#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
CECR2	27443	genome.wustl.edu	37	22	17978507	17978507	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A3XG-01A-31D-A243-09	TCGA-GM-A3XG-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7e92fbc5-c484-449a-8a40-8d820d6fd64d	c1481d6c-531b-4d94-be70-9370c5e53417	g.chr22:17978507G>T	ENST00000400573.5	+	4	412	c.405G>T	c.(403-405)tgG>tgT	p.W135C	CECR2_ENST00000342247.5_Missense_Mutation_p.W115C|CECR2_ENST00000400585.2_5'UTR|CECR2_ENST00000262608.8_Missense_Mutation_p.W116C			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	157					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		CACTATATTGGTATTTCTATG	0.483																																						dbGAP											0													87.0	83.0	84.0					22																	17978507		1860	4104	5964	-	-	-	SO:0001583	missense	0			AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400573.5:c.405G>T	22.37:g.17978507G>T	ENSP00000383417:p.Trp135Cys		A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.W135C	ENST00000400573.5	37	c.405		22	.	.	.	.	.	.	.	.	.	.	G	26.5	4.739850	0.89573	.	.	ENSG00000099954	ENST00000342247;ENST00000400573;ENST00000262608	T;T;T	0.48836	0.8;0.8;0.8	6.01	6.01	0.97437	.	0.000000	0.34435	U	0.003965	T	0.73946	0.3652	M	0.83774	2.66	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.75786	-0.3195	10	0.87932	D	0	-6.5409	20.5141	0.99211	0.0:0.0:1.0:0.0	.	157	Q9BXF3	CECR2_HUMAN	C	115;135;116	ENSP00000341219:W115C;ENSP00000383417:W135C;ENSP00000262608:W116C	ENSP00000262608:W116C	W	+	3	0	CECR2	16358507	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.381000	0.97205	2.850000	0.98022	0.655000	0.94253	TGG	CECR2	-	NULL	ENSG00000099954		0.483	CECR2-001	NOVEL	basic|appris_candidate_longest	protein_coding	CECR2	HGNC	protein_coding	OTTHUMT00000316104.5	32	0.00	0	G	NM_031413		17978507	17978507	+1	no_errors	ENST00000400573	ensembl	human	novel	69_37n	missense	31	11.43	4	SNP	1.000	T
COG1	9382	genome.wustl.edu	37	17	71197882	71197882	+	Nonsense_Mutation	SNP	C	C	A			TCGA-GM-A3XG-01A-31D-A243-09	TCGA-GM-A3XG-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7e92fbc5-c484-449a-8a40-8d820d6fd64d	c1481d6c-531b-4d94-be70-9370c5e53417	g.chr17:71197882C>A	ENST00000299886.4	+	7	1996	c.1916C>A	c.(1915-1917)tCa>tAa	p.S639*		NM_018714.2	NP_061184.1	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1	639					Golgi organization (GO:0007030)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18			LUSC - Lung squamous cell carcinoma(166;0.197)			TCAGAGAGCTCAGAGAAACCA	0.507																																						dbGAP											0													58.0	60.0	59.0					17																	71197882		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS11692.1	17q25.1	2008-05-14	2002-05-28	2002-05-31		ENSG00000166685		"""Components of oligomeric golgi complex"""	6545	protein-coding gene	gene with protein product		606973	"""low density lipoprotein receptor defect B complementing"""	LDLB		9927668	Standard	NM_018714		Approved	KIAA1381	uc002jjg.3	Q8WTW3		ENST00000299886.4:c.1916C>A	17.37:g.71197882C>A	ENSP00000299886:p.Ser639*		Q9NPV9|Q9P2G6	Nonsense_Mutation	SNP	pfam_Vps51	p.S639*	ENST00000299886.4	37	c.1916	CCDS11692.1	17	.	.	.	.	.	.	.	.	.	.	C	18.30	3.592686	0.66219	.	.	ENSG00000166685	ENST00000438720;ENST00000299886	.	.	.	5.25	5.25	0.73442	.	0.683389	0.15155	N	0.277490	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	-1.2052	14.2425	0.65966	0.0:0.9266:0.0:0.0734	.	.	.	.	X	639	.	ENSP00000299886:S639X	S	+	2	0	COG1	68709477	0.000000	0.05858	0.005000	0.12908	0.051000	0.14879	1.113000	0.31184	2.485000	0.83878	0.650000	0.86243	TCA	COG1	-	NULL	ENSG00000166685		0.507	COG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG1	HGNC	protein_coding	OTTHUMT00000441638.1	42	0.00	0	C			71197882	71197882	+1	no_errors	ENST00000299886	ensembl	human	known	69_37n	nonsense	35	10.26	4	SNP	0.008	A
