#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABHD16B	140701	genome.wustl.edu	37	20	62494080	62494080	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr20:62494080C>T	ENST00000369916.3	+	1	1515	c.1187C>T	c.(1186-1188)gCg>gTg	p.A396V	TPD52L2_ENST00000348257.5_5'Flank|TPD52L2_ENST00000217121.5_5'Flank|C20ORF135_ENST00000601296.1_5'Flank|TPD52L2_ENST00000369927.4_5'Flank|TPD52L2_ENST00000352482.4_5'Flank|TPD52L2_ENST00000351424.4_5'Flank|TPD52L2_ENST00000358548.4_5'Flank|TPD52L2_ENST00000346249.4_5'Flank	NM_080622.3	NP_542189.1	Q9H3Z7	ABHGB_HUMAN	abhydrolase domain containing 16B	396							hydrolase activity (GO:0016787)			endometrium(2)|kidney(1)|lung(3)	6						TGGTGCCTGGCGCTGCTGCGC	0.731																																						dbGAP											0													10.0	10.0	10.0					20																	62494080		1987	3808	5795	-	-	-	SO:0001583	missense	0				CCDS13539.1	20q13.33	2013-01-17	2010-12-09	2010-12-09	ENSG00000183260	ENSG00000183260		"""Abhydrolase domain containing"""	16128	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 135"""	C20orf135			Standard	NM_080622		Approved	dJ591C20.1	uc002ygx.1	Q9H3Z7	OTTHUMG00000033010	ENST00000369916.3:c.1187C>T	20.37:g.62494080C>T	ENSP00000358932:p.Ala396Val			Missense_Mutation	SNP	pfam_AB_hydrolase_1	p.A396V	ENST00000369916.3	37	c.1187	CCDS13539.1	20	.	.	.	.	.	.	.	.	.	.	C	6.743	0.505968	0.12883	.	.	ENSG00000183260	ENST00000369916	T	0.45276	0.9	5.04	0.747	0.18371	.	0.307172	0.30293	N	0.009951	T	0.25121	0.0610	L	0.29908	0.895	0.09310	N	1	B	0.16166	0.016	B	0.09377	0.004	T	0.14559	-1.0468	10	0.62326	D	0.03	-11.8076	4.3872	0.11323	0.278:0.5093:0.1347:0.0781	.	396	Q9H3Z7	ABHGB_HUMAN	V	396	ENSP00000358932:A396V	ENSP00000358932:A396V	A	+	2	0	ABHD16B	61964524	0.002000	0.14202	0.001000	0.08648	0.000000	0.00434	0.033000	0.13754	-0.088000	0.12506	-1.115000	0.02055	GCG	ABHD16B	-	NULL	ENSG00000183260		0.731	ABHD16B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD16B	HGNC	protein_coding	OTTHUMT00000080254.1	41	0.00	0	C			62494080	62494080	+1	no_errors	ENST00000369916	ensembl	human	known	69_37n	missense	18	37.93	11	SNP	0.024	T
ANKIB1	54467	genome.wustl.edu	37	7	92027881	92027881	+	Missense_Mutation	SNP	C	C	G			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr7:92027881C>G	ENST00000265742.3	+	20	3264	c.2888C>G	c.(2887-2889)cCc>cGc	p.P963R		NM_019004.1	NP_061877.1	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	963							zinc ion binding (GO:0008270)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(19)|skin(1)	41	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			GGCCAGGACCCCAACATCAAT	0.488																																						dbGAP											0													139.0	136.0	137.0					7																	92027881		2043	4186	6229	-	-	-	SO:0001583	missense	0			AB037807	CCDS47639.1	7q21.3	2013-01-10			ENSG00000001629	ENSG00000001629		"""Ankyrin repeat domain containing"""	22215	protein-coding gene	gene with protein product							Standard	NM_019004		Approved	DKFZP434A0225, KIAA1386	uc003ulw.2	Q9P2G1	OTTHUMG00000155859	ENST00000265742.3:c.2888C>G	7.37:g.92027881C>G	ENSP00000265742:p.Pro963Arg		Q6GMS4|Q6P3S9|Q9NTD7|Q9NW49	Missense_Mutation	SNP	pfam_Znf_C6HC,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Znf_RING,smart_Znf_C6HC,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Ubiquitin-int_motif,pfscan_Znf_RING	p.P963R	ENST00000265742.3	37	c.2888	CCDS47639.1	7	.	.	.	.	.	.	.	.	.	.	C	11.24	1.581577	0.28180	.	.	ENSG00000001629	ENST00000265742	T	0.11385	2.78	5.61	4.71	0.59529	.	0.262395	0.37809	N	0.001933	T	0.09818	0.0241	N	0.24115	0.695	0.54753	D	0.999985	P;B	0.36909	0.573;0.177	B;B	0.36186	0.219;0.1	T	0.10917	-1.0609	10	0.87932	D	0	.	15.9734	0.80040	0.1359:0.8641:0.0:0.0	.	315;963	Q4VBX8;Q9P2G1	.;AKIB1_HUMAN	R	963	ENSP00000265742:P963R	ENSP00000265742:P963R	P	+	2	0	ANKIB1	91865817	1.000000	0.71417	0.420000	0.26596	0.418000	0.31294	5.512000	0.67030	1.456000	0.47831	0.655000	0.94253	CCC	ANKIB1	-	NULL	ENSG00000001629		0.488	ANKIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKIB1	HGNC	protein_coding	OTTHUMT00000342018.1	57	0.00	0	C			92027881	92027881	+1	no_errors	ENST00000265742	ensembl	human	known	69_37n	missense	16	48.39	15	SNP	1.000	G
AP1G1	164	genome.wustl.edu	37	16	71773187	71773187	+	Missense_Mutation	SNP	A	A	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr16:71773187A>T	ENST00000299980.4	-	20	2498	c.2057T>A	c.(2056-2058)tTc>tAc	p.F686Y	AP1G1_ENST00000569748.1_Missense_Mutation_p.F686Y|AP1G1_ENST00000564155.1_Missense_Mutation_p.F111Y|AP1G1_ENST00000423132.2_Missense_Mutation_p.F689Y|AP1G1_ENST00000433195.2_Missense_Mutation_p.F709Y|AP1G1_ENST00000393512.3_Missense_Mutation_p.F689Y	NM_001128.5	NP_001119.3	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1 subunit	686					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|Golgi to lysosome transport (GO:0090160)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network membrane (GO:0032588)	GTP-dependent protein binding (GO:0030742)|kinesin binding (GO:0019894)|protein transporter activity (GO:0008565)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(8)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|urinary_tract(1)	28		Ovarian(137;0.125)				ATCCAACAAGAAGGGGGGCTG	0.473																																						dbGAP											0													77.0	80.0	79.0					16																	71773187		2198	4300	6498	-	-	-	SO:0001583	missense	0			Y12226	CCDS32480.1, CCDS45522.1	16q23	2009-08-03				ENSG00000166747			555	protein-coding gene	gene with protein product	"""gamma1-adaptin"""	603533		CLAPG1, ADTG		9653655, 9733768	Standard	NM_001128		Approved		uc010cgg.3	O43747		ENST00000299980.4:c.2057T>A	16.37:g.71773187A>T	ENSP00000299980:p.Phe686Tyr		O75709|O75842|Q9UG09|Q9Y3U4	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP1_complex_gsu,pfscan_Clathrin_g-adaptin_app	p.F709Y	ENST00000299980.4	37	c.2126	CCDS32480.1	16	.	.	.	.	.	.	.	.	.	.	A	11.29	1.594716	0.28445	.	.	ENSG00000166747	ENST00000299980;ENST00000393512;ENST00000423132;ENST00000433195	T;T;T;T	0.14516	2.51;2.51;2.5;2.5	5.65	5.65	0.86999	Clathrin adaptor, gamma-adaptin, appendage (1);	0.000000	0.85682	D	0.000000	T	0.09423	0.0232	N	0.24115	0.695	0.58432	D	0.999995	B;B;B	0.25719	0.0;0.132;0.001	B;B;B	0.24701	0.002;0.055;0.003	T	0.04796	-1.0926	10	0.02654	T	1	-9.8707	15.8645	0.79055	1.0:0.0:0.0:0.0	.	686;709;689	O43747;B3KXW5;O43747-2	AP1G1_HUMAN;.;.	Y	686;689;689;709	ENSP00000299980:F686Y;ENSP00000377148:F689Y;ENSP00000409153:F689Y;ENSP00000403259:F709Y	ENSP00000299980:F686Y	F	-	2	0	AP1G1	70330688	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.900000	0.92551	2.147000	0.66899	0.528000	0.53228	TTC	AP1G1	-	pirsf_AP1_complex_gsu	ENSG00000166747		0.473	AP1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP1G1	HGNC	protein_coding	OTTHUMT00000434147.1	22	0.00	0	A			71773187	71773187	-1	no_errors	ENST00000433195	ensembl	human	known	69_37n	missense	15	31.82	7	SNP	1.000	T
AP1M1	8907	genome.wustl.edu	37	19	16338376	16338376	+	Missense_Mutation	SNP	G	G	A			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr19:16338376G>A	ENST00000291439.3	+	7	1140	c.691G>A	c.(691-693)Gtg>Atg	p.V231M	AP1M1_ENST00000541844.1_Missense_Mutation_p.V159M|AP1M1_ENST00000590756.1_Missense_Mutation_p.V159M|AP1M1_ENST00000429941.2_Missense_Mutation_p.V231M|AP1M1_ENST00000444449.2_Missense_Mutation_p.V243M	NM_032493.3	NP_115882.1	Q9BXS5	AP1M1_HUMAN	adaptor-related protein complex 1, mu 1 subunit	231	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|trans-Golgi network membrane (GO:0032588)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(3)|prostate(2)	21						AAGCAAATCCGTGGAGCTGGA	0.597																																						dbGAP											0													196.0	160.0	172.0					19																	16338376		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12342.1, CCDS46008.1	19p13.12	2008-05-23							13667	protein-coding gene	gene with protein product		603535				9653655, 17988225	Standard	NM_032493		Approved	AP47, CLAPM2	uc002ndv.2	Q9BXS5		ENST00000291439.3:c.691G>A	19.37:g.16338376G>A	ENSP00000291439:p.Val231Met		Q4TTY5	Missense_Mutation	SNP	pfam_Clathrin_mu_C,pfam_AP_mu_sigma_su,superfamily_Clathrin_mu_C,superfamily_Longin-like_dom,pirsf_Clathrin_mu,pfscan_Clathrin_mu_C,prints_Clathrin_mu	p.V243M	ENST00000291439.3	37	c.727	CCDS12342.1	19	.	.	.	.	.	.	.	.	.	.	G	19.55	3.847836	0.71603	.	.	ENSG00000072958	ENST00000444449;ENST00000291439;ENST00000541844;ENST00000429941	T;T;T;T	0.20738	2.05;2.05;2.05;2.05	3.98	3.98	0.46160	Clathrin adaptor, mu subunit, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.56156	0.1966	M	0.93550	3.43	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.78314	0.935;0.991;0.988	T	0.70324	-0.4903	10	0.66056	D	0.02	-32.808	15.259	0.73606	0.0:0.0:1.0:0.0	.	231;243;231	E7ENJ6;Q4TTY5;Q9BXS5	.;.;AP1M1_HUMAN	M	243;231;159;231	ENSP00000388996:V243M;ENSP00000291439:V231M;ENSP00000445682:V159M;ENSP00000411498:V231M	ENSP00000291439:V231M	V	+	1	0	AP1M1	16199376	1.000000	0.71417	0.930000	0.37139	0.661000	0.39034	9.356000	0.97091	2.064000	0.61679	0.561000	0.74099	GTG	AP1M1	-	pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,pirsf_Clathrin_mu,pfscan_Clathrin_mu_C	ENSG00000072958		0.597	AP1M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP1M1	HGNC	protein_coding	OTTHUMT00000460492.1	34	0.00	0	G	NM_032493		16338376	16338376	+1	no_errors	ENST00000444449	ensembl	human	known	69_37n	missense	19	17.39	4	SNP	0.999	A
ARAP3	64411	genome.wustl.edu	37	5	141041664	141041664	+	Missense_Mutation	SNP	G	G	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr5:141041664G>T	ENST00000239440.4	-	20	3024	c.2959C>A	c.(2959-2961)Ctc>Atc	p.L987I	ARAP3_ENST00000513878.1_Missense_Mutation_p.L649I|ARAP3_ENST00000512390.1_5'UTR|ARAP3_ENST00000508305.1_Intron	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	987	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						GGGTCATCGAGCTCACGAAAG	0.597																																						dbGAP											0													137.0	123.0	128.0					5																	141041664		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.2959C>A	5.37:g.141041664G>T	ENSP00000239440:p.Leu987Ile		B4DIT1|D3DQE3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ras-assoc,pfam_SAM_2,pfam_SAM_type1,superfamily_Rho_GTPase_activation_prot,superfamily_ArfGAP,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.L987I	ENST00000239440.4	37	c.2959	CCDS4266.1	5	.	.	.	.	.	.	.	.	.	.	G	14.70	2.614811	0.46631	.	.	ENSG00000120318	ENST00000239440;ENST00000513878	T;T	0.31510	1.49;1.49	5.54	5.54	0.83059	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.152343	0.45867	D	0.000335	T	0.44286	0.1286	M	0.80028	2.48	0.46499	D	0.999073	P;P	0.42296	0.565;0.775	B;B	0.43658	0.401;0.426	T	0.31558	-0.9939	10	0.26408	T	0.33	.	19.2713	0.94011	0.0:0.0:1.0:0.0	.	649;987	B4DIT1;Q8WWN8	.;ARAP3_HUMAN	I	987;649	ENSP00000239440:L987I;ENSP00000421468:L649I	ENSP00000239440:L987I	L	-	1	0	ARAP3	141021848	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.367000	0.44213	2.890000	0.99128	0.650000	0.86243	CTC	ARAP3	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000120318		0.597	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP3	HGNC	protein_coding	OTTHUMT00000251805.1	59	0.00	0	G	NM_022481		141041664	141041664	-1	no_errors	ENST00000239440	ensembl	human	known	69_37n	missense	19	17.39	4	SNP	1.000	T
ASH1L	55870	genome.wustl.edu	37	1	155311817	155311817	+	Nonsense_Mutation	SNP	G	G	C			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr1:155311817G>C	ENST00000368346.3	-	25	9024	c.8385C>G	c.(8383-8385)taC>taG	p.Y2795*	ASH1L_ENST00000392403.3_Nonsense_Mutation_p.Y2790*			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	2795	BAH. {ECO:0000255|PROSITE- ProRule:PRU00370}.				cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			GGTGGATCTTGTAAAACAGGT	0.478																																						dbGAP											0													237.0	223.0	228.0					1																	155311817		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.8385C>G	1.37:g.155311817G>C	ENSP00000357330:p.Tyr2795*		Q59GP1|Q5T714|Q5T715|Q9P2C7	Nonsense_Mutation	SNP	pfam_SET_dom,pfam_BAH_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_AT_hook_DNA-bd_motif,smart_AWS,smart_SET_dom,smart_Bromodomain,smart_Znf_PHD,smart_BAH_dom,pfscan_AWS,pfscan_BAH_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Bromodomain	p.Y2795*	ENST00000368346.3	37	c.8385		1	.	.	.	.	.	.	.	.	.	.	G	52	18.730382	0.99909	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	.	.	.	5.27	1.06	0.20224	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.1364	0.42708	0.3743:0.0:0.6257:0.0	.	.	.	.	X	2795;2790	.	ENSP00000357330:Y2795X	Y	-	3	2	ASH1L	153578441	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.569000	0.36428	0.318000	0.23185	-0.378000	0.06908	TAC	ASH1L	-	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	ENSG00000116539		0.478	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	ASH1L	HGNC	protein_coding	OTTHUMT00000039400.1	53	0.00	0	G	NM_018489		155311817	155311817	-1	no_errors	ENST00000368346	ensembl	human	known	69_37n	nonsense	83	13.54	13	SNP	1.000	C
ARF1	375	genome.wustl.edu	37	1	228285577	228285577	+	Missense_Mutation	SNP	G	G	A			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr1:228285577G>A	ENST00000541182.1	+	5	671	c.409G>A	c.(409-411)Gcc>Acc	p.A137T	MIR3620_ENST00000584469.1_RNA|ARF1_ENST00000272102.5_Missense_Mutation_p.A137T|ARF1_ENST00000540651.1_Missense_Mutation_p.A137T|C1orf35_ENST00000472617.1_5'Flank|ARF1_ENST00000478424.1_3'UTR	NM_001024227.1|NM_001024228.1	NP_001019398.1|NP_001019399.1	P84077	ARF1_HUMAN	ADP-ribosylation factor 1	137					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cellular copper ion homeostasis (GO:0006878)|COPI coating of Golgi vesicle (GO:0048205)|dendritic spine organization (GO:0097061)|GTP catabolic process (GO:0006184)|long term synaptic depression (GO:0060292)|membrane organization (GO:0061024)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|regulation of Arp2/3 complex-mediated actin nucleation (GO:0034315)|regulation of defense response to virus by virus (GO:0050690)|regulation of receptor internalization (GO:0002090)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|receptor signaling protein activity (GO:0005057)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)	10		Prostate(94;0.0405)				CATGAATGCGGCCGAGATCAC	0.627																																						dbGAP											0													65.0	66.0	66.0					1																	228285577		2203	4300	6503	-	-	-	SO:0001583	missense	0			M84326	CCDS1565.1	1q42.13	2014-01-30			ENSG00000143761	ENSG00000143761		"""ADP-ribosylation factors"", ""Endogenous ligands"""	652	protein-coding gene	gene with protein product		103180				1577740	Standard	NM_001658		Approved		uc001hrr.3	P84077	OTTHUMG00000037595	ENST00000541182.1:c.409G>A	1.37:g.228285577G>A	ENSP00000440005:p.Ala137Thr		P10947|P32889	Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_Small_GTPase,pfam_Gtr1_RagA,pfam_Gprotein_alpha_su,pfam_MIRO-like,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,smart_Small_GTPase_Rab_type,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.A137T	ENST00000541182.1	37	c.409	CCDS1565.1	1	.	.	.	.	.	.	.	.	.	.	G	17.13	3.311800	0.60414	.	.	ENSG00000143761	ENST00000272102;ENST00000540651;ENST00000542941;ENST00000541182	T;T;T	0.63913	-0.07;-0.07;-0.07	5.42	5.42	0.78866	Small GTP-binding protein domain (1);	0.000000	0.64402	D	0.000002	T	0.57770	0.2076	L	0.41079	1.255	0.80722	D	1	B	0.11235	0.004	B	0.10450	0.005	T	0.52968	-0.8504	10	0.52906	T	0.07	-10.0277	19.4067	0.94649	0.0:0.0:1.0:0.0	.	137	P84077	ARF1_HUMAN	T	137;137;128;137	ENSP00000272102:A137T;ENSP00000442980:A137T;ENSP00000440005:A137T	ENSP00000272102:A137T	A	+	1	0	ARF1	226352200	1.000000	0.71417	0.208000	0.23602	0.638000	0.38207	9.483000	0.97937	2.826000	0.97356	0.491000	0.48974	GCC	ARF1	-	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_Small_GTPase,pfam_Gtr1_RagA,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,smart_Small_GTPase_Rab_type,prints_Small_GTPase_ARF/SAR,tigrfam_Small_GTP-bd_dom	ENSG00000143761		0.627	ARF1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ARF1	HGNC	protein_coding	OTTHUMT00000091650.1	36	0.00	0	G	NM_001024227		228285577	228285577	+1	no_errors	ENST00000272102	ensembl	human	known	69_37n	missense	43	17.31	9	SNP	1.000	A
ATOH8	84913	genome.wustl.edu	37	2	86015022	86015022	+	3'UTR	SNP	G	G	C	rs531820988	byFrequency	TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr2:86015022G>C	ENST00000306279.3	+	0	2271					NM_032827.6	NP_116216.2	Q96SQ7	ATOH8_HUMAN	atonal homolog 8 (Drosophila)						cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(1)|lung(2)	5						GGTGTGCAGGGGCAGAGAAGG	0.627																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK074681	CCDS1985.1	2p11.2	2013-05-21			ENSG00000168874	ENSG00000168874		"""Basic helix-loop-helix proteins"""	24126	protein-coding gene	gene with protein product	"""basic helix loop helix transcription factor 6"""					12419857	Standard	NM_032827		Approved	HATH6, FLJ14708, bHLHa21	uc002sqn.3	Q96SQ7	OTTHUMG00000130178	ENST00000306279.3:c.*1009G>C	2.37:g.86015022G>C			Q504S2|Q659B0	RNA	SNP	-	NULL	ENST00000306279.3	37	NULL	CCDS1985.1	2																																																																																			ATOH8	-	-	ENSG00000168874		0.627	ATOH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATOH8	HGNC	protein_coding	OTTHUMT00000252496.1	54	0.00	0	G	NM_032827		86015022	86015022	+1	no_errors	ENST00000469442	ensembl	human	known	69_37n	rna	25	39.02	16	SNP	0.001	C
BCORL1	63035	genome.wustl.edu	37	X	129189956	129189956	+	Missense_Mutation	SNP	G	G	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chrX:129189956G>T	ENST00000218147.7	+	13	5178	c.4981G>T	c.(4981-4983)Gcc>Tcc	p.A1661S	BCORL1_ENST00000303743.5_Missense_Mutation_p.A1735S|BCORL1_ENST00000540052.1_Missense_Mutation_p.A1661S|BCORL1_ENST00000359304.2_Missense_Mutation_p.A1531S			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	1661					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						CAGGCAGGTGGCCTCCAGTCA	0.612																																						dbGAP											0													76.0	76.0	76.0					X																	129189956		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.4981G>T	X.37:g.129189956G>T	ENSP00000218147:p.Ala1661Ser		B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A1735S	ENST00000218147.7	37	c.5203	CCDS14616.1	X	.	.	.	.	.	.	.	.	.	.	g	10.34	1.321806	0.23994	.	.	ENSG00000085185	ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052;ENST00000456822	T;T;T;T;T	0.37584	1.19;1.64;1.2;1.19;1.7	4.59	3.7	0.42460	.	0.249758	0.20996	N	0.081951	T	0.22666	0.0547	N	0.05441	-0.05	0.29155	N	0.87815	D;B	0.56035	0.974;0.145	P;B	0.53062	0.717;0.097	T	0.10382	-1.0632	10	0.02654	T	1	-11.6889	8.3449	0.32266	0.0:0.1314:0.4879:0.3807	.	1735;1661	Q5H9F3-3;Q5H9F3	.;BCORL_HUMAN	S	1661;1735;1531;1661;1335	ENSP00000218147:A1661S;ENSP00000307541:A1735S;ENSP00000352253:A1531S;ENSP00000437775:A1661S;ENSP00000399483:A1335S	ENSP00000218147:A1661S	A	+	1	0	BCORL1	129017637	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.782000	0.38654	0.889000	0.36185	0.509000	0.49947	GCC	BCORL1	-	NULL	ENSG00000085185		0.612	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCORL1	HGNC	protein_coding	OTTHUMT00000058223.1	54	0.00	0	G	NM_021946		129189956	129189956	+1	no_errors	ENST00000303743	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	T
BRCA1	672	genome.wustl.edu	37	17	41256900	41256900	+	Missense_Mutation	SNP	C	C	G	rs80357110		TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr17:41256900C>G	ENST00000357654.3	-	5	404	c.286G>C	c.(286-288)Gac>Cac	p.D96H	BRCA1_ENST00000354071.3_Missense_Mutation_p.D96H|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000351666.3_Missense_Mutation_p.D96H|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000468300.1_Missense_Mutation_p.D96H|BRCA1_ENST00000352993.3_Missense_Mutation_p.D96H|BRCA1_ENST00000471181.2_Missense_Mutation_p.D96H|BRCA1_ENST00000309486.4_5'UTR|BRCA1_ENST00000493795.1_Missense_Mutation_p.D49H|BRCA1_ENST00000346315.3_Missense_Mutation_p.D96H|BRCA1_ENST00000491747.2_Missense_Mutation_p.D96H|BRCA1_ENST00000591534.1_Intron	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	96					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		AAACCTGTGTCAAGCTGAAAA	0.373			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																												dbGAP	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	0			GRCh37	CM041691	BRCA1	M	rs80357110						106.0	96.0	99.0					17																	41256900		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.286G>C	17.37:g.41256900C>G	ENSP00000350283:p.Asp96His		O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	pirsf_BRCA1,pfam_BRCT_dom,pfam_Znf_C3HC4_RING-type,superfamily_BRCT_dom,smart_Znf_RING,smart_BRCT_dom,pfscan_BRCT_dom,pfscan_Znf_RING	p.D96H	ENST00000357654.3	37	c.286	CCDS11453.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.2|20.2	3.944399|3.944399	0.73672|0.73672	.|.	.|.	ENSG00000012048|ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000354071;ENST00000352993;ENST00000346315;ENST00000351666;ENST00000468300;ENST00000393691;ENST00000471181;ENST00000493795;ENST00000491747;ENST00000478531;ENST00000484087;ENST00000493919;ENST00000487825;ENST00000470026;ENST00000477152;ENST00000494123;ENST00000476777;ENST00000489037|ENST00000473961	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D|D	0.95001|0.95518	-3.11;-3.11;-3.11;-3.11;-3.11;-3.11;-1.98;-3.11;-1.98;-3.11;-3.11;-3.58;-1.98;-3.16;-3.11;-1.98;-3.11;-3.11;-1.98|-3.73	5.3|5.3	5.3|5.3	0.74995|0.74995	.|.	0.000000|.	0.53938|.	D|.	0.000045|.	D|D	0.96842|0.96842	0.8969|0.8969	M|M	0.70275|0.70275	2.135|2.135	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.999;1.0|.	D;D;D;D;D;D;D;D;D|.	0.97110|.	0.999;0.996;0.999;0.999;0.998;0.999;0.999;0.921;1.0|.	D|D	0.97101|0.97101	0.9797|0.9797	10|7	0.87932|0.87932	D|D	0|0	.|.	16.2626|16.2626	0.82553|0.82553	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	49;96;96;96;96;96;96;96;96|.	B4DES0;E7ETR2;E7EMP0;Q5YLB2;P38398-3;Q6IN79;E9PFC7;P38398;P38398-2|.	.;.;.;.;.;.;.;BRCA1_HUMAN;.|.	H|F	96;96;96;96;96;96;96;49;96;49;96;96;12;49;12;96;70;96;96;70|3	ENSP00000350283:D96H;ENSP00000326002:D96H;ENSP00000312236:D96H;ENSP00000246907:D96H;ENSP00000338007:D96H;ENSP00000417148:D96H;ENSP00000377294:D49H;ENSP00000418960:D96H;ENSP00000418775:D49H;ENSP00000420705:D96H;ENSP00000420412:D96H;ENSP00000419481:D12H;ENSP00000418819:D49H;ENSP00000418212:D12H;ENSP00000419274:D96H;ENSP00000419988:D70H;ENSP00000419103:D96H;ENSP00000417554:D96H;ENSP00000420781:D70H|ENSP00000420201:L3F	ENSP00000246907:D96H|ENSP00000420201:L3F	D|L	-|-	1|3	0|2	BRCA1|BRCA1	38510426|38510426	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.850000|0.850000	0.48378|0.48378	4.475000|4.475000	0.60210|0.60210	2.756000|2.756000	0.94617|0.94617	0.563000|0.563000	0.77884|0.77884	GAC|TTG	BRCA1	-	pirsf_BRCA1	ENSG00000012048		0.373	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA1	HGNC	protein_coding	OTTHUMT00000348798.2	19	0.00	0	C	NM_007294		41256900	41256900	-1	no_errors	ENST00000471181	ensembl	human	known	69_37n	missense	4	50.00	4	SNP	1.000	G
