#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ABCC11	85320	genome.wustl.edu	37	16	48212593	48212593	+	Missense_Mutation	SNP	G	G	T	rs376835882		TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr16:48212593G>T	ENST00000394747.1	-	23	3612	c.3263C>A	c.(3262-3264)gCg>gAg	p.A1088E	ABCC11_ENST00000394748.1_Missense_Mutation_p.A1088E|ABCC11_ENST00000565329.1_5'UTR|ABCC11_ENST00000356608.2_Missense_Mutation_p.A1088E|ABCC11_ENST00000353782.5_Missense_Mutation_p.A1088E	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	1088	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	GAAGCTGGACGCCAGCTAGAA	0.567																																																	0													80.0	72.0	75.0					16																	48212593		2201	4300	6501	SO:0001583	missense	85320			AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.3263C>A	16.37:g.48212593G>T	ENSP00000378230:p.Ala1088Glu		Q8TDJ0|Q96JA6|Q9BX80	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.A1088E	ENST00000394747.1	37	c.3263	CCDS10732.1	16	.	.	.	.	.	.	.	.	.	.	G	15.29	2.788612	0.49997	.	.	ENSG00000121270	ENST00000353782;ENST00000356608;ENST00000394748;ENST00000394747	D;D;D;D	0.94758	-3.51;-3.51;-3.51;-3.51	3.75	2.78	0.32641	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, transmembrane domain (1);	0.201869	0.42294	D	0.000722	D	0.93789	0.8014	L	0.56769	1.78	0.80722	D	1	D;P	0.53462	0.96;0.777	P;P	0.52881	0.712;0.602	D	0.92323	0.5867	10	0.87932	D	0	-6.1554	7.3547	0.26713	0.1235:0.0:0.8765:0.0	.	1088;1088	Q96J66-2;Q96J66	.;ABCCB_HUMAN	E	1088	ENSP00000311326:A1088E;ENSP00000349017:A1088E;ENSP00000378231:A1088E;ENSP00000378230:A1088E	ENSP00000311326:A1088E	A	-	2	0	ABCC11	46770094	0.988000	0.35896	0.437000	0.26809	0.177000	0.22998	2.087000	0.41653	0.795000	0.33922	0.462000	0.41574	GCG	ABCC11	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1		0.567	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ABCC11	HGNC	protein_coding	OTTHUMT00000429984.1	G	NM_032583		48212593	-1	no_errors	ENST00000356608	ensembl	human	known	70_37	missense	SNP	0.973	T
AHNAK2	113146	genome.wustl.edu	37	14	105417627	105417627	+	Silent	SNP	G	G	A			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr14:105417627G>A	ENST00000333244.5	-	7	4280	c.4161C>T	c.(4159-4161)ctC>ctT	p.L1387L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1387						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGCCAGCCTGGAGCTCCAGGT	0.642																																																	0													74.0	59.0	65.0					14																	105417627		1761	2805	4566	SO:0001819	synonymous_variant	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.4161C>T	14.37:g.105417627G>A			Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L1387	ENST00000333244.5	37	c.4161	CCDS45177.1	14																																																																																			AHNAK2	-	NULL		0.642	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	G	NM_138420		105417627	-1	no_errors	ENST00000333244	ensembl	human	known	70_37	silent	SNP	0.003	A
ANKRD31	256006	genome.wustl.edu	37	5	74413999	74413999	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr5:74413999C>G	ENST00000274361.3	-	17	4020	c.3829G>C	c.(3829-3831)Gag>Cag	p.E1277Q	ANKRD31_ENST00000506364.2_Missense_Mutation_p.E1334Q|ANKRD31_ENST00000504022.1_5'UTR	NM_001164443.1	NP_001157915.1	Q8N7Z5	ANR31_HUMAN	ankyrin repeat domain 31	1277										endometrium(1)|kidney(4)	5						TTAACAGTCTCAATAGCACCA	0.318																																																	0													203.0	166.0	177.0					5																	74413999		692	1591	2283	SO:0001583	missense	256006			AK097510	CCDS47233.1	5q13.3	2013-01-10			ENSG00000145700	ENSG00000145700		"""Ankyrin repeat domain containing"""	26853	protein-coding gene	gene with protein product							Standard	NM_001164443		Approved	FLJ40191	uc003kdo.2	Q8N7Z5	OTTHUMG00000162649	ENST00000274361.3:c.3829G>C	5.37:g.74413999C>G	ENSP00000274361:p.Glu1277Gln			Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E1277Q	ENST00000274361.3	37	c.3829		5	.	.	.	.	.	.	.	.	.	.	C	10.52	1.373907	0.24857	.	.	ENSG00000145700	ENST00000274361	T	0.33438	1.41	5.25	4.38	0.52667	.	.	.	.	.	T	0.25531	0.0621	N	0.25380	0.74	0.24743	N	0.99302	.	.	.	.	.	.	T	0.16630	-1.0396	7	0.20519	T	0.43	.	12.3034	0.54887	0.0:0.8295:0.1705:0.0	.	.	.	.	Q	1277	ENSP00000274361:E1277Q	ENSP00000274361:E1277Q	E	-	1	0	ANKRD31	74449755	0.143000	0.22626	0.704000	0.30370	0.735000	0.41995	1.437000	0.34991	1.345000	0.45676	-0.252000	0.11476	GAG	ANKRD31	-	NULL		0.318	ANKRD31-201	KNOWN	basic|appris_principal	protein_coding	ANKRD31	HGNC	protein_coding		C	NM_001164443		74413999	-1	no_errors	ENST00000274361	ensembl	human	known	70_37	missense	SNP	0.869	G
BACH1	571	genome.wustl.edu	37	21	30714889	30714889	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr21:30714889C>T	ENST00000399921.1	+	5	2189	c.1946C>T	c.(1945-1947)tCa>tTa	p.S649L	BACH1_ENST00000286800.3_Missense_Mutation_p.S649L	NM_206866.1	NP_996749.1	Q9BX63	FANCJ_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 1	0					DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|urinary_tract(2)	27						TGCCCACTTTCATTTTTAATT	0.428																																																	0													97.0	105.0	103.0					21																	30714889		2203	4300	6503	SO:0001583	missense	571			AF026200	CCDS13585.1	21q22.1	2013-01-10			ENSG00000156273	ENSG00000156273		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	935	protein-coding gene	gene with protein product		602751				9544839, 9479503	Standard	NR_027655		Approved	BACH-1, BTBD24	uc002ynj.3	O14867	OTTHUMG00000078878	ENST00000399921.1:c.1946C>T	21.37:g.30714889C>T	ENSP00000382805:p.Ser649Leu		Q3MJE2|Q8NCI5	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_bZIP,superfamily_BTB/POZ_fold,superfamily_Euk_TF_DNA-bd,smart_BTB/POZ-like,smart_bZIP,pfscan_BTB/POZ-like,pfscan_bZIP	p.S649L	ENST00000399921.1	37	c.1946	CCDS13585.1	21	.	.	.	.	.	.	.	.	.	.	C	19.73	3.881775	0.72294	.	.	ENSG00000156273	ENST00000286800;ENST00000399921	T;T	0.72615	-0.67;-0.67	5.86	5.86	0.93980	.	0.180261	0.38663	N	0.001610	T	0.68677	0.3027	L	0.56769	1.78	0.43740	D	0.996232	P	0.35077	0.483	B	0.35859	0.212	T	0.66392	-0.5935	10	0.33141	T	0.24	-16.7934	16.4809	0.84157	0.1314:0.8686:0.0:0.0	.	649	O14867	BACH1_HUMAN	L	649	ENSP00000286800:S649L;ENSP00000382805:S649L	ENSP00000286800:S649L	S	+	2	0	BACH1	29636760	0.994000	0.37717	0.977000	0.42913	0.998000	0.95712	3.517000	0.53443	2.781000	0.95711	0.650000	0.86243	TCA	BACH1	-	NULL		0.428	BACH1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BACH1	HGNC	protein_coding	OTTHUMT00000171974.1	C	NM_206866		30714889	+1	no_errors	ENST00000286800	ensembl	human	known	70_37	missense	SNP	0.873	T
BCDIN3D	144233	genome.wustl.edu	37	12	50236730	50236730	+	Silent	SNP	G	G	A			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr12:50236730G>A	ENST00000333924.4	-	1	182	c.141C>T	c.(139-141)ctC>ctT	p.L47L	BCDIN3D-AS1_ENST00000549124.1_RNA|BCDIN3D-AS1_ENST00000548872.1_RNA	NM_181708.2	NP_859059.1	Q7Z5W3	BN3D2_HUMAN	BCDIN3 domain containing	47					miRNA metabolic process (GO:0010586)|negative regulation of pre-miRNA processing (GO:2000632)|RNA methylation (GO:0001510)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	O-methyltransferase activity (GO:0008171)|RNA methyltransferase activity (GO:0008173)			endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)|stomach(1)	9						GCAGGAGGCGGAGCCGTTGCT	0.632																																																	0													56.0	67.0	63.0					12																	50236730		2203	4300	6503	SO:0001819	synonymous_variant	144233				CCDS8790.1	12q13.13	2008-03-12				ENSG00000186666			27050	protein-coding gene	gene with protein product							Standard	NM_181708		Approved		uc001rvh.3	Q7Z5W3	OTTHUMG00000169807	ENST00000333924.4:c.141C>T	12.37:g.50236730G>A			A8K829	Missense_Mutation	SNP	NULL	p.S40F	ENST00000333924.4	37	c.119	CCDS8790.1	12	.	.	.	.	.	.	.	.	.	.	G	14.06	2.421718	0.43020	.	.	ENSG00000186666	ENST00000550861	.	.	.	6.08	1.63	0.23807	.	.	.	.	.	T	0.42585	0.1209	.	.	.	0.25286	N	0.989398	.	.	.	.	.	.	T	0.37686	-0.9695	5	0.87932	D	0	.	7.5654	0.27876	0.2307:0.127:0.6423:0.0	.	.	.	.	F	40	.	ENSP00000447796:S40F	S	-	2	0	BCDIN3D	48522997	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.118000	0.41949	0.427000	0.26145	0.591000	0.81541	TCC	BCDIN3D	-	NULL		0.632	BCDIN3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCDIN3D	HGNC	protein_coding	OTTHUMT00000405982.1	G	NM_181708		50236730	-1	no_errors	ENST00000550861	ensembl	human	putative	70_37	missense	SNP	0.998	A
C11orf21	29125	genome.wustl.edu	37	11	2322040	2322040	+	Intron	SNP	C	C	G			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr11:2322040C>G	ENST00000381153.3	-	2	305				TSPAN32_ENST00000182290.4_5'Flank|C11orf21_ENST00000470369.1_5'UTR|TSPAN32_ENST00000381121.3_5'Flank|TSPAN32_ENST00000451520.2_5'Flank			Q9P2W6	CK021_HUMAN	chromosome 11 open reading frame 21							cytoplasm (GO:0005737)											CTCATCTTCCCTGGAGAGGAC	0.617																																																	0													31.0	34.0	33.0					11																	2322040		692	1591	2283	SO:0001627	intron_variant	29125			AB029488	CCDS44518.1	11p15.5	2012-08-09			ENSG00000110665	ENSG00000110665			13231	protein-coding gene	gene with protein product		611033				11054561	Standard	NM_001142946		Approved		uc009ydj.2	Q9P2W6	OTTHUMG00000009759	ENST00000381153.3:c.54-197G>C	11.37:g.2322040C>G				RNA	SNP	-	NULL	ENST00000381153.3	37	NULL		11																																																																																			C11orf21	-	-		0.617	C11orf21-001	KNOWN	basic	protein_coding	C11orf21	HGNC	protein_coding	OTTHUMT00000026908.2	C	NM_001142946		2322040	-1	no_errors	ENST00000470369	ensembl	human	known	70_37	rna	SNP	0.000	G
CAPN12	147968	genome.wustl.edu	37	19	39230771	39230771	+	Silent	SNP	G	G	A	rs59420559|rs532284494		TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr19:39230771G>A	ENST00000328867.4	-	5	957	c.649C>T	c.(649-651)Ctg>Ttg	p.L217L	CTD-2540F13.2_ENST00000602255.1_RNA|CAPN12_ENST00000601953.1_Silent_p.L68L	NM_144691.3	NP_653292.2	Q6ZSI9	CAN12_HUMAN	calpain 12	217	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			TTTTGTCTCAGATAGAGCACC	0.627																																																	0													43.0	38.0	40.0					19																	39230771		2203	4300	6503	SO:0001819	synonymous_variant	147968			BC014027	CCDS12519.1	19q13.2	2014-08-12			ENSG00000182472	ENSG00000182472		"""EF-hand domain containing"""	13249	protein-coding gene	gene with protein product		608839					Standard	NM_144691		Approved		uc002ojd.1	Q6ZSI9	OTTHUMG00000182525	ENST00000328867.4:c.649C>T	19.37:g.39230771G>A				Silent	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,pfscan_EF_HAND_2,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.L217	ENST00000328867.4	37	c.649	CCDS12519.1	19																																																																																			CAPN12	-	pfam_Peptidase_C2_calpain_cat,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease		0.627	CAPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN12	HGNC	protein_coding	OTTHUMT00000462151.1	G			39230771	-1	no_errors	ENST00000328867	ensembl	human	known	70_37	silent	SNP	1.000	A
CCDC141	285025	genome.wustl.edu	37	2	179714862	179714862	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr2:179714862C>T	ENST00000420890.2	-	21	3388	c.3271G>A	c.(3271-3273)Gag>Aag	p.E1091K	CCDC141_ENST00000295723.5_Missense_Mutation_p.E516K	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	1091										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			ACTATTTTCTCAATATATTTC	0.358																																																	0													101.0	98.0	99.0					2																	179714862		2203	4300	6503	SO:0001583	missense	285025			AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.3271G>A	2.37:g.179714862C>T	ENSP00000395995:p.Glu1091Lys		H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Spectrin_repeat,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.E1091K	ENST00000420890.2	37	c.3271		2	.	.	.	.	.	.	.	.	.	.	C	27.2	4.814192	0.90790	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723	T;T;T	0.35789	1.29;1.29;1.29	5.73	5.73	0.89815	.	0.000000	0.56097	D	0.000027	T	0.52403	0.1732	L	0.34521	1.04	0.42109	D	0.991371	D	0.89917	1.0	D	0.87578	0.998	T	0.51741	-0.8667	10	0.59425	D	0.04	-20.5715	19.4934	0.95062	0.0:1.0:0.0:0.0	.	516	Q6ZP82	CC141_HUMAN	K	1091;535;516	ENSP00000395995:E1091K;ENSP00000344627:E535K;ENSP00000295723:E516K	ENSP00000295723:E516K	E	-	1	0	CCDC141	179423107	1.000000	0.71417	0.990000	0.47175	0.796000	0.44982	4.859000	0.62954	2.718000	0.92993	0.650000	0.86243	GAG	CCDC141	-	NULL		0.358	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	CCDC141	HGNC	protein_coding		C	NM_173648		179714862	-1	no_errors	ENST00000420890	ensembl	human	known	70_37	missense	SNP	1.000	T
CEP44	80817	genome.wustl.edu	37	4	175224923	175224923	+	Missense_Mutation	SNP	G	G	A			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr4:175224923G>A	ENST00000503780.1	+	5	721	c.307G>A	c.(307-309)Gaa>Aaa	p.E103K	CEP44_ENST00000457424.2_Missense_Mutation_p.E103K|CEP44_ENST00000296519.4_Missense_Mutation_p.E103K|CEP44_ENST00000426172.1_Missense_Mutation_p.E103K	NM_001040157.2	NP_001035247.1	Q9C0F1	CEP44_HUMAN	centrosomal protein 44kDa	103						centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|spindle pole (GO:0000922)				endometrium(2)|large_intestine(4)|lung(5)|stomach(1)	12						TGGGTTTGCAGAATGGAAAAT	0.303																																																	0													75.0	78.0	77.0					4																	175224923		2201	4298	6499	SO:0001583	missense	80817			AB051499	CCDS34106.1, CCDS47163.1	4q34	2014-02-20	2011-05-06	2011-05-06	ENSG00000164118	ENSG00000164118			29356	protein-coding gene	gene with protein product			"""KIAA1712"""	KIAA1712		21399614	Standard	NM_001040157		Approved		uc010iro.2	Q9C0F1	OTTHUMG00000160752	ENST00000503780.1:c.307G>A	4.37:g.175224923G>A	ENSP00000423153:p.Glu103Lys		A8K8W9|A8MW11|B3KT53|D3DP42|Q8IXZ4	Missense_Mutation	SNP	NULL	p.E103K	ENST00000503780.1	37	c.307	CCDS34106.1	4	.	.	.	.	.	.	.	.	.	.	G	33	5.277061	0.95459	.	.	ENSG00000164118	ENST00000503780;ENST00000505124;ENST00000457424;ENST00000514712;ENST00000515299;ENST00000503053;ENST00000426172;ENST00000296519	T;T;T;T;T	0.64991	-0.07;-0.13;0.0;-0.13;-0.07	5.61	5.61	0.85477	.	0.056221	0.64402	D	0.000002	D	0.82595	0.5071	M	0.85197	2.74	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.84454	0.0590	10	0.87932	D	0	.	20.0044	0.97430	0.0:0.0:1.0:0.0	.	103;103	Q9C0F1-2;Q9C0F1	.;CEP44_HUMAN	K	103	ENSP00000423153:E103K;ENSP00000389427:E103K;ENSP00000421128:E103K;ENSP00000408221:E103K;ENSP00000296519:E103K	ENSP00000296519:E103K	E	+	1	0	CEP44	175461498	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.789000	0.69029	2.804000	0.96469	0.650000	0.86243	GAA	CEP44	-	NULL		0.303	CEP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP44	HGNC	protein_coding	OTTHUMT00000362109.2	G	NM_030633		175224923	+1	no_errors	ENST00000426172	ensembl	human	known	70_37	missense	SNP	1.000	A
DERL1	79139	genome.wustl.edu	37	8	124033739	124033739	+	Splice_Site	SNP	C	C	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr8:124033739C>T	ENST00000259512.4	-	6	754	c.454G>A	c.(454-456)Gcc>Acc	p.A152T	RP11-557C18.3_ENST00000521258.1_RNA|DERL1_ENST00000405944.3_Splice_Site_p.A152T|DERL1_ENST00000419562.2_Splice_Site_p.A52T|DERL1_ENST00000519018.1_Splice_Site_p.A52T|DERL1_ENST00000523036.1_Splice_Site_p.A52T	NM_001134671.2|NM_024295.5	NP_001128143.1|NP_077271.1	Q9BUN8	DERL1_HUMAN	derlin 1	152					endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|intracellular transport of viral protein in host cell (GO:0019060)|response to unfolded protein (GO:0006986)|retrograde protein transport, ER to cytosol (GO:0030970)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)	MHC class I protein binding (GO:0042288)|receptor activity (GO:0004872)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)	8	Lung NSC(37;1.06e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			AAATAGCAGGCCTAGGATGGA	0.413																																																	0													96.0	99.0	98.0					8																	124033739		2203	4300	6503	SO:0001630	splice_region_variant	79139			BC002457	CCDS6337.1, CCDS47915.1	8q24.13	2012-02-01	2012-02-01		ENSG00000136986	ENSG00000136986			28454	protein-coding gene	gene with protein product		608813	"""Der1-like domain family, member 1"""			12975309, 15215855	Standard	NM_024295		Approved	MGC3067, PRO2577, FLJ13784, DER1, DER-1, derlin-1	uc003ypl.3	Q9BUN8	OTTHUMG00000165080	ENST00000259512.4:c.454-1G>A	8.37:g.124033739C>T			B3KW41|E9PH19	Missense_Mutation	SNP	pfam_DER1	p.A152T	ENST00000259512.4	37	c.454	CCDS6337.1	8	.	.	.	.	.	.	.	.	.	.	C	36	5.701244	0.96812	.	.	ENSG00000136986	ENST00000259512;ENST00000405944;ENST00000419562;ENST00000519018;ENST00000523036	T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.73024	0.3534	M	0.89840	3.065	0.80722	D	1	D;D;D	0.89917	1.0;0.986;0.999	D;P;D	0.97110	1.0;0.798;0.996	T	0.77830	-0.2442	10	0.66056	D	0.02	.	19.7959	0.96481	0.0:1.0:0.0:0.0	.	52;152;152	B4E1G1;Q9BUN8-2;Q9BUN8	.;.;DERL1_HUMAN	T	152;152;52;52;52	ENSP00000259512:A152T;ENSP00000384289:A152T;ENSP00000389965:A52T;ENSP00000430086:A52T;ENSP00000429199:A52T	ENSP00000259512:A152T	A	-	1	0	DERL1	124102920	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	7.377000	0.79668	2.689000	0.91719	0.655000	0.94253	GCC	DERL1	-	pfam_DER1		0.413	DERL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DERL1	HGNC	protein_coding	OTTHUMT00000381714.2	C	NM_024295	Missense_Mutation	124033739	-1	no_errors	ENST00000259512	ensembl	human	known	70_37	missense	SNP	1.000	T
