#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AFF2	2334	genome.wustl.edu	37	X	147743964	147743964	+	Missense_Mutation	SNP	C	C	T	rs199567128		TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chrX:147743964C>T	ENST00000370460.2	+	3	1195	c.716C>T	c.(715-717)cCg>cTg	p.P239L	AFF2_ENST00000370458.1_Missense_Mutation_p.P235L|AFF2_ENST00000370457.5_Missense_Mutation_p.P235L|AFF2_ENST00000342251.3_Missense_Mutation_p.P235L	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	239					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					TCCAATTCACCGGAAGAATCT	0.453																																						dbGAP											0													134.0	140.0	138.0					X																	147743964		2203	4300	6503	-	-	-	SO:0001583	missense	0			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.716C>T	X.37:g.147743964C>T	ENSP00000359489:p.Pro239Leu		A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.P239L	ENST00000370460.2	37	c.716	CCDS14684.1	X	.	.	.	.	.	.	.	.	.	.	C	12.81	2.050761	0.36181	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000370458	T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27	5.82	4.96	0.65561	.	0.271890	0.36134	N	0.002780	T	0.65595	0.2706	L	0.49126	1.545	0.80722	D	1	P;P;P;P;P;P	0.48503	0.804;0.804;0.804;0.804;0.837;0.911	B;B;B;B;P;B	0.45037	0.23;0.23;0.23;0.336;0.467;0.437	T	0.69281	-0.5186	10	0.87932	D	0	.	13.9926	0.64376	0.0:0.9255:0.0:0.0744	.	239;235;235;235;239;235	P51816-6;P51816-3;P51816-2;P51816-5;P51816;P51816-4	.;.;.;.;AFF2_HUMAN;.	L	239;235;235;235	ENSP00000359489:P239L;ENSP00000359486:P235L;ENSP00000345459:P235L;ENSP00000359487:P235L	ENSP00000345459:P235L	P	+	2	0	AFF2	147551656	0.304000	0.24472	0.999000	0.59377	0.643000	0.38383	2.895000	0.48648	1.208000	0.43306	0.600000	0.82982	CCG	AFF2	-	pfam_TF_AF4/FMR2	ENSG00000155966		0.453	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFF2	HGNC	protein_coding	OTTHUMT00000058673.2	56	0.00	0	C	NM_002025		147743964	147743964	+1	no_errors	ENST00000370460	ensembl	human	known	69_37n	missense	21	41.67	15	SNP	1.000	T
AKAP3	10566	genome.wustl.edu	37	12	4737717	4737717	+	Silent	SNP	G	G	A			TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr12:4737717G>A	ENST00000545990.2	-	5	875	c.351C>T	c.(349-351)aaC>aaT	p.N117N	AKAP3_ENST00000228850.1_Silent_p.N117N|RP11-500M8.7_ENST00000536588.1_Intron	NM_001278309.1	NP_001265238.1	O75969	AKAP3_HUMAN	A kinase (PRKA) anchor protein 3	117					acrosome reaction (GO:0007340)|cellular component movement (GO:0006928)|protein localization (GO:0008104)|single fertilization (GO:0007338)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	acrosomal vesicle (GO:0001669)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	protein kinase A binding (GO:0051018)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|liver(1)|lung(17)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	51						CTGAACTCCCGTTGCCAAGTT	0.493																																						dbGAP											0													110.0	101.0	104.0					12																	4737717		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U85715	CCDS8531.1	12p13.3	2009-03-12				ENSG00000111254		"""A-kinase anchor proteins"""	373	protein-coding gene	gene with protein product	"""Fibrous Sheath Protein of 95 kDa"", ""cancer/testis antigen 82"""	604689				10334916, 10319321	Standard	NM_001278309		Approved	FSP95, SOB1, AKAP110, CT82	uc001qnb.4	O75969		ENST00000545990.2:c.351C>T	12.37:g.4737717G>A			O75945|Q86X01|Q9UM61	Silent	SNP	pfam_AKAP_110_C,pfam_RII_binding_1,smart_AKAP_110	p.N117	ENST00000545990.2	37	c.351	CCDS8531.1	12																																																																																			AKAP3	-	smart_AKAP_110	ENSG00000111254		0.493	AKAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP3	HGNC	protein_coding	OTTHUMT00000398911.2	79	0.00	0	G	NM_006422		4737717	4737717	-1	no_errors	ENST00000228850	ensembl	human	known	69_37n	silent	31	31.11	14	SNP	0.000	A
ARHGAP42	143872	genome.wustl.edu	37	11	100812591	100812591	+	Silent	SNP	A	A	G			TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr11:100812591A>G	ENST00000298815.8	+	9	912	c.909A>G	c.(907-909)tcA>tcG	p.S303S	ARHGAP42_ENST00000524892.2_Silent_p.S269S	NM_152432.2	NP_689645.2	A6NI28	RHG42_HUMAN	Rho GTPase activating protein 42	303	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				signal transduction (GO:0007165)	intracellular (GO:0005622)	GTPase activator activity (GO:0005096)			endometrium(3)|skin(2)	5						TGAGTGTTTCAGAAATGAAAT	0.274																																						dbGAP											0													110.0	95.0	100.0					11																	100812591		692	1585	2277	-	-	-	SO:0001819	synonymous_variant	0					11q22.1	2012-04-19			ENSG00000165895	ENSG00000165895		"""Rho GTPase activating proteins"""	26545	protein-coding gene	gene with protein product		615936				18954304	Standard	NM_152432		Approved	FLJ32810, GRAF3	uc001pge.2	A6NI28	OTTHUMG00000167530	ENST00000298815.8:c.909A>G	11.37:g.100812591A>G			Q96M56	Silent	SNP	pfam_RhoGAP_dom,pfam_SH3_domain,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_RhoGAP_dom,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.S303	ENST00000298815.8	37	c.909		11																																																																																			ARHGAP42	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000165895		0.274	ARHGAP42-201	KNOWN	basic|appris_principal	protein_coding	ARHGAP42	HGNC	protein_coding		115	0.00	0	A	NM_152432		100812591	100812591	+1	no_errors	ENST00000298815	ensembl	human	known	69_37n	silent	23	28.12	9	SNP	0.989	G
ARHGEF12	23365	genome.wustl.edu	37	11	120317216	120317216	+	Splice_Site	SNP	C	C	T			TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr11:120317216C>T	ENST00000397843.2	+	17	1616	c.1450C>T	c.(1450-1452)Cgg>Tgg	p.R484W	ARHGEF12_ENST00000356641.3_Splice_Site_p.R465W|ARHGEF12_ENST00000532993.1_Splice_Site_p.R381W	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	484	RGSL.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		AGAAGATTTTCGGTAAGCTTA	0.343			T	MLL	AML																																	dbGAP		Dom	yes		11	11q23.3	23365	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)		L	0													90.0	82.0	85.0					11																	120317216		1850	4104	5954	-	-	-	SO:0001630	splice_region_variant	0			AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.1451+1C>T	11.37:g.120317216C>T			O15086|Q6P526	Missense_Mutation	SNP	pfam_Regulat_G_prot_signal-like,pfam_DH-domain,pfam_PDZ,superfamily_Regulat_G_prot_signal_superfam,superfamily_DH-domain,superfamily_PDZ,smart_PDZ,smart_DH-domain,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.R465W	ENST00000397843.2	37	c.1393	CCDS41727.1	11	.	.	.	.	.	.	.	.	.	.	C	26.5	4.744819	0.89663	.	.	ENSG00000196914	ENST00000397843;ENST00000356641;ENST00000532993	D;D;D	0.86497	-2.13;-2.13;-2.13	5.73	4.76	0.60689	Regulator of G protein signalling superfamily (1);Regulator of G protein signalling-like fold (1);	0.000000	0.46145	D	0.000314	D	0.92701	0.7680	M	0.79926	2.475	0.58432	D	0.999995	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.92862	0.6306	10	0.87932	D	0	-14.3914	11.3712	0.49699	0.3943:0.6057:0.0:0.0	.	381;465;484	B4DGW2;Q9NZN5-2;Q9NZN5	.;.;ARHGC_HUMAN	W	484;465;381	ENSP00000380942:R484W;ENSP00000349056:R465W;ENSP00000432984:R381W	ENSP00000349056:R465W	R	+	1	2	ARHGEF12	119822426	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	4.661000	0.61518	2.721000	0.93114	0.655000	0.94253	CGG	ARHGEF12	-	pfam_Regulat_G_prot_signal-like,superfamily_Regulat_G_prot_signal_superfam	ENSG00000196914		0.343	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ARHGEF12	HGNC	protein_coding	OTTHUMT00000388052.1	80	0.00	0	C	NM_015313	Missense_Mutation	120317216	120317216	+1	no_errors	ENST00000356641	ensembl	human	known	69_37n	missense	20	25.93	7	SNP	1.000	T
