#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCB7	22	genome.wustl.edu	37	X	74296484	74296484	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chrX:74296484C>T	ENST00000373394.3	-	5	466	c.459G>A	c.(457-459)atG>atA	p.M153I	ABCB7_ENST00000534570.1_5'Flank|ABCB7_ENST00000339447.4_Missense_Mutation_p.M113I|ABCB7_ENST00000253577.3_Missense_Mutation_p.M154I			O75027	ABCB7_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 7	153	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)			breast(1)|endometrium(5)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)	20						CCACAATATTCATGGCCTAAA	0.323																																						dbGAP											0													90.0	70.0	77.0					X																	74296484		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF038950	CCDS14428.1, CCDS65290.1, CCDS65291.1, CCDS75994.1	Xq13.3	2012-03-14			ENSG00000131269	ENSG00000131269		"""ATP binding cassette transporters / subfamily B"""	48	protein-coding gene	gene with protein product		300135		ABC7		9143506	Standard	NM_004299		Approved	EST140535, Atm1p, ASAT	uc004ebz.4	O75027	OTTHUMG00000021862	ENST00000373394.3:c.459G>A	X.37:g.74296484C>T	ENSP00000362492:p.Met153Ile		G3XAC4|O75345|Q5VWY7|Q5VWY8|Q9BRE1|Q9UND1|Q9UP01	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.M154I	ENST00000373394.3	37	c.462		X	.	.	.	.	.	.	.	.	.	.	C	15.30	2.792426	0.50102	.	.	ENSG00000131269	ENST00000535115;ENST00000253577;ENST00000339447;ENST00000373394;ENST00000529949;ENST00000534524;ENST00000526404	D;D;D;D;D	0.91068	-2.45;-2.45;-2.45;-2.45;-2.78	5.4	5.4	0.78164	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.131184	0.64402	D	0.000001	T	0.74884	0.3775	N	0.00385	-1.57	0.51233	D	0.999913	B;B;B;B;B	0.22800	0.002;0.027;0.075;0.002;0.061	B;B;B;B;B	0.29440	0.001;0.047;0.102;0.001;0.061	T	0.73266	-0.4037	10	0.27785	T	0.31	-2.1973	17.1188	0.86696	0.0:1.0:0.0:0.0	.	127;113;154;153;154	G3V1J3;G3XAC4;B3KM98;O75027;O75027-2	.;.;.;ABCB7_HUMAN;.	I	127;154;113;153;127;98;166	ENSP00000253577:M154I;ENSP00000343849:M113I;ENSP00000362492:M153I;ENSP00000436586:M127I;ENSP00000435521:M98I	ENSP00000253577:M154I	M	-	3	0	ABCB7	74213209	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.351000	0.66022	2.252000	0.74401	0.544000	0.68410	ATG	ABCB7	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000131269		0.323	ABCB7-002	KNOWN	basic|appris_candidate	protein_coding	ABCB7	HGNC	protein_coding	OTTHUMT00000057274.1	95	0.00	0	C	NM_004299		74296484	74296484	-1	no_errors	ENST00000253577	ensembl	human	known	69_37n	missense	37	40.32	25	SNP	1.000	T
ANKRD12	23253	genome.wustl.edu	37	18	9256119	9256122	+	Frame_Shift_Del	DEL	AAAG	AAAG	-			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	AAAG	AAAG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr18:9256119_9256122delAAAG	ENST00000262126.4	+	9	3094_3097	c.2854_2857delAAAG	c.(2854-2859)aaagaafs	p.KE952fs	ANKRD12_ENST00000383440.2_Frame_Shift_Del_p.KE929fs|ANKRD12_ENST00000400020.3_Frame_Shift_Del_p.KE929fs	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	952						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						AGGCAAAAATAAAGAAAAAGACAG	0.289																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.2854_2857delAAAG	18.37:g.9256119_9256122delAAAG	ENSP00000262126:p.Lys952fs		O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Frame_Shift_Del	DEL	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E953fs	ENST00000262126.4	37	c.2854_2857	CCDS11843.1	18																																																																																			ANKRD12	-	NULL	ENSG00000101745		0.289	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	HGNC	protein_coding	OTTHUMT00000254478.2	28	0.00	0	AAAG	NM_015208		9256119	9256122	+1	no_errors	ENST00000262126	ensembl	human	known	69_37n	frame_shift_del	10	37.50	6	DEL	0.994:0.999:1.000:1.000	-
ATG9A	79065	genome.wustl.edu	37	2	220090180	220090180	+	Silent	SNP	C	C	T			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr2:220090180C>T	ENST00000409618.1	-	6	766	c.327G>A	c.(325-327)aaG>aaA	p.K109K	AC068946.1_ENST00000408417.1_RNA|ATG9A_ENST00000396761.2_Silent_p.K109K|ATG9A_ENST00000488833.1_5'Flank|ATG9A_ENST00000361242.4_Silent_p.K109K|ATG9A_ENST00000409422.1_Silent_p.K48K			Q7Z3C6	ATG9A_HUMAN	autophagy related 9A	109					autophagic vacuole assembly (GO:0000045)|late nucleophagy (GO:0044805)|mitochondrion degradation (GO:0000422)|piecemeal microautophagy of nucleus (GO:0034727)|protein localization to pre-autophagosomal structure (GO:0034497)|protein transport (GO:0015031)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)				endometrium(2)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|stomach(1)	13		Renal(207;0.0474)		Epithelial(149;1.37e-06)|all cancers(144;0.000222)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCAGAGTGACCTTGACGGGTT	0.522																																						dbGAP											0													123.0	128.0	126.0					2																	220090180		2027	4189	6216	-	-	-	SO:0001819	synonymous_variant	0			AK021732	CCDS42820.1	2q35	2014-02-12	2012-06-06	2005-09-11	ENSG00000198925	ENSG00000198925			22408	protein-coding gene	gene with protein product		612204	"""APG9 autophagy 9-like 1 (S. cerevisiae)"", ""ATG9 autophagy related 9 homolog A (S. cerevisiae)"""	APG9L1			Standard	NM_024085		Approved	FLJ22169	uc002vkf.1	Q7Z3C6	OTTHUMG00000154557	ENST00000409618.1:c.327G>A	2.37:g.220090180C>T			Q3ZAQ6|Q6P0N7|Q7Z317|Q7Z320|Q8NDK6|Q8WU65|Q9BVL5|Q9H6L1|Q9HAG7	Silent	SNP	pfam_Autophagy-rel_prot_9,superfamily_Cyt_c_oxidase_su3	p.K109	ENST00000409618.1	37	c.327	CCDS42820.1	2																																																																																			ATG9A	-	NULL	ENSG00000198925		0.522	ATG9A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ATG9A	HGNC	protein_coding	OTTHUMT00000335930.1	94	0.00	0	C	NM_024085		220090180	220090180	-1	no_errors	ENST00000361242	ensembl	human	known	69_37n	silent	42	23.64	13	SNP	1.000	T
ATP8B2	57198	genome.wustl.edu	37	1	154319121	154319121	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr1:154319121C>T	ENST00000368489.3	+	26	3149	c.3149C>T	c.(3148-3150)aCg>aTg	p.T1050M		NM_020452.3	NP_065185.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	1036					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)		IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			GGCTACTGGACGGCCATCAAC	0.547																																						dbGAP											0													201.0	143.0	163.0					1																	154319121		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	ENST00000368489.3:c.3149C>T	1.37:g.154319121C>T	ENSP00000357475:p.Thr1050Met		B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.T1050M	ENST00000368489.3	37	c.3149	CCDS1066.1	1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.601562	0.87055	.	.	ENSG00000143515	ENST00000368489	T	0.66099	-0.19	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	D	0.85792	0.5779	H	0.98542	4.26	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.91193	0.4985	10	0.87932	D	0	.	16.7081	0.85377	0.0:1.0:0.0:0.0	.	1050	P98198-3	.	M	1050	ENSP00000357475:T1050M	ENSP00000357475:T1050M	T	+	2	0	ATP8B2	152585745	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	7.647000	0.83462	2.512000	0.84698	0.655000	0.94253	ACG	ATP8B2	-	tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000143515		0.547	ATP8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8B2	HGNC	protein_coding	OTTHUMT00000087658.2	126	0.00	0	C	NM_020452		154319121	154319121	+1	no_errors	ENST00000368489	ensembl	human	known	69_37n	missense	49	28.99	20	SNP	1.000	T
BRPF3	27154	genome.wustl.edu	37	6	36182131	36182131	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr6:36182131G>A	ENST00000357641.6	+	8	3210	c.2957G>A	c.(2956-2958)gGg>gAg	p.G986E	BRPF3_ENST00000534400.1_Missense_Mutation_p.G986E|BRPF3_ENST00000443324.2_Intron|BRPF3_ENST00000534694.1_Intron|BRPF3_ENST00000543502.1_Intron|BRPF3_ENST00000339717.7_Intron	NM_015695.2	NP_056510.2	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	986					blood coagulation (GO:0007596)|histone H3 acetylation (GO:0043966)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	cytosol (GO:0005829)|extracellular region (GO:0005576)|MOZ/MORF histone acetyltransferase complex (GO:0070776)	zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	40						GAGAGCGAAGGGGAGAGGTCC	0.602																																						dbGAP											0													34.0	42.0	39.0					6																	36182131		2200	4298	6498	-	-	-	SO:0001583	missense	0			AB033112	CCDS34437.1	6p21.31	2008-02-05			ENSG00000096070	ENSG00000096070			14256	protein-coding gene	gene with protein product						10574462	Standard	NM_015695		Approved	KIAA1286	uc003olv.4	Q9ULD4	OTTHUMG00000014589	ENST00000357641.6:c.2957G>A	6.37:g.36182131G>A	ENSP00000350267:p.Gly986Glu		A6ND56|A6NJE2|B7ZLN5|E7EX85|Q17RB6|Q5R3K8	Missense_Mutation	SNP	pfam_Enhancer_polycomb-like_N,pfam_Bromodomain,pfam_PWWP,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Bromodomain,smart_PWWP,pfscan_PWWP,pfscan_Znf_PHD-finger,pfscan_Bromodomain,prints_Bromodomain	p.G986E	ENST00000357641.6	37	c.2957	CCDS34437.1	6	.	.	.	.	.	.	.	.	.	.	G	3.841	-0.033824	0.07543	.	.	ENSG00000096070	ENST00000357641;ENST00000534400;ENST00000394572	T;T	0.14516	2.64;2.5	5.69	5.69	0.88448	.	0.201065	0.45126	D	0.000400	T	0.03695	0.0105	L	0.27053	0.805	0.80722	D	1	B	0.30824	0.296	B	0.31101	0.124	T	0.06807	-1.0806	10	0.05833	T	0.94	.	15.1368	0.72572	0.0:0.1403:0.8597:0.0	.	986	Q9ULD4	BRPF3_HUMAN	E	986;986;400	ENSP00000350267:G986E;ENSP00000436504:G986E	ENSP00000350267:G986E	G	+	2	0	BRPF3	36290109	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.337000	0.43947	2.673000	0.90976	0.455000	0.32223	GGG	BRPF3	-	NULL	ENSG00000096070		0.602	BRPF3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	BRPF3	HGNC	protein_coding	OTTHUMT00000040335.3	78	0.00	0	G	NM_015695		36182131	36182131	+1	no_errors	ENST00000357641	ensembl	human	known	69_37n	missense	21	25.00	7	SNP	1.000	A
TMEM256	254863	genome.wustl.edu	37	17	7307396	7307396	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr17:7307396C>T	ENST00000302422.3	-	1	60	c.8G>A	c.(7-9)gGg>gAg	p.G3E	TMEM256-PLSCR3_ENST00000535512.1_5'UTR|NLGN2_ENST00000575301.1_5'Flank|C17orf61-PLSCR3_ENST00000573331.1_Missense_Mutation_p.G3E	NM_152766.3	NP_689979.1	Q8N2U0	TM256_HUMAN	transmembrane protein 256	3						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											TGCAGCTGGCCCGGCCATAGC	0.667																																						dbGAP											0													10.0	13.0	12.0					17																	7307396		2172	4262	6434	-	-	-	SO:0001583	missense	0			BC030270	CCDS11102.1	17p13.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000205544	ENSG00000205544			28618	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 61"""	C17orf61		12477932	Standard	NM_152766		Approved	MGC40107	uc002ggs.3	Q8N2U0	OTTHUMG00000132900	ENST00000302422.3:c.8G>A	17.37:g.7307396C>T	ENSP00000301939:p.Gly3Glu			Missense_Mutation	SNP	pfam_DUF423	p.G3E	ENST00000302422.3	37	c.8	CCDS11102.1	17	.	.	.	.	.	.	.	.	.	.	C	13.38	2.220742	0.39201	.	.	ENSG00000205544	ENST00000302422	.	.	.	4.97	3.97	0.46021	.	0.803616	0.11186	N	0.590395	T	0.37999	0.1024	L	0.40543	1.245	0.09310	N	1	B	0.20052	0.041	B	0.24155	0.051	T	0.28202	-1.0051	9	0.11182	T	0.66	1.4759	10.9755	0.47463	0.0:0.8114:0.1886:0.0	.	3	Q8N2U0	CQ061_HUMAN	E	3	.	ENSP00000301939:G3E	G	-	2	0	C17orf61	7248120	0.001000	0.12720	0.001000	0.08648	0.003000	0.03518	0.866000	0.27954	1.258000	0.44101	0.561000	0.74099	GGG	C17orf61	-	NULL	ENSG00000205544		0.667	TMEM256-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf61	HGNC	protein_coding	OTTHUMT00000256404.1	49	0.00	0	C	NM_152766		7307396	7307396	-1	no_errors	ENST00000302422	ensembl	human	known	69_37n	missense	31	18.42	7	SNP	0.005	T
C22orf23	84645	genome.wustl.edu	37	22	38340200	38340200	+	Silent	SNP	C	C	T			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr22:38340200C>T	ENST00000249079.2	-	7	892	c.636G>A	c.(634-636)aaG>aaA	p.K212K	C22orf23_ENST00000403305.1_Silent_p.K212K|C22orf23_ENST00000403026.1_Silent_p.K212K			Q9BZE7	EVG1_HUMAN	chromosome 22 open reading frame 23	212										endometrium(3)|kidney(2)|large_intestine(7)	12	Melanoma(58;0.045)					TGGCAAGACCCTTCCTAAGTT	0.562																																						dbGAP											0													163.0	131.0	142.0					22																	38340200		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF324466	CCDS13962.1, CCDS74860.1	22q13.1	2013-10-11			ENSG00000128346	ENSG00000128346			18589	protein-coding gene	gene with protein product						11237012	Standard	NM_032561		Approved	FLJ32787, EVG1, LOC84645	uc003auj.2	Q9BZE7	OTTHUMG00000150672	ENST00000249079.2:c.636G>A	22.37:g.38340200C>T			Q5JYU9|Q96M68	Silent	SNP	pfam_UPF0193	p.K212	ENST00000249079.2	37	c.636	CCDS13962.1	22																																																																																			C22orf23	-	pfam_UPF0193	ENSG00000128346		0.562	C22orf23-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C22orf23	HGNC	protein_coding	OTTHUMT00000319564.1	133	0.00	0	C	NM_032561		38340200	38340200	-1	no_errors	ENST00000249079	ensembl	human	known	69_37n	silent	42	28.81	17	SNP	0.973	T
LINC00696	100128378	genome.wustl.edu	37	3	52097497	52097497	+	Nonsense_Mutation	SNP	G	G	C			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr3:52097497G>C	ENST00000541313.1	-	1	70	c.71C>G	c.(70-72)tCa>tGa	p.S24*				Q6ZRV3	CC074_HUMAN	long intergenic non-protein coding RNA 696	24																	gggatcttttgagaaggtgga	0.597																																						dbGAP											0													9.0	10.0	10.0					3																	52097497		864	1972	2836	-	-	-	SO:0001587	stop_gained	0			AK127958		3p21.1	2013-01-16	2012-11-20	2012-11-20				"""Long non-coding RNAs"""	34426	non-coding RNA	RNA, long non-coding			"""chromosome 3 open reading frame 74"""	C3orf74			Standard	NR_027331		Approved		uc010hmb.2	Q6ZRV3		ENST00000541313.1:c.71C>G	3.37:g.52097497G>C	ENSP00000437714:p.Ser24*			Nonsense_Mutation	SNP	NULL	p.S24*	ENST00000541313.1	37	c.71		3	.	.	.	.	.	.	.	.	.	.	G	13.37	2.215828	0.39102	.	.	ENSG00000256097	ENST00000541313	.	.	.	1.32	1.32	0.21799	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	6.0504	0.19783	0.0:0.0:1.0:0.0	.	.	.	.	X	24	.	ENSP00000437714:S24X	S	-	2	0	C3orf74	52072537	0.000000	0.05858	0.384000	0.26145	0.440000	0.31957	0.404000	0.20999	1.064000	0.40671	0.591000	0.81541	TCA	C3orf74	-	NULL	ENSG00000256097		0.597	LINC00696-201	KNOWN	basic|appris_principal	protein_coding	C3orf74	HGNC	protein_coding		46	0.00	0	G	NR_027331		52097497	52097497	-1	no_errors	ENST00000541313	ensembl	human	known	69_37n	nonsense	15	40.00	10	SNP	0.401	C