DLEC1	9940	genome.wustl.edu	37	3	38080893	38080893	+	Silent	SNP	C	C	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr3:38080893C>T	ENST00000308059.6	+	1	198	c.177C>T	c.(175-177)ttC>ttT	p.F59F	DLEC1_ENST00000452631.2_Silent_p.F59F|DLEC1_ENST00000346219.3_Silent_p.F59F					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		ACTACAGCTTCGCAGCCCGGC	0.672																																																	0													42.0	50.0	48.0					3																	38080893		1993	4180	6173	SO:0001819	synonymous_variant	9940			AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.177C>T	3.37:g.38080893C>T				Silent	SNP	superfamily_PapD-like	p.F59	ENST00000308059.6	37	c.177	CCDS2672.2	3																																																																																			DLEC1	-	NULL		0.672	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DLEC1	HGNC	protein_coding	OTTHUMT00000253745.3	C	NM_007337		38080893	+1	no_errors	ENST00000346219	ensembl	human	known	70_37	silent	SNP	0.000	T
DNAH10	196385	genome.wustl.edu	37	12	124345682	124345682	+	Missense_Mutation	SNP	G	G	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr12:124345682G>T	ENST00000409039.3	+	38	6544	c.6519G>T	c.(6517-6519)agG>agT	p.R2173S		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2173	AAA 2. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		ACATCTTCAGGGAAATCAACA	0.453																																																	0													59.0	57.0	58.0					12																	124345682		1881	4118	5999	SO:0001583	missense	196385			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.6519G>T	12.37:g.124345682G>T	ENSP00000386770:p.Arg2173Ser		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_PyrdxlP-dep_Trfase_major_dom,smart_AAA+_ATPase	p.R2173S	ENST00000409039.3	37	c.6519	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	G	22.2	4.254427	0.80135	.	.	ENSG00000197653	ENST00000409039	D	0.93953	-3.32	5.7	4.81	0.61882	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.169589	0.37136	U	0.002224	D	0.97816	0.9283	H	0.96943	3.91	0.58432	D	0.999996	D	0.89917	1.0	D	0.87578	0.998	D	0.98888	1.0772	10	0.87932	D	0	.	14.532	0.67934	0.0703:0.0:0.9297:0.0	.	2173	Q8IVF4	DYH10_HUMAN	S	2173	ENSP00000386770:R2173S	ENSP00000386770:R2173S	R	+	3	2	DNAH10	122911635	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.787000	0.38704	1.421000	0.47157	0.655000	0.94253	AGG	DNAH10	-	pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase		0.453	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	G			124345682	+1	no_errors	ENST00000409039	ensembl	human	known	70_37	missense	SNP	1.000	T
DPYSL5	56896	genome.wustl.edu	37	2	27164947	27164947	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr2:27164947C>T	ENST00000288699.6	+	10	1377	c.1219C>T	c.(1219-1221)Cca>Tca	p.P407S	DPYSL5_ENST00000401478.1_Missense_Mutation_p.P407S	NM_001253724.1|NM_020134.3	NP_001240653.1|NP_064519.2	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	407					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)|signal transduction (GO:0007165)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			breast(1)|endometrium(5)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGTGTGGGACCCAGAAGCCAC	0.507											OREG0014510	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													86.0	90.0	89.0					2																	27164947		2203	4300	6503	SO:0001583	missense	56896			AF264015	CCDS1730.1	2p23.3	2008-02-05			ENSG00000157851	ENSG00000157851			20637	protein-coding gene	gene with protein product		608383				10851247, 11034345	Standard	NM_020134		Approved	CRMP5, Ulip6, CRMP-5, CRAM	uc002rhu.4	Q9BPU6	OTTHUMG00000097071	ENST00000288699.6:c.1219C>T	2.37:g.27164947C>T	ENSP00000288699:p.Pro407Ser	792	Q8TCL6|Q9NQC4|Q9NRY9	Missense_Mutation	SNP	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.P407S	ENST00000288699.6	37	c.1219	CCDS1730.1	2	.	.	.	.	.	.	.	.	.	.	C	33	5.214029	0.95104	.	.	ENSG00000157851	ENST00000288699;ENST00000401478	D;D	0.89050	-2.46;-2.46	5.62	5.62	0.85841	Metal-dependent hydrolase, composite domain (1);	0.000000	0.85682	D	0.000000	D	0.92463	0.7607	M	0.91561	3.22	0.58432	D	0.999999	P	0.47841	0.901	B	0.43536	0.423	D	0.94000	0.7274	10	0.72032	D	0.01	-11.5392	18.4289	0.90618	0.0:1.0:0.0:0.0	.	407	Q9BPU6	DPYL5_HUMAN	S	407	ENSP00000288699:P407S;ENSP00000385549:P407S	ENSP00000288699:P407S	P	+	1	0	DPYSL5	27018451	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	7.690000	0.84178	2.667000	0.90743	0.561000	0.74099	CCA	DPYSL5	-	superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase		0.507	DPYSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYSL5	HGNC	protein_coding	OTTHUMT00000214187.2	C	NM_020134		27164947	+1	no_errors	ENST00000288699	ensembl	human	known	70_37	missense	SNP	1.000	T
EGFL6	25975	genome.wustl.edu	37	X	13636149	13636149	+	Missense_Mutation	SNP	G	G	A			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chrX:13636149G>A	ENST00000361306.1	+	8	1336	c.1079G>A	c.(1078-1080)cGa>cAa	p.R360Q	EGFL6_ENST00000380602.3_Missense_Mutation_p.R360Q	NM_001167890.1|NM_015507.3	NP_001161362.1|NP_056322.2	Q8IUX8	EGFL6_HUMAN	EGF-like-domain, multiple 6	360					cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)|skin(3)	23						ATAGAGGAGCGAAGCCTGCGA	0.363																																																	0													46.0	48.0	48.0					X																	13636149		2203	4298	6501	SO:0001583	missense	25975			AF186084	CCDS14155.1, CCDS55370.1	Xp22	2008-02-05	2002-10-09		ENSG00000198759	ENSG00000198759			3235	protein-coding gene	gene with protein product		300239	"""MAM and EGF domain containing"""	MAEG		10610727	Standard	NM_015507		Approved		uc004cvj.3	Q8IUX8	OTTHUMG00000021155	ENST00000361306.1:c.1079G>A	X.37:g.13636149G>A	ENSP00000355126:p.Arg360Gln		B2RCB1|Q6UXJ1|Q8NBV0|Q8WYG3|Q9NY67|Q9NZL7|Q9UFK6	Missense_Mutation	SNP	pfam_MAM_dom,pfam_EGF-like_Ca-bd,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_MAM_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.R360Q	ENST00000361306.1	37	c.1079	CCDS14155.1	X	.	.	.	.	.	.	.	.	.	.	G	2.188	-0.385968	0.04966	.	.	ENSG00000198759	ENST00000361306;ENST00000380602	T;T	0.69435	-0.4;-0.29	5.49	-0.431	0.12295	.	1.126930	0.06428	N	0.723569	T	0.31888	0.0811	N	0.01493	-0.835	0.09310	N	1	B;B	0.16603	0.014;0.018	B;B	0.06405	0.002;0.002	T	0.26710	-1.0095	10	0.02654	T	1	.	6.9635	0.24610	0.6083:0.1152:0.2765:0.0	.	360;360	Q8IUX8-2;Q8IUX8	.;EGFL6_HUMAN	Q	360	ENSP00000355126:R360Q;ENSP00000369976:R360Q	ENSP00000355126:R360Q	R	+	2	0	EGFL6	13546070	0.002000	0.14202	0.000000	0.03702	0.951000	0.60555	0.655000	0.24933	-0.499000	0.06623	0.589000	0.80489	CGA	EGFL6	-	NULL		0.363	EGFL6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	EGFL6	HGNC	protein_coding	OTTHUMT00000055800.1	G	NM_015507		13636149	+1	no_errors	ENST00000380602	ensembl	human	known	70_37	missense	SNP	0.000	A
LINC01090	104355152	genome.wustl.edu	37	2	189093056	189093056	+	lincRNA	SNP	G	G	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr2:189093056G>T	ENST00000415357.1	-	0	371																											TTCACCAGCAGAAGTTATTGA	0.502																																																	0																																												0																															2.37:g.189093056G>T				RNA	SNP	-	NULL	ENST00000415357.1	37	NULL		2																																																																																			AC068718.1	-	-		0.502	AC068718.1-002	KNOWN	basic	lincRNA	ENSG00000231689	Clone_based_vega_gene	lincRNA	OTTHUMT00000334696.1	G			189093056	-1	no_errors	ENST00000415357	ensembl	human	known	70_37	rna	SNP	0.998	T
EYS	346007	genome.wustl.edu	37	6	64431264	64431264	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr6:64431264C>T	ENST00000370621.3	-	44	9252	c.8726G>A	c.(8725-8727)gGt>gAt	p.G2909D	EYS_ENST00000503581.1_Missense_Mutation_p.G2888D|EYS_ENST00000370616.2_Missense_Mutation_p.G2909D			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	2909	EGF-like 26. {ECO:0000255|PROSITE- ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TGTACATTCACCTCCATTTCT	0.408																																																	0													124.0	82.0	95.0					6																	64431264		692	1591	2283	SO:0001583	missense	346007				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.8726G>A	6.37:g.64431264C>T	ENSP00000359655:p.Gly2909Asp		A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.G2909D	ENST00000370621.3	37	c.8726		6	.	.	.	.	.	.	.	.	.	.	C	14.38	2.519177	0.44866	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.91740	-2.9;-2.9;-2.9	4.86	4.86	0.63082	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	U	0.000002	D	0.97087	0.9048	H	0.95294	3.65	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.98321	1.0528	10	0.87932	D	0	.	16.1831	0.81925	0.0:1.0:0.0:0.0	.	2888;2909	Q5T1H1-1;Q5T1H1	.;EYS_HUMAN	D	2888;2909;2909	ENSP00000424243:G2888D;ENSP00000359655:G2909D;ENSP00000359650:G2909D	ENSP00000359650:G2909D	G	-	2	0	EYS	64489223	1.000000	0.71417	0.100000	0.21137	0.019000	0.09904	5.086000	0.64474	2.251000	0.74343	0.655000	0.94253	GGT	EYS	-	smart_EG-like_dom,pfscan_EG-like_dom		0.408	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	C	XM_294050		64431264	-1	no_errors	ENST00000370616	ensembl	human	known	70_37	missense	SNP	0.999	T
FAM63A	55793	genome.wustl.edu	37	1	150975116	150975116	+	5'UTR	SNP	G	G	C			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr1:150975116G>C	ENST00000361936.5	-	0	932				FAM63A_ENST00000493834.2_Intron|FAM63A_ENST00000361738.6_Missense_Mutation_p.P41R|FAM63A_ENST00000470877.1_Intron|FAM63A_ENST00000312210.5_Intron	NM_018379.4	NP_060849	Q8N5J2	FA63A_HUMAN	family with sequence similarity 63, member A							extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(3)|large_intestine(4)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CTTGGCTGAGGGGCACTGAAG	0.522																																																	0													43.0	41.0	41.0					1																	150975116		2203	4299	6502	SO:0001623	5_prime_UTR_variant	55793			BC032321	CCDS976.1, CCDS30854.1, CCDS53361.1, CCDS55635.1	1q21.2	2008-02-05			ENSG00000143409	ENSG00000143409			25648	protein-coding gene	gene with protein product						10718198	Standard	NM_001040217		Approved	FLJ11280	uc010pcn.2	Q8N5J2	OTTHUMG00000035061	ENST00000361936.5:c.-23C>G	1.37:g.150975116G>C			B3KWP4|B3KWV8|B4DXF2|B4E1S4|D3DV09|J3KP53|Q5SZF0|Q9NUL9|Q9P2F7	Missense_Mutation	SNP	pfam_DUF544	p.P41R	ENST00000361936.5	37	c.122	CCDS976.1	1	.	.	.	.	.	.	.	.	.	.	G	11.39	1.623460	0.28889	.	.	ENSG00000143409	ENST00000361738	T	0.48522	0.81	5.18	2.08	0.27032	.	1.814860	0.03311	N	0.190489	T	0.16171	0.0389	.	.	.	0.09310	N	1	B	0.22983	0.078	B	0.25405	0.06	T	0.19943	-1.0290	9	0.46703	T	0.11	-2.9086	4.1078	0.10045	0.1933:0.0:0.6111:0.1956	.	41	Q8N5J2-3	.	R	41	ENSP00000354669:P41R	ENSP00000354669:P41R	P	-	2	0	FAM63A	149241740	0.001000	0.12720	0.001000	0.08648	0.027000	0.11550	0.534000	0.23098	0.764000	0.33197	0.655000	0.94253	CCC	FAM63A	-	NULL		0.522	FAM63A-005	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM63A	HGNC	protein_coding	OTTHUMT00000411753.1	G	NM_018379		150975116	-1	no_errors	ENST00000361738	ensembl	human	known	70_37	missense	SNP	0.000	C
FAM78B	149297	genome.wustl.edu	37	1	166039976	166039976	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr1:166039976C>G	ENST00000338353.3	-	3	877	c.288G>C	c.(286-288)ttG>ttC	p.L96F	FAM78B_ENST00000354422.3_Missense_Mutation_p.L96F			Q5VT40	FA78B_HUMAN	family with sequence similarity 78, member B	96										central_nervous_system(1)|endometrium(5)|large_intestine(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(923;0.0813)|Acute lymphoblastic leukemia(8;0.155)					TCCCTTCCCTCAAGTCAGGCA	0.512																																																	0													53.0	53.0	53.0					1																	166039976		2203	4300	6503	SO:0001583	missense	149297			AL626787	CCDS30931.1	1q24.1	2008-02-05			ENSG00000188859	ENSG00000188859			13495	protein-coding gene	gene with protein product							Standard	NM_001017961		Approved		uc021pee.1	Q5VT40	OTTHUMG00000034705	ENST00000338353.3:c.288G>C	1.37:g.166039976C>G	ENSP00000339681:p.Leu96Phe		B7Z693	Missense_Mutation	SNP	NULL	p.L96F	ENST00000338353.3	37	c.288	CCDS30931.1	1	.	.	.	.	.	.	.	.	.	.	C	17.48	3.401339	0.62288	.	.	ENSG00000188859	ENST00000354422;ENST00000338353	.	.	.	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.75817	0.3901	M	0.75777	2.31	0.51233	D	0.999911	D	0.76494	0.999	D	0.80764	0.994	T	0.77869	-0.2427	8	0.87932	D	0	-2.9861	17.3458	0.87309	0.0:1.0:0.0:0.0	.	96	Q5VT40	FA78B_HUMAN	F	96	.	ENSP00000339681:L96F	L	-	3	2	FAM78B	164306600	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.013000	0.40942	2.758000	0.94735	0.655000	0.94253	TTG	FAM78B	-	NULL		0.512	FAM78B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM78B	HGNC	protein_coding	OTTHUMT00000343108.1	C	NM_001017961		166039976	-1	no_errors	ENST00000338353	ensembl	human	known	70_37	missense	SNP	1.000	G
GPC4	2239	genome.wustl.edu	37	X	132548981	132548981	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chrX:132548981C>T	ENST00000370828.3	-	1	537	c.13G>A	c.(13-15)Ggc>Agc	p.G5S	GPC4_ENST00000535467.1_5'Flank	NM_001448.2	NP_001439.2	O75487	GPC4_HUMAN	glypican 4	5					anatomical structure morphogenesis (GO:0009653)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;0.000127)					GCGGGCAAGCCGAACCGTGCC	0.697																																																	0													22.0	24.0	23.0					X																	132548981		2201	4291	6492	SO:0001583	missense	2239			AF030186	CCDS14637.1	Xq26.1	2008-02-05			ENSG00000076716	ENSG00000076716		"""Proteoglycans / Cell Surface : Glypicans"""	4452	protein-coding gene	gene with protein product	"""glypican proteoglycan 4"""	300168				9787072	Standard	NM_001448		Approved	K-glypican	uc004exc.1	O75487	OTTHUMG00000022434	ENST00000370828.3:c.13G>A	X.37:g.132548981C>T	ENSP00000359864:p.Gly5Ser		B2R6J7|B4E2C0|Q6ZMA6|Q96L43|Q9NU08|Q9UJN1|Q9UPD9	Missense_Mutation	SNP	pfam_Glypican	p.G5S	ENST00000370828.3	37	c.13	CCDS14637.1	X	.	.	.	.	.	.	.	.	.	.	C	9.790	1.177636	0.21787	.	.	ENSG00000076716	ENST00000370828;ENST00000536418	T	0.36878	1.23	4.22	2.18	0.27775	.	0.834886	0.10617	N	0.653769	T	0.15219	0.0367	N	0.03608	-0.345	0.09310	N	1	B	0.14438	0.01	B	0.01281	0.0	T	0.29427	-1.0012	10	0.19147	T	0.46	.	7.4057	0.26989	0.1544:0.5029:0.3427:0.0	.	5	O75487	GPC4_HUMAN	S	5	ENSP00000359864:G5S	ENSP00000359864:G5S	G	-	1	0	GPC4	132376647	0.999000	0.42202	0.985000	0.45067	0.831000	0.47069	0.480000	0.22244	0.570000	0.29347	0.468000	0.43344	GGC	GPC4	-	NULL		0.697	GPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC4	HGNC	protein_coding	OTTHUMT00000058338.1	C	NM_001448		132548981	-1	no_errors	ENST00000370828	ensembl	human	known	70_37	missense	SNP	0.081	T
HDAC4	9759	genome.wustl.edu	37	2	240098187	240098187	+	Missense_Mutation	SNP	G	G	A			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr2:240098187G>A	ENST00000345617.3	-	5	1203	c.412C>T	c.(412-414)Cgc>Tgc	p.R138C	HDAC4_ENST00000541256.1_Missense_Mutation_p.R107C	NM_006037.3	NP_006028.2	P56524	HDAC4_HUMAN	histone deacetylase 4	138	Interaction with MEF2A.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cardiac muscle hypertrophy in response to stress (GO:0014898)|chromatin remodeling (GO:0006338)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|osteoblast development (GO:0002076)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression, epigenetic (GO:0040029)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to drug (GO:0042493)|response to interleukin-1 (GO:0070555)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	A band (GO:0031672)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)|Z disc (GO:0030018)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|potassium ion binding (GO:0030955)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(5)	62		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		tgctcctggcggtgcctctcc	0.602																																																	0													148.0	127.0	134.0					2																	240098187		2203	4300	6503	SO:0001583	missense	9759			AB006626	CCDS2529.1	2q37.3	2014-02-12			ENSG00000068024	ENSG00000068024			14063	protein-coding gene	gene with protein product		605314	"""brachydactyly-mental retardation syndrome"""	BDMR		10206986, 10220385, 20691407	Standard	NM_006037		Approved	KIAA0288, HDAC-A, HDACA, HD4, HA6116, HDAC-4	uc002vyk.4	P56524	OTTHUMG00000133344	ENST00000345617.3:c.412C>T	2.37:g.240098187G>A	ENSP00000264606:p.Arg138Cys		Q9UND6	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pfam_Hist_deacetylase_Gln_rich_N,pfam_Arb2_domain,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse	p.R138C	ENST00000345617.3	37	c.412	CCDS2529.1	2	.	.	.	.	.	.	.	.	.	.	G	18.19	3.569118	0.65765	.	.	ENSG00000068024	ENST00000345617;ENST00000456922;ENST00000541256;ENST00000393621;ENST00000454542;ENST00000446876	D;D;T;T	0.84873	-1.91;-1.91;0.67;0.52	2.74	2.74	0.32292	Histone deacetylase, glutamine rich N-terminal domain (1);	0.066133	0.64402	D	0.000009	D	0.86460	0.5938	M	0.65975	2.015	0.80722	D	1	D;D;D;D;D;D	0.76494	0.993;0.996;0.999;0.999;0.976;0.976	P;P;P;P;P;P	0.54401	0.652;0.614;0.711;0.733;0.751;0.751	D	0.85562	0.1228	9	.	.	.	.	9.1379	0.36886	0.0:0.0:1.0:0.0	.	133;21;107;107;106;138	B7Z8G5;F5H0Q9;F5H5W4;B7Z8I2;Q53SM2;P56524	.;.;.;.;.;HDAC4_HUMAN	C	138;21;107;21;107;111	ENSP00000264606:R138C;ENSP00000443057:R107C;ENSP00000405226:R107C;ENSP00000392912:R111C	.	R	-	1	0	HDAC4	239763124	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.202000	0.51067	1.845000	0.53610	0.491000	0.48974	CGC	HDAC4	-	pfam_Hist_deacetylase_Gln_rich_N,pirsf_Histone_deAcase_II_euk		0.602	HDAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDAC4	HGNC	protein_coding	OTTHUMT00000257174.2	G	NM_006037		240098187	-1	no_errors	ENST00000345617	ensembl	human	known	70_37	missense	SNP	1.000	A