BPIFB4	149954	genome.wustl.edu	37	20	31692615	31692615	+	Splice_Site	SNP	G	G	T			TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr20:31692615G>T	ENST00000375483.3	+	14	1680		c.e14-1		BPIFB4_ENST00000494121.1_3'UTR	NM_182519.2	NP_872325.2	P59827	BPIB4_HUMAN	BPI fold containing family B, member 4							cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										TTCCTCTGCAGATTGGCCTCA	0.597																																						dbGAP											0													102.0	91.0	95.0					20																	31692615		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF549190	CCDS13213.2	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186191	ENSG00000186191		"""BPI fold containing"""	16179	protein-coding gene	gene with protein product		615718	"""chromosome 20 open reading frame 186"""	C20orf186		11971875, 21787333	Standard	NM_182519		Approved	dJ726C3.5, LPLUNC4	uc010zue.2	P59827	OTTHUMG00000032235	ENST00000375483.3:c.1681-1G>T	20.37:g.31692615G>T			Q5TDX6	Splice_Site	SNP	-	e14-1	ENST00000375483.3	37	c.1681-1	CCDS13213.2	20	.	.	.	.	.	.	.	.	.	.	G	9.916	1.210969	0.22289	.	.	ENSG00000186191	ENST00000375483	.	.	.	4.51	4.51	0.55191	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.9021	0.58130	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BPIFB4	31156276	1.000000	0.71417	0.992000	0.48379	0.216000	0.24613	4.901000	0.63259	2.501000	0.84356	0.561000	0.74099	.	BPIFB4	-	-	ENSG00000186191		0.597	BPIFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BPIFB4	HGNC	protein_coding	OTTHUMT00000078655.5	116	0.00	0	G	NM_182519	Intron	31692615	31692615	+1	no_errors	ENST00000375483	ensembl	human	known	69_37n	splice_site	37	24.49	12	SNP	0.993	T
C12orf5	57103	genome.wustl.edu	37	12	4458991	4458991	+	Missense_Mutation	SNP	C	C	A			TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr12:4458991C>A	ENST00000179259.4	+	4	266	c.199C>A	c.(199-201)Cat>Aat	p.H67N	C12orf5_ENST00000537251.1_3'UTR	NM_020375.2	NP_065108.1	Q9NQ88	TIGAR_HUMAN	chromosome 12 open reading frame 5	67					intestinal epithelial cell development (GO:0060576)|negative regulation of macromitophagy (GO:1901525)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|response to gamma radiation (GO:0010332)|response to xenobiotic stimulus (GO:0009410)	intracellular (GO:0005622)	fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)			endometrium(1)|large_intestine(1)|lung(5)|skin(3)	10			all cancers(3;1.15e-07)|Colorectal(7;0.00165)|OV - Ovarian serous cystadenocarcinoma(31;0.00596)|COAD - Colon adenocarcinoma(12;0.0229)|GBM - Glioblastoma multiforme(3;0.0266)|STAD - Stomach adenocarcinoma(119;0.206)			TCAGACCATGCATGGAATTTT	0.328																																					Colon(1;100 192 35375 49454 52532)	dbGAP											0													84.0	87.0	86.0					12																	4458991		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ272206	CCDS8525.1	12p13.32	2014-05-29	2009-11-24	2009-11-24	ENSG00000078237	ENSG00000078237	3.1.3.46		1185	protein-coding gene	gene with protein product	"""TP53-induced glycolysis and apoptosis regulator"""	610775				16140933, 16839880, 18945750, 19713938	Standard	NM_020375		Approved	TIGAR	uc001qmp.3	Q9NQ88		ENST00000179259.4:c.199C>A	12.37:g.4458991C>A	ENSP00000179259:p.His67Asn		B2R840	Missense_Mutation	SNP	pfam_His_Pase_superF_clade-1,smart_His_Pase_superF_clade-1	p.H67N	ENST00000179259.4	37	c.199	CCDS8525.1	12	.	.	.	.	.	.	.	.	.	.	C	3.821	-0.037835	0.07497	.	.	ENSG00000078237	ENST00000179259	T	0.71341	-0.56	4.58	1.56	0.23342	Histidine phosphatase superfamily, clade-1 (2);	0.769595	0.12494	N	0.463970	T	0.40196	0.1107	N	0.03608	-0.345	0.09310	N	1	B	0.13145	0.007	B	0.21151	0.033	T	0.28964	-1.0027	10	0.10636	T	0.68	-9.489	5.0472	0.14490	0.0:0.4727:0.2403:0.287	.	67	Q9NQ88	TIGAR_HUMAN	N	67	ENSP00000179259:H67N	ENSP00000179259:H67N	H	+	1	0	C12orf5	4329252	0.027000	0.19231	0.857000	0.33713	0.875000	0.50365	0.424000	0.21330	0.671000	0.31185	-0.140000	0.14226	CAT	C12orf5	-	pfam_His_Pase_superF_clade-1,smart_His_Pase_superF_clade-1	ENSG00000078237		0.328	C12orf5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf5	HGNC	protein_coding	OTTHUMT00000398290.1	56	0.00	0	C	NM_020375		4458991	4458991	+1	no_errors	ENST00000179259	ensembl	human	known	69_37n	missense	29	21.62	8	SNP	0.000	A
C5orf42	65250	genome.wustl.edu	37	5	37187668	37187668	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr5:37187668C>T	ENST00000508244.1	-	22	4021	c.3928G>A	c.(3928-3930)Gaa>Aaa	p.E1310K	C5orf42_ENST00000274258.7_Missense_Mutation_p.E191K|C5orf42_ENST00000425232.2_Missense_Mutation_p.E1310K			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	1310						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			AACTCCACTTCAAGGTCCTAA	0.343																																						dbGAP											0													75.0	70.0	72.0					5																	37187668		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.3928G>A	5.37:g.37187668C>T	ENSP00000421690:p.Glu1310Lys		A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	superfamily_Quino_amine_DH_bsu	p.E1310K	ENST00000508244.1	37	c.3928	CCDS34146.2	5	.	.	.	.	.	.	.	.	.	.	C	15.06	2.722684	0.48728	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29	5.65	4.78	0.61160	.	0.164319	0.38005	N	0.001851	T	0.49167	0.1541	N	0.19112	0.55	0.09310	N	1	B;B	0.10296	0.003;0.003	B;B	0.14578	0.009;0.011	T	0.36187	-0.9758	10	0.33141	T	0.24	.	9.8232	0.40896	0.0:0.8027:0.0:0.1973	.	1310;191	E9PH94;Q9H799	.;CE042_HUMAN	K	1310;1310;191;358;191	ENSP00000421690:E1310K;ENSP00000389014:E1310K;ENSP00000274258:E191K;ENSP00000424223:E358K	ENSP00000274258:E191K	E	-	1	0	C5orf42	37223425	0.053000	0.20554	0.812000	0.32479	0.945000	0.59286	1.568000	0.36418	1.532000	0.49169	-0.424000	0.05967	GAA	C5orf42	-	NULL	ENSG00000197603		0.343	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C5orf42	HGNC	protein_coding	OTTHUMT00000360806.1	77	0.00	0	C	NM_023073		37187668	37187668	-1	no_errors	ENST00000425232	ensembl	human	known	69_37n	missense	23	22.58	7	SNP	0.048	T
CDH17	1015	genome.wustl.edu	37	8	95183115	95183115	+	Silent	SNP	C	C	A			TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr8:95183115C>A	ENST00000027335.3	-	8	1006	c.882G>T	c.(880-882)gtG>gtT	p.V294V	CDH17_ENST00000450165.2_Silent_p.V294V|CDH17_ENST00000441892.2_Intron	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	294	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)			NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			AGGGCTGAGTCACGTAAATAT	0.458																																						dbGAP											0													155.0	152.0	153.0					8																	95183115		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.882G>T	8.37:g.95183115C>A			Q15336|Q2M2E0	Silent	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.V294	ENST00000027335.3	37	c.882	CCDS6260.1	8																																																																																			CDH17	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000079112		0.458	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH17	HGNC	protein_coding	OTTHUMT00000378560.1	132	0.00	0	C	NM_004063		95183115	95183115	-1	no_errors	ENST00000027335	ensembl	human	known	69_37n	silent	49	33.78	25	SNP	1.000	A
CHD8	57680	genome.wustl.edu	37	14	21869629	21869629	+	Missense_Mutation	SNP	T	T	A			TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr14:21869629T>A	ENST00000557364.1	-	21	4369	c.4106A>T	c.(4105-4107)gAt>gTt	p.D1369V	CHD8_ENST00000555962.1_Intron|CHD8_ENST00000430710.3_Missense_Mutation_p.D1090V|CHD8_ENST00000399982.2_Missense_Mutation_p.D1369V			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1369					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		GTTGGGGTCATCCAAAGAAAT	0.408																																						dbGAP											0													59.0	58.0	58.0					14																	21869629		1843	4095	5938	-	-	-	SO:0001583	missense	0			AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.4106A>T	14.37:g.21869629T>A	ENSP00000451601:p.Asp1369Val		Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_BRK_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.D1369V	ENST00000557364.1	37	c.4106	CCDS53885.1	14	.	.	.	.	.	.	.	.	.	.	T	19.69	3.874680	0.72180	.	.	ENSG00000100888	ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364	D;D;D	0.85629	-2.01;-2.01;-2.01	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.93579	0.7950	M	0.91663	3.23	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.74348	0.964;0.983	D	0.94810	0.7978	10	0.87932	D	0	-17.7842	14.7364	0.69419	0.0:0.0:0.0:1.0	.	1369;1090	Q9HCK8;Q9HCK8-2	CHD8_HUMAN;.	V	1090;1369;1089;1369	ENSP00000406288:D1090V;ENSP00000382863:D1369V;ENSP00000451601:D1369V	ENSP00000262707:D1089V	D	-	2	0	CHD8	20939469	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.868000	0.87116	2.302000	0.77476	0.533000	0.62120	GAT	CHD8	-	NULL	ENSG00000100888		0.408	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD8	HGNC	protein_coding	OTTHUMT00000410436.1	75	0.00	0	T	NM_020920		21869629	21869629	-1	no_errors	ENST00000399982	ensembl	human	known	69_37n	missense	25	21.88	7	SNP	1.000	A
