3-467L1.4_ENST00000451646.1_RNA|PER3_ENST00000377532.3_Missense_Mutation_p.Q802R	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	794	Pro-rich.				circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		GTGCCCAGCCAGGCCCCTTAC	0.692																																						dbGAP											0													46.0	48.0	47.0					1																	7887394		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.2381A>G	1.37:g.7887394A>G	ENSP00000355031:p.Gln794Arg		Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Missense_Mutation	SNP	pfam_Period_circadian-like_C,pfam_PAS_fold_3,pfam_PAS_fold,smart_PAS,pfscan_PAS	p.Q794R	ENST00000361923.2	37	c.2381	CCDS89.1	1	.	.	.	.	.	.	.	.	.	.	A	16.23	3.064123	0.55432	.	.	ENSG00000049246	ENST00000377532;ENST00000361923;ENST00000539773	T;T	0.10477	2.88;2.87	4.11	-1.84	0.07809	.	3.376920	0.00937	N	0.002792	T	0.11750	0.0286	L	0.50333	1.59	0.09310	N	1	P;B;B;P	0.48764	0.915;0.085;0.138;0.915	B;B;B;B	0.42062	0.374;0.025;0.055;0.374	T	0.38436	-0.9661	10	0.26408	T	0.33	.	7.0895	0.25275	0.4024:0.452:0.0:0.1456	.	794;802;802;794	A2I2N5;A6H8X0;P56645-2;P56645	.;.;.;PER3_HUMAN	R	802;794;5	ENSP00000366755:Q802R;ENSP00000355031:Q794R	ENSP00000355031:Q794R	Q	+	2	0	PER3	7809981	0.969000	0.33509	0.258000	0.24420	0.699000	0.40488	-0.070000	0.11523	-0.138000	0.11434	0.459000	0.35465	CAG	PER3	-	NULL	ENSG00000049246		0.692	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PER3	HGNC	protein_coding	OTTHUMT00000003607.1	34	0.00	0	A	NM_016831		7887394	7887394	+1	no_errors	ENST00000361923	ensembl	human	known	69_37n	missense	20	28.57	8	SNP	0.205	G
PFKFB4	5210	genome.wustl.edu	37	3	48557223	48557223	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr3:48557223C>T	ENST00000232375.3	-	14	1479	c.1367G>A	c.(1366-1368)aGa>aAa	p.R456K	PFKFB4_ENST00000536104.1_Missense_Mutation_p.R445K|PFKFB4_ENST00000383734.2_Missense_Mutation_p.R421K|PFKFB4_ENST00000416568.1_Missense_Mutation_p.R449K|PFKFB4_ENST00000541519.1_Missense_Mutation_p.R422K|PFKFB4_ENST00000490115.1_5'UTR	NM_004567.2	NP_004558.1	Q16877	F264_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4	456	Fructose-2,6-bisphosphatase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)			breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(193;0.0003)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)		CTCTGGAGGTCTTGAGATGTC	0.532																																						dbGAP											0													141.0	117.0	125.0					3																	48557223		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC010269	CCDS2771.1	3p22-p21	2004-03-02			ENSG00000114268	ENSG00000114268			8875	protein-coding gene	gene with protein product		605320				8830046, 10095107	Standard	NM_004567		Approved		uc003ctv.3	Q16877	OTTHUMG00000133528	ENST00000232375.3:c.1367G>A	3.37:g.48557223C>T	ENSP00000232375:p.Arg456Lys		Q5S3G5|Q5XLC2|Q64EX5	Missense_Mutation	SNP	pfam_6Phosfructo_kin,pfam_His_Pase_superF_clade-1,smart_His_Pase_superF_clade-1,pirsf_Bifunct_6PFK/fruc_bisP_Ptase,prints_6Pfruct_kin	p.R456K	ENST00000232375.3	37	c.1367	CCDS2771.1	3	.	.	.	.	.	.	.	.	.	.	C	26.5	4.741246	0.89573	.	.	ENSG00000114268	ENST00000232375;ENST00000536104;ENST00000416568;ENST00000383734;ENST00000541519	.	.	.	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.67896	0.2942	M	0.78049	2.395	0.80722	D	1	B;P;B;B	0.38195	0.023;0.622;0.341;0.022	B;B;B;B	0.41440	0.126;0.152;0.357;0.126	T	0.71318	-0.4629	9	0.46703	T	0.11	-19.2754	16.158	0.81680	0.0:1.0:0.0:0.0	.	445;421;449;456	B7Z5C3;Q5XLC2;Q66S35;Q16877	.;.;.;F264_HUMAN	K	456;445;449;421;422	.	ENSP00000232375:R456K	R	-	2	0	PFKFB4	48532227	1.000000	0.71417	0.950000	0.38849	0.820000	0.46376	7.045000	0.76585	2.474000	0.83562	0.655000	0.94253	AGA	PFKFB4	-	pirsf_Bifunct_6PFK/fruc_bisP_Ptase	ENSG00000114268		0.532	PFKFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFKFB4	HGNC	protein_coding	OTTHUMT00000257503.2	43	0.00	0	C	NM_004567		48557223	48557223	-1	no_errors	ENST00000232375	ensembl	human	known	69_37n	missense	34	27.66	13	SNP	0.997	T
PICK1	9463	genome.wustl.edu	37	22	38468540	38468540	+	Missense_Mutation	SNP	G	G	A	rs200906170		TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr22:38468540G>A	ENST00000404072.3	+	9	960	c.613G>A	c.(613-615)Gag>Aag	p.E205K	RP5-1039K5.13_ENST00000445483.1_RNA|PICK1_ENST00000356976.3_Missense_Mutation_p.E205K	NM_001039583.1|NM_001039584.1	NP_001034672.1|NP_001034673.1	Q9NRD5	PICK1_HUMAN	protein interacting with PRKCA 1	205	AH. {ECO:0000255|PROSITE- ProRule:PRU00294}.				ATP catabolic process (GO:0006200)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|dendritic spine maintenance (GO:0097062)|dendritic spine organization (GO:0097061)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|glial cell development (GO:0021782)|long term synaptic depression (GO:0060292)|monoamine transport (GO:0015844)|negative regulation of Arp2/3 complex-mediated actin nucleation (GO:0034316)|neuronal ion channel clustering (GO:0045161)|positive regulation of receptor internalization (GO:0002092)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|protein targeting (GO:0006605)|receptor clustering (GO:0043113)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endocytic vesicle membrane (GO:0030666)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	actin filament binding (GO:0051015)|Arp2/3 complex binding (GO:0071933)|ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein kinase C binding (GO:0005080)|receptor binding (GO:0005102)	p.E205K(1)		cervix(1)|endometrium(3)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13	Melanoma(58;0.045)					AGCTGCGAGCGAGGCTTTTGT	0.597																																						dbGAP											1	Substitution - Missense(1)	lung(1)											60.0	63.0	62.0					22																	38468540		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL049654	CCDS13965.1	22q13.1	2006-02-14	2006-02-14	2006-02-14	ENSG00000100151	ENSG00000100151			9394	protein-coding gene	gene with protein product		605926	"""protein kinase C, alpha binding protein"", ""protein interacting with PRKCA"""	PRKCABP		10340301, 10591208	Standard	XM_006724377		Approved	dJ1039K5, MGC15204	uc003aus.3	Q9NRD5	OTTHUMG00000151159	ENST00000404072.3:c.613G>A	22.37:g.38468540G>A	ENSP00000385205:p.Glu205Lys		B3KS52|O95906	Missense_Mutation	SNP	pfam_Arfaptin_homology_dom,pfam_PDZ,pfam_BAR_dom,superfamily_PDZ,smart_PDZ,pfscan_Arfaptin_homology_dom,pfscan_PDZ	p.E205K	ENST00000404072.3	37	c.613	CCDS13965.1	22	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	34	5.408086	0.96051	.	.	ENSG00000100151	ENST00000404072;ENST00000424694;ENST00000356976	T;T;T	0.78364	-1.17;-1.17;-1.17	4.67	4.67	0.58626	Arfaptin-like (3);	0.000000	0.85682	D	0.000000	D	0.82646	0.5082	M	0.70842	2.15	0.80722	D	1	D	0.58268	0.982	P	0.50825	0.651	D	0.83757	0.0212	10	0.44086	T	0.13	-35.9667	18.4439	0.90677	0.0:0.0:1.0:0.0	.	205	Q9NRD5	PICK1_HUMAN	K	205	ENSP00000385205:E205K;ENSP00000398141:E205K;ENSP00000349465:E205K	ENSP00000349465:E205K	E	+	1	0	PICK1	36798486	1.000000	0.71417	0.996000	0.52242	0.888000	0.51559	9.545000	0.98095	2.522000	0.85027	0.655000	0.94253	GAG	PICK1	-	pfam_Arfaptin_homology_dom,pfam_BAR_dom,pfscan_Arfaptin_homology_dom	ENSG00000100151		0.597	PICK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PICK1	HGNC	protein_coding	OTTHUMT00000321569.2	34	0.00	0	G	NM_012407		38468540	38468540	+1	no_errors	ENST00000356976	ensembl	human	known	69_37n	missense	33	19.51	8	SNP	1.000	A
PIK3C2B	5287	genome.wustl.edu	37	1	204411737	204411737	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:204411737C>T	ENST00000367187.3	-	21	3629	c.3073G>A	c.(3073-3075)Gag>Aag	p.E1025K	PIK3C2B_ENST00000424712.2_Missense_Mutation_p.E997K	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	1025					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			TGCTTCACCTCCTCCAGGCCC	0.592																																						dbGAP											0													40.0	33.0	35.0					1																	204411737		2178	4246	6424	-	-	-	SO:0001583	missense	0			Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.3073G>A	1.37:g.204411737C>T	ENSP00000356155:p.Glu1025Lys		O95666|Q5SW99	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_PI3K_Ras-bd_dom,pfam_Phox,pfam_C2_Ca-dep,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Phox,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.E1025K	ENST00000367187.3	37	c.3073	CCDS1446.1	1	.	.	.	.	.	.	.	.	.	.	C	15.61	2.883775	0.51908	.	.	ENSG00000133056	ENST00000367187;ENST00000424712	T;T	0.80738	-1.41;-1.41	5.57	5.57	0.84162	Protein kinase-like domain (1);	0.166139	0.52532	D	0.000069	T	0.68595	0.3018	N	0.16743	0.435	0.40118	D	0.976567	B;B	0.24963	0.0;0.115	B;B	0.20577	0.003;0.03	T	0.64647	-0.6358	10	0.26408	T	0.33	.	17.3215	0.87238	0.0:1.0:0.0:0.0	.	997;1025	F5GWN5;O00750	.;P3C2B_HUMAN	K	1025;997	ENSP00000356155:E1025K;ENSP00000400561:E997K	ENSP00000356155:E1025K	E	-	1	0	PIK3C2B	202678360	0.509000	0.26163	1.000000	0.80357	0.842000	0.47809	1.171000	0.31896	2.631000	0.89168	0.467000	0.42956	GAG	PIK3C2B	-	superfamily_Kinase-like_dom	ENSG00000133056		0.592	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3C2B	HGNC	protein_coding	OTTHUMT00000087965.1	40	0.00	0	C	NM_002646		204411737	204411737	-1	no_errors	ENST00000367187	ensembl	human	known	69_37n	missense	48	20.00	12	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178928079	178928079	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr3:178928079G>A	ENST00000263967.3	+	8	1514	c.1357G>A	c.(1357-1359)Gaa>Aaa	p.E453K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	453	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.		E -> Q (in CRC; likely involved in disease pathogenesis; shows an increase in lipid kinase activity; may disrupt the interaction of the C2 PI3K-type domain with the iSH2 region of the p85 regulatory subunit).|Missing (in MCAP). {ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E453K(11)|p.E453Q(5)|p.H450fs*9(1)|p.G451_L456>V(1)|p.P449_L455del(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCATGGATTAGAAGATTTGCT	0.348		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	19	Substitution - Missense(16)|Complex - frameshift(1)|Complex - deletion inframe(1)|Deletion - In frame(1)	endometrium(8)|breast(6)|lung(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)											137.0	130.0	132.0					3																	178928079		1829	4090	5919	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1357G>A	3.37:g.178928079G>A	ENSP00000263967:p.Glu453Lys		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E453K	ENST00000263967.3	37	c.1357	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	32	5.164616	0.94727	.	.	ENSG00000121879	ENST00000263967	T	0.71103	-0.54	5.64	5.64	0.86602	C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (1);	0.000000	0.85682	D	0.000000	T	0.77130	0.4085	M	0.68317	2.08	0.80722	D	1	P	0.50528	0.936	P	0.50970	0.655	T	0.72500	-0.4274	10	0.20046	T	0.44	-22.2286	19.6973	0.96031	0.0:0.0:1.0:0.0	.	453	P42336	PK3CA_HUMAN	K	453	ENSP00000263967:E453K	ENSP00000263967:E453K	E	+	1	0	PIK3CA	180410773	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.448000	0.97600	2.674000	0.91012	0.655000	0.94253	GAA	PIK3CA	-	pfam_PI3K_C2_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000121879		0.348	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	68	0.00	0	G			178928079	178928079	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	47	34.72	25	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	43	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	41	33.87	21	SNP	1.000	G
PLA2G4F	255189	genome.wustl.edu	37	15	42445858	42445858	+	Splice_Site	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr15:42445858C>T	ENST00000382396.4	-	5	537	c.451G>A	c.(451-453)Gat>Aat	p.D151N	PLA2G4F_ENST00000397272.3_Splice_Site_p.D151N			Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	151					arachidonic acid secretion (GO:0050482)|cellular response to antibiotic (GO:0071236)|cellular response to organic cyclic compound (GO:0071407)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	calcium-dependent phospholipase A2 activity (GO:0047498)|lysophospholipase activity (GO:0004622)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		TCTTGTGAATCCTACATGGAG	0.552																																						dbGAP											0													58.0	59.0	59.0					15																	42445858		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0				CCDS32204.1	15q15.1	2008-09-19				ENSG00000168907	3.1.1.4		27396	protein-coding gene	gene with protein product						14702039, 15866882	Standard	NM_213600		Approved	PLA2G4F/Z	uc001zoz.3	Q68DD2		ENST00000382396.4:c.451-1G>A	15.37:g.42445858C>T			Q6ZMC8	Missense_Mutation	SNP	pfam_LysoPLipase_cat_dom,pfam_C2_Ca-dep,superfamily_Acyl_Trfase/lysoPLipase,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_LysoPLipase_cat_dom,pfscan_C2_membr_targeting,pfscan_LysoPLipase_cat_dom	p.D151N	ENST00000382396.4	37	c.451	CCDS32204.1	15	.	.	.	.	.	.	.	.	.	.	C	1.958	-0.439473	0.04636	.	.	ENSG00000168907	ENST00000290497;ENST00000397272;ENST00000382396;ENST00000357924;ENST00000443825	T;T	0.62639	0.01;0.01	5.02	3.11	0.35812	C2 calcium/lipid-binding domain, CaLB (1);	0.308062	0.27375	N	0.019650	T	0.50531	0.1621	L	0.47716	1.5	0.34402	D	0.695385	B	0.15930	0.015	B	0.14023	0.01	T	0.53315	-0.8456	10	0.20519	T	0.43	-14.1627	9.8096	0.40815	0.0:0.8299:0.0:0.1701	.	151	Q68DD2	PA24F_HUMAN	N	147;151;151;151;151	ENSP00000380442:D151N;ENSP00000371833:D151N	ENSP00000290497:D147N	D	-	1	0	PLA2G4F	40233150	0.888000	0.30383	0.829000	0.32907	0.013000	0.08279	1.256000	0.32921	0.770000	0.33336	-0.140000	0.14226	GAT	PLA2G4F	-	superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000168907		0.552	PLA2G4F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLA2G4F	HGNC	protein_coding	OTTHUMT00000420463.1	30	0.00	0	C	NM_213600	Missense_Mutation	42445858	42445858	-1	no_errors	ENST00000397272	ensembl	human	known	69_37n	missense	25	30.56	11	SNP	0.988	T
PLCH1	23007	genome.wustl.edu	37	3	155203309	155203309	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr3:155203309G>A	ENST00000340059.7	-	22	2833	c.2834C>T	c.(2833-2835)tCt>tTt	p.S945F	PLCH1_ENST00000447496.2_Missense_Mutation_p.S945F|PLCH1_ENST00000334686.6_Missense_Mutation_p.S907F|PLCH1_ENST00000414191.1_Missense_Mutation_p.S907F|PLCH1-AS2_ENST00000472913.1_RNA|PLCH1_ENST00000494598.1_Missense_Mutation_p.S925F|PLCH1_ENST00000460012.1_Missense_Mutation_p.S907F	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	945					inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			CTCGGACACAGAATCCTTTAT	0.517																																						dbGAP											0													157.0	147.0	150.0					3																	155203309		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.2834C>T	3.37:g.155203309G>A	ENSP00000345988:p.Ser945Phe		Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_EF_hand_Ca-bd,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pfscan_EF_HAND_2,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.S945F	ENST00000340059.7	37	c.2834	CCDS46939.1	3	.	.	.	.	.	.	.	.	.	.	G	13.31	2.198554	0.38806	.	.	ENSG00000114805	ENST00000494598;ENST00000460012;ENST00000447496;ENST00000340059;ENST00000334686;ENST00000414191	T;T;T;T;T;T	0.32023	1.98;1.91;1.47;1.91;1.91;1.91	5.88	1.86	0.25419	.	0.509174	0.22308	N	0.061775	T	0.20941	0.0504	L	0.40543	1.245	0.09310	N	1	P;P;P	0.43231	0.801;0.7;0.488	B;B;B	0.42062	0.359;0.374;0.163	T	0.17868	-1.0355	10	0.72032	D	0.01	.	1.2178	0.01918	0.1718:0.2178:0.3786:0.2318	.	907;945;945	Q4KWH8-2;Q4KWH8;Q4KWH8-3	.;PLCH1_HUMAN;.	F	925;907;945;945;907;907	ENSP00000419100:S925F;ENSP00000417502:S907F;ENSP00000402759:S945F;ENSP00000345988:S945F;ENSP00000335469:S907F;ENSP00000412977:S907F	ENSP00000335469:S907F	S	-	2	0	PLCH1	156686003	0.171000	0.23029	0.178000	0.23040	0.451000	0.32288	1.154000	0.31688	0.788000	0.33755	0.655000	0.94253	TCT	PLCH1	-	NULL	ENSG00000114805		0.517	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCH1	HGNC	protein_coding	OTTHUMT00000351125.1	90	0.00	0	G	NM_014996		155203309	155203309	-1	no_errors	ENST00000340059	ensembl	human	known	69_37n	missense	59	29.76	25	SNP	0.012	A
PLEKHG1	57480	genome.wustl.edu	37	6	151130863	151130863	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr6:151130863C>T	ENST00000358517.2	+	10	1482	c.1271C>T	c.(1270-1272)cCa>cTa	p.P424L	PLEKHG1_ENST00000367328.1_Missense_Mutation_p.P424L			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	424							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		GCCAAGATTCCAGCTAAGGTA	0.483																																						dbGAP											0													63.0	56.0	59.0					6																	151130863		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.1271C>T	6.37:g.151130863C>T	ENSP00000351318:p.Pro424Leu		Q5T1F2	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.P424L	ENST00000358517.2	37	c.1271	CCDS34552.1	6	.	.	.	.	.	.	.	.	.	.	C	20.3	3.960545	0.74016	.	.	ENSG00000120278	ENST00000367328;ENST00000535018;ENST00000358517	D;D	0.86562	-2.14;-2.14	5.76	5.76	0.90799	Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	D	0.93239	0.7846	M	0.82193	2.58	0.80722	D	1	D;D;D	0.64830	0.994;0.971;0.971	D;P;P	0.64687	0.928;0.846;0.846	D	0.93427	0.6782	10	0.87932	D	0	.	19.9857	0.97347	0.0:1.0:0.0:0.0	.	231;424;424	Q5EBL9;Q5JYA6;Q9ULL1	.;.;PKHG1_HUMAN	L	424	ENSP00000356297:P424L;ENSP00000351318:P424L	ENSP00000351318:P424L	P	+	2	0	PLEKHG1	151172556	1.000000	0.71417	0.782000	0.31804	0.054000	0.15201	7.624000	0.83124	2.706000	0.92434	0.655000	0.94253	CCA	PLEKHG1	-	NULL	ENSG00000120278		0.483	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHG1	HGNC	protein_coding	OTTHUMT00000042691.1	23	0.00	0	C			151130863	151130863	+1	no_errors	ENST00000358517	ensembl	human	known	69_37n	missense	28	26.32	10	SNP	1.000	T
PLXNB2	23654	genome.wustl.edu	37	22	50718173	50718173	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr22:50718173G>C	ENST00000449103.1	-	27	4415	c.4275C>G	c.(4273-4275)ttC>ttG	p.F1425L	PLXNB2_ENST00000359337.4_Missense_Mutation_p.F1425L			O15031	PLXB2_HUMAN	plexin B2	1425					brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TGATGGCCTTGAAGAGCTTGT	0.632																																						dbGAP											0													138.0	149.0	145.0					22																	50718173		1906	4115	6021	-	-	-	SO:0001583	missense	0				CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.4275C>G	22.37:g.50718173G>C	ENSP00000409171:p.Phe1425Leu		A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT_TIG_rcpt,pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.F1425L	ENST00000449103.1	37	c.4275	CCDS43035.1	22	.	.	.	.	.	.	.	.	.	.	G	19.55	3.848517	0.71603	.	.	ENSG00000196576	ENST00000449103;ENST00000359337;ENST00000399964	T;T	0.11495	2.77;2.77	4.17	3.15	0.36227	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.64402	D	0.000001	T	0.22322	0.0538	L	0.58810	1.83	0.54753	D	0.999985	D	0.55605	0.972	P	0.58520	0.84	T	0.01105	-1.1450	10	0.36615	T	0.2	.	12.5525	0.56233	0.0827:0.0:0.9173:0.0	.	1425	O15031	PLXB2_HUMAN	L	1425;1425;57	ENSP00000409171:F1425L;ENSP00000352288:F1425L	ENSP00000352288:F1425L	F	-	3	2	PLXNB2	49060300	1.000000	0.71417	1.000000	0.80357	0.790000	0.44656	3.158000	0.50723	1.102000	0.41551	-0.368000	0.07277	TTC	PLXNB2	-	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot	ENSG00000196576		0.632	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNB2	HGNC	protein_coding	OTTHUMT00000316874.3	68	0.00	0	G	NM_012401		50718173	50718173	-1	no_errors	ENST00000359337	ensembl	human	known	69_37n	missense	53	35.37	29	SNP	1.000	C
POTEC	388468	genome.wustl.edu	37	18	14511953	14511953	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr18:14511953C>T	ENST00000358970.5	-	11	1572	c.1573G>A	c.(1573-1575)Gaa>Aaa	p.E525K		NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	525										NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						ATGCTGTTTTCACGCAAGAGA	0.348																																						dbGAP											0													92.0	69.0	76.0					18																	14511953		692	1591	2283	-	-	-	SO:0001583	missense	0			BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.1573G>A	18.37:g.14511953C>T	ENSP00000351856:p.Glu525Lys			Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E525K	ENST00000358970.5	37	c.1573	CCDS45835.1	18	.	.	.	.	.	.	.	.	.	.	C	7.954	0.745563	0.15710	.	.	ENSG00000183206	ENST00000358970	T	0.27402	1.67	1.44	-1.51	0.08664	.	.	.	.	.	T	0.16041	0.0386	N	0.19112	0.55	0.09310	N	1	B	0.13594	0.008	B	0.06405	0.002	T	0.24119	-1.0169	9	0.87932	D	0	.	3.0434	0.06146	0.0:0.3917:0.2599:0.3484	.	525	B2RU33	POTEC_HUMAN	K	525	ENSP00000351856:E525K	ENSP00000351856:E525K	E	-	1	0	POTEC	14501953	0.018000	0.18449	0.001000	0.08648	0.006000	0.05464	-0.259000	0.08721	-0.367000	0.08052	0.205000	0.17691	GAA	POTEC	-	NULL	ENSG00000183206		0.348	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	POTEC	HGNC	protein_coding	OTTHUMT00000371179.1	130	0.00	0	C	XM_496269		14511953	14511953	-1	no_errors	ENST00000358970	ensembl	human	known	69_37n	missense	96	17.95	21	SNP	0.004	T
PPEF1	5475	genome.wustl.edu	37	X	18842151	18842151	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chrX:18842151G>A	ENST00000361511.4	+	17	2106	c.1612G>A	c.(1612-1614)Gtt>Att	p.V538I	PPEF1_ENST00000349874.5_Missense_Mutation_p.V476I|PPEF1_ENST00000359763.6_Missense_Mutation_p.V485I|PPEF1_ENST00000544635.1_Missense_Mutation_p.V473I|PPEF1_ENST00000543630.1_3'UTR	NM_006240.2|NM_152224.1	NP_006231.2|NP_689410.1	O14829	PPE1_HUMAN	protein phosphatase, EF-hand calcium binding domain 1	538					detection of stimulus involved in sensory perception (GO:0050906)|phototransduction, visible light (GO:0007603)|protein dephosphorylation (GO:0006470)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)			breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	43	Hepatocellular(33;0.183)					AAATGGAAACGTTGAATACAT	0.443																																						dbGAP											0													165.0	139.0	148.0					X																	18842151		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC036026	CCDS14188.1, CCDS43920.1	Xp22	2013-01-10			ENSG00000086717	ENSG00000086717		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9243	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, alpha isozyme"""	300109		PPEF		9215685, 9326663	Standard	NM_152224		Approved	PPP7CA	uc004cyq.3	O14829	OTTHUMG00000021219	ENST00000361511.4:c.1612G>A	X.37:g.18842151G>A	ENSP00000354871:p.Val538Ile		A6NHP4|A8K348|O15253|Q9NU21|Q9UJH0	Missense_Mutation	SNP	pfam_Metallo_PEstase_dom,pfam_EF-hand,pfam_PPP_dom,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,smart_Ser/Thr-sp_prot-phosphatase,smart_EF_hand_Ca-bd,pirsf_Ser/Thr-Pase_EF-hand_contain,pfscan_EF_HAND_2,pfscan_IQ_motif_EF-hand-BS,prints_Ser/Thr-sp_prot-phosphatase	p.V538I	ENST00000361511.4	37	c.1612	CCDS14188.1	X	.	.	.	.	.	.	.	.	.	.	G	10.02	1.235362	0.22626	.	.	ENSG00000086717	ENST00000361511;ENST00000359763;ENST00000349874;ENST00000544635	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.2	-2.4	0.06583	.	1.557460	0.03419	N	0.206037	T	0.37265	0.0997	L	0.35854	1.095	0.09310	N	1	B;B;B	0.23990	0.078;0.095;0.007	B;B;B	0.17098	0.017;0.017;0.004	T	0.38757	-0.9646	10	0.45353	T	0.12	-1.8165	15.0462	0.71830	0.115:0.0:0.885:0.0	.	476;538;510	O14829-5;O14829;O14829-3	.;PPE1_HUMAN;.	I	538;485;476;473	ENSP00000354871:V538I;ENSP00000352806:V485I;ENSP00000341892:V476I;ENSP00000441289:V473I	ENSP00000341892:V476I	V	+	1	0	PPEF1	18752072	0.088000	0.21588	0.000000	0.03702	0.004000	0.04260	0.264000	0.18497	-1.029000	0.03317	-0.192000	0.12808	GTT	PPEF1	-	pirsf_Ser/Thr-Pase_EF-hand_contain	ENSG00000086717		0.443	PPEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPEF1	HGNC	protein_coding	OTTHUMT00000055953.3	92	0.00	0	G	NM_006240		18842151	18842151	+1	no_errors	ENST00000361511	ensembl	human	known	69_37n	missense	83	30.00	36	SNP	0.002	A
TRIM37	4591	genome.wustl.edu	37	17	57057536	57057536	+	IGR	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr17:57057536C>T	ENST00000393066.3	-	0	3622				PPM1E_ENST00000308249.2_Missense_Mutation_p.S471L	NM_001005207.2	NP_001005207.1	O94972	TRI37_HUMAN	tripartite motif containing 37						aggresome assembly (GO:0070842)|negative regulation of centriole replication (GO:0046600)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autoubiquitination (GO:0051865)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisome (GO:0005777)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(13)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					TTAGTGGCATCAGCTCGTGAT	0.458									Mulibrey Nanism																													dbGAP											0													135.0	109.0	118.0					17																	57057536		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0	Familial Cancer Database	Perheentupa syndrome	AB020705	CCDS32694.1, CCDS45746.1	17q	2014-02-17	2011-01-25	2001-11-30		ENSG00000108395		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	7523	protein-coding gene	gene with protein product	"""RING-B-box-coiled-coil protein"""	605073	"""tripartite motif-containing 37"""	MUL		9106536, 10888877	Standard	NM_015294		Approved	KIAA0898, POB1, TEF3	uc002iwy.4	O94972			17.37:g.57057536C>T			Q7Z3E6|Q8IYF7|Q8WYF7	Missense_Mutation	SNP	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	p.S471L	ENST00000393066.3	37	c.1412	CCDS45746.1	17	.	.	.	.	.	.	.	.	.	.	C	17.12	3.308439	0.60305	.	.	ENSG00000175175	ENST00000308249;ENST00000443121	T	0.16073	2.37	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.11707	0.0285	N	0.03967	-0.31	0.80722	D	1	B;B	0.28584	0.113;0.216	B;B	0.33196	0.159;0.159	T	0.31052	-0.9957	10	0.45353	T	0.12	-2.7701	19.8464	0.96708	0.0:1.0:0.0:0.0	.	480;471	Q8WY54-3;Q8WY54-2	.;.	L	471;322	ENSP00000312411:S471L	ENSP00000312411:S471L	S	+	2	0	PPM1E	54412318	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.710000	0.92621	0.491000	0.48974	TCA	PPM1E	-	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	ENSG00000175175		0.458	TRIM37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1E	HGNC	protein_coding	OTTHUMT00000445928.1	73	0.00	0	C	NM_015294		57057536	57057536	+1	no_errors	ENST00000308249	ensembl	human	known	69_37n	missense	65	17.72	14	SNP	1.000	T
PRKRIR	5612	genome.wustl.edu	37	11	76076976	76076976	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr11:76076976C>T	ENST00000260045.3	-	2	235	c.130G>A	c.(130-132)Gaa>Aaa	p.E44K	PRKRIR_ENST00000531878.1_5'UTR	NM_004705.2	NP_004696.2	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)	44					negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)|signal transduction (GO:0007165)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|large_intestine(4)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	25						GTTTTATCTTCTAAGTCTGCT	0.353																																						dbGAP											0													131.0	125.0	127.0					11																	76076976		2200	4290	6490	-	-	-	SO:0001583	missense	0			AF007393	CCDS8243.1	11q13.5	2013-01-25			ENSG00000137492	ENSG00000137492		"""THAP (C2CH-type zinc finger) domain containing"""	9440	protein-coding gene	gene with protein product	"""THAP domain containing 12"""	607374				9447982	Standard	NM_004705		Approved	P52rIPK, DAP4, THAP12	uc001oxh.1	O43422	OTTHUMG00000165280	ENST00000260045.3:c.130G>A	11.37:g.76076976C>T	ENSP00000260045:p.Glu44Lys		A8K728|Q17RY9|Q8WTW1|Q9Y3Z4	Missense_Mutation	SNP	pfam_Znf_C2CH,pfam_HATC,superfamily_RNaseH-like_dom,smart_Znf_C2CH,pfscan_Znf_C2CH	p.E44K	ENST00000260045.3	37	c.130	CCDS8243.1	11	.	.	.	.	.	.	.	.	.	.	C	16.29	3.081988	0.55861	.	.	ENSG00000137492	ENST00000260045	.	.	.	5.58	5.58	0.84498	Zinc finger, C2CH-type (4);	0.000000	0.85682	D	0.000000	T	0.49406	0.1555	N	0.16862	0.45	0.52501	D	0.999959	B	0.33637	0.42	B	0.39419	0.299	T	0.48433	-0.9036	9	0.40728	T	0.16	.	18.6924	0.91588	0.0:1.0:0.0:0.0	.	44	O43422	P52K_HUMAN	K	44	.	ENSP00000260045:E44K	E	-	1	0	PRKRIR	75754624	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.326000	0.59241	2.780000	0.95670	0.655000	0.94253	GAA	PRKRIR	-	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	ENSG00000137492		0.353	PRKRIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKRIR	HGNC	protein_coding	OTTHUMT00000383188.1	90	0.00	0	C	NM_004705		76076976	76076976	-1	no_errors	ENST00000260045	ensembl	human	known	69_37n	missense	79	24.76	26	SNP	1.000	T
PROM2	150696	genome.wustl.edu	37	2	95946989	95946989	+	Splice_Site	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:95946989G>A	ENST00000317620.9	+	12	1560		c.e12-1		PROM2_ENST00000317668.4_Splice_Site|PROM2_ENST00000403131.2_Splice_Site|PROM2_ENST00000542147.1_Splice_Site	NM_001165978.1	NP_001159450.1	Q8N271	PROM2_HUMAN	prominin 2						negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of pinocytosis (GO:0048550)|positive regulation of cell projection organization (GO:0031346)|positive regulation of protein phosphorylation (GO:0001934)|regulation of Cdc42 GTPase activity (GO:0043088)	cell projection (GO:0042995)|cell surface (GO:0009986)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microspike (GO:0044393)|microvillus (GO:0005902)|prominosome (GO:0071914)	cholesterol binding (GO:0015485)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	32						GCCTACCCCAGAGGTGTGGGC	0.652																																						dbGAP											0													81.0	77.0	78.0					2																	95946989		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF245303	CCDS2012.1	2q11.1	2008-02-05			ENSG00000155066	ENSG00000155066			20685	protein-coding gene	gene with protein product						12514187	Standard	NM_001165978		Approved		uc002sui.3	Q8N271	OTTHUMG00000130393	ENST00000317620.9:c.1428-1G>A	2.37:g.95946989G>A			A8K2V1|Q2HIX6|Q8NB84|Q8TAE2	Splice_Site	SNP	-	e12-1	ENST00000317620.9	37	c.1428-1	CCDS2012.1	2	.	.	.	.	.	.	.	.	.	.	G	9.747	1.166480	0.21621	.	.	ENSG00000155066	ENST00000403131;ENST00000317668;ENST00000317620;ENST00000542147	.	.	.	4.93	4.93	0.64822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6429	0.62263	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PROM2	95310716	1.000000	0.71417	0.856000	0.33681	0.076000	0.17211	7.070000	0.76763	2.265000	0.75225	0.561000	0.74099	.	PROM2	-	-	ENSG00000155066		0.652	PROM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PROM2	HGNC	protein_coding	OTTHUMT00000252771.1	38	0.00	0	G	NM_144707	Intron	95946989	95946989	+1	no_errors	ENST00000317620	ensembl	human	known	69_37n	splice_site	22	33.33	11	SNP	0.995	A
ZNF512B	57473	genome.wustl.edu	37	20	62641605	62641605	+	Intron	SNP	G	G	C	rs41278236	byFrequency	TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr20:62641605G>C	ENST00000450537.1	-	1	56				PRPF6_ENST00000535781.1_Silent_p.L413L|ZNF512B_ENST00000217130.3_Intron			Q96KM6	Z512B_HUMAN	zinc finger protein 512B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					CCGTTGAGCTGGAAGAACCTG	0.552																																						dbGAP											0													115.0	105.0	108.0					20																	62641605		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.4+38452C>G	20.37:g.62641605G>C			Q08AK9|Q9ULM4	Silent	SNP	pfam_PRP1_N,smart_HAT,smart_TPR_repeat,pfscan_TPR-contain_dom	p.L413	ENST00000450537.1	37	c.1239	CCDS13548.1	20																																																																																			PRPF6	-	smart_HAT	ENSG00000101161		0.552	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF6	HGNC	protein_coding	OTTHUMT00000080246.1	39	0.00	0	G	NM_020713		62641605	62641605	+1	no_errors	ENST00000266079	ensembl	human	known	69_37n	silent	24	27.27	9	SNP	1.000	C
PTPRK	5796	genome.wustl.edu	37	6	128302332	128302332	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr6:128302332C>T	ENST00000368215.3	-	25	3636	c.3637G>A	c.(3637-3639)Gac>Aac	p.D1213N	PTPRK_ENST00000368226.4_Missense_Mutation_p.D1214N|PTPRK_ENST00000368207.3_Missense_Mutation_p.D1246N|PTPRK_ENST00000368227.3_Missense_Mutation_p.D1231N|PTPRK_ENST00000368213.5_Missense_Mutation_p.D1220N|PTPRK_ENST00000368210.3_Missense_Mutation_p.D1232N|PTPRK_ENST00000532331.1_Missense_Mutation_p.D1236N			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	1213	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)		PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		AGACATCTGTCAGGTGGCAGC	0.463																																						dbGAP											0													117.0	96.0	103.0					6																	128302332		2203	4300	6503	-	-	-	SO:0001583	missense	0			L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.3637G>A	6.37:g.128302332C>T	ENSP00000357198:p.Asp1213Asn		B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.D1231N	ENST00000368215.3	37	c.3691		6	.	.	.	.	.	.	.	.	.	.	C	35	5.578024	0.96565	.	.	ENSG00000152894	ENST00000368226;ENST00000368227;ENST00000532331;ENST00000368213;ENST00000368210;ENST00000368215;ENST00000368207	D;D;D;D;D;D;D	0.88586	-2.4;-2.4;-2.4;-2.4;-2.4;-2.4;-2.4	5.75	5.75	0.90469	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	D	0.95379	0.8500	M	0.88979	2.995	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.998;0.998	D;D;D;D	0.83275	0.996;0.987;0.977;0.96	D	0.95437	0.8522	10	0.87932	D	0	.	19.9233	0.97095	0.0:1.0:0.0:0.0	.	1236;1220;1213;1214	B7ZMG0;Q15262-3;Q15262;Q15262-2	.;.;PTPRK_HUMAN;.	N	1214;1231;1236;1220;1232;1213;1246	ENSP00000357209:D1214N;ENSP00000357210:D1231N;ENSP00000432973:D1236N;ENSP00000357196:D1220N;ENSP00000357193:D1232N;ENSP00000357198:D1213N;ENSP00000357190:D1246N	ENSP00000357190:D1246N	D	-	1	0	PTPRK	128344025	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.728000	0.93425	0.655000	0.94253	GAC	PTPRK	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000152894		0.463	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	PTPRK	HGNC	protein_coding	OTTHUMT00000042163.1	48	0.00	0	C			128302332	128302332	-1	no_errors	ENST00000368227	ensembl	human	known	69_37n	missense	35	39.66	23	SNP	1.000	T