HLA-V	352962	genome.wustl.edu	37	6	29760373	29760373	+	RNA	SNP	A	A	C	rs60681449|rs2905755|rs140982245	byFrequency	TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr6:29760373A>C	ENST00000457107.1	+	0	243									major histocompatibility complex, class I, V (pseudogene)																		TGGATGGAGCAGGAGGGGCCG	0.652													a|||	1897	0.378794	0.5946	0.3646	5008	,	,		11594	0.1925		0.3012	False		,,,				2504	0.3691																0																																												352962			M96332		6p21.3	2012-10-05	2007-12-12	2007-12-12	ENSG00000181126	ENSG00000181126		"""Histocompatibility complex"""	23482	pseudogene	pseudogene			"""HLA-75 pseudogene"""	HLA-75			Standard	NG_002729		Approved	dJ377H14.4			OTTHUMG00000031277		6.37:g.29760373A>C				RNA	SNP	-	NULL	ENST00000457107.1	37	NULL		6																																																																																			HLA-V	-	-		0.652	HLA-V-003	KNOWN	basic	processed_transcript	HLA-V	HGNC	pseudogene	OTTHUMT00000105231.1	A	NG_002729		29760373	+1	no_errors	ENST00000399243	ensembl	human	known	70_37	rna	SNP	1.000	C
CXCL8	3576	genome.wustl.edu	37	4	74606440	74606441	+	Splice_Site	INS	-	-	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr4:74606440_74606441insT	ENST00000307407.3	+	1	217		c.e1+1		IL8_ENST00000401931.1_Splice_Site	NM_000584.3	NP_000575.1	P10145	IL8_HUMAN							activation of signaling protein activity involved in unfolded protein response (GO:0006987)|angiogenesis (GO:0001525)|calcium-mediated signaling (GO:0019722)|cell cycle arrest (GO:0007050)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|chemotaxis (GO:0006935)|embryonic digestive tract development (GO:0048566)|endoplasmic reticulum unfolded protein response (GO:0030968)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of neutrophil chemotaxis (GO:0090023)|receptor internalization (GO:0031623)|regulation of cell adhesion (GO:0030155)|regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045091)|response to endoplasmic reticulum stress (GO:0034976)|response to molecule of bacterial origin (GO:0002237)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)|interleukin-8 receptor binding (GO:0005153)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|ovary(2)|urinary_tract(1)	6	Breast(15;0.00102)		all cancers(17;0.00169)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)	LUSC - Lung squamous cell carcinoma(721;0.008)		CTGTGTGAAGGTAAGCACATCT	0.436																																																	0																																										SO:0001630	splice_region_variant	3576																														ENST00000307407.3:c.64+1->T	4.37:g.74606441_74606441dupT			B2R4L8|Q6FGF6|Q6LAE6|Q96RG6|Q9C077|Q9UCE1|Q9UCR8|Q9UCR9|Q9UCS0	Splice_Site	INS	-	e1+1	ENST00000307407.3	37	c.64+1_64+1	CCDS34005.1	4																																																																																			IL8	-	-		0.436	IL8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL8	HGNC	protein_coding	OTTHUMT00000322211.1	-		Intron	74606441	+1	no_errors	ENST00000307407	ensembl	human	known	70_37	splice_site_ins	INS	1.000:1.000	T
IPO9	55705	genome.wustl.edu	37	1	201798396	201798396	+	Missense_Mutation	SNP	G	G	A			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr1:201798396G>A	ENST00000361565.4	+	1	128	c.59G>A	c.(58-60)gGa>gAa	p.G20E	IPO9_ENST00000464348.1_3'UTR|IPO9-AS1_ENST00000413035.1_RNA|IPO9-AS1_ENST00000421159.1_RNA|IPO9-AS1_ENST00000421449.1_RNA	NM_018085.4	NP_060555.2	Q96P70	IPO9_HUMAN	importin 9	20					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone binding (GO:0042393)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	38						GTGGCACAAGGATTAAAGGAA	0.667																																																	0													26.0	25.0	26.0					1																	201798396		2194	4290	6484	SO:0001583	missense	55705			AF410465	CCDS1415.1	1q31.3	2008-02-05			ENSG00000198700	ENSG00000198700		"""Importins"""	19425	protein-coding gene	gene with protein product						11823430, 10574461	Standard	NM_018085		Approved	Imp9, FLJ10402	uc001gwz.3	Q96P70	OTTHUMG00000035805	ENST00000361565.4:c.59G>A	1.37:g.201798396G>A	ENSP00000354742:p.Gly20Glu		B1ASV5|Q8N1Y1|Q8N3I2|Q8NCG9|Q96SU6|Q9NW01|Q9P0A8|Q9ULM8	Missense_Mutation	SNP	pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.G20E	ENST00000361565.4	37	c.59	CCDS1415.1	1	.	.	.	.	.	.	.	.	.	.	G	16.50	3.141607	0.57044	.	.	ENSG00000198700	ENST00000361565	.	.	.	5.42	5.42	0.78866	Armadillo-like helical (1);	0.053556	0.85682	D	0.000000	T	0.38295	0.1035	N	0.08118	0	0.54753	D	0.999982	B	0.06786	0.001	B	0.04013	0.001	T	0.19614	-1.0300	9	0.21014	T	0.42	-2.2909	16.6887	0.85315	0.0:0.0:1.0:0.0	.	20	Q96P70	IPO9_HUMAN	E	20	.	ENSP00000354742:G20E	G	+	2	0	IPO9	200065019	1.000000	0.71417	0.981000	0.43875	0.497000	0.33675	5.168000	0.64978	2.513000	0.84729	0.655000	0.94253	GGA	IPO9	-	NULL		0.667	IPO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO9	HGNC	protein_coding	OTTHUMT00000087088.1	G	NM_018085		201798396	+1	no_errors	ENST00000361565	ensembl	human	known	70_37	missense	SNP	0.996	A
JUP	3728	genome.wustl.edu	37	17	39913930	39913930	+	Missense_Mutation	SNP	G	G	A			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr17:39913930G>A	ENST00000393931.3	-	11	1998	c.1880C>T	c.(1879-1881)tCg>tTg	p.S627L	JUP_ENST00000310706.5_Missense_Mutation_p.S627L|JUP_ENST00000540235.1_Intron|JUP_ENST00000393930.1_Missense_Mutation_p.S627L	NM_002230.2	NP_002221.1	P14923	PLAK_HUMAN	junction plakoglobin	627	Interaction with DSC1.				adherens junction organization (GO:0034332)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell-cell junction organization (GO:0045216)|cellular response to indole-3-methanol (GO:0071681)|cytoskeletal anchoring at plasma membrane (GO:0007016)|desmosome assembly (GO:0002159)|detection of mechanical stimulus (GO:0050982)|ectoderm development (GO:0007398)|endothelial cell-cell adhesion (GO:0071603)|establishment of protein localization to plasma membrane (GO:0090002)|gastrulation (GO:0007369)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|nervous system development (GO:0007399)|oocyte development (GO:0048599)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein heterooligomerization (GO:0051291)|regulation of cell proliferation (GO:0042127)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)|ventricular cardiac muscle cell action potential (GO:0086005)	actin cytoskeleton (GO:0015629)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gamma-catenin-TCF7L2 complex (GO:0071665)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|cadherin binding (GO:0045296)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|structural constituent of cell wall (GO:0005199)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	23		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		GAGTGGGGCCGAGGCCCCCTC	0.682																																					Colon(16;42 520 6044 17852 28530)												0													26.0	27.0	27.0					17																	39913930		2202	4300	6502	SO:0001583	missense	3728			AF233882	CCDS11407.1	17q21	2014-09-17	2004-08-09		ENSG00000173801	ENSG00000173801		"""Armadillo repeat containing"""	6207	protein-coding gene	gene with protein product		173325	"""catenin (cadherin-associated protein), gamma 80kDa"""	CTNNG		1889810, 7604000	Standard	NM_021991		Approved	DP3, PDGB, PKGB, DPIII	uc002hxs.2	P14923	OTTHUMG00000133494	ENST00000393931.3:c.1880C>T	17.37:g.39913930G>A	ENSP00000377508:p.Ser627Leu		Q15093|Q15151|Q7L3S5|Q86W21|Q9BWC4|Q9HCX9	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,prints_Beta-catenin	p.S627L	ENST00000393931.3	37	c.1880	CCDS11407.1	17	.	.	.	.	.	.	.	.	.	.	G	16.21	3.057736	0.55325	.	.	ENSG00000173801	ENST00000393930;ENST00000310706;ENST00000393931	T;T;T	0.60672	0.17;0.17;0.17	4.68	4.68	0.58851	Armadillo-like helical (1);Armadillo-type fold (1);	0.132361	0.53938	D	0.000059	T	0.42200	0.1192	L	0.34521	1.04	0.80722	D	1	D	0.59357	0.985	B	0.32724	0.151	T	0.53507	-0.8429	10	0.52906	T	0.07	-10.5587	16.7016	0.85350	0.0:0.0:1.0:0.0	.	627	P14923	PLAK_HUMAN	L	627	ENSP00000377507:S627L;ENSP00000311113:S627L;ENSP00000377508:S627L	ENSP00000311113:S627L	S	-	2	0	JUP	37167456	1.000000	0.71417	0.916000	0.36221	0.224000	0.24922	7.416000	0.80143	2.595000	0.87683	0.561000	0.74099	TCG	JUP	-	superfamily_ARM-type_fold,smart_Armadillo		0.682	JUP-008	KNOWN	basic|appris_principal|CCDS	protein_coding	JUP	HGNC	protein_coding	OTTHUMT00000257406.1	G			39913930	-1	no_errors	ENST00000310706	ensembl	human	known	70_37	missense	SNP	0.995	A
KCNK6	9424	genome.wustl.edu	37	19	38818030	38818030	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr19:38818030C>T	ENST00000263372.3	+	3	1036	c.929C>T	c.(928-930)tCc>tTc	p.S310F		NM_004823.1	NP_004814.1	Q9Y257	KCNK6_HUMAN	potassium channel, subfamily K, member 6	310					negative regulation of systemic arterial blood pressure (GO:0003085)|potassium ion transport (GO:0006813)|regulation of resting membrane potential (GO:0060075)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)	17	all_cancers(60;5.83e-07)		Lung(45;0.00047)|LUSC - Lung squamous cell carcinoma(53;0.000613)		Ibutilide(DB00308)|Quinidine(DB00908)	GACTACGCTTCCATCCCCAGG	0.647																																																	0													35.0	36.0	35.0					19																	38818030		2203	4300	6503	SO:0001583	missense	9424			AF117708	CCDS12513.1	19q13.1	2012-03-07				ENSG00000099337		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6281	protein-coding gene	gene with protein product		603939				10075682, 10393428, 16382106	Standard	NM_004823		Approved	K2p6.1, TWIK-2	uc002oic.3	Q9Y257		ENST00000263372.3:c.929C>T	19.37:g.38818030C>T	ENSP00000263372:p.Ser310Phe		Q9HB47	Missense_Mutation	SNP	pfam_Ion_trans_2,pirsf_2pore_dom_K_chnl_TASK/TWIK,prints_2pore_dom_K_chnl_TWIK2,prints_2pore_dom_K_chnl_TWIK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TWIK1	p.S310F	ENST00000263372.3	37	c.929	CCDS12513.1	19	.	.	.	.	.	.	.	.	.	.	C	25.4	4.638064	0.87760	.	.	ENSG00000099337	ENST00000263372	T	0.26957	1.7	5.36	4.27	0.50696	.	0.310059	0.34555	N	0.003866	T	0.43590	0.1254	M	0.72118	2.19	0.47862	D	0.999537	D	0.64830	0.994	P	0.57679	0.825	T	0.43925	-0.9361	10	0.87932	D	0	.	13.2238	0.59903	0.0:0.8389:0.1611:0.0	.	310	Q9Y257	KCNK6_HUMAN	F	310	ENSP00000263372:S310F	ENSP00000263372:S310F	S	+	2	0	KCNK6	43509870	0.991000	0.36638	1.000000	0.80357	0.879000	0.50718	3.667000	0.54547	2.529000	0.85273	0.561000	0.74099	TCC	KCNK6	-	pirsf_2pore_dom_K_chnl_TASK/TWIK		0.647	KCNK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK6	HGNC	protein_coding	OTTHUMT00000460524.1	C	NM_004823		38818030	+1	no_errors	ENST00000263372	ensembl	human	known	70_37	missense	SNP	1.000	T
KIAA0754	643314	genome.wustl.edu	37	1	39878480	39878480	+	Missense_Mutation	SNP	A	A	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr1:39878480A>T	ENST00000530275.1	+	1	2330	c.2135A>T	c.(2134-2136)gAt>gTt	p.D712V	MACF1_ENST00000545844.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000564288.1_Intron|MACF1_ENST00000372915.3_Intron|MACF1_ENST00000289893.4_Intron|MACF1_ENST00000567887.1_Intron|MACF1_ENST00000539005.1_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	712										central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GATGCCCTAGATGCTGCACTG	0.547																																																	0													37.0	37.0	37.0					1																	39878480		1984	4164	6148	SO:0001583	missense	643314					1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.2135A>T	1.37:g.39878480A>T	ENSP00000431179:p.Asp712Val		E9PMC2|Q6ZSB2	Missense_Mutation	SNP	NULL	p.D712V	ENST00000530275.1	37	c.2135		1	.	.	.	.	.	.	.	.	.	.	A	14.05	2.418991	0.42918	.	.	ENSG00000255103	ENST00000530275	T	0.29655	1.56	4.0	1.52	0.23074	.	.	.	.	.	T	0.17874	0.0429	N	0.24115	0.695	0.09310	N	0.999999	P	0.36354	0.549	B	0.34779	0.189	T	0.14952	-1.0454	9	0.59425	D	0.04	.	4.4398	0.11568	0.4834:0.3975:0.1191:0.0	.	712	O94854	K0754_HUMAN	V	712	ENSP00000431179:D712V	ENSP00000431179:D712V	D	+	2	0	RP4-562N20.1	39651067	0.006000	0.16342	0.001000	0.08648	0.556000	0.35491	-0.276000	0.08514	0.046000	0.15833	0.459000	0.35465	GAT	KIAA0754	-	NULL		0.547	KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	KIAA0754	HGNC	protein_coding	OTTHUMT00000392100.1	A	NM_015038		39878480	+1	no_errors	ENST00000530275	ensembl	human	known	70_37	missense	SNP	0.005	T
KIF1A	547	genome.wustl.edu	37	2	241685531	241685531	+	Missense_Mutation	SNP	G	G	A			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr2:241685531G>A	ENST00000320389.7	-	28	2982	c.2824C>T	c.(2824-2826)Cgc>Tgc	p.R942C	KIF1A_ENST00000498729.2_Missense_Mutation_p.R1043C	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	942					anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		TCCACGATGCGAAGCTCTTCC	0.642																																																	0													20.0	23.0	22.0					2																	241685531		2002	4161	6163	SO:0001583	missense	547			AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2824C>T	2.37:g.241685531G>A	ENSP00000322791:p.Arg942Cys		B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_Pleckstrin_homology,pfam_KIF1B,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,smart_Pleckstrin_homology,pfscan_FHA_dom,pfscan_Pleckstrin_homology,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R1043C	ENST00000320389.7	37	c.3127	CCDS46561.1	2	.	.	.	.	.	.	.	.	.	.	G	21.0	4.078009	0.76528	.	.	ENSG00000130294	ENST00000320389;ENST00000498729;ENST00000373308;ENST00000404283	T;T;T	0.79845	-1.31;-1.31;-1.31	4.27	3.38	0.38709	.	0.000000	0.85682	U	0.000000	D	0.88757	0.6523	M	0.81497	2.545	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.988;0.997;0.935	D	0.89053	0.3457	10	0.87932	D	0	.	11.7573	0.51882	0.0873:0.0:0.9127:0.0	.	1043;1043;942	F5H045;Q12756-2;Q12756	.;.;KIF1A_HUMAN	C	942;1043;1043;1043	ENSP00000322791:R942C;ENSP00000438388:R1043C;ENSP00000384231:R1043C	ENSP00000322791:R942C	R	-	1	0	KIF1A	241334204	1.000000	0.71417	0.753000	0.31225	0.778000	0.44026	7.653000	0.83643	0.782000	0.33613	0.313000	0.20887	CGC	KIF1A	-	NULL		0.642	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF1A	HGNC	protein_coding	OTTHUMT00000324536.3	G	NM_138483		241685531	-1	no_errors	ENST00000498729	ensembl	human	known	70_37	missense	SNP	1.000	A
KIF7	374654	genome.wustl.edu	37	15	90171708	90171708	+	Missense_Mutation	SNP	C	C	T	rs73477443		TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr15:90171708C>T	ENST00000394412.3	-	19	4050	c.3974G>A	c.(3973-3975)cGg>cAg	p.R1325Q	KIF7_ENST00000558928.1_Intron	NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	1325					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			CAGTTCCCGCCGGGGCTTGGA	0.672													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15326	0.0		0.0	False		,,,				2504	0.0																0													35.0	43.0	40.0					15																	90171708		2198	4287	6485	SO:0001583	missense	374654			AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.3974G>A	15.37:g.90171708C>T	ENSP00000377934:p.Arg1325Gln		Q3SXY0|Q6UXE9|Q8IW72	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R1325Q	ENST00000394412.3	37	c.3974	CCDS32325.2	15	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	21.4	4.139195	0.77775	.	.	ENSG00000166813	ENST00000394412	T	0.77877	-1.13	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.83672	0.5305	L	0.32530	0.975	0.54753	D	0.99998	P;D	0.89917	0.941;1.0	P;D	0.79108	0.572;0.992	D	0.84890	0.0836	10	0.66056	D	0.02	.	19.5768	0.95447	0.0:1.0:0.0:0.0	.	811;1325	B7ZKY4;Q2M1P5	.;KIF7_HUMAN	Q	1325	ENSP00000377934:R1325Q	ENSP00000377934:R1325Q	R	-	2	0	KIF7	87972712	1.000000	0.71417	1.000000	0.80357	0.112000	0.19704	6.610000	0.74178	2.635000	0.89317	0.462000	0.41574	CGG	KIF7	-	NULL		0.672	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF7	HGNC	protein_coding	OTTHUMT00000347782.1	C	NM_198525		90171708	-1	no_errors	ENST00000394412	ensembl	human	known	70_37	missense	SNP	1.000	T
KLHDC7A	127707	genome.wustl.edu	37	1	18807595	18807595	+	Silent	SNP	G	G	A			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr1:18807595G>A	ENST00000400664.1	+	1	172	c.120G>A	c.(118-120)tcG>tcA	p.S40S		NM_152375.2	NP_689588.2	Q5VTJ3	KLD7A_HUMAN	kelch domain containing 7A	40						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	22		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		TGTACAAGTCGAGGCCTGCCC	0.642																																																	0													29.0	34.0	32.0					1																	18807595		2035	4196	6231	SO:0001819	synonymous_variant	127707			AK096072	CCDS185.2	1p36.13	2008-02-05			ENSG00000179023	ENSG00000179023			26791	protein-coding gene	gene with protein product							Standard	NM_152375		Approved	FLJ38753	uc001bax.3	Q5VTJ3	OTTHUMG00000002431	ENST00000400664.1:c.120G>A	1.37:g.18807595G>A			Q8N8W6	Silent	SNP	pfam_Kelch_1,smart_Kelch_1	p.S40	ENST00000400664.1	37	c.120	CCDS185.2	1																																																																																			KLHDC7A	-	NULL		0.642	KLHDC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC7A	HGNC	protein_coding	OTTHUMT00000006923.3	G	NM_152375		18807595	+1	no_errors	ENST00000400664	ensembl	human	known	70_37	silent	SNP	0.940	A