CROCCP2	84809	genome.wustl.edu	37	1	16944953	16944953	+	lincRNA	SNP	T	T	G	rs12021621	byFrequency	TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr1:16944953T>G	ENST00000412962.1	-	0	2566				RP5-1182A14.5_ENST00000607700.1_lincRNA			Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											GTGTATACATTCATAGGTTGG	0.408													.|||	782	0.15615	0.0197	0.134	5008	,	,		67898	0.3304		0.164	False		,,,				2504	0.1687					dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16944953T>G			Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.408	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	9	0.00	0	T	NR_026752.1		16944953	16944953	-1	no_errors	ENST00000412962	ensembl	human	known	69_37n	rna	11	26.67	4	SNP	0.000	G
CROCCP2	84809	genome.wustl.edu	37	1	16945027	16945027	+	lincRNA	SNP	T	T	C	rs1050322	byFrequency	TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr1:16945027T>C	ENST00000412962.1	-	0	2492				RP5-1182A14.5_ENST00000607700.1_lincRNA			Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											gcaaaaatgctctctgcagca	0.323													.|||	970	0.19369	0.211	0.2896	5008	,	,		74411	0.0337		0.2316	False		,,,				2504	0.228					dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16945027T>C			Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.323	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	9	0.00	0	T	NR_026752.1		16945027	16945027	-1	no_errors	ENST00000412962	ensembl	human	known	69_37n	rna	12	33.33	6	SNP	0.007	C
CROCCP2	84809	genome.wustl.edu	37	1	16950063	16950063	+	lincRNA	SNP	C	C	A	rs9329438	byFrequency	TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr1:16950063C>A	ENST00000412962.1	-	0	1000							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											CGATGAACAGCAGTTACTGTT	0.552																																						dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16950063C>A			Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.552	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	8	0.00	0	C	NR_026752.1		16950063	16950063	-1	no_errors	ENST00000421700	ensembl	human	known	69_37n	rna	12	25.00	4	SNP	0.000	A
FAF1	11124	genome.wustl.edu	37	1	50907189	50907189	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr1:50907189G>A	ENST00000396153.2	-	19	2327	c.1876C>T	c.(1876-1878)Caa>Taa	p.Q626*	FAF1_ENST00000545823.1_Nonsense_Mutation_p.Q384*|FAF1_ENST00000371778.4_Nonsense_Mutation_p.Q626*	NM_007051.2	NP_008982.1	Q9UNN5	FAF1_HUMAN	Fas (TNFRSF6) associated factor 1	626	UBX. {ECO:0000255|PROSITE- ProRule:PRU00215}.				apoptotic process (GO:0006915)|cell death (GO:0008219)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of protein complex assembly (GO:0031334)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of cell adhesion (GO:0030155)|regulation of protein catabolic process (GO:0042176)|regulation of protein kinase activity (GO:0045859)	CD95 death-inducing signaling complex (GO:0031265)|Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	heat shock protein binding (GO:0031072)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|pancreas(2)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)		GGGTCCAGTTGAGTTACCTAA	0.388																																						dbGAP											0													34.0	33.0	33.0					1																	50907189		2109	4113	6222	-	-	-	SO:0001587	stop_gained	0			AF132938	CCDS554.1	1p32.3	2012-09-20			ENSG00000185104	ENSG00000185104		"""UBX domain containing"""	3578	protein-coding gene	gene with protein product	"""TNFRSF6-associated factor 1"", ""UBX domain protein 3A"""	604460				10462485	Standard	NM_007051		Approved	CGI-03, hFAF1, HFAF1s, UBXD12, UBXN3A	uc001cse.1	Q9UNN5	OTTHUMG00000007930	ENST00000396153.2:c.1876C>T	1.37:g.50907189G>A	ENSP00000379457:p.Gln626*		Q549F0|Q9UF34|Q9UNT3|Q9Y2Z3	Nonsense_Mutation	SNP	pfam_UBX,superfamily_UBA-like,smart_UAS,smart_UBX,pfscan_UBX	p.Q626*	ENST00000396153.2	37	c.1876	CCDS554.1	1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.404918	0.83230	.	.	ENSG00000185104	ENST00000396153;ENST00000371778;ENST00000545823;ENST00000371780;ENST00000543607	.	.	.	6.03	6.03	0.97812	.	0.237508	0.44688	D	0.000431	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-29.3554	18.7374	0.91761	0.0:0.0:1.0:0.0	.	.	.	.	X	626;626;384;466;474	.	ENSP00000360843:Q626X	Q	-	1	0	FAF1	50679777	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.163000	0.77524	2.861000	0.98227	0.655000	0.94253	CAA	FAF1	-	pfam_UBX,smart_UBX,pfscan_UBX	ENSG00000185104		0.388	FAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAF1	HGNC	protein_coding	OTTHUMT00000021807.1	56	0.00	0	G	NM_007051		50907189	50907189	-1	no_errors	ENST00000371778	ensembl	human	known	69_37n	nonsense	31	18.42	7	SNP	1.000	A
FAM21A	387680	genome.wustl.edu	37	10	51853633	51853633	+	Missense_Mutation	SNP	C	C	T	rs199520696	byFrequency	TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr10:51853633C>T	ENST00000282633.5	+	13	1181	c.1136C>T	c.(1135-1137)aCg>aTg	p.T379M	FAM21A_ENST00000314664.7_Missense_Mutation_p.T379M|FAM21A_ENST00000399339.2_Missense_Mutation_p.T291M|FAM21A_ENST00000351071.6_Missense_Mutation_p.T379M	NM_001005751.1	NP_001005751.1	Q641Q2	FA21A_HUMAN	family with sequence similarity 21, member A	379					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|WASH complex (GO:0071203)				breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	15						GACCTCTTCACGGAAGCCCCC	0.488																																						dbGAP											0													1.0	1.0	1.0					10																	51853633		353	936	1289	-	-	-	SO:0001583	missense	0			BC082258	CCDS41527.1	10q11.23	2014-06-19			ENSG00000099290	ENSG00000099290			23416	protein-coding gene	gene with protein product			"""family with sequence similarity 21, member B"""	FAM21B			Standard	XM_005269805		Approved	bA56A21.1, bA98I6.1, FLJ10824	uc001jjb.3	Q641Q2	OTTHUMG00000018225	ENST00000282633.5:c.1136C>T	10.37:g.51853633C>T	ENSP00000282633:p.Thr379Met		A2A3S2|A2A3U6|Q6DHY0	Missense_Mutation	SNP	NULL	p.T379M	ENST00000282633.5	37	c.1136	CCDS41527.1	10	.	.	.	.	.	.	.	.	.	.	C	6.414	0.444490	0.12164	.	.	ENSG00000099290	ENST00000351071;ENST00000314664;ENST00000434114;ENST00000282633;ENST00000399339	.	.	.	3.88	-5.37	0.02681	.	0.781535	0.12699	N	0.446536	T	0.14527	0.0351	N	0.19112	0.55	0.09310	N	1	B;B;B;B;B	0.29253	0.05;0.02;0.005;0.02;0.239	B;B;B;B;B	0.16722	0.013;0.013;0.003;0.013;0.016	T	0.05767	-1.0865	9	0.42905	T	0.14	2.3495	2.2948	0.04147	0.3714:0.2592:0.2739:0.0955	.	379;379;291;379;273	E7ESD2;Q641Q2-2;F8W7U3;Q641Q2;Q5T1D7	.;.;.;FA21A_HUMAN;.	M	379;379;273;379;291	.	ENSP00000282633:T379M	T	+	2	0	FAM21A	51523639	0.024000	0.19004	0.096000	0.21009	0.033000	0.12548	-0.884000	0.04166	-1.796000	0.01253	-1.109000	0.02080	ACG	FAM21A	-	NULL	ENSG00000099290		0.488	FAM21A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM21A	HGNC	protein_coding	OTTHUMT00000276917.2	9	0.00	0	C	NM_001005751		51853633	51853633	+1	no_errors	ENST00000282633	ensembl	human	known	69_37n	missense	1	66.67	2	SNP	0.370	T