PXDN	7837	genome.wustl.edu	37	2	1680709	1680709	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:1680709G>A	ENST00000252804.4	-	8	888	c.838C>T	c.(838-840)Ctg>Ttg	p.L280L	PXDN_ENST00000483018.1_5'Flank	NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	280	Ig-like C2-type 1.				extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		TTGTTTCGCAGCCAGATGATC	0.587																																						dbGAP											0													60.0	69.0	66.0					2																	1680709		2052	4195	6247	-	-	-	SO:0001819	synonymous_variant	0			AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.838C>T	2.37:g.1680709G>A			A8QM65|D6W4Y0|Q4KMG2	Silent	SNP	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like	p.L280	ENST00000252804.4	37	c.838	CCDS46221.1	2																																																																																			PXDN	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000130508		0.587	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDN	HGNC	protein_coding	OTTHUMT00000322505.1	45	0.00	0	G	XM_056455		1680709	1680709	-1	no_errors	ENST00000252804	ensembl	human	known	69_37n	silent	25	26.47	9	SNP	1.000	A
QSER1	79832	genome.wustl.edu	37	11	32975639	32975639	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr11:32975639G>A	ENST00000399302.2	+	5	4362	c.4027G>A	c.(4027-4029)Gag>Aag	p.E1343K	QSER1_ENST00000527788.1_Missense_Mutation_p.E1104K	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	1343										breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					TTTTACAGATGAGGAGGACAC	0.433																																						dbGAP											0													130.0	133.0	132.0					11																	32975639		1996	4168	6164	-	-	-	SO:0001583	missense	0			AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.4027G>A	11.37:g.32975639G>A	ENSP00000382241:p.Glu1343Lys		Q6ZU30|Q6ZUR5	Missense_Mutation	SNP	NULL	p.E1343K	ENST00000399302.2	37	c.4027	CCDS41631.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.951343|5.951343	0.97139|0.97139	.|.	.|.	ENSG00000060749|ENSG00000060749	ENST00000399302;ENST00000078652;ENST00000527788|ENST00000524678	T;T|.	0.35789|.	1.62;1.29|.	5.92|5.92	5.92|5.92	0.95590|0.95590	.|.	0.082566|.	0.49916|.	D|.	0.000128|.	T|T	0.82231|0.82231	0.4992|0.4992	M|M	0.80183|0.80183	2.485|2.485	0.80722|0.80722	D|D	1|1	D;D;P|.	0.61697|.	0.971;0.99;0.891|.	P;P;B|.	0.56648|.	0.654;0.803;0.43|.	T|T	0.81315|0.81315	-0.0988|-0.0988	10|5	0.72032|.	D|.	0.01|.	.|.	20.33|20.33	0.98713|0.98713	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1104;1104;1343|.	C9JJ88;Q2KHR3-2;Q2KHR3|.	.;.;QSER1_HUMAN|.	K|I	1343;1104;1104|363	ENSP00000382241:E1343K;ENSP00000432766:E1104K|.	ENSP00000078652:E1104K|.	E|M	+|+	1|3	0|0	QSER1|QSER1	32932215|32932215	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	9.476000|9.476000	0.97823|0.97823	2.810000|2.810000	0.96702|0.96702	0.585000|0.585000	0.79938|0.79938	GAG|ATG	QSER1	-	NULL	ENSG00000060749		0.433	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSER1	HGNC	protein_coding	OTTHUMT00000388448.1	54	0.00	0	G	NM_024774		32975639	32975639	+1	no_errors	ENST00000399302	ensembl	human	known	69_37n	missense	40	33.33	20	SNP	1.000	A
RAB1B	81876	genome.wustl.edu	37	11	66043605	66043605	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr11:66043605G>A	ENST00000311481.6	+	6	649	c.502G>A	c.(502-504)Gaa>Aaa	p.E168K	RP11-867G23.4_ENST00000526951.1_RNA|CNIH2_ENST00000528852.1_5'Flank|RP11-867G23.3_ENST00000501708.1_lincRNA|RP11-867G23.4_ENST00000528650.1_RNA|CNIH2_ENST00000311445.6_5'Flank|RAB1B_ENST00000527397.1_Missense_Mutation_p.E136K	NM_030981.2	NP_112243.1	Q9H0U4	RAB1B_HUMAN	RAB1B, member RAS oncogene family	168					ER to Golgi vesicle-mediated transport (GO:0006888)|positive regulation of glycoprotein metabolic process (GO:1903020)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|virion assembly (GO:0019068)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)			large_intestine(2)|lung(1)|ovary(1)|prostate(1)	5						CATGGCTGCTGAAATCAAAAA	0.597																																						dbGAP											0													38.0	37.0	37.0					11																	66043605		2200	4295	6495	-	-	-	SO:0001583	missense	0			AJ245875	CCDS31613.1	11q13.1	2008-02-05			ENSG00000174903	ENSG00000174903		"""RAB, member RAS oncogene"""	18370	protein-coding gene	gene with protein product		612565				9030196	Standard	NM_030981		Approved		uc001ohf.3	Q9H0U4	OTTHUMG00000166916	ENST00000311481.6:c.502G>A	11.37:g.66043605G>A	ENSP00000310226:p.Glu168Lys		A8K7S1	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_ProtSyn_GTP-bd,pfam_SRP_receptor_beta_su,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.E168K	ENST00000311481.6	37	c.502	CCDS31613.1	11	.	.	.	.	.	.	.	.	.	.	G	14.74	2.626714	0.46840	.	.	ENSG00000174903	ENST00000311481;ENST00000527397	T;T	0.76578	-1.03;-1.03	3.9	3.9	0.45041	.	0.000000	0.64402	D	0.000001	T	0.62732	0.2452	N	0.12831	0.26	0.80722	D	1	B	0.24618	0.107	B	0.24701	0.055	T	0.65282	-0.6206	10	0.72032	D	0.01	.	13.7053	0.62633	0.0:0.0:1.0:0.0	.	168	Q9H0U4	RAB1B_HUMAN	K	168;136	ENSP00000310226:E168K;ENSP00000435195:E136K	ENSP00000310226:E168K	E	+	1	0	RAB1B	65800181	1.000000	0.71417	0.999000	0.59377	0.287000	0.27160	9.631000	0.98424	1.880000	0.54463	0.313000	0.20887	GAA	RAB1B	-	pfam_Small_GTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase	ENSG00000174903		0.597	RAB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB1B	HGNC	protein_coding	OTTHUMT00000391886.2	56	0.00	0	G	NM_030981		66043605	66043605	+1	no_errors	ENST00000311481	ensembl	human	known	69_37n	missense	20	47.37	18	SNP	1.000	A
RAB3GAP2	25782	genome.wustl.edu	37	1	220355610	220355610	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:220355610G>A	ENST00000358951.2	-	21	2415	c.2299C>T	c.(2299-2301)Cag>Tag	p.Q767*		NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	767					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		AACAACAGCTGAGGGCTAAGA	0.408																																						dbGAP											0													135.0	128.0	130.0					1																	220355610		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.2299C>T	1.37:g.220355610G>A	ENSP00000351832:p.Gln767*		A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	Nonsense_Mutation	SNP	superfamily_WD40_repeat_dom	p.Q767*	ENST00000358951.2	37	c.2299	CCDS31028.1	1	.	.	.	.	.	.	.	.	.	.	G	41	9.101332	0.99066	.	.	ENSG00000118873	ENST00000358951	.	.	.	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	.	20.1012	0.97876	0.0:0.0:1.0:0.0	.	.	.	.	X	767	.	ENSP00000351832:Q767X	Q	-	1	0	RAB3GAP2	218422233	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.572000	0.90756	2.754000	0.94517	0.650000	0.86243	CAG	RAB3GAP2	-	NULL	ENSG00000118873		0.408	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB3GAP2	HGNC	protein_coding	OTTHUMT00000090205.2	41	0.00	0	G	NM_012414		220355610	220355610	-1	no_errors	ENST00000358951	ensembl	human	known	69_37n	nonsense	53	39.77	35	SNP	1.000	A
RALGAPA2	57186	genome.wustl.edu	37	20	20571870	20571870	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr20:20571870G>T	ENST00000202677.7	-	17	2299	c.2292C>A	c.(2290-2292)agC>agA	p.S764R		NM_020343.3	NP_065076.2	Q2PPJ7	RGPA2_HUMAN	Ral GTPase activating protein, alpha subunit 2 (catalytic)	764					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	54						AGGTGCTGCTGCTCCGAAGGA	0.522																																						dbGAP											0													73.0	80.0	78.0					20																	20571870		2043	4194	6237	-	-	-	SO:0001583	missense	0			AL078634, DQ310704	CCDS46584.1	20p11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000188559	ENSG00000188559			16207	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 74"""	C20orf74		16490346, 19520869	Standard	NM_020343		Approved	dJ1049G11.4, AS250, KIAA1272, RapGAPalpha2	uc002wrz.3	Q2PPJ7	OTTHUMG00000032010	ENST00000202677.7:c.2292C>A	20.37:g.20571870G>T	ENSP00000202677:p.Ser764Arg		Q4VXU6|Q5JUA3|Q5JUA4|Q5T9K3|Q96CX9|Q9BQT7|Q9H9D9|Q9ULE8	Missense_Mutation	SNP	pfam_Rap_GAP,superfamily_ARM-type_fold,pfscan_Rap_GAP	p.S764R	ENST00000202677.7	37	c.2292	CCDS46584.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.04|17.04	3.288237|3.288237	0.59976|0.59976	.|.	.|.	ENSG00000188559|ENSG00000188559	ENST00000430436|ENST00000202677	.|T	.|0.70749	.|-0.51	5.85|5.85	4.91|4.91	0.64330|0.64330	.|.	.|0.090779	.|0.85682	.|D	.|0.000000	T|T	0.81230|0.81230	0.4779|0.4779	M|M	0.83953|0.83953	2.67|2.67	0.51012|0.51012	D|D	0.999902|0.999902	.|B;D	.|0.71674	.|0.409;0.998	.|B;P	.|0.59487	.|0.082;0.858	T|T	0.82655|0.82655	-0.0350|-0.0350	5|10	.|0.52906	.|T	.|0.07	.|.	10.3735|10.3735	0.44068|0.44068	0.1519:0.0:0.8481:0.0|0.1519:0.0:0.8481:0.0	.|.	.|602;764	.|A8MSM5;Q2PPJ7	.|.;RGPA2_HUMAN	E|R	581|764	.|ENSP00000202677:S764R	.|ENSP00000202677:S764R	A|S	-|-	2|3	0|2	RALGAPA2|RALGAPA2	20519870|20519870	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.322000|0.322000	0.28314|0.28314	1.871000|1.871000	0.39539|0.39539	1.496000|1.496000	0.48567|0.48567	-0.119000|-0.119000	0.15052|0.15052	GCA|AGC	RALGAPA2	-	NULL	ENSG00000188559		0.522	RALGAPA2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	RALGAPA2	HGNC	protein_coding	OTTHUMT00000471941.1	31	0.00	0	G	NM_020343		20571870	20571870	-1	no_errors	ENST00000202677	ensembl	human	known	69_37n	missense	28	37.78	17	SNP	1.000	T
RANBP2	5903	genome.wustl.edu	37	2	109381005	109381005	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:109381005C>G	ENST00000283195.6	+	20	4136	c.4010C>G	c.(4009-4011)tCt>tGt	p.S1337C		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1337					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						ATTTGCAAATCTGATGCTGGA	0.393																																						dbGAP											0													70.0	74.0	73.0					2																	109381005		2203	4299	6502	-	-	-	SO:0001583	missense	0			D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.4010C>G	2.37:g.109381005C>G	ENSP00000283195:p.Ser1337Cys		Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_Znf_RanBP2,pfam_IR1-M,pfam_Cyclophilin-like_PPIase_dom,pfam_TPR-1,superfamily_Cyclophilin-like_PPIase_dom,smart_TPR_repeat,smart_Ran_bind_dom,smart_Znf_RanBP2,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Znf_RanBP2,pfscan_Cyclophilin-like_PPIase_dom,pfscan_Ran_bind_dom,prints_Cyclophilin-like_PPIase_dom	p.S1337C	ENST00000283195.6	37	c.4010	CCDS2079.1	2	.	.	.	.	.	.	.	.	.	.	C	18.49	3.635477	0.67130	.	.	ENSG00000153201	ENST00000283195	T	0.28895	1.59	5.38	5.38	0.77491	.	.	.	.	.	T	0.31513	0.0799	N	0.24115	0.695	0.36907	D	0.890709	P	0.50710	0.938	P	0.47206	0.541	T	0.33033	-0.9884	9	0.72032	D	0.01	-6.8746	19.1382	0.93436	0.0:1.0:0.0:0.0	.	1337	P49792	RBP2_HUMAN	C	1337	ENSP00000283195:S1337C	ENSP00000283195:S1337C	S	+	2	0	RANBP2	108747437	0.111000	0.22076	0.996000	0.52242	0.997000	0.91878	3.081000	0.50120	2.507000	0.84556	0.655000	0.94253	TCT	RANBP2	-	NULL	ENSG00000153201		0.393	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RANBP2	HGNC	protein_coding	OTTHUMT00000253594.1	26	0.00	0	C	NM_006267		109381005	109381005	+1	no_errors	ENST00000283195	ensembl	human	known	69_37n	missense	30	14.29	5	SNP	0.989	G
RARS	5917	genome.wustl.edu	37	5	167944845	167944845	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr5:167944845G>A	ENST00000231572.3	+	14	1705	c.1651G>A	c.(1651-1653)Gat>Aat	p.D551N	RARS_ENST00000538719.1_Missense_Mutation_p.D345N	NM_002887.3	NP_002878.2	P54136	SYRC_HUMAN	arginyl-tRNA synthetase	551					arginyl-tRNA aminoacylation (GO:0006420)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	arginine binding (GO:0034618)|arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)|tRNA binding (GO:0000049)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|stomach(1)	22	Renal(175;0.000159)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0208)|all_neural(177;0.0227)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0693)|Epithelial(171;0.131)|OV - Ovarian serous cystadenocarcinoma(192;0.156)		GGCCAATATTGATGAAGAAAT	0.408																																						dbGAP											0													72.0	75.0	74.0					5																	167944845		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC000528	CCDS4367.1	5q35.1	2011-07-01			ENSG00000113643	ENSG00000113643	6.1.1.19	"""Aminoacyl tRNA synthetases / Class I"""	9870	protein-coding gene	gene with protein product	"""arginine tRNA ligase 1, cytoplasmic"""	107820				7590355	Standard	NM_002887		Approved	DALRD1	uc003lzx.3	P54136	OTTHUMG00000130411	ENST00000231572.3:c.1651G>A	5.37:g.167944845G>A	ENSP00000231572:p.Asp551Asn		B2RBS9|Q53GY4|Q9BWA1	Missense_Mutation	SNP	pfam_Arg-tRNA-synth_Ia_core,pfam_DALR_anticod-bd,pfam_Arg-tRNA-synth_N,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Arg-tRNA-synth_N,smart_DALR_anticod-bd,prints_Arg-tRNA-synth_Ia_core,tigrfam_Arg-tRNA-synth_Ia	p.D551N	ENST00000231572.3	37	c.1651	CCDS4367.1	5	.	.	.	.	.	.	.	.	.	.	G	10.91	1.484893	0.26598	.	.	ENSG00000113643	ENST00000231572;ENST00000538719	T;T	0.76448	-1.02;-1.02	5.59	3.82	0.43975	Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);DALR anticodon binding (2);	0.259110	0.43747	N	0.000528	T	0.69233	0.3088	L	0.46885	1.475	0.36102	D	0.844224	B	0.02656	0.0	B	0.15052	0.012	T	0.67031	-0.5773	10	0.39692	T	0.17	-15.0651	9.5091	0.39065	0.215:0.0:0.785:0.0	.	551	P54136	SYRC_HUMAN	N	551;345	ENSP00000231572:D551N;ENSP00000439108:D345N	ENSP00000231572:D551N	D	+	1	0	RARS	167877423	1.000000	0.71417	0.602000	0.28890	0.411000	0.31082	4.316000	0.59178	0.724000	0.32296	-0.150000	0.13652	GAT	RARS	-	pfam_DALR_anticod-bd,superfamily_tRNAsynth_1a_anticodon-bd,smart_DALR_anticod-bd,tigrfam_Arg-tRNA-synth_Ia	ENSG00000113643		0.408	RARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RARS	HGNC	protein_coding	OTTHUMT00000252794.2	37	0.00	0	G	NM_002887		167944845	167944845	+1	no_errors	ENST00000231572	ensembl	human	known	69_37n	missense	30	21.05	8	SNP	0.987	A
RBP3	5949	genome.wustl.edu	37	10	48390700	48390700	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr10:48390700C>T	ENST00000224600.4	-	1	291	c.178G>A	c.(178-180)Gag>Aag	p.E60K		NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	60	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	CTCAGAATCTCATGGCTCTTG	0.597																																						dbGAP											0													62.0	55.0	58.0					10																	48390700		2203	4300	6503	-	-	-	SO:0001583	missense	0			M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.178G>A	10.37:g.48390700C>T	ENSP00000224600:p.Glu60Lys		Q0QD34|Q5VSR0|Q8IXN0	Missense_Mutation	SNP	pfam_Interphotoreceptor_retinol-bd,pfam_Interphotorcpt_retinol-bd_N,smart_Interphotoreceptor_retinol-bd	p.E60K	ENST00000224600.4	37	c.178	CCDS7218.1	10	.	.	.	.	.	.	.	.	.	.	C	32	5.108346	0.94292	.	.	ENSG00000107618	ENST00000224600	T	0.63913	-0.07	5.71	5.71	0.89125	.	0.045737	0.85682	D	0.000000	T	0.80465	0.4628	M	0.78456	2.415	0.80722	D	1	D	0.89917	1.0	D	0.72075	0.976	T	0.82074	-0.0637	10	0.87932	D	0	-40.8092	18.848	0.92215	0.0:1.0:0.0:0.0	.	60	P10745	RET3_HUMAN	K	60	ENSP00000224600:E60K	ENSP00000224600:E60K	E	-	1	0	RBP3	48010706	1.000000	0.71417	0.956000	0.39512	0.630000	0.37929	5.719000	0.68462	2.710000	0.92621	0.655000	0.94253	GAG	RBP3	-	NULL	ENSG00000107618		0.597	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBP3	HGNC	protein_coding	OTTHUMT00000047888.1	20	0.00	0	C	NM_002900		48390700	48390700	-1	no_errors	ENST00000224600	ensembl	human	known	69_37n	missense	21	27.59	8	SNP	1.000	T
RFPL1	5988	genome.wustl.edu	37	22	29833798	29833798	+	5'Flank	SNP	G	G	A	rs562182728		TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr22:29833798G>A	ENST00000354373.2	+	0	0				RFPL1S_ENST00000461286.3_RNA	NM_021026.2	NP_066306.2	O75677	RFPL1_HUMAN	ret finger protein-like 1								zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(1)|lung(6)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	16						ATGAATGAGAGAAATTCGTAA	0.488																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AJ010228	CCDS13857.2	22q12	2006-04-25			ENSG00000128250	ENSG00000128250		"""RING-type (C3HC4) zinc fingers"""	9977	protein-coding gene	gene with protein product		605968				10508838	Standard	NM_021026		Approved	RNF78	uc003afn.3	O75677	OTTHUMG00000150516		22.37:g.29833798G>A	Exception_encountered		Q6IC06|Q9UJ97	RNA	SNP	-	NULL	ENST00000354373.2	37	NULL	CCDS13857.2	22																																																																																			RFPL1-AS1	-	-	ENSG00000225465		0.488	RFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFPL1-AS1	HGNC	protein_coding	OTTHUMT00000318719.1	20	0.00	0	G	NM_021026		29833798	29833798	-1	no_errors	ENST00000461286	ensembl	human	known	69_37n	rna	13	27.78	5	SNP	0.000	A
RHOBTB3	22836	genome.wustl.edu	37	5	95128768	95128768	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr5:95128768G>A	ENST00000379982.3	+	12	2234	c.1726G>A	c.(1726-1728)Gaa>Aaa	p.E576K	RHOBTB3_ENST00000504179.1_Missense_Mutation_p.E207K|GLRX_ENST00000508780.1_Intron|GLRX_ENST00000507605.1_Intron	NM_014899.3	NP_055714.3	O94955	RHBT3_HUMAN	Rho-related BTB domain containing 3	576	Interaction with Rab9.				ATP catabolic process (GO:0006200)|retrograde transport, endosome to Golgi (GO:0042147)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|GTP binding (GO:0005525)|Rab GTPase binding (GO:0017137)	p.E576Q(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|skin(1)	16		all_cancers(142;2.58e-06)|all_epithelial(76;4.19e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0164)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.79e-16)		TTCAGTGGAAGAACGCAGTTT	0.368																																						dbGAP											1	Substitution - Missense(1)	breast(1)											105.0	102.0	103.0					5																	95128768		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020685	CCDS4077.1	5q15	2014-05-09			ENSG00000164292	ENSG00000164292		"""BTB/POZ domain containing"""	18757	protein-coding gene	gene with protein product		607353				11222756, 17035353	Standard	NM_014899		Approved	KIAA0878	uc003klm.3	O94955	OTTHUMG00000121171	ENST00000379982.3:c.1726G>A	5.37:g.95128768G>A	ENSP00000369318:p.Glu576Lys		A0PJA4|A8K1W9|Q8IW06	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Small_GTPase,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.E576K	ENST00000379982.3	37	c.1726	CCDS4077.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.92|17.92	3.506555|3.506555	0.64410|0.64410	.|.	.|.	ENSG00000164292|ENSG00000164292	ENST00000379982;ENST00000504179;ENST00000514198|ENST00000503737	T;T|.	0.74002|.	-0.09;-0.8|.	6.17|6.17	5.31|5.31	0.75309|0.75309	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.67832|0.67832	0.2935|0.2935	L|L	0.51422|0.51422	1.61|1.61	0.80722|0.80722	D|D	1|1	D|.	0.54601|.	0.967|.	P|.	0.47044|.	0.535|.	T|T	0.65890|0.65890	-0.6058|-0.6058	10|5	0.41790|.	T|.	0.15|.	-25.5103|-25.5103	15.5243|15.5243	0.75890|0.75890	0.0665:0.0:0.9335:0.0|0.0665:0.0:0.9335:0.0	.|.	576|.	O94955|.	RHBT3_HUMAN|.	K|K	576;207;22|78	ENSP00000369318:E576K;ENSP00000422360:E207K|.	ENSP00000369318:E576K|.	E|R	+|+	1|2	0|0	RHOBTB3|RHOBTB3	95154524|95154524	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.608000|0.608000	0.37181|0.37181	7.980000|7.980000	0.88113|0.88113	1.631000|1.631000	0.50456|0.50456	0.655000|0.655000	0.94253|0.94253	GAA|AGA	RHOBTB3	-	NULL	ENSG00000164292		0.368	RHOBTB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOBTB3	HGNC	protein_coding	OTTHUMT00000241658.1	47	0.00	0	G	NM_014899		95128768	95128768	+1	no_errors	ENST00000379982	ensembl	human	known	69_37n	missense	50	23.08	15	SNP	1.000	A
RGS14	10636	genome.wustl.edu	37	5	176793213	176793213	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr5:176793213G>A	ENST00000408923.3	+	3	291	c.103G>A	c.(103-105)Gag>Aag	p.E35K		NM_006480.4	NP_006471.2	O43566	RGS14_HUMAN	regulator of G-protein signaling 14	35					cell division (GO:0051301)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mitotic nuclear division (GO:0007067)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of synaptic plasticity (GO:0031914)|nucleocytoplasmic transport (GO:0006913)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neurogenesis (GO:0050769)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to oxidative stress (GO:0006979)|spindle organization (GO:0007051)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual learning (GO:0008542)|zygote asymmetric cell division (GO:0010070)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|microtubule (GO:0005874)|nuclear body (GO:0016604)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|spindle (GO:0005819)|spindle pole (GO:0000922)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|microtubule binding (GO:0008017)|receptor signaling complex scaffold activity (GO:0030159)|receptor signaling protein activity (GO:0005057)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(3)|upper_aerodigestive_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGGCCAGGGCGAGGGCCGCGG	0.697																																					NSCLC(47;353 1896 28036)	dbGAP											0													14.0	21.0	18.0					5																	176793213		1959	4142	6101	-	-	-	SO:0001583	missense	0			AF037195	CCDS43405.1	5q35.3	2008-02-05	2007-08-14		ENSG00000169220	ENSG00000169220		"""Regulators of G-protein signaling"""	9996	protein-coding gene	gene with protein product		602513	"""regulator of G-protein signalling 14"""				Standard	NM_006480		Approved		uc003mgf.3	O43566	OTTHUMG00000163324	ENST00000408923.3:c.103G>A	5.37:g.176793213G>A	ENSP00000386229:p.Glu35Lys		O43565|Q506M1|Q6ZWA4|Q8TD62	Missense_Mutation	SNP	pfam_Raf-like_ras-bd,pfam_Regulat_G_prot_signal,pfam_GoLoco_motif,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,smart_Raf-like_ras-bd,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_Raf-like_ras-bd,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.E35K	ENST00000408923.3	37	c.103	CCDS43405.1	5	.	.	.	.	.	.	.	.	.	.	G	10.64	1.406282	0.25378	.	.	ENSG00000169220	ENST00000408923;ENST00000336477	T	0.37915	1.17	4.27	3.32	0.38043	.	0.545159	0.19685	N	0.108407	T	0.22666	0.0547	N	0.19112	0.55	0.27358	N	0.956035	B	0.17038	0.02	B	0.09377	0.004	T	0.16482	-1.0401	10	0.72032	D	0.01	.	9.1937	0.37215	0.0:0.223:0.777:0.0	.	35	O43566	RGS14_HUMAN	K	35	ENSP00000386229:E35K	ENSP00000336864:E35K	E	+	1	0	RGS14	176725819	0.972000	0.33761	0.997000	0.53966	0.996000	0.88848	1.547000	0.36190	1.932000	0.55993	0.442000	0.29010	GAG	RGS14	-	NULL	ENSG00000169220		0.697	RGS14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS14	HGNC	protein_coding	OTTHUMT00000372676.1	19	0.00	0	G	NM_006480		176793213	176793213	+1	no_errors	ENST00000408923	ensembl	human	known	69_37n	missense	14	22.22	4	SNP	1.000	A
RHOXF2B	727940	genome.wustl.edu	37	X	119211054	119211054	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chrX:119211054G>T	ENST00000371402.2	-	2	468	c.279C>A	c.(277-279)aaC>aaA	p.N93K	RP4-755D9.1_ENST00000553843.1_RNA	NM_001099685.1	NP_001093155.1	P0C7M4	RHF2B_HUMAN	Rhox homeobox family, member 2B	93					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(2)|skin(3)|upper_aerodigestive_tract(1)	7						TGCCCTCGAGGTTTCCTTCCC	0.632																																						dbGAP											0													42.0	45.0	44.0					X																	119211054		1980	3865	5845	-	-	-	SO:0001583	missense	0				CCDS43985.1	Xq24	2011-06-20			ENSG00000203989	ENSG00000203989		"""Homeoboxes / PRD class"""	33519	protein-coding gene	gene with protein product							Standard	NM_001099685		Approved		uc004esj.4	P0C7M4	OTTHUMG00000022288	ENST00000371402.2:c.279C>A	X.37:g.119211054G>T	ENSP00000360455:p.Asn93Lys			Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.N93K	ENST00000371402.2	37	c.279	CCDS43985.1	X	.	.	.	.	.	.	.	.	.	.	g	9.847	1.192654	0.21954	.	.	ENSG00000203989	ENST00000371402	D	0.91407	-2.84	1.17	-1.31	0.09230	.	.	.	.	.	T	0.80358	0.4608	N	0.19112	0.55	0.09310	N	1	D	0.53885	0.963	B	0.44108	0.441	T	0.71527	-0.4566	9	0.41790	T	0.15	0.0533	2.4305	0.04470	0.2564:0.3208:0.4228:0.0	.	93	P0C7M4	RHF2B_HUMAN	K	93	ENSP00000360455:N93K	ENSP00000360455:N93K	N	-	3	2	RHOXF2B	119095082	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	0.003000	0.13083	-0.541000	0.06257	-0.370000	0.07254	AAC	RHOXF2B	-	NULL	ENSG00000203989		0.632	RHOXF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOXF2B	HGNC	protein_coding	OTTHUMT00000058081.2	33	0.00	0	G	NM_001099685		119211054	119211054	-1	no_errors	ENST00000371402	ensembl	human	known	69_37n	missense	28	20.00	7	SNP	0.000	T
RIC8A	60626	genome.wustl.edu	37	11	209670	209670	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr11:209670G>A	ENST00000526104.1	+	3	1740	c.396G>A	c.(394-396)caG>caA	p.Q132Q	BET1L_ENST00000486280.1_5'Flank|BET1L_ENST00000382762.3_5'Flank|BET1L_ENST00000332865.6_5'Flank|BET1L_ENST00000325147.9_5'Flank|BET1L_ENST00000529614.2_5'Flank|RIC8A_ENST00000325207.5_Silent_p.Q132Q|RIC8A_ENST00000527696.1_Silent_p.Q126Q|BET1L_ENST00000410108.1_5'Flank			Q9NPQ8	RIC8A_HUMAN	RIC8 guanine nucleotide exchange factor A	132					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|basement membrane organization (GO:0071711)|cell migration involved in gastrulation (GO:0042074)|cell-cell adhesion involved in gastrulation (GO:0070586)|in utero embryonic development (GO:0001701)|vasculature development (GO:0001944)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(1)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)	13		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.45e-27)|Epithelial(43;2.94e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.86e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		CTGTGGCACAGATGCTGGCAG	0.602																																						dbGAP											0													44.0	42.0	43.0					11																	209670		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK022870	CCDS7690.1, CCDS65982.1	11p15.5	2013-08-05	2013-08-05		ENSG00000177963	ENSG00000177963			29550	protein-coding gene	gene with protein product		609146	"""resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)"""			10985349, 11230166	Standard	XM_005253052		Approved	synembryn, synembryn-A	uc001lof.3	Q9NPQ8	OTTHUMG00000119069	ENST00000526104.1:c.396G>A	11.37:g.209670G>A			Q0P508|Q2T9J1|Q7Z352|Q96EZ1|Q96SZ2|Q9H064|Q9H5H3|Q9H9E7	Missense_Mutation	SNP	pfam_Gua_nucleotide_exch_fac_Ric8,superfamily_ARM-type_fold,prints_Synembryn	p.R14K	ENST00000526104.1	37	c.41		11	.	.	.	.	.	.	.	.	.	.	G	4.185	0.033022	0.08101	.	.	ENSG00000177963	ENST00000527728	.	.	.	4.56	3.64	0.41730	.	.	.	.	.	T	0.63046	0.2478	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61667	-0.7016	4	.	.	.	-34.1355	12.453	0.55686	0.0836:0.0:0.9164:0.0	.	.	.	.	K	14	.	.	R	+	2	0	RIC8A	199670	1.000000	0.71417	0.312000	0.25196	0.337000	0.28794	4.282000	0.58971	1.229000	0.43630	-0.258000	0.10820	AGA	RIC8A	-	pfam_Gua_nucleotide_exch_fac_Ric8,superfamily_ARM-type_fold	ENSG00000177963		0.602	RIC8A-002	KNOWN	basic|appris_candidate	protein_coding	RIC8A	HGNC	protein_coding	OTTHUMT00000384761.1	35	0.00	0	G	NM_021932		209670	209670	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000527728	ensembl	human	novel	69_37n	missense	35	14.63	6	SNP	1.000	A
RICTOR	253260	genome.wustl.edu	37	5	38949951	38949951	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr5:38949951C>T	ENST00000357387.3	-	31	4029	c.3999G>A	c.(3997-3999)ctG>ctA	p.L1333L	RICTOR_ENST00000296782.5_Silent_p.L1333L	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					GTAGTCTTTTCAGTGTAGCAT	0.393																																						dbGAP											0													163.0	155.0	157.0					5																	38949951		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.3999G>A	5.37:g.38949951C>T				Silent	SNP	superfamily_ARM-type_fold	p.L1333	ENST00000357387.3	37	c.3999	CCDS34148.1	5																																																																																			RICTOR	-	NULL	ENSG00000164327		0.393	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RICTOR	HGNC	protein_coding	OTTHUMT00000366985.1	80	0.00	0	C	NM_152756		38949951	38949951	-1	no_errors	ENST00000296782	ensembl	human	known	69_37n	silent	60	15.49	11	SNP	1.000	T
RILPL1	353116	genome.wustl.edu	37	12	123957184	123957184	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:123957184C>T	ENST00000376874.4	-	7	1348	c.1113G>A	c.(1111-1113)caG>caA	p.Q371Q	SNRNP35_ENST00000527158.2_3'UTR|RILPL1_ENST00000544468.1_Silent_p.Q44Q|RILPL1_ENST00000340724.6_Silent_p.Q251Q	NM_178314.3	NP_847884.2	Q5EBL4	RIPL1_HUMAN	Rab interacting lysosomal protein-like 1	371					epithelial cell morphogenesis (GO:0003382)|intracellular protein transport (GO:0006886)|regulation of neuron death (GO:1901214)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)				endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.00067)|all cancers(50;0.00836)|BRCA - Breast invasive adenocarcinoma(302;0.197)		GCACGTTTCTCTGTGTGTTGG	0.527																																						dbGAP											0													100.0	96.0	97.0					12																	123957184		2002	4185	6187	-	-	-	SO:0001819	synonymous_variant	0			AK097550	CCDS45006.1	12q24.31	2007-11-27			ENSG00000188026	ENSG00000188026			26814	protein-coding gene	gene with protein product		614092				14668488	Standard	NM_178314		Approved	FLJ39378	uc001ufe.2	Q5EBL4	OTTHUMG00000168686	ENST00000376874.4:c.1113G>A	12.37:g.123957184C>T			Q66K36|Q8N1M0	Silent	SNP	pfam_JNK/Rab-associated_protein-1_N,pfam_RILP	p.Q371	ENST00000376874.4	37	c.1113	CCDS45006.1	12																																																																																			RILPL1	-	NULL	ENSG00000188026		0.527	RILPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RILPL1	HGNC	protein_coding	OTTHUMT00000400595.1	95	0.00	0	C	NM_178314		123957184	123957184	-1	no_errors	ENST00000376874	ensembl	human	known	69_37n	silent	84	23.64	26	SNP	1.000	T
RNF167	26001	genome.wustl.edu	37	17	4847936	4847936	+	Intron	SNP	G	G	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr17:4847936G>T	ENST00000262482.6	+	9	1407				RNF167_ENST00000576229.1_Intron|RNF167_ENST00000572430.1_Intron|RNF167_ENST00000571816.1_Intron|RNF167_ENST00000575111.1_Intron	NM_015528.1	NP_056343.1	Q9H6Y7	RN167_HUMAN	ring finger protein 167						negative regulation of cell cycle (GO:0045786)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(1)	4						TGCTCATGGTGAGGCCCTCAC	0.587																																						dbGAP											0													121.0	103.0	109.0					17																	4847936		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AL050060	CCDS11060.1	17p13.3	2013-02-21			ENSG00000108523	ENSG00000108523		"""RING-type (C3HC4) zinc fingers"""	24544	protein-coding gene	gene with protein product		610431				23129617, 23353890	Standard	NM_015528		Approved	DKFZP566H073	uc002fzs.3	Q9H6Y7	OTTHUMG00000099397	ENST00000262482.6:c.751+3G>T	17.37:g.4847936G>T			D3DTK8|Q6XYE0|Q8NDC1|Q9Y3V1	Nonsense_Mutation	SNP	NULL	p.E141*	ENST00000262482.6	37	c.421	CCDS11060.1	17																																																																																			RNF167	-	NULL	ENSG00000108523		0.587	RNF167-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF167	HGNC	protein_coding	OTTHUMT00000216854.3	51	0.00	0	G	NM_015528		4847936	4847936	+1	no_start_codon	ENST00000572382	ensembl	human	putative	69_37n	nonsense	44	24.14	14	SNP	1.000	T
RNF213	57674	genome.wustl.edu	37	17	78307961	78307961	+	Silent	SNP	C	C	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr17:78307961C>A	ENST00000582970.1	+	22	4343	c.4200C>A	c.(4198-4200)ctC>ctA	p.L1400L	RNF213_ENST00000508628.2_Silent_p.L1449L|RNF213_ENST00000456466.1_Silent_p.L1400L	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	1400					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			ACCAGGAGCTCATCCAGGCCA	0.547																																						dbGAP											0													92.0	80.0	84.0					17																	78307961		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.4200C>A	17.37:g.78307961C>A			C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.L1400	ENST00000582970.1	37	c.4200	CCDS58606.1	17																																																																																			RNF213	-	NULL	ENSG00000173821		0.547	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1	41	0.00	0	C	NM_020914		78307961	78307961	+1	no_errors	ENST00000582970	ensembl	human	known	69_37n	silent	26	42.22	19	SNP	0.771	A
RNPEP	6051	genome.wustl.edu	37	1	201969071	201969071	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:201969071C>T	ENST00000295640.4	+	6	1175	c.1132C>T	c.(1132-1134)Ctg>Ttg	p.L378L	RNPEP_ENST00000367286.3_Silent_p.L339L|RNPEP_ENST00000471105.1_3'UTR|RP11-465N4.4_ENST00000415582.1_RNA|RP11-465N4.4_ENST00000419190.1_RNA	NM_020216.3	NP_064601.3	Q9H4A4	AMPB_HUMAN	arginyl aminopeptidase (aminopeptidase B)	378					leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|epoxide hydrolase activity (GO:0004301)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|large_intestine(4)|lung(6)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.005)		GGGGCGGGCTCTGCTGCGTCA	0.567											OREG0014093	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									GBM(19;39 479 7473 13131 19462)	dbGAP											0													89.0	77.0	81.0					1																	201969071		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC001064	CCDS1418.1	1q32	2008-02-05			ENSG00000176393	ENSG00000176393	3.4.11.6		10078	protein-coding gene	gene with protein product		602675				9533033, 10467730	Standard	NM_020216		Approved		uc001gxd.3	Q9H4A4	OTTHUMG00000035866	ENST00000295640.4:c.1132C>T	1.37:g.201969071C>T		2125	Q9BVM9|Q9H1D4|Q9NPT7	Silent	SNP	pfam_Peptidase_M1_N,pfam_Peptidase_M1_C,superfamily_ARM-type_fold,prints_Peptidase_M1_N	p.L378	ENST00000295640.4	37	c.1132	CCDS1418.1	1																																																																																			RNPEP	-	pfam_Peptidase_M1_N	ENSG00000176393		0.567	RNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNPEP	HGNC	protein_coding	OTTHUMT00000087345.1	44	0.00	0	C	NM_020216		201969071	201969071	+1	no_errors	ENST00000295640	ensembl	human	known	69_37n	silent	56	20.00	14	SNP	0.984	T