C5orf38	153571	genome.wustl.edu	37	5	2755276	2755276	+	3'UTR	SNP	G	G	C			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr5:2755276G>C	ENST00000334000.3	+	0	655				C5orf38_ENST00000397835.4_Missense_Mutation_p.R156T|IRX2_ENST00000502957.1_5'Flank	NM_178569.2	NP_848664.1	Q86SI9	CEI_HUMAN	chromosome 5 open reading frame 38							extracellular region (GO:0005576)				endometrium(2)|large_intestine(1)|lung(1)	4				GBM - Glioblastoma multiforme(108;0.205)		GGCCGACTGAGAAggccgggg	0.776																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AY249324	CCDS34131.1	5p15.33	2014-06-02			ENSG00000186493	ENSG00000186493			24226	protein-coding gene	gene with protein product	"""coordinated expression to IRX2"", ""IRX2 neighbor"""	610522				16515847, 16750006	Standard	XM_005248256		Approved	CEI, IRX2NB	uc003jdc.3	Q86SI9	OTTHUMG00000161741	ENST00000334000.3:c.*121G>C	5.37:g.2755276G>C				Missense_Mutation	SNP	NULL	p.R156T	ENST00000334000.3	37	c.467	CCDS34131.1	5	.	.	.	.	.	.	.	.	.	.	G	10.96	1.498556	0.26861	.	.	ENSG00000186493	ENST00000397835	.	.	.	2.75	-0.454	0.12197	.	.	.	.	.	T	0.23289	0.0563	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26224	-1.0109	4	.	.	.	.	4.1805	0.10372	0.1702:0.4775:0.3523:0.0	.	.	.	.	T	156	.	.	R	+	2	0	C5orf38	2808276	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	-0.247000	0.08866	-0.092000	0.12417	-0.232000	0.12228	AGA	C5orf38	-	NULL	ENSG00000186493		0.776	C5orf38-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C5orf38	HGNC	protein_coding	OTTHUMT00000365956.2	8	0.00	0	G	NM_178569		2755276	2755276	+1	no_errors	ENST00000397835	ensembl	human	putative	69_37n	missense	9	30.77	4	SNP	0.001	C
CACNA1B	774	genome.wustl.edu	37	9	140878699	140878699	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr9:140878699C>T	ENST00000371372.1	+	13	1911	c.1766C>T	c.(1765-1767)aCg>aTg	p.T589M	CACNA1B_ENST00000277549.5_5'UTR|CACNA1B_ENST00000371357.1_Missense_Mutation_p.T590M|CACNA1B_ENST00000277551.2_Missense_Mutation_p.T589M|CACNA1B_ENST00000371363.1_Missense_Mutation_p.T589M|CACNA1B_ENST00000371355.4_Missense_Mutation_p.T590M	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	589					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	TTCAAAGTCACGAAGTACGTC	0.637																																						dbGAP											0													48.0	55.0	53.0					9																	140878699		2054	4186	6240	-	-	-	SO:0001583	missense	0			AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.1766C>T	9.37:g.140878699C>T	ENSP00000360423:p.Thr589Met		B1AQK5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_N_a1su,prints_PKD_2	p.T590M	ENST00000371372.1	37	c.1769	CCDS59522.1	9	.	.	.	.	.	.	.	.	.	.	C	16.66	3.184079	0.57800	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D	0.98455	-4.94;-4.94;-4.94;-4.94;-4.94	4.5	4.5	0.54988	.	0.099683	0.64402	D	0.000002	D	0.98985	0.9654	M	0.84433	2.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99802	1.1036	10	0.87932	D	0	.	17.6287	0.88100	0.0:1.0:0.0:0.0	.	589;589	B1AQK4;B1AQK6	.;.	M	589;589;589;590;590	ENSP00000360423:T589M;ENSP00000277551:T589M;ENSP00000360414:T589M;ENSP00000360408:T590M;ENSP00000360406:T590M	ENSP00000277551:T589M	T	+	2	0	CACNA1B	139998520	1.000000	0.71417	0.955000	0.39395	0.400000	0.30750	7.578000	0.82498	2.202000	0.70862	0.555000	0.69702	ACG	CACNA1B	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel	ENSG00000148408		0.637	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1B	HGNC	protein_coding	OTTHUMT00000055380.1	68	0.00	0	C	NM_000718		140878699	140878699	+1	no_errors	ENST00000371355	ensembl	human	known	69_37n	missense	17	50.00	17	SNP	1.000	T
CAPRIN1	4076	genome.wustl.edu	37	11	34093309	34093309	+	Missense_Mutation	SNP	G	G	A			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr11:34093309G>A	ENST00000341394.4	+	3	442	c.253G>A	c.(253-255)Ggg>Agg	p.G85R	CAPRIN1_ENST00000389645.3_Missense_Mutation_p.G85R|CAPRIN1_ENST00000532820.1_Missense_Mutation_p.G85R|CAPRIN1_ENST00000530820.1_Missense_Mutation_p.G85R|CAPRIN1_ENST00000529307.1_Missense_Mutation_p.G4R	NM_005898.4	NP_005889.3	Q14444	CAPR1_HUMAN	cell cycle associated protein 1	85					negative regulation of translation (GO:0017148)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	18		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				AATGAACAAAGGGGAAAGGCT	0.308																																						dbGAP											0													109.0	118.0	115.0					11																	34093309		2202	4298	6500	-	-	-	SO:0001583	missense	0			BC001731	CCDS31453.1, CCDS31454.1	11p13	2010-08-03	2007-03-27	2007-03-27	ENSG00000135387	ENSG00000135387			6743	protein-coding gene	gene with protein product	"""cytoplasmic activation/proliferation-associated protein-1"""	601178	"""membrane component, chromosome 11, surface marker 1"", ""GPI-anchored membrane protein 1"""	M11S1, GPIAP1		7657653, 16177067, 17210633, 14764709, 15471883	Standard	NM_005898		Approved	caprin-1, RNG105	uc001mvh.1	Q14444	OTTHUMG00000166248	ENST00000341394.4:c.253G>A	11.37:g.34093309G>A	ENSP00000340329:p.Gly85Arg		A6NMY7|D3DR06|Q15074|Q6IMN4|Q6IMN7|Q9BV09	Missense_Mutation	SNP	pfam_Caprin-1_C	p.G85R	ENST00000341394.4	37	c.253	CCDS31453.1	11	.	.	.	.	.	.	.	.	.	.	G	33	5.203014	0.95033	.	.	ENSG00000135387	ENST00000341394;ENST00000389645;ENST00000534825;ENST00000532820;ENST00000530820;ENST00000529307	T;T;T;T;T;T	0.26660	1.72;1.72;1.72;1.72;1.72;1.72	5.75	5.75	0.90469	.	0.045336	0.85682	N	0.000000	T	0.55847	0.1946	M	0.82132	2.575	0.80722	D	1	D;D	0.89917	1.0;0.993	D;D	0.69307	0.963;0.932	T	0.58989	-0.7538	10	0.87932	D	0	.	19.9395	0.97153	0.0:0.0:1.0:0.0	.	85;85	Q14444;Q14444-2	CAPR1_HUMAN;.	R	85;85;85;85;85;4	ENSP00000340329:G85R;ENSP00000374296:G85R;ENSP00000431373:G85R;ENSP00000434150:G85R;ENSP00000434204:G85R;ENSP00000431581:G4R	ENSP00000340329:G85R	G	+	1	0	CAPRIN1	34049885	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.375000	0.97178	2.716000	0.92895	0.563000	0.77884	GGG	CAPRIN1	-	NULL	ENSG00000135387		0.308	CAPRIN1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	CAPRIN1	HGNC	protein_coding	OTTHUMT00000388680.2	118	0.00	0	G	NM_005898		34093309	34093309	+1	no_errors	ENST00000341394	ensembl	human	known	69_37n	missense	135	14.56	23	SNP	1.000	A
CD36	948	genome.wustl.edu	37	7	80300444	80300444	+	Missense_Mutation	SNP	T	T	A			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr7:80300444T>A	ENST00000435819.1	+	13	1654	c.970T>A	c.(970-972)Tca>Aca	p.S324T	CD36_ENST00000433696.2_Missense_Mutation_p.S285T|CD36_ENST00000534394.1_Missense_Mutation_p.S248T|CD36_ENST00000544133.1_Intron|CD36_ENST00000309881.7_Missense_Mutation_p.S324T|CD36_ENST00000432207.1_Missense_Mutation_p.S324T|CD36_ENST00000447544.2_Missense_Mutation_p.S324T|CD36_ENST00000394788.3_Missense_Mutation_p.S324T|CD36_ENST00000538969.1_Missense_Mutation_p.S264T			P16671	CD36_HUMAN	CD36 molecule (thrombospondin receptor)	324					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cellular lipid metabolic process (GO:0044255)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to hydroperoxide (GO:0071447)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cGMP-mediated signaling (GO:0019934)|cholesterol transport (GO:0030301)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response (GO:0045087)|lipid metabolic process (GO:0006629)|lipid storage (GO:0019915)|lipoprotein transport (GO:0042953)|long-chain fatty acid import (GO:0044539)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle mediated signaling (GO:0055096)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of transcription factor import into nucleus (GO:0042992)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nitric oxide mediated signal transduction (GO:0007263)|phagocytosis, recognition (GO:0006910)|plasma lipoprotein particle clearance (GO:0034381)|plasma membrane long-chain fatty acid transport (GO:0015911)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood microparticle formation (GO:2000334)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of removal of superoxide radicals (GO:2000121)|response to stilbenoid (GO:0035634)|small molecule metabolic process (GO:0044281)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)|lipoprotein particle binding (GO:0071813)|lipoteichoic acid receptor activity (GO:0070892)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|thrombospondin receptor activity (GO:0070053)|transforming growth factor beta binding (GO:0050431)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(10)|large_intestine(1)|lung(6)|ovary(1)	21						AAATTGTACATCATATGGTGT	0.363																																						dbGAP											0													81.0	80.0	80.0					7																	80300444		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z32770	CCDS34673.1	7q11.2	2010-02-26	2006-03-28		ENSG00000135218	ENSG00000135218		"""CD molecules"""	1663	protein-coding gene	gene with protein product		173510	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)"""			7503937	Standard	NM_001001548		Approved	SCARB3, GPIV, FAT, GP4, GP3B	uc003uhg.4	P16671	OTTHUMG00000155383	ENST00000435819.1:c.970T>A	7.37:g.80300444T>A	ENSP00000399421:p.Ser324Thr		D9IX66|D9IX67|D9IX68|D9IX69|Q13966|Q16093|Q8TCV7|Q9BPZ8|Q9BQC2|Q9BZM8|Q9BZN3|Q9BZN4|Q9BZN5	Missense_Mutation	SNP	pfam_CD36,prints_CD36_antigen,prints_CD36	p.S324T	ENST00000435819.1	37	c.970	CCDS34673.1	7	.	.	.	.	.	.	.	.	.	.	T	8.892	0.954276	0.18431	.	.	ENSG00000135218	ENST00000435819;ENST00000309881;ENST00000534394;ENST00000394788;ENST00000447544;ENST00000432207;ENST00000419819;ENST00000538969;ENST00000433696	T;T;T;T;T;T;T;T;T	0.71934	-0.61;-0.61;-0.61;-0.61;-0.61;-0.61;-0.61;-0.61;-0.61	5.57	4.43	0.53597	.	0.712376	0.13859	N	0.357837	T	0.64886	0.2639	M	0.69823	2.125	0.09310	N	1	B	0.29862	0.259	B	0.31101	0.124	T	0.58538	-0.7619	9	.	.	.	0.3547	2.846	0.05543	0.1294:0.0777:0.2517:0.5413	.	324	P16671	CD36_HUMAN	T	324;324;248;324;324;324;324;264;285	ENSP00000399421:S324T;ENSP00000308165:S324T;ENSP00000431296:S248T;ENSP00000378268:S324T;ENSP00000415743:S324T;ENSP00000411411:S324T;ENSP00000392298:S324T;ENSP00000439543:S264T;ENSP00000401863:S285T	.	S	+	1	0	CD36	80138380	0.000000	0.05858	0.012000	0.15200	0.955000	0.61496	-0.604000	0.05667	0.954000	0.37851	0.397000	0.26171	TCA	CD36	-	pfam_CD36,prints_CD36	ENSG00000135218		0.363	CD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD36	HGNC	protein_coding	OTTHUMT00000339767.6	23	0.00	0	T	NM_001001547		80300444	80300444	+1	no_errors	ENST00000309881	ensembl	human	known	69_37n	missense	11	38.89	7	SNP	0.000	A
CHD6	84181	genome.wustl.edu	37	20	40033821	40033821	+	Missense_Mutation	SNP	C	C	G			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr20:40033821C>G	ENST00000373233.3	-	37	7737	c.7560G>C	c.(7558-7560)atG>atC	p.M2520I	CHD6_ENST00000480022.1_5'UTR	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	2520					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				CTGGCAGCATCATGGGCAGCA	0.612																																						dbGAP											0													79.0	69.0	72.0					20																	40033821		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.7560G>C	20.37:g.40033821C>G	ENSP00000362330:p.Met2520Ile		Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_BRK_domain,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.M2520I	ENST00000373233.3	37	c.7560	CCDS13317.1	20	.	.	.	.	.	.	.	.	.	.	C	25.9	4.687727	0.88639	.	.	ENSG00000124177	ENST00000373233	D	0.88509	-2.39	5.55	5.55	0.83447	.	0.077388	0.56097	D	0.000034	D	0.93930	0.8057	M	0.68593	2.085	0.80722	D	1	D	0.63880	0.993	D	0.70227	0.968	D	0.93775	0.7078	10	0.72032	D	0.01	-22.8144	19.7069	0.96076	0.0:1.0:0.0:0.0	.	2520	Q8TD26	CHD6_HUMAN	I	2520	ENSP00000362330:M2520I	ENSP00000362330:M2520I	M	-	3	0	CHD6	39467235	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.615000	0.83006	2.894000	0.99253	0.591000	0.81541	ATG	CHD6	-	NULL	ENSG00000124177		0.612	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD6	HGNC	protein_coding	OTTHUMT00000079270.1	55	0.00	0	C			40033821	40033821	-1	no_errors	ENST00000373233	ensembl	human	known	69_37n	missense	13	38.10	8	SNP	1.000	G
CNDP1	84735	genome.wustl.edu	37	18	72245477	72245477	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr18:72245477C>T	ENST00000358821.3	+	9	1310	c.1082C>T	c.(1081-1083)aCt>aTt	p.T361I	CNDP1_ENST00000582365.1_Missense_Mutation_p.T318I	NM_032649.5	NP_116038	Q96KN2	CNDP1_HUMAN	carnosine dipeptidase 1 (metallopeptidase M20 family)	361						extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27		Esophageal squamous(42;0.129)|Prostate(75;0.157)|Melanoma(33;0.211)		BRCA - Breast invasive adenocarcinoma(31;0.109)		GAGCCTGGAACTAAAACAGTC	0.413																																					Melanoma(32;1029 1042 25286 38395 44237)	dbGAP											0													127.0	122.0	124.0					18																	72245477		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12007.1	18q22.3	2014-07-14			ENSG00000150656	ENSG00000150656	3.4.13.20		20675	protein-coding gene	gene with protein product	"""carnosinase 1"", ""glutamate carboxypeptidase-like protein 2"""	609064				12473676	Standard	NM_032649		Approved	MGC10825, CN1, CPGL2, HsT2308	uc002llq.3	Q96KN2	OTTHUMG00000132852	ENST00000358821.3:c.1082C>T	18.37:g.72245477C>T	ENSP00000351682:p.Thr361Ile		Q14D40|Q17S05|Q2TBG0|Q6UWK2|Q9BT98	Missense_Mutation	SNP	pfam_Peptidase_M20,pfam_Peptidase_M20_dimer,pirsf_GSH_degradosome_DUG1	p.T361I	ENST00000358821.3	37	c.1082	CCDS12007.1	18	.	.	.	.	.	.	.	.	.	.	C	6.001	0.368612	0.11352	.	.	ENSG00000150656	ENST00000358821	T	0.57752	0.38	5.64	1.92	0.25849	Peptidase M20, dimerisation (1);	0.488471	0.24050	N	0.042006	T	0.35537	0.0935	N	0.21617	0.685	0.09310	N	1	B	0.09022	0.002	B	0.17098	0.017	T	0.28004	-1.0057	10	0.54805	T	0.06	-5.6736	8.3893	0.32518	0.0:0.581:0.0:0.419	.	361	Q96KN2	CNDP1_HUMAN	I	361	ENSP00000351682:T361I	ENSP00000351682:T361I	T	+	2	0	CNDP1	70396457	0.000000	0.05858	0.011000	0.14972	0.082000	0.17680	1.200000	0.32247	0.342000	0.23796	0.650000	0.86243	ACT	CNDP1	-	pfam_Peptidase_M20,pfam_Peptidase_M20_dimer,pirsf_GSH_degradosome_DUG1	ENSG00000150656		0.413	CNDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNDP1	HGNC	protein_coding	OTTHUMT00000256326.1	55	0.00	0	C	NM_032649		72245477	72245477	+1	no_errors	ENST00000358821	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	0.001	T
COX7A2L	9167	genome.wustl.edu	37	2	42578323	42578323	+	3'UTR	SNP	T	T	C			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr2:42578323T>C	ENST00000378669.1	-	0	1210				COX7A2L_ENST00000234301.2_3'UTR|COX7A2L_ENST00000482463.1_5'UTR			O14548	COX7R_HUMAN	cytochrome c oxidase subunit VIIa polypeptide 2 like						cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)	cytochrome-c oxidase activity (GO:0004129)			lung(4)	4						TCAAAGGGTTTATGCCAAAAA	0.378																																						dbGAP											0													41.0	38.0	39.0					2																	42578323		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			AB007618	CCDS1808.1	2p21	2010-06-14			ENSG00000115944	ENSG00000115944			2289	protein-coding gene	gene with protein product		605771				9418891	Standard	NM_004718		Approved	EB1, COX7RP, COX7AR, SIG81	uc002rsk.3	O14548	OTTHUMG00000128605	ENST00000378669.1:c.*36A>G	2.37:g.42578323T>C			Q9P118	RNA	SNP	-	NULL	ENST00000378669.1	37	NULL	CCDS1808.1	2																																																																																			COX7A2L	-	-	ENSG00000115944		0.378	COX7A2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX7A2L	HGNC	protein_coding	OTTHUMT00000250466.3	38	0.00	0	T	NM_004718		42578323	42578323	-1	no_errors	ENST00000482463	ensembl	human	known	69_37n	rna	36	14.29	6	SNP	0.027	C
CPT1B	1375	genome.wustl.edu	37	22	51012017	51012017	+	Silent	SNP	C	C	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr22:51012017C>T	ENST00000360719.2	-	10	1235	c.1098G>A	c.(1096-1098)agG>agA	p.R366R	CPT1B_ENST00000312108.7_Silent_p.R366R|CPT1B_ENST00000405237.3_Silent_p.R366R|CPT1B_ENST00000395650.2_Silent_p.R366R|CPT1B_ENST00000434492.2_Silent_p.R163R|CPT1B_ENST00000440709.1_Intron|CPT1B_ENST00000457250.1_Silent_p.R332R|CHKB-CPT1B_ENST00000453634.1_3'UTR	NM_001145135.1|NM_152245.2	NP_001138607.1|NP_689451.1	Q92523	CPT1B_HUMAN	carnitine palmitoyltransferase 1B (muscle)	366					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)		CGTCCAGGATCCTCTGGAACT	0.617																																					Esophageal Squamous(170;988 1933 25577 30295 48163)	dbGAP											0													60.0	59.0	59.0					22																	51012017		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U62733	CCDS14098.1, CCDS46734.1	22q13.33	2007-07-26			ENSG00000205560	ENSG00000205560			2329	protein-coding gene	gene with protein product		601987				9070950	Standard	NM_152245		Approved	M-CPT1, CPT1-M	uc003bmm.3	Q92523	OTTHUMG00000137390	ENST00000360719.2:c.1098G>A	22.37:g.51012017C>T			B7Z4U4|B7Z5T8|E9PCP2|Q13389|Q99655|Q9BY90	Silent	SNP	pfam_Carn_acyl_trans	p.R366	ENST00000360719.2	37	c.1098	CCDS14098.1	22																																																																																			CPT1B	-	pfam_Carn_acyl_trans	ENSG00000205560		0.617	CPT1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CPT1B	HGNC	protein_coding	OTTHUMT00000317264.5	66	0.00	0	C	NM_152246		51012017	51012017	-1	no_errors	ENST00000312108	ensembl	human	known	69_37n	silent	21	47.50	19	SNP	0.998	T
CRB1	23418	genome.wustl.edu	37	1	197446852	197446852	+	Missense_Mutation	SNP	T	T	G			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr1:197446852T>G	ENST00000367400.3	+	12	4199	c.4064T>G	c.(4063-4065)tTg>tGg	p.L1355W	CRB1_ENST00000535699.1_Missense_Mutation_p.L1331W|CRB1_ENST00000538660.1_Missense_Mutation_p.L819W|CRB1_ENST00000544212.1_Missense_Mutation_p.L836W|CRB1_ENST00000367399.2_Missense_Mutation_p.L1243W	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	1355					cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						ACTGTCGCCTTGTTACTGATC	0.488																																						dbGAP											0													112.0	93.0	99.0					1																	197446852		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.4064T>G	1.37:g.197446852T>G	ENSP00000356370:p.Leu1355Trp		A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_Laminin_G,pfam_EGF_extracell,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.L1355W	ENST00000367400.3	37	c.4064	CCDS1390.1	1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.355589	0.82243	.	.	ENSG00000134376	ENST00000535699;ENST00000538660;ENST00000367400;ENST00000367399;ENST00000544212	D;D;D;D;D	0.89681	-2.23;-2.37;-2.08;-2.55;-2.36	5.92	5.92	0.95590	.	.	.	.	.	D	0.94268	0.8159	M	0.79475	2.455	0.58432	D	0.999998	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.993;0.997;0.997;0.993	D	0.93975	0.7253	9	0.45353	T	0.12	.	16.356	0.83235	0.0:0.0:0.0:1.0	.	819;1331;1243;1355	B7Z5T2;F5H0L2;P82279-3;P82279	.;.;.;CRUM1_HUMAN	W	1331;819;1355;1243;836	ENSP00000438786:L1331W;ENSP00000438091:L819W;ENSP00000356370:L1355W;ENSP00000356369:L1243W;ENSP00000444556:L836W	ENSP00000356369:L1243W	L	+	2	0	CRB1	195713475	1.000000	0.71417	0.050000	0.19076	0.008000	0.06430	7.686000	0.84128	2.253000	0.74438	0.528000	0.53228	TTG	CRB1	-	NULL	ENSG00000134376		0.488	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB1	HGNC	protein_coding	OTTHUMT00000086565.2	25	0.00	0	T	NM_201253		197446852	197446852	+1	no_errors	ENST00000367400	ensembl	human	known	69_37n	missense	13	45.83	11	SNP	0.932	G
DCLK1	9201	genome.wustl.edu	37	13	36686248	36686248	+	Silent	SNP	G	G	T	rs368906217		TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr13:36686248G>T	ENST00000360631.3	-	3	692	c.481C>A	c.(481-483)Cgg>Agg	p.R161R	DCLK1_ENST00000255448.4_Silent_p.R161R|DCLK1_ENST00000379892.4_Silent_p.R161R			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	161					axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		GACACTGCCCGAGAAGCCGAG	0.522																																						dbGAP											0													79.0	80.0	79.0					13																	36686248		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.481C>A	13.37:g.36686248G>T			B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Doublecortin_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Doublecortin_dom,pfscan_Prot_kinase_cat_dom	p.R161	ENST00000360631.3	37	c.481		13																																																																																			DCLK1	-	superfamily_Doublecortin_dom	ENSG00000133083		0.522	DCLK1-010	KNOWN	basic	protein_coding	DCLK1	HGNC	protein_coding	OTTHUMT00000044487.1	42	0.00	0	G	NM_004734		36686248	36686248	-1	no_errors	ENST00000360631	ensembl	human	known	69_37n	silent	15	16.67	3	SNP	1.000	T
DNAH1	25981	genome.wustl.edu	37	3	52407038	52407038	+	Missense_Mutation	SNP	C	C	A			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr3:52407038C>A	ENST00000420323.2	+	44	7215	c.6954C>A	c.(6952-6954)gaC>gaA	p.D2318E		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	2318	AAA 3. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		AGTGGATGGACCACGGCGGCT	0.627																																						dbGAP											0													49.0	54.0	52.0					3																	52407038		2077	4207	6284	-	-	-	SO:0001583	missense	0			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.6954C>A	3.37:g.52407038C>A	ENSP00000401514:p.Asp2318Glu		B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA	p.D2318E	ENST00000420323.2	37	c.6954	CCDS46842.1	3	.	.	.	.	.	.	.	.	.	.	C	22.1	4.240847	0.79912	.	.	ENSG00000114841	ENST00000420323	T	0.38077	1.16	4.5	2.65	0.31530	.	0.000000	0.51477	D	0.000082	T	0.50701	0.1631	M	0.62266	1.93	0.49798	D	0.999828	D	0.89917	1.0	D	0.85130	0.997	T	0.44081	-0.9351	10	0.49607	T	0.09	.	6.8917	0.24232	0.1425:0.7033:0.0:0.1542	.	2318	C9JXH6	.	E	2318	ENSP00000401514:D2318E	ENSP00000401514:D2318E	D	+	3	2	DNAH1	52382078	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	3.086000	0.50159	0.601000	0.29879	-0.181000	0.13052	GAC	DNAH1	-	NULL	ENSG00000114841		0.627	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH1	HGNC	protein_coding	OTTHUMT00000350816.1	38	0.00	0	C	NM_015512		52407038	52407038	+1	no_errors	ENST00000420323	ensembl	human	known	69_37n	missense	32	21.95	9	SNP	1.000	A
EGFEM1P	93556	genome.wustl.edu	37	3	168538980	168538980	+	RNA	SNP	G	G	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr3:168538980G>T	ENST00000483846.1	+	0	547					NR_021485.2		Q0D2K5	EGFEM_HUMAN	EGF-like and EMI domain containing 1, pseudogene																		TTTGCTTATAGACTGTCTCGA	0.468																																						dbGAP											0																																										-	-	-			0			AF086185		3q26.2	2010-09-24	2010-09-24	2010-09-24	ENSG00000206120	ENSG00000206120			25149	pseudogene	pseudogene			"""chromosome 3 open reading frame 50"", ""non-protein coding RNA 259"""	C3orf50, NCRNA00259		12477932	Standard	NR_021485		Approved		uc003ffh.4	Q0D2K5	OTTHUMG00000154721		3.37:g.168538980G>T				Splice_Site	SNP	-	NULL	ENST00000483846.1	37	c.NULL		3																																																																																			EGFEM1P	-	-	ENSG00000206120		0.468	EGFEM1P-007	KNOWN	basic	processed_transcript	EGFEM1P	HGNC	pseudogene	OTTHUMT00000351389.1	54	0	0	G	NR_021485		168538980	168538980	+1	no_errors	ENST00000382864	ensembl	human	known	69_37n	splice_site	39	31.58	18	SNP	1.000	T