FAM71A	149647	genome.wustl.edu	37	1	212799872	212799872	+	Silent	SNP	C	C	T	rs199742571		TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr1:212799872C>T	ENST00000294829.3	+	1	2084	c.1653C>T	c.(1651-1653)aaC>aaT	p.N551N	RP11-338C15.5_ENST00000427949.1_RNA	NM_153606.3	NP_705834.2	Q8IYT1	FA71A_HUMAN	family with sequence similarity 71, member A	551			N -> D (in dbSNP:rs3122713). {ECO:0000269|PubMed:15489334}.			nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(12)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)		GAGATGTGAACGTCATGGCTA	0.572													C|||	1	0.000199681	0.0	0.0	5008	,	,		19215	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													80.0	74.0	76.0					1																	212799872		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS1507.1	1q32.3	2008-02-05			ENSG00000162771	ENSG00000162771			26541	protein-coding gene	gene with protein product						12477932	Standard	NM_153606		Approved	FLJ32796	uc010pth.1	Q8IYT1	OTTHUMG00000041084	ENST00000294829.3:c.1653C>T	1.37:g.212799872C>T			Q5VTZ1	Silent	SNP	pfam_DUF3699	p.N551	ENST00000294829.3	37	c.1653	CCDS1507.1	1																																																																																			FAM71A	-	NULL	ENSG00000162771		0.572	FAM71A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM71A	HGNC	protein_coding	OTTHUMT00000098529.1	50	0.00	0	C	NM_153606		212799872	212799872	+1	no_errors	ENST00000294829	ensembl	human	known	69_37n	silent	24	14.29	4	SNP	0.000	T
GPC5	2262	genome.wustl.edu	37	13	92101096	92101096	+	Missense_Mutation	SNP	G	G	C	rs201226040		TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr13:92101096G>C	ENST00000377067.3	+	2	617	c.245G>C	c.(244-246)cGc>cCc	p.R82P		NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	82					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				ATTGCGGCTCGCCAGGATATG	0.428																																						dbGAP											0													137.0	128.0	131.0					13																	92101096		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.245G>C	13.37:g.92101096G>C	ENSP00000366267:p.Arg82Pro		B2R726|O60436|Q9BX27	Missense_Mutation	SNP	pfam_Glypican	p.R82P	ENST00000377067.3	37	c.245	CCDS9468.1	13	.	.	.	.	.	.	.	.	.	.	G	10.48	1.362742	0.24684	.	.	ENSG00000179399	ENST00000377067	T	0.54071	0.59	5.5	1.78	0.24846	.	0.421215	0.24039	N	0.042102	T	0.59797	0.2220	M	0.62723	1.935	0.09310	N	1	P	0.50272	0.933	P	0.54140	0.743	T	0.55335	-0.8157	10	0.87932	D	0	.	11.0331	0.47785	0.3543:0.0:0.6457:0.0	.	82	P78333	GPC5_HUMAN	P	82	ENSP00000366267:R82P	ENSP00000366267:R82P	R	+	2	0	GPC5	90899097	0.898000	0.30612	0.022000	0.16811	0.005000	0.04900	3.005000	0.49521	0.029000	0.15352	-1.595000	0.00837	CGC	GPC5	-	pfam_Glypican	ENSG00000179399		0.428	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC5	HGNC	protein_coding	OTTHUMT00000045454.1	68	0.00	0	G	NM_004466		92101096	92101096	+1	no_errors	ENST00000377067	ensembl	human	known	69_37n	missense	36	21.74	10	SNP	0.047	C
HPCAL1	3241	genome.wustl.edu	37	2	10560114	10560114	+	Silent	SNP	C	C	T			TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr2:10560114C>T	ENST00000381765.3	+	4	757	c.231C>T	c.(229-231)gaC>gaT	p.D77D	HPCAL1_ENST00000307845.3_Silent_p.D77D	NM_134421.2	NP_602293.1	P37235	HPCL1_HUMAN	hippocalcin-like 1	77	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	9	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.214)		CCAACGGCGACGGCACCATCG	0.602																																					Pancreas(70;1384 1800 31595 46836)	dbGAP											0													105.0	89.0	94.0					2																	10560114		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS1671.1	2p25.1	2013-01-10			ENSG00000115756	ENSG00000115756		"""EF-hand domain containing"""	5145	protein-coding gene	gene with protein product	"""visinin-like protein 3"", ""calcium-binding protein BDR-1"""	600207				8038222, 14739275	Standard	NM_002149		Approved	BDR1, HLP2, VILIP-3	uc031rnq.1	P37235	OTTHUMG00000090451	ENST00000381765.3:c.231C>T	2.37:g.10560114C>T			Q969S5	Silent	SNP	pfam_EF-hand,pfam_SPARC/Testican_Ca-bd-dom,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,prints_Recoverin	p.D77	ENST00000381765.3	37	c.231	CCDS1671.1	2																																																																																			HPCAL1	-	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,prints_Recoverin	ENSG00000115756		0.602	HPCAL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HPCAL1	HGNC	protein_coding	OTTHUMT00000206898.1	63	0.00	0	C	NM_002149		10560114	10560114	+1	no_errors	ENST00000307845	ensembl	human	known	69_37n	silent	24	33.33	12	SNP	0.908	T
IFT52	51098	genome.wustl.edu	37	20	42271138	42271138	+	Silent	SNP	A	A	G			TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr20:42271138A>G	ENST00000373030.3	+	13	1270	c.1140A>G	c.(1138-1140)gaA>gaG	p.E380E	IFT52_ENST00000471199.1_3'UTR|IFT52_ENST00000373039.4_Silent_p.E380E	NM_016004.2	NP_057088.2	Q9Y366	IFT52_HUMAN	intraflagellar transport 52	380					cilium morphogenesis (GO:0060271)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|intraciliary transport (GO:0042073)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube formation (GO:0001841)|regulation of protein processing (GO:0070613)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)	protein C-terminus binding (GO:0008022)			endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			AAGACCTGGAATTTTATGTCA	0.408																																						dbGAP											0													129.0	118.0	121.0					20																	42271138		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF151811	CCDS33470.1	20q12-q13.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000101052	ENSG00000101052		"""Intraflagellar transport homologs"""	15901	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 9"", ""intraflagellar transport 52 homolog (Chlamydomonas)"""	C20orf9		10810093	Standard	NM_016004		Approved	CGI-53, NGD5, dJ1028D15.1, NGD2	uc002xkw.3	Q9Y366	OTTHUMG00000032513	ENST00000373030.3:c.1140A>G	20.37:g.42271138A>G			B3KMA1|E1P5W9|Q5H8Z0|Q9H1G3|Q9H1G4|Q9H1H2	Silent	SNP	pfam_ABC_transp_unknown	p.E380	ENST00000373030.3	37	c.1140	CCDS33470.1	20																																																																																			IFT52	-	NULL	ENSG00000101052		0.408	IFT52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT52	HGNC	protein_coding	OTTHUMT00000079317.1	104	0.00	0	A	NM_016004		42271138	42271138	+1	no_errors	ENST00000373030	ensembl	human	known	69_37n	silent	28	21.62	8	SNP	1.000	G
KAT2B	8850	genome.wustl.edu	37	3	20193909	20193910	+	Frame_Shift_Ins	INS	-	-	A			TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr3:20193909_20193910insA	ENST00000263754.4	+	18	2846_2847	c.2391_2392insA	c.(2392-2394)aatfs	p.N798fs		NM_003884.4	NP_003875.3	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B	798	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035, ECO:0000305}.				cell cycle arrest (GO:0007050)|cellular response to insulin stimulus (GO:0032869)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|histone H3-K9 acetylation (GO:0043970)|internal peptidyl-lysine acetylation (GO:0018393)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|Notch signaling pathway (GO:0007219)|peptidyl-lysine acetylation (GO:0018394)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein acetylation (GO:0006473)|regulation of protein ADP-ribosylation (GO:0010835)|rhythmic process (GO:0048511)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	A band (GO:0031672)|actomyosin (GO:0042641)|Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|I band (GO:0031674)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	acetyltransferase activity (GO:0016407)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|histone acetyltransferase activity (GO:0004402)|histone deacetylase binding (GO:0042826)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	40						GAGTCTTTACCAATTGCAAAGA	0.386																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U57316	CCDS2634.1	3p24	2011-07-01	2008-07-04	2008-07-04	ENSG00000114166	ENSG00000114166		"""Chromatin-modifying enzymes / K-acetyltransferases"""	8638	protein-coding gene	gene with protein product		602303	"""p300/CBP-associated factor"""	PCAF		8684459, 9722949	Standard	NM_003884		Approved	P/CAF, GCN5, GCN5L	uc003cbq.3	Q92831	OTTHUMG00000130481	ENST00000263754.4:c.2393dupA	3.37:g.20193911_20193911dupA	ENSP00000263754:p.Asn798fs		Q6NSK1	Frame_Shift_Ins	INS	pirsf_Hist_acetylase_PCAF,pfam_PCAF_N,pfam_Bromodomain,pfam_GNAT_dom,superfamily_Bromodomain,superfamily_Acyl_CoA_acyltransferase,smart_Bromodomain,pfscan_Bromodomain,pfscan_GNAT_dom,prints_Bromodomain	p.N797fs	ENST00000263754.4	37	c.2391_2392	CCDS2634.1	3																																																																																			KAT2B	-	pirsf_Hist_acetylase_PCAF,pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	ENSG00000114166		0.386	KAT2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAT2B	HGNC	protein_coding	OTTHUMT00000252880.1	59	0.00	0	-	NM_003884		20193909	20193910	+1	no_errors	ENST00000263754	ensembl	human	known	69_37n	frame_shift_ins	19	34.48	10	INS	1.000:1.000	A