CHD8	57680	genome.wustl.edu	37	14	21868628	21868628	+	Missense_Mutation	SNP	C	C	A			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr14:21868628C>A	ENST00000557364.1	-	23	4777	c.4514G>T	c.(4513-4515)tGg>tTg	p.W1505L	CHD8_ENST00000555962.1_Intron|CHD8_ENST00000430710.3_Missense_Mutation_p.W1226L|CHD8_ENST00000399982.2_Missense_Mutation_p.W1505L			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1505					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		AATCAAGTCCCAGATGAAGCC	0.398																																						dbGAP											0													45.0	44.0	44.0					14																	21868628		1846	4084	5930	-	-	-	SO:0001583	missense	0			AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.4514G>T	14.37:g.21868628C>A	ENSP00000451601:p.Trp1505Leu		Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_BRK_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.W1505L	ENST00000557364.1	37	c.4514	CCDS53885.1	14	.	.	.	.	.	.	.	.	.	.	C	20.7	4.038172	0.75617	.	.	ENSG00000100888	ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364	D;D;D	0.98028	-4.67;-4.67;-4.67	4.83	4.83	0.62350	.	0.136076	0.53938	D	0.000058	D	0.98566	0.9521	M	0.87456	2.885	0.80722	D	1	P;D	0.58268	0.898;0.982	P;P	0.60682	0.714;0.878	D	0.98745	1.0718	10	0.44086	T	0.13	-11.7211	16.8554	0.86004	0.0:1.0:0.0:0.0	.	1505;1226	Q9HCK8;Q9HCK8-2	CHD8_HUMAN;.	L	1226;1505;1225;1505	ENSP00000406288:W1226L;ENSP00000382863:W1505L;ENSP00000451601:W1505L	ENSP00000262707:W1225L	W	-	2	0	CHD8	20938468	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.651000	0.83577	2.493000	0.84123	0.655000	0.94253	TGG	CHD8	-	NULL	ENSG00000100888		0.398	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD8	HGNC	protein_coding	OTTHUMT00000410436.1	61	0.00	0	C	NM_020920		21868628	21868628	-1	no_errors	ENST00000399982	ensembl	human	known	69_37n	missense	18	25.00	6	SNP	1.000	A
CUL5	8065	genome.wustl.edu	37	11	107959361	107959361	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr11:107959361delA	ENST00000393094.2	+	12	1902	c.1286delA	c.(1285-1287)gagfs	p.E429fs		NM_003478.3	NP_003469.2	Q93034	CUL5_HUMAN	cullin 5	429					calcium ion transmembrane transport (GO:0070588)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cytosolic calcium ion homeostasis (GO:0051480)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|response to osmotic stress (GO:0006970)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul5-RING ubiquitin ligase complex (GO:0031466)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|receptor activity (GO:0004872)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(1)|prostate(1)|skin(1)	23		all_cancers(61;7.09e-10)|all_epithelial(67;2.97e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|Melanoma(852;4.48e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;3.58e-05)|Epithelial(105;4.68e-05)|all cancers(92;0.00122)|OV - Ovarian serous cystadenocarcinoma(223;0.217)		ACCTCTGAAGAGATTGAAGCA	0.328																																						dbGAP											0													64.0	65.0	64.0					11																	107959361		2201	4298	6499	-	-	-	SO:0001589	frameshift_variant	0			X81882	CCDS31668.1	11q22.3	2011-05-24			ENSG00000166266	ENSG00000166266			2556	protein-coding gene	gene with protein product		601741				8681378, 9037604	Standard	XM_005271682		Approved	VACM-1	uc001pjv.3	Q93034	OTTHUMG00000166369	ENST00000393094.2:c.1286delA	11.37:g.107959361delA	ENSP00000376808:p.Glu429fs		A8K960|O14766|Q9BZC6	Frame_Shift_Del	DEL	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.E429fs	ENST00000393094.2	37	c.1286	CCDS31668.1	11																																																																																			CUL5	-	pfam_Cullin_N,superfamily_Cullin_homology,pfscan_Cullin_homology	ENSG00000166266		0.328	CUL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL5	HGNC	protein_coding	OTTHUMT00000389429.1	42	0.00	0	A			107959361	107959361	+1	no_errors	ENST00000393094	ensembl	human	known	69_37n	frame_shift_del	10	37.50	6	DEL	1.000	-
DGKD	8527	genome.wustl.edu	37	2	234347021	234347021	+	Missense_Mutation	SNP	C	C	A			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr2:234347021C>A	ENST00000264057.2	+	9	1093	c.1081C>A	c.(1081-1083)Ctc>Atc	p.L361I	DGKD_ENST00000409813.3_Missense_Mutation_p.L317I	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	361	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	AGGCCCACACCTCGGGTAGGA	0.413																																						dbGAP											0													67.0	75.0	72.0					2																	234347021		2203	4300	6503	-	-	-	SO:0001583	missense	0			D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.1081C>A	2.37:g.234347021C>A	ENSP00000264057:p.Leu361Ile		Q14158|Q6PK55|Q8NG53	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_SAM_2,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_SAM_type1,pfam_Pleckstrin_homology,superfamily_SAM/pointed,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_SAM,pfscan_Pleckstrin_homology,pfscan_SAM,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.L361I	ENST00000264057.2	37	c.1081	CCDS2504.1	2	.	.	.	.	.	.	.	.	.	.	C	27.4	4.824073	0.90873	.	.	ENSG00000077044	ENST00000264057;ENST00000409813	T;T	0.21543	2.0;2.0	4.34	4.34	0.51931	Diacylglycerol kinase, catalytic domain (3);	0.000000	0.64402	D	0.000003	T	0.34629	0.0904	L	0.34521	1.04	0.80722	D	1	D;D;P	0.71674	0.967;0.998;0.803	P;D;P	0.77557	0.897;0.99;0.524	T	0.03728	-1.1009	10	0.26408	T	0.33	.	17.4621	0.87622	0.0:1.0:0.0:0.0	.	245;317;361	Q53SE4;Q16760-2;Q16760	.;.;DGKD_HUMAN	I	361;317	ENSP00000264057:L361I;ENSP00000386455:L317I	ENSP00000264057:L361I	L	+	1	0	DGKD	234011760	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	5.879000	0.69690	2.429000	0.82318	0.650000	0.86243	CTC	DGKD	-	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	ENSG00000077044		0.413	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKD	HGNC	protein_coding	OTTHUMT00000257072.2	92	0.00	0	C	NM_003648		234347021	234347021	+1	no_errors	ENST00000264057	ensembl	human	known	69_37n	missense	29	36.96	17	SNP	1.000	A
EPHA7	2045	genome.wustl.edu	37	6	94120444	94120444	+	Missense_Mutation	SNP	T	T	C			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr6:94120444T>C	ENST00000369303.4	-	3	791	c.607A>G	c.(607-609)Aag>Gag	p.K203E	EPHA7_ENST00000369297.1_Missense_Mutation_p.K203E	NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	203	Cys-rich.|Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		CAGCACTTCTTGTAGTACACT	0.433																																						dbGAP											0													79.0	84.0	82.0					6																	94120444		2203	4300	6503	-	-	-	SO:0001583	missense	0			L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.607A>G	6.37:g.94120444T>C	ENSP00000358309:p.Lys203Glu		A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom	p.K203E	ENST00000369303.4	37	c.607	CCDS5031.1	6	.	.	.	.	.	.	.	.	.	.	T	24.2	4.508198	0.85282	.	.	ENSG00000135333	ENST00000369303;ENST00000369297	T;T	0.10763	2.84;2.84	5.66	5.66	0.87406	Tyrosine-protein kinase, receptor class V, conserved site (1);Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.30070	0.0753	M	0.85197	2.74	0.58432	D	0.999997	D;D;D;D	0.71674	0.974;0.994;0.998;0.998	D;P;D;D	0.75484	0.953;0.734;0.977;0.986	T	0.14783	-1.0460	10	0.87932	D	0	.	16.1819	0.81915	0.0:0.0:0.0:1.0	.	203;203;203;203	Q15375-4;Q15375-3;Q15375-2;Q15375	.;.;.;EPHA7_HUMAN	E	203	ENSP00000358309:K203E;ENSP00000358303:K203E	ENSP00000358303:K203E	K	-	1	0	EPHA7	94177165	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.997000	0.88414	2.279000	0.76181	0.533000	0.62120	AAG	EPHA7	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ephrin_rcpt_lig-bd_dom,superfamily_Galactose-bd-like,smart_Ephrin_rcpt_lig-bd_dom	ENSG00000135333		0.433	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA7	HGNC	protein_coding	OTTHUMT00000041545.1	53	0.00	0	T			94120444	94120444	-1	no_errors	ENST00000369303	ensembl	human	known	69_37n	missense	18	28.00	7	SNP	1.000	C
ERCC2	2068	genome.wustl.edu	37	19	45856499	45856499	+	Splice_Site	SNP	C	C	T			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr19:45856499C>T	ENST00000391945.4	-	18	1836		c.e18+1		ERCC2_ENST00000391944.3_Splice_Site	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2						7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		CGCACACCCACCTCCTGGTAC	0.607			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													dbGAP	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	0													76.0	65.0	69.0					19																	45856499		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.1758+1G>A	19.37:g.45856499C>T			Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Splice_Site	SNP	-	e18+1	ENST00000391945.4	37	c.1758+1	CCDS33049.1	19	.	.	.	.	.	.	.	.	.	.	C	29.4	5.000477	0.93227	.	.	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.2199	0.86954	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ERCC2	50548339	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.020000	0.76419	2.667000	0.90743	0.561000	0.74099	.	ERCC2	-	-	ENSG00000104884		0.607	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC2	HGNC	protein_coding	OTTHUMT00000109626.2	37	0.00	0	C	NM_000400	Intron	45856499	45856499	-1	no_errors	ENST00000391945	ensembl	human	known	69_37n	splice_site	17	29.17	7	SNP	1.000	T
ETV5	2119	genome.wustl.edu	37	3	185802069	185802069	+	Intron	DEL	G	G	-	rs367652160		TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr3:185802069delG	ENST00000306376.5	-	6	479				ETV5_ENST00000537818.1_Intron|ETV5_ENST00000434744.1_Intron	NM_004454.2	NP_004445.1	P41161	ETV5_HUMAN	ets variant 5						cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|locomotory behavior (GO:0007626)|male germ-line stem cell asymmetric division (GO:0048133)|neuromuscular synaptic transmission (GO:0007274)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of synapse organization (GO:0050807)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	28	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			GAAAAGAAATGCTaaaaaaaa	0.323			T	"""TMPRSS2, SCL45A3"""	Prostate																																	dbGAP		Dom	yes		3	3q28	2119	ets variant gene 5		E	0																																										-	-	-	SO:0001627	intron_variant	0			BC007333	CCDS33906.1	3q28	2008-09-12	2008-09-12		ENSG00000244405	ENSG00000244405			3494	protein-coding gene	gene with protein product	"""ets-related molecule"""	601600	"""ets variant gene 5 (ets-related molecule)"""			8152800	Standard	NM_004454		Approved	ERM	uc003fpz.3	P41161	OTTHUMG00000156639	ENST00000306376.5:c.233-3105C>-	3.37:g.185802069delG			A6NH46|B7Z7D7|Q6IBN5	Frame_Shift_Del	DEL	pfam_ETS_PEA3_N	p.P78fs	ENST00000306376.5	37	c.233	CCDS33906.1	3																																																																																			ETV5	-	pfam_ETS_PEA3_N	ENSG00000244405		0.323	ETV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV5	HGNC	protein_coding	OTTHUMT00000344947.1	11	0.00	0	G	NM_004454		185802069	185802069	-1	no_stop_codon	ENST00000422039	ensembl	human	novel	69_37n	frame_shift_del	4	33.33	2	DEL	0.005	-
FBRS	64319	genome.wustl.edu	37	16	30673785	30673785	+	5'Flank	SNP	C	C	G			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr16:30673785C>G	ENST00000287468.5	+	0	0				FBRS_ENST00000356166.6_Missense_Mutation_p.S250R|FBRS_ENST00000568722.1_5'UTR|FBRS_ENST00000395073.2_5'Flank|FBRS_ENST00000482749.1_3'UTR	NM_001105079.1	NP_001098549.1	Q9HAH7	FBRS_HUMAN	fibrosin											ovary(1)	1			Colorectal(24;0.103)			TCTCAACCAGCAAAGGTTGGT	0.612																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AK021680		16p11.2	2008-02-05	2007-04-18	2007-04-18	ENSG00000156860	ENSG00000156860			20442	protein-coding gene	gene with protein product		608601	"""fibrosin 1"""	FBS1		7892239, 9809749	Standard	NM_001105079		Approved	FBS, FLJ11618	uc002dzd.4	Q9HAH7	OTTHUMG00000132390		16.37:g.30673785C>G	Exception_encountered		B4DP86|Q96CI9|Q9H9X4	Missense_Mutation	SNP	prints_AUTS2	p.S250R	ENST00000287468.5	37	c.750		16	.	.	.	.	.	.	.	.	.	.	C	12.47	1.948072	0.34377	.	.	ENSG00000156860	ENST00000356166	T	0.32272	1.46	4.71	3.76	0.43208	.	1.642920	0.06907	U	0.806909	T	0.34424	0.0897	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.01930	-1.1245	7	0.26408	T	0.33	-2.5949	10.0554	0.42241	0.0:0.9044:0.0:0.0956	.	.	.	.	R	250	ENSP00000348489:S250R	ENSP00000348489:S250R	S	+	3	2	FBRS	30581286	1.000000	0.71417	1.000000	0.80357	0.774000	0.43823	1.702000	0.37836	1.217000	0.43442	-0.339000	0.08088	AGC	FBRS	-	NULL	ENSG00000156860		0.612	FBRS-201	KNOWN	basic|appris_principal	protein_coding	FBRS	HGNC	protein_coding		123	0.00	0	C	NM_022452		30673785	30673785	+1	no_errors	ENST00000356166	ensembl	human	known	69_37n	missense	44	25.42	15	SNP	1.000	G
FBXL22	283807	genome.wustl.edu	37	15	63889651	63889651	+	Silent	SNP	C	C	T	rs201716646		TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr15:63889651C>T	ENST00000360587.2	+	1	100	c.60C>T	c.(58-60)ctC>ctT	p.L20L	USP3-AS1_ENST00000560962.1_RNA|USP3-AS1_ENST00000558831.1_RNA|FBXL22_ENST00000534939.1_Silent_p.L20L|USP3-AS1_ENST00000561191.1_RNA|USP3-AS1_ENST00000561256.1_RNA|USP3-AS1_ENST00000559737.1_RNA|FBXL22_ENST00000539570.3_Silent_p.L14L|USP3-AS1_ENST00000560622.1_RNA|USP3-AS1_ENST00000559861.1_RNA	NM_203373.2	NP_976307.2	Q6P050	FXL22_HUMAN	F-box and leucine-rich repeat protein 22	20	F-box.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				lung(4)	4						TGCTGCACCTCTTCTCCTTCC	0.622																																						dbGAP											0													62.0	55.0	57.0					15																	63889651		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC065833	CCDS10187.1, CCDS10187.2	15q22.1	2012-04-05			ENSG00000197361	ENSG00000197361		"""F-boxes / Leucine-rich repeats"""	27537	protein-coding gene	gene with protein product		609088				12477932	Standard	NM_203373		Approved	Fbl22, FLJ39626	uc002amn.4	Q6P050	OTTHUMG00000132905	ENST00000360587.2:c.60C>T	15.37:g.63889651C>T				Silent	SNP	superfamily_F-box_dom_cyclin-like	p.L20	ENST00000360587.2	37	c.60	CCDS10187.2	15																																																																																			AC118274.1	-	superfamily_F-box_dom_cyclin-like	ENSG00000259662		0.622	FBXL22-001	KNOWN	downstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	FBXL22	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000256412.4	57	0.00	0	C	NM_203373		63889651	63889651	+1	no_errors	ENST00000539570	ensembl	human	known	69_37n	silent	22	26.67	8	SNP	1.000	T
FOXA1	3169	genome.wustl.edu	37	14	38061248	38061248	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr14:38061248G>C	ENST00000250448.2	-	2	802	c.741C>G	c.(739-741)caC>caG	p.H247Q	FOXA1_ENST00000540786.1_Missense_Mutation_p.H214Q|FOXA1_ENST00000545425.2_5'UTR	NM_004496.3	NP_004487.2	P55317	FOXA1_HUMAN	forkhead box A1	247					anatomical structure formation involved in morphogenesis (GO:0048646)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|epithelial cell maturation involved in prostate gland development (GO:0060743)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|glucose homeostasis (GO:0042593)|hormone metabolic process (GO:0042445)|lung epithelial cell differentiation (GO:0060487)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|prostate gland stromal morphogenesis (GO:0060741)|response to estradiol (GO:0032355)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)	microvillus (GO:0005902)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(12)	19	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		CGGAGTCCGGGTGCAGCGTCC	0.672																																						dbGAP											0													32.0	31.0	31.0					14																	38061248		2203	4300	6503	-	-	-	SO:0001583	missense	0			U39840	CCDS9665.1	14q12-q13	2008-04-10		2002-09-20	ENSG00000129514	ENSG00000129514		"""Forkhead boxes"""	5021	protein-coding gene	gene with protein product		602294	"""hepatocyte nuclear factor 3, alpha"""	HNF3A		9119385, 8652662	Standard	NM_004496		Approved		uc001wuf.4	P55317	OTTHUMG00000140253	ENST00000250448.2:c.741C>G	14.37:g.38061248G>C	ENSP00000250448:p.His247Gln		B2R9H6|B7ZAP5|Q9H2A0	Missense_Mutation	SNP	pfam_TF_fork_head,pfam_Fork-head_N,pfam_Forkhead_box_C,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.H247Q	ENST00000250448.2	37	c.741	CCDS9665.1	14	.	.	.	.	.	.	.	.	.	.	G	23.7	4.450340	0.84101	.	.	ENSG00000129514	ENST00000250448;ENST00000540786	D;D	0.95342	-3.68;-3.68	4.0	4.0	0.46444	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.000000	0.85682	D	0.000000	D	0.97111	0.9056	M	0.83012	2.62	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97855	1.0277	10	0.87932	D	0	.	15.0053	0.71507	0.0:0.0:1.0:0.0	.	247	P55317	FOXA1_HUMAN	Q	247;214	ENSP00000250448:H247Q;ENSP00000440178:H214Q	ENSP00000250448:H247Q	H	-	3	2	FOXA1	37130999	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.448000	0.35112	2.057000	0.61298	0.400000	0.26472	CAC	FOXA1	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head	ENSG00000129514		0.672	FOXA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXA1	HGNC	protein_coding	OTTHUMT00000276735.1	84	0.00	0	G			38061248	38061248	-1	no_errors	ENST00000250448	ensembl	human	known	69_37n	missense	38	26.42	14	SNP	1.000	C