DCTN5	84516	genome.wustl.edu	37	16	23680339	23680339	+	3'UTR	SNP	G	G	T			TCGA-GM-A3XG-01A-31D-A243-09	TCGA-GM-A3XG-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7e92fbc5-c484-449a-8a40-8d820d6fd64d	c1481d6c-531b-4d94-be70-9370c5e53417	g.chr16:23680339G>T	ENST00000300087.2	+	0	2574				CTD-2196E14.9_ENST00000566996.1_lincRNA	NM_001199743.1|NM_032486.3	NP_001186672.1|NP_115875.1	Q9BTE1	DCTN5_HUMAN	dynactin 5 (p25)						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)				endometrium(2)|lung(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	10				GBM - Glioblastoma multiforme(48;0.0156)		ATAATTATGTGCTGATGTATT	0.438																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS10615.1, CCDS58435.1, CCDS58436.1	16p12.1	2008-02-05			ENSG00000166847	ENSG00000166847			24594	protein-coding gene	gene with protein product		612962				10525537, 15043994	Standard	NM_032486		Approved	MGC3248, p25	uc002dly.2	Q9BTE1	OTTHUMG00000131610	ENST00000300087.2:c.*1874G>T	16.37:g.23680339G>T			A8K9X8|H3BN51|H3BQA4	RNA	SNP	-	NULL	ENST00000300087.2	37	NULL	CCDS10615.1	16																																																																																			DCTN5	-	-	ENSG00000166847		0.438	DCTN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCTN5	HGNC	protein_coding	OTTHUMT00000254497.1	43	0.00	0	G	NM_032486		23680339	23680339	+1	no_errors	ENST00000563614	ensembl	human	known	69_37n	rna	36	10.00	4	SNP	0.001	T
FAM208B	54906	genome.wustl.edu	37	10	5789185	5789185	+	Silent	SNP	G	G	T			TCGA-GM-A3XG-01A-31D-A243-09	TCGA-GM-A3XG-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7e92fbc5-c484-449a-8a40-8d820d6fd64d	c1481d6c-531b-4d94-be70-9370c5e53417	g.chr10:5789185G>T	ENST00000328090.5	+	15	4426	c.3801G>T	c.(3799-3801)gtG>gtT	p.V1267V		NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	1267																	GCCTGTCTGTGAGTAGAGAGG	0.393																																						dbGAP											0													83.0	86.0	85.0					10																	5789185		1875	4118	5993	-	-	-	SO:0001819	synonymous_variant	0			BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.3801G>T	10.37:g.5789185G>T			Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Silent	SNP	pfam_DUF3715,pfam_DUF3699	p.V1267	ENST00000328090.5	37	c.3801	CCDS41485.1	10																																																																																			FAM208B	-	NULL	ENSG00000108021		0.393	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM208B	HGNC	protein_coding	OTTHUMT00000046571.2	18	0.00	0	G	NM_017782		5789185	5789185	+1	no_errors	ENST00000328090	ensembl	human	known	69_37n	silent	17	19.05	4	SNP	0.014	T
LINC00588	26138	genome.wustl.edu	37	8	58197243	58197243	+	lincRNA	SNP	G	G	C	rs6999878	byFrequency	TCGA-GM-A3XG-01A-31D-A243-09	TCGA-GM-A3XG-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7e92fbc5-c484-449a-8a40-8d820d6fd64d	c1481d6c-531b-4d94-be70-9370c5e53417	g.chr8:58197243G>C	ENST00000521663.1	+	0	1828					NR_026772.1		Q9Y4M8	CH071_HUMAN	long intergenic non-protein coding RNA 588																		GTCAGTTTTTGCTATTTGGAA	0.269													C|||	962	0.192093	0.2852	0.1628	5008	,	,		16848	0.2054		0.175	False		,,,				2504	0.091					dbGAP											0																																										-	-	-			0					8q12.1	2012-10-12	2012-04-17	2012-04-17	ENSG00000215117	ENSG00000215117		"""Long non-coding RNAs"""	24494	non-coding RNA	RNA, long non-coding			"""chromosome 8 open reading frame 71"""	C8orf71		11230166	Standard	NR_026772		Approved	DKFZP434F122	uc003xtg.3	Q9Y4M8	OTTHUMG00000164424		8.37:g.58197243G>C				RNA	SNP	-	NULL	ENST00000521663.1	37	NULL		8																																																																																			LINC00588	-	-	ENSG00000215117		0.269	LINC00588-001	KNOWN	basic	lincRNA	LINC00588	HGNC	lincRNA	OTTHUMT00000378704.1	8	0.00	0	G	NR_026772		58197243	58197243	+1	no_errors	ENST00000521663	ensembl	human	known	69_37n	rna	4	55.56	5	SNP	0.000	C