EGFEM1P	93556	genome.wustl.edu	37	3	168538980	168538980	+	RNA	SNP	G	G	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr3:168538980G>T	ENST00000483846.1	+	0	547					NR_021485.2		Q0D2K5	EGFEM_HUMAN	EGF-like and EMI domain containing 1, pseudogene																		TTTGCTTATAGACTGTCTCGA	0.468																																						dbGAP											0																																										-	-	-			0			AF086185		3q26.2	2010-09-24	2010-09-24	2010-09-24	ENSG00000206120	ENSG00000206120			25149	pseudogene	pseudogene			"""chromosome 3 open reading frame 50"", ""non-protein coding RNA 259"""	C3orf50, NCRNA00259		12477932	Standard	NR_021485		Approved		uc003ffh.4	Q0D2K5	OTTHUMG00000154721		3.37:g.168538980G>T				Splice_Site	SNP	-	NULL	ENST00000483846.1	37	c.NULL		3																																																																																			EGFEM1P	-	-	ENSG00000206120		0.468	EGFEM1P-007	KNOWN	basic	processed_transcript	EGFEM1P	HGNC	pseudogene	OTTHUMT00000351389.1	54	0.00	0	G	NR_021485		168538980	168538980	+1	no_errors	ENST00000382864	ensembl	human	known	69_37n	splice_site	39	31.58	18	SNP	1.000	T
EYS	346007	genome.wustl.edu	37	6	66012732	66012732	+	Intron	SNP	T	T	C			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr6:66012732T>C	ENST00000370621.3	-	12	2293				EYS_ENST00000370616.2_Intron|EYS_ENST00000503581.1_Intron			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)						detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						CCACTGTGCCTGAGTCACCAG	0.478																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.1767-6720A>G	6.37:g.66012732T>C			A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	RNA	SNP	-	NULL	ENST00000370621.3	37	NULL		6																																																																																			EYS	-	-	ENSG00000188107		0.478	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	30	0.00	0	T	XM_294050		66012732	66012732	-1	no_errors	ENST00000370615	ensembl	human	putative	69_37n	rna	17	15.00	3	SNP	0.951	C
F5	2153	genome.wustl.edu	37	1	169484771	169484771	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr1:169484771C>T	ENST00000367797.3	-	24	6640	c.6439G>A	c.(6439-6441)Gaa>Aaa	p.E2147K	F5_ENST00000367796.3_Missense_Mutation_p.E2152K	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	2147	F5/8 type C 2. {ECO:0000255|PROSITE- ProRule:PRU00081}.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)	p.E2147Q(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	ACATACATTTCAGAGGACAGA	0.433																																						dbGAP											1	Substitution - Missense(1)	lung(1)											177.0	165.0	169.0					1																	169484771		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.6439G>A	1.37:g.169484771C>T	ENSP00000356771:p.Glu2147Lys		A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.E2152K	ENST00000367797.3	37	c.6454	CCDS1281.1	1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.786962	0.90367	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	D;D	0.82344	-1.6;-1.6	5.61	5.61	0.85477	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.049952	0.85682	D	0.000000	D	0.84252	0.5431	L	0.33668	1.02	0.46725	D	0.999172	D	0.67145	0.996	D	0.65987	0.94	D	0.84963	0.0878	9	0.52906	T	0.07	-24.8747	19.223	0.93806	0.0:1.0:0.0:0.0	.	2147	P12259	FA5_HUMAN	K	2147;2152	ENSP00000356771:E2147K;ENSP00000356770:E2152K	ENSP00000356770:E2152K	E	-	1	0	F5	167751395	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	6.455000	0.73497	2.635000	0.89317	0.467000	0.42956	GAA	F5	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	ENSG00000198734		0.433	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	F5	HGNC	protein_coding	OTTHUMT00000083712.1	62	0.00	0	C	NM_000130		169484771	169484771	-1	no_errors	ENST00000367796	ensembl	human	known	69_37n	missense	21	72.73	56	SNP	1.000	T
FAM78A	286336	genome.wustl.edu	37	9	134151294	134151294	+	Silent	SNP	G	G	A			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr9:134151294G>A	ENST00000372271.3	-	1	640	c.273C>T	c.(271-273)atC>atT	p.I91I		NM_033387.3	NP_203745.2	Q5JUQ0	FA78A_HUMAN	family with sequence similarity 78, member A	91										NS(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.15e-05)|Epithelial(140;0.000267)		TGCACGCCTGGATCCAGCCAA	0.642																																						dbGAP											0													59.0	51.0	54.0					9																	134151294		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK095423	CCDS6941.2	9q34	2008-02-05	2005-07-18	2005-07-18	ENSG00000126882	ENSG00000126882			25465	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 59"""	C9orf59		11214971	Standard	NM_033387		Approved	FLJ00024	uc004cak.3	Q5JUQ0	OTTHUMG00000020821	ENST00000372271.3:c.273C>T	9.37:g.134151294G>A			Q86VQ9|Q9H7P4	Silent	SNP	NULL	p.I91	ENST00000372271.3	37	c.273	CCDS6941.2	9																																																																																			FAM78A	-	NULL	ENSG00000126882		0.642	FAM78A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM78A	HGNC	protein_coding	OTTHUMT00000054720.1	42	0.00	0	G	NM_033387		134151294	134151294	-1	no_errors	ENST00000372271	ensembl	human	known	69_37n	silent	27	20.59	7	SNP	0.349	A
FBXW12	285231	genome.wustl.edu	37	3	48419899	48419899	+	Silent	SNP	G	G	C			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr3:48419899G>C	ENST00000296438.5	+	6	684	c.498G>C	c.(496-498)cgG>cgC	p.R166R	FBXW12_ENST00000436231.1_Silent_p.R9R|FBXW12_ENST00000415155.1_Intron|RN7SL321P_ENST00000581742.1_RNA|FBXW12_ENST00000445170.1_Silent_p.R147R	NM_207102.2	NP_996985.2	Q6X9E4	FBW12_HUMAN	F-box and WD repeat domain containing 12	166			R -> W (in dbSNP:rs6442117).							breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CTATGGATCGGAAAAAAACTA	0.488																																						dbGAP											0													92.0	80.0	84.0					3																	48419899		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK097594, AY247969	CCDS2764.1, CCDS54577.1, CCDS54578.1	3p21.31	2011-07-01	2007-02-08	2004-07-21	ENSG00000164049	ENSG00000164049		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	20729	protein-coding gene	gene with protein product		609075	"""F-box only protein 35"", ""F-box and WD-40 domain protein 12"""	FBXO35		15040455	Standard	NM_207102		Approved	Fbw12	uc010hjv.3	Q6X9E4	OTTHUMG00000133530	ENST00000296438.5:c.498G>C	3.37:g.48419899G>C			E9PG36|Q494Y9|Q494Z0	Silent	SNP	pfam_F-box_dom_cyclin-like,superfamily_Quino_amine_DH_bsu,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	p.R166	ENST00000296438.5	37	c.498	CCDS2764.1	3																																																																																			FBXW12	-	superfamily_Quino_amine_DH_bsu	ENSG00000164049		0.488	FBXW12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FBXW12	HGNC	protein_coding	OTTHUMT00000257505.1	39	0.00	0	G	NM_207102		48419899	48419899	+1	no_errors	ENST00000296438	ensembl	human	known	69_37n	silent	17	26.09	6	SNP	0.000	C
FCRL3	115352	genome.wustl.edu	37	1	157669486	157669486	+	Silent	SNP	T	T	C			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr1:157669486T>C	ENST00000368184.3	-	3	339	c.48A>G	c.(46-48)caA>caG	p.Q16Q	FCRL3_ENST00000368186.5_Silent_p.Q16Q|FCRL3_ENST00000473231.1_5'Flank	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	16						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					ACTTACCTGATTGTTCTCTTC	0.493																																						dbGAP											0													129.0	113.0	118.0					1																	157669486		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.48A>G	1.37:g.157669486T>C			A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Silent	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.Q16	ENST00000368184.3	37	c.48	CCDS1167.1	1																																																																																			FCRL3	-	NULL	ENSG00000160856		0.493	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	FCRL3	HGNC	protein_coding	OTTHUMT00000051419.2	30	0.00	0	T	NM_052939		157669486	157669486	-1	no_errors	ENST00000368186	ensembl	human	known	69_37n	silent	38	11.63	5	SNP	0.000	C
FUBP3	8939	genome.wustl.edu	37	9	133470877	133470877	+	Missense_Mutation	SNP	C	C	G			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr9:133470877C>G	ENST00000319725.9	+	2	167	c.92C>G	c.(91-93)gCt>gGt	p.A31G		NM_003934.1	NP_003925.1	Q96I24	FUBP3_HUMAN	far upstream element (FUSE) binding protein 3	31					positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(10)|ovary(2)|urinary_tract(2)	21				OV - Ovarian serous cystadenocarcinoma(145;0.000279)		TAGATTGCTGCTAAAATTGAT	0.418																																						dbGAP											0													165.0	150.0	155.0					9																	133470877		1857	4099	5956	-	-	-	SO:0001583	missense	0			U69127	CCDS43893.1	9q34.11	2008-02-05			ENSG00000107164	ENSG00000107164			4005	protein-coding gene	gene with protein product		603536		FBP3		8940189	Standard	NM_003934		Approved		uc004bzr.1	Q96I24	OTTHUMG00000020809	ENST00000319725.9:c.92C>G	9.37:g.133470877C>G	ENSP00000318177:p.Ala31Gly		A3KFK8|A3KFL0|Q92946|Q9BVB6	Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_KH_dom_type_2,smart_KH_dom,pfscan_KH_dom_type_1	p.A31G	ENST00000319725.9	37	c.92	CCDS43893.1	9	.	.	.	.	.	.	.	.	.	.	C	17.62	3.433745	0.62955	.	.	ENSG00000107164	ENST00000358721;ENST00000319725	T	0.50277	0.75	5.73	5.73	0.89815	.	0.139494	0.51477	D	0.000087	T	0.54078	0.1836	M	0.77486	2.375	0.80722	D	1	B	0.18166	0.026	B	0.12837	0.008	T	0.54609	-0.8268	10	0.87932	D	0	-10.1215	18.4771	0.90797	0.0:1.0:0.0:0.0	.	31	Q96I24	FUBP3_HUMAN	G	18;31	ENSP00000318177:A31G	ENSP00000318177:A31G	A	+	2	0	FUBP3	132460698	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.322000	0.65852	2.721000	0.93114	0.655000	0.94253	GCT	FUBP3	-	NULL	ENSG00000107164		0.418	FUBP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FUBP3	HGNC	protein_coding	OTTHUMT00000054666.1	42	0.00	0	C			133470877	133470877	+1	no_errors	ENST00000319725	ensembl	human	known	69_37n	missense	18	28.00	7	SNP	1.000	G
GAB3	139716	genome.wustl.edu	37	X	153906338	153906338	+	3'UTR	SNP	G	G	A			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chrX:153906338G>A	ENST00000369575.3	-	0	1909				GAB3_ENST00000496390.1_5'UTR|GAB3_ENST00000424127.2_3'UTR	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	Q8WWW8	GAB3_HUMAN	GRB2-associated binding protein 3						macrophage differentiation (GO:0030225)					NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)	25	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TTCTCTCTTGGTTTTGACCTG	0.393																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AY057989	CCDS14760.1, CCDS48198.1, CCDS65357.1	Xq28	2013-01-10			ENSG00000160219	ENSG00000160219		"""Pleckstrin homology (PH) domain containing"""	17515	protein-coding gene	gene with protein product	"""DOS/Gab family member 3"", ""Gab3 scaffolding protein"""	300482				11739737	Standard	XM_005274648		Approved		uc004fmk.1	Q8WWW8	OTTHUMG00000024245	ENST00000369575.3:c.*117C>T	X.37:g.153906338G>A			A6NHF8|E9PB44	RNA	SNP	-	NULL	ENST00000369575.3	37	NULL	CCDS14760.1	X																																																																																			GAB3	-	-	ENSG00000160219		0.393	GAB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GAB3	HGNC	protein_coding	OTTHUMT00000061192.2	17	0.00	0	G	NM_001081573		153906338	153906338	-1	no_errors	ENST00000496390	ensembl	human	known	69_37n	rna	11	21.43	3	SNP	0.000	A
PAXBP1	94104	genome.wustl.edu	37	21	34132196	34132196	+	Missense_Mutation	SNP	G	G	A			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr21:34132196G>A	ENST00000331923.4	-	6	1274	c.1085C>T	c.(1084-1086)tCa>tTa	p.S362L	PAXBP1_ENST00000290178.4_Missense_Mutation_p.S362L|PAXBP1_ENST00000472588.1_5'UTR	NM_016631.3	NP_057715.2	Q9Y5B6	PAXB1_HUMAN	PAX3 and PAX7 binding protein 1	362					muscle organ development (GO:0007517)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of satellite cell proliferation (GO:0014842)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GGCATCTGATGATCCATAGGC	0.403																																						dbGAP											0													164.0	166.0	166.0					21																	34132196		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF231920	CCDS13619.1, CCDS33541.1	21q22.11	2014-01-23	2013-01-08	2013-01-08	ENSG00000159086	ENSG00000159086			13579	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 105"", ""GC-rich sequence DNA-binding factor candidate"""		"""chromosome 21 open reading frame 66"", ""GC-rich sequence DNA-binding factor 1"""	C21orf66, GCFC1		11707072, 22862948	Standard	NM_016631		Approved	GCFC, fSAP105	uc002yqn.3	Q9Y5B6	OTTHUMG00000064980	ENST00000331923.4:c.1085C>T	21.37:g.34132196G>A	ENSP00000328992:p.Ser362Leu		D3DSE7|Q96DU8|Q9NYQ0	Missense_Mutation	SNP	pfam_GCFC_dom	p.S362L	ENST00000331923.4	37	c.1085	CCDS13619.1	21	.	.	.	.	.	.	.	.	.	.	G	14.71	2.615378	0.46631	.	.	ENSG00000159086	ENST00000331923;ENST00000290178	T;T	0.33216	1.85;1.42	5.79	5.79	0.91817	.	0.225843	0.42548	D	0.000700	T	0.31420	0.0796	L	0.50333	1.59	0.47094	D	0.999312	B;B	0.30973	0.2;0.302	B;B	0.26770	0.034;0.073	T	0.03157	-1.1066	10	0.29301	T	0.29	-9.9706	19.6353	0.95728	0.0:0.0:1.0:0.0	.	362;362	Q9Y5B6-2;Q9Y5B6	.;GCFC1_HUMAN	L	362	ENSP00000328992:S362L;ENSP00000290178:S362L	ENSP00000290178:S362L	S	-	2	0	GCFC1	33054067	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.822000	0.62686	2.750000	0.94351	0.563000	0.77884	TCA	GCFC1	-	NULL	ENSG00000159086		0.403	PAXBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCFC1	HGNC	protein_coding	OTTHUMT00000139563.1	36	0.00	0	G	NM_013329		34132196	34132196	-1	no_errors	ENST00000331923	ensembl	human	known	69_37n	missense	43	18.52	10	SNP	1.000	A
GEMIN4	50628	genome.wustl.edu	37	17	649773	649773	+	Missense_Mutation	SNP	G	G	A			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr17:649773G>A	ENST00000319004.5	-	2	1628	c.1510C>T	c.(1510-1512)Cgt>Tgt	p.R504C	GEMIN4_ENST00000576778.1_Missense_Mutation_p.R493C	NM_015721.2	NP_056536.2	P57678	GEMI4_HUMAN	gem (nuclear organelle) associated protein 4	504					gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)				breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		CCCCAGGAACGCAGGATACCT	0.512																																						dbGAP											0													36.0	37.0	37.0					17																	649773		1920	4128	6048	-	-	-	SO:0001583	missense	0			AF177341	CCDS45559.1	17p13.3	2008-07-18				ENSG00000179409			15717	protein-coding gene	gene with protein product	"""HCC-associated protein 1"", ""component of gems 4"""	606969				10725331	Standard	NM_015721		Approved	HHRF-1, DKFZP434B131, p97, DKFZP434D174, HC56, HCAP1	uc002frs.1	P57678		ENST00000319004.5:c.1510C>T	17.37:g.649773G>A	ENSP00000321706:p.Arg504Cys		Q9NZS7|Q9UG32|Q9Y4Q2	Missense_Mutation	SNP	NULL	p.R504C	ENST00000319004.5	37	c.1510	CCDS45559.1	17	.	.	.	.	.	.	.	.	.	.	G	7.297	0.612302	0.14066	.	.	ENSG00000179409	ENST00000319004	T	0.15017	2.46	5.54	0.567	0.17325	.	2.054310	0.01822	N	0.034146	T	0.09335	0.0230	N	0.08118	0	0.39559	D	0.969098	B	0.31790	0.34	B	0.33890	0.172	T	0.33574	-0.9863	10	0.51188	T	0.08	-0.0132	0.8083	0.01088	0.2452:0.2605:0.32:0.1743	.	504	P57678	GEMI4_HUMAN	C	504	ENSP00000321706:R504C	ENSP00000321706:R504C	R	-	1	0	GEMIN4	596523	0.100000	0.21855	0.268000	0.24571	0.564000	0.35744	0.373000	0.20484	0.377000	0.24735	0.591000	0.81541	CGT	GEMIN4	-	NULL	ENSG00000179409		0.512	GEMIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GEMIN4	HGNC	protein_coding	OTTHUMT00000437181.1	47	0.00	0	G	NM_015721		649773	649773	-1	no_errors	ENST00000319004	ensembl	human	known	69_37n	missense	14	53.33	16	SNP	0.046	A
GLIS3	169792	genome.wustl.edu	37	9	4299661	4299661	+	5'UTR	SNP	C	C	A			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr9:4299661C>A	ENST00000381971.3	-	0	255				RP11-358M14.2_ENST00000440674.1_RNA	NM_001042413.1	NP_001035878.1	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(12)|lung(4)|ovary(2)|prostate(1)|skin(1)	26		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		GCAGCGGCGGCAGGGGGAGGA	0.612																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			BC033899	CCDS6451.1, CCDS43784.1	9p24.2	2008-05-02	2004-07-16	2004-07-16	ENSG00000107249	ENSG00000107249		"""Zinc fingers, C2H2-type"""	28510	protein-coding gene	gene with protein product		610192	"""zinc finger protein 515"""	ZNF515		14500813	Standard	NM_152629		Approved	MGC33662	uc003zhx.1	Q8NEA6	OTTHUMG00000019463	ENST00000381971.3:c.-339G>T	9.37:g.4299661C>A			B1AL19|Q1PHK5	RNA	SNP	-	NULL	ENST00000381971.3	37	NULL	CCDS43784.1	9																																																																																			GLIS3	-	-	ENSG00000107249		0.612	GLIS3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	GLIS3	HGNC	protein_coding	OTTHUMT00000354776.1	16	0.00	0	C	NM_152629		4299661	4299661	-1	no_errors	ENST00000490709	ensembl	human	known	69_37n	rna	5	50.00	5	SNP	0.651	A
GPR144	347088	genome.wustl.edu	37	9	127215772	127215772	+	Missense_Mutation	SNP	C	C	G	rs72616654	byFrequency	TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr9:127215772C>G	ENST00000334810.1	+	4	796	c.796C>G	c.(796-798)Cac>Gac	p.H266D				Q7Z7M1	GP144_HUMAN	G protein-coupled receptor 144	266	Pentaxin.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)	4						CTCGGTGCGTCACGCCCTCAG	0.761													G|||	2623	0.523762	0.4834	0.6009	5008	,	,		6568	0.4494		0.5726	False		,,,				2504	0.5501					dbGAP											0													4.0	5.0	4.0					9																	127215772		654	1515	2169	-	-	-	SO:0001583	missense	0			AY278562		9q34.11	2014-08-08			ENSG00000180264	ENSG00000180264		"""-"", ""GPCR / Class B : Orphans"""	18651	protein-coding gene	gene with protein product							Standard	XM_006710216		Approved	PGR24	uc010mwn.3	Q7Z7M1	OTTHUMG00000020652	ENST00000334810.1:c.796C>G	9.37:g.127215772C>G	ENSP00000335156:p.His266Asp		Q86SL4|Q8NH12	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_Pentaxin,pfam_GPS_dom,superfamily_ConA-like_lec_gl,superfamily_C-type_lectin_fold,smart_Pentaxin,smart_GPS_dom,prints_Pentaxin,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_GPCR_2-like	p.H266D	ENST00000334810.1	37	c.796	CCDS48016.1	9	1149	0.5260989010989011	257	0.5223577235772358	216	0.5966850828729282	250	0.4370629370629371	426	0.5620052770448549	G	1.281	-0.610443	0.03690	.	.	ENSG00000180264	ENST00000334810	T	0.05996	3.36	3.81	2.9	0.33743	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	.	.	.	.	T	0.00012	0.0000	N	0.00707	-1.245	0.53688	P	2.2999999999995246E-5	B	0.02656	0.0	B	0.01281	0.0	T	0.21861	-1.0233	8	0.08837	T	0.75	.	7.5506	0.27796	0.0951:0.1682:0.7367:0.0	.	266	Q7Z7M1	GP144_HUMAN	D	266	ENSP00000335156:H266D	ENSP00000335156:H266D	H	+	1	0	GPR144	126255593	0.998000	0.40836	0.052000	0.19188	0.277000	0.26821	3.079000	0.50104	0.133000	0.18654	-0.647000	0.03941	CAC	GPR144	-	pfam_Pentaxin,superfamily_ConA-like_lec_gl,smart_Pentaxin,prints_Pentaxin	ENSG00000180264		0.761	GPR144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR144	HGNC	protein_coding	OTTHUMT00000054026.2	9	0.00	0	C	NM_182611		127215772	127215772	+1	no_errors	ENST00000334810	ensembl	human	known	69_37n	missense	0	100.00	4	SNP	0.836	G
GRIN2A	2903	genome.wustl.edu	37	16	9892166	9892166	+	Missense_Mutation	SNP	A	A	G			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr16:9892166A>G	ENST00000396573.2	-	12	2633	c.2324T>C	c.(2323-2325)aTc>aCc	p.I775T	GRIN2A_ENST00000330684.3_Missense_Mutation_p.I775T|GRIN2A_ENST00000562109.1_Missense_Mutation_p.I775T|GRIN2A_ENST00000535259.1_Missense_Mutation_p.I618T|GRIN2A_ENST00000404927.2_Missense_Mutation_p.I775T|GRIN2A_ENST00000396575.2_Missense_Mutation_p.I775T	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	775					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GGCCAGGTCGATCTGCCTCTT	0.547																																						dbGAP											0													100.0	74.0	83.0					16																	9892166		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.2324T>C	16.37:g.9892166A>G	ENSP00000379818:p.Ile775Thr		O00669|Q17RZ6	Missense_Mutation	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.I775T	ENST00000396573.2	37	c.2324	CCDS10539.1	16	.	.	.	.	.	.	.	.	.	.	A	18.91	3.722919	0.68959	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.57752	0.38;0.38;0.38;0.38;0.38	5.03	5.03	0.67393	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.112377	0.64402	D	0.000011	T	0.74951	0.3784	M	0.87900	2.915	0.45567	D	0.998511	P;P;P	0.49307	0.905;0.922;0.867	D;D;D	0.68621	0.931;0.959;0.927	T	0.78770	-0.2074	9	.	.	.	.	13.9455	0.64082	1.0:0.0:0.0:0.0	.	618;775;775	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	T	775;775;618;775;775	ENSP00000379818:I775T;ENSP00000385872:I775T;ENSP00000441572:I618T;ENSP00000332549:I775T;ENSP00000379820:I775T	.	I	-	2	0	GRIN2A	9799667	1.000000	0.71417	0.960000	0.40013	0.720000	0.41350	9.172000	0.94808	1.894000	0.54839	0.455000	0.32223	ATC	GRIN2A	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000183454		0.547	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2A	HGNC	protein_coding	OTTHUMT00000251930.3	44	0.00	0	A			9892166	9892166	-1	no_errors	ENST00000330684	ensembl	human	known	69_37n	missense	25	26.47	9	SNP	0.999	G
GRIN3A	116443	genome.wustl.edu	37	9	104432738	104432738	+	Missense_Mutation	SNP	G	G	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr9:104432738G>T	ENST00000361820.3	-	3	2556	c.1956C>A	c.(1954-1956)agC>agA	p.S652R		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	652					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	AGATGCCCAAGCTGGTGGAGA	0.537																																						dbGAP											0													76.0	79.0	78.0					9																	104432738		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.1956C>A	9.37:g.104432738G>T	ENSP00000355155:p.Ser652Arg		B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,prints_NMDA_rcpt	p.S652R	ENST00000361820.3	37	c.1956	CCDS6758.1	9	.	.	.	.	.	.	.	.	.	.	G	15.99	2.994291	0.54041	.	.	ENSG00000198785	ENST00000361820	T	0.54071	0.59	5.63	3.77	0.43336	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.68760	0.3036	M	0.73962	2.25	0.54753	D	0.999988	D	0.89917	1.0	D	0.91635	0.999	T	0.69837	-0.5037	10	0.87932	D	0	.	9.1161	0.36758	0.292:0.0:0.708:0.0	.	652	Q8TCU5	NMD3A_HUMAN	R	652	ENSP00000355155:S652R	ENSP00000355155:S652R	S	-	3	2	GRIN3A	103472559	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.935000	0.48963	0.834000	0.34852	0.580000	0.79431	AGC	GRIN3A	-	pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000198785		0.537	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN3A	HGNC	protein_coding	OTTHUMT00000053453.1	16	0.00	0	G			104432738	104432738	-1	no_errors	ENST00000361820	ensembl	human	known	69_37n	missense	1	85.71	6	SNP	1.000	T
GRIN3B	116444	genome.wustl.edu	37	19	1005215	1005215	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr19:1005215C>T	ENST00000234389.3	+	3	1734	c.1715C>T	c.(1714-1716)cCc>cTc	p.P572L	GRIN3B_ENST00000588335.1_3'UTR|AC004528.4_ENST00000588380.1_RNA	NM_138690.1	NP_619635.1	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3B	572					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|protein insertion into membrane (GO:0051205)|regulation of calcium ion transport (GO:0051924)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|neurotransmitter receptor activity (GO:0030594)			breast(1)|kidney(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TTTATGTGGCCCCTGCACTGG	0.657																																						dbGAP											0													57.0	53.0	54.0					19																	1005215		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32861.1	19p13.3	2014-05-06			ENSG00000116032	ENSG00000116032		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16768	protein-coding gene	gene with protein product		606651					Standard	XM_003403700		Approved	GluN3B	uc002lqo.1	O60391	OTTHUMG00000181904	ENST00000234389.3:c.1715C>T	19.37:g.1005215C>T	ENSP00000234389:p.Pro572Leu		Q5EAK7|Q7RTW9	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.P572L	ENST00000234389.3	37	c.1715	CCDS32861.1	19	.	.	.	.	.	.	.	.	.	.	C	24.2	4.510490	0.85389	.	.	ENSG00000116032	ENST00000234389	T	0.57595	0.39	4.53	4.53	0.55603	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.78735	0.4330	M	0.92367	3.3	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85048	0.0927	10	0.87932	D	0	.	15.8728	0.79136	0.0:1.0:0.0:0.0	.	572	O60391	NMD3B_HUMAN	L	572	ENSP00000234389:P572L	ENSP00000234389:P572L	P	+	2	0	GRIN3B	956215	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	7.671000	0.83941	2.100000	0.63781	0.485000	0.47835	CCC	GRIN3B	-	pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000116032		0.657	GRIN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN3B	HGNC	protein_coding	OTTHUMT00000103923.2	127	0.00	0	C			1005215	1005215	+1	no_errors	ENST00000234389	ensembl	human	known	69_37n	missense	34	24.44	11	SNP	1.000	T