GLUL	2752	genome.wustl.edu	37	1	182354468	182354468	+	Intron	SNP	A	A	G			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr1:182354468A>G	ENST00000331872.6	-	6	1344				GLUL_ENST00000417584.2_Intron|GLUL_ENST00000339526.4_Intron|GLUL_ENST00000491322.1_5'UTR|GLUL_ENST00000311223.5_Intron	NM_001033044.2	NP_001028216.1	P15104	GLNA_HUMAN	glutamate-ammonia ligase						cell proliferation (GO:0008283)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to starvation (GO:0009267)|glutamate catabolic process (GO:0006538)|glutamine biosynthetic process (GO:0006542)|neurotransmitter uptake (GO:0001504)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of insulin secretion (GO:0032024)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein homooligomerization (GO:0051260)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glial cell projection (GO:0097386)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|glutamate-ammonia ligase activity (GO:0004356)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			endometrium(2)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	16					Ceftriaxone(DB01212)|Diazoxide(DB01119)|L-Glutamine(DB00130)|L-Methionine(DB00134)|Pegvisomant(DB00082)	GAGATTAAAGATGGCCCCAGC	0.488																																						dbGAP											0													33.0	32.0	32.0					1																	182354468		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AL161952	CCDS1344.1	1q31	2010-05-04	2010-05-04		ENSG00000135821	ENSG00000135821	6.3.1.2		4341	protein-coding gene	gene with protein product	"""glutamine synthetase"""	138290	"""glutamate-ammonia ligase (glutamine synthase)"""	GLNS		1681907, 2888076	Standard	NM_002065		Approved		uc001gpa.2	P15104	OTTHUMG00000037407	ENST00000331872.6:c.803+23T>C	1.37:g.182354468A>G			Q499Y9|Q5T9Z1|Q7Z3W4|Q8IZ17	RNA	SNP	-	NULL	ENST00000331872.6	37	NULL	CCDS1344.1	1																																																																																			GLUL	-	-	ENSG00000135821		0.488	GLUL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLUL	HGNC	protein_coding	OTTHUMT00000091043.1	31	0.00	0	A	NM_002065		182354468	182354468	-1	no_errors	ENST00000491322	ensembl	human	known	69_37n	rna	13	40.91	9	SNP	0.000	G
GPR174	84636	genome.wustl.edu	37	X	78426712	78426712	+	Missense_Mutation	SNP	C	C	A			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chrX:78426712C>A	ENST00000276077.1	+	1	244	c.208C>A	c.(208-210)Ctt>Att	p.L70I		NM_032553.1	NP_115942.1	Q9BXC1	GP174_HUMAN	G protein-coupled receptor 174	70						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	38						ACTACAAGTTCTTTCCTTGCC	0.388										HNSCC(63;0.18)																												dbGAP											0													126.0	93.0	104.0					X																	78426712		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF345567	CCDS14443.1	Xq13.3	2012-08-21			ENSG00000147138	ENSG00000147138		"""GPCR / Class A : Orphans"""	30245	protein-coding gene	gene with protein product		300903					Standard	NM_032553		Approved	FKSG79	uc004edg.1	Q9BXC1	OTTHUMG00000021898	ENST00000276077.1:c.208C>A	X.37:g.78426712C>A	ENSP00000276077:p.Leu70Ile		Q2M3F7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor	p.L70I	ENST00000276077.1	37	c.208	CCDS14443.1	X	.	.	.	.	.	.	.	.	.	.	c	18.15	3.560568	0.65538	.	.	ENSG00000147138	ENST00000276077	T	0.41065	1.01	5.18	5.18	0.71444	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	T	0.55940	0.1952	L	0.48218	1.51	0.45930	D	0.998766	D	0.65815	0.995	D	0.67382	0.951	T	0.51052	-0.8754	10	0.30854	T	0.27	.	16.3016	0.82820	0.0:1.0:0.0:0.0	.	70	Q9BXC1	GP174_HUMAN	I	70	ENSP00000276077:L70I	ENSP00000276077:L70I	L	+	1	0	GPR174	78313368	0.993000	0.37304	1.000000	0.80357	0.935000	0.57460	1.917000	0.39996	2.159000	0.67721	0.534000	0.68092	CTT	GPR174	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor	ENSG00000147138		0.388	GPR174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR174	HGNC	protein_coding	OTTHUMT00000057327.1	91	0.00	0	C	NM_032553		78426712	78426712	+1	no_errors	ENST00000276077	ensembl	human	known	69_37n	missense	31	27.91	12	SNP	1.000	A
HEYL	26508	genome.wustl.edu	37	1	40097235	40097235	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr1:40097235C>T	ENST00000372852.3	-	3	483	c.164G>A	c.(163-165)cGt>cAt	p.R55H	HEYL_ENST00000535435.1_Missense_Mutation_p.R27H|RP1-144F13.3_ENST00000424418.1_RNA	NM_014571.3	NP_055386	Q9NQ87	HEYL_HUMAN	hes-related family bHLH transcription factor with YRPW motif-like	55	Transcriptional repression and interaction with NCOR1 and SIN3A. {ECO:0000250}.|bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				atrioventricular valve morphogenesis (GO:0003181)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to BMP stimulus (GO:0071773)|endocardial cushion morphogenesis (GO:0003203)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|glomerulus development (GO:0032835)|mesenchymal cell development (GO:0014031)|negative regulation of androgen receptor activity (GO:2000824)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal tubule development (GO:0072014)|pulmonary valve morphogenesis (GO:0003184)|skeletal muscle cell differentiation (GO:0035914)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-1 domain binding (GO:0050683)|microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	7	Lung NSC(20;3.81e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.1e-18)|Epithelial(16;2.77e-17)|all cancers(16;5.64e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			GCGGTCTCGACGCCGTTTCTC	0.443																																						dbGAP											0													162.0	127.0	139.0					1																	40097235		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC006087	CCDS439.1	1p34.3	2013-10-17	2013-10-17		ENSG00000163909	ENSG00000163909		"""Basic helix-loop-helix proteins"""	4882	protein-coding gene	gene with protein product	"""hairy/enhancer-of-split related with YRPW motif 3"""	609034	"""hairy/enhancer-of-split related with YRPW motif-like"""			10415358, 10860664	Standard	NM_014571		Approved	bHLHb33, HEY3, HESR3	uc001cdp.3	Q9NQ87	OTTHUMG00000000458	ENST00000372852.3:c.164G>A	1.37:g.40097235C>T	ENSP00000361943:p.Arg55His		Q5TG99	Missense_Mutation	SNP	pfam_HLH_DNA-bd,pfam_Orange,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_Orange_subgr,pfscan_Orange,pfscan_HLH_DNA-bd	p.R55H	ENST00000372852.3	37	c.164	CCDS439.1	1	.	.	.	.	.	.	.	.	.	.	C	31	5.089371	0.94149	.	.	ENSG00000163909	ENST00000372852;ENST00000535435	D;D	0.99722	-6.53;-6.53	4.96	4.96	0.65561	Helix-loop-helix DNA-binding (5);	0.062472	0.64402	D	0.000006	D	0.99750	0.9900	M	0.92412	3.305	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	D	0.97231	0.9884	10	0.87932	D	0	-10.5241	14.4477	0.67364	0.0:1.0:0.0:0.0	.	55	Q9NQ87	HEYL_HUMAN	H	55;27	ENSP00000361943:R55H;ENSP00000439071:R27H	ENSP00000361943:R55H	R	-	2	0	HEYL	39869822	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.061000	0.76699	2.683000	0.91414	0.655000	0.94253	CGT	HEYL	-	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	ENSG00000163909		0.443	HEYL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEYL	HGNC	protein_coding	OTTHUMT00000001179.2	126	0.00	0	C	NM_014571		40097235	40097235	-1	no_errors	ENST00000372852	ensembl	human	known	69_37n	missense	48	29.41	20	SNP	1.000	T
HIST1H2AC	8334	genome.wustl.edu	37	6	26124464	26124464	+	Missense_Mutation	SNP	T	T	C			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr6:26124464T>C	ENST00000602637.1	+	1	34	c.4T>C	c.(4-6)Tct>Cct	p.S2P	HIST1H2BC_ENST00000314332.5_5'Flank|HIST1H2BC_ENST00000396984.1_5'Flank|HIST1H2AC_ENST00000377791.2_Missense_Mutation_p.S2P			Q93077	H2A1C_HUMAN	histone cluster 1, H2ac	2						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(5)	12						GATTGCAATGTCTGGACGTGG	0.507																																						dbGAP											0													46.0	48.0	47.0					6																	26124464		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z80778	CCDS4585.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000180573	ENSG00000180573		"""Histones / Replication-dependent"""	4733	protein-coding gene	gene with protein product		602794	"""H2A histone family, member L"", ""histone 1, H2ac"""	H2AFL		9119399, 12408966	Standard	NM_003512		Approved		uc003ngm.3	Q93077	OTTHUMG00000014428	ENST00000602637.1:c.4T>C	6.37:g.26124464T>C	ENSP00000473534:p.Ser2Pro		B2R4F7|O00775|O00776|O00777|O00778|Q540R1	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.S2P	ENST00000602637.1	37	c.4	CCDS4585.1	6	.	.	.	.	.	.	.	.	.	.	.	9.278	1.047496	0.19827	.	.	ENSG00000180573	ENST00000377791;ENST00000314088	D;D	0.93019	-3.15;-3.15	5.78	5.78	0.91487	Histone-fold (2);	0.000000	0.43579	D	0.000560	D	0.91583	0.7341	M	0.84433	2.695	0.35405	D	0.791906	B	0.02656	0.0	B	0.01281	0.0	D	0.90819	0.4707	10	0.87932	D	0	.	15.5859	0.76482	0.0:0.0:0.0:1.0	.	2	Q93077	H2A1C_HUMAN	P	2	ENSP00000367022:S2P;ENSP00000321389:S2P	ENSP00000321389:S2P	S	+	1	0	HIST1H2AC	26232443	1.000000	0.71417	1.000000	0.80357	0.042000	0.13812	3.026000	0.49689	2.333000	0.79357	0.482000	0.46254	TCT	HIST1H2AC	-	superfamily_Histone-fold	ENSG00000180573		0.507	HIST1H2AC-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AC	HGNC	protein_coding	OTTHUMT00000468023.1	115	0.00	0	T	NM_003512		26124464	26124464	+1	no_errors	ENST00000314088	ensembl	human	known	69_37n	missense	61	26.51	22	SNP	1.000	C
HOXC9	3225	genome.wustl.edu	37	12	54396402	54396402	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr12:54396402C>G	ENST00000303450.4	+	2	797	c.727C>G	c.(727-729)Cga>Gga	p.R243G	RP11-834C11.12_ENST00000513209.1_Intron|HOXC9_ENST00000504557.1_3'UTR|HOXC9_ENST00000508190.1_Missense_Mutation_p.R243G|HOXC-AS1_ENST00000512427.1_RNA|HOXC-AS1_ENST00000505700.1_RNA	NM_006897.1	NP_008828.1	P31274	HXC9_HUMAN	homeobox C9	243					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.R243*(1)		large_intestine(3)|liver(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	14						GTTTCAGAATCGAAGGATGAA	0.478																																						dbGAP											1	Substitution - Nonsense(1)	large_intestine(1)											52.0	57.0	55.0					12																	54396402		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8869.1	12q13.13	2011-06-20	2005-12-22			ENSG00000180806		"""Homeoboxes / ANTP class : HOXL subclass"""	5130	protein-coding gene	gene with protein product		142971	"""homeo box C9"""	HOX3, HOX3B		1973146	Standard	NM_006897		Approved		uc001seq.3	P31274		ENST00000303450.4:c.727C>G	12.37:g.54396402C>G	ENSP00000302836:p.Arg243Gly		B2RCN7|Q9H1I0	Missense_Mutation	SNP	pfam_Hox9_activation_N,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pirsf_Homeobox_Hox9,prints_Homeobox_metazoa,pfscan_Homeodomain	p.R243G	ENST00000303450.4	37	c.727	CCDS8869.1	12	.	.	.	.	.	.	.	.	.	.	C	15.23	2.772379	0.49680	.	.	ENSG00000180806	ENST00000508190;ENST00000303450	D;D	0.97791	-4.54;-4.54	4.13	4.13	0.48395	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.64402	D	0.000010	D	0.98947	0.9642	H	0.96489	3.83	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98863	1.0763	10	0.87932	D	0	.	9.6306	0.39776	0.3274:0.6726:0.0:0.0	.	243	P31274	HXC9_HUMAN	G	243	ENSP00000423861:R243G;ENSP00000302836:R243G	ENSP00000302836:R243G	R	+	1	2	HOXC9	52682669	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.665000	0.61547	2.326000	0.78906	0.561000	0.74099	CGA	HOXC9	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pirsf_Homeobox_Hox9,prints_Homeobox_metazoa,pfscan_Homeodomain	ENSG00000180806		0.478	HOXC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXC9	HGNC	protein_coding	OTTHUMT00000358958.1	33	0.00	0	C			54396402	54396402	+1	no_errors	ENST00000303450	ensembl	human	known	69_37n	missense	14	33.33	7	SNP	1.000	G
KIAA0319L	79932	genome.wustl.edu	37	1	35907883	35907883	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr1:35907883C>T	ENST00000325722.3	-	19	3068	c.2834G>A	c.(2833-2835)gGa>gAa	p.G945E	KIAA0319L_ENST00000485551.1_5'UTR|KIAA0319L_ENST00000373266.4_Missense_Mutation_p.G382E	NM_024874.4	NP_079150.3	Q8IZA0	K319L_HUMAN	KIAA0319-like	945						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(12)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	34		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				AGACAGGATTCCCAAGGCAAC	0.443																																						dbGAP											0													223.0	217.0	219.0					1																	35907883		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY163234	CCDS390.1	1p34.3	2008-10-24			ENSG00000142687	ENSG00000142687			30071	protein-coding gene	gene with protein product		613535				11347906	Standard	NM_024874		Approved	KIAA1837	uc001byx.3	Q8IZA0	OTTHUMG00000004370	ENST00000325722.3:c.2834G>A	1.37:g.35907883C>T	ENSP00000318406:p.Gly945Glu		B1AN13|D3DPR8|O95010|Q6PJJ7|Q7L1C9|Q8N2B3|Q8NDA0|Q8WY39|Q8WYZ5|Q96IC3|Q96JJ0|Q9BUW6|Q9H7V0	Missense_Mutation	SNP	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_PKD/Chitinase_dom,pfscan_MANSC,pfscan_PKD_dom	p.G945E	ENST00000325722.3	37	c.2834	CCDS390.1	1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.329780	0.81690	.	.	ENSG00000142687	ENST00000325722;ENST00000373266;ENST00000426982	T;T;T	0.10192	3.15;2.9;3.15	5.75	5.75	0.90469	.	0.048206	0.85682	D	0.000000	T	0.28433	0.0703	L	0.52573	1.65	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.996	D;D;D	0.74023	0.982;0.96;0.914	T	0.00185	-1.1943	10	0.30078	T	0.28	-10.5164	18.9336	0.92576	0.0:1.0:0.0:0.0	.	945;945;387	Q8IZA0-2;Q8IZA0;Q8IZA0-3	.;K319L_HUMAN;.	E	945;382;945	ENSP00000318406:G945E;ENSP00000362363:G382E;ENSP00000395883:G945E	ENSP00000318406:G945E	G	-	2	0	KIAA0319L	35680470	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	5.978000	0.70501	2.708000	0.92522	0.557000	0.71058	GGA	KIAA0319L	-	NULL	ENSG00000142687		0.443	KIAA0319L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0319L	HGNC	protein_coding	OTTHUMT00000012684.2	55	0.00	0	C	NM_024874		35907883	35907883	-1	no_errors	ENST00000325722	ensembl	human	known	69_37n	missense	25	37.50	15	SNP	1.000	T
IGSF3	3321	genome.wustl.edu	37	1	117142614	117142614	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr1:117142614G>A	ENST00000369486.3	-	7	2743	c.1978C>T	c.(1978-1980)Cga>Tga	p.R660*	IGSF3_ENST00000369483.1_Nonsense_Mutation_p.R680*|IGSF3_ENST00000318837.6_Nonsense_Mutation_p.R680*	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	660	Ig-like C2-type 5.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		TCCGCCAGTCGCGTCCAGGTG	0.612																																						dbGAP											0													70.0	54.0	60.0					1																	117142614		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.1978C>T	1.37:g.117142614G>A	ENSP00000358498:p.Arg660*		A6NJZ6|A6NMC7	Nonsense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.R680*	ENST00000369486.3	37	c.2038	CCDS30813.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.055812	0.97241	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	.	.	.	4.56	1.5	0.22942	.	0.270543	0.31010	N	0.008430	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-28.9658	6.3189	0.21206	0.0913:0.0:0.5737:0.3351	.	.	.	.	X	660;680;680	.	ENSP00000321184:R680X	R	-	1	2	IGSF3	116944137	0.632000	0.27172	0.446000	0.26920	0.517000	0.34286	1.076000	0.30729	0.126000	0.18424	0.455000	0.32223	CGA	IGSF3	-	smart_Ig_sub	ENSG00000143061		0.612	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF3	HGNC	protein_coding	OTTHUMT00000059040.1	119	0.00	0	G	NM_001542		117142614	117142614	-1	no_errors	ENST00000318837	ensembl	human	known	69_37n	nonsense	50	23.08	15	SNP	0.285	A