KIAA0100	9703	genome.wustl.edu	37	17	26962549	26962549	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr17:26962549G>C	ENST00000528896.2	-	16	2130	c.2056C>G	c.(2056-2058)Cta>Gta	p.L686V	KIAA0100_ENST00000544884.1_Missense_Mutation_p.L543V|RP11-192H23.7_ENST00000583787.1_RNA|KIAA0100_ENST00000389003.3_Missense_Mutation_p.L543V|RP11-192H23.7_ENST00000577814.1_RNA	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	686						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					CGGCACTGTAGAGTGGCCAGG	0.527																																						dbGAP											0													77.0	74.0	75.0					17																	26962549		2203	4300	6503	-	-	-	SO:0001583	missense	0			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.2056C>G	17.37:g.26962549G>C	ENSP00000436773:p.Leu686Val		A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	pfam_FMP27_C,pfam_FMP27_N,pfam_FMP27_GFWDK_dom	p.L686V	ENST00000528896.2	37	c.2056	CCDS32595.1	17	.	.	.	.	.	.	.	.	.	.	G	9.427	1.084599	0.20309	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.23754	1.91;1.89	5.71	1.03	0.20045	.	0.308684	0.32687	N	0.005780	T	0.13713	0.0332	L	0.43152	1.355	0.09310	N	1	P	0.37466	0.596	B	0.26770	0.073	T	0.18429	-1.0337	10	0.26408	T	0.33	.	5.0962	0.14735	0.3894:0.0:0.4817:0.1289	.	686	Q14667	K0100_HUMAN	V	686;686;686;543	ENSP00000436773:L686V;ENSP00000446443:L543V	ENSP00000005905:L686V	L	-	1	2	KIAA0100	23986676	0.006000	0.16342	0.024000	0.17045	0.355000	0.29361	-0.015000	0.12634	-0.020000	0.14032	0.563000	0.77884	CTA	KIAA0100	-	NULL	ENSG00000007202		0.527	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0100	HGNC	protein_coding	OTTHUMT00000390571.3	41	0.00	0	G	NM_014680		26962549	26962549	-1	no_errors	ENST00000005905	ensembl	human	known	69_37n	missense	11	87.36	76	SNP	0.010	C
LGMN	5641	genome.wustl.edu	37	14	93178044	93178044	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr14:93178044G>A	ENST00000393218.2	-	11	1116	c.779C>T	c.(778-780)tCg>tTg	p.S260L	LGMN_ENST00000557434.1_Missense_Mutation_p.S260L|LGMN_ENST00000555699.1_Missense_Mutation_p.S260L|LGMN_ENST00000334869.4_Missense_Mutation_p.S260L	NM_001008530.2	NP_001008530.1	Q99538	LGMN_HUMAN	legumain	260					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|innate immune response (GO:0045087)|negative regulation of ERBB signaling pathway (GO:1901185)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of neuron apoptotic process (GO:0043524)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|receptor catabolic process (GO:0032801)|renal system process (GO:0003014)|response to acidic pH (GO:0010447)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|toll-like receptor signaling pathway (GO:0002224)|vitamin D metabolic process (GO:0042359)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(5)|skin(2)	18		all_cancers(154;0.0706)		COAD - Colon adenocarcinoma(157;0.224)		GTTGGTGTGCGATTTTACCAG	0.512																																						dbGAP											0													260.0	249.0	253.0					14																	93178044		2203	4300	6503	-	-	-	SO:0001583	missense	0			D55696	CCDS9904.1	14q32.12	2011-04-08		2002-01-18	ENSG00000100600	ENSG00000100600			9472	protein-coding gene	gene with protein product		602620	"""protease, cysteine, 1 (legumain)"""	PRSC1		8893817, 9065484	Standard	NM_001008530		Approved	LGMN1	uc001yaw.3	Q99538		ENST00000393218.2:c.779C>T	14.37:g.93178044G>A	ENSP00000376911:p.Ser260Leu		O00123|Q86TV2|Q86TV3|Q9BTY1	Missense_Mutation	SNP	pfam_Peptidase_C13,prints_Peptidase_C13	p.S260L	ENST00000393218.2	37	c.779	CCDS9904.1	14	.	.	.	.	.	.	.	.	.	.	G	13.06	2.123394	0.37436	.	.	ENSG00000100600	ENST00000555699;ENST00000334869;ENST00000557434;ENST00000334864;ENST00000262004;ENST00000393218;ENST00000539531;ENST00000535855	T;T;T;T	0.45276	0.9;0.9;0.91;0.9	5.28	3.34	0.38264	.	0.953267	0.08870	N	0.881685	T	0.33644	0.0870	L	0.52905	1.665	0.09310	N	1	B;B;P;B	0.34629	0.35;0.35;0.46;0.35	B;B;B;B	0.27500	0.08;0.08;0.046;0.08	T	0.10776	-1.0615	10	0.27785	T	0.31	-24.3052	7.6842	0.28530	0.0:0.1256:0.5208:0.3537	.	260;260;260;260	A8K669;Q99538;Q86TV2;Q86TV3	.;LGMN_HUMAN;.;.	L	260;260;260;260;260;260;237;225	ENSP00000451861:S260L;ENSP00000334052:S260L;ENSP00000452572:S260L;ENSP00000376911:S260L	ENSP00000262004:S260L	S	-	2	0	LGMN	92247797	0.010000	0.17322	0.633000	0.29310	0.739000	0.42172	0.939000	0.28978	2.628000	0.89032	0.511000	0.50034	TCG	LGMN	-	pfam_Peptidase_C13	ENSG00000100600		0.512	LGMN-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LGMN	HGNC	protein_coding	OTTHUMT00000412288.1	135	0.00	0	G	NM_005606		93178044	93178044	-1	no_errors	ENST00000334869	ensembl	human	known	69_37n	missense	43	27.87	17	SNP	0.086	A
LRP12	29967	genome.wustl.edu	37	8	105510194	105510194	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr8:105510194C>T	ENST00000276654.5	-	5	694	c.586G>A	c.(586-588)Gat>Aat	p.D196N	LRP12_ENST00000518375.1_5'Flank|LRP12_ENST00000424843.2_Missense_Mutation_p.D177N	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	196	LDL-receptor class A 1. {ECO:0000255|PROSITE-ProRule:PRU00124}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			ATCTCTTCATCGGAACTATCT	0.423																																						dbGAP											0													189.0	170.0	177.0					8																	105510194		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.586G>A	8.37:g.105510194C>T	ENSP00000276654:p.Asp196Asn		A8K137|B4DRQ2	Missense_Mutation	SNP	pfam_CUB,pfam_LDrepeatLR_classA_rpt,superfamily_CUB,superfamily_LDrepeatLR_classA_rpt,smart_CUB,smart_LDrepeatLR_classA_rpt,pfscan_CUB,pfscan_LDrepeatLR_classA_rpt	p.D177N	ENST00000276654.5	37	c.529	CCDS6303.1	8	.	.	.	.	.	.	.	.	.	.	C	26.1	4.702550	0.88924	.	.	ENSG00000147650	ENST00000424843;ENST00000276654	D;D	0.99214	-5.57;-5.57	5.38	5.38	0.77491	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99684	0.9881	H	0.97758	4.07	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.994;0.996	D	0.97403	0.9997	10	0.87932	D	0	-25.5047	19.1664	0.93559	0.0:1.0:0.0:0.0	.	177;196	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	N	177;196	ENSP00000399148:D177N;ENSP00000276654:D196N	ENSP00000276654:D196N	D	-	1	0	LRP12	105579370	1.000000	0.71417	0.938000	0.37757	0.895000	0.52256	7.487000	0.81328	2.524000	0.85096	0.563000	0.77884	GAT	LRP12	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000147650		0.423	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRP12	HGNC	protein_coding	OTTHUMT00000380821.1	91	0.00	0	C	NM_013437		105510194	105510194	-1	no_errors	ENST00000424843	ensembl	human	known	69_37n	missense	44	35.29	24	SNP	1.000	T