KLRG2	346689	genome.wustl.edu	37	7	139164445	139164445	+	Silent	SNP	C	C	A	rs201132743		TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr7:139164445C>A	ENST00000340940.4	-	3	1002	c.933G>T	c.(931-933)gcG>gcT	p.A311A	KLRG2_ENST00000393039.2_Intron	NM_198508.2	NP_940910.1	A4D1S0	KLRG2_HUMAN	killer cell lectin-like receptor subfamily G, member 2	311	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|large_intestine(2)|lung(3)	6	Melanoma(164;0.233)					CCCAGGCCTGCGCTTCTGCAG	0.617																																																	0													66.0	64.0	65.0					7																	139164445		2203	4300	6503	SO:0001819	synonymous_variant	346689			AK126174	CCDS5854.1	7q34	2011-08-30			ENSG00000188883	ENSG00000188883		"""Killer cell lectin-like receptors"", ""C-type lectin domain containing"""	24778	protein-coding gene	gene with protein product	"""C-type lectin domain family 15, member B"""						Standard	XM_005250311		Approved	FLJ44186, CLEC15B	uc003vvb.3	A4D1S0	OTTHUMG00000157705	ENST00000340940.4:c.933G>T	7.37:g.139164445C>A			Q2NL79|Q6ZTV6	Silent	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.A311	ENST00000340940.4	37	c.933	CCDS5854.1	7																																																																																			KLRG2	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin		0.617	KLRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLRG2	HGNC	protein_coding	OTTHUMT00000349433.1	C	NM_198508		139164445	-1	no_errors	ENST00000340940	ensembl	human	known	70_37	silent	SNP	0.000	A
KPNA1	3836	genome.wustl.edu	37	3	122152575	122152575	+	Missense_Mutation	SNP	G	G	A			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr3:122152575G>A	ENST00000344337.6	-	12	1359	c.1183C>T	c.(1183-1185)Cgg>Tgg	p.R395W	KPNA1_ENST00000466923.1_5'UTR|RP11-299J3.8_ENST00000608346.1_RNA|RP11-299J3.8_ENST00000609469.1_RNA	NM_002264.3	NP_002255.3	P52294	IMA5_HUMAN	karyopherin alpha 1 (importin alpha 5)	395	Binding to RAG1.|NLS binding site (minor). {ECO:0000250}.				apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|regulation of DNA recombination (GO:0000018)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|protein transporter activity (GO:0008565)			NS(1)|breast(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	21				GBM - Glioblastoma multiforme(114;0.0898)		TTTCTTGTCCGAAATTCAGCA	0.373																																					Melanoma(12;340 801 11196 19797)												0													99.0	98.0	98.0					3																	122152575		2203	4300	6503	SO:0001583	missense	3836			S75295	CCDS3013.1	3q21	2013-02-14			ENSG00000114030	ENSG00000114030		"""Importins"", ""Armadillo repeat containing"""	6394	protein-coding gene	gene with protein product		600686				8052633	Standard	NM_002264		Approved	SRP1, RCH2, NPI-1, IPOA5	uc003efe.2	P52294	OTTHUMG00000159487	ENST00000344337.6:c.1183C>T	3.37:g.122152575G>A	ENSP00000343701:p.Arg395Trp		D3DN93|Q6IBQ9|Q9BQ56	Missense_Mutation	SNP	pfam_Armadillo,pfam_Importin-a_IBB,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.R395W	ENST00000344337.6	37	c.1183	CCDS3013.1	3	.	.	.	.	.	.	.	.	.	.	G	24.3	4.516101	0.85495	.	.	ENSG00000114030	ENST00000344337	T	0.70516	-0.49	5.24	5.24	0.73138	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.78253	0.4254	L	0.49778	1.585	0.80722	D	1	D	0.89917	1.0	D	0.64776	0.929	T	0.79598	-0.1737	10	0.87932	D	0	-13.479	13.0056	0.58703	0.0:0.0:0.8389:0.1611	.	395	P52294	IMA1_HUMAN	W	395	ENSP00000343701:R395W	ENSP00000343701:R395W	R	-	1	2	KPNA1	123635265	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.348000	0.66004	2.724000	0.93272	0.563000	0.77884	CGG	KPNA1	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo		0.373	KPNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNA1	HGNC	protein_coding	OTTHUMT00000355740.1	G	NM_002264		122152575	-1	no_errors	ENST00000344337	ensembl	human	known	70_37	missense	SNP	1.000	A
SPACA6	147650	genome.wustl.edu	37	19	52206523	52206523	+	RNA	SNP	C	C	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr19:52206523C>T	ENST00000573266.1	+	0	1426					NR_024330.1																						GCTATGTTTTCTTGCATCGTA	0.597																																																	0																																												147650																															19.37:g.52206523C>T				RNA	SNP	-	NULL	ENST00000573266.1	37	NULL		19																																																																																			LINC00085	-	-		0.597	LINC00085-002	KNOWN	basic	lincRNA	LINC00085	HGNC	processed_transcript	OTTHUMT00000436553.1	C			52206523	+1	no_errors	ENST00000573266	ensembl	human	known	70_37	rna	SNP	0.550	T
LZTR1	8216	genome.wustl.edu	37	22	21345972	21345972	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr22:21345972C>T	ENST00000215739.8	+	9	1206	c.847C>T	c.(847-849)Cgg>Tgg	p.R283W	LZTR1_ENST00000479606.1_3'UTR|LZTR1_ENST00000389355.3_Missense_Mutation_p.R264W	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	283					anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			ACCCCCGCAGCGGCGCTACGG	0.632																																																	0													32.0	30.0	30.0					22																	21345972		2202	4295	6497	SO:0001583	missense	8216			D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.847C>T	22.37:g.21345972C>T	ENSP00000215739:p.Arg283Trp		Q14776|Q20WK0	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_Kelch_1,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.R283W	ENST00000215739.8	37	c.847	CCDS33606.1	22	.	.	.	.	.	.	.	.	.	.	C	22.1	4.244941	0.79912	.	.	ENSG00000099949	ENST00000539817;ENST00000215739;ENST00000389355	T;T	0.79352	-1.26;-1.26	5.18	3.0	0.34707	Kelch-type beta propeller (1);	0.049603	0.85682	D	0.000000	D	0.89051	0.6605	M	0.92026	3.265	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.996;0.999;0.991;0.976	D	0.89157	0.3527	10	0.66056	D	0.02	-39.5062	11.1917	0.48690	0.485:0.515:0.0:0.0	.	264;242;283;242	B7Z3T9;Q6ZSY0;Q8N653;F5GXU8	.;.;LZTR1_HUMAN;.	W	242;283;264	ENSP00000215739:R283W;ENSP00000374006:R264W	ENSP00000215739:R283W	R	+	1	2	LZTR1	19675972	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	2.752000	0.47516	0.527000	0.28560	0.407000	0.27541	CGG	LZTR1	-	pfam_Kelch_1,pfam_Kelch_2,smart_Kelch_1		0.632	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LZTR1	HGNC	protein_coding	OTTHUMT00000320387.1	C	NM_006767		21345972	+1	no_errors	ENST00000215739	ensembl	human	known	70_37	missense	SNP	1.000	T
MAGEB10	139422	genome.wustl.edu	37	X	27839694	27839694	+	Missense_Mutation	SNP	G	G	A			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chrX:27839694G>A	ENST00000356790.2	+	3	516	c.271G>A	c.(271-273)Gaa>Aaa	p.E91K		NM_182506.3	NP_872312.2	Q96LZ2	MAGBA_HUMAN	melanoma antigen family B, 10	91										NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	26						CGACCAAATGGAAGAAAGGCC	0.468																																																	0													57.0	44.0	48.0					X																	27839694		2202	4300	6502	SO:0001583	missense	139422				CCDS35221.1	Xp21.3	2008-02-05			ENSG00000177689	ENSG00000177689			25377	protein-coding gene	gene with protein product		300761				11454705	Standard	NM_182506		Approved	FLJ32965	uc004dbw.3	Q96LZ2	OTTHUMG00000046084	ENST00000356790.2:c.271G>A	X.37:g.27839694G>A	ENSP00000368304:p.Glu91Lys		Q494Y6|Q494Y7|Q9BZ78	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.E91K	ENST00000356790.2	37	c.271	CCDS35221.1	X	.	.	.	.	.	.	.	.	.	.	G	12.58	1.980156	0.34942	.	.	ENSG00000177689	ENST00000356790	T	0.08008	3.14	2.2	-0.476	0.12100	Melanoma associated antigen, MAGE, N-terminal (1);	0.423288	0.23208	N	0.050712	T	0.12518	0.0304	M	0.82823	2.61	0.09310	N	1	P	0.39003	0.654	B	0.43052	0.406	T	0.09885	-1.0654	10	0.34782	T	0.22	.	4.5473	0.12087	0.5557:0.0:0.4443:0.0	.	91	Q96LZ2	MAGBA_HUMAN	K	91	ENSP00000368304:E91K	ENSP00000368304:E91K	E	+	1	0	MAGEB10	27749615	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.266000	0.08631	-0.215000	0.10063	0.422000	0.28245	GAA	MAGEB10	-	pfam_Melanoma_ass_antigen_N		0.468	MAGEB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB10	HGNC	protein_coding	OTTHUMT00000106216.1	G	NM_182506		27839694	+1	no_errors	ENST00000356790	ensembl	human	known	70_37	missense	SNP	0.000	A
MST1R	4486	genome.wustl.edu	37	3	49939929	49939929	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr3:49939929C>T	ENST00000296474.3	-	1	1141	c.1114G>A	c.(1114-1116)Gac>Aac	p.D372N	CTD-2330K9.3_ENST00000419183.1_5'Flank|MST1R_ENST00000344206.4_Missense_Mutation_p.D372N|CTD-2330K9.2_ENST00000435478.1_RNA	NM_002447.2	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor (c-met-related tyrosine kinase)	372	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cellular component movement (GO:0006928)|defense response (GO:0006952)|innate immune response (GO:0045087)|macrophage colony-stimulating factor signaling pathway (GO:0038145)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|response to virus (GO:0009615)|signal transduction (GO:0007165)|single fertilization (GO:0007338)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|macrophage colony-stimulating factor receptor activity (GO:0005011)			cervix(1)|endometrium(5)|large_intestine(3)|lung(17)|ovary(5)|prostate(2)|skin(1)|urinary_tract(3)	37				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		TCCAGCAGGTCAATGGGGAAG	0.597																																																	0													122.0	124.0	123.0					3																	49939929		2203	4300	6503	SO:0001583	missense	4486			X70040	CCDS2807.1, CCDS58833.1	3p21	2008-08-18			ENSG00000164078	ENSG00000164078		"""CD molecules"""	7381	protein-coding gene	gene with protein product		600168	"""PTK8 protein tyrosine kinase 8"""	RON, PTK8		8386824	Standard	NM_002447		Approved	CDw136, CD136	uc003cxy.4	Q04912	OTTHUMG00000156709	ENST00000296474.3:c.1114G>A	3.37:g.49939929C>T	ENSP00000296474:p.Asp372Asn		B5A944|B5A945|B5A946|B5A947	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_IPT_TIG_rcpt,superfamily_Semaphorin/CD100_Ag,superfamily_Kinase-like_dom,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_HGF/MSP_rcpt,pfscan_Semaphorin/CD100_Ag,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D372N	ENST00000296474.3	37	c.1114	CCDS2807.1	3	.	.	.	.	.	.	.	.	.	.	C	11.62	1.691569	0.30052	.	.	ENSG00000164078	ENST00000296474;ENST00000344206	T;T	0.04862	3.54;3.54	4.77	-3.95	0.04118	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.945233	0.09041	N	0.857363	T	0.04724	0.0128	L	0.42245	1.32	0.09310	N	1	B;B;B;B;B	0.15473	0.004;0.013;0.004;0.004;0.001	B;B;B;B;B	0.13407	0.009;0.003;0.009;0.009;0.005	T	0.43814	-0.9368	10	0.30078	T	0.28	-2.5115	3.1437	0.06464	0.1089:0.1162:0.3194:0.4556	.	372;372;372;372;372	Q04912-3;Q04912-4;Q04912-6;Q04912-5;Q04912	.;.;.;.;RON_HUMAN	N	372	ENSP00000296474:D372N;ENSP00000341325:D372N	ENSP00000296474:D372N	D	-	1	0	MST1R	49914933	0.000000	0.05858	0.006000	0.13384	0.983000	0.72400	-2.003000	0.01463	-0.670000	0.05282	0.561000	0.74099	GAC	MST1R	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pirsf_Tyr_kinase_HGF/MSP_rcpt,pfscan_Semaphorin/CD100_Ag		0.597	MST1R-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MST1R	HGNC	protein_coding	OTTHUMT00000345403.1	C			49939929	-1	no_errors	ENST00000296474	ensembl	human	known	70_37	missense	SNP	0.000	T
MUC16	94025	genome.wustl.edu	37	19	9057477	9057477	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr19:9057477C>T	ENST00000397910.4	-	3	30172	c.29969G>A	c.(29968-29970)aGa>aAa	p.R9990K		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9992	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTGTAAAAATCTAGGAGGAAC	0.458																																																	0													141.0	138.0	139.0					19																	9057477		1922	4129	6051	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.29969G>A	19.37:g.9057477C>T	ENSP00000381008:p.Arg9990Lys		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.R9990K	ENST00000397910.4	37	c.29969	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	c	5.887	0.347699	0.11126	.	.	ENSG00000181143	ENST00000397910	T	0.21361	2.01	1.61	0.551	0.17225	.	.	.	.	.	T	0.10078	0.0247	N	0.19112	0.55	.	.	.	P	0.34977	0.478	B	0.25987	0.065	T	0.19647	-1.0299	8	0.87932	D	0	.	3.8896	0.09113	0.0:0.7655:0.0:0.2345	.	9990	B5ME49	.	K	9990	ENSP00000381008:R9990K	ENSP00000381008:R9990K	R	-	2	0	MUC16	8918477	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.365000	0.02587	0.235000	0.21160	0.460000	0.39030	AGA	MUC16	-	NULL		0.458	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	C	NM_024690		9057477	-1	no_errors	ENST00000397910	ensembl	human	known	70_37	missense	SNP	0.000	T
MUC16	94025	genome.wustl.edu	37	19	9058918	9058918	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr19:9058918C>T	ENST00000397910.4	-	3	28731	c.28528G>A	c.(28528-28530)Gag>Aag	p.E9510K		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9512	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGAATTGCCTCTGTCTCCGTG	0.493																																																	0													156.0	152.0	154.0					19																	9058918		1990	4166	6156	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.28528G>A	19.37:g.9058918C>T	ENSP00000381008:p.Glu9510Lys		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.E9510K	ENST00000397910.4	37	c.28528	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	c	7.864	0.726771	0.15439	.	.	ENSG00000181143	ENST00000397910	T	0.34072	1.38	2.22	1.14	0.20703	.	.	.	.	.	T	0.21801	0.0525	N	0.08118	0	.	.	.	P	0.34977	0.478	B	0.41236	0.351	T	0.30416	-0.9979	8	0.87932	D	0	.	6.6339	0.22872	0.0:0.5072:0.4928:0.0	.	9510	B5ME49	.	K	9510	ENSP00000381008:E9510K	ENSP00000381008:E9510K	E	-	1	0	MUC16	8919918	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-1.014000	0.03641	0.482000	0.27582	0.197000	0.17608	GAG	MUC16	-	NULL		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	C	NM_024690		9058918	-1	no_errors	ENST00000397910	ensembl	human	known	70_37	missense	SNP	0.000	T
MYC	4609	genome.wustl.edu	37	8	128750880	128750880	+	Silent	SNP	C	C	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr8:128750880C>T	ENST00000259523.6	+	2	1577	c.372C>T	c.(370-372)ttC>ttT	p.F124F	MYC_ENST00000524013.1_Silent_p.F138F|MYC_ENST00000377970.2_Silent_p.F139F			P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	124					branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	ACGAGACCTTCATCAAAAACA	0.597		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""						OREG0018982	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																												Dom	yes		8	8q24.12-q24.13	4609	v-myc myelocytomatosis viral oncogene homolog (avian)		"""L, E"""	0													70.0	71.0	70.0					8																	128750880		2203	4300	6503	SO:0001819	synonymous_variant	4609				CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000259523.6:c.372C>T	8.37:g.128750880C>T		1567	A8WFE7|P01107|Q14026	Silent	SNP	pfam_Tscrpt_reg_Myc_N,pfam_Myc-LZ,pfam_HLH_dom,superfamily_HLH_dom,smart_HLH_dom,pfscan_HLH_dom,prints_Tscrpt_reg_Myc	p.F139	ENST00000259523.6	37	c.417		8																																																																																			MYC	-	pfam_Tscrpt_reg_Myc_N		0.597	MYC-002	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	MYC	HGNC	protein_coding	OTTHUMT00000250278.1	C			128750880	+1	no_errors	ENST00000377970	ensembl	human	known	70_37	silent	SNP	1.000	T
NACAD	23148	genome.wustl.edu	37	7	45125156	45125156	+	Missense_Mutation	SNP	A	A	G			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr7:45125156A>G	ENST00000490531.2	-	2	642	c.623T>C	c.(622-624)cTg>cCg	p.L208P		NM_001146334.1	NP_001139806.1	O15069	NACAD_HUMAN	NAC alpha domain containing	208					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|skin(2)	5						CGAGTCCAGCAGCTCATCCCG	0.687																																																	0													18.0	24.0	22.0					7																	45125156		692	1590	2282	SO:0001583	missense	23148			AB002361	CCDS47582.1	7p13	2010-07-14			ENSG00000136274	ENSG00000136274			22196	protein-coding gene	gene with protein product							Standard	NM_001146334		Approved	KIAA0363	uc003tmt.3	O15069	OTTHUMG00000159170	ENST00000490531.2:c.623T>C	7.37:g.45125156A>G	ENSP00000420477:p.Leu208Pro			Missense_Mutation	SNP	pfam_Nas_poly-pep-assoc_cplx,pfscan_Nas_poly-pep-assoc_cplx	p.L208P	ENST00000490531.2	37	c.623	CCDS47582.1	7	.	.	.	.	.	.	.	.	.	.	a	7.227	0.598514	0.13939	.	.	ENSG00000136274	ENST00000490531	T	0.12361	2.69	1.09	1.09	0.20402	.	3.116010	0.01993	N	0.045712	T	0.19005	0.0456	N	0.14661	0.345	0.41417	D	0.987772	D	0.63046	0.992	D	0.63488	0.915	T	0.41787	-0.9489	10	0.87932	D	0	-0.7795	4.3906	0.11339	1.0:0.0:0.0:0.0	.	208	O15069	NACAD_HUMAN	P	208	ENSP00000420477:L208P	ENSP00000420477:L208P	L	-	2	0	NACAD	45091681	0.336000	0.24757	0.551000	0.28230	0.083000	0.17756	0.739000	0.26173	0.751000	0.32900	0.375000	0.23000	CTG	NACAD	-	NULL		0.687	NACAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NACAD	HGNC	protein_coding	OTTHUMT00000353652.2	A	NM_001146334		45125156	-1	no_errors	ENST00000490531	ensembl	human	known	70_37	missense	SNP	0.992	G