OR4C5	79346	genome.wustl.edu	37	11	48387890	48387890	+	Missense_Mutation	SNP	T	T	C	rs74623688	byFrequency	TCGA-GM-A3XG-01A-31D-A243-09	TCGA-GM-A3XG-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7e92fbc5-c484-449a-8a40-8d820d6fd64d	c1481d6c-531b-4d94-be70-9370c5e53417	g.chr11:48387890T>C	ENST00000319813.3	-	1	127	c.128A>G	c.(127-129)gAg>gGg	p.E43G				Q8NGB2	OR4C5_HUMAN	olfactory receptor, family 4, subfamily C, member 5	43						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										TTTCTGTGCCTCTGCGTTCTG	0.433																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0					11p11.2	2013-03-27	2004-03-04	2004-03-05	ENSG00000176540	ENSG00000176540		"""GPCR / Class A : Olfactory receptors"""	14702	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 5 pseudogene"""	OR4C5P			Standard	NG_002247		Approved	OR4C5Q		Q8NGB2	OTTHUMG00000169462	ENST00000319813.3:c.128A>G	11.37:g.48387890T>C	ENSP00000321338:p.Glu43Gly		Q6IFB2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.E43G	ENST00000319813.3	37	c.128		11	.	.	.	.	.	.	.	.	.	.	T	8.389	0.839369	0.16891	.	.	ENSG00000176540	ENST00000319813	T	0.00444	7.4	5.03	3.89	0.44902	.	1.106440	0.06781	N	0.785294	T	0.00384	0.0012	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.53892	-0.8374	7	0.40728	T	0.16	.	9.0064	0.36115	0.0:0.0895:0.0:0.9105	.	.	.	.	G	43	ENSP00000321338:E43G	ENSP00000321338:E43G	E	-	2	0	OR4C5	48344466	0.000000	0.05858	0.007000	0.13788	0.441000	0.31987	0.165000	0.16564	0.885000	0.36088	0.381000	0.24937	GAG	OR4C5	-	NULL	ENSG00000176540		0.433	OR4C5-001	KNOWN	basic|appris_principal	protein_coding	OR4C5	HGNC	protein_coding	OTTHUMT00000404174.1	35	0.00	0	T	NG_002247		48387890	48387890	-1	no_errors	ENST00000319813	ensembl	human	known	69_37n	missense	33	17.50	7	SNP	0.003	C
SLC22A16	85413	genome.wustl.edu	37	6	110757113	110757113	+	Missense_Mutation	SNP	C	C	T	rs557232227		TCGA-GM-A3XG-01A-31D-A243-09	TCGA-GM-A3XG-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7e92fbc5-c484-449a-8a40-8d820d6fd64d	c1481d6c-531b-4d94-be70-9370c5e53417	g.chr6:110757113C>T	ENST00000368919.3	-	6	1429	c.1363G>A	c.(1363-1365)Ggg>Agg	p.G455R	SLC22A16_ENST00000330550.4_Missense_Mutation_p.G421R|SLC22A16_ENST00000439654.1_Missense_Mutation_p.G455R	NM_033125.3	NP_149116.2	Q86VW1	S22AG_HUMAN	solute carrier family 22 (organic cation/carnitine transporter), member 16	455					acid secretion (GO:0046717)|amine transport (GO:0015837)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|organic cation transport (GO:0015695)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carnitine transmembrane transporter activity (GO:0015226)|organic cation transmembrane transporter activity (GO:0015101)			breast(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)	Doxorubicin(DB00997)|L-Carnitine(DB00583)	AATGCTGCCCCGATGGCAAAT	0.358																																						dbGAP											0													97.0	95.0	96.0					6																	110757113		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5084.1	6q21	2013-05-22	2008-01-11		ENSG00000004809	ENSG00000004809		"""Solute carriers"""	20302	protein-coding gene	gene with protein product		608276	"""solute carrier family 22 (organic cation transporter), member 16"""			12372408, 12089149, 17473959	Standard	NM_033125		Approved	FLIPT2, CT2, OKB1, OAT6	uc003puf.3	Q86VW1	OTTHUMG00000016171	ENST00000368919.3:c.1363G>A	6.37:g.110757113C>T	ENSP00000357915:p.Gly455Arg		O14567|Q5JXM1|Q8IUG8|Q8IZD5|Q96M90|Q96RU0	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.G455R	ENST00000368919.3	37	c.1363	CCDS5084.1	6	.	