MAPK10	5602	genome.wustl.edu	37	4	87028414	87028414	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr4:87028414G>C	ENST00000359221.3	-	5	854	c.328C>G	c.(328-330)Cgg>Ggg	p.R110G	MAPK10_ENST00000513839.1_5'UTR|MAPK10_ENST00000395157.3_5'UTR|MAPK10_ENST00000361569.2_Missense_Mutation_p.R110G|MAPK10_ENST00000395169.3_Missense_Mutation_p.R72G|MAPK10_ENST00000395160.3_5'UTR|MAPK10_ENST00000395161.2_Missense_Mutation_p.R110G|MAPK10_ENST00000395166.1_Missense_Mutation_p.R72G|MAPK10_ENST00000449047.2_5'UTR			P53779	MK10_HUMAN	mitogen-activated protein kinase 10	110	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|JUN kinase activity (GO:0004705)|MAP kinase kinase activity (GO:0004708)	p.R110R(1)		breast(1)|central_nervous_system(1)|stomach(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)		ACCAGCTCCCGGTACGCTCTC	0.438																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											131.0	124.0	126.0					4																	87028414		2203	4300	6503	-	-	-	SO:0001583	missense	0			U07620	CCDS3612.1, CCDS3613.1, CCDS34026.1, CCDS43247.1	4q22-q23	2011-06-09			ENSG00000109339	ENSG00000109339	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6872	protein-coding gene	gene with protein product		602897		PRKM10		8654373, 12436199	Standard	NM_002753		Approved	JNK3, p493F12, p54bSAPK	uc003hpt.3	P53779	OTTHUMG00000130604	ENST00000359221.3:c.328C>G	4.37:g.87028414G>C	ENSP00000352157:p.Arg110Gly		A6NFS3|A6NG28|B3KQ94|Q15707|Q49AP1	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_MAPK_JNK	p.R110G	ENST00000359221.3	37	c.328	CCDS34026.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.59|19.59	3.855317|3.855317	0.71719|0.71719	.|.	.|.	ENSG00000109339|ENSG00000109339	ENST00000515400|ENST00000395169;ENST00000359221;ENST00000361569;ENST00000395166;ENST00000395161;ENST00000512017;ENST00000512564;ENST00000511167;ENST00000511328;ENST00000509464	.|D;D;D;D;D;D;D;D;D;D	.|0.85088	.|-1.94;-1.94;-1.94;-1.94;-1.94;-1.94;-1.94;-1.94;-1.94;-1.94	5.9|5.9	4.98|4.98	0.66077|0.66077	.|Serine/threonine-protein kinase-like domain (1);MAP kinase, conserved site (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.93314|0.93314	0.7869|0.7869	M|M	0.89478|0.89478	3.035|3.035	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|1.0;1.0;1.0	D|D	0.94102|0.94102	0.7363|0.7363	5|10	.|0.87932	.|D	.|0	-14.0013|-14.0013	16.0722|16.0722	0.80943|0.80943	0.0:0.0:0.801:0.199|0.0:0.0:0.801:0.199	.|.	.|72;110;110	.|P53779-3;P53779-2;P53779	.|.;.;MK10_HUMAN	R|G	22|72;110;110;72;110;110;72;110;110;72	.|ENSP00000378598:R72G;ENSP00000352157:R110G;ENSP00000355297:R110G;ENSP00000378595:R72G;ENSP00000378590:R110G;ENSP00000424755:R110G;ENSP00000422985:R72G;ENSP00000422277:R110G;ENSP00000421762:R110G;ENSP00000424128:R72G	.|ENSP00000309857:R110G	P|R	-|-	2|1	0|2	MAPK10|MAPK10	87247438|87247438	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	1.764000|1.764000	0.38471|0.38471	2.798000|2.798000	0.96311|0.96311	0.650000|0.650000	0.86243|0.86243	CCG|CGG	MAPK10	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000109339		0.438	MAPK10-012	KNOWN	basic|CCDS	protein_coding	MAPK10	HGNC	protein_coding	OTTHUMT00000361363.2	171	0.58	1	G			87028414	87028414	-1	no_errors	ENST00000359221	ensembl	human	known	69_37n	missense	43	33.85	22	SNP	1.000	C
MUC17	140453	genome.wustl.edu	37	7	100676392	100676392	+	Silent	SNP	T	T	C			TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr7:100676392T>C	ENST00000306151.4	+	3	1759	c.1695T>C	c.(1693-1695)ccT>ccC	p.P565P		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	565	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CCTCAACTCCTAGTGAAGGAA	0.498																																						dbGAP											0													301.0	313.0	309.0					7																	100676392		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.1695T>C	7.37:g.100676392T>C			O14761|Q685J2|Q8TDH7	Silent	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.P565	ENST00000306151.4	37	c.1695	CCDS34711.1	7																																																																																			MUC17	-	NULL	ENSG00000169876		0.498	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	181	0.00	0	T	NM_001040105		100676392	100676392	+1	no_errors	ENST00000306151	ensembl	human	known	69_37n	silent	43	23.21	13	SNP	0.000	C
MYO6	4646	genome.wustl.edu	37	6	76596584	76596584	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr6:76596584G>A	ENST00000369977.3	+	25	2670	c.2531G>A	c.(2530-2532)gGc>gAc	p.G844D	MYO6_ENST00000369981.3_Missense_Mutation_p.G844D|MYO6_ENST00000369975.1_Missense_Mutation_p.G844D|MYO6_ENST00000369985.4_Missense_Mutation_p.G844D	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	844					actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		GTTAAGGTGGGCACACTGAAA	0.323																																						dbGAP											0													84.0	88.0	87.0					6																	76596584		2203	4300	6503	-	-	-	SO:0001583	missense	0			U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.2531G>A	6.37:g.76596584G>A	ENSP00000358994:p.Gly844Asp		A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.G844D	ENST00000369977.3	37	c.2531	CCDS34487.1	6	.	.	.	.	.	.	.	.	.	.	G	11.03	1.518037	0.27211	.	.	ENSG00000196586	ENST00000428345;ENST00000369981;ENST00000369985;ENST00000369977;ENST00000369975	D;D;D;T	0.88664	-2.39;-2.41;-2.4;2.03	5.93	5.93	0.95920	.	0.166437	0.53938	D	0.000051	T	0.66489	0.2794	N	0.08118	0	0.33957	D	0.645126	P;B	0.35033	0.481;0.062	B;B	0.32465	0.146;0.015	T	0.68496	-0.5393	10	0.25106	T	0.35	.	13.5336	0.61635	0.0709:0.0:0.9291:0.0	.	844;844	Q9UM54-2;Q9UM54-1	.;.	D	844	ENSP00000358998:G844D;ENSP00000359002:G844D;ENSP00000358994:G844D;ENSP00000358992:G844D	ENSP00000358992:G844D	G	+	2	0	MYO6	76653304	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.262000	0.43285	2.798000	0.96311	0.655000	0.94253	GGC	MYO6	-	NULL	ENSG00000196586		0.323	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO6	HGNC	protein_coding	OTTHUMT00000041279.2	73	0.00	0	G	NM_004999		76596584	76596584	+1	no_errors	ENST00000369981	ensembl	human	known	69_37n	missense	24	22.58	7	SNP	1.000	A
OLFML2A	169611	genome.wustl.edu	37	9	127549306	127549306	+	Missense_Mutation	SNP	G	G	A	rs549641804		TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr9:127549306G>A	ENST00000373580.3	+	2	143	c.143G>A	c.(142-144)cGt>cAt	p.R48H		NM_182487.2	NP_872293.2	Q68BL7	OLM2A_HUMAN	olfactomedin-like 2A	48					extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			endometrium(5)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	25						TCCGACTGCCGTTGCAAGTGC	0.647																																						dbGAP											0													63.0	70.0	68.0					9																	127549306		2116	4224	6340	-	-	-	SO:0001583	missense	0			AK092255	CCDS6857.2, CCDS65129.1	9q34.11	2008-02-05			ENSG00000185585	ENSG00000185585			27270	protein-coding gene	gene with protein product		615899				12477932	Standard	NM_001282715		Approved	FLJ00237	uc004bov.3	Q68BL7	OTTHUMG00000020663	ENST00000373580.3:c.143G>A	9.37:g.127549306G>A	ENSP00000362682:p.Arg48His		Q5JTM5|Q5JTM6|Q6UXW1|Q7Z5V3	Missense_Mutation	SNP	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	p.R48H	ENST00000373580.3	37	c.143	CCDS6857.2	9	.	.	.	.	.	.	.	.	.	.	G	35	5.519971	0.96416	.	.	ENSG00000185585	ENST00000331715;ENST00000425732;ENST00000373580	T;T	0.47177	0.85;0.85	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.70500	0.3231	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.72789	-0.4187	10	0.87932	D	0	.	18.4586	0.90729	0.0:0.0:1.0:0.0	.	48;48	Q5JTM7;Q68BL7	.;OLM2A_HUMAN	H	48	ENSP00000336425:R48H;ENSP00000362682:R48H	ENSP00000336425:R48H	R	+	2	0	OLFML2A	126589127	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.605000	0.82844	2.699000	0.92147	0.655000	0.94253	CGT	OLFML2A	-	NULL	ENSG00000185585		0.647	OLFML2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFML2A	HGNC	protein_coding	OTTHUMT00000054046.2	55	0.00	0	G	NM_182487		127549306	127549306	+1	no_errors	ENST00000373580	ensembl	human	known	69_37n	missense	18	35.71	10	SNP	1.000	A