KIAA0922	23240	genome.wustl.edu	37	4	154471274	154471274	+	Missense_Mutation	SNP	G	G	T			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr4:154471274G>T	ENST00000409663.3	+	4	341	c.289G>T	c.(289-291)Gtt>Ttt	p.V97F	KIAA0922_ENST00000440693.1_Missense_Mutation_p.V97F|KIAA0922_ENST00000409959.3_Missense_Mutation_p.V97F	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	97						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				TCAGCCATCAGTTTTAGATTT	0.239																																						dbGAP											0													98.0	80.0	85.0					4																	154471274		692	1585	2277	-	-	-	SO:0001583	missense	0			AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.289G>T	4.37:g.154471274G>T	ENSP00000386574:p.Val97Phe		B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Missense_Mutation	SNP	pfam_DUF3651_TMEM131	p.V97F	ENST00000409663.3	37	c.289	CCDS3783.2	4	.	.	.	.	.	.	.	.	.	.	G	17.58	3.424078	0.62733	.	.	ENSG00000121210	ENST00000409663;ENST00000440693;ENST00000409959	T;T;T	0.19105	2.43;2.17;2.43	5.77	4.92	0.64577	.	.	.	.	.	T	0.32496	0.0831	L	0.53249	1.67	0.22819	N	0.998697	D;B	0.53462	0.96;0.3	P;B	0.54312	0.748;0.131	T	0.09952	-1.0651	9	0.41790	T	0.15	.	10.6164	0.45454	0.0683:0.0:0.7977:0.1339	.	97;97	A2VDJ0-5;A2VDJ0	.;T131L_HUMAN	F	97	ENSP00000386574:V97F;ENSP00000409663:V97F;ENSP00000386787:V97F	ENSP00000386574:V97F	V	+	1	0	KIAA0922	154690724	1.000000	0.71417	0.998000	0.56505	0.955000	0.61496	5.359000	0.66074	1.535000	0.49220	0.655000	0.94253	GTT	KIAA0922	-	NULL	ENSG00000121210		0.239	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA0922	HGNC	protein_coding	OTTHUMT00000330370.1	67	0.00	0	G	NM_015196		154471274	154471274	+1	no_errors	ENST00000409959	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	T
KLHL6	89857	genome.wustl.edu	37	3	183217542	183217542	+	Missense_Mutation	SNP	G	G	A	rs372412048		TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr3:183217542G>A	ENST00000341319.3	-	4	1018	c.983C>T	c.(982-984)aCg>aTg	p.T328M		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	328					B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)					breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			TTCATCCTTCGTGCAGCCGCC	0.582																																						dbGAP											0													76.0	64.0	68.0					3																	183217542		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.983C>T	3.37:g.183217542G>A	ENSP00000341342:p.Thr328Met		B2RB31|D3DNS8|Q8N5I1|Q8N892	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.T328M	ENST00000341319.3	37	c.983	CCDS3245.2	3	.	.	.	.	.	.	.	.	.	.	G	25.2	4.614749	0.87359	.	.	ENSG00000172578	ENST00000341319	T	0.67523	-0.27	5.13	5.13	0.70059	Kelch-type beta propeller (1);	0.044947	0.85682	D	0.000000	T	0.76630	0.4014	L	0.51422	1.61	0.58432	D	0.999999	D	0.76494	0.999	P	0.62184	0.899	T	0.76397	-0.2974	10	0.46703	T	0.11	.	18.9602	0.92674	0.0:0.0:1.0:0.0	.	328	Q8WZ60	KLHL6_HUMAN	M	328	ENSP00000341342:T328M	ENSP00000341342:T328M	T	-	2	0	KLHL6	184700236	1.000000	0.71417	0.953000	0.39169	0.823000	0.46562	9.420000	0.97426	2.561000	0.86390	0.561000	0.74099	ACG	KLHL6	-	pirsf_Kelch-like_gigaxonin	ENSG00000172578		0.582	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL6	HGNC	protein_coding	OTTHUMT00000309024.1	46	0.00	0	G	NM_130446		183217542	183217542	-1	no_errors	ENST00000341319	ensembl	human	known	69_37n	missense	27	28.95	11	SNP	1.000	A
MCTP2	55784	genome.wustl.edu	37	15	94983526	94983526	+	Splice_Site	SNP	A	A	G			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr15:94983526A>G	ENST00000357742.4	+	17	2207	c.2207A>G	c.(2206-2208)cAg>cGg	p.Q736R	MCTP2_ENST00000451018.3_Intron	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	736					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			CAGGACAGCCAGGTAAGCAAG	0.438																																						dbGAP											0													133.0	122.0	126.0					15																	94983526		2197	4298	6495	-	-	-	SO:0001630	splice_region_variant	0			AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.2208+1A>G	15.37:g.94983526A>G			A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_PRibTrfase_C,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.Q736R	ENST00000357742.4	37	c.2207	CCDS32338.1	15	.	.	.	.	.	.	.	.	.	.	A	9.639	1.138572	0.21123	.	.	ENSG00000140563	ENST00000357742	T	0.64085	-0.08	5.84	5.84	0.93424	Phosphoribosyltransferase C-terminal (1);	0.324362	0.33496	N	0.004853	T	0.46444	0.1393	N	0.16368	0.405	0.80722	D	1	B	0.16166	0.016	B	0.15484	0.013	T	0.37641	-0.9697	10	0.23302	T	0.38	.	14.7869	0.69810	1.0:0.0:0.0:0.0	.	736	Q6DN12	MCTP2_HUMAN	R	736	ENSP00000350377:Q736R	ENSP00000350377:Q736R	Q	+	2	0	MCTP2	92784530	1.000000	0.71417	1.000000	0.80357	0.299000	0.27559	5.736000	0.68597	2.243000	0.73865	0.533000	0.62120	CAG	MCTP2	-	pfam_PRibTrfase_C	ENSG00000140563		0.438	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MCTP2	HGNC	protein_coding	OTTHUMT00000415060.3	77	0.00	0	A	NM_018349	Missense_Mutation	94983526	94983526	+1	no_errors	ENST00000357742	ensembl	human	known	69_37n	missense	38	30.91	17	SNP	1.000	G
MMP10	4319	genome.wustl.edu	37	11	102647065	102647065	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr11:102647065delA	ENST00000279441.4	-	6	914	c.878delT	c.(877-879)ttgfs	p.L293fs		NM_002425.2	NP_002416.1	P09238	MMP10_HUMAN	matrix metallopeptidase 10 (stromelysin 2)	293					collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|regulation of cell migration (GO:0030334)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|liver(2)|lung(6)	22	all_epithelial(12;0.00961)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0303)|Lung(13;0.0828)|all cancers(10;0.116)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0145)	Marimastat(DB00786)	ATCGAAGGACAAAGCAGGATC	0.458																																						dbGAP											0													97.0	92.0	94.0					11																	102647065		2203	4299	6502	-	-	-	SO:0001589	frameshift_variant	0			X07820	CCDS8321.1	11q22.3	2008-02-05	2005-08-08		ENSG00000166670	ENSG00000166670	3.4.24.22		7156	protein-coding gene	gene with protein product		185260	"""matrix metalloproteinase 10 (stromelysin 2)"""	STMY2			Standard	NM_002425		Approved		uc001phg.2	P09238	OTTHUMG00000168083	ENST00000279441.4:c.878delT	11.37:g.102647065delA	ENSP00000279441:p.Leu293fs		B2R9X9|Q53HH9	Frame_Shift_Del	DEL	pirsf_Pept_M10A_matrix_strom,pfam_Pept_M10_metallopeptidase,pfam_Hemopexin/matrixin_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,prints_Pept_M10A_matrixin	p.L293fs	ENST00000279441.4	37	c.878	CCDS8321.1	11																																																																																			MMP10	-	pirsf_Pept_M10A_matrix_strom,superfamily_Hemopexin/matrixin	ENSG00000166670		0.458	MMP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP10	HGNC	protein_coding	OTTHUMT00000398014.1	58	0.00	0	A			102647065	102647065	-1	no_errors	ENST00000279441	ensembl	human	known	69_37n	frame_shift_del	17	10.53	2	DEL	0.985	-
MTHFD1L	25902	genome.wustl.edu	37	6	151277147	151277147	+	Silent	SNP	C	C	T			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr6:151277147C>T	ENST00000367321.3	+	17	2017	c.1743C>T	c.(1741-1743)gaC>gaT	p.D581D		NM_001242767.1|NM_001242768.1|NM_015440.4	NP_001229696.1|NP_001229697.1|NP_056255.2	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like	581	Formyltetrahydrofolate synthetase.				folic acid-containing compound biosynthetic process (GO:0009396)|folic acid-containing compound metabolic process (GO:0006760)|formate metabolic process (GO:0015942)|one-carbon metabolic process (GO:0006730)|oxidation-reduction process (GO:0055114)|tetrahydrofolate interconversion (GO:0035999)|tetrahydrofolate metabolic process (GO:0046653)	membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	29		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		ATACAAATGACCGATTTCTAC	0.478																																						dbGAP											0													99.0	97.0	98.0					6																	151277147		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC017477	CCDS5228.1, CCDS56457.1, CCDS75535.1, CCDS75536.1	6q25.1	2010-07-19	2004-12-13	2004-12-14	ENSG00000120254	ENSG00000120254	6.3.4.3		21055	protein-coding gene	gene with protein product	"""10-formyl-THF synthetase"", ""mitochondrial C1-tetrahydrofolate synthase"", ""monofunctional C1-tetrahydrofolate synthase, mitochondrial"""	611427	"""formyltetrahydrofolate synthetase domain containing 1"""	FTHFSDC1		18804703	Standard	NM_015440		Approved	DKFZP586G1517, FLJ21145	uc021zgs.1	Q6UB35	OTTHUMG00000015828	ENST00000367321.3:c.1743C>T	6.37:g.151277147C>T			Q2TBF3|Q8WVW0|Q96HG8|Q9H789|Q9UFU8	Silent	SNP	pfam_Formate_THF_ligase,pfam_THF_DH/CycHdrlase_NAD-bd_dom,pfam_THF_DH/CycHdrlase_cat_dom,prints_THF_DH/CycHdrlase	p.D581	ENST00000367321.3	37	c.1743	CCDS5228.1	6																																																																																			MTHFD1L	-	pfam_Formate_THF_ligase	ENSG00000120254		0.478	MTHFD1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MTHFD1L	HGNC	protein_coding	OTTHUMT00000042699.1	54	0.00	0	C	NM_015440		151277147	151277147	+1	no_errors	ENST00000367321	ensembl	human	known	69_37n	silent	26	29.73	11	SNP	1.000	T
MTM1	4534	genome.wustl.edu	37	X	149828874	149828874	+	Missense_Mutation	SNP	T	T	C			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chrX:149828874T>C	ENST00000370396.2	+	13	1438	c.1384T>C	c.(1384-1386)Ttt>Ctt	p.F462L	MTM1_ENST00000543350.1_Missense_Mutation_p.F347L|MTM1_ENST00000413012.2_Missense_Mutation_p.F425L|MTM1_ENST00000542741.1_Missense_Mutation_p.F367L|MTM1_ENST00000306167.7_3'UTR	NM_000252.2	NP_000243.1	Q13496	MTM1_HUMAN	myotubularin 1	462	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				endosome to lysosome transport (GO:0008333)|intermediate filament organization (GO:0045109)|mitochondrion distribution (GO:0048311)|mitochondrion morphogenesis (GO:0070584)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|protein transport (GO:0015031)|regulation of vacuole organization (GO:0044088)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	intermediate filament binding (GO:0019215)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Acute lymphoblastic leukemia(192;6.56e-05)					CAATGAACAATTTTTGATTAT	0.313																																						dbGAP											0													94.0	86.0	89.0					X																	149828874		2201	4297	6498	-	-	-	SO:0001583	missense	0			U46024	CCDS14694.1	Xq27.3-q28	2014-09-17			ENSG00000171100	ENSG00000171100		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7448	protein-coding gene	gene with protein product		300415	"""myotubular myopathy 1"""				Standard	NM_000252		Approved		uc004fef.4	Q13496	OTTHUMG00000024158	ENST00000370396.2:c.1384T>C	X.37:g.149828874T>C	ENSP00000359423:p.Phe462Leu		A6NDB1|B7Z491|F2Z330|Q8NEL1	Missense_Mutation	SNP	pfam_Myotub-related,pfam_GRAM,smart_GRAM,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase	p.F462L	ENST00000370396.2	37	c.1384	CCDS14694.1	X	.	.	.	.	.	.	.	.	.	.	T	11.97	1.798983	0.31777	.	.	ENSG00000171100	ENST00000370396;ENST00000542741;ENST00000543350;ENST00000413012	D;D;D;D	0.89681	-2.55;-2.55;-2.55;-2.55	5.63	4.47	0.54385	Myotubularin phosphatase domain (1);	0.206543	0.51477	D	0.000084	D	0.82323	0.5012	L	0.35542	1.07	0.32641	N	0.520656	B;B	0.15141	0.004;0.012	B;B	0.18263	0.02;0.021	T	0.78560	-0.2157	10	0.32370	T	0.25	.	10.7192	0.46030	0.0:0.0756:0.0:0.9244	.	425;462	B7Z491;Q13496	.;MTM1_HUMAN	L	462;367;347;425	ENSP00000359423:F462L;ENSP00000444015:F367L;ENSP00000439784:F347L;ENSP00000389157:F425L	ENSP00000359423:F462L	F	+	1	0	MTM1	149579532	0.978000	0.34361	0.343000	0.25615	0.902000	0.53008	1.958000	0.40402	0.770000	0.33336	-0.323000	0.08544	TTT	MTM1	-	smart_Tyr_Pase_cat	ENSG00000171100		0.313	MTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MTM1	HGNC	protein_coding	OTTHUMT00000060847.3	59	0.00	0	T	NM_000252		149828874	149828874	+1	no_errors	ENST00000370396	ensembl	human	known	69_37n	missense	18	25.00	6	SNP	0.654	C
MUC12	10071	genome.wustl.edu	37	7	100637179	100637179	+	Missense_Mutation	SNP	C	C	A			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr7:100637179C>A	ENST00000379442.3	+	5	3764	c.3764C>A	c.(3763-3765)aCc>aAc	p.T1255N	MUC12_ENST00000536621.1_Missense_Mutation_p.T1112N			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	1255	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						AGATCACCAACCACAACACTC	0.542																																						dbGAP											0													124.0	104.0	110.0					7																	100637179		687	1583	2270	-	-	-	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.3764C>A	7.37:g.100637179C>A	ENSP00000368755:p.Thr1255Asn		A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.T1255N	ENST00000379442.3	37	c.3764		7	.	.	.	.	.	.	.	.	.	.	-	0.671	-0.802037	0.02841	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.12039	2.72;2.72	0.713	-0.475	0.12104	.	.	.	.	.	T	0.05410	0.0143	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.43669	-0.9377	6	0.19590	T	0.45	.	.	.	.	.	.	.	.	N	1255;1112	ENSP00000368755:T1255N;ENSP00000441929:T1112N	ENSP00000368755:T1255N	T	+	2	0	MUC12	100423899	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.480000	0.06559	-0.199000	0.10317	0.184000	0.17185	ACC	MUC12	-	NULL	ENSG00000205277		0.542	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	273	0.00	0	C	XM_379904		100637179	100637179	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	missense	148	14.45	25	SNP	0.000	A
MYOM2	9172	genome.wustl.edu	37	8	1998981	1998981	+	Nonsense_Mutation	SNP	C	C	G			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr8:1998981C>G	ENST00000262113.4	+	2	242	c.101C>G	c.(100-102)tCa>tGa	p.S34*	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	34					muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		GAATATGCGTCAAAAAAGTAA	0.488																																						dbGAP											0													96.0	74.0	81.0					8																	1998981		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.101C>G	8.37:g.1998981C>G	ENSP00000262113:p.Ser34*		Q7Z3Y2	Nonsense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.S34*	ENST00000262113.4	37	c.101	CCDS5957.1	8	.	.	.	.	.	.	.	.	.	.	C	22.2	4.264108	0.80358	.	.	ENSG00000036448	ENST00000262113	.	.	.	5.78	4.89	0.63831	.	0.410170	0.23093	N	0.052002	.	.	.	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	14.94	0.70986	0.0:0.93:0.0:0.07	.	.	.	.	X	34	.	ENSP00000262113:S34X	S	+	2	0	MYOM2	1986388	0.322000	0.24634	0.002000	0.10522	0.003000	0.03518	2.381000	0.44336	1.411000	0.46957	0.563000	0.77884	TCA	MYOM2	-	NULL	ENSG00000036448		0.488	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOM2	HGNC	protein_coding	OTTHUMT00000251249.1	83	0.00	0	C	NM_003970		1998981	1998981	+1	no_errors	ENST00000262113	ensembl	human	known	69_37n	nonsense	18	50.00	18	SNP	0.117	G