ROBO2	6092	genome.wustl.edu	37	3	77147253	77147253	+	Silent	SNP	G	G	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr3:77147253G>T	ENST00000461745.1	+	2	1050	c.150G>T	c.(148-150)ctG>ctT	p.L50L	ROBO2_ENST00000487694.3_Silent_p.L66L|ROBO2_ENST00000332191.8_Silent_p.L50L	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	50	Ig-like C2-type 1.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		CCACGACTCTGAACTGCAAGG	0.597																																						dbGAP											0													48.0	53.0	51.0					3																	77147253		1968	4157	6125	-	-	-	SO:0001819	synonymous_variant	0			AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.150G>T	3.37:g.77147253G>T			O43608|Q19AB4|Q19AB5	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.L50	ENST00000461745.1	37	c.150	CCDS43109.1	3																																																																																			ROBO2	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000185008		0.597	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ROBO2	HGNC	protein_coding	OTTHUMT00000352600.2	44	0.00	0	G	XM_031246		77147253	77147253	+1	no_errors	ENST00000461745	ensembl	human	known	69_37n	silent	38	11.63	5	SNP	1.000	T
RP1	6101	genome.wustl.edu	37	8	55540971	55540971	+	Missense_Mutation	SNP	C	C	G	rs56286461		TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr8:55540971C>G	ENST00000220676.1	+	4	4677	c.4529C>G	c.(4528-4530)tCt>tGt	p.S1510C		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1510					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			ATAGACATCTCTAGTAAGAAT	0.333																																					Colon(91;1014 1389 7634 14542 40420)	dbGAP											0													36.0	41.0	39.0					8																	55540971		2202	4291	6493	-	-	-	SO:0001583	missense	0			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.4529C>G	8.37:g.55540971C>G	ENSP00000220676:p.Ser1510Cys			Missense_Mutation	SNP	pfam_Doublecortin_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.S1510C	ENST00000220676.1	37	c.4529	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	C	7.289	0.610718	0.14066	.	.	ENSG00000104237	ENST00000220676	T	0.67171	-0.25	5.34	4.45	0.53987	.	0.173268	0.27951	N	0.017192	T	0.63153	0.2487	M	0.64997	1.995	0.09310	N	1	P	0.45348	0.856	B	0.43360	0.417	T	0.63409	-0.6644	10	0.87932	D	0	.	7.7953	0.29143	0.0:0.7706:0.0:0.2294	.	1510	P56715	RP1_HUMAN	C	1510	ENSP00000220676:S1510C	ENSP00000220676:S1510C	S	+	2	0	RP1	55703524	0.000000	0.05858	0.013000	0.15412	0.002000	0.02628	0.504000	0.22626	2.476000	0.83614	0.655000	0.94253	TCT	RP1	-	NULL	ENSG00000104237		0.333	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	HGNC	protein_coding	OTTHUMT00000378532.2	12	0.00	0	C	NM_006269		55540971	55540971	+1	no_errors	ENST00000220676	ensembl	human	known	69_37n	missense	16	20.00	4	SNP	0.003	G
RPS6KA2	6196	genome.wustl.edu	37	6	166952216	166952216	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr6:166952216C>T	ENST00000265678.4	-	2	379	c.156G>A	c.(154-156)gaG>gaA	p.E52E	RPS6KA2_ENST00000405189.3_5'UTR|RPS6KA2_ENST00000503859.1_Silent_p.E60E|RPS6KA2_ENST00000481261.2_5'UTR|RPS6KA2_ENST00000510118.1_Silent_p.E77E|RPS6KA2_ENST00000366863.2_5'UTR	NM_021135.4	NP_066958.2	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 2	52					axon guidance (GO:0007411)|brain renin-angiotensin system (GO:0002035)|cardiac muscle cell apoptotic process (GO:0010659)|cellular response to carbohydrate stimulus (GO:0071322)|heart contraction (GO:0060047)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression (GO:0010628)|regulation of protein processing (GO:0070613)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ribosomal protein S6 kinase activity (GO:0004711)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		GATCTGCCTTCTCAAAGCCCT	0.522																																						dbGAP											0													160.0	137.0	145.0					6																	166952216		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L07598	CCDS5294.1, CCDS34570.1	6q27	2011-04-05	2002-08-29		ENSG00000071242	ENSG00000071242			10431	protein-coding gene	gene with protein product		601685	"""ribosomal protein S6 kinase, 90kD, polypeptide 2"""			8141249	Standard	NM_001006932		Approved	RSK, RSK3, HU-2	uc003qvc.1	Q15349	OTTHUMG00000016007	ENST00000265678.4:c.156G>A	6.37:g.166952216C>T			B3KTK9|Q15419|Q59GJ3|Q5TI68|Q96J38|Q9UJN5	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Ribosomal_S6_kinase_II,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E77	ENST00000265678.4	37	c.231	CCDS5294.1	6																																																																																			RPS6KA2	-	superfamily_Kinase-like_dom,pirsf_Ribosomal_S6_kinase_II	ENSG00000071242		0.522	RPS6KA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KA2	HGNC	protein_coding	OTTHUMT00000043075.3	55	0.00	0	C	NM_021135		166952216	166952216	-1	no_errors	ENST00000510118	ensembl	human	known	69_37n	silent	63	21.25	17	SNP	1.000	T
RRS1	23212	genome.wustl.edu	37	8	67341415	67341415	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr8:67341415G>A	ENST00000320270.2	+	1	153	c.49G>A	c.(49-51)Gag>Aag	p.E17K	RP11-346I3.4_ENST00000499642.1_lincRNA	NM_015169.3	NP_055984.1	Q15050	RRS1_HUMAN	RRS1 ribosome biogenesis regulator homolog (S. cerevisiae)	17					hematopoietic progenitor cell differentiation (GO:0002244)|mitotic metaphase plate congression (GO:0007080)|ribosome biogenesis (GO:0042254)	condensed nuclear chromosome (GO:0000794)|endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(2)|lung(2)	4		Lung NSC(129;0.197)	Epithelial(68;0.0391)|all cancers(69;0.0898)|BRCA - Breast invasive adenocarcinoma(89;0.111)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			AGAGCAGGACGAGGCAGAGAA	0.632											OREG0018806	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													67.0	56.0	60.0					8																	67341415		2202	4300	6502	-	-	-	SO:0001583	missense	0			BC001811	CCDS6189.1	8q13.1	2013-10-22			ENSG00000179041	ENSG00000179041			17083	protein-coding gene	gene with protein product						7788527, 10688653	Standard	NM_015169		Approved	KIAA0112	uc003xwa.3	Q15050	OTTHUMG00000164765	ENST00000320270.2:c.49G>A	8.37:g.67341415G>A	ENSP00000322396:p.Glu17Lys	1098	Q9BUX8	Missense_Mutation	SNP	pfam_Ribosom_reg	p.E17K	ENST00000320270.2	37	c.49	CCDS6189.1	8	.	.	.	.	.	.	.	.	.	.	G	26.4	4.732651	0.89482	.	.	ENSG00000179041	ENST00000320270	T	0.23348	1.91	6.16	6.16	0.99307	.	0.047463	0.85682	D	0.000000	T	0.23611	0.0571	L	0.31476	0.935	0.80722	D	1	D	0.60160	0.987	B	0.41510	0.359	T	0.00731	-1.1590	10	0.46703	T	0.11	-26.8519	19.4379	0.94804	0.0:0.0:1.0:0.0	.	17	Q15050	RRS1_HUMAN	K	17	ENSP00000322396:E17K	ENSP00000322396:E17K	E	+	1	0	RRS1	67503969	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	9.021000	0.93673	2.937000	0.99478	0.650000	0.86243	GAG	RRS1	-	NULL	ENSG00000179041		0.632	RRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRS1	HGNC	protein_coding	OTTHUMT00000380126.1	26	0.00	0	G	NM_015169		67341415	67341415	+1	no_errors	ENST00000320270	ensembl	human	known	69_37n	missense	17	19.05	4	SNP	1.000	A
RSRC2	65117	genome.wustl.edu	37	12	123001887	123001887	+	Missense_Mutation	SNP	C	C	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:123001887C>A	ENST00000331738.7	-	5	634	c.489G>T	c.(487-489)aaG>aaT	p.K163N	RSRC2_ENST00000354654.2_Missense_Mutation_p.K115N	NM_023012.5	NP_075388.2	Q7L4I2	RSRC2_HUMAN	arginine/serine-rich coiled-coil 2	163	Ser-rich.						poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|urinary_tract(2)	24	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.14e-05)|Epithelial(86;0.000183)|BRCA - Breast invasive adenocarcinoma(302;0.201)		ATCTCGATTTCTTCCTCTCTC	0.502																																						dbGAP											0													207.0	170.0	182.0					12																	123001887		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF161432	CCDS31920.1	12q24.31	2007-02-13			ENSG00000111011	ENSG00000111011			30559	protein-coding gene	gene with protein product						17203224	Standard	NM_023012		Approved	FLJ11021	uc001ucr.3	Q7L4I2	OTTHUMG00000167572	ENST00000331738.7:c.489G>T	12.37:g.123001887C>A	ENSP00000330188:p.Lys163Asn		Q6N040|Q6NW16|Q9H864	Missense_Mutation	SNP	NULL	p.K163N	ENST00000331738.7	37	c.489	CCDS31920.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.09|13.09	2.133280|2.133280	0.37630|0.37630	.|.	.|.	ENSG00000111011|ENSG00000111011	ENST00000331738;ENST00000354654;ENST00000418773;ENST00000344591|ENST00000526560	T;T;T|T	0.22945|0.56941	1.93;1.93;1.93|0.43	5.28|5.28	4.38|4.38	0.52667|0.52667	.|.	0.190495|.	0.37304|.	N|.	0.002143|.	T|T	0.60051|0.60051	0.2239|0.2239	M|M	0.66939|0.66939	2.045|2.045	0.27329|0.27329	N|N	0.956836|0.956836	P;P;P;P|.	0.42039|.	0.769;0.769;0.769;0.769|.	P;P;P;P|.	0.49332|.	0.607;0.607;0.607;0.607|.	T|T	0.56926|0.56926	-0.7898|-0.7898	10|7	0.32370|0.87932	T|D	0.25|0	.|.	10.0172|10.0172	0.42022|0.42022	0.0:0.9065:0.0:0.0935|0.0:0.9065:0.0:0.0935	.|.	163;115;163;104|.	F5GXM2;Q7L4I2-2;Q7L4I2;E1B6W4|.	.;.;RSRC2_HUMAN;.|.	N|I	163;115;163;104|57	ENSP00000330188:K163N;ENSP00000346678:K115N;ENSP00000343315:K104N|ENSP00000446470:R57I	ENSP00000330188:K163N|ENSP00000446470:R57I	K|R	-|-	3|2	2|0	RSRC2|RSRC2	121567840|121567840	0.977000|0.977000	0.34250|0.34250	1.000000|1.000000	0.80357|0.80357	0.558000|0.558000	0.35554|0.35554	0.472000|0.472000	0.22116|0.22116	1.364000|1.364000	0.46038|0.46038	0.655000|0.655000	0.94253|0.94253	AAG|AGA	RSRC2	-	NULL	ENSG00000111011		0.502	RSRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSRC2	HGNC	protein_coding	OTTHUMT00000395096.3	118	0.00	0	C	NM_023012		123001887	123001887	-1	no_errors	ENST00000331738	ensembl	human	known	69_37n	missense	93	19.13	22	SNP	1.000	A
RUFY4	285180	genome.wustl.edu	37	2	218935485	218935485	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:218935485C>G	ENST00000344321.7	+	4	574	c.56C>G	c.(55-57)tCt>tGt	p.S19C	RUFY4_ENST00000374155.3_Missense_Mutation_p.S19C|RUFY4_ENST00000441828.2_Missense_Mutation_p.S19C	NM_198483.3	NP_940885.2	Q6ZNE9	RUFY4_HUMAN	RUN and FYVE domain containing 4	19							metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(1)	10		Renal(207;0.0915)		Epithelial(149;4.11e-06)|all cancers(144;0.000519)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		GCTGCCGTCTCTGCCATCCTC	0.642																																						dbGAP											0													32.0	42.0	39.0					2																	218935485		692	1591	2283	-	-	-	SO:0001583	missense	0			AK128393		2q35	2007-01-29			ENSG00000188282	ENSG00000188282		"""Zinc fingers, FYVE domain containing"""	24804	protein-coding gene	gene with protein product							Standard	NM_198483		Approved	FLJ46536	uc010fvl.2	Q6ZNE9	OTTHUMG00000155235	ENST00000344321.7:c.56C>G	2.37:g.218935485C>G	ENSP00000345900:p.Ser19Cys		Q6ZR96	Missense_Mutation	SNP	pfam_Run,superfamily_Znf_FYVE_PHD,smart_Run,pfscan_Run	p.S19C	ENST00000344321.7	37	c.56		2	.	.	.	.	.	.	.	.	.	.	C	16.47	3.131091	0.56828	.	.	ENSG00000188282	ENST00000344321;ENST00000441828;ENST00000374155	T;T;T	0.12361	2.69;2.69;2.69	4.21	2.32	0.28847	.	0.255793	0.20509	N	0.090928	T	0.21921	0.0528	L	0.58101	1.795	0.21762	N	0.999556	.	.	.	.	.	.	T	0.05599	-1.0875	8	0.87932	D	0	-2.2882	11.6323	0.51183	0.0:0.6545:0.3455:0.0	.	.	.	.	C	19	ENSP00000345900:S19C;ENSP00000388839:S19C;ENSP00000363270:S19C	ENSP00000345900:S19C	S	+	2	0	RUFY4	218643730	0.009000	0.17119	0.921000	0.36526	0.973000	0.67179	1.062000	0.30555	0.486000	0.27676	0.563000	0.77884	TCT	RUFY4	-	NULL	ENSG00000188282		0.642	RUFY4-201	KNOWN	basic|appris_principal	protein_coding	RUFY4	HGNC	protein_coding		32	0.00	0	C	NM_198483		218935485	218935485	+1	no_errors	ENST00000374155	ensembl	human	known	69_37n	missense	21	32.26	10	SNP	0.669	G
RUNX1	861	genome.wustl.edu	37	21	36171619	36171619	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr21:36171619C>T	ENST00000344691.4	-	5	2442	c.865G>A	c.(865-867)Gaa>Aaa	p.E289K	RUNX1_ENST00000325074.5_Missense_Mutation_p.E304K|RUNX1_ENST00000399240.1_Missense_Mutation_p.E225K|RUNX1_ENST00000300305.3_Missense_Mutation_p.E316K|RUNX1_ENST00000437180.1_Missense_Mutation_p.E316K	NM_001001890.2	NP_001001890.1	Q01196	RUNX1_HUMAN	runt-related transcription factor 1	289	Pro/Ser/Thr-rich.				behavioral response to pain (GO:0048266)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system development (GO:0007417)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|hair follicle morphogenesis (GO:0031069)|hematopoietic stem cell proliferation (GO:0071425)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|myeloid cell differentiation (GO:0030099)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of granulocyte differentiation (GO:0030853)|peripheral nervous system neuron development (GO:0048935)|positive regulation of angiogenesis (GO:0045766)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of progesterone secretion (GO:2000872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hair follicle cell proliferation (GO:0071336)|regulation of signal transduction (GO:0009966)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(5)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(428)|large_intestine(3)|lung(6)|oesophagus(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	452						CTGGAAAGTTCTGCAGAGAGG	0.532			T	"""RPL22, MDS1, EVI1, CBFA2T3, CBFA2T1, ETV6, LAF4"""	"""AML, preB- ALL, T-ALL"""																																	dbGAP		Dom	yes		21	21q22.3	861	runt-related transcription factor 1  (AML1)		L	0													157.0	144.0	148.0					21																	36171619		2203	4300	6503	-	-	-	SO:0001583	missense	0			X79549	CCDS13639.1, CCDS42922.1, CCDS46646.1	21q22.3	2014-09-17	2008-07-29		ENSG00000159216	ENSG00000159216			10471	protein-coding gene	gene with protein product	"""aml1 oncogene"""	151385	"""acute myeloid leukemia 1"""	AML1, CBFA2		1427868, 7835892	Standard	NM_001001890		Approved	PEBP2A2, AMLCR1	uc010gmv.3	Q01196	OTTHUMG00000086299	ENST00000344691.4:c.865G>A	21.37:g.36171619C>T	ENSP00000340690:p.Glu289Lys		A8MV94|B2RMS4|D3DSG1|O60472|O60473|O76047|O76089|Q13081|Q13755|Q13756|Q13757|Q13758|Q13759|Q15341|Q15343|Q16122|Q16284|Q16285|Q16286|Q16346|Q16347|Q92479	Missense_Mutation	SNP	pfam_AML1/Runt_N,pfam_RunxI,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,pfscan_AML1/Runt_N,prints_AML1_Runt	p.E316K	ENST00000344691.4	37	c.946	CCDS42922.1	21	.	.	.	.	.	.	.	.	.	.	C	20.8	4.056977	0.76074	.	.	ENSG00000159216	ENST00000344691;ENST00000300305;ENST00000437180;ENST00000325074;ENST00000399240;ENST00000431176;ENST00000399245	T;T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03;-0.03	5.78	5.78	0.91487	.	0.052181	0.85682	D	0.000000	T	0.62563	0.2438	L	0.58101	1.795	0.80722	D	1	B;P;P;B;P	0.49783	0.435;0.787;0.787;0.373;0.928	B;B;B;B;B	0.42030	0.081;0.298;0.298;0.158;0.373	T	0.63328	-0.6662	10	0.37606	T	0.19	-14.5601	19.6065	0.95583	0.0:1.0:0.0:0.0	.	292;184;316;304;289	C9JK12;Q01196-11;Q01196-8;Q01196-10;Q01196	.;.;.;.;RUNX1_HUMAN	K	289;316;316;304;225;50;292	ENSP00000340690:E289K;ENSP00000300305:E316K;ENSP00000409227:E316K;ENSP00000319459:E304K;ENSP00000382184:E225K	ENSP00000300305:E316K	E	-	1	0	RUNX1	35093489	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	6.581000	0.74045	2.731000	0.93534	0.650000	0.86243	GAA	RUNX1	-	pirsf_TF_Runt-rel_RUNX	ENSG00000159216		0.532	RUNX1-001	KNOWN	basic|CCDS	protein_coding	RUNX1	HGNC	protein_coding	OTTHUMT00000194230.1	83	0.00	0	C			36171619	36171619	-1	no_errors	ENST00000300305	ensembl	human	known	69_37n	missense	43	28.33	17	SNP	1.000	T
SBNO2	22904	genome.wustl.edu	37	19	1119543	1119543	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr19:1119543C>G	ENST00000361757.3	-	13	1582	c.1345G>C	c.(1345-1347)Gag>Cag	p.E449Q	SBNO2_ENST00000587024.1_Missense_Mutation_p.E449Q|SBNO2_ENST00000438103.2_Missense_Mutation_p.E392Q	NM_014963.2	NP_055778.2	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 (Drosophila)	449					bone mineralization (GO:0030282)|bone trabecula morphogenesis (GO:0061430)|macrophage activation involved in immune response (GO:0002281)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoclast fusion (GO:0072675)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of inflammatory response (GO:0050727)|transcription, DNA-templated (GO:0006351)					NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGAACTCCTCAAAGTTCCGG	0.647																																						dbGAP											0													30.0	33.0	32.0					19																	1119543		1951	4137	6088	-	-	-	SO:0001583	missense	0			AK074102	CCDS45894.1, CCDS45895.1	19p13.3	2008-02-05	2006-10-06	2006-10-06		ENSG00000064932			29158	protein-coding gene	gene with protein product		615729	"""KIAA0963"""	KIAA0963		10231032	Standard	NM_014963		Approved	FLJ00173, Stno, Sno	uc002lrk.4	Q9Y2G9		ENST00000361757.3:c.1345G>C	19.37:g.1119543C>G	ENSP00000354733:p.Glu449Gln		A8K8P2|B3KWJ1|O75257|Q3KQX0|Q8TEM0	Missense_Mutation	SNP	NULL	p.E449Q	ENST00000361757.3	37	c.1345	CCDS45894.1	19	.	.	.	.	.	.	.	.	.	.	C	12.51	1.959269	0.34565	.	.	ENSG00000064932	ENST00000361757;ENST00000438103;ENST00000250872	D;D	0.94046	-3.34;-3.34	4.33	4.33	0.51752	.	0.581779	0.18439	N	0.141189	D	0.93562	0.7945	L	0.40543	1.245	0.34260	D	0.679843	D;B;D;P	0.61080	0.989;0.008;0.958;0.948	P;B;P;P	0.61722	0.893;0.044;0.816;0.72	D	0.93017	0.6437	10	0.17832	T	0.49	-18.8257	15.6124	0.76737	0.0:1.0:0.0:0.0	.	392;449;449;392	B4DL53;B4DV91;Q9Y2G9;Q9Y2G9-3	.;.;SBNO2_HUMAN;.	Q	449;392;473	ENSP00000354733:E449Q;ENSP00000400762:E392Q	ENSP00000250872:E473Q	E	-	1	0	SBNO2	1070543	1.000000	0.71417	0.937000	0.37676	0.027000	0.11550	5.478000	0.66806	2.247000	0.74100	0.558000	0.71614	GAG	SBNO2	-	NULL	ENSG00000064932		0.647	SBNO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SBNO2	HGNC	protein_coding	OTTHUMT00000458065.2	27	0.00	0	C	NM_014963		1119543	1119543	-1	no_errors	ENST00000361757	ensembl	human	known	69_37n	missense	11	31.25	5	SNP	1.000	G
RYR1	6261	genome.wustl.edu	37	19	39003071	39003071	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr19:39003071C>T	ENST00000359596.3	+	63	9420	c.9420C>T	c.(9418-9420)ctC>ctT	p.L3140L	RYR1_ENST00000355481.4_Silent_p.L3140L|RYR1_ENST00000360985.3_Silent_p.L3140L			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	3140					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TGCCGGTCCTCACCACCCTCT	0.647																																						dbGAP											0													69.0	59.0	63.0					19																	39003071		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.9420C>T	19.37:g.39003071C>T			Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.L3140	ENST00000359596.3	37	c.9420	CCDS33011.1	19																																																																																			RYR1	-	NULL	ENSG00000196218		0.647	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	17	0.00	0	C			39003071	39003071	+1	no_errors	ENST00000359596	ensembl	human	known	69_37n	silent	15	42.31	11	SNP	1.000	T
SCN5A	6331	genome.wustl.edu	37	3	38627266	38627266	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr3:38627266C>T	ENST00000333535.4	-	16	2852	c.2703G>A	c.(2701-2703)gaG>gaA	p.E901E	SCN5A_ENST00000450102.2_Silent_p.E901E|SCN5A_ENST00000449557.2_Silent_p.E901E|SCN5A_ENST00000451551.2_Silent_p.E901E|SCN5A_ENST00000423572.2_Silent_p.E901E|SCN5A_ENST00000414099.2_Silent_p.E901E|SCN5A_ENST00000455624.2_Silent_p.E901E|SCN5A_ENST00000443581.1_Silent_p.E901E|SCN5A_ENST00000413689.1_Silent_p.E901E|SCN5A_ENST00000425664.1_Silent_p.E901E			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	901					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	CCCACATGGTCTCGATCCACT	0.547																																						dbGAP											0													126.0	125.0	125.0					3																	38627266		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.2703G>A	3.37:g.38627266C>T			A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Silent	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,prints_Na_channel_a5su,prints_Na_channel_asu	p.E901	ENST00000333535.4	37	c.2703	CCDS46796.1	3																																																																																			SCN5A	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel	ENSG00000183873		0.547	SCN5A-014	KNOWN	basic|CCDS	protein_coding	SCN5A	HGNC	protein_coding	OTTHUMT00000377958.1	73	0.00	0	C	NM_198056		38627266	38627266	-1	no_errors	ENST00000333535	ensembl	human	known	69_37n	silent	48	26.87	18	SNP	1.000	T
SENP1	29843	genome.wustl.edu	37	12	48439129	48439129	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:48439129C>G	ENST00000004980.5	-	18	2389	c.1911G>C	c.(1909-1911)gaG>gaC	p.E637D	SENP1_ENST00000551330.1_Missense_Mutation_p.E637D|SENP1_ENST00000339976.6_3'UTR|SENP1_ENST00000549518.1_Missense_Mutation_p.E637D|SENP1_ENST00000448372.1_Missense_Mutation_p.E636D|SENP1_ENST00000549595.1_Missense_Mutation_p.E636D			Q9P0U3	SENP1_HUMAN	SUMO1/sentrin specific peptidase 1	637					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic signaling pathway (GO:0097190)|cellular protein metabolic process (GO:0044267)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-translational protein modification (GO:0043687)|protein desumoylation (GO:0016926)|protein sumoylation (GO:0016925)|proteolysis (GO:0006508)|regulation of definitive erythrocyte differentiation (GO:0010724)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|SUMO-specific protease activity (GO:0016929)			large_intestine(3)|lung(1)|pancreas(2)|stomach(1)	7		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)				GGTGGAGGATCTCCCAGACCA	0.493																																						dbGAP											0													115.0	117.0	116.0					12																	48439129		1969	4158	6127	-	-	-	SO:0001583	missense	0			AF149770	CCDS44868.1, CCDS44868.2	12q13.1	2008-02-05	2005-08-17			ENSG00000079387			17927	protein-coding gene	gene with protein product		612157	"""SUMO1/sentrin specific protease 1"""			10652325, 14563852	Standard	NM_001267595		Approved		uc009zkx.4	Q9P0U3	OTTHUMG00000169896	ENST00000004980.5:c.1911G>C	12.37:g.48439129C>G	ENSP00000004980:p.Glu637Asp		A8K7P5|Q86XC8	Missense_Mutation	SNP	pfam_Peptidase_C48,pfscan_Peptidase_C48	p.E637D	ENST00000004980.5	37	c.1911	CCDS44868.2	12	.	.	.	.	.	.	.	.	.	.	C	18.48	3.633210	0.67015	.	.	ENSG00000079387	ENST00000004980;ENST00000448372;ENST00000551330;ENST00000549595;ENST00000549518	T;T;T;T;T	0.47528	0.84;1.45;0.84;1.45;0.84	5.74	2.8	0.32819	.	0.000000	0.85682	D	0.000000	T	0.67655	0.2916	M	0.84219	2.685	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.997	T	0.68307	-0.5443	10	0.87932	D	0	-13.424	10.1459	0.42762	0.0:0.708:0.0:0.292	.	637;636	Q9P0U3;Q9P0U3-2	SENP1_HUMAN;.	D	637;636;637;636;637	ENSP00000004980:E637D;ENSP00000394791:E636D;ENSP00000446681:E637D;ENSP00000450076:E636D;ENSP00000447328:E637D	ENSP00000004980:E637D	E	-	3	2	SENP1	46725396	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	0.765000	0.26546	0.288000	0.22398	0.655000	0.94253	GAG	SENP1	-	NULL	ENSG00000079387		0.493	SENP1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SENP1	HGNC	protein_coding	OTTHUMT00000406471.1	71	0.00	0	C	NM_014554		48439129	48439129	-1	no_errors	ENST00000004980	ensembl	human	known	69_37n	missense	53	31.17	24	SNP	1.000	G
SETD7	80854	genome.wustl.edu	37	4	140432838	140432838	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr4:140432838G>A	ENST00000274031.3	-	8	1716	c.1080C>T	c.(1078-1080)ttC>ttT	p.F360F	SETD7_ENST00000506866.2_Intron	NM_030648.2	NP_085151.1	Q8WTS6	SETD7_HUMAN	SET domain containing (lysine methyltransferase) 7	360					chromatin modification (GO:0016568)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	8	all_hematologic(180;0.156)					GGGTGGCCTGGAAGGCCTTCA	0.557																																						dbGAP											0													62.0	66.0	64.0					4																	140432838		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB051504	CCDS3748.1	4q31.1	2011-07-01			ENSG00000145391	ENSG00000145391		"""Chromatin-modifying enzymes / K-methyltransferases"""	30412	protein-coding gene	gene with protein product		606594				11850410, 11779497	Standard	NM_030648		Approved	KIAA1717, SET7, SET7/9, Set9, KMT7	uc003ihw.3	Q8WTS6	OTTHUMG00000133385	ENST00000274031.3:c.1080C>T	4.37:g.140432838G>A			B5WWL3|Q0VAH3|Q4W5A9|Q9C0E6	Silent	SNP	pfam_MORN,pfam_SET_dom,smart_SET_dom,pirsf_Hist-Lys_N-MeTrfase_SET,pfscan_SET_dom	p.F360	ENST00000274031.3	37	c.1080	CCDS3748.1	4																																																																																			SETD7	-	pirsf_Hist-Lys_N-MeTrfase_SET	ENSG00000145391		0.557	SETD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD7	HGNC	protein_coding	OTTHUMT00000257236.1	21	0.00	0	G	NM_030648		140432838	140432838	-1	no_errors	ENST00000274031	ensembl	human	known	69_37n	silent	15	21.05	4	SNP	1.000	A
SH3GLB2	56904	genome.wustl.edu	37	9	131771580	131771580	+	Silent	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr9:131771580G>C	ENST00000372564.3	-	10	1030	c.885C>G	c.(883-885)ccC>ccG	p.P295P	SH3GLB2_ENST00000372554.4_Silent_p.P304P|SH3GLB2_ENST00000372559.1_Silent_p.P295P|SH3GLB2_ENST00000417224.1_Silent_p.P300P|SH3GLB2_ENST00000416629.1_Silent_p.P274P	NM_020145.2	NP_064530.1	Q9NR46	SHLB2_HUMAN	SH3-domain GRB2-like endophilin B2	295						cytoplasm (GO:0005737)				NS(1)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)	12						TGCTGCTCAGGGGTGGGGAGG	0.672																																						dbGAP											0													15.0	14.0	14.0					9																	131771580		2165	4248	6413	-	-	-	SO:0001819	synonymous_variant	0			AF257319	CCDS6916.1, CCDS69680.1	9q34	2008-02-05	2001-12-04		ENSG00000148341	ENSG00000148341			10834	protein-coding gene	gene with protein product		609288	"""SH3-domain, GRB2-like, endophilin B2"""			11161816	Standard	NM_020145		Approved	KIAA1848	uc004bwv.3	Q9NR46	OTTHUMG00000020769	ENST00000372564.3:c.885C>G	9.37:g.131771580G>C			A6NC47|A8MPS4|Q8WY61|Q96JH9	Silent	SNP	pfam_BAR_dom,pfam_BAR_dom-cont,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain	p.P304	ENST00000372564.3	37	c.912	CCDS6916.1	9																																																																																			SH3GLB2	-	NULL	ENSG00000148341		0.672	SH3GLB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3GLB2	HGNC	protein_coding	OTTHUMT00000054535.2	23	0.00	0	G			131771580	131771580	-1	no_errors	ENST00000372554	ensembl	human	known	69_37n	silent	10	33.33	5	SNP	0.961	C
SIK3	23387	genome.wustl.edu	37	11	116827733	116827733	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr11:116827733C>T	ENST00000292055.4	-	2	182	c.147G>A	c.(145-147)ttG>ttA	p.L49L	SIK3_ENST00000375288.1_5'UTR|SIK3_ENST00000375300.1_Silent_p.L107L|SIK3_ENST00000542607.1_Silent_p.L49L|SIK3_ENST00000446921.2_Silent_p.L107L|SIK3_ENST00000434315.2_5'UTR	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	49	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						AAATCTTCTTCAAGTTTTCTT	0.393																																						dbGAP											0													210.0	227.0	221.0					11																	116827733		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.147G>A	11.37:g.116827733C>T			A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom	p.E101K	ENST00000292055.4	37	c.301	CCDS8379.1	11	.	.	.	.	.	.	.	.	.	.	C	10.45	1.353446	0.24512	.	.	ENSG00000160584	ENST00000445177;ENST00000446921;ENST00000413553	.	.	.	6.17	0.169	0.15017	.	.	.	.	.	T	0.43919	0.1269	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.22800	-1.0206	4	.	.	.	.	3.7411	0.08530	0.0897:0.4919:0.1548:0.2635	.	.	.	.	K	101;72;10	.	.	E	-	1	0	SIK3	116332943	0.984000	0.35163	0.998000	0.56505	0.997000	0.91878	0.253000	0.18296	0.107000	0.17824	0.655000	0.94253	GAA	SIK3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000160584		0.393	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIK3	HGNC	protein_coding		100	0.00	0	C	NM_025164		116827733	116827733	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000445177	ensembl	human	novel	69_37n	missense	45	33.82	23	SNP	0.993	T
SLC15A5	729025	genome.wustl.edu	37	12	16410669	16410669	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:16410669C>T	ENST00000344941.3	-	3	719	c.720G>A	c.(718-720)atG>atA	p.M240I		NM_001170798.1	NP_001164269.1	A6NIM6	S15A5_HUMAN	solute carrier family 15, member 5	240					peptide transport (GO:0015833)|protein transport (GO:0015031)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			breast(2)|lung(1)	3						TGTAGTATATCATATGAAGAG	0.348																																						dbGAP											0													101.0	92.0	94.0					12																	16410669		692	1591	2283	-	-	-	SO:0001583	missense	0					12p12.3	2013-07-18			ENSG00000188991	ENSG00000188991		"""Solute carriers"""	33455	protein-coding gene	gene with protein product						21044875	Standard	NM_001170798		Approved		uc021qvs.1	A6NIM6	OTTHUMG00000168793	ENST00000344941.3:c.720G>A	12.37:g.16410669C>T	ENSP00000340402:p.Met240Ile			Missense_Mutation	SNP	pfam_Oligopeptide_transporter,superfamily_MFS_dom_general_subst_transpt	p.M240I	ENST00000344941.3	37	c.720		12	.	.	.	.	.	.	.	.	.	.	C	12.62	1.991512	0.35131	.	.	ENSG00000188991	ENST00000344941	T	0.79940	-1.32	5.06	5.06	0.68205	.	0.044635	0.85682	D	0.000000	D	0.82426	0.5034	L	0.60455	1.87	0.42529	D	0.99303	.	.	.	.	.	.	T	0.77501	-0.2564	8	0.12430	T	0.62	.	16.3807	0.83460	0.0:1.0:0.0:0.0	.	.	.	.	I	240	ENSP00000340402:M240I	ENSP00000340402:M240I	M	-	3	0	SLC15A5	16301936	1.000000	0.71417	0.951000	0.38953	0.156000	0.22039	4.414000	0.59802	2.637000	0.89404	0.591000	0.81541	ATG	SLC15A5	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000188991		0.348	SLC15A5-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	SLC15A5	HGNC	protein_coding	OTTHUMT00000401119.2	54	0.00	0	C	XM_001129090		16410669	16410669	-1	no_errors	ENST00000344941	ensembl	human	novel	69_37n	missense	39	22.00	11	SNP	0.998	T
SLC16A14	151473	genome.wustl.edu	37	2	230911111	230911111	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:230911111C>T	ENST00000295190.4	-	4	1189	c.731G>A	c.(730-732)gGa>gAa	p.G244E		NM_152527.4	NP_689740.2	Q7RTX9	MOT14_HUMAN	solute carrier family 16, member 14	244						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			NS(1)|cervix(1)|endometrium(7)|large_intestine(7)|lung(3)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)		TTCTGTTCTTCCCTGCTGTCC	0.587																																						dbGAP											0													107.0	112.0	110.0					2																	230911111		2203	4300	6503	-	-	-	SO:0001583	missense	0			BN000146	CCDS2473.1	2q37.1	2013-07-18	2013-07-18		ENSG00000163053	ENSG00000163053		"""Solute carriers"""	26417	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 14"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 14"""				Standard	NM_152527		Approved	FLJ30794, MCT14	uc002vqd.2	Q7RTX9	OTTHUMG00000133205	ENST00000295190.4:c.731G>A	2.37:g.230911111C>T	ENSP00000295190:p.Gly244Glu		A8KA08|Q53R92|Q96NI7	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.G244E	ENST00000295190.4	37	c.731	CCDS2473.1	2	.	.	.	.	.	.	.	.	.	.	C	0.045	-1.268341	0.01433	.	.	ENSG00000163053	ENST00000295190;ENST00000457406;ENST00000412034	T;T;T	0.07114	3.23;3.22;3.23	4.7	-2.07	0.07276	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	4.236570	0.00664	N	0.000615	T	0.05593	0.0147	N	0.17082	0.46	0.09310	N	1	B;B	0.19445	0.001;0.036	B;B	0.30943	0.02;0.122	T	0.36648	-0.9739	10	0.02654	T	1	.	6.9315	0.24444	0.0:0.4299:0.1191:0.451	.	244;244	E7EMG7;Q7RTX9	.;MOT14_HUMAN	E	244	ENSP00000295190:G244E;ENSP00000400352:G244E;ENSP00000395775:G244E	ENSP00000295190:G244E	G	-	2	0	SLC16A14	230619355	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.208000	0.09371	-0.289000	0.09038	0.561000	0.74099	GGA	SLC16A14	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000163053		0.587	SLC16A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A14	HGNC	protein_coding	OTTHUMT00000256918.2	40	0.00	0	C	NM_152527		230911111	230911111	-1	no_errors	ENST00000295190	ensembl	human	known	69_37n	missense	34	29.17	14	SNP	0.000	T
SLC25A22	79751	genome.wustl.edu	37	11	792901	792901	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr11:792901C>T	ENST00000320230.5	-	6	862	c.381G>A	c.(379-381)ctG>ctA	p.L127L	CEND1_ENST00000330106.4_5'Flank|SLC25A22_ENST00000531214.1_Silent_p.L127L|CEND1_ENST00000524587.1_5'Flank	NM_001191061.1|NM_024698.5	NP_001177990.1|NP_078974.1	Q9H936	GHC1_HUMAN	solute carrier family 25 (mitochondrial carrier: glutamate), member 22	127					L-glutamate transport (GO:0015813)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			endometrium(1)|kidney(1)|lung(2)|urinary_tract(1)	5		all_cancers(49;4.75e-06)|all_epithelial(84;0.00204)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;6.27e-26)|Epithelial(43;4.84e-25)|OV - Ovarian serous cystadenocarcinoma(40;2.72e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCTGGATCTTCAGCATCTCCA	0.667																																					Colon(93;848 1468 3270 23355 49636)	dbGAP											0													43.0	36.0	39.0					11																	792901		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AJ428202	CCDS7715.1	11p15.5	2013-05-22			ENSG00000177542	ENSG00000177542		"""Solute carriers"""	19954	protein-coding gene	gene with protein product		609302				11897791	Standard	NM_024698		Approved	GC1, FLJ13044, NET44, EIEE3	uc001lrj.3	Q9H936	OTTHUMG00000133310	ENST00000320230.5:c.381G>A	11.37:g.792901C>T			A8K366|C9J1H6|E9PJD3|E9PKB2|E9PL68|E9PN26|E9PNQ3|E9PP01|E9PR97|Q8TBU8	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.L127	ENST00000320230.5	37	c.381	CCDS7715.1	11																																																																																			SLC25A22	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000177542		0.667	SLC25A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A22	HGNC	protein_coding	OTTHUMT00000257107.2	26	0.00	0	C			792901	792901	-1	no_errors	ENST00000320230	ensembl	human	known	69_37n	silent	23	20.69	6	SNP	0.997	T