ORC3	23595	genome.wustl.edu	37	6	88375529	88375529	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr6:88375529G>A	ENST00000392844.3	+	19	2056	c.2008G>A	c.(2008-2010)Gaa>Aaa	p.E670K	ORC3_ENST00000546266.1_Missense_Mutation_p.E527K|ORC3_ENST00000257789.4_Missense_Mutation_p.E671K	NM_012381.3|NM_181837.2	NP_036513.2|NP_862820.1	Q9UBD5	ORC3_HUMAN	origin recognition complex, subunit 3	670					DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|neural precursor cell proliferation (GO:0061351)	nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|origin recognition complex (GO:0000808)	DNA replication origin binding (GO:0003688)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	28						TGCAACCTCAGAAGAAATGAA	0.323																																						dbGAP											0													54.0	55.0	55.0					6																	88375529		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF093535	CCDS5012.1, CCDS43486.1, CCDS56440.1	6q	2010-10-12	2010-10-12	2010-10-12	ENSG00000135336	ENSG00000135336			8489	protein-coding gene	gene with protein product		604972	"""origin recognition complex, subunit 3 (yeast homolog)-like"", ""origin recognition complex, subunit 3-like (yeast)"", ""origin recognition complex, subunit 3 honolog (yeast)"""	ORC3L		9829972, 10402192	Standard	NM_181837		Approved	IMAGE50150, LATHEO	uc003pmg.3	Q9UBD5	OTTHUMG00000015179	ENST00000392844.3:c.2008G>A	6.37:g.88375529G>A	ENSP00000376586:p.Glu670Lys		A2A2T5|B4E025|Q13565|Q53GY6|Q5T159|Q6IUY7|Q86TN5|Q9UG44|Q9UNT6	Missense_Mutation	SNP	pfam_ORC3	p.E671K	ENST00000392844.3	37	c.2011	CCDS43486.1	6	.	.	.	.	.	.	.	.	.	.	G	16.84	3.235270	0.58886	.	.	ENSG00000135336	ENST00000392844;ENST00000257789;ENST00000546266	T;T;T	0.13089	2.99;2.99;2.62	5.85	4.99	0.66335	.	0.153741	0.64402	D	0.000019	T	0.04588	0.0125	L	0.37561	1.115	0.40560	D	0.981203	B;B;B	0.14805	0.007;0.006;0.011	B;B;B	0.14023	0.01;0.005;0.007	T	0.19386	-1.0307	10	0.12430	T	0.62	-8.752	14.93	0.70908	0.0685:0.0:0.9315:0.0	.	608;670;671	B4E014;Q9UBD5;Q9UBD5-2	.;ORC3_HUMAN;.	K	670;671;527	ENSP00000376586:E670K;ENSP00000257789:E671K;ENSP00000444695:E527K	ENSP00000257789:E671K	E	+	1	0	ORC3	88432248	1.000000	0.71417	0.992000	0.48379	0.978000	0.69477	6.874000	0.75546	1.486000	0.48398	0.655000	0.94253	GAA	ORC3	-	NULL	ENSG00000135336		0.323	ORC3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ORC3	HGNC	protein_coding	OTTHUMT00000041452.2	66	0.00	0	G			88375529	88375529	+1	no_errors	ENST00000257789	ensembl	human	known	69_37n	missense	31	20.51	8	SNP	1.000	A
PDLIM1	9124	genome.wustl.edu	37	10	97007096	97007096	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr10:97007096G>C	ENST00000329399.6	-	5	669	c.561C>G	c.(559-561)agC>agG	p.S187R	PDLIM1_ENST00000477757.1_5'UTR	NM_020992.2	NP_066272.1	O00151	PDLI1_HUMAN	PDZ and LIM domain 1	187					regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(5)|lung(1)|ovary(1)|skin(2)	10		Colorectal(252;0.083)		Epithelial(162;1.64e-06)|all cancers(201;3.71e-05)		CGATGACAAGGCTGCTTGGAG	0.428																																						dbGAP											0													96.0	90.0	92.0					10																	97007096		2203	4300	6503	-	-	-	SO:0001583	missense	0			U90878	CCDS7441.1	10q23.1	2008-07-29	2008-07-29		ENSG00000107438	ENSG00000107438			2067	protein-coding gene	gene with protein product	"""carboxyl terminal LIM domain protein 1"", ""elfin"""	605900	"""PDZ and LIM domain 1 (elfin)"""	CLIM1		10861853	Standard	NM_020992		Approved	CLP-36, hCLIM1, CLP36	uc001kkh.4	O00151	OTTHUMG00000018810	ENST00000329399.6:c.561C>G	10.37:g.97007096G>C	ENSP00000360305:p.Ser187Arg		B2RBS6|Q5VZH5|Q9BPZ9	Missense_Mutation	SNP	pfam_PDZ,pfam_Znf_LIM,superfamily_PDZ,smart_PDZ,smart_ZASP,smart_Znf_LIM,pfscan_Znf_LIM,pfscan_PDZ	p.S187R	ENST00000329399.6	37	c.561	CCDS7441.1	10	.	.	.	.	.	.	.	.	.	.	G	1.991	-0.431740	0.04669	.	.	ENSG00000107438	ENST00000329399	T	0.43294	0.95	5.73	3.8	0.43715	.	0.802457	0.12048	N	0.504384	T	0.26919	0.0659	L	0.32530	0.975	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.31280	-0.9949	10	0.12103	T	0.63	-1.0661	4.9249	0.13889	0.244:0.0:0.5646:0.1913	.	187	O00151	PDLI1_HUMAN	R	187	ENSP00000360305:S187R	ENSP00000360305:S187R	S	-	3	2	PDLIM1	96997086	0.150000	0.22732	0.938000	0.37757	0.257000	0.26127	1.484000	0.35508	0.665000	0.31066	0.655000	0.94253	AGC	PDLIM1	-	NULL	ENSG00000107438		0.428	PDLIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDLIM1	HGNC	protein_coding	OTTHUMT00000049508.1	90	0.00	0	G			97007096	97007096	-1	no_errors	ENST00000329399	ensembl	human	known	69_37n	missense	25	38.10	16	SNP	0.096	C
PKP1	5317	genome.wustl.edu	37	1	201282596	201282596	+	Silent	SNP	G	G	A	rs148914791	byFrequency	TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr1:201282596G>A	ENST00000352845.3	+	3	609	c.609G>A	c.(607-609)ccG>ccA	p.P203P	PKP1_ENST00000367324.3_Silent_p.P203P|PKP1_ENST00000263946.3_Silent_p.P203P			Q13835	PKP1_HUMAN	plakophilin 1	203					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intermediate filament bundle assembly (GO:0045110)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|lamin binding (GO:0005521)|signal transducer activity (GO:0004871)|structural constituent of epidermis (GO:0030280)			NS(2)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(5)|prostate(1)	22						CTGTGCGCCCGCCCTCTTGTG	0.597													G|||	2	0.000399361	0.0	0.0	5008	,	,		17490	0.0		0.002	False		,,,				2504	0.0					dbGAP											0													52.0	50.0	51.0					1																	201282596		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X79293	CCDS30966.1, CCDS30967.1	1q32	2014-06-18	2014-06-18		ENSG00000081277	ENSG00000081277		"""Armadillo repeat containing"""	9023	protein-coding gene	gene with protein product	"""ectodermal dysplasia/skin fragility syndrome"""	601975	"""plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)"""			9272178	Standard	NM_001005337		Approved	B6P	uc001gwd.3	Q13835	OTTHUMG00000035729	ENST00000352845.3:c.609G>A	1.37:g.201282596G>A			O00645|Q14CA0|Q15152	Silent	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.P203	ENST00000352845.3	37	c.609	CCDS30966.1	1																																																																																			PKP1	-	NULL	ENSG00000081277		0.597	PKP1-004	KNOWN	basic|CCDS	protein_coding	PKP1	HGNC	protein_coding	OTTHUMT00000086897.1	65	0.00	0	G	NM_000299		201282596	201282596	+1	no_errors	ENST00000263946	ensembl	human	known	69_37n	silent	22	31.25	10	SNP	0.141	A
RAB3GAP1	22930	genome.wustl.edu	37	2	135848655	135848655	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr2:135848655G>A	ENST00000264158.8	+	4	281	c.238G>A	c.(238-240)Gta>Ata	p.V80I	RAB3GAP1_ENST00000539493.1_Missense_Mutation_p.V36I|RAB3GAP1_ENST00000487003.1_3'UTR|RAB3GAP1_ENST00000442034.1_Missense_Mutation_p.V80I	NM_012233.2	NP_036365.1	Q15042	RB3GP_HUMAN	RAB3 GTPase activating protein subunit 1 (catalytic)	80					brain development (GO:0007420)|camera-type eye development (GO:0043010)|establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|face morphogenesis (GO:0060325)|hypothalamus development (GO:0021854)|lipid particle organization (GO:0034389)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of calcium ion-dependent exocytosis of neurotransmitter (GO:1903233)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of GTPase activity (GO:0043087)|regulation of short-term neuronal synaptic plasticity (GO:0048172)	cytoplasm (GO:0005737)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32				BRCA - Breast invasive adenocarcinoma(221;0.117)		TCATTATCTTGTACAAGAGTC	0.338																																						dbGAP											0													92.0	94.0	93.0					2																	135848655		2203	4298	6501	-	-	-	SO:0001583	missense	0			D31886	CCDS33294.1, CCDS54402.1	2q21.3	2013-07-09			ENSG00000115839	ENSG00000115839			17063	protein-coding gene	gene with protein product		602536				9030515, 15696165	Standard	NM_012233		Approved	RAB3GAP, KIAA0066, RAB3GAP130, WARBM1	uc010fnf.3	Q15042	OTTHUMG00000154889	ENST00000264158.8:c.238G>A	2.37:g.135848655G>A	ENSP00000264158:p.Val80Ile		A6H8Z3|C9J837|Q659F5|Q8TBB4	Missense_Mutation	SNP	NULL	p.V80I	ENST00000264158.8	37	c.238	CCDS33294.1	2	.	.	.	.	.	.	.	.	.	.	G	14.67	2.604865	0.46423	.	.	ENSG00000115839	ENST00000264158;ENST00000539493;ENST00000442034	T;T;T	0.44482	0.94;0.93;0.92	5.14	4.26	0.50523	.	0.114484	0.64402	D	0.000017	T	0.27419	0.0673	N	0.24115	0.695	0.32970	D	0.522211	P;P	0.42827	0.791;0.791	B;B	0.35182	0.197;0.197	T	0.40515	-0.9559	10	0.42905	T	0.14	-10.9398	13.5865	0.61933	0.0762:0.0:0.9238:0.0	.	80;80	C9J837;Q15042	.;RB3GP_HUMAN	I	80;36;80	ENSP00000264158:V80I;ENSP00000444306:V36I;ENSP00000411418:V80I	ENSP00000264158:V80I	V	+	1	0	RAB3GAP1	135565125	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.269000	0.58890	1.298000	0.44778	0.585000	0.79938	GTA	RAB3GAP1	-	NULL	ENSG00000115839		0.338	RAB3GAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB3GAP1	HGNC	protein_coding	OTTHUMT00000337514.2	109	0.00	0	G	NM_012233		135848655	135848655	+1	no_errors	ENST00000264158	ensembl	human	known	69_37n	missense	26	33.33	13	SNP	1.000	A