NDUFA8	4702	genome.wustl.edu	37	9	124906636	124906636	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr9:124906636G>A	ENST00000373768.3	-	4	544	c.403C>T	c.(403-405)Cga>Tga	p.R135*	NDUFA8_ENST00000537618.1_Intron	NM_014222.2	NP_055037.1	P51970	NDUA8_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8, 19kDa	135					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)|protein complex binding (GO:0032403)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)	9						GGTAAAGGTCGATCTGTTTTC	0.527																																																	0													138.0	113.0	121.0					9																	124906636		2203	4300	6503	SO:0001587	stop_gained	4702			AF044953	CCDS6835.1	9q33.2	2011-07-04	2002-08-29		ENSG00000119421	ENSG00000119421		"""Mitochondrial respiratory chain complex / Complex I"""	7692	protein-coding gene	gene with protein product	"""complex I PGIV subunit"""	603359	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8 (19kD, PGIV)"""			9763677	Standard	NM_014222		Approved	PGIV, MGC793	uc004blv.3	P51970	OTTHUMG00000020598	ENST00000373768.3:c.403C>T	9.37:g.124906636G>A	ENSP00000362873:p.Arg135*		B1AM93|Q9Y6N0	Nonsense_Mutation	SNP	pfam_CHCH,pirsf_NADH_Ub_cplx-1_asu_su-8	p.R135*	ENST00000373768.3	37	c.403	CCDS6835.1	9	.	.	.	.	.	.	.	.	.	.	G	27.2	4.807963	0.90707	.	.	ENSG00000119421	ENST00000373768	.	.	.	5.81	4.89	0.63831	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.3294	11.6269	0.51151	0.0:0.0:0.6766:0.3234	.	.	.	.	X	135	.	ENSP00000362873:R135X	R	-	1	2	NDUFA8	123946457	0.993000	0.37304	1.000000	0.80357	0.878000	0.50629	2.240000	0.43088	1.403000	0.46800	0.655000	0.94253	CGA	NDUFA8	-	pirsf_NADH_Ub_cplx-1_asu_su-8		0.527	NDUFA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFA8	HGNC	protein_coding	OTTHUMT00000053909.1	G	NM_014222		124906636	-1	no_errors	ENST00000373768	ensembl	human	known	70_37	nonsense	SNP	1.000	A
NOTCH4	4855	genome.wustl.edu	37	6	32188317	32188317	+	Missense_Mutation	SNP	C	C	T	rs144492578	byFrequency	TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr6:32188317C>T	ENST00000375023.3	-	6	1162	c.1024G>A	c.(1024-1026)Gtg>Atg	p.V342M		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	342	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						CTCACACACACGCAGTGAAAG	0.612													C|||	2	0.000399361	0.0015	0.0	5008	,	,		18417	0.0		0.0	False		,,,				2504	0.0																0								C	MET/VAL	3,3019		0,3,1508	102.0	100.0	101.0		1024	4.9	1.0	6	dbSNP_134	101	0,5418		0,0,2709	yes	missense	NOTCH4	NM_004557.3	21	0,3,4217	TT,TC,CC		0.0,0.0993,0.0355	probably-damaging	342/2004	32188317	3,8437	1511	2709	4220	SO:0001583	missense	4855				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.1024G>A	6.37:g.32188317C>T	ENSP00000364163:p.Val342Met		B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Ankyrin_rpt,pfam_EGF-like_Ca-bd,pfam_Notch_dom,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_4,prints_Notch_dom	p.V342M	ENST00000375023.3	37	c.1024	CCDS34420.1	6	.	.	.	.	.	.	.	.	.	.	C	21.5	4.154163	0.78114	9.93E-4	0.0	ENSG00000204301	ENST00000375023	D	0.91894	-2.93	4.9	4.9	0.64082	EGF-like region, conserved site (2);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.39687	N	0.001289	D	0.93779	0.8011	L	0.55103	1.725	0.80722	D	1	D;P	0.89917	1.0;0.915	D;B	0.97110	1.0;0.378	D	0.93414	0.6771	10	0.48119	T	0.1	.	15.6115	0.76721	0.0:1.0:0.0:0.0	.	342;342	Q6P3V5;Q99466	.;NOTC4_HUMAN	M	342	ENSP00000364163:V342M	ENSP00000364163:V342M	V	-	1	0	NOTCH4	32296295	1.000000	0.71417	0.999000	0.59377	0.949000	0.60115	5.366000	0.66122	2.539000	0.85634	0.491000	0.48974	GTG	NOTCH4	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EG-like_dom,pirsf_Notch,pfscan_EG-like_dom		0.612	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH4	HGNC	protein_coding	OTTHUMT00000076045.2	C			32188317	-1	no_errors	ENST00000375023	ensembl	human	known	70_37	missense	SNP	1.000	T
NRXN1	9378	genome.wustl.edu	37	2	50148111	50148112	+	3'UTR	INS	-	-	AAGT	rs201032546|rs3839058|rs71902030|rs70946881	byFrequency	TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr2:50148111_50148112insAAGT	ENST00000406316.2	-	0	6880_6881				NRXN1_ENST00000342183.5_3'UTR|NRXN1_ENST00000401710.1_3'UTR|NRXN1_ENST00000404971.1_3'UTR	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1						adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TTAAAAAATAAAAGTAATTGTG	0.292														2457	0.490615	0.4788	0.5086	5008	,	,		14783	0.4306		0.4692	False		,,,				2504	0.5777																0																																										SO:0001624	3_prime_UTR_variant	9378			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.*971->ACTT	2.37:g.50148112_50148115dupAAGT			A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	RNA	INS	-	NULL	ENST00000406316.2	37	NULL	CCDS54360.1	2																																																																																			NRXN1	-	-		0.292	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	HGNC	protein_coding	OTTHUMT00000325291.2	-			50148112	-1	no_errors	ENST00000484192	ensembl	human	known	70_37	rna	INS	0.004:0.237	AAGT
FFAR4	338557	genome.wustl.edu	37	10	95326827	95326827	+	Missense_Mutation	SNP	T	T	G			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr10:95326827T>G	ENST00000371483.4	+	1	406	c.350T>G	c.(349-351)gTg>gGg	p.V117G	FFAR4_ENST00000604414.1_Missense_Mutation_p.V117G|FFAR4_ENST00000371481.4_Missense_Mutation_p.V117G	NM_181745.3	NP_859529.2	Q5NUL3	FFAR4_HUMAN	free fatty acid receptor 4	117					hormone secretion (GO:0046879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of inflammatory response (GO:0050728)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of glucose transport (GO:0010827)	endocytic vesicle (GO:0030139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fatty acid binding (GO:0005504)|taste receptor activity (GO:0008527)										CTCTTCTACGTGATGACCCTG	0.682																																																	0													35.0	34.0	34.0					10																	95326827		2202	4298	6500	SO:0001583	missense	338557				CCDS31248.1, CCDS55720.1	10q23.33	2012-11-16	2012-11-16	2012-11-16	ENSG00000186188	ENSG00000186188		"""GPCR / Class A : Fatty acid receptors"""	19061	protein-coding gene	gene with protein product		609044	"""G protein-coupled receptor 129"", ""G protein-coupled receptor 120"", ""omega-3 fatty acid receptor 1"""	GPR129, GPR120, O3FAR1		20471368, 19723586, 15619630, 20813258	Standard	NM_181745		Approved	PGR4	uc010qnt.2	Q5NUL3	OTTHUMG00000034409	ENST00000371483.4:c.350T>G	10.37:g.95326827T>G	ENSP00000360538:p.Val117Gly		Q495H1|Q5VY25|Q5VY26|Q7Z605|Q86SM7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.V117G	ENST00000371483.4	37	c.350	CCDS31248.1	10	.	.	.	.	.	.	.	.	.	.	T	16.10	3.027776	0.54790	.	.	ENSG00000186188	ENST00000371481;ENST00000371483	T;T	0.39229	1.09;1.09	5.22	2.7	0.31948	GPCR, rhodopsin-like superfamily (1);	0.773311	0.11908	N	0.517943	T	0.42359	0.1199	L	0.55213	1.73	0.47905	D	0.999541	B;B	0.28419	0.003;0.211	B;B	0.32533	0.004;0.147	T	0.44452	-0.9327	10	0.87932	D	0	-2.7603	12.1452	0.54020	0.0:0.0:0.2692:0.7308	.	117;117	Q5NUL3-2;Q5NUL3	.;O3FA1_HUMAN	G	117	ENSP00000360536:V117G;ENSP00000360538:V117G	ENSP00000360536:V117G	V	+	2	0	O3FAR1	95316817	0.992000	0.36948	0.992000	0.48379	0.967000	0.64934	1.973000	0.40550	0.968000	0.38212	0.459000	0.35465	GTG	O3FAR1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.682	FFAR4-002	KNOWN	basic|CCDS	protein_coding	O3FAR1	HGNC	protein_coding	OTTHUMT00000083179.1	T	NM_181745		95326827	+1	no_errors	ENST00000371483	ensembl	human	known	70_37	missense	SNP	0.986	G
OR10AB1P	390091	genome.wustl.edu	37	11	7749644	7749644	+	lincRNA	SNP	G	G	A			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr11:7749644G>A	ENST00000527565.1	-	0	542																											GGAGAAAAGAGAGATAAACAG	0.343																																																	0																																												390091																															11.37:g.7749644G>A				Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	p.E5K	ENST00000527565.1	37	c.13		11	.	.	.	.	.	.	.	.	.	.	G	13.94	2.388326	0.42308	.	.	ENSG00000176716	ENST00000317359	T	0.00542	6.69	4.7	-5.42	0.02640	.	3.826720	0.00465	N	0.000103	T	0.00440	0.0014	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.40365	-0.9567	7	0.45353	T	0.12	.	3.3021	0.06987	0.5433:0.1319:0.2056:0.1192	.	.	.	.	K	5	ENSP00000322295:E5K	ENSP00000322295:E5K	E	+	1	0	OR10AB1P	7706220	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-0.111000	0.10807	-1.141000	0.02873	0.655000	0.94253	GAG	OR10AB1P	-	NULL		0.343	RP11-35J10.5-001	KNOWN	basic|readthrough_transcript	lincRNA	OR10AB1P	HGNC	lincRNA	OTTHUMT00000385692.1	G			7749644	+1	no_errors	ENST00000317359	ensembl	human	known	70_37	missense	SNP	0.000	A
SAMD4B	55095	genome.wustl.edu	37	19	39876993	39876993	+	IGR	SNP	C	C	G			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr19:39876993C>G	ENST00000314471.6	+	0	4519				PAF1_ENST00000221266.7_Intron|PAF1_ENST00000221265.3_Missense_Mutation_p.E412Q|PAF1_ENST00000595564.1_Intron	NM_018028.2	NP_060498.2	Q5PRF9	SMAG2_HUMAN	sterile alpha motif domain containing 4B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(5)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(2)	15	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			CCCGAGTGCTCATCTTCACTG	0.607																																																	0													215.0	192.0	199.0					19																	39876993		2203	4300	6503	SO:0001628	intergenic_variant	54623				CCDS33020.1	19q13.2	2013-01-10				ENSG00000179134		"""Sterile alpha motif (SAM) domain containing"""	25492	protein-coding gene	gene with protein product	"""smaug homolog B (Drosophila)"""					16221671	Standard	XM_005259029		Approved	FLJ10211, MGC99832, SMGB, hSmaug2	uc002olb.3	Q5PRF9			19.37:g.39876993C>G			A5Z0M6|Q6P194	Missense_Mutation	SNP	pfam_RNA_pol_II-assoc_Paf1	p.E412Q	ENST00000314471.6	37	c.1234	CCDS33020.1	19	.	.	.	.	.	.	.	.	.	.	c	13.03	2.116872	0.37339	.	.	ENSG00000006712	ENST00000221265	.	.	.	5.36	5.36	0.76844	.	0.055090	0.64402	D	0.000001	T	0.58308	0.2113	L	0.44542	1.39	0.80722	D	1	B	0.20887	0.049	B	0.29663	0.105	T	0.53718	-0.8399	9	0.33940	T	0.23	-16.4261	16.628	0.84984	0.0:1.0:0.0:0.0	.	412	Q8N7H5	PAF1_HUMAN	Q	412	.	ENSP00000221265:E412Q	E	-	1	0	PAF1	44568833	1.000000	0.71417	0.889000	0.34880	0.188000	0.23474	7.177000	0.77650	2.528000	0.85240	0.450000	0.29827	GAG	PAF1	-	pfam_RNA_pol_II-assoc_Paf1		0.607	SAMD4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAF1	HGNC	protein_coding	OTTHUMT00000464467.1	C	NM_018028		39876993	-1	no_errors	ENST00000221265	ensembl	human	known	70_37	missense	SNP	1.000	G
PAWR	5074	genome.wustl.edu	37	12	80083663	80083663	+	Missense_Mutation	SNP	G	G	A	rs377609790	byFrequency	TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr12:80083663G>A	ENST00000328827.4	-	2	734	c.362C>T	c.(361-363)cCg>cTg	p.P121L	PAWR_ENST00000547571.1_5'UTR|RP11-530C5.1_ENST00000551995.1_lincRNA	NM_002583.2	NP_002574.2	Q96IZ0	PAWR_HUMAN	PRKC, apoptosis, WT1, regulator	121					actin filament bundle assembly (GO:0051017)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|interleukin-2 biosynthetic process (GO:0042094)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of amyloid precursor protein biosynthetic process (GO:0042986)|positive regulation of apoptotic process (GO:0043065)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|enzyme binding (GO:0019899)|leucine zipper domain binding (GO:0043522)|transcription corepressor activity (GO:0003714)			NS(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	8						CTGGGGCGGCGGTGCAGCCGA	0.746																																																	0													5.0	5.0	5.0					12																	80083663		2132	4196	6328	SO:0001583	missense	5074			U63809	CCDS31863.1	12q21.2	2013-03-07			ENSG00000177425	ENSG00000177425			8614	protein-coding gene	gene with protein product	"""prostate apoptosis response-4"""	601936				8943350, 9790775	Standard	NM_002583		Approved	par-4, PAR4	uc001syx.3	Q96IZ0	OTTHUMG00000170080	ENST00000328827.4:c.362C>T	12.37:g.80083663G>A	ENSP00000328088:p.Pro121Leu		O75796|Q6FHY9|Q8N700	Missense_Mutation	SNP	NULL	p.P121L	ENST00000328827.4	37	c.362	CCDS31863.1	12	.	.	.	.	.	.	.	.	.	.	G	7.973	0.749490	0.15778	.	.	ENSG00000177425	ENST00000328827	T	0.20200	2.09	2.98	0.859	0.19036	.	0.572937	0.18139	N	0.150462	T	0.13841	0.0335	L	0.40543	1.245	0.09310	N	1	B	0.13145	0.007	B	0.04013	0.001	T	0.22208	-1.0223	9	.	.	.	-2.3605	6.4531	0.21914	0.1128:0.0:0.7099:0.1772	.	121	Q96IZ0	PAWR_HUMAN	L	121	ENSP00000328088:P121L	.	P	-	2	0	PAWR	78607794	0.029000	0.19370	0.001000	0.08648	0.071000	0.16799	1.196000	0.32198	0.562000	0.29204	-0.448000	0.05591	CCG	PAWR	-	NULL		0.746	PAWR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAWR	HGNC	protein_coding	OTTHUMT00000407175.1	G	NM_002583		80083663	-1	no_errors	ENST00000328827	ensembl	human	known	70_37	missense	SNP	0.001	A
PCDH15	65217	genome.wustl.edu	37	10	55581942	55581942	+	Silent	SNP	G	G	A			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr10:55581942G>A	ENST00000320301.6	-	33	5938	c.5544C>T	c.(5542-5544)tgC>tgT	p.C1848C	PCDH15_ENST00000395445.1_Intron|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000361849.3_Silent_p.C1850C|PCDH15_ENST00000437009.1_Silent_p.C1779C|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395432.2_Silent_p.C1808C|PCDH15_ENST00000395430.1_Silent_p.C1845C|PCDH15_ENST00000395438.1_Intron|PCDH15_ENST00000395433.1_Silent_p.C1825C|PCDH15_ENST00000373957.3_Intron	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1848					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				AGTTGGTCGTGCATTTAACAC	0.468										HNSCC(58;0.16)																																							0													182.0	170.0	174.0					10																	55581942		2203	4300	6503	SO:0001819	synonymous_variant	65217			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.5544C>T	10.37:g.55581942G>A			A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.C1848	ENST00000320301.6	37	c.5544	CCDS7248.1	10																																																																																			PCDH15	-	NULL		0.468	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000048121.2	G	NM_033056		55581942	-1	no_errors	ENST00000320301	ensembl	human	known	70_37	silent	SNP	0.005	A
PCDHA8	56140	genome.wustl.edu	37	5	140220969	140220969	+	Silent	SNP	C	C	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr5:140220969C>T	ENST00000531613.1	+	1	63	c.63C>T	c.(61-63)ctC>ctT	p.L21L	PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000378123.3_Silent_p.L21L|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	21					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCTGCTCCTCGCAGCCTGGA	0.567																																																	0													65.0	68.0	67.0					5																	140220969		2203	4299	6502	SO:0001819	synonymous_variant	56140			AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.63C>T	5.37:g.140220969C>T			B9EGT7|O75281	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L21	ENST00000531613.1	37	c.63	CCDS54919.1	5																																																																																			PCDHA8	-	NULL		0.567	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA8	HGNC	protein_coding	OTTHUMT00000372830.2	C	NM_018911		140220969	+1	no_errors	ENST00000531613	ensembl	human	known	70_37	silent	SNP	0.000	T
PCSK7	9159	genome.wustl.edu	37	11	117098005	117098005	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr11:117098005C>G	ENST00000320934.3	-	5	1267	c.637G>C	c.(637-639)Gac>Cac	p.D213H		NM_004716.2	NP_004707.2	Q16549	PCSK7_HUMAN	proprotein convertase subtilisin/kexin type 7	213	Peptidase S8.				peptide hormone processing (GO:0016486)|protein processing (GO:0016485)	integral component of Golgi membrane (GO:0030173)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	16	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|Epithelial(105;6.71e-05)|all cancers(92;0.000537)		GGGTCAGGGTCATTAGAGTTG	0.557			T	IGH@	MLCLS																																			Dom	yes		11	11q23.3	9159	proprotein convertase subtilisin/kexin type 7		L	0													107.0	107.0	107.0					11																	117098005		2201	4296	6497	SO:0001583	missense	9159			U40623	CCDS8382.1	11q23-q24	2008-02-01			ENSG00000160613	ENSG00000160613			8748	protein-coding gene	gene with protein product		604872				8615762, 9820811	Standard	XM_006718938		Approved	PC7, PC8, LPC, SPC7	uc001pqr.3	Q16549	OTTHUMG00000165640	ENST00000320934.3:c.637G>C	11.37:g.117098005C>G	ENSP00000325917:p.Asp213His		B0YJ60|Q3C1X1|Q53GM4|Q96FK8|Q9UL57	Missense_Mutation	SNP	pfam_Peptidase_S8/S53,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.D213H	ENST00000320934.3	37	c.637	CCDS8382.1	11	.	.	.	.	.	.	.	.	.	.	C	31	5.104247	0.94245	.	.	ENSG00000160613	ENST00000320934;ENST00000543900;ENST00000525027	D;D	0.89050	-2.46;-2.46	5.61	5.61	0.85477	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	D	0.95522	0.8545	M	0.89030	3	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.95866	0.8887	10	0.72032	D	0.01	-34.8218	18.6171	0.91306	0.0:1.0:0.0:0.0	.	213	Q16549	PCSK7_HUMAN	H	213	ENSP00000325917:D213H;ENSP00000431181:D213H	ENSP00000325917:D213H	D	-	1	0	PCSK7	116603215	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	7.818000	0.86416	2.633000	0.89246	0.655000	0.94253	GAC	PCSK7	-	pfam_Peptidase_S8/S53,superfamily_Peptidase_S8/S53		0.557	PCSK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK7	HGNC	protein_coding	OTTHUMT00000385529.2	C	NM_004716		117098005	-1	no_errors	ENST00000320934	ensembl	human	known	70_37	missense	SNP	1.000	G