HKDC1	80201	genome.wustl.edu	37	10	71010072	71010072	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr10:71010072C>T	ENST00000354624.5	+	11	1730	c.1597C>T	c.(1597-1599)Ctt>Ttt	p.L533F	HKDC1_ENST00000395086.2_Missense_Mutation_p.L533F	NM_025130.3	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1	533	Hexokinase type-1 2.				carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)	cytosol (GO:0005829)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|mannokinase activity (GO:0019158)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						CGCCCTGGATCTTGGGGGAAC	0.537																																						dbGAP											0													137.0	144.0	142.0					10																	71010072		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7288.1	10q22.1	2006-10-24			ENSG00000156510	ENSG00000156510			23302	protein-coding gene	gene with protein product						12477932	Standard	NM_025130		Approved	FLJ37767, FLJ22761	uc001jpf.4	Q2TB90	OTTHUMG00000018371	ENST00000354624.5:c.1597C>T	10.37:g.71010072C>T	ENSP00000346643:p.Leu533Phe		B5MDN9|Q2TB91|Q5VTC7|Q7Z373|Q8WU37|Q96EH2|Q9H5Y9	Missense_Mutation	SNP	pfam_Hexokinase_C,pfam_Hexokinase_N,prints_Hexokinase	p.L533F	ENST00000354624.5	37	c.1597	CCDS7288.1	10	.	.	.	.	.	.	.	.	.	.	C	20.8	4.051233	0.75960	.	.	ENSG00000156510	ENST00000354624;ENST00000395087;ENST00000395086	D;D	0.99098	-5.42;-5.42	5.2	1.96	0.26148	Hexokinase, N-terminal (1);	0.000000	0.64402	D	0.000001	D	0.98963	0.9647	M	0.77486	2.375	0.50313	D	0.999867	D	0.63880	0.993	D	0.70716	0.97	D	0.99094	1.0841	10	0.87932	D	0	-14.0368	10.5067	0.44839	0.0:0.8003:0.0:0.1997	.	533	Q2TB90	HKDC1_HUMAN	F	533	ENSP00000346643:L533F;ENSP00000378521:L533F	ENSP00000346643:L533F	L	+	1	0	HKDC1	70680078	1.000000	0.71417	0.939000	0.37840	0.923000	0.55619	3.223000	0.51231	0.217000	0.20800	0.561000	0.74099	CTT	HKDC1	-	pfam_Hexokinase_N,prints_Hexokinase	ENSG00000156510		0.537	HKDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HKDC1	HGNC	protein_coding	OTTHUMT00000048389.1	45	0.00	0	C	NM_025130		71010072	71010072	+1	no_errors	ENST00000354624	ensembl	human	known	69_37n	missense	13	43.48	10	SNP	1.000	T
HPS3	84343	genome.wustl.edu	37	3	148884851	148884851	+	Missense_Mutation	SNP	G	G	A			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr3:148884851G>A	ENST00000296051.2	+	15	2760	c.2620G>A	c.(2620-2622)Gct>Act	p.A874T	HPS3_ENST00000460120.1_Missense_Mutation_p.A709T	NM_032383.3	NP_115759.2	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3	874					organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	34			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			ATTTGACATAGCTTCCATTAT	0.403									Hermansky-Pudlak syndrome																													dbGAP											0													150.0	149.0	149.0					3																	148884851		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HPS, HPS1-8	AY033141	CCDS3140.1	3q24	2014-06-18			ENSG00000163755	ENSG00000163755			15597	protein-coding gene	gene with protein product		606118				11455388	Standard	NM_032383		Approved	SUTAL	uc003ewu.1	Q969F9	OTTHUMG00000159548	ENST00000296051.2:c.2620G>A	3.37:g.148884851G>A	ENSP00000296051:p.Ala874Thr		A8K6G6|Q8WTV6|Q96AP1|Q96MR3|Q9H608	Splice_Site	SNP	-	e5-1	ENST00000296051.2	37	c.718-1	CCDS3140.1	3	.	.	.	.	.	.	.	.	.	.	G	16.49	3.137069	0.56936	.	.	ENSG00000163755	ENST00000296051;ENST00000460120	T;T	0.64991	-0.13;-0.12	5.82	4.94	0.65067	.	0.469763	0.26828	N	0.022295	T	0.40956	0.1138	N	0.12182	0.205	0.80722	D	1	B;B	0.24618	0.107;0.061	B;B	0.26202	0.067;0.046	T	0.28004	-1.0057	10	0.19590	T	0.45	-7.9624	9.9216	0.41468	0.2008:0.0:0.7992:0.0	.	709;874	G5E9V4;Q969F9	.;HPS3_HUMAN	T	874;709	ENSP00000296051:A874T;ENSP00000418230:A709T	ENSP00000296051:A874T	A	+	1	0	HPS3	150367541	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.268000	0.33062	2.762000	0.94881	0.650000	0.86243	GCT	HPS3	-	-	ENSG00000163755		0.403	HPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPS3	HGNC	protein_coding	OTTHUMT00000356151.1	10	0.00	0	G	NM_032383		148884851	148884851	+1	no_start_codon	ENST00000460822	ensembl	human	known	69_37n	splice_site	7	36.36	4	SNP	1.000	A
HUWE1	10075	genome.wustl.edu	37	X	53610743	53610743	+	Missense_Mutation	SNP	C	C	A			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chrX:53610743C>A	ENST00000342160.3	-	41	5752	c.5295G>T	c.(5293-5295)atG>atT	p.M1765I	HUWE1_ENST00000262854.6_Missense_Mutation_p.M1765I			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	1765					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						GGACTCCCAGCATGCTCACGC	0.517																																						dbGAP											0													94.0	76.0	82.0					X																	53610743		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.5295G>T	X.37:g.53610743C>A	ENSP00000340648:p.Met1765Ile		O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/transl_elong_EF1B_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.M1765I	ENST00000342160.3	37	c.5295	CCDS35301.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.83|15.83	2.950439|2.950439	0.53186|0.53186	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000427052|ENST00000342160;ENST00000262854	.|T;T	.|0.36157	.|1.27;1.27	5.6|5.6	5.6|5.6	0.85130|0.85130	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.32585|0.32585	0.0834|0.0834	L|L	0.38531|0.38531	1.155|1.155	0.58432|0.58432	D|D	0.999999|0.999999	.|B;B	.|0.30236	.|0.272;0.274	.|B;B	.|0.34242	.|0.086;0.178	T|T	0.07424|0.07424	-1.0773|-1.0773	5|10	.|0.15952	.|T	.|0.53	.|.	17.2084|17.2084	0.86924|0.86924	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1765;1765	.|Q7Z6Z7;Q7Z6Z7-2	.|HUWE1_HUMAN;.	S|I	799|1765	.|ENSP00000340648:M1765I;ENSP00000262854:M1765I	.|ENSP00000262854:M1765I	A|M	-|-	1|3	0|0	HUWE1|HUWE1	53627468|53627468	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	5.749000|5.749000	0.68704|0.68704	2.329000|2.329000	0.79093|0.79093	0.600000|0.600000	0.82982|0.82982	GCT|ATG	HUWE1	-	NULL	ENSG00000086758		0.517	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	62	0.00	0	C	XM_497119		53610743	53610743	-1	no_errors	ENST00000262854	ensembl	human	known	69_37n	missense	49	24.62	16	SNP	1.000	A
IGHA1	3493	genome.wustl.edu	37	14	106173708	106173708	+	RNA	SNP	G	G	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr14:106173708G>T	ENST00000390547.2	-	0	858				AL928768.3_ENST00000497872.2_lincRNA			P01876	IGHA1_HUMAN	immunoglobulin heavy constant alpha 1						antibacterial humoral response (GO:0019731)|glomerular filtration (GO:0003094)|immune response (GO:0006955)|positive regulation of respiratory burst (GO:0060267)|protein-chromophore linkage (GO:0018298)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|monomeric IgA immunoglobulin complex (GO:0071748)|secretory dimeric IgA immunoglobulin complex (GO:0071752)|secretory IgA immunoglobulin complex (GO:0071751)	antigen binding (GO:0003823)										GTGGTGCCCTGGCTGGGCTCC	0.662																																						dbGAP											0													49.0	78.0	69.0					14																	106173708		2099	4248	6347	-	-	-			0			J00220		14q32.33	2012-10-02			ENSG00000211895	ENSG00000211895		"""Immunoglobulins / IGH locus"""	5478	other	immunoglobulin gene		146900					Standard	NG_001019		Approved			P01876	OTTHUMG00000152494		14.37:g.106173708G>T				Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	p.Q287K	ENST00000390547.2	37	c.859		14																																																																																			IGHA1	-	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	ENSG00000211895		0.662	IGHA1-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IGHA1	HGNC	IG_C_gene	OTTHUMT00000326459.1	111	0.00	0	G	NG_001019		106173708	106173708	-1	no_start_codon	ENST00000390547	ensembl	human	known	69_37n	missense	33	13.16	5	SNP	0.011	T
IGKV1-27	28935	genome.wustl.edu	37	2	89513340	89513340	+	RNA	SNP	G	G	A	rs577004736	byFrequency	TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr2:89513340G>A	ENST00000498435.1	-	0	73									immunoglobulin kappa variable 1-27																		GGGAGCCAGAGCAGCAGGAGT	0.478													G|||	4	0.000798722	0.003	0.0	5008	,	,		14919	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													73.0	73.0	73.0					2																	89513340		1865	4101	5966	-	-	-			0			X63398		2p11.2	2012-02-10			ENSG00000244575	ENSG00000244575		"""Immunoglobulins / IGK locus"""	5735	other	immunoglobulin gene							Standard	NG_000834		Approved	IGKV127, A20			OTTHUMG00000151640		2.37:g.89513340G>A				Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.L15F	ENST00000498435.1	37	c.43		2																																																																																			IGKV1-27	-	NULL	ENSG00000244575		0.478	IGKV1-27-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGKV1-27	HGNC	IG_V_gene	OTTHUMT00000323389.1	54	0.00	0	G	NG_000834		89513340	89513340	-1	no_stop_codon	ENST00000498435	ensembl	human	known	69_37n	missense	28	22.22	8	SNP	0.995	A
INO80D	54891	genome.wustl.edu	37	2	206872095	206872095	+	Missense_Mutation	SNP	G	G	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr2:206872095G>T	ENST00000403263.1	-	10	2235	c.1831C>A	c.(1831-1833)Cca>Aca	p.P611T	Vault_ENST00000516676.1_RNA	NM_017759.4	NP_060229.3	Q53TQ3	IN80D_HUMAN	INO80 complex subunit D	611					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	26						AAGTCATGTGGAATGTCAGTG	0.458																																						dbGAP											0													125.0	124.0	125.0					2																	206872095		2033	4192	6225	-	-	-	SO:0001583	missense	0				CCDS46500.1	2q33.3	2011-07-06			ENSG00000114933	ENSG00000114933		"""INO80 complex subunits"""	25997	protein-coding gene	gene with protein product						16230350	Standard	NM_017759		Approved	FLJ20309	uc002vaz.4	Q53TQ3	OTTHUMG00000154649	ENST00000403263.1:c.1831C>A	2.37:g.206872095G>T	ENSP00000384198:p.Pro611Thr		B3KU68|B9EG77|Q6PJC6|Q6PJU1|Q6PKA1|Q9NXD5	Missense_Mutation	SNP	NULL	p.P611T	ENST00000403263.1	37	c.1831	CCDS46500.1	2	.	.	.	.	.	.	.	.	.	.	G	32	5.112784	0.94339	.	.	ENSG00000114933	ENST00000403263;ENST00000233270	T	0.37235	1.21	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.54886	0.1886	L	0.51422	1.61	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.40646	-0.9552	10	0.21014	T	0.42	.	19.3371	0.94324	0.0:0.0:1.0:0.0	.	611	Q53TQ3-2	.	T	611	ENSP00000384198:P611T	ENSP00000233270:P611T	P	-	1	0	INO80D	206580340	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.567000	0.86603	0.561000	0.74099	CCA	INO80D	-	NULL	ENSG00000114933		0.458	INO80D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INO80D	HGNC	protein_coding	OTTHUMT00000336459.1	35	0.00	0	G	NM_017759		206872095	206872095	-1	no_errors	ENST00000403263	ensembl	human	known	69_37n	missense	20	25.93	7	SNP	1.000	T
ITPRIP	85450	genome.wustl.edu	37	10	106074852	106074852	+	Missense_Mutation	SNP	C	C	G			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr10:106074852C>G	ENST00000337478.1	-	2	1129	c.958G>C	c.(958-960)Gag>Cag	p.E320Q	RP11-127L20.5_ENST00000472915.2_RNA|ITPRIP_ENST00000278071.2_Missense_Mutation_p.E320Q|ITPRIP_ENST00000358187.2_Missense_Mutation_p.E320Q	NM_001272013.1	NP_001258942.1	Q8IWB1	IPRI_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein	320						membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(9)|upper_aerodigestive_tract(1)	20						AGGTCGAACTCGTACTTGTGG	0.577																																						dbGAP											0													83.0	81.0	81.0					10																	106074852		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051541	CCDS7557.1	10q25.1	2011-04-28	2011-04-28	2008-08-11	ENSG00000148841	ENSG00000148841			29370	protein-coding gene	gene with protein product			"""KIAA1754"", ""inositol 1,4,5-triphosphate receptor interacting protein"""	KIAA1754		11214970, 16990268	Standard	NM_001272012		Approved	bA127L20.2, DANGER	uc001kye.4	Q8IWB1	OTTHUMG00000019003	ENST00000337478.1:c.958G>C	10.37:g.106074852C>G	ENSP00000337178:p.Glu320Gln		D3DRA5|Q5JU17|Q96MS8|Q9C0A9	Missense_Mutation	SNP	NULL	p.E320Q	ENST00000337478.1	37	c.958	CCDS7557.1	10	.	.	.	.	.	.	.	.	.	.	C	21.0	4.088108	0.76642	.	.	ENSG00000148841	ENST00000337478;ENST00000278071;ENST00000358187	T;T;T	0.24538	1.85;1.85;1.85	5.09	5.09	0.68999	.	0.050975	0.85682	D	0.000000	T	0.51058	0.1652	M	0.65975	2.015	0.40753	D	0.982933	D	0.76494	0.999	D	0.74023	0.982	T	0.53493	-0.8431	10	0.59425	D	0.04	-30.1429	18.859	0.92265	0.0:1.0:0.0:0.0	.	320	Q8IWB1	IPRI_HUMAN	Q	320	ENSP00000337178:E320Q;ENSP00000278071:E320Q;ENSP00000350915:E320Q	ENSP00000278071:E320Q	E	-	1	0	ITPRIP	106064842	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.742000	0.85008	2.517000	0.84864	0.462000	0.41574	GAG	ITPRIP	-	NULL	ENSG00000148841		0.577	ITPRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPRIP	HGNC	protein_coding	OTTHUMT00000050204.1	45	0.00	0	C	NM_033397		106074852	106074852	-1	no_errors	ENST00000278071	ensembl	human	known	69_37n	missense	16	54.29	19	SNP	1.000	G
JAK2	3717	genome.wustl.edu	37	9	5073764	5073764	+	Missense_Mutation	SNP	G	G	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr9:5073764G>T	ENST00000381652.3	+	14	2337	c.1843G>T	c.(1843-1845)Gta>Tta	p.V615L	JAK2_ENST00000544510.1_Missense_Mutation_p.V466L|JAK2_ENST00000539801.1_Missense_Mutation_p.V615L	NM_004972.3	NP_004963.1	O60674	JAK2_HUMAN	Janus kinase 2	615	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin filament polymerization (GO:0030041)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone receptor signaling pathway (GO:0060396)|histone H3-Y41 phosphorylation (GO:0035409)|hormone-mediated signaling pathway (GO:0009755)|host programmed cell death induced by symbiont (GO:0034050)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-12-mediated signaling pathway (GO:0035722)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|mammary gland epithelium development (GO:0061180)|mesoderm development (GO:0007498)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA binding (GO:0043392)|negative regulation of heart contraction (GO:0045822)|negative regulation of neuron apoptotic process (GO:0043524)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell activation (GO:0050867)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA binding (GO:0043388)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of inflammatory response (GO:0050729)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to antibiotic (GO:0046677)|response to hydroperoxide (GO:0033194)|response to interleukin-12 (GO:0070671)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|tyrosine phosphorylation of STAT protein (GO:0007260)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome lumen (GO:0031904)|membrane raft (GO:0045121)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|heme binding (GO:0020037)|histone binding (GO:0042393)|histone kinase activity (H3-Y41 specific) (GO:0035401)|interleukin-12 receptor binding (GO:0005143)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)		BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)|ETV6/JAK2(11)|PCM1/JAK2(30)|PAX5/JAK2(18)	breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(32944)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(4)|skin(2)|urinary_tract(1)	32998	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	AAATTATGGAGTATGTGTCTG	0.338		1	"""T, Mis, O"""	"""ETV6, PCM1, BCR"""	"""ALL, AML, MPD,  CML"""				Polycythemia Vera, Familial																													dbGAP		Dom	yes		9	9p24	3717	Janus kinase 2		L	0													98.0	108.0	104.0					9																	5073764		2203	4299	6502	-	-	-	SO:0001583	missense	0	Familial Cancer Database			CCDS6457.1	9p24	2014-09-17	2009-04-23		ENSG00000096968	ENSG00000096968	2.7.10.1	"""SH2 domain containing"""	6192	protein-coding gene	gene with protein product		147796				1848670	Standard	NM_004972		Approved	JTK10	uc003ziw.3	O60674	OTTHUMG00000019490	ENST00000381652.3:c.1843G>T	9.37:g.5073764G>T	ENSP00000371067:p.Val615Leu		O14636|O75297	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain,pfscan_SH2,pfscan_Prot_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Tyr_kinase_non-rcpt_Jak2,prints_Ser-Thr/Tyr_kinase_cat_dom	p.V615L	ENST00000381652.3	37	c.1843	CCDS6457.1	9	.	.	.	.	.	.	.	.	.	.	G	20.7	4.028095	0.75390	.	.	ENSG00000096968	ENST00000539801;ENST00000381652;ENST00000544510	D;D;D	0.83914	-1.78;-1.78;-1.78	5.51	4.62	0.57501	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.055836	0.64402	D	0.000001	D	0.84356	0.5454	M	0.79258	2.445	0.54753	D	0.999982	P	0.44309	0.832	B	0.42495	0.389	D	0.86396	0.1739	10	0.87932	D	0	-18.3112	14.5283	0.67905	0.0708:0.0:0.9292:0.0	.	615	O60674	JAK2_HUMAN	L	615;615;466	ENSP00000440387:V615L;ENSP00000371067:V615L;ENSP00000443103:V466L	ENSP00000371067:V615L	V	+	1	0	JAK2	5063764	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	5.089000	0.64492	1.327000	0.45338	-0.216000	0.12614	GTA	JAK2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_Prot_kinase_cat_dom	ENSG00000096968		0.338	JAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAK2	HGNC	protein_coding	OTTHUMT00000051609.1	38	0.00	0	G			5073764	5073764	+1	no_errors	ENST00000381652	ensembl	human	known	69_37n	missense	26	13.33	4	SNP	1.000	T
KCMF1	56888	genome.wustl.edu	37	2	85280279	85280279	+	Missense_Mutation	SNP	A	A	C			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr2:85280279A>C	ENST00000409785.4	+	7	1252	c.893A>C	c.(892-894)gAt>gCt	p.D298A		NM_020122.4	NP_064507.3	Q9P0J7	KCMF1_HUMAN	potassium channel modulatory factor 1	298							ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			ovary(3)	3						AGGTTGAATGATCCTAAAATG	0.438																																						dbGAP											0													32.0	32.0	32.0					2																	85280279		1891	4116	6007	-	-	-	SO:0001583	missense	0			AF155652	CCDS46350.1	2p11.2	2010-11-23			ENSG00000176407	ENSG00000176407		"""Zinc fingers, ZZ-type"""	20589	protein-coding gene	gene with protein product		614719					Standard	NM_020122		Approved	DEBT91, PCMF, DKFZP434L1021, ZZZ1	uc002sox.4	Q9P0J7	OTTHUMG00000153004	ENST00000409785.4:c.893A>C	2.37:g.85280279A>C	ENSP00000386738:p.Asp298Ala		Q4ZG04|Q53SC7|Q9BWK2|Q9H8P5|Q9UFE8	Missense_Mutation	SNP	pfam_Znf_ZZ,pfam_Di19_RING_finger_144,smart_Znf_ZZ,smart_Znf_C2H2-like,pfscan_Znf_ZZ,pfscan_Znf_C2H2	p.D298A	ENST00000409785.4	37	c.893	CCDS46350.1	2	.	.	.	.	.	.	.	.	.	.	A	16.39	3.108646	0.56291	.	.	ENSG00000176407	ENST00000409785	T	0.44083	0.93	6.07	6.07	0.98685	.	0.088853	0.85682	D	0.000000	T	0.34803	0.0910	L	0.40543	1.245	0.58432	D	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.12578	-1.0542	10	0.19147	T	0.46	-14.3965	14.5871	0.68335	1.0:0.0:0.0:0.0	.	298	Q9P0J7	KCMF1_HUMAN	A	298	ENSP00000386738:D298A	ENSP00000386738:D298A	D	+	2	0	KCMF1	85133790	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	9.076000	0.94009	2.330000	0.79161	0.477000	0.44152	GAT	KCMF1	-	NULL	ENSG00000176407		0.438	KCMF1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	KCMF1	HGNC	protein_coding	OTTHUMT00000328942.4	55	0.00	0	A	NM_020122		85280279	85280279	+1	no_errors	ENST00000409785	ensembl	human	known	69_37n	missense	12	47.83	11	SNP	1.000	C
KIF13B	23303	genome.wustl.edu	37	8	29043904	29043904	+	Silent	SNP	A	A	T	rs559831487	byFrequency	TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr8:29043904A>T	ENST00000524189.1	-	6	440	c.402T>A	c.(400-402)acT>acA	p.T134T	KIF13B_ENST00000521515.1_Silent_p.T134T	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	134	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		CCTCTTTCTGAGTTCGTTCAA	0.378																																						dbGAP											0													122.0	124.0	123.0					8																	29043904		1825	4085	5910	-	-	-	SO:0001819	synonymous_variant	0			AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.402T>A	8.37:g.29043904A>T			B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Silent	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_CAP-Gly_domain,pfam_KIF1B,pfam_FHA_dom,superfamily_CAP-Gly_domain,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_CAP-Gly_domain,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.T134	ENST00000524189.1	37	c.402	CCDS55217.1	8																																																																																			KIF13B	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000197892		0.378	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF13B	HGNC	protein_coding	OTTHUMT00000376878.1	25	0.00	0	A			29043904	29043904	-1	no_errors	ENST00000524189	ensembl	human	known	69_37n	silent	11	21.43	3	SNP	0.804	T
KLHDC7B	113730	genome.wustl.edu	37	22	50987927	50987927	+	Silent	SNP	G	G	A			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr22:50987927G>A	ENST00000395676.2	+	1	1466	c.1332G>A	c.(1330-1332)gaG>gaA	p.E444E	CTA-384D8.31_ENST00000434237.1_RNA	NM_138433.3	NP_612442.2	Q96G42	KLD7B_HUMAN	kelch domain containing 7B	444										central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	14		all_cancers(38;1.53e-10)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		OV - Ovarian serous cystadenocarcinoma(4;7.49e-69)|all cancers(3;9.79e-66)|Epithelial(4;1.3e-63)|GBM - Glioblastoma multiforme(4;0.000399)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TGGCCCACGAGGCTGTGGCCT	0.662																																						dbGAP											0													67.0	70.0	69.0					22																	50987927		2200	4299	6499	-	-	-	SO:0001819	synonymous_variant	0			BC009980	CCDS14097.2	22q13.33	2006-11-29		2005-12-13	ENSG00000130487	ENSG00000130487			25145	protein-coding gene	gene with protein product							Standard	NM_138433		Approved	MGC16635	uc003bmi.3	Q96G42	OTTHUMG00000150250	ENST00000395676.2:c.1332G>A	22.37:g.50987927G>A				Silent	SNP	pfam_Kelch_1,smart_Kelch_1	p.E444	ENST00000395676.2	37	c.1332	CCDS14097.2	22																																																																																			KLHDC7B	-	smart_Kelch_1	ENSG00000130487		0.662	KLHDC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC7B	HGNC	protein_coding	OTTHUMT00000317089.2	35	0.00	0	G	NM_138433		50987927	50987927	+1	no_errors	ENST00000395676	ensembl	human	known	69_37n	silent	19	42.42	14	SNP	1.000	A