NFATC1	4772	genome.wustl.edu	37	18	77170736	77170736	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr18:77170736C>T	ENST00000427363.2	+	2	461	c.461C>T	c.(460-462)aCg>aTg	p.T154M	NFATC1_ENST00000586434.1_Missense_Mutation_p.T141M|NFATC1_ENST00000397790.2_Intron|NFATC1_ENST00000542384.1_Missense_Mutation_p.T154M|NFATC1_ENST00000591814.1_Missense_Mutation_p.T154M|NFATC1_ENST00000329101.4_Missense_Mutation_p.T141M|NFATC1_ENST00000253506.5_Missense_Mutation_p.T154M|NFATC1_ENST00000592223.1_Missense_Mutation_p.T141M|NFATC1_ENST00000545796.1_Intron|NFATC1_ENST00000587635.1_Missense_Mutation_p.T154M|NFATC1_ENST00000318065.5_Missense_Mutation_p.T141M			O95644	NFAC1_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1	154	Trans-activation domain A (TAD-A).				calcium ion transport (GO:0006816)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	FK506 binding (GO:0005528)|mitogen-activated protein kinase p38 binding (GO:0048273)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(1)|soft_tissue(1)	40		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;3.73e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0257)	Pseudoephedrine(DB00852)	TCCCCCTCCACGGCCACGCTG	0.622																																					GBM(151;1210 2593 28719 45011)	dbGAP											0													37.0	36.0	37.0					18																	77170736		2202	4293	6495	-	-	-	SO:0001583	missense	0			U08015	CCDS12015.1, CCDS12016.1, CCDS32850.1, CCDS59326.1, CCDS59327.1, CCDS62467.1, CCDS62468.1, CCDS62469.1, CCDS62470.1, CCDS62471.1	18q23	2009-11-24			ENSG00000131196	ENSG00000131196		"""Nuclear factor of activated T-cells"""	7775	protein-coding gene	gene with protein product		600489				8202141	Standard	NM_001278669		Approved	NF-ATC, NFATc, NFAT2	uc002lnf.3	O95644	OTTHUMG00000132897	ENST00000427363.2:c.461C>T	18.37:g.77170736C>T	ENSP00000389377:p.Thr154Met		B5B2M4|B5B2M5|B5B2M6|B5B2M7|B5B2M8|B5B2M9|B5B2N1|Q12865|Q15793|Q2M1S3	Missense_Mutation	SNP	pfam_RHD,pfam_IPT_TIG_rcpt,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT_TIG_rcpt,prints_NFAT,pfscan_RHD	p.T154M	ENST00000427363.2	37	c.461		18	.	.	.	.	.	.	.	.	.	.	C	13.25	2.181223	0.38511	.	.	ENSG00000131196	ENST00000318065;ENST00000253506;ENST00000542384;ENST00000329101;ENST00000427363;ENST00000397794	T;T;T	0.76839	-1.05;-1.05;-1.05	4.46	3.58	0.41010	.	0.054286	0.64402	D	0.000001	D	0.85296	0.5664	M	0.63428	1.95	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.999;0.999;0.999;1.0;1.0;1.0;0.999	P;P;P;D;D;D;P	0.70935	0.906;0.906;0.906;0.971;0.971;0.971;0.906	D	0.86781	0.1979	10	0.72032	D	0.01	-17.3728	14.6625	0.68882	0.0:0.854:0.146:0.0	.	141;141;154;154;154;141;154	B5B2M7;B5B2N1;B5B2M6;O95644;B5B2M4;B5B2M5;Q2M1S3	.;.;.;NFAC1_HUMAN;.;.;.	M	154;154;154;141;141;118	ENSP00000253506:T154M;ENSP00000442435:T154M;ENSP00000327850:T141M	ENSP00000253506:T154M	T	+	2	0	NFATC1	75271724	1.000000	0.71417	0.508000	0.27688	0.515000	0.34225	4.970000	0.63742	1.069000	0.40788	0.561000	0.74099	ACG	NFATC1	-	NULL	ENSG00000131196		0.622	NFATC1-007	KNOWN	basic	protein_coding	NFATC1	HGNC	protein_coding	OTTHUMT00000450507.1	109	0.90	1	C	NM_172390		77170736	77170736	+1	no_errors	ENST00000427363	ensembl	human	known	69_37n	missense	38	20.83	10	SNP	0.990	T
NTRK1	4914	genome.wustl.edu	37	1	156838347	156838347	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr1:156838347G>C	ENST00000524377.1	+	6	666	c.625G>C	c.(625-627)Gac>Cac	p.D209H	NTRK1_ENST00000358660.3_Missense_Mutation_p.D209H|NTRK1_ENST00000392302.2_Missense_Mutation_p.D179H|NTRK1_ENST00000368196.3_Missense_Mutation_p.D209H	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	209	Ig-like C2-type 1.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	GGATGTGGGGGACGACGTGCT	0.682			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																												dbGAP		Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	0													21.0	18.0	19.0					1																	156838347		2167	4268	6435	-	-	-	SO:0001583	missense	0			Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.625G>C	1.37:g.156838347G>C	ENSP00000431418:p.Asp209His		B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Cys-rich_flank_reg_C,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_Tyr_kinase_neurotrophic_rcpt_1,prints_Tyr_kinase_NGF_rcpt	p.D209H	ENST00000524377.1	37	c.625	CCDS1161.1	1	.	.	.	.	.	.	.	.	.	.	G	17.58	3.424797	0.62733	.	.	ENSG00000198400	ENST00000392302;ENST00000368196;ENST00000524377;ENST00000358660	T;T;T;T	0.17213	2.29;2.29;2.29;2.29	4.38	4.38	0.52667	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.112753	0.38720	N	0.001582	T	0.21347	0.0514	L	0.55481	1.735	0.40525	D	0.980875	P;D;D;D	0.69078	0.895;0.982;0.997;0.992	P;P;P;P	0.58520	0.739;0.623;0.84;0.838	T	0.00651	-1.1626	10	0.66056	D	0.02	.	12.6154	0.56573	0.0:0.0:1.0:0.0	.	209;209;209;179	A8K3Z4;P04629-2;P04629;A6NF12	.;.;NTRK1_HUMAN;.	H	179;209;209;209	ENSP00000376120:D179H;ENSP00000357179:D209H;ENSP00000431418:D209H;ENSP00000351486:D209H	ENSP00000351486:D209H	D	+	1	0	NTRK1	155104971	0.939000	0.31865	0.891000	0.34965	0.533000	0.34776	3.169000	0.50809	2.432000	0.82394	0.462000	0.41574	GAC	NTRK1	-	pfscan_Ig-like	ENSG00000198400		0.682	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NTRK1	HGNC	protein_coding	OTTHUMT00000392279.1	127	0.00	0	G	NM_002529		156838347	156838347	+1	no_errors	ENST00000524377	ensembl	human	known	69_37n	missense	46	13.21	7	SNP	0.852	C
NTPCR	84284	genome.wustl.edu	37	1	233105442	233105442	+	Intron	SNP	G	G	A	rs6658396	byFrequency	TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr1:233105442G>A	ENST00000366628.5	+	4	381				NTPCR_ENST00000366627.4_Intron|NTPCR_ENST00000490098.1_3'UTR	NM_032324.1	NP_115700.1	Q9BSD7	NTPCR_HUMAN	nucleoside-triphosphatase, cancer-related							extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|nucleoside-triphosphatase activity (GO:0017111)|nucleotide phosphatase activity, acting on free nucleotides (GO:0098519)|poly(A) RNA binding (GO:0044822)			large_intestine(2)|lung(1)|ovary(1)	4						gcttccaagagtcctaatgat	0.483													G|||	883	0.176318	0.2368	0.1268	5008	,	,		18697	0.1647		0.1978	False		,,,				2504	0.1196					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC005102	CCDS1597.1	1q42.2	2010-12-20	2010-12-20	2010-12-20	ENSG00000135778	ENSG00000135778	3.6.1.15		28204	protein-coding gene	gene with protein product	"""human cancer-related NTPase"""		"""chromosome 1 open reading frame 57"""	C1orf57		17291528	Standard	NM_032324		Approved	MGC13186, HCR-NTPase	uc001hvj.1	Q9BSD7	OTTHUMG00000037822	ENST00000366628.5:c.295-213G>A	1.37:g.233105442G>A				RNA	SNP	-	NULL	ENST00000366628.5	37	NULL	CCDS1597.1	1																																																																																			NTPCR	-	-	ENSG00000135778		0.483	NTPCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTPCR	HGNC	protein_coding	OTTHUMT00000092324.2	11	0.00	0	G	NM_032324		233105442	233105442	+1	no_errors	ENST00000490098	ensembl	human	known	69_37n	rna	3	70.00	7	SNP	0.000	A
NXN	64359	genome.wustl.edu	37	17	704332	704332	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr17:704332G>A	ENST00000336868.3	-	8	1256	c.1165C>T	c.(1165-1167)Cct>Tct	p.P389S	NXN_ENST00000538650.1_Missense_Mutation_p.P80S|NXN_ENST00000575801.1_Missense_Mutation_p.P281S|NXN_ENST00000537628.2_Missense_Mutation_p.P140S	NM_022463.4	NP_071908.2	Q6DKJ4	NXN_HUMAN	nucleoredoxin	389					cardiovascular system development (GO:0072358)|cell differentiation (GO:0030154)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein-disulfide reductase activity (GO:0047134)|thioredoxin-disulfide reductase activity (GO:0004791)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|prostate(1)	13				UCEC - Uterine corpus endometrioid carcinoma (25;0.0237)		GCAGCCTCAGGCAGGTTGGTG	0.567																																						dbGAP											0													67.0	60.0	62.0					17																	704332		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS10998.1, CCDS56013.1	17p13	2007-08-10			ENSG00000167693	ENSG00000167693			18008	protein-coding gene	gene with protein product		612895					Standard	NM_022463		Approved	FLJ12614, NRX	uc002fsa.3	Q6DKJ4	OTTHUMG00000090307	ENST00000336868.3:c.1165C>T	17.37:g.704332G>A	ENSP00000337443:p.Pro389Ser		B4DXQ0|D3DTH2|Q3SWW6|Q6P3U6|Q7L4C6|Q9H9Q1	Missense_Mutation	SNP	pfam_AhpC/TSA,pfam_Redoxin,superfamily_Thioredoxin-like_fold	p.P389S	ENST00000336868.3	37	c.1165	CCDS10998.1	17	.	.	.	.	.	.	.	.	.	.	G	25.5	4.646346	0.87958	.	.	ENSG00000167693	ENST00000336868;ENST00000538650;ENST00000537628	T;T	0.12039	2.72;2.72	5.99	5.99	0.97316	Thioredoxin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.28400	0.0702	L	0.34521	1.04	0.80722	D	1	D;D;D	0.89917	0.997;0.996;1.0	D;D;D	0.91635	0.992;0.986;0.999	T	0.00575	-1.1663	10	0.26408	T	0.33	-18.4812	19.0415	0.93002	0.0:0.0:1.0:0.0	.	281;80;389	B4DXQ0;B4DNN6;Q6DKJ4	.;.;NXN_HUMAN	S	389;80;281	ENSP00000337443:P389S;ENSP00000445087:P80S	ENSP00000337443:P389S	P	-	1	0	NXN	651082	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	9.837000	0.99465	2.840000	0.97914	0.655000	0.94253	CCT	NXN	-	superfamily_Thioredoxin-like_fold	ENSG00000167693		0.567	NXN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXN	HGNC	protein_coding	OTTHUMT00000206669.1	41	0.00	0	G			704332	704332	-1	no_errors	ENST00000336868	ensembl	human	known	69_37n	missense	30	23.08	9	SNP	1.000	A
ONECUT1	3175	genome.wustl.edu	37	15	53081276	53081276	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr15:53081276C>T	ENST00000305901.5	-	1	933	c.806G>A	c.(805-807)cGg>cAg	p.R269Q	ONECUT1_ENST00000561401.2_Intron	NM_004498.2	NP_004489.1	Q9UBC0	HNF6_HUMAN	one cut homeobox 1	269					B cell differentiation (GO:0030183)|cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|endoderm development (GO:0007492)|epithelial cell development (GO:0002064)|glucose metabolic process (GO:0006006)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription, DNA-templated (GO:0006355)|spleen development (GO:0048536)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	17				all cancers(107;0.0708)		GTTGGGCTCCCGGGCTGTGCC	0.647																																						dbGAP											0													89.0	92.0	91.0					15																	53081276		2194	4293	6487	-	-	-	SO:0001583	missense	0			U77975	CCDS10150.1	15q21.3	2012-03-09	2007-07-16		ENSG00000169856	ENSG00000169856		"""Homeoboxes / CUT class"""	8138	protein-coding gene	gene with protein product		604164	"""one cut domain, family member 1"""	HNF6, HNF6A		8887657, 8790352	Standard	NM_004498		Approved	HNF-6	uc002aci.2	Q9UBC0	OTTHUMG00000131899	ENST00000305901.5:c.806G>A	15.37:g.53081276C>T	ENSP00000302630:p.Arg269Gln		B2RTV4|Q99744|Q9UMR6	Missense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Hmoeo_CUT	p.R269Q	ENST00000305901.5	37	c.806	CCDS10150.1	15	.	.	.	.	.	.	.	.	.	.	C	19.35	3.811560	0.70797	.	.	ENSG00000169856	ENST00000305901	T	0.46819	0.86	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.48995	0.1531	M	0.69358	2.11	0.80722	D	1	D	0.63880	0.993	B	0.44108	0.441	T	0.49925	-0.8887	10	0.23891	T	0.37	-18.0538	16.4501	0.83977	0.0:1.0:0.0:0.0	.	269	Q9UBC0	HNF6_HUMAN	Q	269	ENSP00000302630:R269Q	ENSP00000302630:R269Q	R	-	2	0	ONECUT1	50868568	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.574000	0.82434	2.437000	0.82529	0.609000	0.83330	CGG	ONECUT1	-	NULL	ENSG00000169856		0.647	ONECUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ONECUT1	HGNC	protein_coding	OTTHUMT00000254849.2	101	0.00	0	C			53081276	53081276	-1	no_errors	ENST00000305901	ensembl	human	known	69_37n	missense	41	16.33	8	SNP	1.000	T
ABCE1	6059	genome.wustl.edu	37	4	146032219	146032219	+	Intron	SNP	A	A	G			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr4:146032219A>G	ENST00000296577.4	+	8	1225				OTUD4_ENST00000455611.2_5'UTR|ABCE1_ENST00000502803.1_Intron	NM_001040876.1|NM_002940.2	NP_001035809.1|NP_002931.2	P61221	ABCE1_HUMAN	ATP-binding cassette, sub-family E (OABP), member 1						negative regulation of catalytic activity (GO:0043086)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|iron-sulfur cluster binding (GO:0051536)|ribonuclease inhibitor activity (GO:0008428)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|lung(5)|prostate(2)|skin(3)	18	all_hematologic(180;0.151)					GCTGATATGTAGGTTACTTTA	0.348																																						dbGAP											0													115.0	102.0	106.0					4																	146032219		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			X74987	CCDS34071.1	4q31	2012-03-14			ENSG00000164163	ENSG00000164163		"""ATP binding cassette transporters / subfamily E"""	69	protein-coding gene	gene with protein product		601213		RNASEL1, RNASELI, RNS4I		7539425	Standard	NM_002940		Approved	RLI, OABP	uc003ijy.3	P61221	OTTHUMG00000161478	ENST00000296577.4:c.710+3A>G	4.37:g.146032219A>G			O88793|Q13181|Q13864|Q6NR76|Q96AL0|Q96B10|Q99K66	RNA	SNP	-	NULL	ENST00000296577.4	37	NULL	CCDS34071.1	4																																																																																			OTUD4	-	-	ENSG00000164164		0.348	ABCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUD4	HGNC	protein_coding	OTTHUMT00000365104.1	102	0.00	0	A	NM_002940		146032219	146032219	-1	no_errors	ENST00000455611	ensembl	human	known	69_37n	rna	66	27.47	25	SNP	1.000	G
PCDHB18	54660	genome.wustl.edu	37	5	140614330	140614330	+	RNA	SNP	C	C	T			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr5:140614330C>T	ENST00000526308.1	+	0	393					NR_001281.1		Q96TA0	PCDBI_HUMAN	protocadherin beta 18 pseudogene						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|lung(7)|ovary(1)|urinary_tract(1)	18						TCATCTTTGACGACTATAAAC	0.502																																						dbGAP											0																																										-	-	-			0			AF152528		5q31.3	2014-03-20			ENSG00000146001	ENSG00000146001		"""Cadherins / Protocadherins : Clustered"""	14548	pseudogene	pseudogene						10380929	Standard	NR_001281		Approved	PCDH-psi2	uc003ljc.1	Q96TA0	OTTHUMG00000167484		5.37:g.140614330C>T			B3KTF8	RNA	SNP	-	NULL	ENST00000526308.1	37	NULL		5																																																																																			PCDHB18	-	-	ENSG00000146001		0.502	PCDHB18-002	KNOWN	basic	processed_transcript	PCDHB18	HGNC	pseudogene	OTTHUMT00000394776.1	62	0.00	0	C			140614330	140614330	+1	no_errors	ENST00000526308	ensembl	human	known	69_37n	rna	19	26.92	7	SNP	0.001	T
PIK3R4	30849	genome.wustl.edu	37	3	130452625	130452625	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr3:130452625G>C	ENST00000356763.3	-	4	1774	c.1217C>G	c.(1216-1218)gCt>gGt	p.A406G		NM_014602.2	NP_055417.1	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	406					innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(6)|large_intestine(16)|lung(28)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	77						TAATCTTGGAGCCAAATGAAG	0.413																																						dbGAP											0													119.0	115.0	116.0					3																	130452625		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y08991	CCDS3067.1	3q22.1	2013-01-10	2008-02-04		ENSG00000196455	ENSG00000196455		"""WD repeat domain containing"""	8982	protein-coding gene	gene with protein product		602610				8999962	Standard	NM_014602		Approved	VPS15, p150	uc003enj.3	Q99570	OTTHUMG00000159645	ENST00000356763.3:c.1217C>G	3.37:g.130452625G>C	ENSP00000349205:p.Ala406Gly		Q2TBF4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_WD40_repeat,pfam_HEAT,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_WD40_repeat,pfscan_HEAT_type_2,pfscan_Prot_kinase_cat_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A406G	ENST00000356763.3	37	c.1217	CCDS3067.1	3	.	.	.	.	.	.	.	.	.	.	G	17.72	3.460130	0.63401	.	.	ENSG00000196455	ENST00000356763	T	0.35789	1.29	6.17	6.17	0.99709	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.53578	0.1805	L	0.52759	1.655	0.80722	D	1	D	0.59357	0.985	P	0.58013	0.831	T	0.45585	-0.9251	10	0.59425	D	0.04	-24.7354	20.8794	0.99867	0.0:0.0:1.0:0.0	.	406	Q99570	PI3R4_HUMAN	G	406	ENSP00000349205:A406G	ENSP00000349205:A406G	A	-	2	0	PIK3R4	131935315	1.000000	0.71417	0.995000	0.50966	0.169000	0.22640	7.701000	0.84566	2.941000	0.99782	0.655000	0.94253	GCT	PIK3R4	-	superfamily_ARM-type_fold	ENSG00000196455		0.413	PIK3R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3R4	HGNC	protein_coding	OTTHUMT00000356668.1	60	0.00	0	G	NM_014602		130452625	130452625	-1	no_errors	ENST00000356763	ensembl	human	known	69_37n	missense	21	32.26	10	SNP	1.000	C