THG1L	54974	genome.wustl.edu	37	5	157166415	157166415	+	Silent	SNP	A	A	T			TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr5:157166415A>T	ENST00000231198.7	+	6	1066	c.822A>T	c.(820-822)ccA>ccT	p.P274P		NM_017872.3	NP_060342.2	Q9NWX6	THG1_HUMAN	tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)	274					protein homotetramerization (GO:0051289)|tRNA modification (GO:0006400)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|tRNA binding (GO:0000049)|tRNA guanylyltransferase activity (GO:0008193)			NS(1)|central_nervous_system(2)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)|skin(1)	13	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GGACAAAGCCAGTGCCCTTGC	0.463																																						dbGAP											0													103.0	94.0	98.0					5																	157166415		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK223119	CCDS4341.1	5q33.3	2008-02-05			ENSG00000113272	ENSG00000113272			26053	protein-coding gene	gene with protein product	"""interphase cytoplasmic foci protein 45"""					11230166	Standard	XM_005265939		Approved	ICF45, FLJ11601, FLJ20546	uc003lxd.3	Q9NWX6	OTTHUMG00000130254	ENST00000231198.7:c.822A>T	5.37:g.157166415A>T			D3DQJ5|Q53G12|Q7L5R3|Q9H0S2	Silent	SNP	pfam_tRNAHis_GuaTrfase_cat,superfamily_Restrct_endonuc-II-like,pirsf_tRNAHis_GuaTrfase_Thg1	p.P274	ENST00000231198.7	37	c.822	CCDS4341.1	5																																																																																			THG1L	-	pfam_tRNAHis_GuaTrfase_cat,pirsf_tRNAHis_GuaTrfase_Thg1	ENSG00000113272		0.463	THG1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THG1L	HGNC	protein_coding	OTTHUMT00000252579.2	56	0.00	0	A	NM_017872		157166415	157166415	+1	no_errors	ENST00000231198	ensembl	human	known	69_37n	silent	15	28.57	6	SNP	0.006	T
TMEM132C	92293	genome.wustl.edu	37	12	129189746	129189746	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr12:129189746G>A	ENST00000435159.2	+	9	2233	c.2233G>A	c.(2233-2235)Gtg>Atg	p.V745M	TMEM132C_ENST00000315208.8_Missense_Mutation_p.V361M|TMEM132C_ENST00000537538.1_Missense_Mutation_p.V130M	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	745						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						CGAGGCTGTCGTGTCAGTCCC	0.657																																						dbGAP											0													37.0	38.0	38.0					12																	129189746		692	1591	2283	-	-	-	SO:0001583	missense	0			AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.2233G>A	12.37:g.129189746G>A	ENSP00000410852:p.Val745Met		Q69YX8	Missense_Mutation	SNP	NULL	p.V745M	ENST00000435159.2	37	c.2233		12	.	.	.	.	.	.	.	.	.	.	G	11.91	1.778169	0.31502	.	.	ENSG00000181234	ENST00000435159;ENST00000315208;ENST00000537538	T;T;T	0.16897	2.31;2.31;2.31	4.84	1.93	0.25924	.	0.245746	0.27298	N	0.020013	T	0.39911	0.1096	M	0.86864	2.845	0.52501	D	0.99995	D	0.69078	0.997	P	0.61874	0.895	T	0.28586	-1.0039	10	0.87932	D	0	.	9.6912	0.40129	0.2937:0.0:0.7063:0.0	.	745	Q8N3T6	T132C_HUMAN	M	745;361;130	ENSP00000410852:V745M;ENSP00000324458:V361M;ENSP00000438477:V130M	ENSP00000324458:V361M	V	+	1	0	TMEM132C	127755699	1.000000	0.71417	0.013000	0.15412	0.001000	0.01503	3.290000	0.51755	0.091000	0.17302	-0.150000	0.13652	GTG	TMEM132C	-	NULL	ENSG00000181234		0.657	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	TMEM132C	HGNC	protein_coding		31	0.00	0	G	XM_044062		129189746	129189746	+1	no_errors	ENST00000435159	ensembl	human	known	69_37n	missense	19	20.83	5	SNP	0.945	A
TMPRSS5	80975	genome.wustl.edu	37	11	113570327	113570327	+	Silent	SNP	T	T	G			TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr11:113570327T>G	ENST00000299882.5	-	3	343	c.195A>C	c.(193-195)tcA>tcC	p.S65S	TMPRSS5_ENST00000545579.1_Silent_p.S56S|TMPRSS5_ENST00000540540.1_Intron|TMPRSS5_ENST00000536856.1_Intron|TMPRSS5_ENST00000544634.1_Silent_p.S65S|TMPRSS5_ENST00000544476.1_Silent_p.S21S|TMPRSS5_ENST00000538955.1_Silent_p.S21S	NM_030770.2	NP_110397.2	Q9H3S3	TMPS5_HUMAN	transmembrane protease, serine 5	65					proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	peptidase activity (GO:0008233)|scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	10		all_cancers(61;2.71e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.75e-06)|Epithelial(105;6.34e-05)|all cancers(92;0.000502)		CTAGGAGCCATGAGCCAACAC	0.602																																						dbGAP											0													18.0	26.0	23.0					11																	113570327		2075	4203	6278	-	-	-	SO:0001819	synonymous_variant	0			AB028140	CCDS44735.1, CCDS73390.1, CCDS73391.1, CCDS73392.1, CCDS73393.1	11q	2010-04-13	2008-07-31		ENSG00000166682	ENSG00000166682		"""Serine peptidases / Transmembrane"""	14908	protein-coding gene	gene with protein product	"""spinesin"""	606751					Standard	NM_030770		Approved	MGC141886, MGC148044	uc001poc.4	Q9H3S3	OTTHUMG00000168186	ENST00000299882.5:c.195A>C	11.37:g.113570327T>G				Silent	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Srcr_rcpt-rel,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_Peptidase_S1_S6	p.S65	ENST00000299882.5	37	c.195	CCDS44735.1	11																																																																																			TMPRSS5	-	NULL	ENSG00000166682		0.602	TMPRSS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS5	HGNC	protein_coding	OTTHUMT00000398652.1	62	0.00	0	T	NM_030770		113570327	113570327	-1	no_errors	ENST00000299882	ensembl	human	known	69_37n	silent	20	20.00	5	SNP	0.155	G
ZSCAN22	342945	genome.wustl.edu	37	19	58850657	58850657	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A2DA-01A-11D-A18P-09	TCGA-GM-A2DA-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	9e036b90-1cb2-4cb8-857d-09f2ca48e059	073ca5ca-7062-4b02-b5f4-49dbe64aa329	g.chr19:58850657G>T	ENST00000329665.4	+	3	1588	c.1441G>T	c.(1441-1443)Gtt>Ttt	p.V481F		NM_181846.2	NP_862829.1	P10073	ZSC22_HUMAN	zinc finger and SCAN domain containing 22	481					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|pancreas(1)|prostate(2)	16		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0289)		AGCCCTGATGGTTCACTTGCG	0.587																																						dbGAP											0													64.0	56.0	59.0					19																	58850657		2203	4300	6503	-	-	-	SO:0001583	missense	0			M20675	CCDS12975.1	19q13.43	2013-01-08	2006-09-20	2006-09-20				"""-"", ""Zinc fingers, C2H2-type"""	4929	protein-coding gene	gene with protein product	"""oncogene HKR2"""	165260	"""zinc finger protein 50"", ""GLI-Kruppel family member HKR2"""	ZNF50, HKR2		2850480, 1505991	Standard	NM_181846		Approved		uc002qsc.2	P10073		ENST00000329665.4:c.1441G>T	19.37:g.58850657G>T	ENSP00000332433:p.Val481Phe		Q15922|Q7Z3L8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.V481F	ENST00000329665.4	37	c.1441	CCDS12975.1	19	.	.	.	.	.	.	.	.	.	.	G	8.838	0.941471	0.18281	.	.	ENSG00000182318	ENST00000329665	T	0.08720	3.06	4.18	-2.56	0.06268	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07638	0.0192	L	0.60067	1.865	0.09310	N	1	B	0.17852	0.024	B	0.08055	0.003	T	0.40421	-0.9564	9	0.62326	D	0.03	.	2.7995	0.05410	0.3061:0.0:0.3574:0.3365	.	481	P10073	ZSC22_HUMAN	F	481	ENSP00000332433:V481F	ENSP00000332433:V481F	V	+	1	0	ZSCAN22	63542469	0.000000	0.05858	0.013000	0.15412	0.212000	0.24457	-0.866000	0.04245	-0.105000	0.12132	0.563000	0.77884	GTT	ZSCAN22	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000182318		0.587	ZSCAN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN22	HGNC	protein_coding	OTTHUMT00000466765.1	46	0.00	0	G	NM_181846		58850657	58850657	+1	no_errors	ENST00000329665	ensembl	human	known	69_37n	missense	14	33.33	7	SNP	0.004	T