KLHL23	151230	genome.wustl.edu	37	2	170592537	170592537	+	Missense_Mutation	SNP	C	C	A			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr2:170592537C>A	ENST00000392647.2	+	2	1257	c.1013C>A	c.(1012-1014)aCa>aAa	p.T338K	KLHL23_ENST00000272797.4_Missense_Mutation_p.T338K|KLHL23_ENST00000602521.1_Intron	NM_144711.5	NP_653312.2	Q8NBE8	KLH23_HUMAN	kelch-like family member 23	338										breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(4)|skin(1)|urinary_tract(1)	16						GCTCTTGACACAGTGTGGATC	0.453																																						dbGAP											0													211.0	197.0	202.0					2																	170592537		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC010437	CCDS2236.1	2q31.1	2013-01-30	2013-01-30		ENSG00000213160	ENSG00000213160		"""Kelch-like"", ""BTB/POZ domain containing"""	27506	protein-coding gene	gene with protein product			"""kelch-like 23 (Drosophila)"""				Standard	NM_144711		Approved	MGC2610, FLJ37812, MGC22679	uc002ufi.2	Q8NBE8	OTTHUMG00000132213	ENST00000392647.2:c.1013C>A	2.37:g.170592537C>A	ENSP00000376419:p.Thr338Lys		Q8N9B9|Q96FT8	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.T338K	ENST00000392647.2	37	c.1013	CCDS2236.1	2	.	.	.	.	.	.	.	.	.	.	C	14.63	2.592333	0.46214	.	.	ENSG00000213160	ENST00000272797;ENST00000392647;ENST00000437875	T;T;T	0.76968	-1.06;-1.06;-1.06	5.81	5.81	0.92471	Kelch-type beta propeller (1);	0.048899	0.85682	D	0.000000	T	0.79323	0.4426	M	0.78456	2.415	0.33435	D	0.581675	B	0.11235	0.004	B	0.23275	0.045	T	0.80714	-0.1259	9	0.87932	D	0	.	14.2573	0.66060	0.0:0.9292:0.0:0.0708	.	338	Q8NBE8	KLH23_HUMAN	K	338;338;159	ENSP00000272797:T338K;ENSP00000376419:T338K;ENSP00000394732:T159K	ENSP00000272797:T338K	T	+	2	0	KLHL23	170300783	0.978000	0.34361	1.000000	0.80357	0.999000	0.98932	2.505000	0.45424	2.738000	0.93877	0.655000	0.94253	ACA	KLHL23	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000213160		0.453	KLHL23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL23	HGNC	protein_coding	OTTHUMT00000255271.2	59	0.00	0	C	NM_144711		170592537	170592537	+1	no_errors	ENST00000272797	ensembl	human	known	69_37n	missense	29	14.71	5	SNP	0.998	A
KRTAP10-11	386678	genome.wustl.edu	37	21	46067173	46067173	+	Silent	SNP	C	C	T	rs587660459		TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr21:46067173C>T	ENST00000334670.8	+	1	843	c.798C>T	c.(796-798)agC>agT	p.S266S	TSPEAR_ENST00000323084.4_Intron	NM_198692.2	NP_941965.2	P60412	KR10B_HUMAN	keratin associated protein 10-11	266	25 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				NS(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)	12						GCCAGTCCAGCTGCTGCCGCC	0.692													C|||	1	0.000199681	0.0	0.0	5008	,	,		19258	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													42.0	54.0	50.0					21																	46067173		2199	4291	6490	-	-	-	SO:0001819	synonymous_variant	0			AB076359	CCDS42962.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000243489	ENSG00000243489		"""Keratin associated proteins"""	20528	protein-coding gene	gene with protein product			"""keratin associated protein 10-11"""	KRTAP18-11			Standard	NM_198692		Approved	KRTAP18.11, KAP18.11, KAP10.11	uc002zfr.4	P60412	OTTHUMG00000057626	ENST00000334670.8:c.798C>T	21.37:g.46067173C>T			A2RRF9	Silent	SNP	NULL	p.S266	ENST00000334670.8	37	c.798	CCDS42962.1	21																																																																																			KRTAP10-11	-	NULL	ENSG00000243489		0.692	KRTAP10-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-11	HGNC	protein_coding	OTTHUMT00000128029.1	112	0.00	0	C	NM_198692		46067173	46067173	+1	no_errors	ENST00000334670	ensembl	human	known	69_37n	silent	71	37.72	43	SNP	0.997	T
LIG1	3978	genome.wustl.edu	37	19	48640923	48640923	+	Silent	SNP	C	C	A			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr19:48640923C>A	ENST00000263274.7	-	13	1529	c.1110G>T	c.(1108-1110)cgG>cgT	p.R370R	LIG1_ENST00000427526.2_Silent_p.R339R|LIG1_ENST00000536218.1_Silent_p.R302R	NM_000234.1	NP_000225.1	P18858	DNLI1_HUMAN	ligase I, DNA, ATP-dependent	370					anatomical structure morphogenesis (GO:0009653)|base-excision repair (GO:0006284)|cell division (GO:0051301)|DNA biosynthetic process (GO:0071897)|DNA ligation involved in DNA repair (GO:0051103)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|response to hydrogen peroxide (GO:0042542)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(22)|prostate(2)|skin(1)	44		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	CTGCCTCAGCCCGGACGGACT	0.692								Nucleotide excision repair (NER)																														dbGAP											0													25.0	26.0	26.0					19																	48640923		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0				CCDS12711.1, CCDS74409.1, CCDS74410.1	19q13.2-q13.3	2014-09-17				ENSG00000105486	6.5.1.1		6598	protein-coding gene	gene with protein product		126391					Standard	XM_005258934		Approved		uc002pia.1	P18858		ENST00000263274.7:c.1110G>T	19.37:g.48640923C>A			B2RAI8|Q2TB12|Q32P23	Missense_Mutation	SNP	pfam_DNA_ligase_ATP-dep_N,superfamily_DNA_ligase_ATP-dep_N	p.G362V	ENST00000263274.7	37	c.1085	CCDS12711.1	19	.	.	.	.	.	.	.	.	.	.	C	16.80	3.224224	0.58668	.	.	ENSG00000105486	ENST00000542460	T	0.13089	2.62	5.38	-2.17	0.07059	.	.	.	.	.	T	0.12646	0.0307	.	.	.	0.41665	D	0.989204	.	.	.	.	.	.	T	0.28839	-1.0031	6	0.34782	T	0.22	-15.1959	4.2303	0.10599	0.2506:0.4655:0.0:0.2839	.	.	.	.	V	362	ENSP00000445928:G362V	ENSP00000445928:G362V	G	-	2	0	LIG1	53332735	1.000000	0.71417	0.065000	0.19835	0.588000	0.36517	1.041000	0.30291	-0.403000	0.07622	-0.181000	0.13052	GGG	LIG1	-	NULL	ENSG00000105486		0.692	LIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIG1	HGNC	protein_coding	OTTHUMT00000465575.1	130	0.00	0	C	NM_000234		48640923	48640923	-1	no_errors	ENST00000542460	ensembl	human	known	69_37n	missense	147	14.04	24	SNP	0.998	A
MAGI1	9223	genome.wustl.edu	37	3	65425633	65425633	+	Missense_Mutation	SNP	C	C	A			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr3:65425633C>A	ENST00000497477.2	-	9	1190	c.1191G>T	c.(1189-1191)aaG>aaT	p.K397N	MAGI1_ENST00000470990.1_5'UTR|MAGI1_ENST00000402939.2_Missense_Mutation_p.K397N|MAGI1_ENST00000483466.1_Missense_Mutation_p.K397N|MAGI1_ENST00000330909.8_Missense_Mutation_p.K397N			Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	397					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)	p.K397K(2)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		CAAGCTGCTTCTTCCGTTTGG	0.517											OREG0015658	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											2	Substitution - coding silent(2)	lung(2)											145.0	119.0	128.0					3																	65425633		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000497477.2:c.1191G>T	3.37:g.65425633C>A	ENSP00000424369:p.Lys397Asn	1084	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Missense_Mutation	SNP	pfam_PDZ,pfam_WW_Rsp5_WWP,pfam_Guanylate_kin,superfamily_PDZ,superfamily_WW_Rsp5_WWP,smart_PDZ,smart_Guanylate_kin/L-typ_Ca_channel,smart_WW_Rsp5_WWP,pfscan_PDZ,pfscan_WW_Rsp5_WWP,pfscan_Guanylate_kin	p.K397N	ENST00000497477.2	37	c.1191		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.0|22.0	4.232251|4.232251	0.79688|0.79688	.|.	.|.	ENSG00000151276|ENSG00000151276	ENST00000402939;ENST00000330909;ENST00000422949;ENST00000463103;ENST00000483466;ENST00000497477;ENST00000472257;ENST00000479287|ENST00000460329	T;T;T;T;T;T;T|.	0.79141|.	-0.04;-1.24;-1.24;-1.24;-1.24;-1.24;2.25|.	5.86|5.86	4.99|4.99	0.66335|0.66335	.|.	0.304838|.	0.35067|.	N|.	0.003472|.	T|T	0.69486|0.69486	0.3116|0.3116	L|L	0.59436|0.59436	1.845|1.845	0.58432|0.58432	D|D	0.999999|0.999999	D;D;P;P;B|.	0.57899|.	0.981;0.981;0.835;0.929;0.317|.	P;P;P;P;B|.	0.53490|.	0.681;0.727;0.549;0.681;0.187|.	T|T	0.68277|0.68277	-0.5451|-0.5451	10|5	0.45353|.	T|.	0.12|.	-28.091|-28.091	14.7788|14.7788	0.69749|0.69749	0.0:0.9312:0.0:0.0688|0.0:0.9312:0.0:0.0688	.|.	397;397;397;397;397|.	Q96QZ7-6;Q96QZ7-4;Q96QZ7-3;Q96QZ7-2;Q96QZ7-5|.	.;.;.;.;.|.	N|I	397;397;293;272;397;397;183;147|278	ENSP00000385450:K397N;ENSP00000331157:K397N;ENSP00000418177:K272N;ENSP00000420323:K397N;ENSP00000424369:K397N;ENSP00000420796:K183N;ENSP00000418044:K147N|.	ENSP00000331157:K397N|.	K|R	-|-	3|2	2|0	MAGI1|MAGI1	65400673|65400673	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	1.445000|1.445000	0.35079|0.35079	1.490000|1.490000	0.48466|0.48466	0.650000|0.650000	0.86243|0.86243	AAG|AGA	MAGI1	-	NULL	ENSG00000151276		0.517	MAGI1-007	NOVEL	basic|exp_conf	protein_coding	MAGI1	HGNC	protein_coding	OTTHUMT00000349132.2	58	0.00	0	C	NM_004742		65425633	65425633	-1	no_errors	ENST00000402939	ensembl	human	known	69_37n	missense	20	44.44	16	SNP	1.000	A
COPZ2	51226	genome.wustl.edu	37	17	46114548	46114548	+	Intron	SNP	T	T	C			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr17:46114548T>C	ENST00000584666.1	-	2	112				MIR152_ENST00000385212.1_RNA|COPZ2_ENST00000006101.4_Intron			Q9P299	COPZ2_HUMAN	coatomer protein complex, subunit zeta 2						intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	cis-Golgi network (GO:0005801)|COPI vesicle coat (GO:0030126)				lung(3)|upper_aerodigestive_tract(1)	4						GCCCAAGTTCTGTCATGCACT	0.652											OREG0024511	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													36.0	34.0	34.0					17																	46114548		1567	3582	5149	-	-	-	SO:0001627	intron_variant	0			AB037938	CCDS74092.1	17q21.2	2008-07-18				ENSG00000005243			19356	protein-coding gene	gene with protein product	"""nonclathrin coat protein zeta-COP"", ""zeta2-COP"", ""zeta-2 coat protein"""	615526				11056392	Standard	NM_016429		Approved	MGC23008	uc002imy.3	Q9P299		ENST00000584666.1:c.780-257A>G	17.37:g.46114548T>C		936		RNA	SNP	-	NULL	ENST00000584666.1	37	NULL		17																																																																																			MIR152	-	-	ENSG00000207947		0.652	COPZ2-001	KNOWN	basic	processed_transcript	MIR152	HGNC	protein_coding	OTTHUMT00000442953.1	90	0.00	0	T	NM_016429		46114548	46114548	-1	no_errors	ENST00000385212	ensembl	human	known	69_37n	rna	14	71.43	35	SNP	1.000	C
MMP15	4324	genome.wustl.edu	37	16	58076179	58076179	+	Missense_Mutation	SNP	C	C	G			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr16:58076179C>G	ENST00000219271.3	+	7	1994	c.1209C>G	c.(1207-1209)aaC>aaG	p.N403K		NM_002428.2	NP_002419.1	P51511	MMP15_HUMAN	matrix metallopeptidase 15 (membrane-inserted)	403					cellular protein modification process (GO:0006464)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)|response to estradiol (GO:0032355)	extracellular matrix (GO:0031012)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	18					Marimastat(DB00786)	TCCTGGACAACTATCCCATGC	0.632																																						dbGAP											0													84.0	76.0	78.0					16																	58076179		2198	4300	6498	-	-	-	SO:0001583	missense	0			Z48482	CCDS10792.1	16q13	2008-05-14	2005-08-08		ENSG00000102996	ENSG00000102996			7161	protein-coding gene	gene with protein product		602261	"""matrix metalloproteinase 15 (membrane-inserted)"""			9070935, 9119382	Standard	NM_002428		Approved	MT2-MMP, MTMMP2, SMCP-2	uc002ena.3	P51511	OTTHUMG00000133466	ENST00000219271.3:c.1209C>G	16.37:g.58076179C>G	ENSP00000219271:p.Asn403Lys		A0A2U6|Q14111	Missense_Mutation	SNP	pirsf_Pept_M10A_matrix_strom,pfam_Hemopexin/matrixin_repeat,pfam_Pept_M10_metallopeptidase,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,prints_Pept_M10A_matrixin	p.N403K	ENST00000219271.3	37	c.1209	CCDS10792.1	16	.	.	.	.	.	.	.	.	.	.	C	28.5	4.923851	0.92319	.	.	ENSG00000102996	ENST00000219271	T	0.02446	4.29	5.34	4.35	0.52113	Hemopexin/matrixin (2);	0.195954	0.52532	N	0.000063	T	0.08846	0.0219	L	0.52126	1.63	0.80722	D	1	P	0.51057	0.941	P	0.59357	0.856	T	0.27773	-1.0064	10	0.32370	T	0.25	.	14.4441	0.67338	0.1477:0.8523:0.0:0.0	.	403	P51511	MMP15_HUMAN	K	403	ENSP00000219271:N403K	ENSP00000219271:N403K	N	+	3	2	MMP15	56633680	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.236000	0.32683	2.484000	0.83849	0.491000	0.48974	AAC	MMP15	-	pirsf_Pept_M10A_matrix_strom,pfam_Hemopexin/matrixin_repeat,superfamily_Hemopexin/matrixin,smart_Hemopexin/matrixin_repeat	ENSG00000102996		0.632	MMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP15	HGNC	protein_coding	OTTHUMT00000257342.1	77	0.00	0	C	NM_002428		58076179	58076179	+1	no_errors	ENST00000219271	ensembl	human	known	69_37n	missense	26	43.48	20	SNP	1.000	G
MYRIP	25924	genome.wustl.edu	37	3	40204291	40204291	+	Missense_Mutation	SNP	G	G	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr3:40204291G>T	ENST00000302541.6	+	5	882	c.540G>T	c.(538-540)agG>agT	p.R180S	MYRIP_ENST00000444716.1_Missense_Mutation_p.R180S|MYRIP_ENST00000459828.1_3'UTR|MYRIP_ENST00000425621.1_Missense_Mutation_p.R180S|MYRIP_ENST00000396217.3_Missense_Mutation_p.R91S|MYRIP_ENST00000539167.1_5'UTR	NM_001284423.1|NM_001284426.1|NM_015460.2	NP_001271352.1|NP_001271355.1|NP_056275.2	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein	180	Myosin-binding.				intracellular protein transport (GO:0006886)|positive regulation of insulin secretion (GO:0032024)	actin cytoskeleton (GO:0015629)|dense core granule (GO:0031045)|exocyst (GO:0000145)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(2)|lung(10)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		CATTTTATAGGCAGTCAGAAG	0.468																																						dbGAP											0													126.0	124.0	125.0					3																	40204291		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF396687	CCDS2689.1, CCDS68390.1, CCDS68391.1, CCDS68392.1	3p21.33	2010-08-20			ENSG00000170011	ENSG00000170011		"""A-kinase anchor proteins"""	19156	protein-coding gene	gene with protein product	"""synaptotagmin-like protein homologue lacking C2 domains-c"", ""rab effector MYRIP"", ""Slp homologue lacking C2 domains"""	611790				11964381, 12221080	Standard	NM_001284425		Approved	DKFZp586F1018, exophilin-8, MyRIP, SLAC2-C, SLAC2C	uc003cka.3	Q8NFW9	OTTHUMG00000131392	ENST00000302541.6:c.540G>T	3.37:g.40204291G>T	ENSP00000301972:p.Arg180Ser		B3KWM3|B3KWW4|B7Z2H1|B7Z9V3|G3XAI8|Q32M41|Q32M42|Q569F7|Q8IUF5|Q9Y3V4	Missense_Mutation	SNP	pfam_Myelin-assoc_OBP,superfamily_Znf_FYVE_PHD,pfscan_Rab-bd_domain	p.R180S	ENST00000302541.6	37	c.540	CCDS2689.1	3	.	.	.	.	.	.	.	.	.	.	G	16.12	3.032000	0.54790	.	.	ENSG00000170011	ENST00000444716;ENST00000302541;ENST00000425621;ENST00000396217	T;T;T;T	0.38401	1.14;1.14;1.14;1.14	5.25	1.96	0.26148	Myelin-associated oligodendrocytic basic protein (MOBP) (1);	0.055494	0.64402	D	0.000001	T	0.48187	0.1486	L	0.55481	1.735	0.80722	D	1	D;D;D;D	0.89917	0.993;1.0;0.991;0.997	D;D;P;D	0.77004	0.909;0.989;0.852;0.932	T	0.28427	-1.0044	9	.	.	.	.	7.5216	0.27631	0.4388:0.0:0.5612:0.0	.	180;91;180;180	B3KWW4;Q32M42;G3XAI8;Q8NFW9	.;.;.;MYRIP_HUMAN	S	180;180;180;91	ENSP00000398665:R180S;ENSP00000301972:R180S;ENSP00000389323:R180S;ENSP00000379519:R91S	.	R	+	3	2	MYRIP	40179295	1.000000	0.71417	0.979000	0.43373	0.886000	0.51366	1.171000	0.31896	0.120000	0.18254	-1.131000	0.01979	AGG	MYRIP	-	pfam_Myelin-assoc_OBP	ENSG00000170011		0.468	MYRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYRIP	HGNC	protein_coding	OTTHUMT00000254181.2	51	0.00	0	G	NM_015460		40204291	40204291	+1	no_errors	ENST00000302541	ensembl	human	known	69_37n	missense	20	50.00	20	SNP	0.999	T
NFATC1	4772	genome.wustl.edu	37	18	77193711	77193711	+	Silent	SNP	G	G	A	rs202207373		TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr18:77193711G>A	ENST00000427363.2	+	3	1359	c.1359G>A	c.(1357-1359)gcG>gcA	p.A453A	NFATC1_ENST00000318065.5_Silent_p.A440A|NFATC1_ENST00000586434.1_Silent_p.A440A|NFATC1_ENST00000592223.1_Silent_p.A440A|NFATC1_ENST00000397790.2_5'UTR|NFATC1_ENST00000587635.1_Silent_p.A453A|NFATC1_ENST00000542384.1_Silent_p.A453A|NFATC1_ENST00000591814.1_Silent_p.A453A|NFATC1_ENST00000329101.4_Silent_p.A440A|NFATC1_ENST00000545796.1_5'UTR|NFATC1_ENST00000253506.5_Silent_p.A453A			O95644	NFAC1_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1	453	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				calcium ion transport (GO:0006816)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	FK506 binding (GO:0005528)|mitogen-activated protein kinase p38 binding (GO:0048273)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(1)|soft_tissue(1)	40		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;3.73e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0257)	Pseudoephedrine(DB00852)	CCGTGAAGGCGTCGGCCGGAG	0.627																																					GBM(151;1210 2593 28719 45011)	dbGAP											0													52.0	54.0	53.0					18																	77193711		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			U08015	CCDS12015.1, CCDS12016.1, CCDS32850.1, CCDS59326.1, CCDS59327.1, CCDS62467.1, CCDS62468.1, CCDS62469.1, CCDS62470.1, CCDS62471.1	18q23	2009-11-24			ENSG00000131196	ENSG00000131196		"""Nuclear factor of activated T-cells"""	7775	protein-coding gene	gene with protein product		600489				8202141	Standard	NM_001278669		Approved	NF-ATC, NFATc, NFAT2	uc002lnf.3	O95644	OTTHUMG00000132897	ENST00000427363.2:c.1359G>A	18.37:g.77193711G>A			B5B2M4|B5B2M5|B5B2M6|B5B2M7|B5B2M8|B5B2M9|B5B2N1|Q12865|Q15793|Q2M1S3	Silent	SNP	pfam_RHD,pfam_IPT_TIG_rcpt,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT_TIG_rcpt,prints_NFAT,pfscan_RHD	p.A453	ENST00000427363.2	37	c.1359		18																																																																																			NFATC1	-	pfam_RHD,superfamily_p53-like_TF_DNA-bd,prints_NFAT,pfscan_RHD	ENSG00000131196		0.627	NFATC1-007	KNOWN	basic	protein_coding	NFATC1	HGNC	protein_coding	OTTHUMT00000450507.1	84	0.00	0	G	NM_172390		77193711	77193711	+1	no_errors	ENST00000427363	ensembl	human	known	69_37n	silent	38	15.56	7	SNP	0.027	A
NWD1	284434	genome.wustl.edu	37	19	16860392	16860392	+	Nonsense_Mutation	SNP	C	C	A	rs706763	byFrequency	TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr19:16860392C>A	ENST00000552788.1	+	4	939	c.939C>A	c.(937-939)tgC>tgA	p.C313*	NWD1_ENST00000379808.3_Nonsense_Mutation_p.C313*|NWD1_ENST00000524140.2_Nonsense_Mutation_p.C313*|NWD1_ENST00000549814.1_Nonsense_Mutation_p.C313*|NWD1_ENST00000523826.1_Nonsense_Mutation_p.C107*|NWD1_ENST00000339803.6_Nonsense_Mutation_p.C178*			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	313							ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						AGACCTTCTGCGGACGCCAGG	0.632																																						dbGAP											0													39.0	42.0	41.0					19																	16860392		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.939C>A	19.37:g.16860392C>A	ENSP00000447224:p.Cys313*		C9J021|Q68CT3	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.C313*	ENST00000552788.1	37	c.939		19	.	.	.	.	.	.	.	.	.	.	c	12.20	1.867461	0.32977	.	.	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000523826;ENST00000552788;ENST00000339803	.	.	.	4.36	-8.15	0.01065	.	0.389746	0.28766	N	0.014209	.	.	.	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-8.3195	14.232	0.65898	0.0:0.1565:0.0:0.8435	.	.	.	.	X	178;313;313;313;107;313;178	.	ENSP00000340159:C178X	C	+	3	2	NWD1	16721392	0.001000	0.12720	0.579000	0.28588	0.028000	0.11728	-2.786000	0.00770	-1.500000	0.01819	-0.761000	0.03458	TGC	NWD1	-	NULL	ENSG00000188039		0.632	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	NWD1	HGNC	protein_coding	OTTHUMT00000403569.1	28	0.00	0	C	NM_001007525		16860392	16860392	+1	no_errors	ENST00000379808	ensembl	human	known	69_37n	nonsense	7	53.33	8	SNP	0.245	A
NWD1	284434	genome.wustl.edu	37	19	16861091	16861091	+	Missense_Mutation	SNP	G	G	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr19:16861091G>T	ENST00000552788.1	+	4	1638	c.1638G>T	c.(1636-1638)tgG>tgT	p.W546C	NWD1_ENST00000379808.3_Missense_Mutation_p.W546C|NWD1_ENST00000524140.2_Missense_Mutation_p.W546C|NWD1_ENST00000549814.1_Missense_Mutation_p.W546C|NWD1_ENST00000523826.1_Missense_Mutation_p.W340C|NWD1_ENST00000339803.6_Missense_Mutation_p.W411C			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	546	NACHT.						ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CCCGGAAATGGGCCTCTTTCA	0.667																																						dbGAP											0													26.0	28.0	27.0					19																	16861091		2203	4299	6502	-	-	-	SO:0001583	missense	0			BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.1638G>T	19.37:g.16861091G>T	ENSP00000447224:p.Trp546Cys		C9J021|Q68CT3	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.W546C	ENST00000552788.1	37	c.1638		19	.	.	.	.	.	.	.	.	.	.	G	14.17	2.456938	0.43634	.	.	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000523826;ENST00000552788;ENST00000339803	T;T;T;T;T;T	0.66460	-0.21;-0.14;-0.21;-0.2;-0.17;-0.18	5.04	5.04	0.67666	.	0.129699	0.56097	D	0.000031	D	0.84727	0.5536	M	0.90309	3.105	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.997	D	0.87748	0.2590	10	0.62326	D	0.03	-22.5946	15.8447	0.78879	0.0:0.0:1.0:0.0	.	546;546;411	Q149M9;Q149M9-3;C9J2Y8	NWD1_HUMAN;.;.	C	411;546;546;546;340;546;411	ENSP00000428579:W546C;ENSP00000447548:W546C;ENSP00000369136:W546C;ENSP00000428955:W340C;ENSP00000447224:W546C;ENSP00000340159:W411C	ENSP00000340159:W411C	W	+	3	0	NWD1	16722091	1.000000	0.71417	1.000000	0.80357	0.038000	0.13279	7.606000	0.82863	2.339000	0.79563	0.549000	0.68633	TGG	NWD1	-	NULL	ENSG00000188039		0.667	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	NWD1	HGNC	protein_coding	OTTHUMT00000403569.1	40	0.00	0	G	NM_001007525		16861091	16861091	+1	no_errors	ENST00000379808	ensembl	human	known	69_37n	missense	12	36.84	7	SNP	1.000	T
NPAS1	4861	genome.wustl.edu	37	19	47544277	47544277	+	Missense_Mutation	SNP	C	C	G			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr19:47544277C>G	ENST00000602212.1	+	10	1331	c.1111C>G	c.(1111-1113)Ctg>Gtg	p.L371V	NPAS1_ENST00000439365.2_Intron|NPAS1_ENST00000449844.2_Missense_Mutation_p.L371V|NPAS1_ENST00000602189.1_Missense_Mutation_p.L196V			Q99742	NPAS1_HUMAN	neuronal PAS domain protein 1	371	PAC.				central nervous system development (GO:0007417)|maternal behavior (GO:0042711)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)	6		all_cancers(25;4.31e-08)|all_epithelial(76;2.96e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.102)		all cancers(93;6.02e-05)|OV - Ovarian serous cystadenocarcinoma(262;7.35e-05)|Epithelial(262;0.00389)|GBM - Glioblastoma multiforme(486;0.0252)		CTACCGTTGGCTGCAGCGTGC	0.657																																						dbGAP											0													44.0	39.0	41.0					19																	47544277		2200	4296	6496	-	-	-	SO:0001583	missense	0			U77968	CCDS12694.1	19q13.2-q13.3	2013-05-21				ENSG00000130751		"""Basic helix-loop-helix proteins"""	7894	protein-coding gene	gene with protein product	"""neuronal PAS1"", ""member of PAS superfamily 5"""	603346				9012850, 9079689	Standard	NM_002517		Approved	MOP5, PASD5, bHLHe11	uc002pfy.3	Q99742		ENST00000602212.1:c.1111C>G	19.37:g.47544277C>G	ENSP00000469142:p.Leu371Val		B4DR69|Q99632|Q9BY83	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_PAS_fold,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,pfscan_PAS,pfscan_HLH_DNA-bd	p.L371V	ENST00000602212.1	37	c.1111	CCDS12694.1	19	.	.	.	.	.	.	.	.	.	.	C	15.42	2.829172	0.50845	.	.	ENSG00000130751	ENST00000449844	T	0.20069	2.1	5.47	4.42	0.53409	PAS fold-3 (1);	0.000000	0.64402	D	0.000012	T	0.48943	0.1528	M	0.88640	2.97	0.80722	D	1	D	0.65815	0.995	D	0.65323	0.934	T	0.57510	-0.7799	10	0.87932	D	0	.	11.5895	0.50938	0.1785:0.8215:0.0:0.0	.	371	Q99742	NPAS1_HUMAN	V	371	ENSP00000405290:L371V	ENSP00000405290:L371V	L	+	1	2	NPAS1	52236117	1.000000	0.71417	1.000000	0.80357	0.024000	0.10985	5.206000	0.65192	1.301000	0.44836	-0.181000	0.13052	CTG	NPAS1	-	pfam_PAS_fold_3	ENSG00000130751		0.657	NPAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAS1	HGNC	protein_coding	OTTHUMT00000466658.1	146	0.00	0	C	NM_002517		47544277	47544277	+1	no_errors	ENST00000449844	ensembl	human	known	69_37n	missense	79	44.37	63	SNP	1.000	G