SLC35A4	113829	genome.wustl.edu	37	5	139947420	139947420	+	Silent	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr5:139947420C>G	ENST00000514199.1	+	2	2352	c.666C>G	c.(664-666)ctC>ctG	p.L222L	SLC35A4_ENST00000323146.3_Silent_p.L222L|APBB3_ENST00000507279.1_Intron			Q96G79	S35A4_HUMAN	solute carrier family 35, member A4	222	Leu-rich.					Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	sugar:proton symporter activity (GO:0005351)			endometrium(4)|kidney(2)|large_intestine(3)|lung(4)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCAGAACCTCTTCCTCTACA	0.572																																						dbGAP											0													79.0	83.0	82.0					5																	139947420		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ420598	CCDS4231.1	5q31.3	2013-05-22			ENSG00000176087	ENSG00000176087		"""Solute carriers"""	20753	protein-coding gene	gene with protein product							Standard	NM_080670		Approved		uc003lgg.1	Q96G79	OTTHUMG00000129495	ENST00000514199.1:c.666C>G	5.37:g.139947420C>G			A8K013	Silent	SNP	pfam_Nuc_sug_transpt,pfam_DMT,pirsf_UDP/CMP-sugar_transptr	p.L222	ENST00000514199.1	37	c.666	CCDS4231.1	5	.	.	.	.	.	.	.	.	.	.	C	5.968	0.362499	0.11296	.	.	ENSG00000176087	ENST00000432254	.	.	.	4.68	3.77	0.43336	.	0.079005	0.52532	D	0.000071	T	0.57799	0.2078	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54721	-0.8251	5	.	.	.	-1.0539	8.6922	0.34273	0.0:0.6854:0.2218:0.0928	.	.	.	.	V	43	.	.	L	+	1	0	SLC35A4	139927604	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.263000	0.33004	2.423000	0.82170	0.462000	0.41574	CTT	SLC35A4	-	pfam_Nuc_sug_transpt,pirsf_UDP/CMP-sugar_transptr	ENSG00000176087		0.572	SLC35A4-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC35A4	HGNC	protein_coding	OTTHUMT00000372815.1	42	0.00	0	C	NM_080670		139947420	139947420	+1	no_errors	ENST00000323146	ensembl	human	known	69_37n	silent	49	10.91	6	SNP	1.000	G
SLC35E3	55508	genome.wustl.edu	37	12	69145932	69145932	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:69145932G>A	ENST00000398004.2	+	3	906	c.634G>A	c.(634-636)Gaa>Aaa	p.E212K	SLC35E3_ENST00000538043.1_3'UTR	NM_018656.2	NP_061126.2	Q7Z769	S35E3_HUMAN	solute carrier family 35, member E3	212						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12	Breast(13;2.31e-06)|Renal(347;0.0684)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00372)			AGTGTTTGGAGAAGGAGGAAT	0.408																																						dbGAP											0													253.0	237.0	242.0					12																	69145932		1965	4159	6124	-	-	-	SO:0001583	missense	0			AF148713, AY358943	CCDS41808.1	12q15	2014-09-04			ENSG00000175782	ENSG00000175782		"""Solute carriers"""	20864	protein-coding gene	gene with protein product						12975309	Standard	XM_005269006		Approved	BLOV1	uc001suh.3	Q7Z769	OTTHUMG00000169282	ENST00000398004.2:c.634G>A	12.37:g.69145932G>A	ENSP00000381089:p.Glu212Lys		A8K0T0|Q0P5Y5|Q9P0V1	Missense_Mutation	SNP	pfam_DUF250,pfam_DMT	p.E212K	ENST00000398004.2	37	c.634	CCDS41808.1	12	.	.	.	.	.	.	.	.	.	.	G	25.9	4.689532	0.88735	.	.	ENSG00000175782	ENST00000398004;ENST00000431174	T;T	0.63096	-0.02;1.43	5.59	3.69	0.42338	Domain of unknown function DUF250 (1);	0.145791	0.64402	D	0.000008	T	0.49372	0.1553	L	0.35644	1.08	0.50813	D	0.999899	B	0.06786	0.001	B	0.10450	0.005	T	0.41466	-0.9507	9	.	.	.	-13.253	12.1057	0.53811	0.0683:0.1229:0.8088:0.0	.	212	Q7Z769	S35E3_HUMAN	K	212;22	ENSP00000381089:E212K;ENSP00000403769:E22K	.	E	+	1	0	SLC35E3	67432199	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.131000	0.50515	1.472000	0.48140	0.555000	0.69702	GAA	SLC35E3	-	pfam_DUF250,pfam_DMT	ENSG00000175782		0.408	SLC35E3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35E3	HGNC	protein_coding	OTTHUMT00000403241.1	148	0.67	1	G	NM_018656		69145932	69145932	+1	no_errors	ENST00000398004	ensembl	human	known	69_37n	missense	281	14.33	47	SNP	1.000	A
SLC35F3	148641	genome.wustl.edu	37	1	234458869	234458869	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:234458869G>C	ENST00000366617.3	+	7	1374	c.1146G>C	c.(1144-1146)ttG>ttC	p.L382F	SLC35F3_ENST00000366618.3_Missense_Mutation_p.L451F			Q8IY50	S35F3_HUMAN	solute carrier family 35, member F3	382					thiamine transport (GO:0015888)	integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|urinary_tract(1)	32	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)			ATGTCTGGTTGATCAAGCTGC	0.582											OREG0014330	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													108.0	99.0	102.0					1																	234458869		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1600.1, CCDS73050.1	1q42.3	2013-05-22			ENSG00000183780	ENSG00000183780		"""Solute carriers"""	23616	protein-coding gene	gene with protein product							Standard	XM_005273070		Approved	FLJ37712	uc001hvy.1	Q8IY50	OTTHUMG00000037929	ENST00000366617.3:c.1146G>C	1.37:g.234458869G>C	ENSP00000355576:p.Leu382Phe	2373	Q5TDD6|Q8N9C9	Missense_Mutation	SNP	pfam_DMT,pfam_DUF250,pfam_DUF914_euk	p.L451F	ENST00000366617.3	37	c.1353		1	.	.	.	.	.	.	.	.	.	.	G	14.97	2.695657	0.48202	.	.	ENSG00000183780	ENST00000366618;ENST00000366617	T;T	0.49720	0.77;0.8	5.62	2.53	0.30540	.	0.276151	0.31301	N	0.007891	T	0.38081	0.1027	L	0.50333	1.59	0.38373	D	0.944937	P;P	0.46706	0.883;0.879	B;P	0.47573	0.348;0.55	T	0.39396	-0.9616	10	0.15066	T	0.55	-17.6257	1.4655	0.02405	0.195:0.3111:0.3339:0.16	.	382;451	Q8IY50;Q8IY50-2	S35F3_HUMAN;.	F	451;382	ENSP00000355577:L451F;ENSP00000355576:L382F	ENSP00000355576:L382F	L	+	3	2	SLC35F3	232525492	0.996000	0.38824	0.998000	0.56505	0.983000	0.72400	0.336000	0.19823	0.711000	0.32018	0.491000	0.48974	TTG	SLC35F3	-	NULL	ENSG00000183780		0.582	SLC35F3-002	KNOWN	basic|appris_candidate	protein_coding	SLC35F3	HGNC	protein_coding	OTTHUMT00000128322.1	67	0.00	0	G	NM_173508		234458869	234458869	+1	no_errors	ENST00000366618	ensembl	human	known	69_37n	missense	114	12.98	17	SNP	0.999	C
SLC39A6	25800	genome.wustl.edu	37	18	33696718	33696718	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr18:33696718C>T	ENST00000590986.1	-	6	1673	c.1384G>A	c.(1384-1386)Gat>Aat	p.D462N	SLC39A6_ENST00000269187.5_Missense_Mutation_p.D462N|SLC39A6_ENST00000440549.2_Missense_Mutation_p.D187N			Q13433	S39A6_HUMAN	solute carrier family 39 (zinc transporter), member 6	462					cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)|zinc ion transmembrane import (GO:0071578)|zinc ion transmembrane transport (GO:0071577)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|lamellipodium membrane (GO:0031258)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	41						TCCACATCATCATCATTTTCA	0.313																																						dbGAP											0													157.0	139.0	144.0					18																	33696718		1852	4104	5956	-	-	-	SO:0001583	missense	0			U41060	CCDS42428.1, CCDS45854.1	18q12.2	2013-05-22				ENSG00000141424		"""Solute carriers"""	18607	protein-coding gene	gene with protein product		608731	"""solute carrier family 39 (metal ion transporter), member 6"""			12659941, 12839489	Standard	NM_012319		Approved	LIV-1	uc010dmy.3	Q13433		ENST00000590986.1:c.1384G>A	18.37:g.33696718C>T	ENSP00000465915:p.Asp462Asn		B4DR49|B4E224|Q8IXR3|Q96HP5	Missense_Mutation	SNP	pfam_ZIP	p.D462N	ENST00000590986.1	37	c.1384	CCDS42428.1	18	.	.	.	.	.	.	.	.	.	.	C	17.56	3.421257	0.62622	.	.	ENSG00000141424	ENST00000269187;ENST00000543723;ENST00000440549	T;T	0.72615	0.01;-0.67	5.22	5.22	0.72569	.	0.487586	0.23398	N	0.048606	T	0.61912	0.2385	L	0.29908	0.895	0.35693	D	0.814976	B;P	0.37330	0.032;0.59	B;B	0.39904	0.079;0.313	T	0.68413	-0.5415	10	0.32370	T	0.25	-19.6686	14.6418	0.68732	0.0:1.0:0.0:0.0	.	462;187	Q13433;Q13433-2	S39A6_HUMAN;.	N	462;187;187	ENSP00000269187:D462N;ENSP00000401139:D187N	ENSP00000269187:D462N	D	-	1	0	SLC39A6	31950716	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.762000	0.62250	2.617000	0.88574	0.655000	0.94253	GAT	SLC39A6	-	pfam_ZIP	ENSG00000141424		0.313	SLC39A6-004	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	SLC39A6	HGNC	protein_coding	OTTHUMT00000444136.1	134	0.00	0	C			33696718	33696718	-1	no_errors	ENST00000269187	ensembl	human	known	69_37n	missense	118	11.94	16	SNP	1.000	T
SLC9A7	84679	genome.wustl.edu	37	X	46521524	46521524	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chrX:46521524G>A	ENST00000328306.4	-	7	993	c.968C>T	c.(967-969)tCa>tTa	p.S323L		NM_001257291.1|NM_032591.2	NP_001244220.1|NP_115980.1	Q96T83	SL9A7_HUMAN	solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7	323					ion transport (GO:0006811)|potassium ion transmembrane transport (GO:0071805)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)	potassium:proton antiporter activity (GO:0015386)|protein homodimerization activity (GO:0042803)|sodium:proton antiporter activity (GO:0015385)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|skin(1)	21						AATGCCAACTGACTTAAAAAA	0.418																																					Pancreas(118;454 1696 1930 13865 39976)	dbGAP											0													59.0	48.0	52.0					X																	46521524		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF298591	CCDS14269.1, CCDS75967.1	Xp11.3	2013-05-22	2012-03-22		ENSG00000065923	ENSG00000065923		"""Solute carriers"""	17123	protein-coding gene	gene with protein product		300368	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 7"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 7"""			11279194	Standard	NM_001257291		Approved	NHE7	uc004dgv.2	Q96T83	OTTHUMG00000021428	ENST00000328306.4:c.968C>T	X.37:g.46521524G>A	ENSP00000330320:p.Ser323Leu		O75827|Q5JXP9	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_6,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.S323L	ENST00000328306.4	37	c.968	CCDS14269.1	X	.	.	.	.	.	.	.	.	.	.	G	34	5.309218	0.95629	.	.	ENSG00000065923	ENST00000328306	T	0.12039	2.72	5.02	5.02	0.67125	Cation/H+ exchanger (1);	0.000000	0.85682	D	0.000000	T	0.18509	0.0444	N	0.24115	0.695	0.80722	D	1	P;P	0.38148	0.62;0.553	P;B	0.47705	0.555;0.259	T	0.04607	-1.0939	10	0.56958	D	0.05	.	17.8283	0.88673	0.0:0.0:1.0:0.0	.	94;323	B3KPP8;Q96T83	.;SL9A7_HUMAN	L	323	ENSP00000330320:S323L	ENSP00000330320:S323L	S	-	2	0	SLC9A7	46406468	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.303000	0.96183	2.229000	0.72834	0.600000	0.82982	TCA	SLC9A7	-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger	ENSG00000065923		0.418	SLC9A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A7	HGNC	protein_coding	OTTHUMT00000056370.1	44	0.00	0	G	NM_032591		46521524	46521524	-1	no_errors	ENST00000328306	ensembl	human	known	69_37n	missense	31	27.91	12	SNP	1.000	A
SLC9A8	23315	genome.wustl.edu	37	20	48467329	48467329	+	Intron	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr20:48467329G>C	ENST00000361573.2	+	7	576				SLC9A8_ENST00000539601.1_Intron|SLC9A8_ENST00000541138.1_Intron|SLC9A8_ENST00000417961.1_Missense_Mutation_p.V189L			Q9Y2E8	SL9A8_HUMAN	solute carrier family 9, subfamily A (NHE8, cation proton antiporter 8), member 8						ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	potassium:proton antiporter activity (GO:0015386)|sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)			CTGTGTGTTTGTGTGTTTTAT	0.363																																						dbGAP											0													96.0	88.0	91.0					20																	48467329		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB023156	CCDS13421.1, CCDS58774.1	20q13.13	2013-05-22	2012-03-22		ENSG00000197818	ENSG00000197818		"""Solute carriers"""	20728	protein-coding gene	gene with protein product		612730	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 8"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 8"""			12409279	Standard	NM_001260491		Approved	KIAA0939, NHE8	uc002xuv.2	Q9Y2E8	OTTHUMG00000032710	ENST00000361573.2:c.535-18G>C	20.37:g.48467329G>C			B4DTQ8|Q2M1U9|Q68CZ8|Q9BX15|Q9Y507	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.V189L	ENST00000361573.2	37	c.565	CCDS13421.1	20	.	.	.	.	.	.	.	.	.	.	G	4.614	0.114089	0.08831	.	.	ENSG00000197818	ENST00000417961	T	0.63096	-0.02	5.38	3.25	0.37280	.	.	.	.	.	T	0.44329	0.1288	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.18967	-1.0320	6	0.11182	T	0.66	.	4.4519	0.11624	0.0836:0.1309:0.5681:0.2175	.	.	.	.	L	189	ENSP00000416418:V189L	ENSP00000416418:V189L	V	+	1	0	SLC9A8	47900736	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.550000	0.36223	1.335000	0.45486	0.650000	0.86243	GTG	SLC9A8	-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger	ENSG00000197818		0.363	SLC9A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A8	HGNC	protein_coding	OTTHUMT00000106483.3	54	0.00	0	G	XM_030524		48467329	48467329	+1	no_errors	ENST00000417961	ensembl	human	known	69_37n	missense	44	21.43	12	SNP	0.998	C
SLITRK5	26050	genome.wustl.edu	37	13	88329126	88329126	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr13:88329126G>A	ENST00000325089.6	+	2	1702	c.1483G>A	c.(1483-1485)Gag>Aag	p.E495K	SLITRK5_ENST00000400028.3_Missense_Mutation_p.E254K	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	495					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					TCTCATCCGCGAGATTCAGTC	0.532																																						dbGAP											0													76.0	79.0	78.0					13																	88329126		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.1483G>A	13.37:g.88329126G>A	ENSP00000366283:p.Glu495Lys		B3KNB8|B4DSH5|Q5VT81	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.E495K	ENST00000325089.6	37	c.1483	CCDS9465.1	13	.	.	.	.	.	.	.	.	.	.	G	19.40	3.821217	0.71028	.	.	ENSG00000165300	ENST00000325089;ENST00000400028	T;D	0.83591	0.65;-1.74	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	D	0.82921	0.5142	N	0.16037	0.36	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.70716	0.97;0.936	T	0.82352	-0.0500	9	.	.	.	-16.4296	16.2866	0.82724	0.0:0.0:1.0:0.0	.	254;495	B4DSH5;O94991	.;SLIK5_HUMAN	K	495;254	ENSP00000366283:E495K;ENSP00000442244:E254K	.	E	+	1	0	SLITRK5	87127127	1.000000	0.71417	0.979000	0.43373	0.921000	0.55340	9.864000	0.99589	2.426000	0.82243	0.561000	0.74099	GAG	SLITRK5	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000165300		0.532	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK5	HGNC	protein_coding	OTTHUMT00000045416.3	32	0.00	0	G			88329126	88329126	+1	no_errors	ENST00000325089	ensembl	human	known	69_37n	missense	18	25.00	6	SNP	1.000	A
SMARCA2	6595	genome.wustl.edu	37	9	2097429	2097429	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr9:2097429G>A	ENST00000382203.1	+	21	3245	c.3036G>A	c.(3034-3036)ttG>ttA	p.L1012L	SMARCA2_ENST00000349721.2_Silent_p.L1012L|SMARCA2_ENST00000382194.1_Silent_p.L1012L|SMARCA2_ENST00000357248.2_Silent_p.L1012L			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	1012					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		TTATGCAGTTGAGAAAAATCT	0.363																																						dbGAP											0													155.0	146.0	149.0					9																	2097429		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.3036G>A	9.37:g.2097429G>A			B1ALG3|B1ALG4|D3DRH4|D3DRH5	Silent	SNP	pfam_SNF2_N,pfam_Bromodomain,pfam_BRK_domain,pfam_HSA,pfam_Helicase_C,pfam_Gln-Leu-Gln_QLQ,superfamily_Bromodomain,superfamily_RNaseH-like_dom,smart_Gln-Leu-Gln_QLQ,smart_HAS_subgr,smart_BRK_domain,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Bromodomain,prints_Bromodomain,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Bromodomain	p.L1012	ENST00000382203.1	37	c.3036	CCDS34977.1	9																																																																																			SMARCA2	-	pfam_SNF2_N	ENSG00000080503		0.363	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	SMARCA2	HGNC	protein_coding	OTTHUMT00000051505.1	60	0.00	0	G	NM_003070		2097429	2097429	+1	no_errors	ENST00000349721	ensembl	human	known	69_37n	silent	40	27.27	15	SNP	1.000	A
SMARCA4	6597	genome.wustl.edu	37	19	11123624	11123624	+	Splice_Site	SNP	G	G	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr19:11123624G>T	ENST00000429416.3	+	17	2555		c.e17-1		RN7SL192P_ENST00000584303.1_RNA|SMARCA4_ENST00000590574.1_Splice_Site|SMARCA4_ENST00000589677.1_Splice_Site|SMARCA4_ENST00000450717.3_Splice_Site|SMARCA4_ENST00000344626.4_Splice_Site|SMARCA4_ENST00000444061.3_Splice_Site|CTC-215O4.4_ENST00000587831.1_RNA|SMARCA4_ENST00000413806.3_Splice_Site|SMARCA4_ENST00000358026.2_Splice_Site|SMARCA4_ENST00000541122.2_Splice_Site	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4						aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				TGTCCTTGCAGATCAAAGGTT	0.607			"""F, N, Mis"""		NSCLC																																	dbGAP		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	1	Unknown(1)	lung(1)											101.0	85.0	91.0					19																	11123624		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.2275-1G>T	19.37:g.11123624G>T			B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Splice_Site	SNP	-	e15-1	ENST00000429416.3	37	c.2275-1	CCDS12253.1	19	.	.	.	.	.	.	.	.	.	.	G	16.67	3.188257	0.57909	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	.	.	.	4.73	3.7	0.42460	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8932	0.52641	0.0864:0.0:0.9136:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SMARCA4	10984624	1.000000	0.71417	0.999000	0.59377	0.785000	0.44390	7.821000	0.86641	1.223000	0.43536	-0.136000	0.14681	.	SMARCA4	-	-	ENSG00000127616		0.607	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	SMARCA4	HGNC	protein_coding	OTTHUMT00000452638.2	74	0.00	0	G	NM_003072	Intron	11123624	11123624	+1	no_errors	ENST00000358026	ensembl	human	known	69_37n	splice_site	36	40.32	25	SNP	1.000	T
MZT2B	80097	genome.wustl.edu	37	2	130939134	130939134	+	5'Flank	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:130939134G>A	ENST00000281871.6	+	0	0				SMPD4_ENST00000431183.2_Missense_Mutation_p.S14F|SMPD4_ENST00000409031.1_Missense_Mutation_p.S14F|AC018804.1_ENST00000578074.1_RNA|SMPD4_ENST00000339679.7_5'UTR|MZT2B_ENST00000409255.1_5'Flank|SMPD4_ENST00000453750.1_Missense_Mutation_p.S14F|SMPD4_ENST00000473720.1_5'UTR|SMPD4_ENST00000452225.2_5'UTR|SMPD4_ENST00000443958.2_5'UTR|SMPD4_ENST00000351288.6_Missense_Mutation_p.S14F|SMPD4_ENST00000426662.2_5'UTR	NM_025029.3	NP_079305.2	Q6NZ67	MZT2B_HUMAN	mitotic spindle organizing protein 2B							centrosome (GO:0005813)|gamma-tubulin ring complex (GO:0008274)|spindle (GO:0005819)				lung(1)	1						TCGCCTCAGAGATGGAAGCCG	0.706																																						dbGAP											0													8.0	11.0	10.0					2																	130939134		1901	4080	5981	-	-	-	SO:0001631	upstream_gene_variant	0			BC066296	CCDS2157.1	2q21.1	2013-10-11	2010-07-22	2010-07-22	ENSG00000152082	ENSG00000152082			25886	protein-coding gene	gene with protein product	"""mitotic-spindle organizing protein associated with a ring of gamma-tubulin 2B"""	613450	"""family with sequence similarity 128, member B"""	FAM128B		20360068	Standard	NM_025029		Approved	FLJ14346, MOZART2B	uc002tqu.3	Q6NZ67	OTTHUMG00000131625		2.37:g.130939134G>A	Exception_encountered		Q96CG4	Missense_Mutation	SNP	NULL	p.S14F	ENST00000281871.6	37	c.41	CCDS2157.1	2	.	.	.	.	.	.	.	.	.	.	g	9.708	1.156280	0.21454	.	.	ENSG00000136699	ENST00000351288;ENST00000409031;ENST00000431183;ENST00000453750	.	.	.	3.84	-5.41	0.02648	.	1.284760	0.06456	U	0.728573	T	0.24198	0.0586	N	0.19112	0.55	0.20638	N	0.999872	B;B;B	0.18968	0.032;0.032;0.013	B;B;B	0.20577	0.022;0.022;0.03	T	0.35549	-0.9784	9	0.62326	D	0.03	.	5.5953	0.17323	0.5164:0.2838:0.1998:0.0	.	14;14;14	E7ESA2;B4DM23;B1PBA3	.;.;.	F	14	.	ENSP00000259217:S14F	S	-	2	0	SMPD4	130655604	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.386000	0.02537	-0.792000	0.04480	-0.596000	0.04108	TCT	SMPD4	-	NULL	ENSG00000136699		0.706	MZT2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMPD4	HGNC	protein_coding	OTTHUMT00000254518.1	8	0.00	0	G	NM_025029		130939134	130939134	-1	no_errors	ENST00000409031	ensembl	human	known	69_37n	missense	1	90.00	9	SNP	0.000	A
SMARCAL1	50485	genome.wustl.edu	37	2	217329355	217329355	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:217329355C>G	ENST00000357276.4	+	13	2436	c.2106C>G	c.(2104-2106)ttC>ttG	p.F702L	SMARCAL1_ENST00000358207.5_Missense_Mutation_p.F702L	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	702					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		TTCTCTTCTTCAACAGAACAG	0.393									Schimke Immuno-Osseous Dysplasia																													dbGAP											0													160.0	157.0	158.0					2																	217329355		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	SIOD	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.2106C>G	2.37:g.217329355C>G	ENSP00000349823:p.Phe702Leu		A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Missense_Mutation	SNP	pfam_HARP,pfam_SNF2_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.F702L	ENST00000357276.4	37	c.2106	CCDS2403.1	2	.	.	.	.	.	.	.	.	.	.	C	22.6	4.316324	0.81469	.	.	ENSG00000138375	ENST00000357276;ENST00000358207;ENST00000392128	D;D;T	0.91686	-2.89;-2.89;-0.8	5.3	5.3	0.74995	.	0.054414	0.85682	D	0.000000	D	0.93710	0.7990	M	0.83603	2.65	0.35238	D	0.77756	P	0.37423	0.594	P	0.45167	0.472	D	0.93974	0.7252	10	0.17369	T	0.5	-22.2131	17.6906	0.88268	0.0:1.0:0.0:0.0	.	702	Q9NZC9	SMAL1_HUMAN	L	702;702;544	ENSP00000349823:F702L;ENSP00000350940:F702L;ENSP00000375974:F544L	ENSP00000349823:F702L	F	+	3	2	SMARCAL1	217037600	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.235000	0.32671	2.765000	0.95021	0.650000	0.86243	TTC	SMARCAL1	-	NULL	ENSG00000138375		0.393	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCAL1	HGNC	protein_coding	OTTHUMT00000256671.2	79	0.00	0	C			217329355	217329355	+1	no_errors	ENST00000357276	ensembl	human	known	69_37n	missense	71	10.00	8	SNP	1.000	G
SP4	6671	genome.wustl.edu	37	7	21521552	21521552	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr7:21521552G>A	ENST00000222584.3	+	5	2136	c.1918G>A	c.(1918-1920)Gaa>Aaa	p.E640K		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	640					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						AGGCAGTAATGAACCAGGAAA	0.333																																						dbGAP											0													114.0	114.0	114.0					7																	21521552		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.1918G>A	7.37:g.21521552G>A	ENSP00000222584:p.Glu640Lys		O60402|Q32M52	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E640K	ENST00000222584.3	37	c.1918	CCDS5373.1	7	.	.	.	.	.	.	.	.	.	.	G	24.1	4.494847	0.85069	.	.	ENSG00000105866	ENST00000222584	T	0.38401	1.14	5.47	5.47	0.80525	.	0.051128	0.85682	D	0.000000	T	0.42404	0.1201	L	0.57536	1.79	0.80722	D	1	P	0.49447	0.924	B	0.43809	0.432	T	0.34129	-0.9841	10	0.44086	T	0.13	.	19.3343	0.94309	0.0:0.0:1.0:0.0	.	640	Q02446	SP4_HUMAN	K	640	ENSP00000222584:E640K	ENSP00000222584:E640K	E	+	1	0	SP4	21488077	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.573000	0.98181	2.567000	0.86603	0.591000	0.81541	GAA	SP4	-	NULL	ENSG00000105866		0.333	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SP4	HGNC	protein_coding	OTTHUMT00000211617.2	43	0.00	0	G	NM_003112		21521552	21521552	+1	no_errors	ENST00000222584	ensembl	human	known	69_37n	missense	57	16.18	11	SNP	1.000	A
SPAG9	9043	genome.wustl.edu	37	17	49133809	49133809	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr17:49133809C>G	ENST00000262013.7	-	3	667	c.459G>C	c.(457-459)aaG>aaC	p.K153N	SPAG9_ENST00000357122.4_Missense_Mutation_p.K153N|RP11-481C4.1_ENST00000509833.1_RNA|SPAG9_ENST00000505279.1_Missense_Mutation_p.K153N	NM_001130528.2	NP_001124000.1	O60271	JIP4_HUMAN	sperm associated antigen 9	153					activation of JUN kinase activity (GO:0007257)|muscle cell differentiation (GO:0042692)|negative regulation of protein homodimerization activity (GO:0090074)|positive regulation of cell migration (GO:0030335)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|striated muscle cell differentiation (GO:0051146)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				NS(1)|breast(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			TATATTCCTTCTTCAGTTCTG	0.303																																						dbGAP											0													161.0	156.0	157.0					17																	49133809		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011088	CCDS11577.1, CCDS45740.1, CCDS58577.1, CCDS58578.1	17q21.33	2013-09-23			ENSG00000008294	ENSG00000008294			14524	protein-coding gene	gene with protein product	"""sperm surface protein"", ""JNK/SAPK-associated protein"", ""JNK interacting protein"", ""sperm specific protein"", ""c-Jun NH2-terminal kinase-associated leucine zipper protein"", ""Max-binding protein"", ""JNK-associated leucine-zipper protein"", ""HLC-4 protein"", ""lung cancer oncogene 4"", ""proliferation-inducing gene 6"", ""cancer/testis antigen 89"""	605430				9480848, 11106729	Standard	NM_003971		Approved	HSS, SYD1, KIAA0516, MGC14967, MGC74461, MGC117291, JLP, PHET, HLC4, PIG6, FLJ13450, FLJ14006, FLJ26141, FLJ34602, CT89	uc002itc.3	O60271	OTTHUMG00000162316	ENST00000262013.7:c.459G>C	17.37:g.49133809C>G	ENSP00000262013:p.Lys153Asn		A6H8U5|A8MSX0|B4DHH2|O60905|Q3KQU8|Q3MKM7|Q86WC7|Q86WC8|Q8IZX7|Q96II0|Q9H811	Missense_Mutation	SNP	pfam_JNK/Rab-associated_protein-1_N,superfamily_WD40_repeat_dom	p.K153N	ENST00000262013.7	37	c.459	CCDS45740.1	17	.	.	.	.	.	.	.	.	.	.	C	16.93	3.258710	0.59321	.	.	ENSG00000008294	ENST00000262013;ENST00000505279;ENST00000357122	T;T;T	0.56103	0.48;0.48;0.48	5.95	4.98	0.66077	JNK/Rab-associated protein-1, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.71239	0.3316	M	0.81341	2.54	0.58432	D	0.999999	P;P;D	0.59357	0.858;0.954;0.985	P;P;P	0.62740	0.862;0.816;0.906	T	0.74925	-0.3498	10	0.87932	D	0	-18.3257	14.5786	0.68268	0.0:0.9304:0.0:0.0696	.	153;153;153	O60271-2;O60271;O60271-4	.;JIP4_HUMAN;.	N	153	ENSP00000262013:K153N;ENSP00000426900:K153N;ENSP00000349636:K153N	ENSP00000262013:K153N	K	-	3	2	SPAG9	46488808	1.000000	0.71417	1.000000	0.80357	0.244000	0.25665	2.536000	0.45693	2.821000	0.97095	0.650000	0.86243	AAG	SPAG9	-	pfam_JNK/Rab-associated_protein-1_N	ENSG00000008294		0.303	SPAG9-001	KNOWN	basic|CCDS	protein_coding	SPAG9	HGNC	protein_coding	OTTHUMT00000368543.2	135	0.00	0	C	NM_003971		49133809	49133809	-1	no_errors	ENST00000262013	ensembl	human	known	69_37n	missense	123	22.15	35	SNP	1.000	G
SPOCK1	6695	genome.wustl.edu	37	5	136320887	136320887	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr5:136320887G>A	ENST00000394945.1	-	9	1102	c.933C>T	c.(931-933)ctC>ctT	p.L311L	SPOCK1_ENST00000282223.7_Silent_p.L311L|SPOCK1_ENST00000509978.1_5'UTR	NM_004598.3	NP_004589.1	Q08629	TICN1_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1	311	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				cell adhesion (GO:0007155)|central nervous system neuron differentiation (GO:0021953)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron projection development (GO:0010977)|nervous system development (GO:0007399)|neurogenesis (GO:0022008)|neuron migration (GO:0001764)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|postsynaptic density (GO:0014069)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasm (GO:0016528)	calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TCTGGCAAGGGAGACCTAAAA	0.368																																						dbGAP											0													136.0	134.0	135.0					5																	136320887		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF231124	CCDS4191.1	5q31.2	2008-02-05	2005-11-04	2005-11-04	ENSG00000152377	ENSG00000152377			11251	protein-coding gene	gene with protein product		602264	"""sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican)"""	TIC1, SPOCK		9545645	Standard	NM_004598		Approved	testican-1	uc003lbp.3	Q08629	OTTHUMG00000129157	ENST00000394945.1:c.933C>T	5.37:g.136320887G>A			B3KSW3|Q59EW0|Q8N630|Q9UCL8	Silent	SNP	pfam_SPARC/Testican_Ca-bd-dom,pfam_Thyroglobulin_1,pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,superfamily_Thyroglobulin_1,smart_Prot_inh_Kazal,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1	p.L311	ENST00000394945.1	37	c.933	CCDS4191.1	5																																																																																			SPOCK1	-	superfamily_Thyroglobulin_1,pfscan_Thyroglobulin_1	ENSG00000152377		0.368	SPOCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPOCK1	HGNC	protein_coding	OTTHUMT00000251222.1	108	0.00	0	G	NM_004598		136320887	136320887	-1	no_errors	ENST00000282223	ensembl	human	known	69_37n	silent	73	29.81	31	SNP	1.000	A
SPATA24	202051	genome.wustl.edu	37	5	138738367	138738367	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr5:138738367C>T	ENST00000451821.2	-	2	139	c.133G>A	c.(133-135)Gaa>Aaa	p.E45K	SPATA24_ENST00000509959.1_Intron|SPATA24_ENST00000507779.2_Missense_Mutation_p.E45K			Q86W54	SPA24_HUMAN	spermatogenesis associated 24	45					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)										ACAAAATTTTCGTCCTGGAGA	0.552																																						dbGAP											0													159.0	147.0	150.0					5																	138738367		692	1591	2283	-	-	-	SO:0001583	missense	0			AK098740	CCDS47274.1	5q31.2	2014-02-12	2009-09-30		ENSG00000170469	ENSG00000170469			27322	protein-coding gene	gene with protein product	"""coiled-coil domain containing 161"""					16146721	Standard	NM_194296		Approved	T6441, CCDC161	uc003lel.4	Q86W54	OTTHUMG00000163388	ENST00000451821.2:c.133G>A	5.37:g.138738367C>T	ENSP00000400524:p.Glu45Lys			Missense_Mutation	SNP	NULL	p.E45K	ENST00000451821.2	37	c.133		5	.	.	.	.	.	.	.	.	.	.	C	25.3	4.626882	0.87560	.	.	ENSG00000170469	ENST00000302091;ENST00000450845;ENST00000451821;ENST00000507779	.	.	.	5.02	5.02	0.67125	.	0.000000	0.52532	D	0.000073	T	0.57330	0.2046	N	0.24115	0.695	0.34285	D	0.682568	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.83275	0.988;0.988;0.996	T	0.63143	-0.6703	9	0.30854	T	0.27	-12.9714	13.7162	0.62697	0.0:1.0:0.0:0.0	.	45;45;45	Q86W54-2;Q86W54;Q8N799	.;SPA24_HUMAN;.	K	45	.	ENSP00000302917:E45K	E	-	1	0	SPATA24	138766266	0.995000	0.38212	0.998000	0.56505	0.980000	0.70556	3.665000	0.54532	2.612000	0.88384	0.655000	0.94253	GAA	SPATA24	-	NULL	ENSG00000170469		0.552	SPATA24-003	KNOWN	basic	protein_coding	SPATA24	HGNC	protein_coding	OTTHUMT00000372986.1	94	0.00	0	C	NM_194296		138738367	138738367	-1	no_errors	ENST00000450845	ensembl	human	known	69_37n	missense	77	13.33	12	SNP	0.997	T
SRGAP3	9901	genome.wustl.edu	37	3	9034672	9034672	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr3:9034672C>T	ENST00000383836.3	-	20	2903	c.2476G>A	c.(2476-2478)Gat>Aat	p.D826N	SRGAP3_ENST00000360413.3_Missense_Mutation_p.D802N	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	826					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)		SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		GCCTTGTCATCCAGCAATGGC	0.587			T	RAF1	pilocytic astrocytoma																																	dbGAP		Dom	yes		3	3p25.3	9901	SLIT-ROBO Rho GTPase activating protein 3		M	0													81.0	69.0	73.0					3																	9034672		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.2476G>A	3.37:g.9034672C>T	ENSP00000373347:p.Asp826Asn		Q8IX13|Q8IZV8	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FCH,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_FCH,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.D826N	ENST00000383836.3	37	c.2476	CCDS2572.1	3	.	.	.	.	.	.	.	.	.	.	C	28.4	4.921015	0.92249	.	.	ENSG00000196220	ENST00000383836;ENST00000360413	T;T	0.24723	1.84;2.24	5.41	5.41	0.78517	Src homology-3 domain (1);	0.052556	0.64402	D	0.000001	T	0.27205	0.0667	L	0.50333	1.59	0.80722	D	1	P;P	0.40534	0.72;0.598	B;B	0.38020	0.263;0.135	T	0.02345	-1.1173	10	0.26408	T	0.33	.	18.7906	0.91973	0.0:1.0:0.0:0.0	.	802;826	O43295-2;O43295	.;SRGP2_HUMAN	N	826;802	ENSP00000373347:D826N;ENSP00000353587:D802N	ENSP00000353587:D802N	D	-	1	0	SRGAP3	9009672	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.642000	0.83385	2.526000	0.85167	0.591000	0.81541	GAT	SRGAP3	-	superfamily_SH3_domain	ENSG00000196220		0.587	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRGAP3	HGNC	protein_coding	OTTHUMT00000207137.3	42	0.00	0	C			9034672	9034672	-1	no_errors	ENST00000383836	ensembl	human	known	69_37n	missense	38	17.39	8	SNP	1.000	T