.	.	.	.	.	.	.	.	.	C	19.10	3.762495	0.69763	.	.	ENSG00000004809	ENST00000368919;ENST00000451557;ENST00000330550;ENST00000439654	D;D;D;D	0.84730	-1.89;-1.89;-1.89;-1.89	4.75	2.9	0.33743	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.390713	0.27549	N	0.018879	D	0.87842	0.6279	M	0.79258	2.445	0.52099	D	0.999949	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.977	D	0.87135	0.2199	10	0.56958	D	0.05	.	8.7918	0.34854	0.1506:0.7709:0.0:0.0785	.	455;421	Q86VW1;Q86VW1-2	S22AG_HUMAN;.	R	455;372;421;455	ENSP00000357915:G455R;ENSP00000395642:G372R;ENSP00000328583:G421R;ENSP00000408799:G455R	ENSP00000328583:G421R	G	-	1	0	SLC22A16	110863806	0.099000	0.21834	0.000000	0.03702	0.639000	0.38242	2.612000	0.46343	0.562000	0.29204	0.491000	0.48974	GGG	SLC22A16	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000004809		0.358	SLC22A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A16	HGNC	protein_coding	OTTHUMT00000043428.1	16	0.00	0	C	NM_033125		110757113	110757113	-1	no_errors	ENST00000368919	ensembl	human	known	69_37n	missense	17	22.73	5	SNP	0.100	T
TMEM104	54868	genome.wustl.edu	37	17	72787153	72787153	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A3XG-01A-31D-A243-09	TCGA-GM-A3XG-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	7e92fbc5-c484-449a-8a40-8d820d6fd64d	c1481d6c-531b-4d94-be70-9370c5e53417	g.chr17:72787153G>T	ENST00000335464.5	+	6	567	c.405G>T	c.(403-405)atG>atT	p.M135I	TMEM104_ENST00000417024.2_Missense_Mutation_p.M148I|TMEM104_ENST00000582773.1_Missense_Mutation_p.M135I|TMEM104_ENST00000582330.1_Missense_Mutation_p.M135I	NM_017728.3	NP_060198.3	Q8NE00	TM104_HUMAN	transmembrane protein 104	135						integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(5)|ovary(1)	19	all_lung(278;0.23)					TGGGACAAATGGCCTCCATGT	0.522																																						dbGAP											0													99.0	74.0	82.0					17																	72787153		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074029	CCDS32723.1	17q25.1	2005-12-19				ENSG00000109066			25984	protein-coding gene	gene with protein product							Standard	NM_017728		Approved	FLJ20255, FLJ00021	uc002jls.4	Q8NE00		ENST00000335464.5:c.405G>T	17.37:g.72787153G>T	ENSP00000334849:p.Met135Ile		Q8TEU1|Q9NT56|Q9NXH1	Missense_Mutation	SNP	pfam_AA_transpt_TM	p.M135I	ENST00000335464.5	37	c.405	CCDS32723.1	17	.	.	.	.	.	.	.	.	.	.	G	33	5.215952	0.95104	.	.	ENSG00000109066	ENST00000335464;ENST00000417024	T;T	0.61158	4.45;0.13	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.80803	0.4693	M	0.90977	3.165	0.80722	D	1	D;D;D	0.76494	0.996;0.999;0.999	D;D;D	0.83275	0.97;0.996;0.988	T	0.80291	-0.1444	10	0.23891	T	0.37	-48.1095	18.9807	0.92754	0.0:0.0:1.0:0.0	.	148;135;135	B4DKL7;Q8NE00-2;Q8NE00	.;.;TM104_HUMAN	I	135;148	ENSP00000334849:M135I;ENSP00000397676:M148I	ENSP00000334849:M135I	M	+	3	0	TMEM104	70298748	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.056000	0.93881	2.555000	0.86185	0.484000	0.47621	ATG	TMEM104	-	pfam_AA_transpt_TM	ENSG00000109066		0.522	TMEM104-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM104	HGNC	protein_coding	OTTHUMT00000444442.1	22	0.00	0	G	NM_017728		72787153	72787153	+1	no_errors	ENST00000335464	ensembl	human	known	69_37n	missense	25	13.79	4	SNP	1.000	T