NLRP5	126206	genome.wustl.edu	37	19	56515220	56515220	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr19:56515220G>A	ENST00000390649.3	+	2	201	c.201G>A	c.(199-201)tgG>tgA	p.W67*		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	67	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GGCTGCAATGGTGTCTCTATG	0.423																																						dbGAP											0													112.0	105.0	107.0					19																	56515220		1874	4114	5988	-	-	-	SO:0001587	stop_gained	0			AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.201G>A	19.37:g.56515220G>A	ENSP00000375063:p.Trp67*		A8MTY4|Q86W29	Nonsense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.W67*	ENST00000390649.3	37	c.201	CCDS12938.1	19	.	.	.	.	.	.	.	.	.	.	G	16.08	3.021634	0.54576	.	.	ENSG00000171487	ENST00000390649	.	.	.	3.15	3.15	0.36227	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	10.1034	0.42519	0.0:0.0:1.0:0.0	.	.	.	.	X	67	.	ENSP00000375063:W67X	W	+	3	0	NLRP5	61207032	0.737000	0.28175	0.119000	0.21687	0.010000	0.07245	2.247000	0.43151	2.080000	0.62538	0.558000	0.71614	TGG	NLRP5	-	pfam_DAPIN,superfamily_DEATH-like	ENSG00000171487		0.423	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP5	HGNC	protein_coding	OTTHUMT00000313735.1	41	0.00	0	G	NM_153447		56515220	56515220	+1	no_errors	ENST00000390649	ensembl	human	known	69_37n	nonsense	29	12.12	4	SNP	0.145	A
PLD4	122618	genome.wustl.edu	37	14	105395685	105395685	+	Missense_Mutation	SNP	G	G	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr14:105395685G>T	ENST00000392593.4	+	5	678	c.510G>T	c.(508-510)agG>agT	p.R170S	PLD4_ENST00000553861.1_5'Flank|PLD4_ENST00000540372.1_Missense_Mutation_p.R177S	NM_138790.2	NP_620145.2	Q96BZ4	PLD4_HUMAN	phospholipase D family, member 4	170					glycerophospholipid biosynthetic process (GO:0046474)|hematopoietic progenitor cell differentiation (GO:0002244)|inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phagocytosis (GO:0006909)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|trans-Golgi network membrane (GO:0032588)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase D activity (GO:0004630)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	13		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.00067)|OV - Ovarian serous cystadenocarcinoma(23;0.00976)|Epithelial(46;0.0201)|GBM - Glioblastoma multiforme(11;0.116)			TGCTGGGCAGGAACATTTCCC	0.652																																						dbGAP											0													14.0	18.0	16.0					14																	105395685		2007	4151	6158	-	-	-	SO:0001583	missense	0				CCDS9995.2	14q32.33	2014-01-28	2005-05-20	2005-05-20	ENSG00000166428	ENSG00000166428			23792	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 175"""	C14orf175			Standard	XM_006720024		Approved		uc001ypu.1	Q96BZ4	OTTHUMG00000144167	ENST00000392593.4:c.510G>T	14.37:g.105395685G>T	ENSP00000376372:p.Arg170Ser		Q6UWD2	Missense_Mutation	SNP	pfam_PLipase_D/transphosphatidylase,smart_PLipase_D/transphosphatidylase,pfscan_PLipase_D/transphosphatidylase	p.R170S	ENST00000392593.4	37	c.510	CCDS9995.2	14	.	.	.	.	.	.	.	.	.	.	G	14.33	2.503348	0.44558	.	.	ENSG00000166428	ENST00000540372;ENST00000392593;ENST00000557573	T;T;T	0.20881	2.04;2.04;2.04	4.16	1.27	0.21489	.	0.184647	0.45867	D	0.000322	T	0.19644	0.0472	L	0.33668	1.02	0.58432	D	0.999999	B;B	0.32396	0.369;0.253	B;B	0.43225	0.412;0.196	T	0.06075	-1.0847	10	0.59425	D	0.04	7.5232	6.9498	0.24538	0.2636:0.0:0.7364:0.0	.	177;170	F5H2B5;Q96BZ4	.;PLD4_HUMAN	S	177;170;168	ENSP00000438677:R177S;ENSP00000376372:R170S;ENSP00000451278:R168S	ENSP00000376372:R170S	R	+	3	2	PLD4	104466730	0.065000	0.20965	0.010000	0.14722	0.926000	0.56050	0.245000	0.18142	-0.048000	0.13401	0.479000	0.44913	AGG	PLD4	-	NULL	ENSG00000166428		0.652	PLD4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLD4	HGNC	protein_coding	OTTHUMT00000291348.2	88	0.00	0	G	NM_138790		105395685	105395685	+1	no_errors	ENST00000392593	ensembl	human	known	69_37n	missense	26	54.24	32	SNP	0.782	T
POMP	51371	genome.wustl.edu	37	13	29252266	29252266	+	3'UTR	SNP	G	G	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr13:29252266G>T	ENST00000380842.4	+	0	534				POMP_ENST00000460403.1_3'UTR	NM_015932.5	NP_057016.1	Q9Y244	POMP_HUMAN	proteasome maturation protein						proteasome assembly (GO:0043248)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)|proteasome complex (GO:0000502)				endometrium(2)|kidney(1)|large_intestine(1)	4		Lung SC(185;0.0367)		all cancers(112;0.141)|OV - Ovarian serous cystadenocarcinoma(117;0.216)		GAAACCGAGGGCTGCATCTTG	0.388																																						dbGAP											0													193.0	173.0	180.0					13																	29252266		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			AF077200	CCDS9331.1	13q12.13	2013-11-11	2006-07-04	2006-07-04	ENSG00000132963	ENSG00000132963			20330	protein-coding gene	gene with protein product	"""proteassemblin"""	613386	"""chromosome 13 open reading frame 12"""	C13orf12		11042152	Standard	NM_015932		Approved	HSPC014, UMP1	uc001usf.3	Q9Y244	OTTHUMG00000016652	ENST00000380842.4:c.*27G>T	13.37:g.29252266G>T			A5HKJ2|D6MXU3|Q9HB69	RNA	SNP	-	NULL	ENST00000380842.4	37	NULL	CCDS9331.1	13																																																																																			POMP	-	-	ENSG00000132963		0.388	POMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMP	HGNC	protein_coding	OTTHUMT00000044327.1	52	0.00	0	G	NM_015932		29252266	29252266	+1	no_errors	ENST00000460403	ensembl	human	known	69_37n	rna	27	12.90	4	SNP	0.005	T
PON1	5444	genome.wustl.edu	37	7	94931605	94931605	+	Missense_Mutation	SNP	T	T	A			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr7:94931605T>A	ENST00000222381.3	-	8	1052	c.821A>T	c.(820-822)gAt>gTt	p.D274V	PON1_ENST00000542556.1_Missense_Mutation_p.D274V	NM_000446.5	NP_000437.3	P27169	PON1_HUMAN	paraoxonase 1	274					aromatic compound catabolic process (GO:0019439)|carboxylic acid catabolic process (GO:0046395)|dephosphorylation (GO:0016311)|organophosphate catabolic process (GO:0046434)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of binding (GO:0051099)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of transporter activity (GO:0032411)|response to external stimulus (GO:0009605)|response to toxic substance (GO:0009636)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|intracellular membrane-bounded organelle (GO:0043231)|spherical high-density lipoprotein particle (GO:0034366)	aryldialkylphosphatase activity (GO:0004063)|arylesterase activity (GO:0004064)|calcium ion binding (GO:0005509)|phospholipid binding (GO:0005543)|protein homodimerization activity (GO:0042803)			autonomic_ganglia(1)|endometrium(2)|large_intestine(6)|lung(11)|pancreas(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	27	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0031)		Cefazolin(DB01327)	TGTCTCAGGATCCACAGATAT	0.383																																					GBM(119;715 1622 17358 22490 33240)	dbGAP											0													80.0	80.0	80.0					7																	94931605		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF539592	CCDS5638.1	7q21.3	2014-03-14			ENSG00000005421	ENSG00000005421	3.1.1.2	"""Paraoxonases"""	9204	protein-coding gene	gene with protein product	"""esterase A"", ""arylesterase 1"""	168820		PON		8661009, 15450851	Standard	NM_000446		Approved	ESA	uc003uns.3	P27169	OTTHUMG00000153894	ENST00000222381.3:c.821A>T	7.37:g.94931605T>A	ENSP00000222381:p.Asp274Val		B2RA40|Q16052|Q6B0J6|Q9UCB1	Missense_Mutation	SNP	pfam_Arylesterase,pfam_SGL,pfam_Strictosidine_synth_cons-reg,prints_Arylesterase,prints_Paraoxonase1	p.D274V	ENST00000222381.3	37	c.821	CCDS5638.1	7	.	.	.	.	.	.	.	.	.	.	T	19.77	3.888945	0.72524	.	.	ENSG00000005421	ENST00000222381;ENST00000542556	T;T	0.59083	0.29;0.29	4.67	4.67	0.58626	Six-bladed beta-propeller, TolB-like (1);	0.044644	0.85682	D	0.000000	T	0.81108	0.4754	M	0.92367	3.3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.993	D	0.86122	0.1569	10	0.87932	D	0	-32.2036	15.1814	0.72962	0.0:0.0:0.0:1.0	.	274;274	F5H4W9;P27169	.;PON1_HUMAN	V	274	ENSP00000222381:D274V;ENSP00000444854:D274V	ENSP00000222381:D274V	D	-	2	0	PON1	94769541	1.000000	0.71417	0.999000	0.59377	0.702000	0.40608	6.735000	0.74806	2.322000	0.78497	0.528000	0.53228	GAT	PON1	-	pfam_SGL,prints_Arylesterase	ENSG00000005421		0.383	PON1-001	KNOWN	basic|CCDS	protein_coding	PON1	HGNC	protein_coding	OTTHUMT00000332865.2	30	0.00	0	T	NM_000446		94931605	94931605	-1	no_errors	ENST00000222381	ensembl	human	known	69_37n	missense	22	18.52	5	SNP	1.000	A
PPP2R5A	5525	genome.wustl.edu	37	1	212515539	212515539	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr1:212515539G>T	ENST00000261461.2	+	4	1064	c.490G>T	c.(490-492)Gaa>Taa	p.E164*	PPP2R5A_ENST00000537030.3_Nonsense_Mutation_p.E107*|PPP2R5A_ENST00000498129.2_3'UTR	NM_006243.3	NP_006234.1	Q15172	2A5A_HUMAN	protein phosphatase 2, regulatory subunit B', alpha	164					negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of lipid kinase activity (GO:0090219)|positive regulation of protein dephosphorylation (GO:0035307)|signal transduction (GO:0007165)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|M band (GO:0031430)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)|Z disc (GO:0030018)	kinase binding (GO:0019900)|protein phosphatase type 2A regulator activity (GO:0008601)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)	16				OV - Ovarian serous cystadenocarcinoma(81;0.0125)|all cancers(67;0.029)|Epithelial(68;0.154)|GBM - Glioblastoma multiforme(131;0.155)		GTTGGTATATGAATTCTTCTT	0.343																																						dbGAP											0													124.0	119.0	121.0					1																	212515539		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC022474	CCDS1503.1, CCDS55686.1	1q32.2-q32.3	2010-06-18	2010-04-14		ENSG00000066027	ENSG00000066027		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9309	protein-coding gene	gene with protein product		601643	"""protein phosphatase 2, regulatory subunit B (B56), alpha isoform"", ""protein phosphatase 2, regulatory subunit B', alpha isoform"""			7592815	Standard	NM_006243		Approved	PR61A, B56A	uc001hjb.3	Q15172	OTTHUMG00000036750	ENST00000261461.2:c.490G>T	1.37:g.212515539G>T	ENSP00000261461:p.Glu164*		B2R6D2|B7Z7L2|D3DT99|Q2NL72|Q5VVB2|Q8TBI9	Nonsense_Mutation	SNP	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	p.E164*	ENST00000261461.2	37	c.490	CCDS1503.1	1	.	.	.	.	.	.	.	.	.	.	G	39	7.761639	0.98474	.	.	ENSG00000066027	ENST00000542178;ENST00000261461;ENST00000537030	.	.	.	5.86	5.86	0.93980	.	0.043125	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-13.2512	20.1837	0.98210	0.0:0.0:1.0:0.0	.	.	.	.	X	164;164;107	.	ENSP00000261461:E164X	E	+	1	0	PPP2R5A	210582162	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.578000	0.98200	2.774000	0.95407	0.650000	0.86243	GAA	PPP2R5A	-	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	ENSG00000066027		0.343	PPP2R5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R5A	HGNC	protein_coding	OTTHUMT00000089302.1	54	0.00	0	G	NM_006243		212515539	212515539	+1	no_errors	ENST00000261461	ensembl	human	known	69_37n	nonsense	15	37.50	9	SNP	1.000	T
PSMC4	5704	genome.wustl.edu	37	19	40485743	40485743	+	Silent	SNP	G	G	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr19:40485743G>T	ENST00000157812.2	+	7	891	c.693G>T	c.(691-693)gtG>gtT	p.V231V	PSMC4_ENST00000455878.2_Silent_p.V200V	NM_006503.3|NM_153001.2	NP_006494.1|NP_694546.1	P43686	PRS6B_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 4	231					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|blastocyst development (GO:0001824)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|inclusion body (GO:0016234)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					TCCGGGTCGTGGGCTCGGAGT	0.552																																					Colon(105;1478 1543 4034 6132 38638)	dbGAP											0													99.0	105.0	103.0					19																	40485743		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U27515	CCDS12547.1, CCDS46076.1	19q13.11-q13.13	2010-04-21			ENSG00000013275	ENSG00000013275		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9551	protein-coding gene	gene with protein product	"""protease 26S subunit 6"", ""Tat-binding protein 7"", ""MB67 interacting protein"""	602707		MIP224		9473509, 8603043	Standard	NM_006503		Approved	TBP7, S6, MGC8570, MGC13687, MGC23214, TBP-7	uc002omq.4	P43686		ENST00000157812.2:c.693G>T	19.37:g.40485743G>T			Q96FV5|Q9UBM3|Q9UEX3	Silent	SNP	pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-2,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_AAA+_ATPase,tigrfam_26S_Psome_P45	p.V231	ENST00000157812.2	37	c.693	CCDS12547.1	19																																																																																			PSMC4	-	pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-2,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_AAA+_ATPase,tigrfam_26S_Psome_P45	ENSG00000013275		0.552	PSMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMC4	HGNC	protein_coding	OTTHUMT00000462485.1	38	0.00	0	G	NM_006503		40485743	40485743	+1	no_errors	ENST00000157812	ensembl	human	known	69_37n	silent	44	20.00	11	SNP	1.000	T
PSMC4	5704	genome.wustl.edu	37	19	40486244	40486244	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr19:40486244C>T	ENST00000157812.2	+	9	1168	c.970C>T	c.(970-972)Cca>Tca	p.P324S	PSMC4_ENST00000455878.2_Missense_Mutation_p.P293S	NM_006503.3|NM_153001.2	NP_006494.1|NP_694546.1	P43686	PRS6B_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 4	324					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|blastocyst development (GO:0001824)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|inclusion body (GO:0016234)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					CCTGCTACGGCCAGGACGGCT	0.537																																					Colon(105;1478 1543 4034 6132 38638)	dbGAP											0													122.0	126.0	125.0					19																	40486244		2203	4300	6503	-	-	-	SO:0001583	missense	0			U27515	CCDS12547.1, CCDS46076.1	19q13.11-q13.13	2010-04-21			ENSG00000013275	ENSG00000013275		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9551	protein-coding gene	gene with protein product	"""protease 26S subunit 6"", ""Tat-binding protein 7"", ""MB67 interacting protein"""	602707		MIP224		9473509, 8603043	Standard	NM_006503		Approved	TBP7, S6, MGC8570, MGC13687, MGC23214, TBP-7	uc002omq.4	P43686		ENST00000157812.2:c.970C>T	19.37:g.40486244C>T	ENSP00000157812:p.Pro324Ser		Q96FV5|Q9UBM3|Q9UEX3	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-2,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_AAA+_ATPase,tigrfam_26S_Psome_P45	p.P324S	ENST00000157812.2	37	c.970	CCDS12547.1	19	.	.	.	.	.	.	.	.	.	.	c	15.80	2.938989	0.52972	.	.	ENSG00000013275	ENST00000157812;ENST00000455878	D;D	0.95588	-3.75;-3.75	5.69	5.69	0.88448	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.96756	0.8941	L	0.48260	1.515	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.984;1.0	D	0.97232	0.9885	10	0.87932	D	0	-31.1918	17.2983	0.87175	0.0:1.0:0.0:0.0	.	293;324	P43686-2;P43686	.;PRS6B_HUMAN	S	324;293	ENSP00000157812:P324S;ENSP00000413869:P293S	ENSP00000157812:P324S	P	+	1	0	PSMC4	45178084	1.000000	0.71417	1.000000	0.80357	0.027000	0.11550	3.924000	0.56476	2.676000	0.91093	0.655000	0.94253	CCA	PSMC4	-	pfam_ATPase_AAA_core,smart_AAA+_ATPase,tigrfam_26S_Psome_P45	ENSG00000013275		0.537	PSMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMC4	HGNC	protein_coding	OTTHUMT00000462485.1	22	0.00	0	C	NM_006503		40486244	40486244	+1	no_errors	ENST00000157812	ensembl	human	known	69_37n	missense	19	38.71	12	SNP	1.000	T
PSME4	23198	genome.wustl.edu	37	2	54092150	54092150	+	3'UTR	SNP	C	C	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr2:54092150C>T	ENST00000404125.1	-	0	6152				PSME4_ENST00000476586.1_5'UTR|PSME4_ENST00000421748.2_3'UTR	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			ACACAGACTTCACTTCTGTGT	0.468																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.*565G>A	2.37:g.54092150C>T			Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	RNA	SNP	-	NULL	ENST00000404125.1	37	NULL	CCDS33197.2	2																																																																																			PSME4	-	-	ENSG00000068878		0.468	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSME4	HGNC	protein_coding	OTTHUMT00000324163.1	43	0.00	0	C	XM_040158		54092150	54092150	-1	no_errors	ENST00000476586	ensembl	human	known	69_37n	rna	14	33.33	7	SNP	0.022	T
PTEN	5728	genome.wustl.edu	37	10	89692893	89692893	+	Missense_Mutation	SNP	C	C	G			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr10:89692893C>G	ENST00000371953.3	+	5	1734	c.377C>G	c.(376-378)gCt>gGt	p.A126G		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	126	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.?(5)|p.R55fs*1(5)|p.A126D(3)|p.A126V(2)|p.Y27fs*1(2)|p.A121_F145del(1)|p.F56fs*2(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CACTGTAAAGCTGGAAAGGGA	0.408		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																												dbGAP	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	56	Whole gene deletion(37)|Deletion - Frameshift(8)|Substitution - Missense(5)|Unknown(5)|Deletion - In frame(1)	prostate(16)|central_nervous_system(11)|skin(6)|lung(5)|breast(5)|haematopoietic_and_lymphoid_tissue(4)|ovary(4)|endometrium(3)|soft_tissue(1)|urinary_tract(1)											141.0	130.0	133.0					10																	89692893		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.377C>G	10.37:g.89692893C>G	ENSP00000361021:p.Ala126Gly		B2R904|F2YHV0|O00633|O02679|Q6ICT7	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.A126G	ENST00000371953.3	37	c.377	CCDS31238.1	10	.	.	.	.	.	.	.	.	.	.	C	32	5.114317	0.94339	.	.	ENSG00000171862	ENST00000371953	D	0.99089	-5.41	5.22	5.22	0.72569	Phosphatase tensin type (1);Dual specificity phosphatase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.99165	0.9711	M	0.70903	2.155	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99809	1.1040	9	.	.	.	-8.4283	18.7776	0.91918	0.0:1.0:0.0:0.0	.	126	P60484	PTEN_HUMAN	G	126	ENSP00000361021:A126G	.	A	+	2	0	PTEN	89682873	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.452000	0.80683	2.411000	0.81874	0.655000	0.94253	GCT	PTEN	-	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ	ENSG00000171862		0.408	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTEN	HGNC	protein_coding	OTTHUMT00000049241.1	83	0.00	0	C	NM_000314		89692893	89692893	+1	no_errors	ENST00000371953	ensembl	human	known	69_37n	missense	31	47.46	28	SNP	1.000	G
RHD	6007	genome.wustl.edu	37	1	25655578	25655578	+	3'UTR	SNP	C	C	A			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr1:25655578C>A	ENST00000328664.4	+	0	1572				RHD_ENST00000417538.2_3'UTR|RHD_ENST00000454452.2_3'UTR|RHD_ENST00000423810.2_3'UTR|RHD_ENST00000342055.5_Missense_Mutation_p.S478Y|RHD_ENST00000357542.4_3'UTR|RHD_ENST00000568195.1_Missense_Mutation_p.S448Y	NM_001282867.1|NM_016124.3	NP_001269796.1|NP_057208	Q02161	RHD_HUMAN	Rh blood group, D antigen							integral component of plasma membrane (GO:0005887)	ammonium transmembrane transporter activity (GO:0008519)			breast(2)|large_intestine(4)|lung(7)|prostate(1)	14		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.39e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000332)|BRCA - Breast invasive adenocarcinoma(304;0.000438)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000908)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		ctctgccactCTTTGAGGAGA	0.413																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB012623	CCDS262.1, CCDS53285.1, CCDS60027.1, CCDS60028.1, CCDS60029.1, CCDS60030.1, CCDS60031.1	1p36.11	2014-07-19	2013-10-02		ENSG00000187010	ENSG00000187010		"""CD molecules"", ""Blood group antigens"""	10009	protein-coding gene	gene with protein product		111680	"""Rhesus blood group, D antigen"", ""Rh blood group, D antigen"""	RH		8220426	Standard	NM_016124		Approved	Rh30a, Rh4, RhPI, RhII, DIIIc, CD240D	uc001bjz.3	Q02161	OTTHUMG00000003476	ENST00000328664.4:c.*163C>A	1.37:g.25655578C>A			Q02162|Q07618|Q16147|Q16235|Q16355|Q5VSK0|Q5XLS9|Q5XLT1|Q5XLT2|Q9NPK0|Q9UQ20|Q9UQ21|Q9UQ22|Q9UQ23	Missense_Mutation	SNP	pfam_NH4_transpt_AmtB-like,superfamily_NH4_transpt_AmtB-like,prints_RhesusRHD	p.S478Y	ENST00000328664.4	37	c.1433	CCDS262.1	1	.	.	.	.	.	.	.	.	.	.	N	9.278	1.047441	0.19827	.	.	ENSG00000187010	ENST00000419831;ENST00000342055	T	0.24151	1.87	.	.	.	.	1.947900	0.06107	U	0.666357	T	0.33323	0.0859	.	.	.	0.32329	N	0.561342	P;P	0.46578	0.88;0.88	P;P	0.49361	0.608;0.608	T	0.48758	-0.9007	7	0.87932	D	0	.	.	.	.	.	478;448	Q5XLS9;Q5XLT0	.;.	Y	472;478	ENSP00000339577:S478Y	ENSP00000339577:S478Y	S	+	2	0	RHD	25528165	0.446000	0.25665	0.550000	0.28217	0.545000	0.35147	0.197000	0.17197	0.159000	0.19401	0.162000	0.16502	TCT	RHD	-	NULL	ENSG00000187010		0.413	RHD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHD	HGNC	protein_coding	OTTHUMT00000009660.5	23	0.00	0	C	NM_016124		25655578	25655578	+1	no_errors	ENST00000342055	ensembl	human	putative	69_37n	missense	5	72.22	13	SNP	0.609	A
LRRC23	10233	genome.wustl.edu	37	12	6993532	6993532	+	Intron	SNP	C	C	A			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr12:6993532C>A	ENST00000433346.1	+	2	429				SPSB2_ENST00000437851.1_Intron|DSTNP2_ENST00000602547.1_RNA|LRRC23_ENST00000449039.1_Intron|RPL13P5_ENST00000412023.1_RNA			Q53EV4	LRC23_HUMAN	leucine rich repeat containing 23											NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	13						TCCTCTTCCCCAGGAAGCCCT	0.577																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC014450	CCDS8568.1, CCDS8569.1	12p13	2006-02-02			ENSG00000010626	ENSG00000010626			19138	protein-coding gene	gene with protein product						11830501, 11826754	Standard	NM_201650		Approved	B7, LRPB7	uc001qrp.3	Q53EV4	OTTHUMG00000156668	ENST00000433346.1:c.-50+449C>A	12.37:g.6993532C>A			A8K8C6|D3DUT1|Q8N6K6|Q92977|Q99620	RNA	SNP	-	NULL	ENST00000433346.1	37	NULL		12																																																																																			RPL13P5	-	-	ENSG00000240370		0.577	LRRC23-011	PUTATIVE	basic	protein_coding	RPL13P5	HGNC	protein_coding	OTTHUMT00000345224.1	65	0.00	0	C	NM_006992		6993532	6993532	+1	no_errors	ENST00000412023	ensembl	human	known	69_37n	rna	21	27.59	8	SNP	1.000	A
SCN3A	6328	genome.wustl.edu	37	2	165952042	165952042	+	Missense_Mutation	SNP	G	G	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr2:165952042G>T	ENST00000360093.3	-	25	4901	c.4410C>A	c.(4408-4410)aaC>aaA	p.N1470K	SCN3A_ENST00000465043.1_5'Flank|SCN3A_ENST00000283254.7_Missense_Mutation_p.N1470K|SCN3A_ENST00000409101.3_Missense_Mutation_p.N1421K|SCN3A_ENST00000540861.1_5'Flank	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1470					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GCTGGTTGAAGTTATCTATGA	0.328																																						dbGAP											0													99.0	97.0	98.0					2																	165952042		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.4410C>A	2.37:g.165952042G>T	ENSP00000353206:p.Asn1470Lys		Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.N1470K	ENST00000360093.3	37	c.4410		2	.	.	.	.	.	.	.	.	.	.	G	16.64	3.178235	0.57692	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101	D;D;D	0.97378	-4.36;-4.36;-4.36	5.25	5.25	0.73442	.	0.140955	0.45361	D	0.000363	D	0.98507	0.9502	M	0.90309	3.105	0.80722	D	1	D;D;P	0.67145	0.996;0.996;0.64	D;D;P	0.78314	0.991;0.991;0.67	D	0.98593	1.0655	10	0.87932	D	0	.	12.7021	0.57038	0.0751:0.0:0.9249:0.0	.	1421;1421;1470	Q9NY46-2;Q9NY46-4;Q9NY46-3	.;.;.	K	1470;1470;1421	ENSP00000353206:N1470K;ENSP00000283254:N1470K;ENSP00000386726:N1421K	ENSP00000283254:N1470K	N	-	3	2	SCN3A	165660288	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.026000	0.57232	2.894000	0.99253	0.591000	0.81541	AAC	SCN3A	-	NULL	ENSG00000153253		0.328	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	HGNC	protein_coding		35	0.00	0	G	NM_006922		165952042	165952042	-1	no_errors	ENST00000283254	ensembl	human	known	69_37n	missense	25	10.71	3	SNP	1.000	T