SSBP4	170463	genome.wustl.edu	37	19	18543526	18543526	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr19:18543526C>T	ENST00000270061.7	+	12	1061	c.767C>T	c.(766-768)tCa>tTa	p.S256L	SSBP4_ENST00000348495.6_Missense_Mutation_p.S234L|SSBP4_ENST00000599699.2_5'Flank	NM_032627.4	NP_116016.1	Q9BWG4	SSBP4_HUMAN	single stranded DNA binding protein 4	256	Pro-rich.					nucleus (GO:0005634)	single-stranded DNA binding (GO:0003697)			endometrium(2)|kidney(1)|skin(1)	4						TACTCCTCCTCATCCCCCGGC	0.647																																						dbGAP											0													38.0	39.0	39.0					19																	18543526		2203	4298	6501	-	-	-	SO:0001583	missense	0				CCDS12378.1, CCDS32960.1	19p13.1	2008-02-05				ENSG00000130511			15676	protein-coding gene	gene with protein product		607391				12079286	Standard	NM_032627		Approved		uc002niy.3	Q9BWG4		ENST00000270061.7:c.767C>T	19.37:g.18543526C>T	ENSP00000270061:p.Ser256Leu		Q9BWW5	Missense_Mutation	SNP	pfam_SSDP_ss-bd,smart_LisH_dimerisation,pfscan_LisH_dimerisation,prints_SSDP_DNA-bd	p.S256L	ENST00000270061.7	37	c.767	CCDS12378.1	19	.	.	.	.	.	.	.	.	.	.	C	18.19	3.568904	0.65765	.	.	ENSG00000130511	ENST00000270061;ENST00000348495	.	.	.	3.96	3.96	0.45880	.	0.000000	0.64402	U	0.000012	T	0.60792	0.2296	L	0.60455	1.87	0.80722	D	1	P;P	0.41978	0.767;0.767	P;P	0.47941	0.562;0.562	T	0.65092	-0.6252	9	0.59425	D	0.04	-13.5084	11.9006	0.52682	0.0:1.0:0.0:0.0	.	234;256	Q9BWW5;Q9BWG4	.;SSBP4_HUMAN	L	256;234	.	ENSP00000270061:S256L	S	+	2	0	SSBP4	18404526	0.989000	0.36119	0.848000	0.33437	0.235000	0.25334	6.005000	0.70716	1.950000	0.56595	0.511000	0.50034	TCA	SSBP4	-	pfam_SSDP_ss-bd	ENSG00000130511		0.647	SSBP4-002	KNOWN	basic|CCDS	protein_coding	SSBP4	HGNC	protein_coding	OTTHUMT00000466348.3	45	0.00	0	C	NM_032627		18543526	18543526	+1	no_errors	ENST00000270061	ensembl	human	known	69_37n	missense	19	38.71	12	SNP	0.966	T
ST5	6764	genome.wustl.edu	37	11	8752555	8752555	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr11:8752555G>C	ENST00000534127.1	-	6	667	c.282C>G	c.(280-282)ttC>ttG	p.F94L	ST5_ENST00000526757.1_Intron|ST5_ENST00000530438.1_Intron|ST5_ENST00000357665.1_Missense_Mutation_p.F94L|ST5_ENST00000313726.6_Missense_Mutation_p.F94L	NM_005418.3	NP_005409.3	P78524	ST5_HUMAN	suppression of tumorigenicity 5	94					positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(13)|liver(1)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	39				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		TGGCGGTCTTGAAGGGACAGG	0.612																																						dbGAP											0													55.0	63.0	60.0					11																	8752555		2201	4296	6497	-	-	-	SO:0001583	missense	0			U15131	CCDS7791.1, CCDS7792.1	11p15	2012-10-04				ENSG00000166444		"""DENN/MADD domain containing"""	11350	protein-coding gene	gene with protein product	"""DENN/MADD domain containing 2B"""	140750				1390339	Standard	NM_005418		Approved	HTS1, DENND2B, p126	uc001mgt.3	P78524		ENST00000534127.1:c.282C>G	11.37:g.8752555G>C	ENSP00000433528:p.Phe94Leu		B2R6X7|B3KXQ6|P78523|Q16492|Q7KYY2|Q7KZ12|Q8NE12|Q9BQQ6	Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.F94L	ENST00000534127.1	37	c.282	CCDS7791.1	11	.	.	.	.	.	.	.	.	.	.	G	0.223	-1.027093	0.02045	.	.	ENSG00000166444	ENST00000534127;ENST00000313726;ENST00000357665;ENST00000528523;ENST00000527930;ENST00000533681;ENST00000526241;ENST00000530959;ENST00000533580;ENST00000526155;ENST00000534248;ENST00000527347;ENST00000533016;ENST00000527516	T;T;T	0.03330	3.97;3.97;3.97	5.87	4.96	0.65561	.	0.921504	0.09338	N	0.815897	T	0.01320	0.0043	N	0.00308	-1.67	0.25995	N	0.98219	B	0.02656	0.0	B	0.01281	0.0	T	0.20438	-1.0275	10	0.02654	T	1	-4.2922	14.8791	0.70519	0.0685:0.0:0.9315:0.0	.	94	P78524	ST5_HUMAN	L	94;94;94;94;124;94;94;94;111;94;94;94;114;94	ENSP00000433528:F94L;ENSP00000319678:F94L;ENSP00000350294:F94L	ENSP00000319678:F94L	F	-	3	2	ST5	8709131	1.000000	0.71417	1.000000	0.80357	0.162000	0.22319	2.510000	0.45468	1.492000	0.48499	0.655000	0.94253	TTC	ST5	-	NULL	ENSG00000166444		0.612	ST5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ST5	HGNC	protein_coding	OTTHUMT00000386518.1	45	0.00	0	G	NM_005418		8752555	8752555	-1	no_errors	ENST00000313726	ensembl	human	known	69_37n	missense	26	16.13	5	SNP	1.000	C
ST8SIA4	7903	genome.wustl.edu	37	5	100238609	100238609	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr5:100238609C>T	ENST00000231461.5	-	1	361	c.51G>A	c.(49-51)ctG>ctA	p.L17L	ST8SIA4_ENST00000451528.2_Silent_p.L17L	NM_005668.4	NP_005659.1	Q92187	SIA8D_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4	17					axon guidance (GO:0007411)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)	25		all_cancers(142;1.5e-07)|all_epithelial(76;1.43e-10)|Prostate(80;0.000644)|Lung NSC(167;0.0059)|all_lung(232;0.00914)|Ovarian(225;0.024)|Colorectal(57;0.09)|Breast(839;0.203)		COAD - Colon adenocarcinoma(37;0.00402)		TATAAAAGATCAGGAGCAGAC	0.473																																						dbGAP											0													114.0	104.0	107.0					5																	100238609		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L41680	CCDS4091.1, CCDS47252.1	5q21	2013-03-01	2003-01-14	2005-02-07	ENSG00000113532	ENSG00000113532		"""Sialyltransferases"""	10871	protein-coding gene	gene with protein product	"""ST8Sia IV"""	602547	"""sialyltransferase 8 (alpha-2, 8-polysialytransferase) D"""	SIAT8D		7624364	Standard	NM_005668		Approved	PST, PST1	uc003knk.3	Q92187	OTTHUMG00000128727	ENST00000231461.5:c.51G>A	5.37:g.100238609C>T			A8KA07|G3V104|Q8N1F4|Q92693	Silent	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.L17	ENST00000231461.5	37	c.51	CCDS4091.1	5																																																																																			ST8SIA4	-	pirsf_Sialyl_trans	ENSG00000113532		0.473	ST8SIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST8SIA4	HGNC	protein_coding	OTTHUMT00000250632.3	109	0.91	1	C	NM_005668		100238609	100238609	-1	no_errors	ENST00000231461	ensembl	human	known	69_37n	silent	72	26.53	26	SNP	1.000	T
SUDS3	64426	genome.wustl.edu	37	12	118841262	118841262	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:118841262C>T	ENST00000543473.1	+	10	1055	c.743C>T	c.(742-744)tCt>tTt	p.S248F	SUDS3_ENST00000397564.2_Missense_Mutation_p.S249F|SUDS3_ENST00000541280.1_3'UTR	NM_022491.2	NP_071936.2	Q9H7L9	SDS3_HUMAN	suppressor of defective silencing 3 homolog (S. cerevisiae)	248					apoptotic process (GO:0006915)|histone deacetylation (GO:0016575)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Sin3 complex (GO:0016580)	enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)			breast(1)|lung(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CCCGCGGAATCTCCAGCCCAG	0.458																																						dbGAP											0													52.0	52.0	52.0					12																	118841262		1970	4149	6119	-	-	-	SO:0001583	missense	0			AK023801	CCDS44993.1	12q24.23	2006-02-13	2006-02-13		ENSG00000111707	ENSG00000111707			29545	protein-coding gene	gene with protein product	"""sin3A-associated protein, 45kDa"""	608250	"""suppressor of defective silencing 3 homolog (SDS3, S. cerevisiae)"""			11909966	Standard	NM_022491		Approved	SDS3, FLJ00052, SAP45	uc001twz.3	Q9H7L9	OTTHUMG00000168884	ENST00000543473.1:c.743C>T	12.37:g.118841262C>T	ENSP00000443988:p.Ser248Phe		Q4KMQ5|Q8N6H0|Q9H8D2	Missense_Mutation	SNP	pfam_Sds3	p.S249F	ENST00000543473.1	37	c.746	CCDS44993.1	12	.	.	.	.	.	.	.	.	.	.	C	12.04	1.817980	0.32145	.	.	ENSG00000111707	ENST00000543473;ENST00000397564	.	.	.	5.2	5.2	0.72013	.	0.152762	0.64402	D	0.000014	T	0.52629	0.1746	L	0.43152	1.355	0.58432	D	0.999999	P	0.50943	0.94	B	0.41691	0.364	T	0.54132	-0.8339	9	0.37606	T	0.19	-8.3446	18.5243	0.90965	0.0:1.0:0.0:0.0	.	248	Q9H7L9	SDS3_HUMAN	F	248;249	.	ENSP00000380695:S249F	S	+	2	0	SUDS3	117325645	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	2.263000	0.43293	2.691000	0.91804	0.655000	0.94253	TCT	SUDS3	-	NULL	ENSG00000111707		0.458	SUDS3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SUDS3	HGNC	protein_coding	OTTHUMT00000401504.1	55	0.00	0	C	NM_022491		118841262	118841262	+1	no_errors	ENST00000397564	ensembl	human	known	69_37n	missense	39	26.42	14	SNP	1.000	T
SUPT16H	11198	genome.wustl.edu	37	14	21838537	21838537	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr14:21838537C>T	ENST00000216297.2	-	4	779	c.441G>A	c.(439-441)atG>atA	p.M147I		NM_007192.3	NP_009123.1	Q9Y5B9	SP16H_HUMAN	suppressor of Ty 16 homolog (S. cerevisiae)	147					DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|nucleosome disassembly (GO:0006337)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)		TCCAGCTCTTCATGAACTCTC	0.388																																						dbGAP											0													186.0	176.0	180.0					14																	21838537		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF152961	CCDS9569.1	14q11.1	2008-08-13	2001-11-28		ENSG00000092201	ENSG00000092201			11465	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 140 kDa subunit"""	605012	"""suppressor of Ty (S.cerevisiae) 16 homolog"""			9489704, 11239457	Standard	NM_007192		Approved	FACT, FACTP140, SPT16/CDC68, FLJ14010, FLJ10857, CDC68	uc001wao.2	Q9Y5B9	OTTHUMG00000029685	ENST00000216297.2:c.441G>A	14.37:g.21838537C>T	ENSP00000216297:p.Met147Ile		Q6GMT8|Q6P2F1|Q6PJM1|Q9NRX0	Missense_Mutation	SNP	pfam_FACT_Spt16p,pfam_Pept_M24_structural-domain,pfam_DUF1747,superfamily_Pept_M24_structural-domain	p.M147I	ENST00000216297.2	37	c.441	CCDS9569.1	14	.	.	.	.	.	.	.	.	.	.	C	13.40	2.225985	0.39300	.	.	ENSG00000092201	ENST00000216297;ENST00000538230	.	.	.	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.53818	0.1820	L	0.39020	1.185	0.80722	D	1	B	0.17852	0.024	B	0.14578	0.011	T	0.46775	-0.9167	9	0.20519	T	0.43	-16.8444	18.3259	0.90254	0.0:1.0:0.0:0.0	.	147	Q9Y5B9	SP16H_HUMAN	I	147	.	ENSP00000216297:M147I	M	-	3	0	SUPT16H	20908377	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.586000	0.67503	2.623000	0.88846	0.591000	0.81541	ATG	SUPT16H	-	NULL	ENSG00000092201		0.388	SUPT16H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUPT16H	HGNC	protein_coding	OTTHUMT00000074025.2	159	0.62	1	C			21838537	21838537	-1	no_errors	ENST00000216297	ensembl	human	known	69_37n	missense	96	26.72	35	SNP	1.000	T
SV2B	9899	genome.wustl.edu	37	15	91769875	91769875	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr15:91769875G>A	ENST00000394232.1	+	2	852	c.382G>A	c.(382-384)Gtg>Atg	p.V128M	SV2B_ENST00000557291.1_Intron|SV2B_ENST00000330276.4_Missense_Mutation_p.V128M|SV2B_ENST00000545111.2_Intron	NM_014848.4	NP_055663.1	Q7L1I2	SV2B_HUMAN	synaptic vesicle glycoprotein 2B	128					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)			NS(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(17)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)			GGAAGTGTTCGTGGTGAGTTT	0.512																																						dbGAP											0													120.0	92.0	102.0					15																	91769875		2198	4298	6496	-	-	-	SO:0001583	missense	0			AB018278	CCDS10370.1, CCDS53972.1	15q26.1	2005-01-10			ENSG00000185518	ENSG00000185518			16874	protein-coding gene	gene with protein product		185861				9872452, 7681585	Standard	NM_014848		Approved	KIAA0735, HsT19680	uc002bqv.3	Q7L1I2	OTTHUMG00000149833	ENST00000394232.1:c.382G>A	15.37:g.91769875G>A	ENSP00000377779:p.Val128Met		B4DH30|C6G489|O94840|Q6IAR8	Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_SV2_chordata	p.V128M	ENST00000394232.1	37	c.382	CCDS10370.1	15	.	.	.	.	.	.	.	.	.	.	G	26.5	4.741633	0.89573	.	.	ENSG00000185518	ENST00000394232;ENST00000330276	T;T	0.59502	0.26;0.26	5.63	5.63	0.86233	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.73094	0.3543	L	0.53617	1.68	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72750	-0.4199	10	0.52906	T	0.07	-33.3531	18.2388	0.89960	0.0:0.0:1.0:0.0	.	128	Q7L1I2	SV2B_HUMAN	M	128	ENSP00000377779:V128M;ENSP00000332818:V128M	ENSP00000332818:V128M	V	+	1	0	SV2B	89570879	1.000000	0.71417	0.990000	0.47175	0.954000	0.61252	9.594000	0.98254	2.657000	0.90304	0.563000	0.77884	GTG	SV2B	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_SV2_chordata	ENSG00000185518		0.512	SV2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SV2B	HGNC	protein_coding	OTTHUMT00000313494.3	64	0.00	0	G	NM_014848		91769875	91769875	+1	no_errors	ENST00000330276	ensembl	human	known	69_37n	missense	59	15.71	11	SNP	1.000	A
SYNE1	23345	genome.wustl.edu	37	6	152674496	152674496	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr6:152674496C>G	ENST00000367255.5	-	69	11756	c.11155G>C	c.(11155-11157)Gat>Cat	p.D3719H	SYNE1_ENST00000265368.4_Missense_Mutation_p.D3719H|SYNE1_ENST00000423061.1_Missense_Mutation_p.D3704H|SYNE1_ENST00000448038.1_Missense_Mutation_p.D3704H|SYNE1_ENST00000341594.5_Missense_Mutation_p.D3690H	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3719					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCATACCAATCAGAATAGGAA	0.378										HNSCC(10;0.0054)																												dbGAP											0													143.0	143.0	143.0					6																	152674496		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.11155G>C	6.37:g.152674496C>G	ENSP00000356224:p.Asp3719His		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.D3719H	ENST00000367255.5	37	c.11155	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	15.74	2.922360	0.52653	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.56275	0.56;0.54;0.47;0.54;1.28	5.75	4.88	0.63580	.	0.304159	0.28146	N	0.016435	T	0.52403	0.1732	L	0.55481	1.735	0.80722	D	1	D;D;D;D	0.69078	0.997;0.997;0.997;0.996	P;P;P;P	0.61132	0.824;0.824;0.824;0.884	T	0.59156	-0.7507	10	0.66056	D	0.02	.	10.6103	0.45419	0.0:0.7887:0.1351:0.0762	.	3719;3719;3719;3704	B7ZBC3;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	H	3719;3704;3719;3704;3690	ENSP00000356224:D3719H;ENSP00000396024:D3704H;ENSP00000265368:D3719H;ENSP00000390975:D3704H;ENSP00000341887:D3690H	ENSP00000265368:D3719H	D	-	1	0	SYNE1	152716189	1.000000	0.71417	0.481000	0.27354	0.824000	0.46624	4.674000	0.61612	1.405000	0.46838	0.655000	0.94253	GAT	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1	ENSG00000131018		0.378	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	57	0.00	0	C	NM_182961		152674496	152674496	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	missense	52	17.46	11	SNP	0.976	G
TAF5	6877	genome.wustl.edu	37	10	105141539	105141539	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr10:105141539C>T	ENST00000369839.3	+	6	1498	c.1475C>T	c.(1474-1476)tCa>tTa	p.S492L	TAF5_ENST00000351396.4_Missense_Mutation_p.S492L	NM_006951.3	NP_008882.2	Q15542	TAF5_HUMAN	TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa	492					chromatin modification (GO:0016568)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	protein dimerization activity (GO:0046983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)	15		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		TTTGCAGATTCAACTGTCAGA	0.418																																						dbGAP											0													178.0	163.0	168.0					10																	105141539		2203	4300	6503	-	-	-	SO:0001583	missense	0			X95525	CCDS7547.1	10q24-q25.2	2013-01-10	2002-08-29	2001-12-07	ENSG00000148835	ENSG00000148835		"""WD repeat domain containing"""	11539	protein-coding gene	gene with protein product		601787	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, D, 100kD"""	TAF2D		8884287, 8942982	Standard	NM_006951		Approved	TAFII100	uc001kwv.3	Q15542	OTTHUMG00000018985	ENST00000369839.3:c.1475C>T	10.37:g.105141539C>T	ENSP00000358854:p.Ser492Leu		A8K5B4|B2RMR0|B7ZKJ6|Q53EM4|Q5SYD5|Q86UZ7|Q9Y4K5	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_TFIID-su_WD40-assoc_reg,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_LisH_dimerisation,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.S492L	ENST00000369839.3	37	c.1475	CCDS7547.1	10	.	.	.	.	.	.	.	.	.	.	C	35	5.439329	0.96168	.	.	ENSG00000148835	ENST00000369839;ENST00000351396	D;D	0.81821	-1.54;-1.54	5.8	5.8	0.92144	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.93128	0.7812	H	0.94771	3.58	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.994;0.998	D	0.94254	0.7496	10	0.87932	D	0	-8.4789	20.0537	0.97638	0.0:1.0:0.0:0.0	.	492;492	Q15542-2;Q15542	.;TAF5_HUMAN	L	492	ENSP00000358854:S492L;ENSP00000311024:S492L	ENSP00000311024:S492L	S	+	2	0	TAF5	105131529	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.758000	0.94735	0.561000	0.74099	TCA	TAF5	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000148835		0.418	TAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF5	HGNC	protein_coding	OTTHUMT00000050144.1	81	0.00	0	C			105141539	105141539	+1	no_errors	ENST00000369839	ensembl	human	known	69_37n	missense	79	12.22	11	SNP	1.000	T
TATDN2	9797	genome.wustl.edu	37	3	10320626	10320626	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr3:10320626G>C	ENST00000287652.4	+	7	3254	c.2203G>C	c.(2203-2205)Gag>Cag	p.E735Q	RP11-438J1.1_ENST00000450534.1_3'UTR|TATDN2_ENST00000496355.1_3'UTR|TATDN2_ENST00000448281.2_Missense_Mutation_p.E735Q	NM_014760.3	NP_055575.3	Q93075	TATD2_HUMAN	TatD DNase domain containing 2	735					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|DNA catabolic process (GO:0006308)|endoplasmic reticulum unfolded protein response (GO:0030968)	intracellular organelle (GO:0043229)|nucleoplasm (GO:0005654)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(9)|pancreas(2)|prostate(1)|stomach(2)	28						TACGGTCCGAGAGATTGCCAG	0.532																																						dbGAP											0													70.0	62.0	65.0					3																	10320626		2203	4300	6503	-	-	-	SO:0001583	missense	0			D86972	CCDS33698.1	3p25.3	2010-11-24			ENSG00000157014	ENSG00000157014			28988	protein-coding gene	gene with protein product						9039502	Standard	NM_014760		Approved	KIAA0218	uc003bvf.3	Q93075	OTTHUMG00000155361	ENST00000287652.4:c.2203G>C	3.37:g.10320626G>C	ENSP00000287652:p.Glu735Gln		Q3MIL9|Q5BKU0	Missense_Mutation	SNP	pfam_TatD_superfamily	p.E735Q	ENST00000287652.4	37	c.2203	CCDS33698.1	3	.	.	.	.	.	.	.	.	.	.	G	22.8	4.338571	0.81911	.	.	ENSG00000157014	ENST00000287652;ENST00000448281;ENST00000426850	T;T	0.26067	1.76;1.76	5.31	5.31	0.75309	.	0.000000	0.64402	U	0.000009	T	0.41926	0.1180	L	0.38175	1.15	0.50171	D	0.999851	D	0.71674	0.998	D	0.73380	0.98	T	0.22695	-1.0209	10	0.59425	D	0.04	-32.5256	16.5105	0.84283	0.0:0.0:1.0:0.0	.	735	Q93075	TATD2_HUMAN	Q	735;735;156	ENSP00000287652:E735Q;ENSP00000408736:E735Q	ENSP00000287652:E735Q	E	+	1	0	TATDN2	10295626	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	7.830000	0.86741	2.484000	0.83849	0.655000	0.94253	GAG	TATDN2	-	pfam_TatD_superfamily	ENSG00000157014		0.532	TATDN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TATDN2	HGNC	protein_coding	OTTHUMT00000339641.1	41	0.00	0	G	XM_376203		10320626	10320626	+1	no_errors	ENST00000287652	ensembl	human	known	69_37n	missense	27	24.32	9	SNP	1.000	C
TCHH	7062	genome.wustl.edu	37	1	152080607	152080607	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:152080607C>T	ENST00000368804.1	-	2	5085	c.5086G>A	c.(5086-5088)Gag>Aag	p.E1696K		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1696	23 X 26 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGCTGTTCCTCTTCGCGGAAT	0.572																																						dbGAP											0													91.0	90.0	90.0					1																	152080607		1895	4118	6013	-	-	-	SO:0001583	missense	0			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.5086G>A	1.37:g.152080607C>T	ENSP00000357794:p.Glu1696Lys		Q5VUI3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.E1696K	ENST00000368804.1	37	c.5086	CCDS41396.1	1	.	.	.	.	.	.	.	.	.	.	C	12.65	2.000870	0.35320	.	.	ENSG00000159450	ENST00000368804	T	0.14640	2.49	4.23	4.23	0.50019	.	.	.	.	.	T	0.12518	0.0304	M	0.72118	2.19	0.09310	N	0.999995	D	0.55172	0.97	P	0.54346	0.749	T	0.17137	-1.0379	9	0.07482	T	0.82	.	14.1384	0.65303	0.0:1.0:0.0:0.0	.	1696	Q07283	TRHY_HUMAN	K	1696	ENSP00000357794:E1696K	ENSP00000357794:E1696K	E	-	1	0	TCHH	150347231	.	.	0.177000	0.23020	0.136000	0.21042	.	.	2.184000	0.69523	0.453000	0.30009	GAG	TCHH	-	NULL	ENSG00000159450		0.572	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHH	HGNC	protein_coding	OTTHUMT00000036671.2	102	0.00	0	C	NM_007113		152080607	152080607	-1	no_errors	ENST00000368804	ensembl	human	known	69_37n	missense	148	14.94	26	SNP	0.472	T
TEAD4	7004	genome.wustl.edu	37	12	3147214	3147214	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:3147214G>C	ENST00000397122.2	+	9	876	c.591G>C	c.(589-591)atG>atC	p.M197I	TEAD4_ENST00000359864.2_Missense_Mutation_p.M326I|TEAD4_ENST00000358409.2_Missense_Mutation_p.M283I	NM_201443.2	NP_958851.1	Q15561	TEAD4_HUMAN	TEA domain family member 4	326					gene expression (GO:0010467)|hippo signaling (GO:0035329)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	10	Ovarian(42;0.211)		OV - Ovarian serous cystadenocarcinoma(31;0.000563)|COAD - Colon adenocarcinoma(12;0.0831)			CCGAGAACATGATCATCACCT	0.592																																						dbGAP											0													91.0	77.0	82.0					12																	3147214		2203	4300	6503	-	-	-	SO:0001583	missense	0			X94438	CCDS31729.1, CCDS31730.1, CCDS41737.1	12p13.3-p13.2	2008-05-14				ENSG00000197905			11717	protein-coding gene	gene with protein product		601714		TCF13L1		9889009, 8921372	Standard	NM_003213		Approved	TEF-3, TEFR-1, EFTR-2, RTEF-1	uc010sej.2	Q15561		ENST00000397122.2:c.591G>C	12.37:g.3147214G>C	ENSP00000380311:p.Met197Ile		H0Y308|Q6MZR9|Q8NEV5|Q92883|Q96BK2	Missense_Mutation	SNP	pfam_TEA/ATTS,smart_TEA/ATTS,pirsf_TEF,pfscan_TEA/ATTS,prints_TEA/ATTS	p.M326I	ENST00000397122.2	37	c.978	CCDS41737.1	12	.	.	.	.	.	.	.	.	.	.	G	15.73	2.919813	0.52653	.	.	ENSG00000197905	ENST00000358409;ENST00000359864;ENST00000397122	T;T;T	0.29655	1.56;1.56;1.56	4.77	4.77	0.60923	.	0.044457	0.85682	D	0.000000	T	0.37073	0.0990	M	0.73598	2.24	0.80722	D	1	P	0.44816	0.844	B	0.39876	0.312	T	0.41324	-0.9515	10	0.44086	T	0.13	-32.6301	16.8016	0.85616	0.0:0.0:1.0:0.0	.	326	Q15561	TEAD4_HUMAN	I	283;326;197	ENSP00000351184:M283I;ENSP00000352926:M326I;ENSP00000380311:M197I	ENSP00000351184:M283I	M	+	3	0	TEAD4	3017475	1.000000	0.71417	0.999000	0.59377	0.681000	0.39784	7.866000	0.87056	2.182000	0.69389	0.655000	0.94253	ATG	TEAD4	-	pfam_TEA/ATTS,pirsf_TEF	ENSG00000197905		0.592	TEAD4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TEAD4	HGNC	protein_coding	OTTHUMT00000398477.1	32	0.00	0	G	NM_003213		3147214	3147214	+1	no_errors	ENST00000359864	ensembl	human	known	69_37n	missense	23	32.35	11	SNP	1.000	C
TEK	7010	genome.wustl.edu	37	9	27209201	27209201	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr9:27209201C>G	ENST00000380036.4	+	16	3100	c.2658C>G	c.(2656-2658)atC>atG	p.I886M	TEK_ENST00000519097.1_Missense_Mutation_p.I738M|TEK_ENST00000406359.4_Missense_Mutation_p.I843M	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	886	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	CAAACATCATCAATCTCTTAG	0.403																																						dbGAP											0													134.0	108.0	117.0					9																	27209201		2203	4300	6503	-	-	-	SO:0001583	missense	0			L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.2658C>G	9.37:g.27209201C>G	ENSP00000369375:p.Ile886Met		A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Tyr_kin_Tie2_Ig-like_dom-1_N,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.I886M	ENST00000380036.4	37	c.2658	CCDS6519.1	9	.	.	.	.	.	.	.	.	.	.	C	16.64	3.179205	0.57800	.	.	ENSG00000120156	ENST00000519097;ENST00000380036;ENST00000406359	T;T;T	0.71461	-0.57;-0.57;-0.57	5.87	4.76	0.60689	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.49916	D	0.000127	T	0.77651	0.4162	L	0.55743	1.74	0.51482	D	0.999929	D;D;D;D	0.89917	0.996;1.0;0.997;0.996	D;D;D;D	0.91635	0.999;0.998;0.999;0.999	T	0.77846	-0.2436	10	0.87932	D	0	.	6.1652	0.20386	0.2817:0.6008:0.0:0.1175	.	738;919;843;886	E7EWI2;Q59HG2;B4DHD3;Q02763	.;.;.;TIE2_HUMAN	M	738;886;843	ENSP00000430686:I738M;ENSP00000369375:I886M;ENSP00000383977:I843M	ENSP00000369375:I886M	I	+	3	3	TEK	27199201	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.155000	0.31700	1.146000	0.42352	0.643000	0.83706	ATC	TEK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000120156		0.403	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TEK	HGNC	protein_coding	OTTHUMT00000051965.3	56	0.00	0	C			27209201	27209201	+1	no_errors	ENST00000380036	ensembl	human	known	69_37n	missense	38	22.45	11	SNP	1.000	G
TGFBRAP1	9392	genome.wustl.edu	37	2	105897092	105897092	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:105897092G>C	ENST00000393359.2	-	6	1636	c.1210C>G	c.(1210-1212)Ctt>Gtt	p.L404V	TGFBRAP1_ENST00000258449.1_Missense_Mutation_p.L404V			Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor associated protein 1	404					intracellular protein transport (GO:0006886)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|membrane (GO:0016020)	SMAD binding (GO:0046332)|small GTPase regulator activity (GO:0005083)|transforming growth factor beta receptor binding (GO:0005160)			central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	31						TACTCATGAAGAGGAGGGTGG	0.587																																					Esophageal Squamous(183;794 2019 9730 21801 48859)	dbGAP											0													100.0	92.0	95.0					2																	105897092		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF022795	CCDS2067.1	2q12.1	2008-02-05			ENSG00000135966	ENSG00000135966			16836	protein-coding gene	gene with protein product		606237				9545258, 11278302	Standard	NM_001142621		Approved	TRAP-1, TRAP1	uc002tcr.4	Q8WUH2	OTTHUMG00000130809	ENST00000393359.2:c.1210C>G	2.37:g.105897092G>C	ENSP00000377027:p.Leu404Val		A8K5R7|D3DVJ8|O60466	Missense_Mutation	SNP	pfam_VPS39/TGF_beta_rcpt-assoc_2,pfam_VPS39/TGF_beta_rcpt-assoc_1,pfam_Clathrin_H-chain/VPS_repeat,pfam_Citron	p.L404V	ENST00000393359.2	37	c.1210	CCDS2067.1	2	.	.	.	.	.	.	.	.	.	.	G	20.7	4.032826	0.75504	.	.	ENSG00000135966	ENST00000393359;ENST00000258449	T;T	0.46451	0.87;0.87	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.42787	0.1218	M	0.66939	2.045	0.58432	D	0.999999	P	0.46621	0.881	P	0.45138	0.471	T	0.29731	-1.0002	10	0.10636	T	0.68	-19.0347	12.3103	0.54925	0.0775:0.0:0.9225:0.0	.	404	Q8WUH2	TGFA1_HUMAN	V	404	ENSP00000377027:L404V;ENSP00000258449:L404V	ENSP00000258449:L404V	L	-	1	0	TGFBRAP1	105263524	1.000000	0.71417	0.996000	0.52242	0.977000	0.68977	7.973000	0.88032	2.463000	0.83235	0.650000	0.86243	CTT	TGFBRAP1	-	NULL	ENSG00000135966		0.587	TGFBRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBRAP1	HGNC	protein_coding	OTTHUMT00000253354.2	63	0.00	0	G	NM_004257		105897092	105897092	-1	no_errors	ENST00000258449	ensembl	human	known	69_37n	missense	51	29.17	21	SNP	1.000	C
THSD1	55901	genome.wustl.edu	37	13	52951842	52951842	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr13:52951842C>T	ENST00000258613.4	-	5	2441	c.2263G>A	c.(2263-2265)Gag>Aag	p.E755K	THSD1_ENST00000544466.1_Missense_Mutation_p.E376K|THSD1_ENST00000349258.4_Missense_Mutation_p.E702K	NM_018676.3	NP_061146.1	Q9NS62	THSD1_HUMAN	thrombospondin, type I, domain containing 1	755					hematopoietic progenitor cell differentiation (GO:0002244)	cell periphery (GO:0071944)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)		CTGTGGGGCTCTGTTCTCTCA	0.542																																						dbGAP											0													115.0	120.0	118.0					13																	52951842		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096289	CCDS9432.1, CCDS9433.1	13q14.13	2010-04-20	2004-03-11		ENSG00000136114	ENSG00000136114			17754	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain 1"""				Standard	NM_018676		Approved	TMTSP	uc001vgo.3	Q9NS62	OTTHUMG00000016963	ENST00000258613.4:c.2263G>A	13.37:g.52951842C>T	ENSP00000258613:p.Glu755Lys		A2A3J3|B2RCF5|Q6P3U1|Q6UXZ2	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.E755K	ENST00000258613.4	37	c.2263	CCDS9432.1	13	.	.	.	.	.	.	.	.	.	.	C	23.7	4.452439	0.84209	.	.	ENSG00000136114	ENST00000349258;ENST00000544466;ENST00000258613	T;T;T	0.56611	1.07;0.45;1.24	5.28	5.28	0.74379	.	0.102171	0.64402	D	0.000004	T	0.69052	0.3068	M	0.68952	2.095	0.80722	D	1	P;D	0.61697	0.868;0.99	B;P	0.60012	0.443;0.867	T	0.72316	-0.4330	10	0.87932	D	0	-17.7333	18.2866	0.90115	0.0:1.0:0.0:0.0	.	702;755	Q9NS62-2;Q9NS62	.;THSD1_HUMAN	K	702;376;755	ENSP00000340650:E702K;ENSP00000438512:E376K;ENSP00000258613:E755K	ENSP00000258613:E755K	E	-	1	0	THSD1	51849843	1.000000	0.71417	0.818000	0.32626	0.784000	0.44337	6.653000	0.74382	2.624000	0.88883	0.502000	0.49764	GAG	THSD1	-	NULL	ENSG00000136114		0.542	THSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THSD1	HGNC	protein_coding	OTTHUMT00000045058.3	73	0.00	0	C			52951842	52951842	-1	no_errors	ENST00000258613	ensembl	human	known	69_37n	missense	49	18.33	11	SNP	0.999	T
THUMPD2	80745	genome.wustl.edu	37	2	39963984	39963984	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:39963984C>G	ENST00000505747.1	-	10	1430	c.1403G>C	c.(1402-1404)aGa>aCa	p.R468T	THUMPD2_ENST00000260619.6_Missense_Mutation_p.R438T	NM_025264.4	NP_079540.2	Q9BTF0	THUM2_HUMAN	THUMP domain containing 2	468							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|skin(1)	17		all_hematologic(82;0.248)				TGGTGACATTCTGTCTAAGAA	0.403																																						dbGAP											0													201.0	191.0	194.0					2																	39963984		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF380576	CCDS1805.1, CCDS1805.2	2p22.2	2004-06-04	2004-06-04	2004-06-04	ENSG00000138050	ENSG00000138050			14890	protein-coding gene	gene with protein product		611751	"""chromosome 2 open reading frame 8"""	C2orf8		12063391	Standard	NM_025264		Approved	MGC2454	uc002rru.2	Q9BTF0	OTTHUMG00000102149	ENST00000505747.1:c.1403G>C	2.37:g.39963984C>G	ENSP00000423933:p.Arg468Thr		A8K7I7|Q53TT8|Q53TV0	Missense_Mutation	SNP	pfam_RNA_methylase_dom,pfam_Methyltransf_11,pfam_THUMP,pfam_Small_mtfrase_dom,pfam_UbiE/COQ5_MeTrFase,smart_THUMP,pfscan_THUMP	p.R468T	ENST00000505747.1	37	c.1403	CCDS1805.2	2	.	.	.	.	.	.	.	.	.	.	C	13.58	2.279811	0.40294	.	.	ENSG00000138050	ENST00000505747;ENST00000260619	.	.	.	5.91	-4.6	0.03390	.	1.751440	0.02429	N	0.083341	T	0.27027	0.0662	L	0.38175	1.15	0.09310	N	1	B;B	0.26672	0.017;0.156	B;B	0.18871	0.004;0.023	T	0.09228	-1.0684	8	.	.	.	.	3.4019	0.07327	0.1331:0.4456:0.1362:0.2852	.	359;468	B4DP37;Q9BTF0	.;THUM2_HUMAN	T	468;438	.	.	R	-	2	0	THUMPD2	39817488	0.000000	0.05858	0.000000	0.03702	0.157000	0.22087	-0.690000	0.05138	-0.318000	0.08665	-0.290000	0.09829	AGA	THUMPD2	-	NULL	ENSG00000138050		0.403	THUMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THUMPD2	HGNC	protein_coding	OTTHUMT00000219991.2	106	0.00	0	C	NM_025264		39963984	39963984	-1	no_errors	ENST00000505747	ensembl	human	known	69_37n	missense	75	25.00	25	SNP	0.000	G
TLCD1	116238	genome.wustl.edu	37	17	27052391	27052391	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr17:27052391G>A	ENST00000292090.3	-	3	401	c.291C>T	c.(289-291)caC>caT	p.H97H	AC010761.14_ENST00000587898.1_RNA|TLCD1_ENST00000394933.3_Silent_p.H50H|SNORD42A_ENST00000459584.1_RNA|SNORD4A_ENST00000459174.1_RNA|SNORD4B_ENST00000459083.1_RNA|AC010761.8_ENST00000582718.1_RNA	NM_138463.3	NP_612472.1	Q96CP7	TLCD1_HUMAN	TLC domain containing 1	97	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(2)|lung(2)	7	Lung NSC(42;0.00431)					CCACCGTATCGTGGATGAAAT	0.532																																						dbGAP											0													106.0	98.0	100.0					17																	27052391		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC014072	CCDS11242.1, CCDS54102.1	17q11.2	2007-03-23			ENSG00000160606	ENSG00000160606			25177	protein-coding gene	gene with protein product						12151215	Standard	NM_138463		Approved		uc002hco.3	Q96CP7	OTTHUMG00000132683	ENST00000292090.3:c.291C>T	17.37:g.27052391G>A			A8MYP9	Silent	SNP	pfam_TLC-dom,smart_TLC-dom,pfscan_TLC-dom	p.H97	ENST00000292090.3	37	c.291	CCDS11242.1	17																																																																																			TLCD1	-	pfam_TLC-dom,smart_TLC-dom,pfscan_TLC-dom	ENSG00000160606		0.532	TLCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLCD1	HGNC	protein_coding	OTTHUMT00000255973.1	52	0.00	0	G	NM_138463		27052391	27052391	-1	no_errors	ENST00000292090	ensembl	human	known	69_37n	silent	26	29.73	11	SNP	0.459	A
TMEM179	388021	genome.wustl.edu	37	14	105070949	105070949	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr14:105070949C>T	ENST00000556573.1	-	1	371	c.130G>A	c.(130-132)Gag>Aag	p.E44K	TMEM179_ENST00000341595.3_Missense_Mutation_p.E44K			Q6ZVK1	T179A_HUMAN	transmembrane protein 179	44						integral component of membrane (GO:0016021)				endometrium(1)|lung(2)|skin(1)	4			all cancers(16;0.00276)|OV - Ovarian serous cystadenocarcinoma(23;0.0262)|Epithelial(46;0.058)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.129)		CACATGCCCTCGGTGAAGAGC	0.692																																						dbGAP											0													23.0	24.0	23.0					14																	105070949		2184	4291	6475	-	-	-	SO:0001583	missense	0			AK124477	CCDS66723.1, CCDS73688.1	14q32.33	2012-04-11	2006-10-16	2006-10-16	ENSG00000258986	ENSG00000258986			20137	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 90"""	C14orf90			Standard	NM_001286390		Approved	FLJ42486, TMEM179A	uc001yox.1	Q6ZVK1	OTTHUMG00000170829	ENST00000556573.1:c.130G>A	14.37:g.105070949C>T	ENSP00000450958:p.Glu44Lys			Missense_Mutation	SNP	NULL	p.E44K	ENST00000556573.1	37	c.130		14	.	.	.	.	.	.	.	.	.	.	C	14.49	2.551519	0.45487	.	.	ENSG00000189203;ENSG00000258986;ENSG00000258986	ENST00000415614;ENST00000556573;ENST00000341595	T;T;T	0.18502	2.21;2.21;2.21	2.75	2.75	0.32379	.	0.133081	0.50627	D	0.000115	T	0.16214	0.0390	L	0.40543	1.245	0.42234	D	0.991907	D	0.56521	0.976	P	0.46110	0.504	T	0.08638	-1.0712	10	0.18276	T	0.48	.	13.5729	0.61858	0.0:1.0:0.0:0.0	.	44	Q6ZVK1-2	.	K	44	ENSP00000397763:E44K;ENSP00000450958:E44K;ENSP00000340477:E44K	ENSP00000340477:E44K	E	-	1	0	RP11-614O9.3;TMEM179	104141994	1.000000	0.71417	1.000000	0.80357	0.675000	0.39556	4.400000	0.59709	1.352000	0.45808	0.462000	0.41574	GAG	TMEM179	-	NULL	ENSG00000258986		0.692	TMEM179-002	KNOWN	basic|appris_principal	protein_coding	TMEM179	HGNC	protein_coding	OTTHUMT00000410585.1	19	0.00	0	C	NM_207379		105070949	105070949	-1	no_errors	ENST00000556573	ensembl	human	known	69_37n	missense	12	38.10	8	SNP	1.000	T