PLEKHA6	22874	genome.wustl.edu	37	1	204228630	204228630	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr1:204228630C>T	ENST00000272203.3	-	8	1079	c.763G>A	c.(763-765)Gag>Aag	p.E255K	PLEKHA6_ENST00000485632.1_5'Flank|PLEKHA6_ENST00000414478.1_Missense_Mutation_p.E275K	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	255	Pro-rich.									breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			CTTGGGCCCTCGGGGTAAGGG	0.657																																						dbGAP											0													35.0	37.0	36.0					1																	204228630		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.763G>A	1.37:g.204228630C>T	ENSP00000272203:p.Glu255Lys		A7MD51|Q5VTI6	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E255K	ENST00000272203.3	37	c.763	CCDS1444.1	1	.	.	.	.	.	.	.	.	.	.	C	17.19	3.326093	0.60743	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	T;T	0.10382	2.88;3.36	5.35	5.35	0.76521	.	0.819099	0.11582	N	0.549664	T	0.11879	0.0289	L	0.51422	1.61	0.42968	D	0.994424	B	0.29766	0.256	B	0.18871	0.023	T	0.25398	-1.0133	10	0.07644	T	0.81	-13.7735	18.6469	0.91413	0.0:1.0:0.0:0.0	.	255	Q9Y2H5	PKHA6_HUMAN	K	255;275	ENSP00000272203:E255K;ENSP00000402046:E275K	ENSP00000272203:E255K	E	-	1	0	PLEKHA6	202495253	0.850000	0.29656	0.945000	0.38365	0.953000	0.61014	3.960000	0.56752	2.495000	0.84180	0.561000	0.74099	GAG	PLEKHA6	-	NULL	ENSG00000143850		0.657	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA6	HGNC	protein_coding	OTTHUMT00000087889.3	54	0.00	0	C	NM_014935		204228630	204228630	-1	no_errors	ENST00000272203	ensembl	human	known	69_37n	missense	25	30.56	11	SNP	0.995	T
SOX10	6663	genome.wustl.edu	37	22	38382254	38382254	+	Intron	SNP	T	T	C			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr22:38382254T>C	ENST00000360880.2	-	1	78				SOX10_ENST00000470555.1_5'Flank|POLR2F_ENST00000405557.1_Intron|POLR2F_ENST00000407936.1_Silent_p.P129P|SOX10_ENST00000396884.2_5'Flank|MIR4534_ENST00000578108.1_RNA			P56693	SOX10_HUMAN	SRY (sex determining region Y)-box 10						anatomical structure morphogenesis (GO:0009653)|cell maturation (GO:0048469)|developmental growth (GO:0048589)|digestive tract morphogenesis (GO:0048546)|enteric nervous system development (GO:0048484)|in utero embryonic development (GO:0001701)|melanocyte differentiation (GO:0030318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system development (GO:0007422)|positive regulation of gliogenesis (GO:0014015)|positive regulation of neuroblast proliferation (GO:0002052)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	extrinsic component of mitochondrial outer membrane (GO:0031315)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|transcription coactivator activity (GO:0003713)			NS(6)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)|skin(2)	20	Melanoma(58;0.045)					CCGGCTGCCCTGCAGTCGCCT	0.692																																					Melanoma(39;342 1098 6220 32775 40068)|GBM(21;140 497 5227 16059 19275)	dbGAP											0													3.0	3.0	3.0					22																	38382254		787	1809	2596	-	-	-	SO:0001627	intron_variant	0				CCDS13964.1	22q13.1	2014-09-17			ENSG00000100146	ENSG00000100146		"""SRY (sex determining region Y)-boxes"""	11190	protein-coding gene	gene with protein product	"""dominant megacolon, mouse, human homolog of"""	602229				9462749, 10441344, 12944398	Standard	NM_006941		Approved	DOM, WS4, WS2E	uc003aun.1	P56693	OTTHUMG00000149913	ENST00000360880.2:c.186+1097A>G	22.37:g.38382254T>C			B4DV62|Q6FHW7	Missense_Mutation	SNP	NULL	p.C19R	ENST00000360880.2	37	c.55	CCDS13964.1	22	.	.	.	.	.	.	.	.	.	.	T	10.24	1.294571	0.23564	.	.	ENSG00000100142	ENST00000333418;ENST00000427034	.	.	.	3.0	-6.0	0.02206	.	.	.	.	.	T	0.26955	0.0660	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.27331	-1.0077	4	.	.	.	-0.1344	7.7042	0.28640	0.0:0.1786:0.1155:0.7059	.	.	.	.	R	19;17	.	.	C	+	1	0	POLR2F	36712200	0.000000	0.05858	0.000000	0.03702	0.515000	0.34225	-2.889000	0.00710	-1.952000	0.01027	-1.271000	0.01417	TGC	POLR2F	-	NULL	ENSG00000100142		0.692	SOX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2F	HGNC	protein_coding	OTTHUMT00000313874.1	60	0.00	0	T	NM_006941		38382254	38382254	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000333418	ensembl	human	putative	69_37n	missense	22	15.38	4	SNP	0.000	C
RCVRN	5957	genome.wustl.edu	37	17	9808318	9808318	+	Silent	SNP	G	G	T			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr17:9808318G>T	ENST00000226193.5	-	1	620	c.180C>A	c.(178-180)acC>acA	p.T60T		NM_002903.2	NP_002894.1	P35243	RECO_HUMAN	recoverin	60	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				phototransduction, visible light (GO:0007603)|positive regulation of guanylate cyclase activity (GO:0031284)|regulation of calcium ion transport (GO:0051924)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|visual perception (GO:0007601)	dendrite (GO:0030425)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)			endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|upper_aerodigestive_tract(1)	12						CCTTGGGGTCGGTGTCGGGGA	0.602																																						dbGAP											0													132.0	99.0	110.0					17																	9808318		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC001720	CCDS11151.1	17p13.1	2013-01-10		2006-09-26	ENSG00000109047	ENSG00000109047		"""EF-hand domain containing"""	9937	protein-coding gene	gene with protein product		179618		RCV1		1387789, 12507501, 1467959, 12789533	Standard	NM_002903		Approved		uc002gme.1	P35243	OTTHUMG00000130268	ENST00000226193.5:c.180C>A	17.37:g.9808318G>T			Q53XL0	Silent	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,prints_Recoverin	p.T60	ENST00000226193.5	37	c.180	CCDS11151.1	17																																																																																			RCVRN	-	NULL	ENSG00000109047		0.602	RCVRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCVRN	HGNC	protein_coding	OTTHUMT00000252600.2	142	0.00	0	G	NM_002903		9808318	9808318	-1	no_errors	ENST00000226193	ensembl	human	known	69_37n	silent	49	28.99	20	SNP	0.989	T
RLN2	6019	genome.wustl.edu	37	9	5300176	5300176	+	Missense_Mutation	SNP	C	C	A			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr9:5300176C>A	ENST00000381627.3	-	2	868	c.480G>T	c.(478-480)aaG>aaT	p.K160N	RLN2_ENST00000308420.3_3'UTR	NM_134441.2	NP_604390.1	P04090	REL2_HUMAN	relaxin 2	160					female pregnancy (GO:0007565)	extracellular region (GO:0005576)				endometrium(2)|kidney(1)|large_intestine(2)|lung(6)	11	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0201)|Lung(218;0.0987)		AGAGTTGTCTCTTTTTTCGAG	0.373																																						dbGAP											0													116.0	113.0	114.0					9																	5300176		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6460.1	9p24.1	2013-02-26	2004-11-15		ENSG00000107014	ENSG00000107014		"""Endogenous ligands"""	10027	protein-coding gene	gene with protein product	"""relaxin H2"", ""prorelaxin H2"", ""relaxin, ovarian, of pregnancy"""	179740	"""relaxin 2 (H2)"""			6548703, 6548702	Standard	NM_134441		Approved	H2, RLXH2, bA12D24.1.1, bA12D24.1.2	uc003zja.2	P04090	OTTHUMG00000019496	ENST00000381627.3:c.480G>T	9.37:g.5300176C>A	ENSP00000371040:p.Lys160Asn		A0AVM0|Q99936|Q9UCX3|Q9UQJ2	Missense_Mutation	SNP	pfam_Insulin-like,superfamily_Insulin-like,smart_Insulin-like,prints_Relaxin,prints_Insulin_family	p.K160N	ENST00000381627.3	37	c.480	CCDS6460.1	9	.	.	.	.	.	.	.	.	.	.	C	12.70	2.016196	0.35606	.	.	ENSG00000107014	ENST00000381627	T	0.58940	0.3	3.24	1.28	0.21552	Insulin-like (4);	0.844365	0.10325	N	0.688265	T	0.69993	0.3173	M	0.81497	2.545	0.09310	N	1	D	0.67145	0.996	D	0.63283	0.913	T	0.55786	-0.8086	10	0.72032	D	0.01	.	4.3674	0.11230	0.0:0.6305:0.2359:0.1336	.	160	P04090	REL2_HUMAN	N	160	ENSP00000371040:K160N	ENSP00000371040:K160N	K	-	3	2	RLN2	5290176	0.001000	0.12720	0.018000	0.16275	0.003000	0.03518	0.023000	0.13533	0.348000	0.23949	0.585000	0.79938	AAG	RLN2	-	pfam_Insulin-like,superfamily_Insulin-like,smart_Insulin-like	ENSG00000107014		0.373	RLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RLN2	HGNC	protein_coding	OTTHUMT00000051619.1	81	0.00	0	C	NM_134441		5300176	5300176	-1	no_errors	ENST00000381627	ensembl	human	known	69_37n	missense	37	28.85	15	SNP	0.027	A
RRNAD1	51093	genome.wustl.edu	37	1	156703418	156703418	+	Intron	SNP	G	G	A			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr1:156703418G>A	ENST00000368216.4	+	5	1266				RRNAD1_ENST00000476229.1_Intron|RRNAD1_ENST00000368218.4_Intron	NM_015997.3	NP_057081.3	Q96FB5	RRNAD_HUMAN	ribosomal RNA adenine dimethylase domain containing 1							integral component of membrane (GO:0016021)	rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)	9						GCTTGAACTGGTGTGGTCCCT	0.488																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC011382	CCDS1154.1, CCDS44246.1	1q23.1	2011-01-28	2011-01-28	2011-01-28	ENSG00000143303	ENSG00000143303			24273	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 66"""	C1orf66		10810093, 310876	Standard	NM_015997		Approved	CGI-41	uc001fpu.3	Q96FB5	OTTHUMG00000041302	ENST00000368216.4:c.636+106G>A	1.37:g.156703418G>A			D3DVC7|Q4VX71|Q5SZ03|Q9Y358	Splice_Site	SNP	-	NULL	ENST00000368216.4	37	c.NULL	CCDS1154.1	1																																																																																			RRNAD1	-	-	ENSG00000143303		0.488	RRNAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRNAD1	HGNC	protein_coding	OTTHUMT00000098973.1	28	0.00	0	G	NM_015997		156703418	156703418	+1	no_errors	ENST00000462397	ensembl	human	putative	69_37n	splice_site	9	40.00	6	SNP	0.000	A
RSPH6A	81492	genome.wustl.edu	37	19	46299147	46299149	+	In_Frame_Del	DEL	CCT	CCT	-			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	CCT	CCT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr19:46299147_46299149delCCT	ENST00000221538.3	-	6	2274_2276	c.2132_2134delAGG	c.(2131-2136)gagggc>ggc	p.E711del	RSPH6A_ENST00000597055.1_3'UTR|RSPH6A_ENST00000600188.1_In_Frame_Del_p.E447del	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	711	Glu-rich.					intracellular (GO:0005622)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						GTctcctcgccctcctcctcctc	0.557																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.2132_2134delAGG	19.37:g.46299156_46299158delCCT	ENSP00000221538:p.Glu711del		Q53FE2|Q6PEZ9	In_Frame_Del	DEL	pfam_Radial_spoke	p.E711in_frame_del	ENST00000221538.3	37	c.2134_2132	CCDS12675.1	19																																																																																			RSPH6A	-	NULL	ENSG00000104941		0.557	RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH6A	HGNC	protein_coding	OTTHUMT00000461657.1	45	0.00	0	CCT			46299147	46299149	-1	no_errors	ENST00000221538	ensembl	human	known	69_37n	in_frame_del	26	10.34	3	DEL	1.000:1.000:1.000	-
SBNO1	55206	genome.wustl.edu	37	12	123801768	123801768	+	Splice_Site	SNP	C	C	T			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr12:123801768C>T	ENST00000602398.1	-	21	3062	c.2935G>A	c.(2935-2937)Gga>Aga	p.G979R	SBNO1_ENST00000420886.2_Splice_Site_p.G979R|SBNO1_ENST00000267176.4_Splice_Site_p.G978R|SBNO1_ENST00000602750.1_Splice_Site_p.G978R			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	979					regulation of transcription, DNA-templated (GO:0006355)					NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		AGGAACTTACCGAACTGTTGA	0.408																																						dbGAP											0													136.0	128.0	131.0					12																	123801768		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.2935+1G>A	12.37:g.123801768C>T			Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Missense_Mutation	SNP	pfam_Helicase/UvrB_dom,superfamily_Prismane-like	p.G979R	ENST00000602398.1	37	c.2935	CCDS53844.1	12	.	.	.	.	.	.	.	.	.	.	C	32	5.136403	0.94517	.	.	ENSG00000139697	ENST00000420886;ENST00000267176	D;D	0.87334	-2.24;-2.24	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.96093	0.8727	H	0.95884	3.735	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96761	0.9561	9	.	.	.	-26.2729	20.139	0.98050	0.0:1.0:0.0:0.0	.	979;978	A3KN83;A3KN83-2	SBNO1_HUMAN;.	R	979;978	ENSP00000387361:G979R;ENSP00000267176:G978R	.	G	-	1	0	SBNO1	122367721	1.000000	0.71417	0.606000	0.28943	0.015000	0.08874	7.760000	0.85248	2.764000	0.94973	0.655000	0.94253	GGA	SBNO1	-	NULL	ENSG00000139697		0.408	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SBNO1	HGNC	protein_coding	OTTHUMT00000467684.1	61	0.00	0	C	NM_018183	Missense_Mutation	123801768	123801768	-1	no_errors	ENST00000420886	ensembl	human	known	69_37n	missense	31	32.61	15	SNP	1.000	T
SEC22C	9117	genome.wustl.edu	37	3	42602687	42602687	+	Missense_Mutation	SNP	G	G	T			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr3:42602687G>T	ENST00000264454.3	-	4	591	c.448C>A	c.(448-450)Cca>Aca	p.P150T	SEC22C_ENST00000493107.1_5'UTR|SEC22C_ENST00000423701.2_Missense_Mutation_p.P150T|SEC22C_ENST00000273156.7_Missense_Mutation_p.P150T|SEC22C_ENST00000536332.1_Missense_Mutation_p.P80T|SEC22C_ENST00000417572.1_Missense_Mutation_p.P150T			Q9BRL7	SC22C_HUMAN	SEC22 vesicle trafficking protein homolog C (S. cerevisiae)	150					ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)	3				KIRC - Kidney renal clear cell carcinoma(284;0.222)		AGAACCGCTGGAGGCTGCAAC	0.488																																						dbGAP											0													110.0	109.0	109.0					3																	42602687		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039568	CCDS2699.1, CCDS2700.1, CCDS56246.1	3p24.3-p22.1	2006-04-25	2006-04-25	2006-04-25	ENSG00000093183	ENSG00000093183			16828	protein-coding gene	gene with protein product		604028	"""SEC22 vesicle trafficking protein-like 3 (S. cerevisiae)"""	SEC22L3		9501016, 11001058	Standard	NM_004206		Approved	MGC13261, MGC5373	uc003clj.3	Q9BRL7	OTTHUMG00000131797	ENST00000264454.3:c.448C>A	3.37:g.42602687G>T	ENSP00000264454:p.Pro150Thr		O95152|Q68CX3|Q6UW18	Missense_Mutation	SNP	superfamily_Longin-like_dom,pfscan_Longin_dom	p.P150T	ENST00000264454.3	37	c.448	CCDS2700.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.4|20.4	3.978188|3.978188	0.74360|0.74360	.|.	.|.	ENSG00000093183|ENSG00000093183	ENST00000423701;ENST00000273156;ENST00000417572;ENST00000536332;ENST00000264454;ENST00000456515|ENST00000451653	T;T;T;T;T;T|.	0.33216|.	2.01;1.91;1.91;1.42;1.85;2.01|.	5.71|5.71	4.83|4.83	0.62350|0.62350	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73055|0.73055	0.3538|0.3538	M|M	0.72894|0.72894	2.215|2.215	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	1.0;1.0;0.999;0.999|.	T|T	0.73572|0.73572	-0.3940|-0.3940	10|5	0.41790|.	T|.	0.15|.	-22.2609|-22.2609	15.0563|15.0563	0.71915|0.71915	0.0:0.1416:0.8584:0.0|0.0:0.1416:0.8584:0.0	.|.	80;150;150;150|.	F5H0H7;Q9BRL7-3;Q9BRL7;Q9BRL7-2|.	.;.;SC22C_HUMAN;.|.	T|Y	150;150;150;80;150;150|71	ENSP00000414576:P150T;ENSP00000273156:P150T;ENSP00000407564:P150T;ENSP00000439845:P80T;ENSP00000264454:P150T;ENSP00000391170:P150T|.	ENSP00000264454:P150T|.	P|S	-|-	1|2	0|0	SEC22C|SEC22C	42577691|42577691	1.000000|1.000000	0.71417|0.71417	0.123000|0.123000	0.21794|0.21794	0.761000|0.761000	0.43186|0.43186	8.938000|8.938000	0.92943|0.92943	1.396000|1.396000	0.46663|0.46663	-0.175000|-0.175000	0.13238|0.13238	CCA|TCC	SEC22C	-	NULL	ENSG00000093183		0.488	SEC22C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC22C	HGNC	protein_coding	OTTHUMT00000254734.1	44	0.00	0	G	NM_004206		42602687	42602687	-1	no_errors	ENST00000264454	ensembl	human	known	69_37n	missense	19	44.12	15	SNP	0.991	T