SLC25A41	284427	genome.wustl.edu	37	19	6432215	6432215	+	Splice_Site	SNP	C	C	G			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr19:6432215C>G	ENST00000321510.6	-	2	276	c.208G>C	c.(208-210)Gta>Cta	p.V70L		NM_173637.3	NP_775908.2			solute carrier family 25, member 41											large_intestine(1)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	6						GTGTCCAGTACCTGCAGGGCA	0.597																																						dbGAP											0													48.0	54.0	52.0					19																	6432215		2025	4169	6194	-	-	-	SO:0001630	splice_region_variant	0			AK097761	CCDS45937.1	19p13.3	2013-05-22			ENSG00000181240	ENSG00000181240		"""Solute carriers"""	28533	protein-coding gene	gene with protein product		610822				16949250	Standard	NM_173637		Approved	FLJ40442, MGC34725, APC4	uc010dus.3	Q8N5S1		ENST00000321510.6:c.208-1G>C	19.37:g.6432215C>G				Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.V70L	ENST00000321510.6	37	c.208	CCDS45937.1	19	.	.	.	.	.	.	.	.	.	.	C	9.985	1.229200	0.22542	.	.	ENSG00000181240	ENST00000321510;ENST00000458275	T;T	0.80480	-1.38;1.3	4.47	3.4	0.38934	.	0.186259	0.42964	N	0.000633	T	0.70211	0.3198	L	0.27053	0.805	0.31514	N	0.663255	B	0.32040	0.353	B	0.41088	0.347	T	0.66709	-0.5855	10	0.20519	T	0.43	-16.3158	7.1607	0.25662	0.0:0.7297:0.176:0.0943	.	70	Q8N5S1	S2541_HUMAN	L	70	ENSP00000322649:V70L;ENSP00000405411:V70L	ENSP00000322649:V70L	V	-	1	0	SLC25A41	6383215	1.000000	0.71417	0.997000	0.53966	0.608000	0.37181	1.567000	0.36407	1.060000	0.40578	0.491000	0.48974	GTA	SLC25A41	-	NULL	ENSG00000181240		0.597	SLC25A41-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A41	HGNC	protein_coding	OTTHUMT00000462222.1	40	0.00	0	C	NM_173637	Missense_Mutation	6432215	6432215	-1	no_errors	ENST00000321510	ensembl	human	known	69_37n	missense	22	26.67	8	SNP	0.999	G
SLC43A3	29015	genome.wustl.edu	37	11	57182476	57182476	+	Missense_Mutation	SNP	C	C	A			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr11:57182476C>A	ENST00000395123.2	-	10	1177	c.873G>T	c.(871-873)ttG>ttT	p.L291F	SLC43A3_ENST00000533524.1_Missense_Mutation_p.L304F|SLC43A3_ENST00000529554.1_Missense_Mutation_p.L291F|SLC43A3_ENST00000352187.1_Missense_Mutation_p.L291F|SLC43A3_ENST00000528098.1_5'Flank|SLC43A3_ENST00000395124.1_Missense_Mutation_p.L291F	NM_001278201.1|NM_014096.2	NP_001265130.1|NP_054815.2	Q8NBI5	S43A3_HUMAN	solute carrier family 43, member 3	291					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(10)|lung(4)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	27						GGTAGTGCCACAACTGTATCA	0.597																																						dbGAP											0													131.0	113.0	119.0					11																	57182476		2201	4296	6497	-	-	-	SO:0001583	missense	0			AL157431	CCDS7956.1, CCDS60784.1	11q11	2013-05-22			ENSG00000134802	ENSG00000134802		"""Solute carriers"""	17466	protein-coding gene	gene with protein product	"""likely ortholog of mouse embryonic epithelial gene 1"""					7531438, 11704567	Standard	NM_017611		Approved	SEEEG-1, Eeg1, DKFZp762A227, FOAP-13, PRO1659	uc001nki.3	Q8NBI5	OTTHUMG00000167113	ENST00000395123.2:c.873G>T	11.37:g.57182476C>A	ENSP00000378555:p.Leu291Phe		B4DNR8|E7EQD2|Q9NSS4	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.L291F	ENST00000395123.2	37	c.873	CCDS7956.1	11	.	.	.	.	.	.	.	.	.	.	C	16.13	3.037339	0.54896	.	.	ENSG00000134802	ENST00000395123;ENST00000395124;ENST00000352187;ENST00000529554;ENST00000533524;ENST00000530005	T;T;T;T;T;T	0.80824	-1.42;-1.42;-1.42;-1.42;-1.42;0.3	5.05	2.08	0.27032	Major facilitator superfamily domain, general substrate transporter (1);	0.155205	0.44285	D	0.000471	D	0.84754	0.5542	M	0.75085	2.285	0.35665	D	0.812868	D;P;D	0.67145	0.996;0.948;0.989	D;P;P	0.66084	0.941;0.841;0.856	T	0.83210	-0.0074	10	0.42905	T	0.14	-9.9368	4.8154	0.13363	0.1534:0.6154:0.1482:0.083	.	304;291;291	E7EQD2;Q8NBI5;A8K2X6	.;S43A3_HUMAN;.	F	291;291;291;291;304;291	ENSP00000378555:L291F;ENSP00000378556:L291F;ENSP00000337561:L291F;ENSP00000436254:L291F;ENSP00000434515:L304F;ENSP00000435893:L291F	ENSP00000337561:L291F	L	-	3	2	SLC43A3	56939052	0.996000	0.38824	0.701000	0.30321	0.703000	0.40648	0.260000	0.18424	0.151000	0.19162	-0.311000	0.09066	TTG	SLC43A3	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000134802		0.597	SLC43A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC43A3	HGNC	protein_coding	OTTHUMT00000393057.1	53	0.00	0	C	NM_017611		57182476	57182476	-1	no_errors	ENST00000352187	ensembl	human	known	69_37n	missense	37	11.90	5	SNP	0.997	A
SLC7A5	8140	genome.wustl.edu	37	16	87902747	87902747	+	Silent	SNP	G	G	A	rs375318185		TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr16:87902747G>A	ENST00000261622.4	-	1	347	c.282C>T	c.(280-282)gtC>gtT	p.V94V		NM_003486.5	NP_003477.4	Q01650	LAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, L system), member 5	94					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-amino acid transmembrane transporter activity (GO:0015179)|neutral amino acid transmembrane transporter activity (GO:0015175)|peptide antigen binding (GO:0042605)			endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(80;0.049)	Dextrothyroxine(DB00509)|L-DOPA(DB01235)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Melphalan(DB01042)	CGATGGAGAAGACGCCGCACG	0.687																																						dbGAP											0													23.0	27.0	26.0					16																	87902747		2195	4293	6488	-	-	-	SO:0001819	synonymous_variant	0			AF077866	CCDS10964.1	16q24.3	2013-05-22	2011-07-12		ENSG00000103257	ENSG00000103257		"""CD molecules"", ""Solute carriers"""	11063	protein-coding gene	gene with protein product		600182				9751058, 7829099	Standard	XM_006721286		Approved	LAT1, E16, D16S469E, MPE16, CD98	uc002fkm.3	Q01650	OTTHUMG00000137658	ENST00000261622.4:c.282C>T	16.37:g.87902747G>A			Q8IV97|Q9UBN8|Q9UP15|Q9UQC0	Silent	SNP	pfam_AA-permease_dom,pirsf_AA/rel_permease1,tigrfam_L_AA_transporter	p.V94	ENST00000261622.4	37	c.282	CCDS10964.1	16																																																																																			SLC7A5	-	pfam_AA-permease_dom,pirsf_AA/rel_permease1,tigrfam_L_AA_transporter	ENSG00000103257		0.687	SLC7A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A5	HGNC	protein_coding	OTTHUMT00000269110.2	115	0.00	0	G	NM_003486		87902747	87902747	-1	no_errors	ENST00000261622	ensembl	human	known	69_37n	silent	50	20.63	13	SNP	1.000	A
SLC8A3	6547	genome.wustl.edu	37	14	70634857	70634857	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr14:70634857C>T	ENST00000381269.2	-	2	1036	c.283G>A	c.(283-285)Gct>Act	p.A95T	SLC8A3_ENST00000534137.1_Missense_Mutation_p.A95T|SLC8A3_ENST00000357887.3_Missense_Mutation_p.A95T|SLC8A3_ENST00000356921.2_Missense_Mutation_p.A95T|SLC8A3_ENST00000528359.1_Missense_Mutation_p.A95T	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	95					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		AAGCGGTCAGCAATGATGGAC	0.483																																						dbGAP											0													85.0	75.0	78.0					14																	70634857		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.283G>A	14.37:g.70634857C>T	ENSP00000370669:p.Ala95Thr		Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Missense_Mutation	SNP	pfam_NaCa_Exmemb,pfam_Calx_beta,smart_Calx_beta,prints_Na_Ca_Ex,tigrfam_Na_Ca_Ex	p.A95T	ENST00000381269.2	37	c.283	CCDS35498.1	14	.	.	.	.	.	.	.	.	.	.	C	19.84	3.901194	0.72754	.	.	ENSG00000100678	ENST00000356921;ENST00000381269;ENST00000357887;ENST00000534137;ENST00000528359	T;T;T;T;T	0.72615	-0.67;-0.67;-0.67;-0.67;-0.67	4.96	4.96	0.65561	Sodium/calcium exchanger membrane region (1);	0.000000	0.85682	D	0.000000	D	0.83552	0.5279	M	0.71920	2.185	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.997;0.999	D;D;D;D	0.91635	0.996;0.999;0.992;0.995	D	0.83954	0.0318	10	0.49607	T	0.09	.	18.3961	0.90499	0.0:1.0:0.0:0.0	.	95;95;95;95	P57103-2;P57103;Q96QG2;Q96QG1	.;NAC3_HUMAN;.;.	T	95	ENSP00000349392:A95T;ENSP00000370669:A95T;ENSP00000350560:A95T;ENSP00000436688:A95T;ENSP00000433531:A95T	ENSP00000349392:A95T	A	-	1	0	SLC8A3	69704610	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.645000	0.83430	2.573000	0.86826	0.650000	0.86243	GCT	SLC8A3	-	pfam_NaCa_Exmemb,tigrfam_Na_Ca_Ex	ENSG00000100678		0.483	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC8A3	HGNC	protein_coding	OTTHUMT00000390736.1	55	0.00	0	C			70634857	70634857	-1	no_errors	ENST00000381269	ensembl	human	known	69_37n	missense	24	22.58	7	SNP	1.000	T
SNHG24	101929369	genome.wustl.edu	37	14	101441215	101441215	+	lincRNA	SNP	C	C	A			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr14:101441215C>A	ENST00000554693.2	+	0	462				SNORD114-18_ENST00000365272.1_RNA|SNORD114-17_ENST00000364699.1_RNA|SNORD114-14_ENST00000362723.1_RNA|SNORD114-19_ENST00000363072.1_RNA|SNORD113_ENST00000364630.1_RNA|SNORD114-15_ENST00000364687.1_RNA|SNORD114-16_ENST00000363044.1_RNA																							CTCTGAGGTCCAACACAGCAC	0.373																																						dbGAP											0													108.0	92.0	97.0					14																	101441215		876	1991	2867	-	-	-			0																															14.37:g.101441215C>A				RNA	SNP	-	NULL	ENST00000554693.2	37	NULL		14																																																																																			SNORD114-17	-	-	ENSG00000201569		0.373	RP11-909M7.3-001	KNOWN	basic	lincRNA	SNORD114-17	HGNC	lincRNA	OTTHUMT00000468646.1	16	0.00	0	C			101441215	101441215	+1	no_errors	ENST00000364699	ensembl	human	known	69_37n	rna	3	66.67	6	SNP	0.012	A
RPL4	6124	genome.wustl.edu	37	15	66794392	66794392	+	Intron	SNP	G	G	C			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr15:66794392G>C	ENST00000307961.6	-	5	514				ZWILCH_ENST00000535141.2_5'Flank|RPL4_ENST00000568588.1_Intron|SNORD18A_ENST00000363753.1_RNA|SNORD18B_ENST00000365659.1_RNA|SNORD16_ENST00000362803.1_RNA|ZWILCH_ENST00000307897.5_5'Flank|SNORD18C_ENST00000362704.1_RNA	NM_000968.3	NP_000959.2	P36578	RL4_HUMAN	ribosomal protein L4						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|stomach(1)|urinary_tract(1)	17						ATGTGTTTCAGAAACACGGAC	0.323																																						dbGAP											0													98.0	98.0	98.0					15																	66794392		876	1991	2867	-	-	-	SO:0001627	intron_variant	0			AB007167	CCDS10218.1	15q22	2011-04-06			ENSG00000174444	ENSG00000174444		"""L ribosomal proteins"""	10353	protein-coding gene	gene with protein product	"""60S ribosomal protein L4"""	180479				9582194, 8268230	Standard	NM_000968		Approved	L4	uc002apv.3	P36578	OTTHUMG00000133193	ENST00000307961.6:c.422-142C>G	15.37:g.66794392G>C			A8K502|P39029|Q4VBR0|Q969Z9	RNA	SNP	-	NULL	ENST00000307961.6	37	NULL	CCDS10218.1	15																																																																																			SNORD18B	-	-	ENSG00000202529		0.323	RPL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORD18B	HGNC	protein_coding	OTTHUMT00000256903.2	35	0.00	0	G	NM_000968		66794392	66794392	-1	no_errors	ENST00000365659	ensembl	human	known	69_37n	rna	4	71.43	10	SNP	1.000	C
SPAG9	9043	genome.wustl.edu	37	17	49197891	49197891	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr17:49197891C>T	ENST00000262013.7	-	1	335	c.127G>A	c.(127-129)Gac>Aac	p.D43N	SPAG9_ENST00000357122.4_Missense_Mutation_p.D43N|SPAG9_ENST00000505279.1_Missense_Mutation_p.D43N	NM_001130528.2	NP_001124000.1	O60271	JIP4_HUMAN	sperm associated antigen 9	43					activation of JUN kinase activity (GO:0007257)|muscle cell differentiation (GO:0042692)|negative regulation of protein homodimerization activity (GO:0090074)|positive regulation of cell migration (GO:0030335)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|striated muscle cell differentiation (GO:0051146)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				NS(1)|breast(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			ACCTCCTCGTCATAGCGCCCG	0.672																																						dbGAP											0													57.0	50.0	52.0					17																	49197891		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011088	CCDS11577.1, CCDS45740.1, CCDS58577.1, CCDS58578.1	17q21.33	2013-09-23			ENSG00000008294	ENSG00000008294			14524	protein-coding gene	gene with protein product	"""sperm surface protein"", ""JNK/SAPK-associated protein"", ""JNK interacting protein"", ""sperm specific protein"", ""c-Jun NH2-terminal kinase-associated leucine zipper protein"", ""Max-binding protein"", ""JNK-associated leucine-zipper protein"", ""HLC-4 protein"", ""lung cancer oncogene 4"", ""proliferation-inducing gene 6"", ""cancer/testis antigen 89"""	605430				9480848, 11106729	Standard	NM_003971		Approved	HSS, SYD1, KIAA0516, MGC14967, MGC74461, MGC117291, JLP, PHET, HLC4, PIG6, FLJ13450, FLJ14006, FLJ26141, FLJ34602, CT89	uc002itc.3	O60271	OTTHUMG00000162316	ENST00000262013.7:c.127G>A	17.37:g.49197891C>T	ENSP00000262013:p.Asp43Asn		A6H8U5|A8MSX0|B4DHH2|O60905|Q3KQU8|Q3MKM7|Q86WC7|Q86WC8|Q8IZX7|Q96II0|Q9H811	Missense_Mutation	SNP	pfam_JNK/Rab-associated_protein-1_N,superfamily_WD40_repeat_dom	p.D43N	ENST00000262013.7	37	c.127	CCDS45740.1	17	.	.	.	.	.	.	.	.	.	.	C	36	5.612207	0.96637	.	.	ENSG00000008294	ENST00000262013;ENST00000505279;ENST00000357122;ENST00000546269	T;T;T	0.51817	0.69;0.69;0.69	3.66	3.66	0.41972	JNK/Rab-associated protein-1, N-terminal (1);	0.079860	0.47455	U	0.000237	T	0.68559	0.3014	M	0.79475	2.455	0.51233	D	0.999917	D;D;D	0.89917	0.989;1.0;0.993	D;D;D	0.77557	0.972;0.99;0.925	T	0.74813	-0.3537	10	0.62326	D	0.03	-9.8507	15.768	0.78143	0.0:1.0:0.0:0.0	.	43;43;43	O60271-2;O60271;O60271-4	.;JIP4_HUMAN;.	N	43	ENSP00000262013:D43N;ENSP00000426900:D43N;ENSP00000349636:D43N	ENSP00000262013:D43N	D	-	1	0	SPAG9	46552890	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	7.006000	0.76329	1.757000	0.51966	0.298000	0.19748	GAC	SPAG9	-	pfam_JNK/Rab-associated_protein-1_N	ENSG00000008294		0.672	SPAG9-001	KNOWN	basic|CCDS	protein_coding	SPAG9	HGNC	protein_coding	OTTHUMT00000368543.2	70	0.00	0	C	NM_003971		49197891	49197891	-1	no_errors	ENST00000262013	ensembl	human	known	69_37n	missense	17	63.04	29	SNP	1.000	T
SUV39H1	6839	genome.wustl.edu	37	X	48557406	48557406	+	Missense_Mutation	SNP	G	G	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chrX:48557406G>T	ENST00000376687.3	+	2	323	c.133G>T	c.(133-135)Gtc>Ttc	p.V45F	AF196970.3_ENST00000416061.1_RNA|SUV39H1_ENST00000453214.2_5'UTR|SUV39H1_ENST00000337852.6_Missense_Mutation_p.V56F	NM_003173.2	NP_003164.1	O43463	SUV91_HUMAN	suppressor of variegation 3-9 homolog 1 (Drosophila)	45	Chromo. {ECO:0000255|PROSITE- ProRule:PRU00053}.|Interaction with SIRT1.				cell cycle (GO:0007049)|cell differentiation (GO:0030154)|chromatin organization (GO:0006325)|chromatin silencing at rDNA (GO:0000183)|histone H3-K9 dimethylation (GO:0036123)|histone H3-K9 trimethylation (GO:0036124)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin silencing complex (GO:0005677)|chromosome, centromeric region (GO:0000775)|condensed nuclear chromosome (GO:0000794)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|rDNA heterochromatin (GO:0033553)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|protein N-terminus binding (GO:0047485)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14						TGACTTTGAAGTCGAGTACCT	0.547																																						dbGAP											0													86.0	68.0	74.0					X																	48557406		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF019968	CCDS14304.1, CCDS65252.1	Xp11.23	2011-07-01	2001-11-28		ENSG00000101945	ENSG00000101945		"""Chromatin-modifying enzymes / K-methyltransferases"""	11479	protein-coding gene	gene with protein product		300254	"""suppressor of variegation 3-9 (Drosophila) homolog 1"""	SUV39H		10202156	Standard	NM_001282166		Approved	KMT1A	uc004dkn.3	O43463	OTTHUMG00000022701	ENST00000376687.3:c.133G>T	X.37:g.48557406G>T	ENSP00000365877:p.Val45Phe		B2R6E8|B4DST0|Q53G60|Q6FHK6	Missense_Mutation	SNP	pfam_SET_dom,pfam_Pre-SET_dom,pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,smart_Post-SET_dom,pirsf_Histone_H3-K9_MeTrfase,pfscan_SET_dom,pfscan_Pre-SET_dom,pfscan_Post-SET_dom,pfscan_Chromo_domain/shadow	p.V56F	ENST00000376687.3	37	c.166	CCDS14304.1	X	.	.	.	.	.	.	.	.	.	.	G	26.0	4.692160	0.88735	.	.	ENSG00000101945	ENST00000337852;ENST00000376687;ENST00000448548	D;D	0.82526	-1.62;-1.62	3.75	3.75	0.43078	Chromo domain (1);Chromo domain-like (1);Chromo domain/shadow (2);	0.000000	0.64402	D	0.000005	D	0.91395	0.7285	H	0.95745	3.715	0.80722	D	1	P;P	0.50819	0.939;0.939	P;P	0.55345	0.774;0.663	D	0.93524	0.6864	10	0.87932	D	0	.	12.4848	0.55866	0.0:0.0:1.0:0.0	.	56;45	B4DST0;O43463	.;SUV91_HUMAN	F	56;45;45	ENSP00000337976:V56F;ENSP00000365877:V45F	ENSP00000337976:V56F	V	+	1	0	SUV39H1	48442350	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.524000	0.90579	1.882000	0.54519	0.425000	0.28330	GTC	SUV39H1	-	pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pirsf_Histone_H3-K9_MeTrfase,pfscan_Chromo_domain/shadow	ENSG00000101945		0.547	SUV39H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUV39H1	HGNC	protein_coding	OTTHUMT00000058909.1	54	0.00	0	G	NM_003173		48557406	48557406	+1	no_errors	ENST00000337852	ensembl	human	known	69_37n	missense	41	10.87	5	SNP	1.000	T
TAS1R2	80834	genome.wustl.edu	37	1	19186013	19186013	+	Missense_Mutation	SNP	T	T	C			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr1:19186013T>C	ENST00000375371.3	-	1	163	c.142A>G	c.(142-144)Att>Gtt	p.I48V	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	48					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	AGGTGAACAATGCCCTTCATG	0.607																																						dbGAP											0													119.0	109.0	112.0					1																	19186013		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.142A>G	1.37:g.19186013T>C	ENSP00000364520:p.Ile48Val		Q5TZ19	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,pfscan_GPCR_3_C,prints_GPCR_3	p.I48V	ENST00000375371.3	37	c.142	CCDS187.1	1	.	.	.	.	.	.	.	.	.	.	T	0.011	-1.691782	0.00731	.	.	ENSG00000179002	ENST00000375371	D	0.85861	-2.04	4.47	-1.74	0.08056	.	1.108720	0.07171	N	0.852299	T	0.61640	0.2363	N	0.05078	-0.115	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.50423	-0.8830	10	0.09590	T	0.72	.	1.7322	0.02934	0.1597:0.0974:0.3286:0.4143	.	48	Q8TE23	TS1R2_HUMAN	V	48	ENSP00000364520:I48V	ENSP00000364520:I48V	I	-	1	0	TAS1R2	19058600	0.214000	0.23563	0.024000	0.17045	0.603000	0.37013	0.417000	0.21214	-0.123000	0.11745	0.260000	0.18958	ATT	TAS1R2	-	NULL	ENSG00000179002		0.607	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	TAS1R2	HGNC	protein_coding	OTTHUMT00000006953.1	46	0.00	0	T			19186013	19186013	-1	no_errors	ENST00000375371	ensembl	human	novel	69_37n	missense	15	51.61	16	SNP	0.029	C
TCFL5	10732	genome.wustl.edu	37	20	61492866	61492866	+	Frame_Shift_Del	DEL	C	C	-			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr20:61492866delC	ENST00000335351.3	-	1	249	c.157delG	c.(157-159)gagfs	p.E53fs	TCFL5_ENST00000217162.5_Frame_Shift_Del_p.E5fs	NM_006602.2	NP_006593.2	Q9UL49	TCFL5_HUMAN	transcription factor-like 5 (basic helix-loop-helix)	53					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(5)|lung(1)|urinary_tract(1)	9	Breast(26;5.68e-08)					TGCGTGTACTCCACCTCCGTC	0.741																																						dbGAP											0													21.0	20.0	21.0					20																	61492866		2114	4114	6228	-	-	-	SO:0001589	frameshift_variant	0			AB012124	CCDS13506.1	20q13.33	2013-09-19			ENSG00000101190	ENSG00000101190		"""Basic helix-loop-helix proteins"""	11646	protein-coding gene	gene with protein product	"""HPV-16 E2 binding protein 1"""	604745				9763657	Standard	XM_005260185		Approved	Figlb, E2BP-1, CHA, bHLHe82	uc002ydp.3	Q9UL49	OTTHUMG00000032939	ENST00000335351.3:c.157delG	20.37:g.61492866delC	ENSP00000334294:p.Glu53fs		O94771|Q9BYW0	Frame_Shift_Del	DEL	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.E53fs	ENST00000335351.3	37	c.157	CCDS13506.1	20																																																																																			TCFL5	-	NULL	ENSG00000101190		0.741	TCFL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCFL5	HGNC	protein_coding	OTTHUMT00000080079.2	10	0.00	0	C	NM_006602		61492866	61492866	-1	no_errors	ENST00000335351	ensembl	human	known	69_37n	frame_shift_del	2	50.00	2	DEL	0.994	-
TMED10	10972	genome.wustl.edu	37	14	75602565	75602565	+	Missense_Mutation	SNP	G	G	C			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr14:75602565G>C	ENST00000303575.4	-	4	487	c.436C>G	c.(436-438)Cca>Gca	p.P146A	RP11-950C14.7_ENST00000556236.1_RNA|TMED10_ENST00000557670.1_5'UTR	NM_006827.5	NP_006818.3	P49755	TMEDA_HUMAN	transmembrane emp24-like trafficking protein 10 (yeast)	146	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.				beta-amyloid formation (GO:0034205)|cargo loading into vesicle (GO:0035459)|COPI coating of Golgi vesicle (GO:0048205)|COPI-coated vesicle budding (GO:0035964)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|kidney development (GO:0001822)|protein oligomerization (GO:0051259)|regulated secretory pathway (GO:0045055)|response to acid chemical (GO:0001101)|response to alkaloid (GO:0043279)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle targeting, to, from or within Golgi (GO:0048199)	cis-Golgi network (GO:0005801)|COPI-coated vesicle (GO:0030137)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|gamma-secretase complex (GO:0070765)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network transport vesicle (GO:0030140)|zymogen granule membrane (GO:0042589)	syntaxin binding (GO:0019905)			endometrium(1)|large_intestine(5)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(234;0.0126)		ACCTCTAATGGTTTGAGCTTC	0.398																																						dbGAP											0													87.0	80.0	83.0					14																	75602565		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832012, X97442	CCDS9840.1	14q24.3	2008-08-11			ENSG00000170348	ENSG00000170348			16998	protein-coding gene	gene with protein product		605406				7596406, 8663407	Standard	NM_006827		Approved	TMP21, P24(DELTA)	uc001xrm.1	P49755		ENST00000303575.4:c.436C>G	14.37:g.75602565G>C	ENSP00000303145:p.Pro146Ala		B2R605|Q15602|Q16536|Q86TC2|Q86TS5	Missense_Mutation	SNP	pfam_GOLD,pfscan_GOLD	p.P146A	ENST00000303575.4	37	c.436	CCDS9840.1	14	.	.	.	.	.	.	.	.	.	.	G	27.2	4.808969	0.90707	.	.	ENSG00000170348	ENST00000303575	T	0.17854	2.25	5.72	5.72	0.89469	GOLD (2);	0.000000	0.85682	D	0.000000	T	0.47948	0.1473	M	0.83774	2.66	0.80722	D	1	D	0.71674	0.998	D	0.79108	0.992	T	0.39623	-0.9605	10	0.41790	T	0.15	-28.0484	19.8938	0.96942	0.0:0.0:1.0:0.0	.	146	P49755	TMEDA_HUMAN	A	146	ENSP00000303145:P146A	ENSP00000303145:P146A	P	-	1	0	TMED10	74672318	1.000000	0.71417	0.998000	0.56505	0.882000	0.50991	9.417000	0.97391	2.703000	0.92315	0.460000	0.39030	CCA	TMED10	-	pfam_GOLD,pfscan_GOLD	ENSG00000170348		0.398	TMED10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMED10	HGNC	protein_coding	OTTHUMT00000415034.1	34	0.00	0	G	NM_006827		75602565	75602565	-1	no_errors	ENST00000303575	ensembl	human	known	69_37n	missense	13	43.48	10	SNP	1.000	C