TMEM74B	55321	genome.wustl.edu	37	20	1161834	1161834	+	Silent	SNP	G	G	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr20:1161834G>T	ENST00000381894.3	-	2	1100	c.429C>A	c.(427-429)atC>atA	p.I143I	TMEM74B_ENST00000481747.1_5'Flank	NM_018354.1	NP_060824.1	Q9NUR3	TM74B_HUMAN	transmembrane protein 74B	143						integral component of membrane (GO:0016021)											CCTCACGGGGGATGGCGTATG	0.612																																						dbGAP											0													88.0	78.0	82.0					20																	1161834		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK002052	CCDS13011.1	20p13	2011-11-23	2011-11-23	2011-11-23	ENSG00000125895	ENSG00000125895			15893	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 46"""	C20orf46			Standard	XM_005260748		Approved	FLJ11190	uc002weq.1	Q9NUR3	OTTHUMG00000031655	ENST00000381894.3:c.429C>A	20.37:g.1161834G>T			D3DVW5	Silent	SNP	NULL	p.I143	ENST00000381894.3	37	c.429	CCDS13011.1	20																																																																																			TMEM74B	-	NULL	ENSG00000125895		0.612	TMEM74B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM74B	HGNC	protein_coding	OTTHUMT00000077496.2	24	0.00	0	G	NM_018354		1161834	1161834	-1	no_errors	ENST00000381894	ensembl	human	known	69_37n	silent	12	33.33	6	SNP	1.000	T
TNS3	64759	genome.wustl.edu	37	7	47342615	47342615	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr7:47342615G>A	ENST00000398879.1	-	22	3756	c.3390C>T	c.(3388-3390)atC>atT	p.I1130I	TNS3_ENST00000355730.3_Silent_p.I890I|TNS3_ENST00000311160.9_Silent_p.I1130I			Q68CZ2	TENS3_HUMAN	tensin 3	1130					cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						AGGGGATACTGATGGTGCTCC	0.612																																						dbGAP											0													55.0	64.0	61.0					7																	47342615		1968	4144	6112	-	-	-	SO:0001819	synonymous_variant	0			AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.3390C>T	7.37:g.47342615G>A			B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Silent	SNP	pfam_PTB,pfam_Tensin_phosphatase_C2-dom,pfam_SH2,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Tyr_Pase_cat,smart_SH2,smart_PTyr_interaction_dom,pfscan_SH2,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.I1130	ENST00000398879.1	37	c.3390	CCDS5506.2	7																																																																																			TNS3	-	NULL	ENSG00000136205		0.612	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TNS3	HGNC	protein_coding	OTTHUMT00000157253.1	18	0.00	0	G	NM_022748		47342615	47342615	-1	no_errors	ENST00000311160	ensembl	human	known	69_37n	silent	16	36.00	9	SNP	0.999	A
TPP2	7174	genome.wustl.edu	37	13	103299647	103299647	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr13:103299647G>A	ENST00000376065.4	+	21	2617	c.2581G>A	c.(2581-2583)Gac>Aac	p.D861N	TPP2_ENST00000376052.3_Missense_Mutation_p.D861N	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	861					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)			breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GATTATTTTTGACCAGAACAA	0.383																																						dbGAP											0													75.0	73.0	73.0					13																	103299647		2203	4300	6503	-	-	-	SO:0001583	missense	0			M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.2581G>A	13.37:g.103299647G>A	ENSP00000365233:p.Asp861Asn		Q5VZU8	Missense_Mutation	SNP	pfam_Peptidase_S8/S53,pfam_Peptidase_S8A_TPPII,superfamily_Peptidase_S8/S53,prints_Peptidase_S8_subtilisin-rel	p.D861N	ENST00000376065.4	37	c.2581	CCDS9502.1	13	.	.	.	.	.	.	.	.	.	.	G	32	5.139462	0.94560	.	.	ENSG00000134900	ENST00000376065;ENST00000376052	.	.	.	5.76	5.76	0.90799	Peptidase S8A, tripeptidyl peptidase II (1);	0.000000	0.85682	D	0.000000	D	0.82536	0.5058	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81344	-0.0975	9	0.45353	T	0.12	.	19.975	0.97300	0.0:0.0:1.0:0.0	.	861	P29144	TPP2_HUMAN	N	861	.	ENSP00000365220:D861N	D	+	1	0	TPP2	102097648	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.724000	0.93272	0.585000	0.79938	GAC	TPP2	-	pfam_Peptidase_S8A_TPPII	ENSG00000134900		0.383	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPP2	HGNC	protein_coding	OTTHUMT00000045683.2	62	0.00	0	G			103299647	103299647	+1	no_errors	ENST00000376065	ensembl	human	known	69_37n	missense	58	22.67	17	SNP	1.000	A
TRAM2	9697	genome.wustl.edu	37	6	52369549	52369549	+	Silent	SNP	G	G	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr6:52369549G>T	ENST00000182527.3	-	10	878	c.879C>A	c.(877-879)ctC>ctA	p.L293L	EFHC1_ENST00000433625.2_Intron	NM_012288.3	NP_036420.1	Q15035	TRAM2_HUMAN	translocation associated membrane protein 2	293	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				collagen biosynthetic process (GO:0032964)|protein transport (GO:0015031)	integral component of membrane (GO:0016021)				endometrium(3)|large_intestine(1)|lung(7)|prostate(1)|skin(1)	13	Lung NSC(77;0.109)					GCAGCACGCAGAGCCTGCAGA	0.652																																						dbGAP											0													19.0	20.0	20.0					6																	52369549		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			D31762	CCDS34477.1	6p21.1-p12	2008-02-05			ENSG00000065308	ENSG00000065308			16855	protein-coding gene	gene with protein product		608485				7584044, 10594243	Standard	NM_012288		Approved	KIAA0057	uc003paq.3	Q15035	OTTHUMG00000014850	ENST00000182527.3:c.879C>A	6.37:g.52369549G>T			A8K6T6	Silent	SNP	pfam_TRAM1,pfam_TLC-dom,smart_TLC-dom,pirsf_Translocation_assoc_membrane,pfscan_TLC-dom	p.L293	ENST00000182527.3	37	c.879	CCDS34477.1	6																																																																																			TRAM2	-	pfam_TLC-dom,smart_TLC-dom,pirsf_Translocation_assoc_membrane,pfscan_TLC-dom	ENSG00000065308		0.652	TRAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAM2	HGNC	protein_coding	OTTHUMT00000040910.1	20	0.00	0	G	NM_012288		52369549	52369549	-1	no_errors	ENST00000182527	ensembl	human	known	69_37n	silent	11	35.29	6	SNP	0.111	T
TRIM28	10155	genome.wustl.edu	37	19	59061137	59061137	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr19:59061137C>T	ENST00000253024.5	+	14	2305	c.2016C>T	c.(2014-2016)ctC>ctT	p.L672L	TRIM28_ENST00000341753.6_Silent_p.L590L	NM_005762.2	NP_005753.1	Q13263	TIF1B_HUMAN	tripartite motif containing 28	672					convergent extension involved in axis elongation (GO:0060028)|DNA repair (GO:0006281)|embryonic placenta morphogenesis (GO:0060669)|epithelial to mesenchymal transition (GO:0001837)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|Krueppel-associated box domain binding (GO:0035851)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|urinary_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		GCCATGTGCTCCCTGACCTGA	0.602																																						dbGAP											0													125.0	115.0	119.0					19																	59061137		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12985.1	19q13.4	2014-06-13	2011-01-25			ENSG00000130726		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	16384	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 157"""	601742	"""tripartite motif-containing 28"""			11331580, 11226167	Standard	NM_005762		Approved	TIF1B, KAP1, TF1B, RNF96, PPP1R157	uc002qtg.1	Q13263		ENST00000253024.5:c.2016C>T	19.37:g.59061137C>T			O00677|Q7Z632|Q93040|Q96IM1	Silent	SNP	pfam_Znf_B-box,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_B-box,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.L672	ENST00000253024.5	37	c.2016	CCDS12985.1	19																																																																																			TRIM28	-	superfamily_Znf_FYVE_PHD,pfscan_Znf_PHD-finger	ENSG00000130726		0.602	TRIM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM28	HGNC	protein_coding	OTTHUMT00000467074.1	39	0.00	0	C	NM_005762		59061137	59061137	+1	no_errors	ENST00000253024	ensembl	human	known	69_37n	silent	31	49.18	30	SNP	0.935	T
TRIM33	51592	genome.wustl.edu	37	1	114940464	114940464	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:114940464G>A	ENST00000358465.2	-	20	3273	c.3190C>T	c.(3190-3192)Cag>Tag	p.Q1064*	TRIM33_ENST00000369543.2_Nonsense_Mutation_p.Q1047*|TRIM33_ENST00000450349.2_Nonsense_Mutation_p.Q696*	NM_015906.3	NP_056990.3	Q9UPN9	TRI33_HUMAN	tripartite motif containing 33	1064					gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	co-SMAD binding (GO:0070410)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	48	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTCCCTGCCTGAGCTACTTCT	0.433			T	RET	papillary thyroid																																	dbGAP		Dom	yes		1	1p13	51592	""" tripartite motif-containing 33 (PTC7,TIF1G)"""		E	0													166.0	153.0	157.0					1																	114940464		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF220136	CCDS872.1, CCDS873.1	1p13.1	2014-02-17	2011-01-25		ENSG00000197323	ENSG00000197323		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"", ""RING-type (C3HC4) zinc fingers"""	16290	protein-coding gene	gene with protein product	"""transcriptional intermediary factor 1 gamma"", ""ret-fused gene 7"""	605769	"""tripartite motif-containing 33"""			11331580, 10022127	Standard	XM_005270936		Approved	TIF1GAMMA, FLJ11429, KIAA1113, TIFGAMMA, RFG7, TF1G, TIF1G, PTC7	uc001eew.3	Q9UPN9	OTTHUMG00000011891	ENST00000358465.2:c.3190C>T	1.37:g.114940464G>A	ENSP00000351250:p.Gln1064*		O95855|Q5TG72|Q5TG73|Q5TG74|Q9C017|Q9UJ79	Nonsense_Mutation	SNP	pfam_Bromodomain,pfam_Znf_B-box,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Bromodomain,prints_Bromodomain,pfscan_Znf_B-box,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_Bromodomain	p.Q1064*	ENST00000358465.2	37	c.3190	CCDS872.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.180190	0.97352	.	.	ENSG00000197323	ENST00000358465;ENST00000369543;ENST00000450349	.	.	.	5.3	4.38	0.52667	.	0.258406	0.41712	D	0.000831	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-2.274	15.8555	0.78975	0.0:0.0:0.8637:0.1363	.	.	.	.	X	1064;1047;696	.	ENSP00000351250:Q1064X	Q	-	1	0	TRIM33	114741987	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.081000	0.50120	1.345000	0.45676	0.650000	0.86243	CAG	TRIM33	-	superfamily_Bromodomain,smart_Bromodomain	ENSG00000197323		0.433	TRIM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM33	HGNC	protein_coding	OTTHUMT00000032854.1	64	0.00	0	G	NM_015906		114940464	114940464	-1	no_errors	ENST00000358465	ensembl	human	known	69_37n	nonsense	49	30.00	21	SNP	1.000	A
TRMT10A	93587	genome.wustl.edu	37	4	100472076	100472076	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr4:100472076C>G	ENST00000273962.3	-	7	1029	c.717G>C	c.(715-717)aaG>aaC	p.K239N	TRMT10A_ENST00000394876.2_Missense_Mutation_p.K239N|TRMT10A_ENST00000394877.3_Missense_Mutation_p.K239N	NM_152292.4	NP_689505.1	Q8TBZ6	TM10A_HUMAN	tRNA methyltransferase 10 homolog A (S. cerevisiae)	239	SAM-dependent MTase TRM10-type. {ECO:0000255|PROSITE-ProRule:PRU01012}.				magnesium ion homeostasis (GO:0010960)	extracellular vesicular exosome (GO:0070062)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)										GACTATTCATCTTCACAAAAT	0.353																																						dbGAP											0													102.0	96.0	98.0					4																	100472076		2202	4300	6502	-	-	-	SO:0001583	missense	0			BC028373	CCDS3650.1	4q23	2012-06-28	2012-06-28	2012-06-28	ENSG00000145331	ENSG00000145331			28403	protein-coding gene	gene with protein product			"""RNA (guanine-9-) methyltransferase domain containing 2"""	RG9MTD2		12477932	Standard	NM_152292		Approved	MGC27034, TRM10	uc003hva.4	Q8TBZ6	OTTHUMG00000131025	ENST00000273962.3:c.717G>C	4.37:g.100472076C>G	ENSP00000273962:p.Lys239Asn		B2R8X7|Q9Y2T9	Missense_Mutation	SNP	pfam_tRNA_m1G_MeTrfase,pirsf_tRNA_MeTfrase_TRM10	p.K239N	ENST00000273962.3	37	c.717	CCDS3650.1	4	.	.	.	.	.	.	.	.	.	.	C	16.97	3.267973	0.59540	.	.	ENSG00000145331	ENST00000394877;ENST00000273962;ENST00000394876	T;T;T	0.22945	1.93;1.93;1.93	5.86	4.9	0.64082	.	0.137774	0.64402	D	0.000004	T	0.23572	0.0570	L	0.58810	1.83	0.46954	D	0.999267	B	0.32968	0.392	B	0.34346	0.18	T	0.03534	-1.1027	10	0.35671	T	0.21	-15.3688	6.6065	0.22727	0.0:0.7218:0.0:0.2782	.	239	Q8TBZ6	RG9D2_HUMAN	N	239	ENSP00000378343:K239N;ENSP00000273962:K239N;ENSP00000378342:K239N	ENSP00000273962:K239N	K	-	3	2	RG9MTD2	100691099	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.563000	0.36364	2.771000	0.95319	0.650000	0.86243	AAG	TRMT10A	-	pfam_tRNA_m1G_MeTrfase,pirsf_tRNA_MeTfrase_TRM10	ENSG00000145331		0.353	TRMT10A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT10A	HGNC	protein_coding	OTTHUMT00000253668.1	102	0.00	0	C	NM_152292		100472076	100472076	-1	no_errors	ENST00000273962	ensembl	human	known	69_37n	missense	95	10.38	11	SNP	1.000	G
TRPM5	29850	genome.wustl.edu	37	11	2439589	2439589	+	Splice_Site	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr11:2439589C>T	ENST00000155858.6	-	6	723		c.e6-1		TRPM5_ENST00000528453.1_Splice_Site|TRPM5_ENST00000533060.1_Splice_Site|TRPM5_ENST00000452833.1_Splice_Site	NM_014555.3	NP_055370.1			transient receptor potential cation channel, subfamily M, member 5											breast(1)|central_nervous_system(1)|endometrium(4)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	23		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		TGGAGATCCTCTGAGACGGGG	0.677																																					NSCLC(1;49 61 17205 18850 43201)	dbGAP											0													11.0	14.0	13.0					11																	2439589		2158	4252	6410	-	-	-	SO:0001630	splice_region_variant	0			AF177473	CCDS31340.1	11p15.5	2011-12-14			ENSG00000070985	ENSG00000070985		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	14323	protein-coding gene	gene with protein product		604600				10607831, 16382100	Standard	NM_014555		Approved	LTRPC5, MTR1	uc001lwm.4	Q9NZQ8	OTTHUMG00000009896	ENST00000155858.6:c.715-1G>A	11.37:g.2439589C>T				Splice_Site	SNP	-	e6-1	ENST00000155858.6	37	c.721-1	CCDS31340.1	11	.	.	.	.	.	.	.	.	.	.	C	11.62	1.693300	0.30052	.	.	ENSG00000070985	ENST00000533881;ENST00000155858;ENST00000452833;ENST00000533060;ENST00000528453;ENST00000437542	.	.	.	3.42	1.41	0.22369	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.6332	0.33933	0.1732:0.6597:0.1672:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TRPM5	2396165	1.000000	0.71417	0.006000	0.13384	0.214000	0.24535	3.181000	0.50903	0.236000	0.21180	0.491000	0.48974	.	TRPM5	-	-	ENSG00000070985		0.677	TRPM5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TRPM5	HGNC	protein_coding	OTTHUMT00000027378.1	18	0.00	0	C	NM_014555	Intron	2439589	2439589	-1	no_errors	ENST00000452833	ensembl	human	known	69_37n	splice_site	7	56.25	9	SNP	0.980	T
TSEN54	283989	genome.wustl.edu	37	17	73517943	73517943	+	Missense_Mutation	SNP	C	C	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr17:73517943C>A	ENST00000333213.6	+	8	817	c.781C>A	c.(781-783)Ctg>Atg	p.L261M		NM_207346.2	NP_997229.2	Q7Z6J9	SEN54_HUMAN	TSEN54 tRNA splicing endonuclease subunit	261					mRNA processing (GO:0006397)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)	13	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			CTTTCAGCTTCTGGGGTCCCT	0.701																																						dbGAP											0													9.0	13.0	12.0					17																	73517943		2127	4218	6345	-	-	-	SO:0001583	missense	0			AK097583	CCDS11724.1	17q25.1	2013-08-06	2013-08-06		ENSG00000182173	ENSG00000182173		"""tRNA splicing endonuclease subunits"""	27561	protein-coding gene	gene with protein product		608755	"""tRNA splicing endonuclease 54 homolog (SEN54, S. cerevisiae)"", ""tRNA splicing endonuclease 54 homolog (S. cerevisiae)"""			15109492	Standard	NM_207346		Approved	SEN54, SEN54L	uc002jof.1	Q7Z6J9		ENST00000333213.6:c.781C>A	17.37:g.73517943C>A	ENSP00000327487:p.Leu261Met		Q86WV3|Q86XE4|Q8N9H2	Missense_Mutation	SNP	NULL	p.L261M	ENST00000333213.6	37	c.781	CCDS11724.1	17	.	.	.	.	.	.	.	.	.	.	C	11.65	1.702888	0.30232	.	.	ENSG00000182173	ENST00000333213	T	0.58210	0.35	5.41	3.33	0.38152	.	0.741838	0.12310	N	0.480291	T	0.60495	0.2273	M	0.62723	1.935	0.09310	N	1	D	0.61080	0.989	P	0.54401	0.751	T	0.48990	-0.8985	10	0.49607	T	0.09	-1.646	9.3626	0.38206	0.0:0.8136:0.0:0.1864	.	261	Q7Z6J9	SEN54_HUMAN	M	261	ENSP00000327487:L261M	ENSP00000327487:L261M	L	+	1	2	TSEN54	71029538	0.001000	0.12720	0.180000	0.23079	0.308000	0.27856	1.101000	0.31037	0.580000	0.29522	-0.367000	0.07326	CTG	TSEN54	-	NULL	ENSG00000182173		0.701	TSEN54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSEN54	HGNC	protein_coding	OTTHUMT00000447618.1	8	0.00	0	C	NM_207346		73517943	73517943	+1	no_errors	ENST00000333213	ensembl	human	known	69_37n	missense	6	40.00	4	SNP	0.036	A
TTC4	7268	genome.wustl.edu	37	1	55182279	55182279	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:55182279G>C	ENST00000371281.3	+	2	205	c.118G>C	c.(118-120)Gaa>Caa	p.E40Q	TTC4_ENST00000371284.5_3'UTR|MROH7-TTC4_ENST00000414150.2_Missense_Mutation_p.L1275F	NM_004623.4	NP_004614.3	O95801	TTC4_HUMAN	tetratricopeptide repeat domain 4	40										breast(2)|endometrium(3)|kidney(1)|lung(2)|stomach(1)	9						ACAGGAATTTGAAAAGGTCCC	0.393																																						dbGAP											0													83.0	84.0	83.0					1																	55182279		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS596.1	1p32	2013-01-11			ENSG00000243725	ENSG00000243725		"""Tetratricopeptide (TTC) repeat domain containing"""	12394	protein-coding gene	gene with protein product		606753				9933562	Standard	NM_004623		Approved	MGC5097, FLJ41930	uc001cxx.4	O95801	OTTHUMG00000009914	ENST00000371281.3:c.118G>C	1.37:g.55182279G>C	ENSP00000360329:p.Glu40Gln		Q53Y95|Q5TA96|Q9H3I2	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR-contain_dom	p.E40Q	ENST00000371281.3	37	c.118	CCDS596.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.15|17.15	3.316691|3.316691	0.60524|0.60524	.|.	.|.	ENSG00000243725|ENSG00000184313	ENST00000371281;ENST00000371284|ENST00000414867	T|.	0.15256|.	2.44|.	4.92|4.92	4.92|4.92	0.64577|0.64577	.|.	.|1.946880	.|0.02326	.|N	.|0.073464	T|T	0.75295|0.75295	0.3830|0.3830	L|L	0.55743|0.55743	1.74|1.74	0.42061|0.42061	D|D	0.991163|0.991163	B;B|.	0.25563|.	0.129;0.103|.	B;B|.	0.24541|.	0.054;0.033|.	T|T	0.60535|0.60535	-0.7244|-0.7244	9|7	0.51188|0.72032	T|D	0.08|0.01	-3.5527|-3.5527	16.0014|16.0014	0.80294|0.80294	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	40;51|.	O95801;Q5TA95|.	TTC4_HUMAN;.|.	Q|F	40;51|1283	ENSP00000360329:E40Q|.	ENSP00000360329:E40Q|ENSP00000403054:L1283F	E|L	+|+	1|3	0|2	TTC4|HEATR8	54954867|54954867	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	5.122000|5.122000	0.64697|0.64697	2.720000|2.720000	0.93068|0.93068	0.655000|0.655000	0.94253|0.94253	GAA|TTG	TTC4	-	NULL	ENSG00000243725		0.393	TTC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC4	HGNC	protein_coding	OTTHUMT00000027432.1	71	0.00	0	G	NM_004623		55182279	55182279	+1	no_errors	ENST00000371281	ensembl	human	known	69_37n	missense	48	24.62	16	SNP	1.000	C
TTLL6	284076	genome.wustl.edu	37	17	46894360	46894360	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr17:46894360C>T	ENST00000393382.3	-	1	216	c.75G>A	c.(73-75)gcG>gcA	p.A25A	TTLL6_ENST00000470462.2_5'UTR	NM_001130918.1	NP_001124390.1			tubulin tyrosine ligase-like family, member 6											endometrium(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						CGTCTCGCCCCGCTGGGCTGC	0.652																																						dbGAP											0													38.0	47.0	44.0					17																	46894360		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK093127	CCDS11537.2, CCDS45724.1	17q21.32	2013-02-14			ENSG00000170703	ENSG00000170703		"""Tubulin tyrosine ligase-like family"""	26664	protein-coding gene	gene with protein product		610849				15890843	Standard	NM_173623		Approved	FLJ35808	uc021tzm.1	Q8N841	OTTHUMG00000156978	ENST00000393382.3:c.75G>A	17.37:g.46894360C>T				Missense_Mutation	SNP	NULL	p.R27Q	ENST00000393382.3	37	c.80	CCDS45724.1	17																																																																																			TTLL6	-	NULL	ENSG00000170703		0.652	TTLL6-003	KNOWN	downstream_ATG|non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	TTLL6	HGNC	protein_coding	OTTHUMT00000346939.3	23	0.00	0	C	NM_173623		46894360	46894360	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000376681	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	0.017	T
TTN	7273	genome.wustl.edu	37	2	179485612	179485612	+	Missense_Mutation	SNP	C	C	G	rs140795503		TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:179485612C>G	ENST00000591111.1	-	197	41026	c.40802G>C	c.(40801-40803)aGa>aCa	p.R13601T	TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R12674T|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R6302T|TTN_ENST00000589042.1_Missense_Mutation_p.R15242T|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R6177T|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R6369T|TTN-AS1_ENST00000604956.1_RNA|TTN-AS1_ENST00000456053.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13601	Ig-like 92.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCTTCATTTCTGAACCATTT	0.413																																						dbGAP											0													125.0	120.0	121.0					2																	179485612		1865	4086	5951	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.40802G>C	2.37:g.179485612C>G	ENSP00000465570:p.Arg13601Thr		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.R12674T	ENST00000591111.1	37	c.38021		2	.	.	.	.	.	.	.	.	.	.	C	12.65	2.002016	0.35320	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.47528	0.84;0.84;0.84;0.84	5.83	5.83	0.93111	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.45256	0.1333	L	0.59436	1.845	0.35916	D	0.831432	P;P;P;P	0.38677	0.642;0.642;0.642;0.642	B;B;B;B	0.39971	0.315;0.315;0.315;0.315	T	0.60026	-0.7343	9	0.87932	D	0	.	7.637	0.28272	0.0:0.8074:0.0:0.1926	.	6177;6302;6369;13601	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	12674;6177;6369;6302;6177	ENSP00000343764:R12674T;ENSP00000434586:R6177T;ENSP00000340554:R6369T;ENSP00000352154:R6302T	ENSP00000340554:R6369T	R	-	2	0	TTN	179193857	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.969000	0.63735	2.756000	0.94617	0.655000	0.94253	AGA	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,pfscan_Ig-like	ENSG00000155657		0.413	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	85	0.00	0	C	NM_133378		179485612	179485612	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	59	21.33	16	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179586739	179586739	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:179586739C>G	ENST00000591111.1	-	76	21924	c.21700G>C	c.(21700-21702)Gat>Cat	p.D7234H	RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.D6307H|TTN_ENST00000359218.5_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.D7551H|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin	12802	Ig-like 54.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCTTGTTATCTTTTGACCAA	0.418																																						dbGAP											0													264.0	247.0	253.0					2																	179586739		1930	4133	6063	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.21700G>C	2.37:g.179586739C>G	ENSP00000465570:p.Asp7234His		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.D6307H	ENST00000591111.1	37	c.18919		2	.	.	.	.	.	.	.	.	.	.	C	12.51	1.960387	0.34565	.	.	ENSG00000155657	ENST00000342992	T	0.51817	0.69	6.16	6.16	0.99307	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.76737	0.4029	M	0.93978	3.48	0.80722	D	1	D	0.65815	0.995	P	0.60541	0.876	T	0.81433	-0.0935	9	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	7234	Q8WZ42	TITIN_HUMAN	H	6307	ENSP00000343764:D6307H	ENSP00000343764:D6307H	D	-	1	0	TTN	179294984	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.055000	0.71103	2.937000	0.99478	0.650000	0.86243	GAT	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000155657		0.418	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	118	0.00	0	C	NM_133378		179586739	179586739	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	81	30.77	36	SNP	1.000	G
TUBA1A	7846	genome.wustl.edu	37	12	49580117	49580117	+	Silent	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:49580117G>C	ENST00000295766.5	-	3	830	c.351C>G	c.(349-351)ctC>ctG	p.L117L	TUBA1A_ENST00000550767.1_Silent_p.L82L|TUBA1A_ENST00000301071.7_Silent_p.L117L|TUBA1A_ENST00000546918.1_Missense_Mutation_p.S168W	NM_001270399.1	NP_001257328.1	Q71U36	TBA1A_HUMAN	tubulin, alpha 1a	117					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			stomach(1)|upper_aerodigestive_tract(1)	2					Albendazole(DB00518)|Mebendazole(DB00643)|Vinblastine(DB00570)	GGTCCAACACGAGGTCAATGA	0.413																																					Pancreas(111;782 2307 24613 44561)|NSCLC(165;1667 2752 9496 39006)|Ovarian(19;24 776 10875 37451)	dbGAP											0													150.0	150.0	150.0					12																	49580117		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF141347	CCDS8781.1, CCDS58226.1, CCDS58227.1	12q13.12	2007-02-07						"""Tubulins"""	20766	protein-coding gene	gene with protein product	"""tubulin, alpha, brain-specific"""	602529				11504633, 3839072	Standard	NM_006009		Approved	TUBA3, B-ALPHA-1, FLJ25113	uc010smg.1	Q71U36	OTTHUMG00000169511	ENST00000295766.5:c.351C>G	12.37:g.49580117G>C			A8K0B8|G3V1U9|P04687|P05209	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,prints_Tubulin,prints_Alpha_tubulin	p.S168W	ENST00000295766.5	37	c.503	CCDS58227.1	12	.	.	.	.	.	.	.	.	.	.	G	0.294	-0.977858	0.02197	.	.	ENSG00000167552	ENST00000546918	T	0.63096	-0.02	5.22	-10.4	0.00318	.	.	.	.	.	T	0.56171	0.1967	.	.	.	0.27115	N	0.962271	.	.	.	.	.	.	T	0.68066	-0.5507	6	0.87932	D	0	.	9.5611	0.39369	0.1152:0.3535:0.4713:0.0601	.	.	.	.	W	168	ENSP00000446613:S168W	ENSP00000446613:S168W	S	-	2	0	TUBA1A	47866384	0.000000	0.05858	0.007000	0.13788	0.951000	0.60555	-2.935000	0.00686	-4.436000	0.00049	-1.267000	0.01435	TCG	TUBA1A	-	NULL	ENSG00000167552		0.413	TUBA1A-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	TUBA1A	HGNC	protein_coding	OTTHUMT00000404547.2	90	0.00	0	G	NM_006009		49580117	49580117	-1	no_errors	ENST00000546918	ensembl	human	putative	69_37n	missense	75	13.79	12	SNP	0.013	C
TUBGCP3	10426	genome.wustl.edu	37	13	113140349	113140349	+	Silent	SNP	A	A	G	rs41288614	byFrequency	TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr13:113140349A>G	ENST00000261965.3	-	22	2868	c.2682T>C	c.(2680-2682)cgT>cgC	p.R894R		NM_006322.4	NP_006313.1	Q96CW5	GCP3_HUMAN	tubulin, gamma complex associated protein 3	894					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|single fertilization (GO:0007338)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|polar microtubule (GO:0005827)|spindle (GO:0005819)	gamma-tubulin binding (GO:0043015)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|urinary_tract(1)	25	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)					CCAGAGACACACGGAGCCTGG	0.582													a|||	329	0.0656949	0.0461	0.0692	5008	,	,		18149	0.0615		0.1223	False		,,,				2504	0.0358					dbGAP											0													36.0	30.0	32.0					13																	113140349		2202	4295	6497	-	-	-	SO:0001819	synonymous_variant	0			AF042378	CCDS9525.1, CCDS66584.1, CCDS73599.1	13q34	2008-07-18			ENSG00000126216	ENSG00000126216			18598	protein-coding gene	gene with protein product	"""spindle pole body protein"""					9566967, 9566969	Standard	XM_005268293		Approved	GCP3, Spc98p, SPBC98	uc001vse.1	Q96CW5	OTTHUMG00000017367	ENST00000261965.3:c.2682T>C	13.37:g.113140349A>G			O43631|O60852|O60853|Q5T8L2|Q7Z4K1|Q96I79	Silent	SNP	pfam_Spc97_Spc98	p.R894	ENST00000261965.3	37	c.2682	CCDS9525.1	13																																																																																			TUBGCP3	-	NULL	ENSG00000126216		0.582	TUBGCP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP3	HGNC	protein_coding	OTTHUMT00000045825.2	15	0.00	0	A	NM_006322		113140349	113140349	-1	no_errors	ENST00000261965	ensembl	human	known	69_37n	silent	12	25.00	4	SNP	0.027	G
TUBGCP5	114791	genome.wustl.edu	37	15	22866752	22866752	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr15:22866752G>A	ENST00000283645.4	+	17	2494	c.2364G>A	c.(2362-2364)aaG>aaA	p.K788K	TUBGCP5_ENST00000453949.2_Silent_p.K788K	NM_052903.4	NP_443135.3	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5	788					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gamma-tubulin ring complex (GO:0008274)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(5)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	46		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		ACACAGCTAAGAAGAAGCTGC	0.343																																						dbGAP											0													102.0	96.0	98.0					15																	22866752		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB067486	CCDS73697.1, CCDS73698.1	15q11.1	2014-04-17			ENSG00000153575	ENSG00000275835			18600	protein-coding gene	gene with protein product	"""gamma-tubulin complex component GCP5"""	608147				11694571	Standard	NM_052903		Approved	GCP5, KIAA1899	uc001yur.4	Q96RT8	OTTHUMG00000188371	ENST00000283645.4:c.2364G>A	15.37:g.22866752G>A			E9PB12|Q6IQ52|Q96PY8	Missense_Mutation	SNP	pfam_Spc97_Spc98	p.E110K	ENST00000283645.4	37	c.328	CCDS10008.1	15																																																																																			TUBGCP5	-	pfam_Spc97_Spc98	ENSG00000153575		0.343	TUBGCP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP5	HGNC	protein_coding	OTTHUMT00000250998.2	94	0.00	0	G	NM_052903		22866752	22866752	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000561214	ensembl	human	novel	69_37n	missense	59	32.18	28	SNP	1.000	A
TULP4	56995	genome.wustl.edu	37	6	158923524	158923524	+	Silent	SNP	G	G	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr6:158923524G>T	ENST00000367097.3	+	13	4186	c.2829G>T	c.(2827-2829)ctG>ctT	p.L943L	TULP4_ENST00000367094.2_Intron	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	943					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		GTGCCACCCTGAACCGCCTGA	0.682																																						dbGAP											0													58.0	59.0	59.0					6																	158923524		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.2829G>T	6.37:g.158923524G>T			Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Silent	SNP	pfam_Tubby_C,pfam_SOCS_C,pfam_WD40_repeat,superfamily_Tubby_C-like,superfamily_WD40_repeat_dom,superfamily_Tumour_necrosis_fac-like,smart_WD40_repeat,smart_SOCS_C,pfscan_SOCS_C,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L943	ENST00000367097.3	37	c.2829	CCDS34561.1	6																																																																																			TULP4	-	NULL	ENSG00000130338		0.682	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TULP4	HGNC	protein_coding	OTTHUMT00000042869.1	20	0.00	0	G	NM_020245		158923524	158923524	+1	no_errors	ENST00000367097	ensembl	human	known	69_37n	silent	11	26.67	4	SNP	1.000	T
TWIST2	117581	genome.wustl.edu	37	2	239757036	239757036	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:239757036C>T	ENST00000448943.2	+	1	364	c.180C>T	c.(178-180)tcC>tcT	p.S60S		NM_057179.2	NP_476527.1	Q8WVJ9	TWST2_HUMAN	twist family bHLH transcription factor 2	60					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)										GCGCGCAGTCCTTCGAGGAGC	0.692																																						dbGAP											0													27.0	29.0	29.0					2																	239757036		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			BC017907	CCDS46558.1	2q37.3	2013-10-17	2013-10-17		ENSG00000233608	ENSG00000233608		"""Basic helix-loop-helix proteins"""	20670	protein-coding gene	gene with protein product		607556	"""twist homolog 2 (Drosophila)"", ""twist basic helix-loop-helix transcription factor 2"""			7589808, 9061034	Standard	NM_057179		Approved	DERMO1, Dermo-1, bHLHa39	uc021vyw.2	Q8WVJ9	OTTHUMG00000152836	ENST00000448943.2:c.180C>T	2.37:g.239757036C>T			Q3SYL6	Silent	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.S60	ENST00000448943.2	37	c.180	CCDS46558.1	2																																																																																			TWIST2	-	NULL	ENSG00000233608		0.692	TWIST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TWIST2	HGNC	protein_coding	OTTHUMT00000393081.1	14	0.00	0	C			239757036	239757036	+1	no_errors	ENST00000448943	ensembl	human	known	69_37n	silent	14	39.13	9	SNP	0.968	T
UBASH3A	53347	genome.wustl.edu	37	21	43862675	43862675	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr21:43862675G>C	ENST00000319294.6	+	12	1631	c.1600G>C	c.(1600-1602)Gag>Cag	p.E534Q	UBASH3A_ENST00000291535.6_Missense_Mutation_p.E496Q|UBASH3A_ENST00000398367.1_Missense_Mutation_p.E496Q	NM_018961.3	NP_061834.1	P57075	UBS3A_HUMAN	ubiquitin associated and SH3 domain containing A	534	Phosphatase-like.				negative regulation of T cell receptor signaling pathway (GO:0050860)|regulation of cytokine production (GO:0001817)	cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(9)|lung(12)|ovary(3)	28						AGAGCTGAAAGAGGCAAATTT	0.413																																						dbGAP											0													110.0	108.0	109.0					21																	43862675		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ277750	CCDS13687.1, CCDS33566.1, CCDS58791.1	21q22.3	2010-04-28	2010-04-28		ENSG00000160185	ENSG00000160185			12462	protein-coding gene	gene with protein product		605736				11281453	Standard	NM_018961		Approved	STS-2, TULA, CLIP4	uc002zbf.3	P57075	OTTHUMG00000086805	ENST00000319294.6:c.1600G>C	21.37:g.43862675G>C	ENSP00000317327:p.Glu534Gln		G5E9E4|Q6HA34|Q6HA35|Q6ISI6|Q6ISK3|Q6ISS9	Missense_Mutation	SNP	pfam_His_Pase_superF_clade-1,pfam_SH3_domain,superfamily_SH3_domain,superfamily_UBA-like,smart_SH3_domain,pfscan_SH3_domain,pfscan_UBA/transl_elong_EF1B_N_euk	p.E534Q	ENST00000319294.6	37	c.1600	CCDS13687.1	21	.	.	.	.	.	.	.	.	.	.	G	11.85	1.762849	0.31228	.	.	ENSG00000160185	ENST00000291535;ENST00000319294;ENST00000398367	T;T;T	0.73469	-0.75;-0.75;-0.75	4.79	3.68	0.42216	Histidine phosphatase superfamily, clade-1 (1);	0.191507	0.35838	N	0.002949	T	0.65481	0.2695	L	0.54965	1.715	0.09310	N	0.999994	P;P;P	0.41597	0.712;0.712;0.756	B;B;B	0.39027	0.142;0.142;0.288	T	0.56715	-0.7933	10	0.17832	T	0.49	-20.8146	10.9401	0.47268	0.1089:0.0:0.8911:0.0	.	496;496;534	G5E9E4;P57075-2;P57075	.;.;UBS3A_HUMAN	Q	496;534;496	ENSP00000291535:E496Q;ENSP00000317327:E534Q;ENSP00000381408:E496Q	ENSP00000291535:E496Q	E	+	1	0	UBASH3A	42735744	0.998000	0.40836	0.533000	0.28001	0.207000	0.24258	3.213000	0.51153	2.221000	0.72209	0.579000	0.79373	GAG	UBASH3A	-	pfam_His_Pase_superF_clade-1	ENSG00000160185		0.413	UBASH3A-001	KNOWN	basic|CCDS	protein_coding	UBASH3A	HGNC	protein_coding	OTTHUMT00000195382.1	46	0.00	0	G	NM_001001895		43862675	43862675	+1	no_errors	ENST00000319294	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	0.074	C