SLC12A4	6560	genome.wustl.edu	37	16	67981664	67981664	+	Silent	SNP	G	G	T			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr16:67981664G>T	ENST00000316341.3	-	15	2015	c.1875C>A	c.(1873-1875)ctC>ctA	p.L625L	SLC12A4_ENST00000572037.1_Silent_p.L577L|SLC12A4_ENST00000541864.2_Silent_p.L594L|SLC12A4_ENST00000338335.3_Silent_p.L625L|SLC12A4_ENST00000576616.1_Silent_p.L625L|SLC12A4_ENST00000537830.2_Silent_p.L619L|SLC12A4_ENST00000422611.2_Silent_p.L627L	NM_001145961.1|NM_005072.4	NP_001139433.1|NP_005063.1	Q9UP95	S12A4_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 4	625					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|prostate(4)|skin(2)|urinary_tract(3)	29		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	GGGCCAGGCAGAGACTCATGC	0.612																																						dbGAP											0													53.0	45.0	48.0					16																	67981664		2190	4293	6483	-	-	-	SO:0001819	synonymous_variant	0				CCDS10855.1, CCDS54030.1, CCDS54031.1, CCDS54032.1	16q22.1	2013-07-18	2013-07-18		ENSG00000124067	ENSG00000124067		"""Solute carriers"""	10913	protein-coding gene	gene with protein product		604119				8663127	Standard	NM_005072		Approved	KCC1	uc010ceu.2	Q9UP95	OTTHUMG00000137535	ENST00000316341.3:c.1875C>A	16.37:g.67981664G>T			B4DF69|B4DR04|B4DZ82|B7ZAV0|F5H066|F5H0S9|F5H3C0|O60632|O75893|Q13953|Q96LD5	Silent	SNP	pfam_AA-permease_dom,pfam_K/Cl_cotranspt_1/3,prints_KCL_cotranspt,prints_K/Cl_cotranspt1,tigrfam_Na/K/Cl_cotransptS	p.L627	ENST00000316341.3	37	c.1881	CCDS10855.1	16																																																																																			SLC12A4	-	pfam_AA-permease_dom,tigrfam_Na/K/Cl_cotransptS	ENSG00000124067		0.612	SLC12A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC12A4	HGNC	protein_coding	OTTHUMT00000268864.4	35	0.00	0	G	NM_005072		67981664	67981664	-1	no_errors	ENST00000422611	ensembl	human	known	69_37n	silent	15	16.67	3	SNP	0.997	T
SLC38A9	153129	genome.wustl.edu	37	5	54929602	54929602	+	Silent	SNP	G	G	A			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr5:54929602G>A	ENST00000396865.2	-	14	2001	c.1410C>T	c.(1408-1410)atC>atT	p.I470I	SLC38A9_ENST00000512595.1_Silent_p.I407I|SLC38A9_ENST00000416547.2_Silent_p.I346I|SLC38A9_ENST00000318672.3_Silent_p.I470I|SLC38A9_ENST00000539768.1_3'UTR|SLC38A9_ENST00000515629.1_Silent_p.I407I	NM_173514.3	NP_775785.2	Q8NBW4	S38A9_HUMAN	solute carrier family 38, member 9	470					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	8		Lung NSC(810;0.00122)|Prostate(74;0.0376)|Breast(144;0.181)				TGTCACCGAAGATATGGCCCA	0.478																																						dbGAP											0													111.0	100.0	104.0					5																	54929602		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3968.1, CCDS58947.1, CCDS58948.1, CCDS75243.1	5q11.2	2013-05-22			ENSG00000177058	ENSG00000177058		"""Solute carriers"""	26907	protein-coding gene	gene with protein product							Standard	NM_173514		Approved	FLJ90709	uc003jqf.3	Q8NBW4	OTTHUMG00000131189	ENST00000396865.2:c.1410C>T	5.37:g.54929602G>A			B3KXV1|B7Z7D0|Q0P5S0|Q6MZJ8	Missense_Mutation	SNP	pfam_AA_transpt_TM	p.S376F	ENST00000396865.2	37	c.1127	CCDS3968.1	5																																																																																			SLC38A9	-	NULL	ENSG00000177058		0.478	SLC38A9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC38A9	HGNC	protein_coding	OTTHUMT00000253912.2	58	0.00	0	G	NM_173514		54929602	54929602	-1	no_errors	ENST00000505708	ensembl	human	known	69_37n	missense	29	27.50	11	SNP	1.000	A
SLC9A9	285195	genome.wustl.edu	37	3	143412150	143412150	+	Splice_Site	SNP	C	C	T			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr3:143412150C>T	ENST00000316549.6	-	5	742		c.e5-1			NM_173653.3	NP_775924.1	Q8IVB4	SL9A9_HUMAN	solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9						ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|recycling endosome (GO:0055037)	sodium:proton antiporter activity (GO:0015385)			breast(2)|endometrium(5)|kidney(2)|large_intestine(13)|lung(29)|ovary(2)|skin(3)|stomach(1)	57						CATAATTAACCTGTTGAAGAG	0.368																																						dbGAP											0													79.0	77.0	78.0					3																	143412150		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AY254100	CCDS33872.1	3q23-q24	2014-01-28	2012-03-22		ENSG00000181804	ENSG00000181804		"""Solute carriers"""	20653	protein-coding gene	gene with protein product		608396	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 9"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 9"""			14569117	Standard	NM_173653		Approved	FLJ35613, NHE9	uc003evn.3	Q8IVB4	OTTHUMG00000159373	ENST00000316549.6:c.534-1G>A	3.37:g.143412150C>T			A6NMQ9|Q3LIC2|Q5JPI6|Q5WA58|Q8NAB9	Splice_Site	SNP	-	e5-1	ENST00000316549.6	37	c.534-1	CCDS33872.1	3	.	.	.	.	.	.	.	.	.	.	C	21.2	4.113432	0.77210	.	.	ENSG00000181804	ENST00000316549;ENST00000450105	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4414	0.94823	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC9A9	144894840	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.655000	0.74392	2.599000	0.87857	0.650000	0.86243	.	SLC9A9	-	-	ENSG00000181804		0.368	SLC9A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A9	HGNC	protein_coding	OTTHUMT00000354994.1	63	0.00	0	C	NM_173653	Intron	143412150	143412150	-1	no_errors	ENST00000316549	ensembl	human	known	69_37n	splice_site	21	32.26	10	SNP	1.000	T
SMCHD1	23347	genome.wustl.edu	37	18	2778215	2778215	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr18:2778215C>T	ENST00000320876.6	+	44	5863	c.5525C>T	c.(5524-5526)gCg>gTg	p.A1842V	SMCHD1_ENST00000261598.8_Missense_Mutation_p.A1842V|Y_RNA_ENST00000384307.1_RNA|RP11-703M24.5_ENST00000583546.1_RNA	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	1842					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)	p.A1842V(2)|p.A1290V(1)		NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						AATCTGGATGCGGCCAATCAT	0.284																																						dbGAP											3	Substitution - Missense(3)	large_intestine(3)											67.0	64.0	65.0					18																	2778215		1798	4067	5865	-	-	-	SO:0001583	missense	0			AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.5525C>T	18.37:g.2778215C>T	ENSP00000326603:p.Ala1842Val		O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	pfam_SMC_hinge,superfamily_SMC_hinge,superfamily_ATPase-like_ATP-bd,smart_SMC_hinge	p.A1842V	ENST00000320876.6	37	c.5525	CCDS45822.1	18	.	.	.	.	.	.	.	.	.	.	C	28.4	4.920640	0.92249	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	D;D	0.85629	-2.01;-2.01	5.27	5.27	0.74061	SMCs flexible hinge (3);	0.058631	0.64402	D	0.000002	D	0.87140	0.6103	N	0.22421	0.69	0.40934	D	0.984413	D	0.76494	0.999	D	0.81914	0.995	D	0.87456	0.2404	10	0.39692	T	0.17	-18.4144	17.0624	0.86550	0.0:1.0:0.0:0.0	.	1842	A6NHR9	SMHD1_HUMAN	V	1842	ENSP00000326603:A1842V;ENSP00000261598:A1842V	ENSP00000261598:A1842V	A	+	2	0	SMCHD1	2768215	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.262000	0.72514	2.450000	0.82876	0.460000	0.39030	GCG	SMCHD1	-	pfam_SMC_hinge,superfamily_SMC_hinge,smart_SMC_hinge	ENSG00000101596		0.284	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCHD1	HGNC	protein_coding	OTTHUMT00000441082.2	64	0.00	0	C			2778215	2778215	+1	no_errors	ENST00000320876	ensembl	human	known	69_37n	missense	18	37.93	11	SNP	1.000	T
STAP2	55620	genome.wustl.edu	37	19	4325395	4325395	+	Missense_Mutation	SNP	T	T	C			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr19:4325395T>C	ENST00000594605.1	-	10	1100	c.977A>G	c.(976-978)gAt>gGt	p.D326G	STAP2_ENST00000600324.1_Missense_Mutation_p.D326G|STAP2_ENST00000597593.1_5'UTR	NM_001013841.1	NP_001013863.1	Q9UGK3	STAP2_HUMAN	signal transducing adaptor family member 2	326	Pro-rich.					cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		CCACCCACCATCTTGGTTCTC	0.562																																						dbGAP											0													94.0	91.0	92.0					19																	4325395		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ245719	CCDS12128.1, CCDS45926.1	19p13.3	2011-05-03	2007-08-09		ENSG00000178078	ENSG00000178078			30430	protein-coding gene	gene with protein product		607881				10980601, 11441184	Standard	XM_005259592		Approved	STAP-2, BKS	uc002mac.3	Q9UGK3		ENST00000594605.1:c.977A>G	19.37:g.4325395T>C	ENSP00000471052:p.Asp326Gly		A6NKK3|Q9NXI2	Missense_Mutation	SNP	pfscan_SH2	p.D326G	ENST00000594605.1	37	c.977	CCDS45926.1	19	.	.	.	.	.	.	.	.	.	.	T	13.33	2.206283	0.39003	.	.	ENSG00000178078	ENST00000314714;ENST00000424810	.	.	.	4.58	4.58	0.56647	.	0.974283	0.08406	U	0.950585	T	0.44030	0.1274	L	0.57536	1.79	0.09310	N	1	P;P	0.46784	0.884;0.728	B;B	0.41764	0.366;0.297	T	0.38757	-0.9646	9	0.87932	D	0	-13.6545	10.4129	0.44305	0.0:0.0:0.0:1.0	.	326;326	Q9UGK3-2;Q9UGK3	.;STAP2_HUMAN	G	326	.	ENSP00000317912:D326G	D	-	2	0	STAP2	4276395	0.053000	0.20554	0.008000	0.14137	0.033000	0.12548	3.349000	0.52217	1.725000	0.51514	0.450000	0.29827	GAT	STAP2	-	NULL	ENSG00000178078		0.562	STAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	STAP2	HGNC	protein_coding	OTTHUMT00000458114.2	57	0.00	0	T	NM_001013841		4325395	4325395	-1	no_errors	ENST00000314714	ensembl	human	known	69_37n	missense	41	26.79	15	SNP	0.014	C
SUPT16H	11198	genome.wustl.edu	37	14	21840141	21840141	+	Silent	SNP	G	G	A			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr14:21840141G>A	ENST00000216297.2	-	3	560	c.222C>T	c.(220-222)atC>atT	p.I74I		NM_007192.3	NP_009123.1	Q9Y5B9	SP16H_HUMAN	suppressor of Ty 16 homolog (S. cerevisiae)	74					DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|nucleosome disassembly (GO:0006337)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)		TGGCCATAAAGATGATTTTGT	0.398																																						dbGAP											0													108.0	93.0	98.0					14																	21840141		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152961	CCDS9569.1	14q11.1	2008-08-13	2001-11-28		ENSG00000092201	ENSG00000092201			11465	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 140 kDa subunit"""	605012	"""suppressor of Ty (S.cerevisiae) 16 homolog"""			9489704, 11239457	Standard	NM_007192		Approved	FACT, FACTP140, SPT16/CDC68, FLJ14010, FLJ10857, CDC68	uc001wao.2	Q9Y5B9	OTTHUMG00000029685	ENST00000216297.2:c.222C>T	14.37:g.21840141G>A			Q6GMT8|Q6P2F1|Q6PJM1|Q9NRX0	Silent	SNP	pfam_FACT_Spt16p,pfam_Pept_M24_structural-domain,pfam_DUF1747,superfamily_Pept_M24_structural-domain	p.I74	ENST00000216297.2	37	c.222	CCDS9569.1	14																																																																																			SUPT16H	-	NULL	ENSG00000092201		0.398	SUPT16H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUPT16H	HGNC	protein_coding	OTTHUMT00000074025.2	117	0.00	0	G			21840141	21840141	-1	no_errors	ENST00000216297	ensembl	human	known	69_37n	silent	64	22.89	19	SNP	1.000	A
TASP1	55617	genome.wustl.edu	37	20	13415772	13415772	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr20:13415772C>T	ENST00000337743.4	-	12	1135	c.1015G>A	c.(1015-1017)Gtg>Atg	p.V339M	TASP1_ENST00000539805.1_Silent_p.A141A|TASP1_ENST00000480436.1_5'UTR	NM_017714.2	NP_060184.2	Q9H6P5	TASP1_HUMAN	taspase, threonine aspartase, 1	339					positive regulation of transcription, DNA-templated (GO:0045893)		threonine-type endopeptidase activity (GO:0004298)			NS(1)|breast(1)|endometrium(2)|large_intestine(11)|liver(1)|lung(11)|stomach(2)|urinary_tract(2)	31						CCGCCAAGCACGCCATCTTCA	0.403																																						dbGAP											0													64.0	56.0	59.0					20																	13415772		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000219	CCDS13116.1	20p12	2005-10-15	2005-10-15	2005-10-15	ENSG00000089123	ENSG00000089123	3.4.25.-		15859	protein-coding gene	gene with protein product		608270	"""chromosome 20 open reading frame 13"""	C20orf13		14636557	Standard	XR_430268		Approved	FLJ20212, dJ585I14.2	uc002woi.3	Q9H6P5	OTTHUMG00000031904	ENST00000337743.4:c.1015G>A	20.37:g.13415772C>T	ENSP00000338624:p.Val339Met		B7Z690|B7Z963|Q5TDU9|Q9BQN0|Q9NQ08|Q9NTS6|Q9NXJ2	Missense_Mutation	SNP	pfam_Peptidase_T2	p.V339M	ENST00000337743.4	37	c.1015	CCDS13116.1	20	.	.	.	.	.	.	.	.	.	.	C	15.79	2.936538	0.52972	.	.	ENSG00000089123	ENST00000337743	D	0.92965	-3.14	5.84	5.84	0.93424	.	0.054355	0.64402	D	0.000001	D	0.90202	0.6937	L	0.48642	1.525	0.80722	D	1	P	0.51351	0.944	P	0.46172	0.506	D	0.89643	0.3864	10	0.48119	T	0.1	-5.3984	12.2651	0.54674	0.0:0.9216:0.0:0.0784	.	339	Q9H6P5	TASP1_HUMAN	M	339	ENSP00000338624:V339M	ENSP00000338624:V339M	V	-	1	0	TASP1	13363772	0.992000	0.36948	0.966000	0.40874	0.559000	0.35586	2.940000	0.49003	2.765000	0.95021	0.655000	0.94253	GTG	TASP1	-	NULL	ENSG00000089123		0.403	TASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TASP1	HGNC	protein_coding	OTTHUMT00000078041.2	33	0.00	0	C	NM_017714		13415772	13415772	-1	no_errors	ENST00000337743	ensembl	human	known	69_37n	missense	12	36.84	7	SNP	0.986	T
TEP1	7011	genome.wustl.edu	37	14	20852245	20852245	+	Missense_Mutation	SNP	C	C	A			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr14:20852245C>A	ENST00000262715.5	-	24	3526	c.3486G>T	c.(3484-3486)agG>agT	p.R1162S	TEP1_ENST00000545983.1_5'Flank|TEP1_ENST00000556935.1_Missense_Mutation_p.R1054S	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	1162	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		CCAGGCTCAGCCTTCCGTGGG	0.647																																						dbGAP											0													52.0	51.0	51.0					14																	20852245		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.3486G>T	14.37:g.20852245C>A	ENSP00000262715:p.Arg1162Ser		A0AUV9	Missense_Mutation	SNP	pfam_TROVE,pfam_TEP1_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_NACHT_NTPase,pfscan_TROVE,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R1162S	ENST00000262715.5	37	c.3486	CCDS9548.1	14	.	.	.	.	.	.	.	.	.	.	C	3.377	-0.127114	0.06795	.	.	ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935	T;T	0.80393	-1.37;-1.37	5.62	1.57	0.23409	NACHT nucleoside triphosphatase (1);	0.463080	0.26096	N	0.026371	T	0.60958	0.2309	N	0.22421	0.69	0.80722	D	1	B;B;B	0.22146	0.021;0.003;0.065	B;B;B	0.21151	0.013;0.009;0.033	T	0.46911	-0.9157	10	0.25106	T	0.35	-5.9123	3.1747	0.06564	0.1404:0.5549:0.1372:0.1675	.	1054;512;1162	G3V5X7;G3V2A4;Q99973	.;.;TEP1_HUMAN	S	1162;1162;1054	ENSP00000262715:R1162S;ENSP00000452574:R1054S	ENSP00000262715:R1162S	R	-	3	2	TEP1	19922085	0.815000	0.29118	0.999000	0.59377	0.152000	0.21847	0.681000	0.25320	0.737000	0.32582	-0.140000	0.14226	AGG	TEP1	-	pfscan_NACHT_NTPase	ENSG00000129566		0.647	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEP1	HGNC	protein_coding	OTTHUMT00000073563.2	105	0.00	0	C	NM_007110		20852245	20852245	-1	no_errors	ENST00000262715	ensembl	human	known	69_37n	missense	36	25.00	12	SNP	0.999	A