TMEM229A	730130	genome.wustl.edu	37	7	123672212	123672212	+	Silent	SNP	A	A	G			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr7:123672212A>G	ENST00000455783.1	-	1	1311	c.846T>C	c.(844-846)ttT>ttC	p.F282F	RP5-921G16.1_ENST00000484322.1_RNA	NM_001136002.1	NP_001129474.1	B2RXF0	T229A_HUMAN	transmembrane protein 229A	282						host cell nucleus (GO:0042025)|integral component of membrane (GO:0016021)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)	6						TGCCGTACATAAAGAAGGACC	0.567																																						dbGAP											0													59.0	69.0	66.0					7																	123672212		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			BC157828	CCDS47694.1	7q31.32	2009-09-22			ENSG00000234224	ENSG00000234224			37279	protein-coding gene	gene with protein product							Standard	NM_001136002		Approved		uc011kob.2	B2RXF0	OTTHUMG00000154762	ENST00000455783.1:c.846T>C	7.37:g.123672212A>G			A4D0X6	Silent	SNP	NULL	p.F282	ENST00000455783.1	37	c.846	CCDS47694.1	7																																																																																			TMEM229A	-	NULL	ENSG00000234224		0.567	TMEM229A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM229A	HGNC	protein_coding	OTTHUMT00000336960.3	33	0.00	0	A	NM_001136002		123672212	123672212	-1	no_errors	ENST00000455783	ensembl	human	known	69_37n	silent	12	57.14	16	SNP	0.104	G
TNR	7143	genome.wustl.edu	37	1	175334320	175334320	+	Missense_Mutation	SNP	T	T	G			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr1:175334320T>G	ENST00000367674.2	-	12	3121	c.2413A>C	c.(2413-2415)Att>Ctt	p.I805L	TNR_ENST00000263525.2_Missense_Mutation_p.I805L			Q92752	TENR_HUMAN	tenascin R	805	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					TAGTTAAGAATGAGTCTGTCT	0.547																																						dbGAP											0													109.0	102.0	104.0					1																	175334320		2203	4300	6503	-	-	-	SO:0001583	missense	0			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.2413A>C	1.37:g.175334320T>G	ENSP00000356646:p.Ile805Leu		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_Fibronectin_type3	p.I805L	ENST00000367674.2	37	c.2413	CCDS1318.1	1	.	.	.	.	.	.	.	.	.	.	T	16.23	3.063749	0.55432	.	.	ENSG00000116147	ENST00000367674;ENST00000263525	T;T	0.57907	0.37;0.37	5.91	2.08	0.27032	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.108020	0.64402	N	0.000008	T	0.35248	0.0925	N	0.25890	0.77	0.49687	D	0.999815	P	0.42908	0.793	B	0.43508	0.422	T	0.07065	-1.0792	10	0.13853	T	0.58	.	6.4812	0.22063	0.0:0.1325:0.2445:0.623	.	805	Q92752	TENR_HUMAN	L	805	ENSP00000356646:I805L;ENSP00000263525:I805L	ENSP00000263525:I805L	I	-	1	0	TNR	173600943	1.000000	0.71417	0.998000	0.56505	0.865000	0.49528	1.542000	0.36137	0.456000	0.26937	0.533000	0.62120	ATT	TNR	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000116147		0.547	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNR	HGNC	protein_coding	OTTHUMT00000084414.4	47	0.00	0	T	NM_003285		175334320	175334320	-1	no_errors	ENST00000263525	ensembl	human	known	69_37n	missense	29	23.68	9	SNP	1.000	G
TNRC6A	27327	genome.wustl.edu	37	16	24788394	24788394	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr16:24788394C>T	ENST00000395799.3	+	5	433	c.304C>T	c.(304-306)Cag>Tag	p.Q102*	TNRC6A_ENST00000315183.7_Nonsense_Mutation_p.Q102*	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	102	Gln-rich.|Interaction with argonaute family proteins.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		gcagcaacagcagcagccgca	0.592																																						dbGAP											0													19.0	28.0	25.0					16																	24788394		2084	4162	6246	-	-	-	SO:0001587	stop_gained	0			U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.304C>T	16.37:g.24788394C>T	ENSP00000379144:p.Gln102*		C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Nonsense_Mutation	SNP	pfam_Argonaute_hook_dom,superfamily_UBA-like	p.Q102*	ENST00000395799.3	37	c.304	CCDS10624.2	16	.	.	.	.	.	.	.	.	.	.	C	13.09	2.134190	0.37630	.	.	ENSG00000090905	ENST00000315183;ENST00000395799	.	.	.	4.65	3.68	0.42216	.	0.331709	0.22040	N	0.065468	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	9.5541	13.2245	0.59907	0.0:0.838:0.162:0.0	.	.	.	.	X	102	.	ENSP00000326900:Q102X	Q	+	1	0	TNRC6A	24695895	0.426000	0.25506	0.224000	0.23877	0.081000	0.17604	0.714000	0.25808	1.248000	0.43934	0.591000	0.81541	CAG	TNRC6A	-	NULL	ENSG00000090905		0.592	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	TNRC6A	HGNC	protein_coding	OTTHUMT00000214081.1	68	0.00	0	C	NM_020847		24788394	24788394	+1	no_errors	ENST00000395799	ensembl	human	known	69_37n	nonsense	32	28.89	13	SNP	0.897	T
TNS1	7145	genome.wustl.edu	37	2	218712887	218712889	+	In_Frame_Del	DEL	GCT	GCT	-	rs375721540|rs574153391		TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	GCT	GCT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr2:218712887_218712889delGCT	ENST00000171887.4	-	17	2428_2430	c.1976_1978delAGC	c.(1975-1980)cagcct>cct	p.Q659del	TNS1_ENST00000419504.1_In_Frame_Del_p.Q659del|TNS1_ENST00000480665.1_5'Flank|TNS1_ENST00000430930.1_In_Frame_Del_p.Q659del	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	659	Gln-rich.				cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		GGTGGGCGAGgctgctgctgctg	0.66																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.1976_1978delAGC	2.37:g.218712896_218712898delGCT	ENSP00000171887:p.Gln659del		Q4ZG71|Q6IPI5	In_Frame_Del	DEL	pfam_PTB,pfam_Tensin_phosphatase_C2-dom,pfam_SH2,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Tyr_Pase_cat,smart_SH2,smart_PTyr_interaction_dom,pfscan_SH2,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.Q659in_frame_del	ENST00000171887.4	37	c.1978_1976	CCDS2407.1	2																																																																																			TNS1	-	NULL	ENSG00000079308		0.660	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNS1	HGNC	protein_coding	OTTHUMT00000256672.2	32	0.00	0	GCT	NM_022648		218712887	218712889	-1	no_errors	ENST00000171887	ensembl	human	known	69_37n	in_frame_del	17	14.29	3	DEL	1.000:1.000:0.994	-
TP53	7157	genome.wustl.edu	37	17	7577099	7577099	+	Missense_Mutation	SNP	C	C	T	rs121912660		TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr17:7577099C>T	ENST00000269305.4	-	8	1028	c.839G>A	c.(838-840)aGa>aAa	p.R280K	TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.R280K|TP53_ENST00000359597.4_Missense_Mutation_p.R280K|TP53_ENST00000455263.2_Missense_Mutation_p.R280K|TP53_ENST00000420246.2_Missense_Mutation_p.R280K	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	280	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> I (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> K (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1694291}.|R -> P (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).|R -> T (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1631151}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R280T(65)|p.R280K(49)|p.R280I(16)|p.0?(8)|p.?(2)|p.R280_D281delRD(2)|p.A276_R283delACPGRDRR(1)|p.C275fs*20(1)|p.A276fs*64(1)|p.L265_K305del41(1)|p.G279_R280delGR(1)|p.F270_D281del12(1)|p.G279fs*59(1)|p.D281fs*24(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCGCCGGTCTCTCCCAGGACA	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	154	Substitution - Missense(130)|Deletion - In frame(8)|Whole gene deletion(8)|Deletion - Frameshift(6)|Unknown(2)	urinary_tract(50)|breast(22)|lung(20)|upper_aerodigestive_tract(14)|haematopoietic_and_lymphoid_tissue(8)|large_intestine(5)|central_nervous_system(5)|stomach(4)|biliary_tract(4)|oesophagus(4)|skin(4)|ovary(4)|bone(4)|prostate(3)|small_intestine(1)|endometrium(1)|vagina(1)	GRCh37	CM993218	TP53	M	rs121912660						77.0	67.0	70.0					17																	7577099		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.839G>A	17.37:g.7577099C>T	ENSP00000269305:p.Arg280Lys		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R280K	ENST00000269305.4	37	c.839	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	36	5.663043	0.96745	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99854	-7.19;-7.19;-7.19;-7.19;-7.19;-7.19	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99885	0.9945	M	0.92649	3.33	0.80722	D	1	D;D;D;P	0.69078	0.972;0.997;0.977;0.896	D;D;D;D	0.85130	0.942;0.997;0.941;0.921	D	0.96400	0.9296	10	0.87932	D	0	-21.0303	16.1198	0.81342	0.0:1.0:0.0:0.0	.	280;280;280;280	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	K	280;280;280;280;280;269;148	ENSP00000352610:R280K;ENSP00000269305:R280K;ENSP00000398846:R280K;ENSP00000391127:R280K;ENSP00000391478:R280K;ENSP00000425104:R148K	ENSP00000269305:R280K	R	-	2	0	TP53	7517824	0.978000	0.34361	1.000000	0.80357	0.980000	0.70556	7.587000	0.82613	2.667000	0.90743	0.462000	0.41574	AGA	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	45	0.00	0	C	NM_000546		7577099	7577099	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	11	63.33	19	SNP	1.000	T
TRRAP	8295	genome.wustl.edu	37	7	98493397	98493397	+	Missense_Mutation	SNP	T	T	C			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr7:98493397T>C	ENST00000359863.4	+	7	670	c.461T>C	c.(460-462)tTt>tCt	p.F154S	TRRAP_ENST00000446306.3_Missense_Mutation_p.F154S|TRRAP_ENST00000355540.3_Missense_Mutation_p.F154S	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	154					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			ATTCATCATTTTCTGGATTTT	0.279																																						dbGAP											0													82.0	78.0	79.0					7																	98493397		2200	4298	6498	-	-	-	SO:0001583	missense	0			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.461T>C	7.37:g.98493397T>C	ENSP00000352925:p.Phe154Ser		A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.F154S	ENST00000359863.4	37	c.461	CCDS59066.1	7	.	.	.	.	.	.	.	.	.	.	T	20.2	3.941441	0.73557	.	.	ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306	T;T	0.65178	3.47;-0.14	5.74	5.74	0.90152	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80025	0.4548	M	0.79926	2.475	0.80722	D	1	D;D	0.57899	0.981;0.967	D;D	0.68621	0.959;0.91	T	0.82782	-0.0287	10	0.87932	D	0	.	16.3426	0.83092	0.0:0.0:0.0:1.0	.	154;154	Q9Y4A5-2;Q9Y4A5	.;TRRAP_HUMAN	S	154	ENSP00000352925:F154S;ENSP00000347733:F154S	ENSP00000347733:F154S	F	+	2	0	TRRAP	98331333	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.770000	0.85390	2.317000	0.78254	0.460000	0.39030	TTT	TRRAP	-	superfamily_ARM-type_fold	ENSG00000196367		0.279	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	HGNC	protein_coding	OTTHUMT00000317978.1	63	0.00	0	T	NM_003496		98493397	98493397	+1	no_errors	ENST00000359863	ensembl	human	known	69_37n	missense	59	19.18	14	SNP	1.000	C
UBAP2L	9898	genome.wustl.edu	37	1	154231333	154231333	+	Intron	SNP	G	G	A			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr1:154231333G>A	ENST00000361546.2	+	20	2484				UBAP2L_ENST00000428931.1_Intron|SNORA58_ENST00000364259.1_RNA|UBAP2L_ENST00000343815.6_Intron|UBAP2L_ENST00000271877.7_Intron			Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like						binding of sperm to zona pellucida (GO:0007339)		poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|prostate(1)|urinary_tract(2)	50	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			GAAATAATCCGTGTCCTGTTC	0.358																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC003170	CCDS1063.1, CCDS44229.1, CCDS72925.1	1q21.3	2008-02-05			ENSG00000143569	ENSG00000143569			29877	protein-coding gene	gene with protein product						8590280, 11230159	Standard	NM_014847		Approved	NICE-4, KIAA0144	uc001fep.4	Q14157	OTTHUMG00000035983	ENST00000361546.2:c.2443-120G>A	1.37:g.154231333G>A			B4E0U8|Q5VU75|Q5VU76|Q9BTU3|Q9UGL2|Q9UGL3|Q9UGL4|Q9UGL5	RNA	SNP	-	NULL	ENST00000361546.2	37	NULL	CCDS1063.1	1																																																																																			UBAP2L	-	-	ENSG00000143569		0.358	UBAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBAP2L	HGNC	protein_coding	OTTHUMT00000087673.1	118	0.00	0	G	NM_014847		154231333	154231333	+1	no_errors	ENST00000484696	ensembl	human	known	69_37n	rna	65	50.00	65	SNP	0.000	A
TTC24	164118	genome.wustl.edu	37	1	156551235	156551235	+	Nonsense_Mutation	SNP	A	A	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr1:156551235A>T	ENST00000368237.3	+	1	79	c.79A>T	c.(79-81)Aga>Tga	p.R27*	TTC24_ENST00000368236.3_Nonsense_Mutation_p.R27*			A2A3L6	TTC24_HUMAN	tetratricopeptide repeat domain 24	27	Poly-Lys.									breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|prostate(1)	20	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AAAGAAGAAAAGAAAGTGGCT	0.562																																						dbGAP											0													29.0	29.0	29.0					1																	156551235		692	1591	2283	-	-	-	SO:0001587	stop_gained	0				CCDS53379.1	1q22	2013-01-10			ENSG00000187862	ENSG00000187862		"""Tetratricopeptide (TTC) repeat domain containing"""	32348	protein-coding gene	gene with protein product							Standard	NM_001105669		Approved		uc021pbf.1	A2A3L6	OTTHUMG00000033202	ENST00000368237.3:c.79A>T	1.37:g.156551235A>T	ENSP00000357220:p.Arg27*		Q5T3H7	Nonsense_Mutation	SNP	pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R27*	ENST00000368237.3	37	c.79	CCDS53379.1	1	.	.	.	.	.	.	.	.	.	.	A	29.3	4.991696	0.93106	.	.	ENSG00000187862	ENST00000368236;ENST00000368237	.	.	.	4.02	1.58	0.23477	.	0.587090	0.14138	N	0.338897	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.0245	5.8816	0.18858	0.7399:0.1674:0.0927:0.0	.	.	.	.	X	27	.	ENSP00000357219:R27X	R	+	1	2	TTC24	154817859	0.014000	0.17966	0.001000	0.08648	0.494000	0.33585	1.509000	0.35780	0.195000	0.20347	0.379000	0.24179	AGA	TTC24	-	NULL	ENSG00000187862		0.562	TTC24-006	NOVEL	basic|appris_principal|CCDS	protein_coding	TTC24	HGNC	protein_coding	OTTHUMT00000158547.1	22	0.00	0	A	XM_089384		156551235	156551235	+1	no_errors	ENST00000368236	ensembl	human	known	69_37n	nonsense	24	38.46	15	SNP	0.001	T
USP34	9736	genome.wustl.edu	37	2	61441300	61441300	+	Silent	SNP	C	C	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr2:61441300C>T	ENST00000398571.2	-	68	8653	c.8577G>A	c.(8575-8577)agG>agA	p.R2859R	USP34_ENST00000472689.1_5'UTR	NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	2859					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			CACAGCAGAGCCTCAGAATGC	0.493																																						dbGAP											0													101.0	98.0	99.0					2																	61441300		2085	4229	6314	-	-	-	SO:0001819	synonymous_variant	0			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.8577G>A	2.37:g.61441300C>T			A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.A619T	ENST00000398571.2	37	c.1855	CCDS42686.1	2	.	.	.	.	.	.	.	.	.	.	C	7.982	0.751445	0.15778	.	.	ENSG00000115464	ENST00000411912	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	T	0.64994	0.2649	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62315	-0.6880	4	.	.	.	.	12.7469	0.57285	0.1288:0.747:0.1242:0.0	.	.	.	.	T	619	.	.	A	-	1	0	USP34	61294804	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.425000	0.34859	2.738000	0.93877	0.591000	0.81541	GCT	USP34	-	superfamily_ARM-type_fold	ENSG00000115464		0.493	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP34	HGNC	protein_coding	OTTHUMT00000325650.4	65	0.00	0	C			61441300	61441300	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000411912	ensembl	human	novel	69_37n	missense	45	18.18	10	SNP	1.000	T
UNC80	285175	genome.wustl.edu	37	2	210705293	210705293	+	Nonsense_Mutation	SNP	C	C	G			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr2:210705293C>G	ENST00000439458.1	+	20	3364	c.3284C>G	c.(3283-3285)tCa>tGa	p.S1095*	UNC80_ENST00000272845.6_Nonsense_Mutation_p.S1090*	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1095					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						TCATCCCTCTCAGGCCTGGCA	0.423																																						dbGAP											0													146.0	124.0	131.0					2																	210705293		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.3284C>G	2.37:g.210705293C>G	ENSP00000391088:p.Ser1095*		B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Nonsense_Mutation	SNP	NULL	p.S1095*	ENST00000439458.1	37	c.3284	CCDS46504.1	2	.	.	.	.	.	.	.	.	.	.	C	44	11.169577	0.99525	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	.	.	.	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-9.2268	20.3731	0.98895	0.0:1.0:0.0:0.0	.	.	.	.	X	1095;1090	.	ENSP00000272845:S1090X	S	+	2	0	UNC80	210413538	1.000000	0.71417	0.995000	0.50966	0.989000	0.77384	7.798000	0.85924	2.829000	0.97493	0.650000	0.86243	TCA	UNC80	-	NULL	ENSG00000144406		0.423	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	HGNC	protein_coding		38	0.00	0	C	NM_182587		210705293	210705293	+1	no_errors	ENST00000439458	ensembl	human	known	69_37n	nonsense	25	13.33	4	SNP	1.000	G
WASH3P	374666	genome.wustl.edu	37	15	102514187	102514187	+	RNA	SNP	C	C	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr15:102514187C>T	ENST00000557932.1	+	0	780				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						CCTGACCTGCCCGGCATTACC	0.582																																						dbGAP											0																																										-	-	-			0					15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102514187C>T				RNA	SNP	-	NULL	ENST00000557932.1	37	NULL		15	.	.	.	.	.	.	.	.	.	.	c	6.270	0.417989	0.11870	.	.	ENSG00000185596	ENST00000338304;ENST00000398121;ENST00000378819	.	.	.	0.906	0.906	0.19314	.	0.000000	0.85682	D	0.000000	T	0.41488	0.1161	.	.	.	0.45515	D	0.998477	.	.	.	.	.	.	T	0.50039	-0.8874	4	.	.	.	-17.5294	7.6988	0.28611	0.0:1.0:0.0:0.0	.	.	.	.	L	263;252;251	.	.	P	+	2	0	WASH3P	100331710	1.000000	0.71417	0.749000	0.31150	0.474000	0.32979	6.429000	0.73387	0.793000	0.33875	0.184000	0.17185	CCC	WASH3P	-	-	ENSG00000185596		0.582	WASH3P-001	KNOWN	basic	processed_transcript	WASH3P	HGNC	pseudogene	OTTHUMT00000417608.1	178	0.00	0	C	NM_199163		102514187	102514187	+1	no_errors	ENST00000557932	ensembl	human	known	69_37n	rna	54	18.18	12	SNP	1.000	T
ZBTB40	9923	genome.wustl.edu	37	1	22852823	22852823	+	Silent	SNP	C	C	T	rs558000429		TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr1:22852823C>T	ENST00000375647.4	+	18	3861	c.3654C>T	c.(3652-3654)ctC>ctT	p.L1218L	ZBTB40_ENST00000404138.1_Silent_p.L1218L|ZBTB40_ENST00000374651.4_Silent_p.L1106L	NM_014870.3	NP_055685.3	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	1218					bone mineralization (GO:0030282)|cellular response to DNA damage stimulus (GO:0006974)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(4)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		GCTCTGAGCTCGTGGCGGTGA	0.582													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20188	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													145.0	132.0	136.0					1																	22852823		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB007947	CCDS224.1	1p36	2013-01-08			ENSG00000184677	ENSG00000184677		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	29045	protein-coding gene	gene with protein product		612106					Standard	NM_014870		Approved	KIAA0478, ZNF923	uc001bfu.2	Q9NUA8	OTTHUMG00000002897	ENST00000375647.4:c.3654C>T	1.37:g.22852823C>T			O75066|Q5TFU5|Q8N1R1	Silent	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.L1218	ENST00000375647.4	37	c.3654	CCDS224.1	1																																																																																			ZBTB40	-	NULL	ENSG00000184677		0.582	ZBTB40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB40	HGNC	protein_coding	OTTHUMT00000008094.1	126	0.00	0	C	NM_014870		22852823	22852823	+1	no_errors	ENST00000375647	ensembl	human	known	69_37n	silent	40	13.04	6	SNP	0.745	T
ZNF586	54807	genome.wustl.edu	37	19	58290715	58290715	+	Nonsense_Mutation	SNP	A	A	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr19:58290715A>T	ENST00000396154.2	+	3	933	c.760A>T	c.(760-762)Aga>Tga	p.R254*	ZNF586_ENST00000598885.1_Intron|ZNF586_ENST00000396150.4_Nonstop_Mutation_p.*211C|ZNF586_ENST00000598183.1_Intron|ZNF586_ENST00000599802.1_Intron|ZNF586_ENST00000391702.3_Nonsense_Mutation_p.R211*	NM_017652.3	NP_060122.2	Q9NXT0	ZN586_HUMAN	zinc finger protein 586	254					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)	15		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TAAACACTTGAGAGTTCACAC	0.443																																						dbGAP											0													77.0	84.0	82.0					19																	58290715		2190	4300	6490	-	-	-	SO:0001587	stop_gained	0			AK095993	CCDS42640.1, CCDS56107.1, CCDS56108.1	19q13.43	2013-01-08				ENSG00000083828		"""Zinc fingers, C2H2-type"", ""-"""	25949	protein-coding gene	gene with protein product						12477932	Standard	NM_017652		Approved	FLJ20070	uc002qqd.3	Q9NXT0		ENST00000396154.2:c.760A>T	19.37:g.58290715A>T	ENSP00000379458:p.Arg254*		A0JLV8|A8MY63|B3KTS9|E7ERT1|G3XAH3	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R254*	ENST00000396154.2	37	c.760	CCDS42640.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.14|18.14	3.556998|3.556998	0.65425|0.65425	.|.	.|.	ENSG00000083828|ENSG00000083828	ENST00000449441;ENST00000391702;ENST00000396154|ENST00000396150	.|.	.|.	.|.	1.65|1.65	1.65|1.65	0.23941|0.23941	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.02654|.	T|.	1|.	.|.	8.1155|8.1155	0.30940|0.30940	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|.	.|.	.|.	X|C	254;211;254|211	.|.	ENSP00000375583:R211X|.	R|X	+|+	1|3	2|0	ZNF586|ZNF586	62982527|62982527	0.007000|0.007000	0.16637|0.16637	0.010000|0.010000	0.14722|0.14722	0.029000|0.029000	0.11900|0.11900	0.257000|0.257000	0.18369|0.18369	0.732000|0.732000	0.32470|0.32470	0.533000|0.533000	0.62120|0.62120	AGA|TGA	ZNF586	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000083828		0.443	ZNF586-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF586	HGNC	protein_coding	OTTHUMT00000466825.2	43	0.00	0	A	NM_017652		58290715	58290715	+1	no_errors	ENST00000396154	ensembl	human	known	69_37n	nonsense	22	42.11	16	SNP	0.140	T
ZNF589	51385	genome.wustl.edu	37	3	48298422	48298422	+	Intron	SNP	C	C	T			TCGA-LL-A5YP-01A-21D-A28B-09	TCGA-LL-A5YP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	a6206343-6d41-485a-8992-3a466df43286	fe144218-875d-423c-80d7-05de5b2e1496	g.chr3:48298422C>T	ENST00000354698.3	+	3	168				ZNF589_ENST00000454212.1_3'UTR|ZNF589_ENST00000412564.1_Intron|ZNF589_ENST00000427617.2_Intron|ZNF589_ENST00000440261.2_Intron	NM_016089.2	NP_057173.2	Q86UQ0	ZN589_HUMAN	zinc finger protein 589						regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(1)|ovary(1)|skin(1)	4				BRCA - Breast invasive adenocarcinoma(193;0.000649)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GCCTCAAAGGCCGCCATCTTG	0.502																																					Colon(9;319 328 25374 27611 50948)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF114816	CCDS43085.1	3p21	2013-01-08			ENSG00000164048	ENSG00000164048		"""Zinc fingers, C2H2-type"", ""-"""	16747	protein-coding gene	gene with protein product						10029171	Standard	NM_016089		Approved	SZF1	uc003csl.4	Q86UQ0	OTTHUMG00000156833	ENST00000354698.3:c.97-3881C>T	3.37:g.48298422C>T			Q86UC9|Q9BRI6|Q9BRY3|Q9Y611|Q9Y612	RNA	SNP	-	NULL	ENST00000354698.3	37	NULL	CCDS43085.1	3																																																																																			ZNF589	-	-	ENSG00000164048		0.502	ZNF589-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF589	HGNC	protein_coding	OTTHUMT00000346124.1	31	0.00	0	C	NM_016089		48298422	48298422	+1	no_errors	ENST00000454212	ensembl	human	known	69_37n	rna	8	55.56	10	SNP	0.022	T