UBXN6	80700	genome.wustl.edu	37	19	4445603	4445603	+	Silent	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr19:4445603C>G	ENST00000301281.6	-	11	1342	c.1218G>C	c.(1216-1218)ctG>ctC	p.L406L	MIR4746_ENST00000579802.1_RNA|UBXN6_ENST00000394765.3_Silent_p.L353L|CTB-50L17.7_ENST00000588798.1_RNA	NM_025241.2	NP_079517.1	Q9BZV1	UBXN6_HUMAN	UBX domain protein 6	406	UBX. {ECO:0000255|PROSITE- ProRule:PRU00215}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				NS(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	12						ACGAGAAGGTCAGGAGGGCAG	0.677																																						dbGAP											0													75.0	80.0	79.0					19																	4445603		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF272893	CCDS12129.1, CCDS54201.1	19p13	2008-07-25	2008-07-25	2008-07-25		ENSG00000167671		"""UBX domain containing"""	14928	protein-coding gene	gene with protein product		611946	"""UBX domain-containing 1"", ""UBX domain containing 1"""	UBXD1		11342112	Standard	NM_025241		Approved	UBXDC2	uc002man.2	Q9BZV1		ENST00000301281.6:c.1218G>C	19.37:g.4445603C>G			D6W626|Q96AH1|Q96IK9|Q9BZV0	Missense_Mutation	SNP	pfam_PUB_domain,pfam_UBX,smart_PUG-dom,smart_UBX,pfscan_UBX	p.D336H	ENST00000301281.6	37	c.1006	CCDS12129.1	19																																																																																			UBXN6	-	pfam_UBX,smart_UBX,pfscan_UBX	ENSG00000167671		0.677	UBXN6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UBXN6	HGNC	protein_coding	OTTHUMT00000458447.3	19	0.00	0	C	NM_025241		4445603	4445603	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000591919	ensembl	human	novel	69_37n	missense	23	30.30	10	SNP	1.000	G
USP11	8237	genome.wustl.edu	37	X	47104784	47104784	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chrX:47104784G>A	ENST00000218348.3	+	17	2302	c.2302G>A	c.(2302-2304)Gac>Aac	p.D768N	USP11_ENST00000377107.2_Missense_Mutation_p.D725N	NM_004651.3	NP_004642.2	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	768	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|ovary(3)|pancreas(1)|stomach(1)	40						CGTGAAGCATGACTGCGTCGG	0.597																																						dbGAP											0													68.0	52.0	57.0					X																	47104784		2203	4300	6503	-	-	-	SO:0001583	missense	0			U44839	CCDS14277.1	Xp11.23	2008-02-05	2005-08-08		ENSG00000102226	ENSG00000102226		"""Ubiquitin-specific peptidases"""	12609	protein-coding gene	gene with protein product		300050	"""ubiquitin specific protease 11"""			12838346	Standard	XM_005272674		Approved	UHX1	uc004dhp.3	P51784	OTTHUMG00000021437	ENST00000218348.3:c.2302G>A	X.37:g.47104784G>A	ENSP00000218348:p.Asp768Asn		B2RTX1|Q8IUG6|Q9BWE1	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Pept_C19_DUSP,smart_Pept_C19_DUSP,pfscan_Peptidase_C19	p.D768N	ENST00000218348.3	37	c.2302	CCDS14277.1	X	.	.	.	.	.	.	.	.	.	.	G	11.40	1.628531	0.28978	.	.	ENSG00000102226	ENST00000377107;ENST00000218348	T;T	0.21543	2.01;2.0	4.92	4.92	0.64577	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	1.437190	0.04153	N	0.321720	T	0.23289	0.0563	N	0.25245	0.725	0.31291	N	0.689472	B;P	0.36392	0.091;0.551	B;B	0.40285	0.21;0.325	T	0.21143	-1.0254	10	0.35671	T	0.21	-10.705	14.158	0.65430	0.0:0.0:1.0:0.0	.	494;768	B3KP28;P51784	.;UBP11_HUMAN	N	725;768	ENSP00000366311:D725N;ENSP00000218348:D768N	ENSP00000218348:D768N	D	+	1	0	USP11	46989728	1.000000	0.71417	0.945000	0.38365	0.495000	0.33615	2.737000	0.47393	2.031000	0.59945	0.436000	0.28706	GAC	USP11	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000102226		0.597	USP11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP11	HGNC	protein_coding		60	0.00	0	G	NM_004651		47104784	47104784	+1	no_errors	ENST00000218348	ensembl	human	known	69_37n	missense	41	32.79	20	SNP	0.998	A
USP8	9101	genome.wustl.edu	37	15	50786430	50786430	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr15:50786430G>C	ENST00000396444.3	+	16	2949	c.2611G>C	c.(2611-2613)Gaa>Caa	p.E871Q	USP8_ENST00000433963.1_Missense_Mutation_p.E871Q|RP11-562A8.5_ENST00000560159.1_lincRNA|RP11-562A8.4_ENST00000560380.1_RNA|USP8_ENST00000425032.3_Missense_Mutation_p.E765Q|USP8_ENST00000307179.4_Missense_Mutation_p.E871Q	NM_001128610.1|NM_005154.3	NP_001122082.1|NP_005145.3	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	871	USP.				cell proliferation (GO:0008283)|endosome organization (GO:0007032)|mitotic cytokinesis (GO:0000281)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|Ras protein signal transduction (GO:0007265)|ubiquitin-dependent protein catabolic process (GO:0006511)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|midbody (GO:0030496)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		AGATTCACAAGAATTGCTTCT	0.378																																						dbGAP											0													123.0	116.0	118.0					15																	50786430		2196	4294	6490	-	-	-	SO:0001583	missense	0			D29956	CCDS10137.1, CCDS61632.1	15q21.1	2014-03-03	2005-08-08		ENSG00000138592	ENSG00000138592		"""Ubiquitin-specific peptidases"""	12631	protein-coding gene	gene with protein product		603158	"""ubiquitin specific protease 8"""			12838346, 9582025, 24482476	Standard	NM_005154		Approved	HumORF8, KIAA0055, UBPY, SPG59	uc001zyl.4	P40818	OTTHUMG00000131645	ENST00000396444.3:c.2611G>C	15.37:g.50786430G>C	ENSP00000379721:p.Glu871Gln		B4DKA8|Q2TB31|Q7Z3U2|Q86VA0|Q8IWI7	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_DUF1873,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,superfamily_WW_Rsp5_WWP,pfscan_Rhodanese-like_dom,pfscan_Peptidase_C19	p.E871Q	ENST00000396444.3	37	c.2611	CCDS10137.1	15	.	.	.	.	.	.	.	.	.	.	G	28.4	4.919314	0.92249	.	.	ENSG00000138592	ENST00000396444;ENST00000433963;ENST00000307179;ENST00000425032;ENST00000419830;ENST00000396440	T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25	5.18	5.18	0.71444	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	D	0.89223	0.6654	H	0.98089	4.145	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.93143	0.6543	10	0.87932	D	0	-24.2561	19.0607	0.93091	0.0:0.0:1.0:0.0	.	765;871	B4DKA8;P40818	.;UBP8_HUMAN	Q	871;871;871;765;96;91	ENSP00000379721:E871Q;ENSP00000405537:E871Q;ENSP00000302239:E871Q;ENSP00000412682:E765Q	ENSP00000302239:E871Q	E	+	1	0	USP8	48573722	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.577000	0.86979	0.650000	0.86243	GAA	USP8	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000138592		0.378	USP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP8	HGNC	protein_coding	OTTHUMT00000254541.1	41	0.00	0	G	NM_005154		50786430	50786430	+1	no_errors	ENST00000307179	ensembl	human	known	69_37n	missense	28	33.33	14	SNP	1.000	C
VWA3A	146177	genome.wustl.edu	37	16	22145727	22145727	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr16:22145727G>A	ENST00000389398.5	+	21	2203	c.2107G>A	c.(2107-2109)Gag>Aag	p.E703K	VWA3A_ENST00000389397.4_5'UTR	NM_173615.3	NP_775886.3	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	703	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.					extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				GBM - Glioblastoma multiforme(48;0.0439)		CATCATGTCTGAGATGGAAAA	0.502																																						dbGAP											0													60.0	60.0	60.0					16																	22145727		1978	4177	6155	-	-	-	SO:0001583	missense	0			AK128606, AK098260	CCDS45441.1	16p12.1	2008-02-05				ENSG00000175267			27088	protein-coding gene	gene with protein product						12477932	Standard	XM_006721021		Approved	FLJ46765, FLJ40941	uc010vbq.2	A6NCI4		ENST00000389398.5:c.2107G>A	16.37:g.22145727G>A	ENSP00000374049:p.Glu703Lys		A4QMU8|A6NNC0|Q6UTX4|Q6ZQZ9|Q8IUY6|Q8N9W1	Missense_Mutation	SNP	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.E703K	ENST00000389398.5	37	c.2107	CCDS45441.1	16	.	.	.	.	.	.	.	.	.	.	G	21.3	4.123982	0.77436	.	.	ENSG00000175267	ENST00000389398;ENST00000299840	T	0.33438	1.41	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.58438	0.2122	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.61202	-0.7110	10	0.56958	D	0.05	.	17.6519	0.88167	0.0:0.0:1.0:0.0	.	703;327	A6NCI4;A6NCI4-2	VWA3A_HUMAN;.	K	703;326	ENSP00000374049:E703K	ENSP00000299840:E326K	E	+	1	0	VWA3A	22053228	1.000000	0.71417	0.952000	0.39060	0.438000	0.31896	6.306000	0.72810	2.569000	0.86673	0.655000	0.94253	GAG	VWA3A	-	NULL	ENSG00000175267		0.502	VWA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA3A	HGNC	protein_coding	OTTHUMT00000430052.1	74	0.00	0	G			22145727	22145727	+1	no_errors	ENST00000389398	ensembl	human	known	69_37n	missense	66	20.48	17	SNP	0.992	A
VAC14	55697	genome.wustl.edu	37	16	70765530	70765530	+	Splice_Site	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr16:70765530C>G	ENST00000261776.5	-	14	1789	c.1529G>C	c.(1528-1530)gGt>gCt	p.G510A		NM_018052.3	NP_060522.3	Q08AM6	VAC14_HUMAN	Vac14 homolog (S. cerevisiae)	510					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of lipid kinase activity (GO:0043550)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|PAS complex (GO:0070772)	receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(10)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Ovarian(137;0.0699)				GCCTTTGGTACCTGTAGAGAA	0.393																																						dbGAP											0													126.0	128.0	127.0					16																	70765530		2198	4300	6498	-	-	-	SO:0001630	splice_region_variant	0			AK056433	CCDS10896.1	16q22.1	2010-03-23	2005-02-09		ENSG00000103043	ENSG00000103043			25507	protein-coding gene	gene with protein product		604632	"""Tax1 (human T-cell leukemia virus type I) binding protein 2"""	TAX1BP2		15542851, 12719380	Standard	NM_018052		Approved	FLJ10305, ArPIKfyve	uc002ezm.3	Q08AM6	OTTHUMG00000137583	ENST00000261776.5:c.1529-1G>C	16.37:g.70765530C>G			B3KPJ5|B3KSM8|Q13174|Q6IA12|Q7L4Y1|Q9BW96|Q9H6V6	Missense_Mutation	SNP	pfam_DUF3434,pfam_HEAT,superfamily_ARM-type_fold	p.G510A	ENST00000261776.5	37	c.1529	CCDS10896.1	16	.	.	.	.	.	.	.	.	.	.	C	12.67	2.008982	0.35415	.	.	ENSG00000103043	ENST00000261776	.	.	.	5.43	4.47	0.54385	Armadillo-type fold (1);	0.456384	0.25598	N	0.029563	T	0.45054	0.1323	L	0.51422	1.61	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29336	-1.0015	9	0.06494	T	0.89	.	9.7312	0.40361	0.1389:0.7895:0.0:0.0715	.	510	Q08AM6	VAC14_HUMAN	A	510	.	ENSP00000261776:G510A	G	-	2	0	VAC14	69323031	0.999000	0.42202	1.000000	0.80357	0.931000	0.56810	2.503000	0.45407	1.411000	0.46957	0.655000	0.94253	GGT	VAC14	-	superfamily_ARM-type_fold	ENSG00000103043		0.393	VAC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAC14	HGNC	protein_coding	OTTHUMT00000268973.3	38	0.00	0	C	NM_018052	Missense_Mutation	70765530	70765530	-1	no_errors	ENST00000261776	ensembl	human	known	69_37n	missense	18	30.77	8	SNP	1.000	G
VWA3B	200403	genome.wustl.edu	37	2	98709585	98709585	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:98709585C>G	ENST00000477737.1	+	2	234	c.30C>G	c.(28-30)atC>atG	p.I10M	VWA3B_ENST00000451075.2_5'UTR|VWA3B_ENST00000435344.1_Missense_Mutation_p.I10M	NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	10										NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						CTTCTACCATCTCTGAGCAGC	0.443																																						dbGAP											0													75.0	71.0	72.0					2																	98709585		1936	4156	6092	-	-	-	SO:0001583	missense	0			AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.30C>G	2.37:g.98709585C>G	ENSP00000417955:p.Ile10Met		B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.I10M	ENST00000477737.1	37	c.30	CCDS42718.1	2	.	.	.	.	.	.	.	.	.	.	C	14.43	2.534289	0.45073	.	.	ENSG00000168658	ENST00000435344;ENST00000477737	T;T	0.41758	0.99;0.99	5.22	2.44	0.29823	.	1.148320	0.06323	N	0.704852	T	0.40670	0.1126	L	0.44542	1.39	0.19300	N	0.999979	P;P	0.47677	0.838;0.899	B;P	0.45610	0.293;0.487	T	0.31280	-0.9949	10	0.72032	D	0.01	.	6.118	0.20137	0.1547:0.6799:0.0:0.1654	.	10;10	Q502W6;Q502W6-8	VWA3B_HUMAN;.	M	10	ENSP00000401959:I10M;ENSP00000417955:I10M	ENSP00000411168:I10M	I	+	3	3	VWA3B	98076017	0.000000	0.05858	0.406000	0.26421	0.879000	0.50718	0.348000	0.20031	0.876000	0.35872	0.650000	0.86243	ATC	VWA3B	-	NULL	ENSG00000168658		0.443	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA3B	HGNC	protein_coding	OTTHUMT00000353469.2	45	0.00	0	C	NM_144992		98709585	98709585	+1	no_errors	ENST00000477737	ensembl	human	known	69_37n	missense	29	27.50	11	SNP	0.042	G
WAC	51322	genome.wustl.edu	37	10	28905140	28905140	+	Missense_Mutation	SNP	C	C	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr10:28905140C>A	ENST00000354911.4	+	12	1756	c.1595C>A	c.(1594-1596)tCt>tAt	p.S532Y	WAC_ENST00000375664.4_Missense_Mutation_p.S487Y|WAC_ENST00000375646.1_Missense_Mutation_p.S380Y|WAC_ENST00000347934.4_Missense_Mutation_p.S429Y	NM_016628.4	NP_057712.2	Q9BTA9	WAC_HUMAN	WW domain containing adaptor with coiled-coil	532					cellular response to DNA damage stimulus (GO:0006974)|G1 DNA damage checkpoint (GO:0044783)|histone H2B conserved C-terminal lysine ubiquitination (GO:0071894)|histone monoubiquitination (GO:0010390)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	chromatin binding (GO:0003682)|RNA polymerase II core binding (GO:0000993)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|urinary_tract(1)	32						AATCATACTTCTAATAGTAGT	0.408																																						dbGAP											0													141.0	131.0	134.0					10																	28905140		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055852	CCDS7159.1, CCDS7160.1, CCDS7161.1	10p12.1	2007-05-17	2003-03-19		ENSG00000095787	ENSG00000095787			17327	protein-coding gene	gene with protein product		615049	"""WW domain-containing adaptor with coiled coil"""			11827461	Standard	NR_024557		Approved	Wwp4, FLJ31290, PRO1741, BM-016, MGC10753	uc001iuf.3	Q9BTA9	OTTHUMG00000017872	ENST00000354911.4:c.1595C>A	10.37:g.28905140C>A	ENSP00000346986:p.Ser532Tyr		A8K2A9|C9JBT9|D3DRW5|D3DRW6|D3DRW7|Q53EN9|Q5JU75|Q5JU77|Q5VXK0|Q5VXK2|Q8TCK1|Q96DP3|Q96FW6|Q96JI3	Missense_Mutation	SNP	pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP	p.S532Y	ENST00000354911.4	37	c.1595	CCDS7159.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.54|16.54	3.151723|3.151723	0.57151|0.57151	.|.	.|.	ENSG00000095787|ENSG00000095787	ENST00000338396|ENST00000375664;ENST00000375646;ENST00000347934;ENST00000354911	.|T;T;T;T	.|0.52526	.|0.66;0.66;0.66;0.66	5.51|5.51	4.59|4.59	0.56863|0.56863	.|.	.|0.310233	.|0.40469	.|N	.|0.001085	T|T	0.48352|0.48352	0.1495|0.1495	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	.|D;P;D	.|0.60160	.|0.987;0.955;0.978	.|P;P;P	.|0.55303	.|0.773;0.542;0.598	T|T	0.55711|0.55711	-0.8098|-0.8098	6|10	0.87932|0.72032	D|D	0|0.01	-2.9264|-2.9264	16.242|16.242	0.82418|0.82418	0.0:0.8626:0.1374:0.0|0.0:0.8626:0.1374:0.0	.|.	.|487;429;532	.|Q9BTA9-2;Q9BTA9-5;Q9BTA9	.|.;.;WAC_HUMAN	I|Y	95|487;380;429;532	.|ENSP00000364816:S487Y;ENSP00000364797:S380Y;ENSP00000311106:S429Y;ENSP00000346986:S532Y	ENSP00000341462:L95I|ENSP00000311106:S429Y	L|S	+|+	1|2	2|0	WAC|WAC	28945146|28945146	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.943000|0.943000	0.58893|0.58893	3.585000|3.585000	0.53943|0.53943	1.423000|1.423000	0.47198|0.47198	0.655000|0.655000	0.94253|0.94253	CTA|TCT	WAC	-	NULL	ENSG00000095787		0.408	WAC-017	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	WAC	HGNC	protein_coding	OTTHUMT00000047371.1	50	0.00	0	C	NM_100264		28905140	28905140	+1	no_errors	ENST00000354911	ensembl	human	known	69_37n	missense	19	40.62	13	SNP	1.000	A
WDR17	116966	genome.wustl.edu	37	4	177032810	177032810	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr4:177032810G>A	ENST00000280190.4	+	3	307	c.151G>A	c.(151-153)Gac>Aac	p.D51N	WDR17_ENST00000393643.2_Missense_Mutation_p.D27N|WDR17_ENST00000508596.1_Missense_Mutation_p.D27N|WDR17_ENST00000507824.2_Missense_Mutation_p.D51N			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	51										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		TGCCAGTGGAGACAGGTTTGC	0.373																																						dbGAP											0													138.0	125.0	129.0					4																	177032810		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.151G>A	4.37:g.177032810G>A	ENSP00000280190:p.Asp51Asn		E7EQX0|Q0QD35	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.D51N	ENST00000280190.4	37	c.151	CCDS3825.1	4	.	.	.	.	.	.	.	.	.	.	G	14.81	2.645739	0.47258	.	.	ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000296524;ENST00000507824	T;T;T	0.59502	0.29;0.32;0.26	5.39	5.39	0.77823	WD40/YVTN repeat-like-containing domain (1);	0.054132	0.64402	D	0.000001	T	0.45397	0.1340	N	0.17082	0.46	0.80722	D	1	P;B;P	0.40066	0.569;0.011;0.701	B;B;B	0.38458	0.274;0.006;0.274	T	0.43972	-0.9358	10	0.36615	T	0.2	-8.828	19.1629	0.93541	0.0:0.0:1.0:0.0	.	27;51;51	E7EQX0;E7ESC9;Q8IZU2	.;.;WDR17_HUMAN	N	27;27;51;27;51	ENSP00000422763:D27N;ENSP00000377258:D27N;ENSP00000280190:D51N	ENSP00000280190:D51N	D	+	1	0	WDR17	177269804	1.000000	0.71417	0.992000	0.48379	0.043000	0.13939	9.116000	0.94341	2.513000	0.84729	0.467000	0.42956	GAC	WDR17	-	NULL	ENSG00000150627		0.373	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR17	HGNC	protein_coding	OTTHUMT00000362334.2	78	0.00	0	G			177032810	177032810	+1	no_errors	ENST00000280190	ensembl	human	known	69_37n	missense	40	33.33	21	SNP	1.000	A
WDR66	144406	genome.wustl.edu	37	12	122395093	122395093	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr12:122395093C>T	ENST00000288912.4	+	11	2503	c.1649C>T	c.(1648-1650)tCa>tTa	p.S550L	WDR66_ENST00000397454.2_Missense_Mutation_p.S550L	NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	550							calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		CTGTCCTTTTCAAAGACCCCA	0.403																																					Esophageal Squamous(85;849 1794 49757 52143)	dbGAP											0													130.0	123.0	125.0					12																	122395093		1848	4101	5949	-	-	-	SO:0001583	missense	0			AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.1649C>T	12.37:g.122395093C>T	ENSP00000288912:p.Ser550Leu		C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.S550L	ENST00000288912.4	37	c.1649	CCDS41853.1	12	.	.	.	.	.	.	.	.	.	.	C	16.50	3.139358	0.56936	.	.	ENSG00000158023	ENST00000288912;ENST00000397454	T;T	0.30182	1.54;1.54	5.4	5.4	0.78164	WD40 repeat-like-containing domain (1);	0.071197	0.64402	D	0.000018	T	0.35998	0.0951	M	0.69823	2.125	0.39499	D	0.968168	B	0.06786	0.001	B	0.12837	0.008	T	0.22173	-1.0224	10	0.54805	T	0.06	.	14.5174	0.67827	0.1473:0.8526:0.0:0.0	.	550	Q8TBY9	WDR66_HUMAN	L	550	ENSP00000288912:S550L;ENSP00000380595:S550L	ENSP00000288912:S550L	S	+	2	0	WDR66	120879476	0.997000	0.39634	0.046000	0.18839	0.973000	0.67179	4.654000	0.61469	2.535000	0.85469	0.585000	0.79938	TCA	WDR66	-	superfamily_WD40_repeat_dom	ENSG00000158023		0.403	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR66	HGNC	protein_coding	OTTHUMT00000401700.1	61	0.00	0	C	NM_144668		122395093	122395093	+1	no_errors	ENST00000288912	ensembl	human	known	69_37n	missense	52	28.38	21	SNP	0.623	T
TBC1D31	93594	genome.wustl.edu	37	8	124117616	124117616	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr8:124117616G>A	ENST00000287380.1	+	8	1211	c.1121G>A	c.(1120-1122)aGa>aAa	p.R374K	TBC1D31_ENST00000378080.2_Missense_Mutation_p.R269K|TBC1D31_ENST00000518805.1_Missense_Mutation_p.R7K|TBC1D31_ENST00000522420.1_Missense_Mutation_p.R269K|TBC1D31_ENST00000327098.5_Missense_Mutation_p.R374K|TBC1D31_ENST00000309336.3_Missense_Mutation_p.R374K|TBC1D31_ENST00000521676.1_Missense_Mutation_p.R269K	NM_145647.3	NP_663622.2	Q96DN5	TBC31_HUMAN	TBC1 domain family, member 31	374						centrosome (GO:0005813)	Rab GTPase activator activity (GO:0005097)										ACATCAGGGAGAGTACAGCAG	0.358																																						dbGAP											0													59.0	58.0	58.0					8																	124117616		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK094612	CCDS6338.1, CCDS47916.1	8q24.13	2013-07-10	2013-07-10	2013-07-10	ENSG00000156787	ENSG00000156787		"""WD repeat domain containing"""	30888	protein-coding gene	gene with protein product			"""WD repeat domain 67"""	WDR67		12477932	Standard	NM_001145088		Approved	MGC21654, Gm85	uc003ypp.2	Q96DN5	OTTHUMG00000165081	ENST00000287380.1:c.1121G>A	8.37:g.124117616G>A	ENSP00000287380:p.Arg374Lys		B7ZL19|Q2M2J9|Q3MIR6|Q8TBP9	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Rab-GTPase-TBC_dom,smart_WD40_repeat,pfscan_Rab-GTPase-TBC_dom,pfscan_WD40_repeat_dom	p.R374K	ENST00000287380.1	37	c.1121	CCDS6338.1	8	.	.	.	.	.	.	.	.	.	.	G	4.714	0.132834	0.09032	.	.	ENSG00000156787	ENST00000287380;ENST00000309336;ENST00000519418;ENST00000327098;ENST00000522420;ENST00000521676;ENST00000378080;ENST00000518805	T;T;T;T;T;T;T;T	0.78364	-0.14;-0.13;0.97;-0.12;-0.6;-0.79;-1.17;1.89	4.66	2.44	0.29823	.	0.405910	0.27016	N	0.021345	T	0.69287	0.3094	M	0.61703	1.905	0.09310	N	0.999999	B;B;B	0.22851	0.001;0.076;0.0	B;B;B	0.22152	0.002;0.038;0.002	T	0.56438	-0.7979	10	0.30854	T	0.27	-3.7059	6.0256	0.19652	0.1968:0.0:0.647:0.1562	.	374;269;374	B7ZL19;E7ERK7;Q96DN5	.;.;WDR67_HUMAN	K	374;374;42;374;269;269;269;7	ENSP00000287380:R374K;ENSP00000308358:R374K;ENSP00000430927:R42K;ENSP00000312701:R374K;ENSP00000429334:R269K;ENSP00000430628:R269K;ENSP00000367320:R269K;ENSP00000429494:R7K	ENSP00000287380:R374K	R	+	2	0	WDR67	124186797	1.000000	0.71417	0.466000	0.27168	0.219000	0.24729	1.281000	0.33214	0.934000	0.37316	0.558000	0.71614	AGA	WDR67	-	NULL	ENSG00000156787		0.358	TBC1D31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR67	HGNC	protein_coding	OTTHUMT00000381721.1	77	0.00	0	G	NM_145647		124117616	124117616	+1	no_errors	ENST00000287380	ensembl	human	known	69_37n	missense	42	32.81	21	SNP	0.178	A
XRN1	54464	genome.wustl.edu	37	3	142123867	142123867	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr3:142123867C>G	ENST00000264951.4	-	16	1882	c.1765G>C	c.(1765-1767)Gag>Cag	p.E589Q	RNU6-1294P_ENST00000515995.1_RNA|XRN1_ENST00000392981.2_Missense_Mutation_p.E589Q	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	589					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						CTTTTCCTCTCTTCCTTTTTG	0.403																																						dbGAP											0													161.0	147.0	152.0					3																	142123867		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.1765G>C	3.37:g.142123867C>G	ENSP00000264951:p.Glu589Gln		Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	pfam_Put_53exo,pirsf_5_3_exoribonuclease_1	p.E589Q	ENST00000264951.4	37	c.1765	CCDS3123.1	3	.	.	.	.	.	.	.	.	.	.	C	27.1	4.803724	0.90623	.	.	ENSG00000114127	ENST00000264951;ENST00000392981	T;T	0.29655	1.56;1.56	5.53	5.53	0.82687	.	0.112157	0.64402	D	0.000016	T	0.58963	0.2159	M	0.83603	2.65	0.80722	D	1	D;D;D	0.67145	0.992;0.987;0.996	P;P;P	0.62382	0.836;0.901;0.872	T	0.64015	-0.6506	10	0.66056	D	0.02	-16.3389	19.4498	0.94862	0.0:1.0:0.0:0.0	.	450;589;589	B3KW17;Q8IZH2-2;Q8IZH2	.;.;XRN1_HUMAN	Q	589	ENSP00000264951:E589Q;ENSP00000376707:E589Q	ENSP00000264951:E589Q	E	-	1	0	XRN1	143606557	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.784000	0.75084	2.590000	0.87494	0.650000	0.86243	GAG	XRN1	-	pirsf_5_3_exoribonuclease_1	ENSG00000114127		0.403	XRN1-001	KNOWN	basic|CCDS	protein_coding	XRN1	HGNC	protein_coding	OTTHUMT00000354087.2	79	0.00	0	C	NM_019001		142123867	142123867	-1	no_errors	ENST00000264951	ensembl	human	known	69_37n	missense	76	28.30	30	SNP	1.000	G
YEATS2	55689	genome.wustl.edu	37	3	183508693	183508693	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr3:183508693G>A	ENST00000305135.5	+	21	3217	c.3022G>A	c.(3022-3024)Gcc>Acc	p.A1008T		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	1008					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			CTGCAAGGCTGCCACCCCCAC	0.557																																						dbGAP											0													98.0	109.0	106.0					3																	183508693		2059	4204	6263	-	-	-	SO:0001583	missense	0			AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.3022G>A	3.37:g.183508693G>A	ENSP00000306983:p.Ala1008Thr		A7E2B9|D3DNS9|Q641P6|Q9NW96	Missense_Mutation	SNP	pfam_YEATS,pfscan_YEATS	p.A1008T	ENST00000305135.5	37	c.3022	CCDS43175.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.21|10.21	1.287464|1.287464	0.23478|0.23478	.|.	.|.	ENSG00000163872|ENSG00000163872	ENST00000421660;ENST00000305135|ENST00000432781	T|.	0.31247|.	1.5|.	5.44|5.44	-2.06|-2.06	0.07298|0.07298	.|.	1.044020|.	0.07494|.	N|.	0.906133|.	T|T	0.14917|0.14917	0.0360|0.0360	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.06405|.	0.002;0.0|.	T|T	0.27123|0.27123	-1.0083|-1.0083	10|5	0.22706|.	T|.	0.39|.	-0.264|-0.264	5.8589|5.8589	0.18734|0.18734	0.4143:0.2297:0.3559:0.0|0.4143:0.2297:0.3559:0.0	.|.	170;1008|.	Q8N5H6;Q9ULM3|.	.;YETS2_HUMAN|.	T|Y	1008|193	ENSP00000306983:A1008T|.	ENSP00000306983:A1008T|.	A|C	+|+	1|2	0|0	YEATS2|YEATS2	184991387|184991387	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.621000|0.621000	0.37620|0.37620	-0.463000|-0.463000	0.06696|0.06696	-0.840000|-0.840000	0.04206|0.04206	0.585000|0.585000	0.79938|0.79938	GCC|TGC	YEATS2	-	NULL	ENSG00000163872		0.557	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YEATS2	HGNC	protein_coding	OTTHUMT00000346507.2	55	0.00	0	G	NM_018023		183508693	183508693	+1	no_errors	ENST00000305135	ensembl	human	known	69_37n	missense	40	23.08	12	SNP	0.000	A
MAP3K19	80122	genome.wustl.edu	37	2	135738782	135738782	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr2:135738782G>A	ENST00000375845.3	-	9	3559	c.3529C>T	c.(3529-3531)Ctc>Ttc	p.L1177F	MAP3K19_ENST00000392918.3_Missense_Mutation_p.L311F|MAP3K19_ENST00000392917.3_Missense_Mutation_p.L309F|MAP3K19_ENST00000358371.4_Missense_Mutation_p.L1064F|MAP3K19_ENST00000392915.1_3'UTR|MAP3K19_ENST00000315513.3_Missense_Mutation_p.L38F|MAP3K19_ENST00000375844.3_Missense_Mutation_p.L359F	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	1177	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)										TTCTCATGGAGATAAGCAACA	0.413																																						dbGAP											0													145.0	142.0	143.0					2																	135738782		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.3529C>T	2.37:g.135738782G>A	ENSP00000365005:p.Leu1177Phe		B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L1177F	ENST00000375845.3	37	c.3529	CCDS2176.2	2	.	.	.	.	.	.	.	.	.	.	G	18.74	3.688019	0.68271	.	.	ENSG00000176601	ENST00000375845;ENST00000358371;ENST00000375844;ENST00000392918;ENST00000392917;ENST00000437365;ENST00000315513	T;T;T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9;0.9;0.9	5.75	4.69	0.59074	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.37261	N	0.002175	T	0.69043	0.3067	M	0.91872	3.25	0.44261	D	0.997116	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.994;0.999;0.996;0.996;0.999	T	0.74910	-0.3503	10	0.87932	D	0	.	11.1948	0.48707	0.1274:0.0:0.8726:0.0	.	309;1064;311;359;1177	B7ZMH9;Q56UN5-3;Q56UN5-4;Q56UN5-5;Q56UN5	.;.;.;.;YSK4_HUMAN	F	1177;1064;359;311;309;567;38	ENSP00000365005:L1177F;ENSP00000351140:L1064F;ENSP00000365004:L359F;ENSP00000376650:L311F;ENSP00000376649:L309F;ENSP00000392827:L567F;ENSP00000321160:L38F	ENSP00000321160:L38F	L	-	1	0	YSK4	135455252	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.219000	0.72231	2.714000	0.92807	0.563000	0.77884	CTC	YSK4	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000176601		0.413	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	YSK4	HGNC	protein_coding	OTTHUMT00000158244.1	80	0.00	0	G	NM_025052		135738782	135738782	-1	no_errors	ENST00000375845	ensembl	human	known	69_37n	missense	50	30.56	22	SNP	1.000	A
ZBTB8OS	339487	genome.wustl.edu	37	1	33099258	33099258	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr1:33099258G>A	ENST00000468695.1	-	4	369	c.351C>T	c.(349-351)ttC>ttT	p.F117F	ZBTB8OS_ENST00000373501.2_Silent_p.F105F|ZBTB8OS_ENST00000341885.5_Intron|ZBTB8OS_ENST00000492007.1_Intron	NM_178547.2	NP_848642.1	Q8IWT0	ARCH_HUMAN	zinc finger and BTB domain containing 8 opposite strand	105					tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	extracellular vesicular exosome (GO:0070062)|tRNA-splicing ligase complex (GO:0072669)	metal ion binding (GO:0046872)			endometrium(1)|lung(4)|upper_aerodigestive_tract(1)	6		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				GGGGTATGAAGAATTCATCAG	0.313																																						dbGAP											0													52.0	56.0	55.0					1																	33099258		2203	4296	6499	-	-	-	SO:0001819	synonymous_variant	0			AY151084	CCDS365.1	1p35.1	2010-09-30			ENSG00000176261	ENSG00000176261			24094	protein-coding gene	gene with protein product	"""archease"""	615891				12477932	Standard	NM_178547		Approved	ARCH	uc001bvp.3	Q8IWT0	OTTHUMG00000007856	ENST00000468695.1:c.351C>T	1.37:g.33099258G>A			Q5TGK5|Q6PDA1|Q8IWS9|Q8NEV6|Q8NEV7	Missense_Mutation	SNP	pfam_Archease_dom,superfamily_Archease_dom	p.L116F	ENST00000468695.1	37	c.346	CCDS365.1	1	.	.	.	.	.	.	.	.	.	.	G	9.468	1.094861	0.20471	.	.	ENSG00000176261	ENST00000436661	.	.	.	5.4	3.5	0.40072	.	.	.	.	.	T	0.58722	0.2142	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53429	-0.8440	4	.	.	.	-8.7959	8.9009	0.35495	0.2992:0.0:0.7008:0.0	.	.	.	.	F	116	.	.	L	-	1	0	ZBTB8OS	32871845	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.836000	0.48183	0.751000	0.32900	0.655000	0.94253	CTT	ZBTB8OS	-	pfam_Archease_dom,superfamily_Archease_dom	ENSG00000176261		0.313	ZBTB8OS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB8OS	HGNC	protein_coding	OTTHUMT00000021669.3	20	0.00	0	G	NM_178547		33099258	33099258	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000436661	ensembl	human	known	69_37n	missense	23	36.11	13	SNP	1.000	A
ZC3H14	79882	genome.wustl.edu	37	14	89077251	89077251	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr14:89077251G>A	ENST00000251038.5	+	16	2396	c.2171G>A	c.(2170-2172)cGa>cAa	p.R724Q	ZC3H14_ENST00000557607.1_Missense_Mutation_p.R408Q|ZC3H14_ENST00000336693.4_Missense_Mutation_p.R559Q|ZC3H14_ENST00000555755.1_Missense_Mutation_p.R718Q|ZC3H14_ENST00000393514.5_Missense_Mutation_p.R699Q|ZC3H14_ENST00000406216.3_Missense_Mutation_p.R270Q|ZC3H14_ENST00000302216.8_Missense_Mutation_p.R567Q|ZC3H14_ENST00000359301.3_Missense_Mutation_p.R559Q|ZC3H14_ENST00000555900.1_Missense_Mutation_p.R426Q|ZC3H14_ENST00000318308.6_Missense_Mutation_p.R294Q|ZC3H14_ENST00000556945.1_Missense_Mutation_p.R593Q	NM_001160103.1|NM_001160104.1|NM_024824.4	NP_001153575.1|NP_001153576.1|NP_079100.2	Q6PJT7	ZC3HE_HUMAN	zinc finger CCCH-type containing 14	724						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(2)	21						GTCCCACCACGACATGCCTTG	0.378																																						dbGAP											0													210.0	177.0	188.0					14																	89077251		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF155107	CCDS32133.1, CCDS32134.1, CCDS32135.1, CCDS32136.1, CCDS55938.1	14q31.3	2014-08-12			ENSG00000100722	ENSG00000100722		"""Zinc fingers, CCCH-type domain containing"""	20509	protein-coding gene	gene with protein product		613279				10508479	Standard	NM_024824		Approved	FLJ11806, UKp68, NY-REN-37	uc001xww.3	Q6PJT7	OTTHUMG00000170803	ENST00000251038.5:c.2171G>A	14.37:g.89077251G>A	ENSP00000251038:p.Arg724Gln		A8MY46|B4DXU8|B4DZW7|B4E2H4|G3V5R4|Q6MZU4|Q6PJ32|Q6PUI6|Q6PUI8|Q86TQ5|Q86TW0|Q86TW1|Q8NCT6|Q8NCZ3|Q8TDE2|Q9HAC9|Q9Y5A0	Missense_Mutation	SNP	smart_Znf_CCCH	p.R724Q	ENST00000251038.5	37	c.2171	CCDS32133.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.281110|5.281110	0.95489|0.95489	.|.	.|.	ENSG00000100722|ENSG00000100722	ENST00000556000|ENST00000251038;ENST00000393530;ENST00000353091;ENST00000359301;ENST00000302216;ENST00000380684;ENST00000556945;ENST00000557607;ENST00000555755;ENST00000393514;ENST00000336693;ENST00000318308;ENST00000555900;ENST00000406216;ENST00000555792	.|.	.|.	.|.	5.97|5.97	5.97|5.97	0.96955|0.96955	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.79387|0.79387	0.4437|0.4437	M|M	0.72118|0.72118	2.19|2.19	0.43234|0.43234	D|D	0.995134|0.995134	.|D;D;D;D;D;D;D;D	.|0.89917	.|0.999;0.999;1.0;1.0;1.0;1.0;0.998;1.0	.|D;D;D;D;D;D;D;D	.|0.83275	.|0.996;0.983;0.964;0.988;0.955;0.996;0.944;0.988	T|T	0.74435|0.74435	-0.3666|-0.3666	5|9	.|0.31617	.|T	.|0.26	-12.8055|-12.8055	20.4135|20.4135	0.99023|0.99023	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|593;573;718;723;270;294;567;724	.|G3V256;F8W848;G3V5R4;Q6PJT7-2;Q6PJT7-8;Q6PJT7-6;Q6PJT7-3;Q6PJT7	.|.;.;.;.;.;.;.;ZC3HE_HUMAN	N|Q	639|724;699;661;559;567;573;593;408;718;699;559;294;426;270;139	.|.	.|ENSP00000251038:R724Q	D|R	+|+	1|2	0|0	ZC3H14|ZC3H14	88147004|88147004	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	9.213000|9.213000	0.95133|0.95133	2.835000|2.835000	0.97688|0.97688	0.591000|0.591000	0.81541|0.81541	GAC|CGA	ZC3H14	-	NULL	ENSG00000100722		0.378	ZC3H14-001	KNOWN	basic|CCDS	protein_coding	ZC3H14	HGNC	protein_coding	OTTHUMT00000410387.1	109	0.00	0	G	NM_024824		89077251	89077251	+1	no_errors	ENST00000251038	ensembl	human	known	69_37n	missense	84	28.81	34	SNP	1.000	A