PCSK7	9159	genome.wustl.edu	37	11	117098017	117098017	+	Missense_Mutation	SNP	G	G	A			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr11:117098017G>A	ENST00000320934.3	-	5	1255	c.625C>T	c.(625-627)Ctc>Ttc	p.L209F		NM_004716.2	NP_004707.2	Q16549	PCSK7_HUMAN	proprotein convertase subtilisin/kexin type 7	209	Peptidase S8.				peptide hormone processing (GO:0016486)|protein processing (GO:0016485)	integral component of Golgi membrane (GO:0030173)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	16	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|Epithelial(105;6.71e-05)|all cancers(92;0.000537)		TTAGAGTTGAGGTCATAGCTA	0.547			T	IGH@	MLCLS																																			Dom	yes		11	11q23.3	9159	proprotein convertase subtilisin/kexin type 7		L	0													101.0	102.0	102.0					11																	117098017		2201	4296	6497	SO:0001583	missense	9159			U40623	CCDS8382.1	11q23-q24	2008-02-01			ENSG00000160613	ENSG00000160613			8748	protein-coding gene	gene with protein product		604872				8615762, 9820811	Standard	XM_006718938		Approved	PC7, PC8, LPC, SPC7	uc001pqr.3	Q16549	OTTHUMG00000165640	ENST00000320934.3:c.625C>T	11.37:g.117098017G>A	ENSP00000325917:p.Leu209Phe		B0YJ60|Q3C1X1|Q53GM4|Q96FK8|Q9UL57	Missense_Mutation	SNP	pfam_Peptidase_S8/S53,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.L209F	ENST00000320934.3	37	c.625	CCDS8382.1	11	.	.	.	.	.	.	.	.	.	.	G	10.26	1.302038	0.23736	.	.	ENSG00000160613	ENST00000320934;ENST00000543900;ENST00000525027	D;D	0.86562	-2.14;-2.14	5.61	4.7	0.59300	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.64402	D	0.000001	T	0.81861	0.4912	N	0.13198	0.31	0.80722	D	1	P	0.48834	0.916	P	0.52646	0.705	T	0.82639	-0.0358	10	0.87932	D	0	-24.8118	7.3102	0.26471	0.2587:0.0:0.7413:0.0	.	209	Q16549	PCSK7_HUMAN	F	209	ENSP00000325917:L209F;ENSP00000431181:L209F	ENSP00000325917:L209F	L	-	1	0	PCSK7	116603227	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	2.755000	0.47540	1.370000	0.46153	0.655000	0.94253	CTC	PCSK7	-	pfam_Peptidase_S8/S53,superfamily_Peptidase_S8/S53		0.547	PCSK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK7	HGNC	protein_coding	OTTHUMT00000385529.2	G	NM_004716		117098017	-1	no_errors	ENST00000320934	ensembl	human	known	70_37	missense	SNP	1.000	A
PCSK7	9159	genome.wustl.edu	37	11	117100428	117100428	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr11:117100428C>G	ENST00000320934.3	-	3	763	c.133G>C	c.(133-135)Gat>Cat	p.D45H		NM_004716.2	NP_004707.2	Q16549	PCSK7_HUMAN	proprotein convertase subtilisin/kexin type 7	45					peptide hormone processing (GO:0016486)|protein processing (GO:0016485)	integral component of Golgi membrane (GO:0030173)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	16	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|Epithelial(105;6.71e-05)|all cancers(92;0.000537)		CCCTGGCCATCAGGCCCACCT	0.672			T	IGH@	MLCLS																																			Dom	yes		11	11q23.3	9159	proprotein convertase subtilisin/kexin type 7		L	0													25.0	29.0	27.0					11																	117100428		2201	4296	6497	SO:0001583	missense	9159			U40623	CCDS8382.1	11q23-q24	2008-02-01			ENSG00000160613	ENSG00000160613			8748	protein-coding gene	gene with protein product		604872				8615762, 9820811	Standard	XM_006718938		Approved	PC7, PC8, LPC, SPC7	uc001pqr.3	Q16549	OTTHUMG00000165640	ENST00000320934.3:c.133G>C	11.37:g.117100428C>G	ENSP00000325917:p.Asp45His		B0YJ60|Q3C1X1|Q53GM4|Q96FK8|Q9UL57	Missense_Mutation	SNP	pfam_Peptidase_S8/S53,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.D45H	ENST00000320934.3	37	c.133	CCDS8382.1	11	.	.	.	.	.	.	.	.	.	.	C	2.866	-0.235057	0.05983	.	.	ENSG00000160613	ENST00000320934;ENST00000543900;ENST00000525027;ENST00000524507;ENST00000532301;ENST00000530269	T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82	4.21	-1.07	0.09968	.	1.670430	0.03180	N	0.171962	T	0.32376	0.0827	N	0.22421	0.69	0.09310	N	1	B	0.25955	0.138	B	0.21917	0.037	T	0.19778	-1.0295	10	0.42905	T	0.14	-0.0234	5.2043	0.15283	0.0:0.5272:0.1411:0.3317	.	45	Q16549	PCSK7_HUMAN	H	45	ENSP00000325917:D45H;ENSP00000431181:D45H;ENSP00000433841:D45H;ENSP00000436459:D45H;ENSP00000433252:D45H	ENSP00000325917:D45H	D	-	1	0	PCSK7	116605638	0.000000	0.05858	0.002000	0.10522	0.208000	0.24298	-0.047000	0.11963	-0.124000	0.11724	-0.467000	0.05162	GAT	PCSK7	-	NULL		0.672	PCSK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK7	HGNC	protein_coding	OTTHUMT00000385529.2	C	NM_004716		117100428	-1	no_errors	ENST00000320934	ensembl	human	known	70_37	missense	SNP	0.003	G
PDCD7	10081	genome.wustl.edu	37	15	65411147	65411147	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr15:65411147C>T	ENST00000204549.4	-	5	1420	c.1366G>A	c.(1366-1368)Gat>Aat	p.D456N		NM_005707.1	NP_005698.1	Q8N8D1	PDCD7_HUMAN	programmed cell death 7	456					apoptotic process (GO:0006915)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of T cell apoptotic process (GO:0070234)|response to glucocorticoid (GO:0051384)|RNA splicing (GO:0008380)	U12-type spliceosomal complex (GO:0005689)				endometrium(4)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	7						TTGGGATGATCGGATGGCACC	0.438																																																	0													86.0	77.0	80.0					15																	65411147		2202	4299	6501	SO:0001583	missense	10081			AF083930	CCDS10201.1	15q22.2	2012-06-07			ENSG00000090470	ENSG00000090470			8767	protein-coding gene	gene with protein product	"""U11/U12 snRNP 59K"""	608138				10037816	Standard	NM_005707		Approved	HES18, ES18	uc002aol.3	Q8N8D1	OTTHUMG00000133117	ENST00000204549.4:c.1366G>A	15.37:g.65411147C>T	ENSP00000204549:p.Asp456Asn		Q96AK8|Q9Y6D7	Missense_Mutation	SNP	NULL	p.D456N	ENST00000204549.4	37	c.1366	CCDS10201.1	15	.	.	.	.	.	.	.	.	.	.	C	25.3	4.620862	0.87460	.	.	ENSG00000090470	ENST00000204549;ENST00000431964;ENST00000380204	.	.	.	6.17	5.24	0.73138	.	0.076508	0.50627	D	0.000110	T	0.46249	0.1383	L	0.46157	1.445	0.41661	D	0.989183	P	0.37233	0.588	B	0.26614	0.071	T	0.43212	-0.9405	9	0.25751	T	0.34	-2.7804	14.735	0.69409	0.0:0.9287:0.0:0.0713	.	456	Q8N8D1	PDCD7_HUMAN	N	456;241;250	.	ENSP00000204549:D456N	D	-	1	0	PDCD7	63198200	1.000000	0.71417	0.935000	0.37517	0.995000	0.86356	4.674000	0.61612	1.561000	0.49584	0.655000	0.94253	GAT	PDCD7	-	NULL		0.438	PDCD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCD7	HGNC	protein_coding	OTTHUMT00000256784.2	C	NM_005707		65411147	-1	no_errors	ENST00000204549	ensembl	human	known	70_37	missense	SNP	0.991	T
PGAP2	27315	genome.wustl.edu	37	11	3846311	3846311	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr11:3846311C>T	ENST00000463452.2	+	5	670	c.587C>T	c.(586-588)tCg>tTg	p.S196L	PGAP2_ENST00000493547.2_Silent_p.L220L|PGAP2_ENST00000396991.2_Missense_Mutation_p.S257L|PGAP2_ENST00000479072.1_Missense_Mutation_p.S36L|PGAP2_ENST00000278243.4_Missense_Mutation_p.S257L|PGAP2_ENST00000300730.6_Missense_Mutation_p.S249L|PGAP2_ENST00000396993.4_Silent_p.L149L|PGAP2_ENST00000465307.2_Silent_p.L199L|PGAP2_ENST00000532017.1_3'UTR|PGAP2_ENST00000496834.2_Missense_Mutation_p.S40L|PGAP2_ENST00000396986.2_Missense_Mutation_p.S253L	NM_001256240.1	NP_001243169.1	Q9UHJ9	PGAP2_HUMAN	post-GPI attachment to proteins 2	196					GPI anchor biosynthetic process (GO:0006506)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|signal transduction in response to DNA damage (GO:0042770)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)	p.S257L(1)|p.S249L(1)		NS(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|urinary_tract(1)	11						TCCTTCTTCTCGGCGCTGGCT	0.552											OREG0020703	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					2	Substitution - Missense(2)	endometrium(2)											166.0	145.0	152.0					11																	3846311		2201	4298	6499	SO:0001583	missense	27315			AF159615	CCDS7747.1, CCDS44523.1, CCDS58112.1, CCDS58113.1, CCDS73244.1, CCDS73245.1	11p15.4	2014-01-31			ENSG00000148985	ENSG00000148985			17893	protein-coding gene	gene with protein product	"""FGF receptor activating protein 1"", ""cell wall biogenesis 43 N-terminal homolog (S. cerevisiae)"""	615187	"""mental retardation, non-syndromic, autosomal recessive, 21"""	MRT21		10585768, 16407401, 23561846	Standard	NM_014489		Approved	FRAG1, CWH43-N	uc010qxw.3	Q9UHJ9	OTTHUMG00000012238	ENST00000463452.2:c.587C>T	11.37:g.3846311C>T	ENSP00000435223:p.Ser196Leu	614	E9PJG5|H7BXL9|Q6UC77|Q96G66|Q9UF01|Q9Y4N1	Missense_Mutation	SNP	pfam_Frag1/DRAM/Sfk1	p.S257L	ENST00000463452.2	37	c.770	CCDS58112.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.14|11.14	1.549835|1.549835	0.27652|0.27652	.|.	.|.	ENSG00000148985|ENSG00000148985	ENST00000464906;ENST00000464441|ENST00000396986;ENST00000300730;ENST00000396991;ENST00000278243;ENST00000463452;ENST00000479072;ENST00000496834;ENST00000469307	.|T;T;T;T;T;T;T;T	.|0.38722	.|1.12;1.12;1.12;1.12;1.12;1.12;1.12;1.12	5.31|5.31	4.33|4.33	0.51752|0.51752	.|.	.|0.735145	.|0.13477	.|N	.|0.385017	T|T	0.19525|0.19525	0.0469|0.0469	N|N	0.08118|0.08118	0|0	0.28474|0.28474	N|N	0.915278|0.915278	.|B;B;B;B;B	.|0.13145	.|0.007;0.001;0.0;0.004;0.001	.|B;B;B;B;B	.|0.10450	.|0.004;0.001;0.005;0.003;0.001	T|T	0.17501|0.17501	-1.0367|-1.0367	5|10	.|0.08599	.|T	.|0.76	-4.0545|-4.0545	8.0241|8.0241	0.30427|0.30427	0.0:0.8896:0.0:0.1104|0.0:0.8896:0.0:0.1104	.|.	.|253;192;40;257;196	.|A8MYS5;Q9UHJ9-3;E9PPF7;Q9UHJ9;Q9UHJ9-2	.|.;.;.;PGAP2_HUMAN;.	W|L	287;68|253;249;257;257;196;36;40;192	.|ENSP00000380183:S253L;ENSP00000300730:S249L;ENSP00000380188:S257L;ENSP00000278243:S257L;ENSP00000435223:S196L;ENSP00000435338:S36L;ENSP00000432721:S40L;ENSP00000434507:S192L	.|ENSP00000278243:S257L	R|S	+|+	1|2	2|0	PGAP2|PGAP2	3802887|3802887	0.021000|0.021000	0.18746|0.18746	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	2.445000|2.445000	0.44899|0.44899	2.768000|2.768000	0.95171|0.95171	0.491000|0.491000	0.48974|0.48974	CGG|TCG	PGAP2	-	pfam_Frag1/DRAM/Sfk1		0.552	PGAP2-049	KNOWN	basic|CCDS	protein_coding	PGAP2	HGNC	protein_coding	OTTHUMT00000383260.1	C			3846311	+1	no_errors	ENST00000278243	ensembl	human	known	70_37	missense	SNP	0.991	T
PRKAA2	5563	genome.wustl.edu	37	1	57173318	57173318	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr1:57173318C>T	ENST00000371244.4	+	9	1657	c.1591C>T	c.(1591-1593)Cgc>Tgc	p.R531C		NM_006252.3	NP_006243.2	P54646	AAPK2_HUMAN	protein kinase, AMP-activated, alpha 2 catalytic subunit	531					autophagy (GO:0006914)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|cellular response to glucose starvation (GO:0042149)|cellular response to nutrient levels (GO:0031669)|cholesterol biosynthetic process (GO:0006695)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|positive regulation of glycolytic process (GO:0045821)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	[acetyl-CoA carboxylase] kinase activity (GO:0050405)|[hydroxymethylglutaryl-CoA reductase (NADPH)] kinase activity (GO:0047322)|AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			breast(6)|endometrium(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|stomach(1)	23					Acetylsalicylic acid(DB00945)	AGTTTCACCTCGCCTGGGCAG	0.443																																																	0													157.0	140.0	146.0					1																	57173318		2203	4300	6503	SO:0001583	missense	5563			BC069823	CCDS605.1	1p31	2011-08-25			ENSG00000162409	ENSG00000162409			9377	protein-coding gene	gene with protein product		600497		PRKAA		7959015	Standard	NM_006252		Approved	AMPK, AMPKa2	uc001cyk.4	P54646	OTTHUMG00000008282	ENST00000371244.4:c.1591C>T	1.37:g.57173318C>T	ENSP00000360290:p.Arg531Cys		Q9H1E8|Q9UD43	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Kinase-assoc_KA1,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R531C	ENST00000371244.4	37	c.1591	CCDS605.1	1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.887719	0.91814	.	.	ENSG00000162409	ENST00000371244	T	0.73897	-0.79	5.99	5.99	0.97316	.	0.050193	0.85682	D	0.000000	T	0.77935	0.4205	L	0.50333	1.59	0.80722	D	1	D	0.67145	0.996	P	0.49361	0.608	T	0.77958	-0.2392	10	0.52906	T	0.07	-14.2262	20.4777	0.99188	0.0:1.0:0.0:0.0	.	531	P54646	AAPK2_HUMAN	C	531	ENSP00000360290:R531C	ENSP00000360290:R531C	R	+	1	0	PRKAA2	56945906	1.000000	0.71417	1.000000	0.80357	0.699000	0.40488	7.487000	0.81328	2.840000	0.97914	0.655000	0.94253	CGC	PRKAA2	-	NULL		0.443	PRKAA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAA2	HGNC	protein_coding	OTTHUMT00000022753.2	C	NM_006252		57173318	+1	no_errors	ENST00000371244	ensembl	human	known	70_37	missense	SNP	1.000	T
POGK	57645	genome.wustl.edu	37	1	166818801	166818801	+	Missense_Mutation	SNP	C	C	A			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr1:166818801C>A	ENST00000367875.1	+	5	1345	c.985C>A	c.(985-987)Cag>Aag	p.Q329K	POGK_ENST00000367876.4_Missense_Mutation_p.Q329K|POGK_ENST00000536514.1_Missense_Mutation_p.Q244K|POGK_ENST00000537173.1_Missense_Mutation_p.Q211K			Q9P215	POGK_HUMAN	pogo transposable element with KRAB domain	329					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	22						GCCCGTGCCCCAGCACCTGCC	0.537																																					GBM(76;192 1530 30153 48742)												0													77.0	80.0	79.0					1																	166818801		2203	4300	6503	SO:0001583	missense	57645			AB040946	CCDS1254.1	1q23.2	2013-01-08			ENSG00000143157	ENSG00000143157		"""-"""	18800	protein-coding gene	gene with protein product	"""KRAB box domain containing 2"""						Standard	NM_017542		Approved	KIAA15131, LST003, BASS2, KRBOX2	uc001gdt.1	Q9P215	OTTHUMG00000034325	ENST00000367875.1:c.985C>A	1.37:g.166818801C>A	ENSP00000356849:p.Gln329Lys		Q5TIJ1|Q8TE07	Missense_Mutation	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_Brinker_DNA-bd,pfam_HTH_CenpB_DNA-bd_dom,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,superfamily_Homeodomain-like,smart_Krueppel-associated_box,smart_HTH_CenpB_DNA-bd_dom,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.Q329K	ENST00000367875.1	37	c.985	CCDS1254.1	1	.	.	.	.	.	.	.	.	.	.	C	18.67	3.673379	0.67928	.	.	ENSG00000143157	ENST00000537173;ENST00000536514;ENST00000367876;ENST00000367875	T;T;T;T	0.32753	1.46;1.44;4.7;4.7	5.5	5.5	0.81552	.	0.000000	0.48286	D	0.000190	T	0.30792	0.0776	N	0.24115	0.695	0.33422	D	0.579952	D;P;P	0.76494	0.999;0.841;0.734	D;P;B	0.70716	0.97;0.448;0.239	T	0.02519	-1.1147	8	.	.	.	-39.1592	16.94	0.86215	0.0:1.0:0.0:0.0	.	211;244;329	G3V1P0;B4DS22;Q9P215	.;.;POGK_HUMAN	K	211;244;329;329	ENSP00000442763:Q211K;ENSP00000441187:Q244K;ENSP00000356850:Q329K;ENSP00000356849:Q329K	.	Q	+	1	0	POGK	165085425	0.999000	0.42202	0.997000	0.53966	0.986000	0.74619	4.489000	0.60309	2.861000	0.98227	0.655000	0.94253	CAG	POGK	-	NULL		0.537	POGK-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	POGK	HGNC	protein_coding	OTTHUMT00000082888.1	C	NM_017542		166818801	+1	no_errors	ENST00000367875	ensembl	human	known	70_37	missense	SNP	1.000	A
PRKCDBP	112464	genome.wustl.edu	37	11	6341326	6341326	+	Missense_Mutation	SNP	G	G	C			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr11:6341326G>C	ENST00000303927.3	-	1	551	c.381C>G	c.(379-381)ttC>ttG	p.F127L	PRKCDBP_ENST00000530979.1_Missense_Mutation_p.F127L	NM_145040.2	NP_659477.2	Q969G5	PRDBP_HUMAN	protein kinase C, delta binding protein	127					cortical actin cytoskeleton organization (GO:0030866)|negative regulation of fermentation (GO:1901003)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	caveola (GO:0005901)|protein complex (GO:0043234)				large_intestine(3)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CACTGACCTTGAAGAGCAGAA	0.692																																																	0													11.0	11.0	11.0					11																	6341326		2168	4244	6412	SO:0001583	missense	112464			AF339881	CCDS7762.1	11p15.4	2011-04-20			ENSG00000170955	ENSG00000170955			9400	protein-coding gene	gene with protein product	"""sdr-related gene product that binds to c-kinase"""					9054438	Standard	NM_145040		Approved	SRBC, HSRBC, MGC20400, cavin-3, CAVIN3	uc001mcu.1	Q969G5	OTTHUMG00000133378	ENST00000303927.3:c.381C>G	11.37:g.6341326G>C	ENSP00000307292:p.Phe127Leu			Missense_Mutation	SNP	NULL	p.F127L	ENST00000303927.3	37	c.381	CCDS7762.1	11	.	.	.	.	.	.	.	.	.	.	G	18.42	3.620221	0.66787	.	.	ENSG00000170955	ENST00000303927;ENST00000530979	T;T	0.63255	-0.03;-0.03	5.53	2.64	0.31445	.	0.178535	0.49305	D	0.000151	T	0.56202	0.1969	M	0.71036	2.16	0.50313	D	0.999864	P	0.37731	0.607	B	0.34652	0.187	T	0.54938	-0.8218	10	0.66056	D	0.02	-9.248	7.9498	0.30008	0.2522:0.0:0.7478:0.0	.	127	Q969G5	PRDBP_HUMAN	L	127	ENSP00000307292:F127L;ENSP00000432047:F127L	ENSP00000307292:F127L	F	-	3	2	PRKCDBP	6297902	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.673000	0.37534	0.300000	0.22699	0.609000	0.83330	TTC	PRKCDBP	-	NULL		0.692	PRKCDBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCDBP	HGNC	protein_coding	OTTHUMT00000257228.2	G	NM_145040		6341326	-1	no_errors	ENST00000303927	ensembl	human	known	70_37	missense	SNP	1.000	C
PSD	5662	genome.wustl.edu	37	10	104176486	104176486	+	Missense_Mutation	SNP	G	G	A			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr10:104176486G>A	ENST00000020673.5	-	2	836	c.310C>T	c.(310-312)Cgc>Tgc	p.R104C	PSD_ENST00000492902.2_5'UTR|PSD_ENST00000406432.1_Missense_Mutation_p.R104C	NM_001270966.1|NM_002779.4	NP_001257895.1|NP_002770.3	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	104	Pro-rich.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		TCCACAAAGCGGAAGATGACC	0.672																																																	0													34.0	42.0	39.0					10																	104176486		2203	4299	6502	SO:0001583	missense	5662			X99688	CCDS31272.1, CCDS73187.1	10q24	2013-01-10	2004-04-28		ENSG00000059915	ENSG00000059915		"""Pleckstrin homology (PH) domain containing"""	9507	protein-coding gene	gene with protein product		602327	"""pleckstrin and Sec7 domain protein"""			9417912	Standard	NM_002779		Approved	KIAA2011, TYL, PSD1	uc009xxd.2	A5PKW4	OTTHUMG00000018954	ENST00000020673.5:c.310C>T	10.37:g.104176486G>A	ENSP00000020673:p.Arg104Cys		B1AKX7|D3DR87|Q15673|Q8IVG0	Missense_Mutation	SNP	pfam_Sec7,pfam_Pleckstrin_homology,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7,prints_PH_dom-spectrin-type	p.R104C	ENST00000020673.5	37	c.310	CCDS31272.1	10	.	.	.	.	.	.	.	.	.	.	G	19.17	3.775895	0.70107	.	.	ENSG00000059915	ENST00000020673;ENST00000406432	T;T	0.28454	1.61;1.61	5.08	5.08	0.68730	.	0.082887	0.47852	D	0.000213	T	0.31513	0.0799	N	0.08118	0	0.42656	D	0.993461	D	0.89917	1.0	P	0.61722	0.893	T	0.35525	-0.9785	10	0.87932	D	0	.	13.1201	0.59321	0.0:0.0:0.8398:0.1602	.	104	A5PKW4	PSD1_HUMAN	C	104	ENSP00000020673:R104C;ENSP00000384830:R104C	ENSP00000020673:R104C	R	-	1	0	PSD	104166476	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.782000	0.62396	2.375000	0.81037	0.561000	0.74099	CGC	PSD	-	NULL		0.672	PSD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PSD	HGNC	protein_coding	OTTHUMT00000050041.2	G			104176486	-1	no_errors	ENST00000020673	ensembl	human	known	70_37	missense	SNP	1.000	A