TTC7B	145567	genome.wustl.edu	37	14	91007734	91007734	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr14:91007734G>A	ENST00000328459.6	-	20	2631	c.2510C>T	c.(2509-2511)aCc>aTc	p.T837I	TTC7B_ENST00000554654.1_5'UTR|TTC7B_ENST00000357056.2_Missense_Mutation_p.T854I	NM_001010854.1	NP_001010854.1	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B	837										NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	36		Melanoma(154;0.222)				GGGGATGATGGTGAAGGGCAC	0.697																																						dbGAP											0													18.0	21.0	20.0					14																	91007734		2183	4246	6429	-	-	-	SO:0001583	missense	0			BC035865	CCDS32140.1	14q32.12	2013-01-11	2004-06-02	2004-06-04		ENSG00000165914		"""Tetratricopeptide (TTC) repeat domain containing"""	19858	protein-coding gene	gene with protein product			"""tetratricopeptide repeat domain 7 like 1"""	TTC7L1			Standard	XM_005267367		Approved		uc001xyp.3	Q86TV6		ENST00000328459.6:c.2510C>T	14.37:g.91007734G>A	ENSP00000336127:p.Thr837Ile		Q86U24|Q86VT3	Missense_Mutation	SNP	pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.T854I	ENST00000328459.6	37	c.2561	CCDS32140.1	14	.	.	.	.	.	.	.	.	.	.	G	23.0	4.359726	0.82353	.	.	ENSG00000165914	ENST00000555768;ENST00000357056;ENST00000328459;ENST00000553972	T;T;T	0.65732	1.83;1.13;-0.17	5.72	5.72	0.89469	.	0.059495	0.64402	D	0.000005	T	0.73753	0.3627	M	0.62016	1.91	0.80722	D	1	D;P	0.64830	0.994;0.95	P;P	0.55055	0.767;0.55	T	0.74856	-0.3522	10	0.59425	D	0.04	-29.4636	19.8929	0.96937	0.0:0.0:1.0:0.0	.	837;854	Q86TV6;Q86TV6-2	TTC7B_HUMAN;.	I	735;854;837;324	ENSP00000349564:T854I;ENSP00000336127:T837I;ENSP00000451440:T324I	ENSP00000336127:T837I	T	-	2	0	TTC7B	90077487	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.811000	0.86092	2.702000	0.92279	0.462000	0.41574	ACC	TTC7B	-	NULL	ENSG00000165914		0.697	TTC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC7B	HGNC	protein_coding	OTTHUMT00000411364.2	56	0.00	0	G			91007734	91007734	-1	no_errors	ENST00000357056	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	1.000	A
TUBB8	347688	genome.wustl.edu	37	10	94654	94654	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr10:94654C>T	ENST00000309812.4	-	3	240	c.178G>A	c.(178-180)Gtg>Atg	p.V60M	TUBB8_ENST00000332708.5_Silent_p.T23T|TUBB8_ENST00000413237.3_5'UTR|TUBB8_ENST00000447903.2_De_novo_Start_InFrame	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	60					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		GCGCGGGGCACGTACCTGCCA	0.706																																					Pancreas(192;2041 3010 9013 18103)	dbGAP											0													18.0	22.0	20.0					10																	94654		2187	4245	6432	-	-	-	SO:0001583	missense	0			AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.178G>A	10.37:g.94654C>T	ENSP00000311042:p.Val60Met		Q5SQX9|Q8WZ78	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_myosin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.V60M	ENST00000309812.4	37	c.178	CCDS7051.1	10	.	.	.	.	.	.	.	.	.	.	C	8.123	0.781304	0.16120	.	.	ENSG00000173876	ENST00000328974;ENST00000309812	T	0.71222	-0.55	0.109	0.109	0.14578	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.51477	U	0.000085	T	0.78502	0.4293	H	0.98818	4.34	0.80722	D	1	D	0.64830	0.994	B	0.42386	0.386	T	0.78692	-0.2105	10	0.87932	D	0	.	5.9913	0.19465	0.0:0.9994:0.0:6.0E-4	.	60	Q3ZCM7	TBB8_HUMAN	M	60	ENSP00000311042:V60M	ENSP00000311042:V60M	V	-	1	0	RP11-631M21.2	84654	0.997000	0.39634	0.008000	0.14137	0.008000	0.06430	5.289000	0.65656	0.181000	0.19994	0.184000	0.17185	GTG	TUBB8	-	pfam_Tubulin_FtsZ_GTPase,pfam_Misato_II_myosin-like,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Tubulin	ENSG00000173876		0.706	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB8	HGNC	protein_coding	OTTHUMT00000467795.1	93	0.00	0	C	NM_177987		94654	94654	-1	no_errors	ENST00000328974	ensembl	human	known	69_37n	missense	46	24.59	15	SNP	1.000	T
DNAJB7	150353	genome.wustl.edu	37	22	41258059	41258059	+	5'UTR	SNP	C	C	T			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr22:41258059C>T	ENST00000307221.4	-	0	71				XPNPEP3_ENST00000414396.1_Intron|XPNPEP3_ENST00000541156.1_Intron|XPNPEP3_ENST00000482652.1_3'UTR|XPNPEP3_ENST00000544094.1_5'Flank|XPNPEP3_ENST00000357137.4_Intron	NM_145174.1	NP_660157.1	Q7Z6W7	DNJB7_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 7								chaperone binding (GO:0051087)			breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	10						TTCCTCAGCTCAGGCTCTGCT	0.423																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AF085232	CCDS14008.1	22q13.2	2011-09-02			ENSG00000172404	ENSG00000172404		"""Heat shock proteins / DNAJ (HSP40)"""	24986	protein-coding gene	gene with protein product		611336				12477932	Standard	NM_145174		Approved	HSC3	uc003azj.3	Q7Z6W7	OTTHUMG00000151202	ENST00000307221.4:c.-61G>A	22.37:g.41258059C>T			Q2M220|Q5H904|Q8WYJ7	RNA	SNP	-	NULL	ENST00000307221.4	37	NULL	CCDS14008.1	22																																																																																			XPNPEP3	-	-	ENSG00000196236		0.423	DNAJB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPNPEP3	HGNC	protein_coding	OTTHUMT00000321765.1	64	0.00	0	C	NM_145174		41258059	41258059	+1	no_errors	ENST00000482652	ensembl	human	known	69_37n	rna	27	20.59	7	SNP	0.022	T
ZC3H7B	23264	genome.wustl.edu	37	22	41716713	41716713	+	Missense_Mutation	SNP	A	A	T			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr22:41716713A>T	ENST00000352645.4	+	2	306	c.49A>T	c.(49-51)Att>Ttt	p.I17F	ZC3H7B_ENST00000351589.4_Missense_Mutation_p.I17F	NM_017590.4	NP_060060.3	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B	17					viral process (GO:0016032)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						GCTGCAGTTCATTCAGTAAGC	0.597																																						dbGAP											0													129.0	99.0	109.0					22																	41716713		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14013.1	22q13.2	2013-01-10		2005-08-09	ENSG00000100403	ENSG00000100403		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30869	protein-coding gene	gene with protein product						10470851, 11230166	Standard	NM_017590		Approved	RoXaN, FLJ13787, DKFZp434K0920, KIAA1031	uc003azw.4	Q9UGR2	OTTHUMG00000150969	ENST00000352645.4:c.49A>T	22.37:g.41716713A>T	ENSP00000345793:p.Ile17Phe		A7YY88|B2RCA4|Q5TFX9|Q8TBT9|Q9H8B6|Q9UGQ9|Q9UGR0|Q9UGR1|Q9UK03|Q9UPW9	Missense_Mutation	SNP	pfam_Znf_CCCH,pfam_TPR-1,smart_TPR_repeat,smart_Znf_CCCH,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.I17F	ENST00000352645.4	37	c.49	CCDS14013.1	22	.	.	.	.	.	.	.	.	.	.	A	31	5.068004	0.93950	.	.	ENSG00000100403	ENST00000352645;ENST00000351589	T;T	0.15603	2.41;2.41	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.39410	0.1077	L	0.60455	1.87	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.81914	0.995;0.987	T	0.16305	-1.0407	10	0.87932	D	0	-12.7257	15.9478	0.79806	1.0:0.0:0.0:0.0	.	17;17	Q9UGR2-2;Q9UGR2	.;Z3H7B_HUMAN	F	17	ENSP00000345793:I17F;ENSP00000263243:I17F	ENSP00000263243:I17F	I	+	1	0	ZC3H7B	40046659	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.626000	0.83164	2.220000	0.72140	0.533000	0.62120	ATT	ZC3H7B	-	NULL	ENSG00000100403		0.597	ZC3H7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H7B	HGNC	protein_coding	OTTHUMT00000320696.1	59	0.00	0	A	NM_017590		41716713	41716713	+1	no_errors	ENST00000351589	ensembl	human	known	69_37n	missense	24	36.84	14	SNP	1.000	T
MOG	4340	genome.wustl.edu	37	6	29641083	29641083	+	IGR	SNP	G	G	A			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr6:29641083G>A	ENST00000376917.3	+	0	2160				ZFP57_ENST00000376883.1_Missense_Mutation_p.R249W|ZFP57_ENST00000488757.1_Missense_Mutation_p.R269W|ZFP57_ENST00000376881.3_Missense_Mutation_p.R249W	NM_002433.4|NM_206809.3	NP_002424.3|NP_996532.2	Q16653	MOG_HUMAN	myelin oligodendrocyte glycoprotein						cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|positive regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034126)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|skin(2)	19						GACTGGTCCCGGAAGCTCTTC	0.557																																						dbGAP											0													117.0	126.0	123.0					6																	29641083		1306	2579	3885	-	-	-	SO:0001628	intergenic_variant	0				CCDS4667.1, CCDS34366.1, CCDS34367.1, CCDS34368.1, CCDS34369.1, CCDS34370.1, CCDS47394.1, CCDS47395.1, CCDS47395.2, CCDS54977.1	6p22.1	2014-01-16			ENSG00000204655	ENSG00000204655		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	7197	protein-coding gene	gene with protein product		159465					Standard	NM_002433		Approved	BTN6, BTNL11	uc003nne.3	Q16653	OTTHUMG00000031099		6.37:g.29641083G>A			A6NDR4|A6NNJ9|A8MY31|B0UZR9|E9PGF0|F8W9D5|O00713|O00714|O00715|Q13054|Q13055|Q14855|Q29ZN8|Q56UY0|Q5JNX7|Q5JNY1|Q5JNY2|Q5JNY4|Q5SSB5|Q5SSB6|Q5STL9|Q5STM0|Q5STM1|Q5STM2|Q5STM5|Q5SUK5|Q5SUK7|Q5SUK8|Q5SUK9|Q5SUL0|Q5SUL1|Q8IYG5|Q92891|Q92892|Q92893|Q92894|Q92895|Q93053|Q96KU9|Q96KV0|Q96KV1|Q99605	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R269W	ENST00000376917.3	37	c.805	CCDS34370.1	6	.	.	.	.	.	.	.	.	.	.	G	17.15	3.316037	0.60524	.	.	ENSG00000204644	ENST00000488757;ENST00000376881;ENST00000376883	T;T;T	0.54071	0.59;0.59;0.59	4.64	1.76	0.24704	.	0.000000	0.43919	D	0.000516	T	0.46698	0.1406	L	0.50847	1.595	0.21604	N	0.999622	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.984	T	0.27365	-1.0076	10	0.72032	D	0.01	-30.4224	5.7424	0.18102	0.0933:0.0:0.3979:0.5087	.	269;249	Q9NU63-3;Q9NU63-2	.;.	W	269;249;249	ENSP00000418259:R269W;ENSP00000366078:R249W;ENSP00000366080:R249W	ENSP00000366078:R249W	R	-	1	2	ZFP57	29749062	0.000000	0.05858	0.996000	0.52242	0.968000	0.65278	-0.431000	0.06965	0.625000	0.30304	0.563000	0.77884	CGG	ZFP57	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000204644		0.557	MOG-001	KNOWN	basic|CCDS	protein_coding	ZFP57	HGNC	protein_coding	OTTHUMT00000076160.3	105	0.00	0	G	NM_002433		29641083	29641083	-1	no_errors	ENST00000488757	ensembl	human	known	69_37n	missense	51	25.71	18	SNP	0.049	A
ZNF35	7584	genome.wustl.edu	37	3	44701310	44701310	+	Silent	SNP	G	G	A			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr3:44701310G>A	ENST00000396056.2	+	4	1690	c.1455G>A	c.(1453-1455)caG>caA	p.Q485Q	ZNF35_ENST00000296092.3_3'UTR|ZNF35_ENST00000542250.1_Silent_p.Q325Q|RP11-944L7.4_ENST00000457331.1_RNA	NM_003420.3	NP_003411.3	P13682	ZNF35_HUMAN	zinc finger protein 35	485					cellular response to retinoic acid (GO:0071300)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cell (GO:0005623)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(3)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	12		Ovarian(412;0.0228)		OV - Ovarian serous cystadenocarcinoma(275;2.49e-27)|KIRC - Kidney renal clear cell carcinoma(197;0.0475)|Kidney(197;0.0595)		CCTTCAGACAGAGGTCGAGCC	0.478																																						dbGAP											0													76.0	75.0	75.0					3																	44701310		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X07289	CCDS2718.2	3p21.32	2013-01-08	2006-05-11		ENSG00000169981	ENSG00000169981		"""Zinc fingers, C2H2-type"""	13099	protein-coding gene	gene with protein product		194533	"""zinc finger protein 35 (clone HF.10)"""			2108922, 1572646	Standard	NM_003420		Approved	HF.10, HF10, Zfp105	uc003cnq.3	P13682	OTTHUMG00000133091	ENST00000396056.2:c.1455G>A	3.37:g.44701310G>A			B2RBU6|Q53Y54|Q96D01	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q485	ENST00000396056.2	37	c.1455	CCDS2718.2	3																																																																																			ZNF35	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000169981		0.478	ZNF35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF35	HGNC	protein_coding	OTTHUMT00000256749.4	36	0.00	0	G	NM_003420		44701310	44701310	+1	no_errors	ENST00000396056	ensembl	human	known	69_37n	silent	13	45.83	11	SNP	0.000	A
ZNF385A	25946	genome.wustl.edu	37	12	54769725	54769725	+	Missense_Mutation	SNP	T	T	C			TCGA-OL-A66J-01A-11D-A29N-09	TCGA-OL-A66J-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	b2b9b36e-1584-453c-a2cb-6455ef27e088	65db66df-0e02-40dd-9c2a-cc353d980700	g.chr12:54769725T>C	ENST00000338010.5	-	3	214	c.161A>G	c.(160-162)cAg>cGg	p.Q54R	ZNF385A_ENST00000552382.1_5'UTR|ZNF385A_ENST00000551771.1_Missense_Mutation_p.Q34R|ZNF385A_ENST00000551109.1_Missense_Mutation_p.Q34R|ZNF385A_ENST00000546970.1_Missense_Mutation_p.Q34R|ZNF385A_ENST00000394313.2_Missense_Mutation_p.Q34R|ZNF385A_ENST00000352268.6_Missense_Mutation_p.Q54R|RP11-753H16.5_ENST00000552785.1_RNA|RP11-753H16.3_ENST00000550474.1_RNA	NM_001130967.1	NP_001124439.1	Q96PM9	Z385A_HUMAN	zinc finger protein 385A	54					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|hemostasis (GO:0007599)|learning or memory (GO:0007611)|locomotory behavior (GO:0007626)|megakaryocyte development (GO:0035855)|mRNA localization resulting in posttranscriptional regulation of gene expression (GO:0010609)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)|positive regulation of DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:1902164)|positive regulation of fat cell differentiation (GO:0045600)|regulation of cytoplasmic translation (GO:2000765)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA 3'-UTR binding (GO:0003730)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|urinary_tract(1)	15						CACAGCCTTCTGCACAGGGTC	0.542																																						dbGAP											0													72.0	64.0	67.0					12																	54769725		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF304052	CCDS8879.1, CCDS44910.1, CCDS44911.1	12q13.13	2012-10-05	2007-12-06	2007-12-06		ENSG00000161642			17521	protein-coding gene	gene with protein product		609124	"""zinc finger protein 385"""	ZNF385			Standard	XM_005268785		Approved	DKFZp586G1122, Hzf, ZFP385	uc001sfy.3	Q96PM9	OTTHUMG00000169840	ENST00000338010.5:c.161A>G	12.37:g.54769725T>C	ENSP00000338927:p.Gln54Arg		B2RDN5|B4DKH2|F1T0F1|J3KNS3|Q5VH53|Q9H7R6|Q9UFU3	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like	p.Q54R	ENST00000338010.5	37	c.161	CCDS44911.1	12	.	.	.	.	.	.	.	.	.	.	T	24.9	4.577121	0.86645	.	.	ENSG00000161642	ENST00000551109;ENST00000352268;ENST00000394313;ENST00000338010;ENST00000546970;ENST00000551771;ENST00000546919;ENST00000549937;ENST00000547210;ENST00000550774	T;T;T;T;T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96	3.77	3.77	0.43336	.	0.000000	0.85682	D	0.000000	T	0.57286	0.2043	M	0.61703	1.905	0.46874	D	0.999237	D;D;D;D;D	0.65815	0.989;0.995;0.993;0.993;0.993	D;D;D;P;P	0.70487	0.969;0.934;0.91;0.823;0.823	T	0.58261	-0.7667	10	0.49607	T	0.09	-13.15	10.7971	0.46466	0.0:0.0:0.0:1.0	.	34;34;34;34;34	Q96PM9-2;F8VSJ1;F8VRY0;Q96PM9;F1T0F1	.;.;.;Z385A_HUMAN;.	R	34;54;34;54;34;34;34;16;34;34	ENSP00000449161:Q34R;ENSP00000293385:Q54R;ENSP00000377849:Q34R;ENSP00000338927:Q54R;ENSP00000446913:Q34R;ENSP00000447162:Q34R;ENSP00000448466:Q34R;ENSP00000448567:Q16R;ENSP00000448264:Q34R;ENSP00000449462:Q34R	ENSP00000338927:Q54R	Q	-	2	0	ZNF385A	53055992	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.508000	0.81686	1.720000	0.51447	0.459000	0.35465	CAG	ZNF385A	-	NULL	ENSG00000161642		0.542	ZNF385A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF385A	HGNC	protein_coding	OTTHUMT00000406162.1	45	0.00	0	T	NM_015481		54769725	54769725	-1	no_errors	ENST00000338010	ensembl	human	known	69_37n	missense	17	39.29	11	SNP	1.000	C