ZC3HAV1	56829	genome.wustl.edu	37	7	138739960	138739960	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr7:138739960C>G	ENST00000242351.5	-	10	2494	c.2178G>C	c.(2176-2178)aaG>aaC	p.K726N	ZC3HAV1_ENST00000464606.1_Missense_Mutation_p.K848N	NM_020119.3	NP_064504.2	Q7Z2W4	ZCCHV_HUMAN	zinc finger CCCH-type, antiviral 1	726	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of mRNA catabolic process (GO:0061014)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(4)|skin(1)	37						CCTTATATTTCTTTGAGGATA	0.388																																						dbGAP											0													137.0	137.0	137.0					7																	138739960		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX571742	CCDS5851.1, CCDS55171.1	7q34	2012-07-05			ENSG00000105939	ENSG00000105939		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	23721	protein-coding gene	gene with protein product	"""zinc finger antiviral protein"", "" CCCH-type zinc finger antiviral protein"""	607312				12215647, 12851707	Standard	NM_024625		Approved	ZAP, FLB6421, FLJ13288, MGC48898, ZC3HDC2, ZC3H2, PARP13	uc003vun.3	Q7Z2W4	OTTHUMG00000157471	ENST00000242351.5:c.2178G>C	7.37:g.138739960C>G	ENSP00000242351:p.Lys726Asn		A4D1R2|A4D1S4|Q8IW57|Q8TAJ3|Q96N79|Q9H8R9|Q9P0Y7	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_WWE-dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.K726N	ENST00000242351.5	37	c.2178	CCDS5851.1	7	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.080698	0.00375	.	.	ENSG00000105939	ENST00000242351;ENST00000464606	T;T	0.07114	3.22;3.22	3.68	-5.47	0.02600	Poly(ADP-ribose) polymerase, catalytic domain (1);	1.260810	0.05489	N	0.556180	T	0.01905	0.0060	N	0.00996	-1.065	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41413	-0.9510	10	0.14252	T	0.57	.	1.2865	0.02052	0.2636:0.2985:0.2945:0.1435	.	726	Q7Z2W4	ZCCHV_HUMAN	N	726;848	ENSP00000242351:K726N;ENSP00000418385:K848N	ENSP00000242351:K726N	K	-	3	2	ZC3HAV1	138390500	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.649000	0.05384	-1.082000	0.03101	-3.102000	0.00063	AAG	ZC3HAV1	-	pfscan_Poly(ADP-ribose)pol_cat_dom	ENSG00000105939		0.388	ZC3HAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3HAV1	HGNC	protein_coding	OTTHUMT00000348915.1	37	0.00	0	C	NM_020119		138739960	138739960	-1	no_errors	ENST00000242351	ensembl	human	known	69_37n	missense	17	34.62	9	SNP	0.000	G
ZBTB14	7541	genome.wustl.edu	37	18	5290995	5290995	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr18:5290995C>T	ENST00000357006.4	-	4	1550	c.1212G>A	c.(1210-1212)ctG>ctA	p.L404L	ZBTB14_ENST00000400143.3_Silent_p.L404L	NM_001143823.2|NM_001243704.1	NP_001137295.1|NP_001230633.1	O43829	ZBT14_HUMAN	zinc finger and BTB domain containing 14	404					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)										CGTGCCTTTTCAGATCAGATG	0.522																																						dbGAP											0													212.0	159.0	177.0					18																	5290995		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D89859	CCDS11837.1	18p11.31	2013-09-19	2013-01-08	2013-01-08	ENSG00000198081	ENSG00000198081		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12860	protein-coding gene	gene with protein product		602126	"""zinc finger protein 161 homolog (mouse)"", ""zinc finger protein 161"", ""ZFP161 zinc finger protein"""	ZFP161		9244432	Standard	NM_001243702		Approved	ZNF478	uc010dkp.3	O43829	OTTHUMG00000131563	ENST00000357006.4:c.1212G>A	18.37:g.5290995C>T			O00403|Q2TB80	Silent	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.L404	ENST00000357006.4	37	c.1212	CCDS11837.1	18																																																																																			ZFP161	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198081		0.522	ZBTB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP161	HGNC	protein_coding	OTTHUMT00000254425.1	96	0.00	0	C	NM_003409		5290995	5290995	-1	no_errors	ENST00000357006	ensembl	human	known	69_37n	silent	86	14.85	15	SNP	0.999	T
ZFYVE26	23503	genome.wustl.edu	37	14	68229058	68229058	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr14:68229058C>T	ENST00000347230.4	-	34	6369	c.6231G>A	c.(6229-6231)ggG>ggA	p.G2077G	ZFYVE26_ENST00000557306.1_5'Flank|ZFYVE26_ENST00000555452.1_Silent_p.G2077G	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	2077					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		CAGTGAGGTTCCCGGCTTTGA	0.562																																						dbGAP											0													88.0	72.0	77.0					14																	68229058		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.6231G>A	14.37:g.68229058C>T			B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Silent	SNP	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.G2077	ENST00000347230.4	37	c.6231	CCDS9788.1	14																																																																																			ZFYVE26	-	NULL	ENSG00000072121		0.562	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE26	HGNC	protein_coding	OTTHUMT00000412736.2	56	0.00	0	C	NM_015346		68229058	68229058	-1	no_errors	ENST00000347230	ensembl	human	known	69_37n	silent	25	27.78	10	SNP	0.987	T
ZMYND8	23613	genome.wustl.edu	37	20	45891111	45891111	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr20:45891111G>C	ENST00000311275.7	-	12	1735	c.1482C>G	c.(1480-1482)ttC>ttG	p.F494L	ZMYND8_ENST00000396281.4_Missense_Mutation_p.F494L|ZMYND8_ENST00000536340.1_Missense_Mutation_p.F521L|ZMYND8_ENST00000352431.2_Missense_Mutation_p.F514L|ZMYND8_ENST00000458360.2_Missense_Mutation_p.F489L|ZMYND8_ENST00000461685.1_Missense_Mutation_p.F514L|ZMYND8_ENST00000262975.4_Missense_Mutation_p.F494L|ZMYND8_ENST00000540497.1_Intron|ZMYND8_ENST00000355972.4_Missense_Mutation_p.F494L|ZMYND8_ENST00000372023.3_Missense_Mutation_p.F489L|ZMYND8_ENST00000360911.3_Missense_Mutation_p.F489L|ZMYND8_ENST00000471951.2_Missense_Mutation_p.F514L|ZMYND8_ENST00000446994.2_Missense_Mutation_p.F431L|ZMYND8_ENST00000468376.2_5'UTR	NM_001281772.1|NM_001281778.1|NM_001281783.1	NP_001268701.1|NP_001268707.1|NP_001268712.1	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8	494					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|prostate(3)|skin(2)|urinary_tract(8)	62			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			GTTGAGGAGAGAAGGGCTTTG	0.493																																						dbGAP											0													168.0	151.0	157.0					20																	45891111		2203	4300	6503	-	-	-	SO:0001583	missense	0			U48251	CCDS13404.1, CCDS13405.1, CCDS46613.1, CCDS63300.1, CCDS63301.1, CCDS63304.1, CCDS63306.1, CCDS74738.1	20q13.12	2013-01-28	2007-01-29	2007-01-29	ENSG00000101040	ENSG00000101040		"""Zinc fingers, MYND-type"", ""Zinc fingers, PHD-type"""	9397	protein-coding gene	gene with protein product		615713	"""protein kinase C binding protein 1"""	PRKCBP1			Standard	NM_001281769		Approved	RACK7	uc002xtb.1	Q9ULU4	OTTHUMG00000032667	ENST00000311275.7:c.1482C>G	20.37:g.45891111G>C	ENSP00000312237:p.Phe494Leu		B3KVL2|B7Z2A8|B7Z3E0|B7Z680|B7ZM62|E1P5U5|F5H0X3|H7C0U2|J3KPU3|Q13517|Q2HXV1|Q2HXV2|Q2HXV3|Q2HXV4|Q2HXV7|Q2HXV8|Q2HXV9|Q2HXW0|Q2HXW1|Q2HXW2|Q4JJ94|Q4JJ95|Q5TH09|Q5TH11|Q6MZM1|Q8WXC5|Q9H1F3|Q9H1F4|Q9H1F5|Q9H1L8|Q9H1L9|Q9H2G5|Q9NYN3|Q9UIX6	Missense_Mutation	SNP	pfam_DUF3544,pfam_Bromodomain,pfam_PWWP,pfam_Znf_PHD-finger,pfam_Znf_MYND,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Bromodomain,smart_PWWP,pfscan_PWWP,pfscan_Znf_MYND,pfscan_Znf_PHD-finger,pfscan_Bromodomain	p.F521L	ENST00000311275.7	37	c.1563		20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.09|14.09	2.432032|2.432032	0.43122|0.43122	.|.	.|.	ENSG00000101040|ENSG00000101040	ENST00000360911;ENST00000311275;ENST00000458360;ENST00000262975;ENST00000471951;ENST00000352431;ENST00000396281;ENST00000536340;ENST00000355972;ENST00000446994;ENST00000461685;ENST00000372023|ENST00000467200	D;D;D;D;D;D;D;D;D;D;D;D|.	0.89875|.	-1.69;-1.61;-1.71;-1.6;-1.63;-1.58;-1.74;-1.63;-1.62;-2.58;-1.61;-1.71|.	5.34|5.34	4.39|4.39	0.52855|0.52855	.|.	0.101713|.	0.64402|.	D|.	0.000001|.	T|T	0.59321|0.59321	0.2185|0.2185	L|L	0.44542|0.44542	1.39|1.39	0.42364|0.42364	D|D	0.99242|0.99242	B;B;B;P;P;B;B;B;P;P;B;B;B;P;D;B|.	0.56035|.	0.305;0.05;0.062;0.51;0.51;0.062;0.05;0.313;0.454;0.454;0.313;0.062;0.363;0.51;0.974;0.062|.	B;B;B;B;B;B;B;B;B;B;B;B;B;B;D;B|.	0.70487|.	0.216;0.061;0.101;0.216;0.216;0.101;0.061;0.174;0.137;0.137;0.174;0.101;0.216;0.216;0.969;0.101|.	T|T	0.56902|0.56902	-0.7902|-0.7902	10|5	0.19147|.	T|.	0.46|.	-15.3843|-15.3843	13.9084|13.9084	0.63850|0.63850	0.0735:0.0:0.9265:0.0|0.0735:0.0:0.9265:0.0	.|.	489;521;489;489;469;488;514;494;489;514;514;494;431;489;514;494|.	B7ZM62;F5H0X3;Q2HXV7;Q2HXV3;Q5TH11;Q5JV90;Q9ULU4-7;Q9ULU4-9;Q9ULU4-14;Q9ULU4-12;Q9ULU4-13;Q9ULU4;B3KVL2;Q2HXV9;Q9ULU4-8;B7Z2A8|.	.;.;.;.;.;.;.;.;.;.;.;PKCB1_HUMAN;.;.;.;.|.	L|V	489;494;489;494;514;514;494;521;494;431;514;489|421	ENSP00000354166:F489L;ENSP00000312237:F494L;ENSP00000392964:F489L;ENSP00000262975:F494L;ENSP00000420095:F514L;ENSP00000335537:F514L;ENSP00000379577:F494L;ENSP00000439800:F521L;ENSP00000348246:F494L;ENSP00000396725:F431L;ENSP00000418210:F514L;ENSP00000361093:F489L|.	ENSP00000262975:F494L|.	F|L	-|-	3|1	2|0	ZMYND8|ZMYND8	45324518|45324518	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.875000|0.875000	0.50365|0.50365	1.999000|1.999000	0.40806|0.40806	1.253000|1.253000	0.44018|0.44018	0.585000|0.585000	0.79938|0.79938	TTC|CTC	ZMYND8	-	pfam_DUF3544	ENSG00000101040		0.493	ZMYND8-007	KNOWN	basic	protein_coding	ZMYND8	HGNC	protein_coding	OTTHUMT00000079596.2	108	0.00	0	G	NM_183047		45891111	45891111	-1	no_errors	ENST00000536340	ensembl	human	known	69_37n	missense	79	19.39	19	SNP	1.000	C
ZNF12	7559	genome.wustl.edu	37	7	6731836	6731836	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr7:6731836G>C	ENST00000405858.1	-	5	1278	c.737C>G	c.(736-738)tCt>tGt	p.S246C	ZNF12_ENST00000404360.1_Missense_Mutation_p.S172C|AC073343.13_ENST00000366167.2_RNA|AC073343.2_ENST00000577401.1_RNA|ZNF12_ENST00000342651.5_Missense_Mutation_p.S208C	NM_006956.2|NM_016265.3	NP_008887.2|NP_057349.2	P17014	ZNF12_HUMAN	zinc finger protein 12	246					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(3)	16		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0231)		GGCTATTTCAGATCCATTCCA	0.398																																						dbGAP											0													54.0	58.0	57.0					7																	6731836		2118	4260	6378	-	-	-	SO:0001583	missense	0			X52334, AB021643	CCDS47538.1, CCDS47539.1	7p21.1	2013-01-08	2005-06-09		ENSG00000164631	ENSG00000164631		"""Zinc fingers, C2H2-type"", ""-"""	12902	protein-coding gene	gene with protein product		194536	"""zinc finger protein 325"""	ZNF325			Standard	NM_016265		Approved	KOX3, GIOT-3	uc003sqt.1	P17014	OTTHUMG00000151910	ENST00000405858.1:c.737C>G	7.37:g.6731836G>C	ENSP00000385939:p.Ser246Cys		A8MYC4|A8WFQ8|B2RNQ7|B4DF45|Q6N016|Q8NHZ0|Q9H9P0|Q9ULZ6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S246C	ENST00000405858.1	37	c.737	CCDS47538.1	7	.	.	.	.	.	.	.	.	.	.	G	1.569	-0.534640	0.04082	.	.	ENSG00000164631	ENST00000404360;ENST00000405858;ENST00000342651;ENST00000399476;ENST00000330442	T;T;T	0.38560	1.13;3.06;3.06	4.03	4.03	0.46877	Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.172209	0.28382	N	0.015555	T	0.13670	0.0331	N	0.00075	-2.25	0.32813	D	0.501656	D;B	0.64830	0.994;0.019	P;B	0.55545	0.778;0.014	T	0.35126	-0.9801	10	0.02654	T	1	.	10.0665	0.42306	0.0:0.2047:0.7953:0.0	.	246;208	P17014;P17014-5	ZNF12_HUMAN;.	C	172;246;208;304;210	ENSP00000384405:S172C;ENSP00000385939:S246C;ENSP00000344745:S208C	ENSP00000331039:S210C	S	-	2	0	ZNF12	6698361	0.022000	0.18835	0.741000	0.31004	0.981000	0.71138	0.394000	0.20834	2.531000	0.85337	0.563000	0.77884	TCT	ZNF12	-	NULL	ENSG00000164631		0.398	ZNF12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF12	HGNC	protein_coding	OTTHUMT00000324373.2	42	0.00	0	G	NM_016265		6731836	6731836	-1	no_errors	ENST00000405858	ensembl	human	known	69_37n	missense	47	16.07	9	SNP	1.000	C
ZNF135	7694	genome.wustl.edu	37	19	58578410	58578410	+	Silent	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr19:58578410C>T	ENST00000313434.5	+	5	659	c.558C>T	c.(556-558)agC>agT	p.S186S	ZNF135_ENST00000439855.2_Silent_p.S186S|ZNF135_ENST00000359978.6_Silent_p.S198S|ZNF135_ENST00000511556.1_Silent_p.S198S|RN7SL526P_ENST00000469492.2_RNA|ZNF135_ENST00000506786.1_Silent_p.S144S|ZNF135_ENST00000401053.4_Silent_p.S210S	NM_003436.3	NP_003427.3	P52742	ZN135_HUMAN	zinc finger protein 135	186					cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(26)|ovary(1)|skin(1)|urinary_tract(1)	41		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		AAAGACAAAGCCCCCACACAT	0.473																																						dbGAP											0													58.0	57.0	57.0					19																	58578410		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U09413	CCDS12970.1, CCDS12970.2, CCDS54329.1, CCDS54330.1, CCDS74471.1, CCDS74472.1	19q13.4	2013-01-08	2006-05-12			ENSG00000176293		"""Zinc fingers, C2H2-type"", ""-"""	12919	protein-coding gene	gene with protein product		604077	"""zinc finger protein 61"", ""zinc finger protein 135 (clone pHZ-17)"""	ZNF61, ZNF78L1		7557990, 1505991	Standard	NM_003436		Approved	pHZ-17	uc002qrg.3	P52742		ENST00000313434.5:c.558C>T	19.37:g.58578410C>T			B4DHH9|E9PEV2|F5GYY9|I3L0B3|Q5U5L3|Q8N1I7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A204V	ENST00000313434.5	37	c.611		19	.	.	.	.	.	.	.	.	.	.	C	2.872	-0.233753	0.05983	.	.	ENSG00000176293	ENST00000391699	.	.	.	3.63	-7.13	0.01532	.	.	.	.	.	T	0.18002	0.0432	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23940	-1.0174	4	.	.	.	.	4.0215	0.09668	0.1082:0.1432:0.1074:0.6411	.	.	.	.	V	204	.	.	A	+	2	0	ZNF135	63270222	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.608000	0.05641	-1.588000	0.01627	-1.141000	0.01876	GCC	ZNF135	-	NULL	ENSG00000176293		0.473	ZNF135-003	KNOWN	basic|appris_candidate	protein_coding	ZNF135	HGNC	protein_coding	OTTHUMT00000361899.2	28	0.00	0	C	NM_003436		58578410	58578410	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000391699	ensembl	human	putative	69_37n	missense	24	27.27	9	SNP	0.000	T
ZNF343	79175	genome.wustl.edu	37	20	2463944	2463944	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr20:2463944C>T	ENST00000278772.4	-	6	2150	c.1663G>A	c.(1663-1665)Ggc>Agc	p.G555S	RP4-734P14.4_ENST00000461548.1_Intron	NM_001282495.1|NM_001282496.1|NM_024325.4	NP_001269424.1|NP_001269425.1|NP_077301.4	Q6P1L6	ZN343_HUMAN	zinc finger protein 343	555					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|skin(4)|upper_aerodigestive_tract(1)	25						AAGCCTCGGCCACACTCACTG	0.517																																						dbGAP											0													108.0	91.0	97.0					20																	2463944		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096911	CCDS13028.1, CCDS74692.1, CCDS74693.1, CCDS74694.1	20p13	2013-01-08			ENSG00000088876	ENSG00000088876		"""Zinc fingers, C2H2-type"", ""-"""	16017	protein-coding gene	gene with protein product							Standard	NM_001282498		Approved	MGC10715	uc002wge.1	Q6P1L6	OTTHUMG00000031701	ENST00000278772.4:c.1663G>A	20.37:g.2463944C>T	ENSP00000278772:p.Gly555Ser		Q5JXU8|Q5JXU9|Q8N8F2|Q96EX8|Q96NA5|Q9BQB0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G555S	ENST00000278772.4	37	c.1663	CCDS13028.1	20	.	.	.	.	.	.	.	.	.	.	C	17.86	3.492000	0.64074	.	.	ENSG00000088876	ENST00000278772	T	0.21734	1.99	2.39	1.41	0.22369	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.37544	0.1007	M	0.62016	1.91	0.80722	D	1	D	0.69078	0.997	D	0.73708	0.981	T	0.09574	-1.0668	9	0.72032	D	0.01	.	8.1274	0.31008	0.2421:0.7578:0.0:0.0	.	555	Q6P1L6	ZN343_HUMAN	S	555	ENSP00000278772:G555S	ENSP00000278772:G555S	G	-	1	0	ZNF343	2411944	1.000000	0.71417	0.048000	0.18961	0.153000	0.21895	3.622000	0.54217	0.329000	0.23460	-0.230000	0.12252	GGC	ZNF343	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000088876		0.517	ZNF343-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF343	HGNC	protein_coding	OTTHUMT00000077617.1	69	0.00	0	C	NM_024325		2463944	2463944	-1	no_errors	ENST00000278772	ensembl	human	known	69_37n	missense	39	43.48	30	SNP	1.000	T
ZNF423	23090	genome.wustl.edu	37	16	49764732	49764732	+	Missense_Mutation	SNP	A	A	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr16:49764732A>C	ENST00000561648.1	-	3	280	c.227T>G	c.(226-228)tTc>tGc	p.F76C	ZNF423_ENST00000563137.2_Missense_Mutation_p.F16C|ZNF423_ENST00000562871.1_Missense_Mutation_p.F16C|ZNF423_ENST00000262383.2_Missense_Mutation_p.F76C|ZNF423_ENST00000562520.1_Missense_Mutation_p.F16C	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	76					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				CAGAGACTCGAAGTCCTGCTG	0.527																																						dbGAP											0													284.0	228.0	247.0					16																	49764732		2198	4300	6498	-	-	-	SO:0001583	missense	0			AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.227T>G	16.37:g.49764732A>C	ENSP00000455426:p.Phe76Cys		O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F76C	ENST00000561648.1	37	c.227	CCDS32445.1	16	.	.	.	.	.	.	.	.	.	.	A	21.0	4.086674	0.76642	.	.	ENSG00000102935	ENST00000262383	T	0.80304	-1.36	5.15	5.15	0.70609	Zinc finger, C2H2-like (1);	0.000000	0.64402	D	0.000001	D	0.83524	0.5273	L	0.29908	0.895	0.47009	D	0.999281	D	0.89917	1.0	D	0.91635	0.999	T	0.82772	-0.0292	9	.	.	.	.	15.2745	0.73732	1.0:0.0:0.0:0.0	.	76	Q2M1K9	ZN423_HUMAN	C	76	ENSP00000262383:F76C	.	F	-	2	0	ZNF423	48322233	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.892000	0.87324	2.069000	0.61940	0.260000	0.18958	TTC	ZNF423	-	smart_Znf_C2H2-like	ENSG00000102935		0.527	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF423	HGNC	protein_coding	OTTHUMT00000423258.1	113	0.00	0	A	NM_015069		49764732	49764732	-1	no_errors	ENST00000262383	ensembl	human	known	69_37n	missense	25	65.28	47	SNP	1.000	C
ZNF432	9668	genome.wustl.edu	37	19	52538468	52538468	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr19:52538468G>C	ENST00000594154.1	-	5	676	c.464C>G	c.(463-465)tCt>tGt	p.S155C	ZNF432_ENST00000221315.5_Missense_Mutation_p.S155C			O94892	ZN432_HUMAN	zinc finger protein 432	155					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	29		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.0054)|OV - Ovarian serous cystadenocarcinoma(262;0.0182)		AAATTTAGTAGAGTTGTTAAT	0.299																																						dbGAP											0													44.0	43.0	43.0					19																	52538468		2202	4299	6501	-	-	-	SO:0001583	missense	0			AB018341	CCDS12848.1	19q13.41	2013-01-08				ENSG00000256087		"""Zinc fingers, C2H2-type"", ""-"""	20810	protein-coding gene	gene with protein product						9872452	Standard	NM_014650		Approved	KIAA0798	uc002pyk.3	O94892		ENST00000594154.1:c.464C>G	19.37:g.52538468G>C	ENSP00000470488:p.Ser155Cys			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S155C	ENST00000594154.1	37	c.464	CCDS12848.1	19	.	.	.	.	.	.	.	.	.	.	G	5.416	0.261982	0.10239	.	.	ENSG00000256087	ENST00000221315	T	0.05580	3.42	3.78	2.73	0.32206	.	.	.	.	.	T	0.06826	0.0174	L	0.49126	1.545	0.09310	N	1	P	0.52170	0.951	B	0.41036	0.346	T	0.32824	-0.9892	9	0.33141	T	0.24	.	7.4834	0.27419	0.1216:0.0:0.8784:0.0	.	155	O94892	ZN432_HUMAN	C	155	ENSP00000221315:S155C	ENSP00000221315:S155C	S	-	2	0	ZNF432	57230280	0.019000	0.18553	0.002000	0.10522	0.001000	0.01503	1.700000	0.37815	0.927000	0.37143	-0.150000	0.13652	TCT	ZNF432	-	NULL	ENSG00000256087		0.299	ZNF432-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF432	HGNC	protein_coding	OTTHUMT00000462410.1	30	0.00	0	G	NM_014650		52538468	52538468	-1	no_errors	ENST00000221315	ensembl	human	known	69_37n	missense	48	20.00	12	SNP	0.009	C
ZNF442	79973	genome.wustl.edu	37	19	12460899	12460899	+	Silent	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr19:12460899G>A	ENST00000242804.4	-	6	2082	c.1500C>T	c.(1498-1500)ttC>ttT	p.F500F	CTD-3105H18.13_ENST00000563695.2_lincRNA|ZNF442_ENST00000438182.1_Silent_p.F431F	NM_030824.2	NP_110451.1	Q9H7R0	ZN442_HUMAN	zinc finger protein 442	500					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	31						AAAGGTATGTGAAACAACTGA	0.358																																						dbGAP											0													110.0	112.0	111.0					19																	12460899		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK024418	CCDS12271.1	19p13.13	2013-01-08			ENSG00000198342	ENSG00000198342		"""Zinc fingers, C2H2-type"", ""-"""	20877	protein-coding gene	gene with protein product							Standard	NM_030824		Approved	FLJ14356	uc002mtr.1	Q9H7R0	OTTHUMG00000156411	ENST00000242804.4:c.1500C>T	19.37:g.12460899G>A			B4DJ48	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F500	ENST00000242804.4	37	c.1500	CCDS12271.1	19																																																																																			ZNF442	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198342		0.358	ZNF442-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF442	HGNC	protein_coding	OTTHUMT00000344109.1	58	0.00	0	G	NM_030824		12460899	12460899	-1	no_errors	ENST00000242804	ensembl	human	known	69_37n	silent	43	23.21	13	SNP	0.005	A
ZNF432	9668	genome.wustl.edu	37	19	52538586	52538586	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr19:52538586G>C	ENST00000594154.1	-	5	558	c.346C>G	c.(346-348)Caa>Gaa	p.Q116E	ZNF432_ENST00000221315.5_Missense_Mutation_p.Q116E			O94892	ZN432_HUMAN	zinc finger protein 432	116					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	29		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.0054)|OV - Ovarian serous cystadenocarcinoma(262;0.0182)		CTTTTGGTTTGAGAGGCAGTA	0.338																																						dbGAP											0													66.0	62.0	63.0					19																	52538586		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018341	CCDS12848.1	19q13.41	2013-01-08				ENSG00000256087		"""Zinc fingers, C2H2-type"", ""-"""	20810	protein-coding gene	gene with protein product						9872452	Standard	NM_014650		Approved	KIAA0798	uc002pyk.3	O94892		ENST00000594154.1:c.346C>G	19.37:g.52538586G>C	ENSP00000470488:p.Gln116Glu			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q116E	ENST00000594154.1	37	c.346	CCDS12848.1	19	.	.	.	.	.	.	.	.	.	.	G	0.001	-3.121697	0.00031	.	.	ENSG00000256087	ENST00000221315	T	0.04917	3.53	3.88	2.83	0.33086	.	.	.	.	.	T	0.04137	0.0115	N	0.25890	0.77	0.09310	N	1	B	0.28470	0.213	B	0.24006	0.05	T	0.43814	-0.9368	9	0.11485	T	0.65	.	7.3128	0.26483	0.1225:0.0:0.8775:0.0	.	116	O94892	ZN432_HUMAN	E	116	ENSP00000221315:Q116E	ENSP00000221315:Q116E	Q	-	1	0	ZNF432	57230398	0.828000	0.29307	0.002000	0.10522	0.116000	0.19942	1.704000	0.37857	0.966000	0.38159	0.591000	0.81541	CAA	ZNF432	-	NULL	ENSG00000256087		0.338	ZNF432-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF432	HGNC	protein_coding	OTTHUMT00000462410.1	47	0.00	0	G	NM_014650		52538586	52538586	-1	no_errors	ENST00000221315	ensembl	human	known	69_37n	missense	50	24.24	16	SNP	0.002	C
ZNF711	7552	genome.wustl.edu	37	X	84510489	84510489	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chrX:84510489G>A	ENST00000373165.3	+	4	610	c.304G>A	c.(304-306)Gag>Aag	p.E102K	ZNF711_ENST00000542798.1_5'Flank|ZNF711_ENST00000276123.3_Missense_Mutation_p.E102K|ZNF711_ENST00000360700.4_Missense_Mutation_p.E102K|ZNF711_ENST00000395402.1_Missense_Mutation_p.E80K	NM_021998.4	NP_068838.3	Q9Y462	ZN711_HUMAN	zinc finger protein 711	102					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(3)|skin(4)	28						TGCCATTGAAGAGGATTTAGA	0.433																																						dbGAP											0													263.0	225.0	238.0					X																	84510489		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC006349	CCDS35344.1	Xq21.1	2014-02-19	2006-06-29	2006-06-29	ENSG00000147180	ENSG00000147180		"""Zinc fingers, C2H2-type"""	13128	protein-coding gene	gene with protein product		314990	"""zinc finger protein 6 (CMPX1)"", ""zinc finger protein 6"""	ZNF6		19377476	Standard	XM_005262186		Approved	CMPX1, ZNF4, ZNF5, dJ75N13.1, Zfp711, MRX97	uc004eeo.3	Q9Y462	OTTHUMG00000021933	ENST00000373165.3:c.304G>A	X.37:g.84510489G>A	ENSP00000362260:p.Glu102Lys		B4DSV4|Q6NX42|Q9Y4J6	Missense_Mutation	SNP	pfam_Transcrp_activ_Zfx/Zfy-dom,pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E80K	ENST00000373165.3	37	c.238	CCDS35344.1	X	.	.	.	.	.	.	.	.	.	.	G	14.13	2.443053	0.43326	.	.	ENSG00000147180	ENST00000395402;ENST00000373165;ENST00000276123;ENST00000360700	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	5.01	5.01	0.66863	Transcriptional activator, Zfx / Zfy domain (1);	0.000000	0.44688	D	0.000429	T	0.43919	0.1269	L	0.55481	1.735	0.80722	D	1	P;B	0.37207	0.587;0.002	B;B	0.36464	0.225;0.004	T	0.41610	-0.9499	10	0.39692	T	0.17	-11.7547	13.2464	0.60026	0.0:0.1551:0.8449:0.0	.	102;102	Q9Y462-3;Q9Y462	.;ZN711_HUMAN	K	80;102;102;102	ENSP00000378798:E80K;ENSP00000362260:E102K;ENSP00000276123:E102K;ENSP00000353922:E102K	ENSP00000276123:E102K	E	+	1	0	ZNF711	84397145	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.684000	0.74538	2.061000	0.61500	0.550000	0.68814	GAG	ZNF711	-	pfam_Transcrp_activ_Zfx/Zfy-dom	ENSG00000147180		0.433	ZNF711-001	KNOWN	basic|CCDS	protein_coding	ZNF711	HGNC	protein_coding	OTTHUMT00000057388.2	104	0.00	0	G	NM_021998		84510489	84510489	+1	no_errors	ENST00000395402	ensembl	human	known	69_37n	missense	70	30.00	30	SNP	1.000	A
ZNF777	27153	genome.wustl.edu	37	7	149129739	149129739	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr7:149129739C>T	ENST00000247930.4	-	6	1947	c.1624G>A	c.(1624-1626)Ggc>Agc	p.G542S		NM_015694.2	NP_056509.2	Q9ULD5	ZN777_HUMAN	zinc finger protein 777	542					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(5)|lung(17)|ovary(1)|skin(2)|urinary_tract(1)	26	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			GGCCGCTCGCCGCGCCGGTTC	0.657																																						dbGAP											0													38.0	39.0	39.0					7																	149129739		2194	4295	6489	-	-	-	SO:0001583	missense	0			AB033111	CCDS43675.1	7q36.1	2013-01-08			ENSG00000196453	ENSG00000196453		"""Zinc fingers, C2H2-type"", ""-"""	22213	protein-coding gene	gene with protein product							Standard	NM_015694		Approved	KIAA1285	uc003wfv.3	Q9ULD5	OTTHUMG00000158967	ENST00000247930.4:c.1624G>A	7.37:g.149129739C>T	ENSP00000247930:p.Gly542Ser		Q8N2R2|Q8N659	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,pfam_DUF3669_Znf,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G542S	ENST00000247930.4	37	c.1624	CCDS43675.1	7	.	.	.	.	.	.	.	.	.	.	C	18.93	3.727916	0.69074	.	.	ENSG00000196453	ENST00000247930;ENST00000314683	T	0.04917	3.53	4.59	4.59	0.56863	.	0.000000	0.51477	D	0.000093	T	0.08492	0.0211	L	0.55017	1.72	0.36160	D	0.848046	P	0.47191	0.891	B	0.38156	0.266	T	0.17806	-1.0357	10	0.87932	D	0	-13.1389	14.9509	0.71074	0.0:1.0:0.0:0.0	.	542	Q9ULD5-2	.	S	542;285	ENSP00000247930:G542S	ENSP00000247930:G542S	G	-	1	0	ZNF777	148760672	0.118000	0.22208	0.994000	0.49952	0.963000	0.63663	0.922000	0.28734	2.376000	0.81061	0.460000	0.39030	GGC	ZNF777	-	NULL	ENSG00000196453		0.657	ZNF777-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF777	HGNC	protein_coding	OTTHUMT00000352708.1	44	0.00	0	C	NM_015694		149129739	149129739	-1	no_errors	ENST00000247930	ensembl	human	known	69_37n	missense	14	46.43	13	SNP	1.000	T
ZNF841	284371	genome.wustl.edu	37	19	52568470	52568470	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr19:52568470G>C	ENST00000426391.2	-	5	2868	c.2317C>G	c.(2317-2319)Cgc>Ggc	p.R773G	ZNF841_ENST00000359973.2_Missense_Mutation_p.R465G|ZNF432_ENST00000598446.1_Intron|CTC-471J1.2_ENST00000569091.1_RNA|ZNF841_ENST00000594295.1_Missense_Mutation_p.R889G|ZNF841_ENST00000389534.4_Missense_Mutation_p.R889G			Q6ZN19	ZN841_HUMAN	zinc finger protein 841	773					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(3)|lung(3)	11						AGGCCTGAGCGACTAATGTAA	0.428																																						dbGAP											0													251.0	205.0	219.0					19																	52568470		692	1591	2283	-	-	-	SO:0001583	missense	0			AK131409	CCDS46161.1	19q13.41	2013-01-08			ENSG00000197608	ENSG00000197608		"""Zinc fingers, C2H2-type"", ""-"""	27611	protein-coding gene	gene with protein product							Standard	NM_001136499		Approved	LOC284371	uc010ydh.1	Q6ZN19		ENST00000426391.2:c.2317C>G	19.37:g.52568470G>C	ENSP00000415453:p.Arg773Gly		B9EG58|Q6ZN82|Q6ZP71|Q8N9U7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R889G	ENST00000426391.2	37	c.2665		19	.	.	.	.	.	.	.	.	.	.	G	9.780	1.175061	0.21704	.	.	ENSG00000197608	ENST00000389534;ENST00000426391;ENST00000359973	T;T;T	0.61040	0.14;0.14;0.14	1.69	-3.37	0.04898	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.23611	0.0571	N	0.08118	0	0.09310	N	1	P;B;P	0.41784	0.762;0.003;0.478	B;B;B	0.32533	0.147;0.001;0.071	T	0.13361	-1.0512	9	0.32370	T	0.25	.	1.0109	0.01497	0.1445:0.1973:0.3144:0.3438	.	889;465;773	Q6ZN19-3;Q6ZN19-2;Q6ZN19	.;.;ZN841_HUMAN	G	889;773;465	ENSP00000374185:R889G;ENSP00000415453:R773G;ENSP00000353060:R465G	ENSP00000353060:R465G	R	-	1	0	ZNF841	57260282	0.000000	0.05858	0.000000	0.03702	0.884000	0.51177	-3.777000	0.00369	-2.030000	0.00929	0.313000	0.20887	CGC	ZNF841	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197608		0.428	ZNF841-001	PUTATIVE	basic	protein_coding	ZNF841	HGNC	protein_coding	OTTHUMT00000462435.1	142	0.00	0	G	XM_209155		52568470	52568470	-1	no_errors	ENST00000389534	ensembl	human	known	69_37n	missense	139	23.20	42	SNP	0.000	C
ZNF836	162962	genome.wustl.edu	37	19	52658282	52658282	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr19:52658282G>A	ENST00000322146.8	-	5	3175	c.2654C>T	c.(2653-2655)tCt>tTt	p.S885F	ZNF836_ENST00000597252.1_Missense_Mutation_p.S885F|CTC-471J1.8_ENST00000594362.1_RNA	NM_001102657.1	NP_001096127.1	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	885					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						TTTTTCTCCAGAATGAATCAT	0.393																																						dbGAP											0													105.0	113.0	111.0					19																	52658282		2182	4293	6475	-	-	-	SO:0001583	missense	0			BC011784	CCDS46162.1	19q13.33	2013-01-08			ENSG00000196267	ENSG00000196267		"""Zinc fingers, C2H2-type"", ""-"""	34333	protein-coding gene	gene with protein product							Standard	NM_001102657		Approved	FLJ16287	uc010ydj.2	Q6ZNA1		ENST00000322146.8:c.2654C>T	19.37:g.52658282G>A	ENSP00000325038:p.Ser885Phe			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S885F	ENST00000322146.8	37	c.2654	CCDS46162.1	19	.	.	.	.	.	.	.	.	.	.	G	14.40	2.525545	0.44969	.	.	ENSG00000196267	ENST00000322146	T	0.19806	2.12	2.15	1.07	0.20283	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.40956	0.1138	M	0.75085	2.285	0.22880	N	0.998614	D	0.65815	0.995	D	0.68621	0.959	T	0.13656	-1.0501	9	0.87932	D	0	.	7.7329	0.28797	0.1406:0.0:0.8594:0.0	.	885	Q6ZNA1	ZN836_HUMAN	F	885	ENSP00000325038:S885F	ENSP00000325038:S885F	S	-	2	0	ZNF836	57350094	0.003000	0.15002	0.009000	0.14445	0.898000	0.52572	0.916000	0.28651	0.236000	0.21180	0.484000	0.47621	TCT	ZNF836	-	pfscan_Znf_C2H2	ENSG00000196267		0.393	ZNF836-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF836	HGNC	protein_coding	OTTHUMT00000462456.1	92	0.00	0	G	NM_001102657		52658282	52658282	-1	no_errors	ENST00000322146	ensembl	human	known	69_37n	missense	126	16.00	24	SNP	1.000	A
ZSCAN4	201516	genome.wustl.edu	37	19	58190194	58190194	+	Nonsense_Mutation	SNP	C	C	G			TCGA-GM-A2D9-01A-11D-A18P-09	TCGA-GM-A2D9-11A-42D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1e314f3c-88c6-4453-96a7-5d616f1c4e9b	1d25f976-3635-49f6-8d0b-f1501be6b0f4	g.chr19:58190194C>G	ENST00000318203.5	+	5	1920	c.1223C>G	c.(1222-1224)tCa>tGa	p.S408*		NM_152677.2	NP_689890.1	Q8NAM6	ZSCA4_HUMAN	zinc finger and SCAN domain containing 4	408					telomere maintenance via telomere lengthening (GO:0010833)|transcription, DNA-templated (GO:0006351)	nuclear chromosome, telomeric region (GO:0000784)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(5)|liver(2)|lung(17)|ovary(1)|skin(1)|stomach(1)	30		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TACCGCCAGTCATCCACATAC	0.478																																						dbGAP											0													76.0	81.0	79.0					19																	58190194		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK092424	CCDS12958.1	19q13.43	2013-01-08	2004-11-01	2004-11-02		ENSG00000180532		"""-"", ""Zinc fingers, C2H2-type"""	23709	protein-coding gene	gene with protein product		613419	"""zinc finger protein 494"""	ZNF494			Standard	NM_152677		Approved	FLJ35105	uc002qpu.3	Q8NAM6		ENST00000318203.5:c.1223C>G	19.37:g.58190194C>G	ENSP00000321963:p.Ser408*		Q3MIQ2	Nonsense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.S408*	ENST00000318203.5	37	c.1223	CCDS12958.1	19	.	.	.	.	.	.	.	.	.	.	C	42	9.777833	0.99261	.	.	ENSG00000180532	ENST00000318203	.	.	.	4.32	4.32	0.51571	.	0.000000	0.42172	D	0.000750	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	-21.1827	12.6291	0.56646	0.0:1.0:0.0:0.0	.	.	.	.	X	408	.	ENSP00000321963:S408X	S	+	2	0	ZSCAN4	62882006	0.000000	0.05858	0.999000	0.59377	0.885000	0.51271	0.253000	0.18296	2.699000	0.92147	0.650000	0.86243	TCA	ZSCAN4	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000180532		0.478	ZSCAN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN4	HGNC	protein_coding	OTTHUMT00000466812.1	26	0.00	0	C	NM_152677		58190194	58190194	+1	no_errors	ENST00000318203	ensembl	human	known	69_37n	nonsense	22	24.14	7	SNP	0.989	G