PWWP2A	114825	genome.wustl.edu	37	5	159520131	159520131	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr5:159520131C>T	ENST00000307063.7	-	2	1560	c.1526G>A	c.(1525-1527)cGc>cAc	p.R509H	PWWP2A_ENST00000523662.1_Missense_Mutation_p.R509H|PWWP2A_ENST00000456329.3_Missense_Mutation_p.R509H	NM_001130864.1	NP_001124336.1	Q96N64	PWP2A_HUMAN	PWWP domain containing 2A	509										kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGAGGTGCAGCGAGACTGGGG	0.512																																																	0													43.0	40.0	41.0					5																	159520131		1963	4156	6119	SO:0001583	missense	114825				CCDS47331.1, CCDS47332.1, CCDS58990.1	5q33.3	2011-03-23			ENSG00000170234	ENSG00000170234			29406	protein-coding gene	gene with protein product							Standard	NM_052927		Approved	KIAA1935	uc011ded.2	Q96N64	OTTHUMG00000163546	ENST00000307063.7:c.1526G>A	5.37:g.159520131C>T	ENSP00000305151:p.Arg509His		G5EA07|Q2HJJ2|Q8IYR3|Q96PV3	Missense_Mutation	SNP	pfam_PWWP,smart_PWWP,pfscan_PWWP	p.R509H	ENST00000307063.7	37	c.1526	CCDS47332.1	5	.	.	.	.	.	.	.	.	.	.	C	16.04	3.008659	0.54361	.	.	ENSG00000170234	ENST00000456329;ENST00000523662;ENST00000307063	T;T;T	0.58797	2.16;1.19;0.31	5.74	4.87	0.63330	.	0.219996	0.49305	N	0.000159	T	0.43809	0.1264	L	0.27053	0.805	0.49130	D	0.999754	B;B;B	0.32800	0.342;0.385;0.385	B;B;B	0.26614	0.018;0.071;0.04	T	0.45071	-0.9286	10	0.54805	T	0.06	-1.1488	14.4852	0.67611	0.0:0.9289:0.0:0.0711	.	509;509;509	Q96N64;G5EA07;Q96N64-2	PWP2A_HUMAN;.;.	H	509	ENSP00000390462:R509H;ENSP00000428143:R509H;ENSP00000305151:R509H	ENSP00000305151:R509H	R	-	2	0	PWWP2A	159452709	1.000000	0.71417	0.992000	0.48379	0.952000	0.60782	5.699000	0.68310	1.561000	0.49584	0.563000	0.77884	CGC	PWWP2A	-	NULL		0.512	PWWP2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PWWP2A	HGNC	protein_coding	OTTHUMT00000374092.1	C			159520131	-1	no_errors	ENST00000307063	ensembl	human	known	70_37	missense	SNP	1.000	T
RHPN2	85415	genome.wustl.edu	37	19	33493743	33493743	+	Silent	SNP	C	C	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr19:33493743C>T	ENST00000254260.3	-	8	959	c.924G>A	c.(922-924)gtG>gtA	p.V308V	RHPN2_ENST00000400226.4_Silent_p.V157V	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	308	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					GAGCCACCTTCACCAGCATGA	0.547																																																	0													53.0	53.0	53.0					19																	33493743		2203	4300	6503	SO:0001819	synonymous_variant	85415			AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.924G>A	19.37:g.33493743C>T			B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Silent	SNP	pfam_BRO1_dom,pfam_HR1_rho-bd,superfamily_HR1_rho-bd,superfamily_PDZ,smart_HR1_rho-bd,smart_PDZ,pfscan_BRO1_dom	p.V308	ENST00000254260.3	37	c.924	CCDS12427.1	19																																																																																			RHPN2	-	pfam_BRO1_dom,pfscan_BRO1_dom		0.547	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHPN2	HGNC	protein_coding	OTTHUMT00000450828.2	C	NM_033103		33493743	-1	no_errors	ENST00000254260	ensembl	human	known	70_37	silent	SNP	0.994	T
RYR2	6262	genome.wustl.edu	37	1	237787089	237787089	+	Missense_Mutation	SNP	G	G	A			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr1:237787089G>A	ENST00000366574.2	+	39	6258	c.5941G>A	c.(5941-5943)Gat>Aat	p.D1981N	RYR2_ENST00000360064.6_Missense_Mutation_p.D1979N|RYR2_ENST00000542537.1_Missense_Mutation_p.D1965N	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1981	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CAATTTTAAGGATGACAAAAG	0.363																																																	0													94.0	91.0	92.0					1																	237787089		1837	4094	5931	SO:0001583	missense	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.5941G>A	1.37:g.237787089G>A	ENSP00000355533:p.Asp1981Asn		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.D1979N	ENST00000366574.2	37	c.5935	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	18.39	3.614094	0.66672	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.72615	-0.67;-0.67;-0.67	5.34	5.34	0.76211	.	0.075917	0.48767	D	0.000166	T	0.51398	0.1672	N	0.10809	0.05	0.80722	D	1	B	0.19073	0.033	B	0.20184	0.028	T	0.47699	-0.9097	10	0.28530	T	0.3	.	12.7761	0.57448	0.0755:0.0:0.9245:0.0	.	1981	Q92736	RYR2_HUMAN	N	1981;1979;1965	ENSP00000355533:D1981N;ENSP00000353174:D1979N;ENSP00000443798:D1965N	ENSP00000353174:D1979N	D	+	1	0	RYR2	235853712	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.814000	0.62627	2.660000	0.90430	0.650000	0.86243	GAT	RYR2	-	NULL		0.363	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	G	NM_001035		237787089	+1	no_errors	ENST00000360064	ensembl	human	known	70_37	missense	SNP	1.000	A
SCPEP1	59342	genome.wustl.edu	37	17	55055543	55055543	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr17:55055543C>T	ENST00000262288.3	+	1	78	c.23C>T	c.(22-24)tCt>tTt	p.S8F	SCPEP1_ENST00000571898.1_3'UTR	NM_021626.2	NP_067639.1	Q9HB40	RISC_HUMAN	serine carboxypeptidase 1	8					negative regulation of blood pressure (GO:0045776)|positive regulation of vasodilation (GO:0045909)|retinoic acid metabolic process (GO:0042573)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	serine-type carboxypeptidase activity (GO:0004185)			endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|skin(2)	14	Breast(9;2.86e-08)					CTGCGGCGCTCTCCCGTCCCG	0.667																																																	0													22.0	17.0	18.0					17																	55055543		2199	4296	6495	SO:0001583	missense	59342			AF282618	CCDS11593.1	17q22	2012-09-20			ENSG00000121064	ENSG00000121064			29507	protein-coding gene	gene with protein product	"""retinoid inducible serine carboxypeptidase"""					11447226, 12975309	Standard	NM_021626		Approved	RISC	uc002iuv.4	Q9HB40	OTTHUMG00000178129	ENST00000262288.3:c.23C>T	17.37:g.55055543C>T	ENSP00000262288:p.Ser8Phe		Q96A94|Q9H3F0	Missense_Mutation	SNP	pfam_Peptidase_S10,prints_Peptidase_S10	p.S8F	ENST00000262288.3	37	c.23	CCDS11593.1	17	.	.	.	.	.	.	.	.	.	.	C	13.43	2.236165	0.39498	.	.	ENSG00000121064	ENST00000262288	T	0.18502	2.21	4.1	-6.06	0.02165	.	2.144350	0.01465	N	0.016056	T	0.09642	0.0237	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.28650	-1.0037	10	0.18276	T	0.48	-0.5992	10.5101	0.44857	0.0:0.6063:0.1683:0.2254	.	8	Q9HB40	RISC_HUMAN	F	8	ENSP00000262288:S8F	ENSP00000262288:S8F	S	+	2	0	SCPEP1	52410542	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.214000	0.02988	-0.655000	0.05387	-0.251000	0.11542	TCT	SCPEP1	-	NULL		0.667	SCPEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCPEP1	HGNC	protein_coding	OTTHUMT00000440622.1	C	NM_021626		55055543	+1	no_errors	ENST00000262288	ensembl	human	known	70_37	missense	SNP	0.000	T
SERPINA10	51156	genome.wustl.edu	37	14	94756352	94756352	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr14:94756352C>T	ENST00000393096.1	-	2	1044	c.579G>A	c.(577-579)atG>atA	p.M193I	SERPINA10_ENST00000554723.1_Missense_Mutation_p.M233I|SERPINA10_ENST00000554173.1_Missense_Mutation_p.M193I|SERPINA10_ENST00000261994.4_Missense_Mutation_p.M193I	NM_016186.2	NP_057270.1	Q9UK55	ZPI_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10	193					blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)			haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	33		all_cancers(154;0.105)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		TGCGAAAATTCATAGGCACGC	0.403																																																	0													91.0	93.0	92.0					14																	94756352		2203	4300	6503	SO:0001583	missense	51156			AF181467	CCDS9923.1	14q32.13	2014-02-18	2005-08-18		ENSG00000140093	ENSG00000140093		"""Serine (or cysteine) peptidase inhibitors"""	15996	protein-coding gene	gene with protein product		605271	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10"""			10460162, 9689066, 24172014	Standard	NM_016186		Approved	PZI, ZPI	uc001yct.3	Q9UK55	OTTHUMG00000171345	ENST00000393096.1:c.579G>A	14.37:g.94756352C>T	ENSP00000376809:p.Met193Ile		A5Z2A5|Q6UWX9|Q86U20	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.M193I	ENST00000393096.1	37	c.579	CCDS9923.1	14	.	.	.	.	.	.	.	.	.	.	C	1.726	-0.495381	0.04291	.	.	ENSG00000140093	ENST00000554723;ENST00000393096;ENST00000261994;ENST00000554173	D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.69	4.59	0.832	0.18867	Serpin domain (3);	0.864377	0.10145	N	0.710393	T	0.52549	0.1741	N	0.00621	-1.32	0.09310	N	0.999999	B	0.06786	0.001	B	0.12156	0.007	T	0.45629	-0.9248	10	0.25751	T	0.34	.	5.5866	0.17277	0.0:0.4866:0.1304:0.3829	.	193	Q9UK55	ZPI_HUMAN	I	233;193;193;193	ENSP00000450896:M233I;ENSP00000376809:M193I;ENSP00000261994:M193I;ENSP00000450971:M193I	ENSP00000261994:M193I	M	-	3	0	SERPINA10	93826105	0.095000	0.21747	0.002000	0.10522	0.159000	0.22180	0.043000	0.13971	-0.139000	0.11414	0.313000	0.20887	ATG	SERPINA10	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.403	SERPINA10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINA10	HGNC	protein_coding	OTTHUMT00000413061.1	C	NM_016186		94756352	-1	no_errors	ENST00000261994	ensembl	human	known	70_37	missense	SNP	0.174	T
SETMAR	6419	genome.wustl.edu	37	3	4345118	4345118	+	Missense_Mutation	SNP	G	G	A			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr3:4345118G>A	ENST00000358065.4	+	1	131	c.64G>A	c.(64-66)Gag>Aag	p.E22K	SETMAR_ENST00000430981.1_Missense_Mutation_p.E22K|SETMAR_ENST00000425863.1_Missense_Mutation_p.E22K|SUMF1_ENST00000534863.1_Intron	NM_006515.3	NP_006506.3	Q53H47	SETMR_HUMAN	SET domain and mariner transposase fusion gene	22	Histone-lysine N-methyltransferase.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA integration (GO:0015074)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of chromosome organization (GO:2001251)|positive regulation of double-strand break repair via nonhomologous end joining (GO:2001034)|transposition, DNA-mediated (GO:0006313)	chromosome (GO:0005694)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|histone-lysine N-methyltransferase activity (GO:0018024)|protein homodimerization activity (GO:0042803)|structure-specific DNA binding (GO:0043566)|transposase activity (GO:0004803)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)	9		Melanoma(143;0.0657)		Epithelial(13;0.0025)|OV - Ovarian serous cystadenocarcinoma(96;0.011)|all cancers(10;0.0114)		GGAGAAGCCTGAGGCCCCGAC	0.677								Chromatin Structure																																									0													35.0	32.0	33.0					3																	4345118		2203	4300	6503	SO:0001583	missense	6419			U80776	CCDS2563.2, CCDS58814.1, CCDS63528.1	3p26.2	2013-01-31			ENSG00000170364	ENSG00000170364			10762	protein-coding gene	gene with protein product		609834				9461395	Standard	NM_006515		Approved	metnase	uc011asp.2	Q53H47	OTTHUMG00000090265	ENST00000358065.4:c.64G>A	3.37:g.4345118G>A	ENSP00000373354:p.Glu22Lys		B4DY74|E7EN68|Q13579|Q1G668|Q96F41	Missense_Mutation	SNP	pfam_Transposase_1,pfam_SET_dom,pfam_Pre-SET_dom,pfam_Transposase_Tc1-like,pfam_Transposase_14,superfamily_Homeodomain-like,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_SET_dom,pfscan_Pre-SET_dom,pfscan_Post-SET_dom	p.E22K	ENST00000358065.4	37	c.64	CCDS2563.2	3	.	.	.	.	.	.	.	.	.	.	G	18.13	3.555076	0.65425	.	.	ENSG00000170364	ENST00000358065;ENST00000430981;ENST00000425863	D;D;T	0.95035	-3.57;-3.59;0.54	5.07	3.19	0.36642	.	.	.	.	.	D	0.91209	0.7230	L	0.56769	1.78	0.09310	N	1	B;B;B	0.26081	0.03;0.141;0.046	B;B;B	0.18263	0.021;0.021;0.007	D	0.85012	0.0906	9	0.59425	D	0.04	.	6.713	0.23288	0.0966:0.1798:0.7236:0.0	.	22;9;22	E7EN68;Q53H47;C9JHK2	.;SETMR_HUMAN;.	K	22	ENSP00000373354:E22K;ENSP00000403000:E22K;ENSP00000403145:E22K	ENSP00000373354:E22K	E	+	1	0	SETMAR	4320118	0.001000	0.12720	0.005000	0.12908	0.273000	0.26683	0.889000	0.28282	1.356000	0.45884	0.591000	0.81541	GAG	SETMAR	-	NULL		0.677	SETMAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETMAR	HGNC	protein_coding	OTTHUMT00000206587.4	G	NM_006515		4345118	+1	no_errors	ENST00000358065	ensembl	human	known	70_37	missense	SNP	0.006	A
SLC6A17	388662	genome.wustl.edu	37	1	110738295	110738295	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr1:110738295C>G	ENST00000331565.4	+	10	2065	c.1580C>G	c.(1579-1581)tCg>tGg	p.S527W		NM_001010898.2	NP_001010898.1	Q9H1V8	S6A17_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 17	527					alanine transport (GO:0032328)|glycine transport (GO:0015816)|leucine transport (GO:0015820)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		GATGACTACTCGGCCACCCTG	0.537																																																	0													104.0	86.0	92.0					1																	110738295		2203	4300	6503	SO:0001583	missense	388662				CCDS30799.1	1p13.2	2013-07-19	2013-07-19		ENSG00000197106	ENSG00000197106		"""Solute carriers"""	31399	protein-coding gene	gene with protein product		610299	"""solute carrier family 6 (neurotransmitter transporter), member 17"", ""solute carrier family 6, member 17"""				Standard	NM_001010898		Approved		uc009wfq.3	Q9H1V8	OTTHUMG00000011761	ENST00000331565.4:c.1580C>G	1.37:g.110738295C>G	ENSP00000330199:p.Ser527Trp		A6NEA8|A8K1R7|B9EIR5|Q5T5Q9	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_orphan	p.S527W	ENST00000331565.4	37	c.1580	CCDS30799.1	1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.600140	0.87055	.	.	ENSG00000197106	ENST00000331565;ENST00000450985	T	0.77489	-1.1	5.65	4.71	0.59529	.	0.123466	0.56097	D	0.000021	D	0.86033	0.5836	M	0.80422	2.495	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88819	0.3297	10	0.87932	D	0	.	16.3653	0.83319	0.0:0.8677:0.1323:0.0	.	527	Q9H1V8	S6A17_HUMAN	W	527	ENSP00000330199:S527W	ENSP00000330199:S527W	S	+	2	0	SLC6A17	110539818	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.715000	0.84713	1.342000	0.45619	0.655000	0.94253	TCG	SLC6A17	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport		0.537	SLC6A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A17	HGNC	protein_coding	OTTHUMT00000032550.2	C	XM_371280		110738295	+1	no_errors	ENST00000331565	ensembl	human	known	70_37	missense	SNP	1.000	G
SLC9A3	6550	genome.wustl.edu	37	5	476352	476353	+	Frame_Shift_Ins	INS	-	-	T	rs532462442|rs2230437	byFrequency	TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr5:476352_476353insT	ENST00000264938.3	-	13	2040_2041	c.2031_2032insA	c.(2029-2034)gcggccfs	p.A678fs	CTD-2228K2.7_ENST00000607286.1_RNA|CTD-2228K2.7_ENST00000607005.1_RNA|CTD-2228K2.7_ENST00000606319.1_RNA|SLC9A3_ENST00000514375.1_Frame_Shift_Ins_p.A669fs|CTD-2228K2.7_ENST00000606288.1_RNA	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3	678					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)	p.A677A(1)		NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			TACAGCTTGGCCGCCTTCTTGT	0.644																																																	1	Substitution - coding silent(1)	prostate(1)																																								SO:0001589	frameshift_variant	6550				CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.2031_2032insA	5.37:g.476352_476353insT	ENSP00000264938:p.Ala678fs		B7ZKR2|E9PF67|Q3MIW3	Frame_Shift_Ins	INS	pfam_Cation/H_exchanger,superfamily_Reg_factor_effector_bac,prints_Na/H_exchanger_3/5,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.A677fs	ENST00000264938.3	37	c.2032_2031	CCDS3855.1	5																																																																																			SLC9A3	-	NULL		0.644	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A3	HGNC	protein_coding	OTTHUMT00000206677.2	-	NM_004174		476353	-1	no_errors	ENST00000264938	ensembl	human	known	70_37	frame_shift_ins	INS	0.042:0.000	T
SLC6A3	6531	genome.wustl.edu	37	5	1422122	1422122	+	Missense_Mutation	SNP	C	C	T	rs138948519		TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr5:1422122C>T	ENST00000270349.9	-	5	788	c.661G>A	c.(661-663)Gtg>Atg	p.V221M	SLC6A3_ENST00000453492.2_Missense_Mutation_p.V221M	NM_001044.4	NP_001035.1	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 3	221					adenohypophysis development (GO:0021984)|aging (GO:0007568)|cation transmembrane transport (GO:0098655)|cell death (GO:0008219)|dopamine biosynthetic process (GO:0042416)|dopamine catabolic process (GO:0042420)|dopamine transport (GO:0015872)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|neurotransmitter biosynthetic process (GO:0042136)|positive regulation of multicellular organism growth (GO:0040018)|prepulse inhibition (GO:0060134)|regulation of dopamine metabolic process (GO:0042053)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|sensory perception of smell (GO:0007608)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine transmembrane transporter activity (GO:0005329)|dopamine:sodium symporter activity (GO:0005330)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)	p.V221M(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(19)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Benzatropine(DB00245)|Benzphetamine(DB00865)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Cocaine(DB00907)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Diphenylpyraline(DB01146)|Dopamine(DB00988)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fencamfamine(DB01463)|Imipramine(DB00458)|Ioflupane I 123(DB08824)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Pethidine(DB00454)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Trimipramine(DB00726)|Venlafaxine(DB00285)	AGGTGCAGCACGCCACGTCTG	0.662																																																	1	Substitution - Missense(1)	pancreas(1)						C	MET/VAL	0,4406		0,0,2203	64.0	62.0	63.0		661	3.5	0.9	5	dbSNP_134	63	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLC6A3	NM_001044.4	21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	221/621	1422122	1,13005	2203	4300	6503	SO:0001583	missense	6531				CCDS3863.1	5p15.3	2013-07-19	2013-07-19		ENSG00000142319	ENSG00000142319		"""Solute carriers"""	11049	protein-coding gene	gene with protein product	"""dopamine transporter"""	126455	"""solute carrier family 6 (neurotransmitter transporter, dopamine), member 3"", ""dopamine transporter 1"""	DAT1		1406597	Standard	NM_001044		Approved	DAT	uc003jck.3	Q01959	OTTHUMG00000131016	ENST00000270349.9:c.661G>A	5.37:g.1422122C>T	ENSP00000270349:p.Val221Met		A2RUN4|Q14996	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_dopamine	p.V221M	ENST00000270349.9	37	c.661	CCDS3863.1	5	.	.	.	.	.	.	.	.	.	.	C	14.90	2.673830	0.47781	0.0	1.16E-4	ENSG00000142319	ENST00000270349;ENST00000453492;ENST00000513308	T;T;T	0.77489	-1.1;-1.1;-1.1	4.4	3.53	0.40419	.	0.220952	0.37530	N	0.002060	D	0.85279	0.5660	M	0.89658	3.05	0.54753	D	0.999989	P	0.47191	0.891	P	0.53006	0.715	D	0.85139	0.0979	10	0.42905	T	0.14	.	10.424	0.44367	0.0:0.9015:0.0:0.0985	.	221	Q01959	SC6A3_HUMAN	M	221;221;147	ENSP00000270349:V221M;ENSP00000399806:V221M;ENSP00000429101:V147M	ENSP00000270349:V221M	V	-	1	0	SLC6A3	1475122	1.000000	0.71417	0.886000	0.34754	0.782000	0.44232	5.434000	0.66526	0.968000	0.38212	0.462000	0.41574	GTG	SLC6A3	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport		0.662	SLC6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A3	HGNC	protein_coding	OTTHUMT00000253650.3	C	NM_001044		1422122	-1	no_errors	ENST00000270349	ensembl	human	known	70_37	missense	SNP	0.998	T
SNX19	399979	genome.wustl.edu	37	11	130775929	130775929	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr11:130775929C>T	ENST00000265909.4	-	7	2931	c.2362G>A	c.(2362-2364)Gaa>Aaa	p.E788K	SNX19_ENST00000534726.1_Missense_Mutation_p.E28K|SNX19_ENST00000545537.1_Missense_Mutation_p.E28K|SNX19_ENST00000533318.1_5'UTR|SNX19_ENST00000539184.1_Missense_Mutation_p.E231K|SNX19_ENST00000533214.1_Missense_Mutation_p.E771K|SNX19_ENST00000528555.1_Missense_Mutation_p.E168K|SNX19_ENST00000530356.1_Missense_Mutation_p.E168K	NM_014758.2	NP_055573	Q92543	SNX19_HUMAN	sorting nexin 19	788					protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(8)|ovary(3)|prostate(1)|skin(6)|urinary_tract(1)	35	all_hematologic(175;0.0597)	Lung NSC(97;0.000272)|all_lung(97;0.000608)|Breast(109;0.000962)|all_neural(223;0.0298)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;0.0195)|Lung(977;0.233)		GGAGGTTGTTCAGGATCTTTT	0.507																																																	0													149.0	130.0	137.0					11																	130775929		2201	4297	6498	SO:0001583	missense	399979			D87443	CCDS31721.1, CCDS73416.1	11q25	2010-04-20			ENSG00000120451	ENSG00000120451		"""Sorting nexins"""	21532	protein-coding gene	gene with protein product							Standard	NM_014758		Approved	KIAA0254, CHET8	uc001qgk.4	Q92543	OTTHUMG00000165663	ENST00000265909.4:c.2362G>A	11.37:g.130775929C>T	ENSP00000265909:p.Glu788Lys		E9PKB9|Q8IV55	Missense_Mutation	SNP	pfam_Phox_assoc,pfam_Sorting_nexin_C,pfam_Phox,superfamily_Phox,smart_PX_assoc_Snx13,smart_Phox,pfscan_Phox,pfscan_Phox_assoc	p.E788K	ENST00000265909.4	37	c.2362	CCDS31721.1	11	.	.	.	.	.	.	.	.	.	.	C	11.58	1.682320	0.29872	.	.	ENSG00000120451	ENST00000265909;ENST00000534726;ENST00000545537;ENST00000528555;ENST00000530356;ENST00000539184;ENST00000533214	T;T;T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72;0.72;0.72	5.39	2.27	0.28462	.	0.852378	0.10920	N	0.619521	T	0.36220	0.0959	L	0.60455	1.87	0.09310	N	1	B;B;B	0.28584	0.216;0.164;0.037	B;B;B	0.23852	0.049;0.027;0.025	T	0.31251	-0.9950	10	0.08599	T	0.76	-0.0087	5.7805	0.18304	0.0:0.5069:0.3149:0.1782	.	231;771;788	F5H5D1;E9PKB9;Q92543	.;.;SNX19_HUMAN	K	788;28;28;168;168;231;771	ENSP00000265909:E788K;ENSP00000433699:E28K;ENSP00000437982:E28K;ENSP00000435122:E168K;ENSP00000432307:E168K;ENSP00000443480:E231K;ENSP00000435390:E771K	ENSP00000265909:E788K	E	-	1	0	SNX19	130281139	0.000000	0.05858	0.001000	0.08648	0.542000	0.35054	0.131000	0.15870	0.177000	0.19895	0.655000	0.94253	GAA	SNX19	-	NULL		0.507	SNX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX19	HGNC	protein_coding	OTTHUMT00000385649.1	C	NM_014758		130775929	-1	no_errors	ENST00000265909	ensembl	human	known	70_37	missense	SNP	0.001	T
SPTAN1	6709	genome.wustl.edu	37	9	131387373	131387373	+	Intron	SNP	G	G	A			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr9:131387373G>A	ENST00000372731.4	+	46	6087				SPTAN1_ENST00000372739.3_Intron|SPTAN1_ENST00000358161.5_Intron	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1						actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						TCCACACTTCGTTTTCTAGGT	0.453																																					NSCLC(120;833 1744 2558 35612 37579)												0													104.0	99.0	101.0					9																	131387373		2203	4300	6503	SO:0001627	intron_variant	6709			M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.5978-9G>A	9.37:g.131387373G>A			Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	RNA	SNP	-	NULL	ENST00000372731.4	37	NULL	CCDS6905.1	9																																																																																			SPTAN1	-	-		0.453	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTAN1	HGNC	protein_coding	OTTHUMT00000054472.1	G	NM_003127		131387373	+1	no_errors	ENST00000491712	ensembl	human	known	70_37	rna	SNP	0.008	A
STK10	6793	genome.wustl.edu	37	5	171491807	171491807	+	Missense_Mutation	SNP	C	C	T	rs371455341		TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr5:171491807C>T	ENST00000176763.5	-	13	2342	c.1999G>A	c.(1999-2001)Gag>Aag	p.E667K		NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	667					cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TTCTCCACCTCGTTCTTCACC	0.557																																																	0								C	LYS/GLU	0,4406		0,0,2203	136.0	119.0	124.0		1999	5.1	0.9	5		124	2,8598	2.2+/-6.3	0,2,4298	no	missense	STK10	NM_005990.3	56	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	667/969	171491807	2,13004	2203	4300	6503	SO:0001583	missense	6793			AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.1999G>A	5.37:g.171491807C>T	ENSP00000176763:p.Glu667Lys		A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Missense_Mutation	SNP	pfam_PKK,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E667K	ENST00000176763.5	37	c.1999	CCDS34290.1	5	.	.	.	.	.	.	.	.	.	.	C	16.64	3.180416	0.57800	0.0	2.33E-4	ENSG00000072786	ENST00000176763;ENST00000545839	T	0.35789	1.29	5.06	5.06	0.68205	.	0.404808	0.26069	N	0.026523	T	0.38188	0.1031	M	0.73217	2.22	0.30291	N	0.790414	B	0.22800	0.075	B	0.20767	0.031	T	0.41016	-0.9532	10	0.48119	T	0.1	.	11.7657	0.51928	0.0:0.822:0.178:0.0	.	667	O94804	STK10_HUMAN	K	667	ENSP00000176763:E667K	ENSP00000176763:E667K	E	-	1	0	STK10	171424412	0.979000	0.34478	0.945000	0.38365	0.949000	0.60115	2.498000	0.45363	2.338000	0.79540	0.650000	0.86243	GAG	STK10	-	pfam_PKK		0.557	STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK10	HGNC	protein_coding	OTTHUMT00000372374.2	C	NM_005990		171491807	-1	no_errors	ENST00000176763	ensembl	human	known	70_37	missense	SNP	0.747	T
STXBP1	6812	genome.wustl.edu	37	9	130427590	130427590	+	Missense_Mutation	SNP	G	G	A			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr9:130427590G>A	ENST00000373299.1	+	8	758	c.643G>A	c.(643-645)Gat>Aat	p.D215N	STXBP1_ENST00000373302.3_Missense_Mutation_p.D215N	NM_001032221.3	NP_001027392.1	P61764	STXB1_HUMAN	syntaxin binding protein 1	215					axon target recognition (GO:0007412)|energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long term synaptic depression (GO:0060292)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|protein stabilization (GO:0050821)|protein transport (GO:0015031)|regulation of insulin secretion (GO:0050796)|regulation of SNARE complex assembly (GO:0035542)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|regulation of synaptic vesicle priming (GO:0010807)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|protein complex (GO:0043234)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|SNARE binding (GO:0000149)|syntaxin binding (GO:0019905)|syntaxin-1 binding (GO:0017075)			breast(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|skin(2)	23						CTATAAAGCTGATGATCCAAC	0.522																																																	0													193.0	153.0	166.0					9																	130427590		2203	4300	6503	SO:0001583	missense	6812			AF004563	CCDS6874.1, CCDS35146.1	9q34.1	2008-07-21			ENSG00000136854	ENSG00000136854			11444	protein-coding gene	gene with protein product	"""syntaxin-binding protein 1"""	602926				9545644	Standard	NM_001032221		Approved	hUNC18, MUNC18-1, UNC18, rbSec1	uc004brk.2	P61764	OTTHUMG00000020713	ENST00000373299.1:c.643G>A	9.37:g.130427590G>A	ENSP00000362396:p.Asp215Asn		B1AM97|Q28208|Q62759|Q64320|Q96TG8	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.D215N	ENST00000373299.1	37	c.643	CCDS35146.1	9	.	.	.	.	.	.	.	.	.	.	G	33	5.203565	0.95033	.	.	ENSG00000136854	ENST00000535154;ENST00000373302;ENST00000373299	T;T	0.76839	-1.05;-1.05	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	D	0.88403	0.6427	M	0.81239	2.535	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.991	D	0.89690	0.3897	10	0.72032	D	0.01	-24.9836	16.5471	0.84449	0.0:0.0:1.0:0.0	.	215;215	P61764;P61764-2	STXB1_HUMAN;.	N	169;215;215	ENSP00000362399:D215N;ENSP00000362396:D215N	ENSP00000362396:D215N	D	+	1	0	STXBP1	129467411	1.000000	0.71417	0.997000	0.53966	0.896000	0.52359	9.200000	0.95010	2.510000	0.84645	0.561000	0.74099	GAT	STXBP1	-	pfam_Sec1-like,superfamily_Sec1-like		0.522	STXBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP1	HGNC	protein_coding	OTTHUMT00000054229.1	G	NM_003165		130427590	+1	no_errors	ENST00000373299	ensembl	human	known	70_37	missense	SNP	1.000	A
TAF4	6874	genome.wustl.edu	37	20	60574120	60574120	+	Silent	SNP	G	G	A			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr20:60574120G>A	ENST00000252996.4	-	12	2831	c.2832C>T	c.(2830-2832)ctC>ctT	p.L944L		NM_003185.3	NP_003176.2	O00268	TAF4_HUMAN	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	944					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			CAAAAAACTTGAGCTGTGCCC	0.493																																																	0													302.0	310.0	307.0					20																	60574120		2203	4300	6503	SO:0001819	synonymous_variant	6874			Y11354	CCDS33500.1	20q13.33	2010-02-26	2002-08-29	2002-01-18	ENSG00000130699	ENSG00000130699			11537	protein-coding gene	gene with protein product		601796	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C1, 130kD"""	TAF4A, TAF2C1, TAF2C		8942982, 9192867	Standard	NM_003185		Approved	TAFII130, TAFII135	uc002ybs.3	O00268	OTTHUMG00000032893	ENST00000252996.4:c.2832C>T	20.37:g.60574120G>A			A6NGD9|Q5TBP6|Q99721|Q9BR40|Q9BX42	Silent	SNP	pfam_TAF4,pfam_TAFH_NHR1,superfamily_Histone-fold,smart_TAFH_NHR1,pfscan_TAFH_NHR1	p.L944	ENST00000252996.4	37	c.2832	CCDS33500.1	20																																																																																			TAF4	-	pfam_TAF4		0.493	TAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF4	HGNC	protein_coding	OTTHUMT00000079968.2	G	NM_003185		60574120	-1	no_errors	ENST00000252996	ensembl	human	known	70_37	silent	SNP	1.000	A
TRPM3	80036	genome.wustl.edu	37	9	73151768	73151768	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr9:73151768C>T	ENST00000377110.3	-	25	4468	c.4225G>A	c.(4225-4227)Gag>Aag	p.E1409K	TRPM3_ENST00000396292.4_Missense_Mutation_p.E1281K|TRPM3_ENST00000377105.1_Missense_Mutation_p.E1268K|TRPM3_ENST00000396280.5_Missense_Mutation_p.E1258K|TRPM3_ENST00000396285.1_Missense_Mutation_p.E1268K|TRPM3_ENST00000408909.2_Missense_Mutation_p.E1268K|TRPM3_ENST00000377111.2_Intron|TRPM3_ENST00000377106.1_Missense_Mutation_p.E1281K|TRPM3_ENST00000357533.2_Missense_Mutation_p.E1413K|TRPM3_ENST00000358082.3_Missense_Mutation_p.E1271K|TRPM3_ENST00000360823.2_Missense_Mutation_p.E1271K|TRPM3_ENST00000423814.3_Missense_Mutation_p.E1436K			Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	1434					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						CAGTGGAGCTCATCCATAGCA	0.512																																																	0													111.0	106.0	108.0					9																	73151768		2203	4300	6503	SO:0001583	missense	80036			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377110.3:c.4225G>A	9.37:g.73151768C>T	ENSP00000366314:p.Glu1409Lys		A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.E1436K	ENST00000377110.3	37	c.4306	CCDS43835.1	9	.	.	.	.	.	.	.	.	.	.	C	18.21	3.574555	0.65878	.	.	ENSG00000083067	ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814	T;T;T;T;T;T;T;T;T;T	0.60548	0.29;0.2;0.2;0.18;0.29;0.18;0.19;0.2;0.2;0.28	6.02	6.02	0.97574	.	0.166180	0.52532	D	0.000067	T	0.47451	0.1446	L	0.27053	0.805	0.47584	D	0.999467	P;B;B;P;B;P;P	0.37330	0.59;0.112;0.421;0.455;0.22;0.59;0.455	B;B;B;B;B;B;B	0.36378	0.223;0.029;0.118;0.111;0.062;0.223;0.111	T	0.33059	-0.9883	10	0.16896	T	0.51	-19.5519	20.5407	0.99260	0.0:1.0:0.0:0.0	.	1409;1399;1413;1271;1268;1381;1268	Q9HCF6-2;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;Q9HCF6-8;A2A3F3	.;.;.;.;.;.;.	K	1409;1281;1271;1268;1413;1268;1268;1281;1271;1436	ENSP00000366314:E1409K;ENSP00000366310:E1281K;ENSP00000354066:E1271K;ENSP00000366309:E1268K;ENSP00000350140:E1413K;ENSP00000386127:E1268K;ENSP00000379581:E1268K;ENSP00000379587:E1281K;ENSP00000350791:E1271K;ENSP00000389542:E1436K	ENSP00000350140:E1413K	E	-	1	0	TRPM3	72341588	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.294000	0.78760	2.865000	0.98341	0.655000	0.94253	GAG	TRPM3	-	NULL		0.512	TRPM3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM3	HGNC	protein_coding	OTTHUMT00000214158.3	C	NM_206945		73151768	-1	no_errors	ENST00000423814	ensembl	human	known	70_37	missense	SNP	1.000	T
TRAF1	7185	genome.wustl.edu	37	9	123676541	123676541	+	Missense_Mutation	SNP	G	G	A			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr9:123676541G>A	ENST00000373887.3	-	4	2711	c.266C>T	c.(265-267)cCc>cTc	p.P89L	TRAF1_ENST00000546084.1_5'UTR|TRAF1_ENST00000540010.1_Missense_Mutation_p.P89L	NM_005658.4	NP_005649.1	Q13077	TRAF1_HUMAN	TNF receptor-associated factor 1	89					apoptotic process (GO:0006915)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein complex assembly (GO:0006461)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(4)|pancreas(1)|skin(2)	22						ACCTGCAAAGGGGCACCCAAT	0.542																																																	0													67.0	66.0	67.0					9																	123676541		2203	4300	6503	SO:0001583	missense	7185			AK090468	CCDS6825.1, CCDS55335.1	9q33-q34	2008-02-05			ENSG00000056558	ENSG00000056558			12031	protein-coding gene	gene with protein product		601711				8069916	Standard	NM_001190945		Approved	EBI6	uc010mvl.2	Q13077	OTTHUMG00000020578	ENST00000373887.3:c.266C>T	9.37:g.123676541G>A	ENSP00000362994:p.Pro89Leu		B4DJ77|Q658U1|Q8NF13	Missense_Mutation	SNP	pfam_MATH,superfamily_TRAF-like,smart_MATH,pirsf_TNF_rcpt--assoc_TRAF,pfscan_MATH	p.P89L	ENST00000373887.3	37	c.266	CCDS6825.1	9	.	.	.	.	.	.	.	.	.	.	G	13.47	2.247753	0.39697	.	.	ENSG00000056558	ENST00000373887;ENST00000540010	T;T	0.33865	1.39;1.39	5.47	5.47	0.80525	.	0.337468	0.25708	N	0.028833	T	0.36880	0.0983	M	0.65498	2.005	0.80722	D	1	B	0.31581	0.329	B	0.25987	0.065	T	0.15549	-1.0433	10	0.35671	T	0.21	-21.1032	14.7972	0.69886	0.0:0.0:1.0:0.0	.	89	Q13077	TRAF1_HUMAN	L	89	ENSP00000362994:P89L;ENSP00000443183:P89L	ENSP00000362994:P89L	P	-	2	0	TRAF1	122716362	1.000000	0.71417	1.000000	0.80357	0.512000	0.34134	2.189000	0.42621	2.557000	0.86248	0.591000	0.81541	CCC	TRAF1	-	superfamily_TRAF-like,pirsf_TNF_rcpt--assoc_TRAF		0.542	TRAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF1	HGNC	protein_coding	OTTHUMT00000053843.1	G	NM_005658		123676541	-1	no_errors	ENST00000373887	ensembl	human	known	70_37	missense	SNP	1.000	A
USP8	9101	genome.wustl.edu	37	15	50785054	50785054	+	Silent	SNP	C	C	T	rs199814360		TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr15:50785054C>T	ENST00000396444.3	+	15	2729	c.2391C>T	c.(2389-2391)aaC>aaT	p.N797N	USP8_ENST00000425032.3_Silent_p.N691N|USP8_ENST00000307179.4_Silent_p.N797N|RP11-562A8.5_ENST00000560159.1_lincRNA|USP8_ENST00000433963.1_Silent_p.N797N	NM_001128610.1|NM_005154.3	NP_001122082.1|NP_005145.3	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	797	USP.				cell proliferation (GO:0008283)|endosome organization (GO:0007032)|mitotic cytokinesis (GO:0000281)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|Ras protein signal transduction (GO:0007265)|ubiquitin-dependent protein catabolic process (GO:0006511)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|midbody (GO:0030496)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		GCCTATGTAACGCTCCACATT	0.363																																																	0													105.0	96.0	99.0					15																	50785054		2196	4293	6489	SO:0001819	synonymous_variant	9101			D29956	CCDS10137.1, CCDS61632.1	15q21.1	2014-03-03	2005-08-08		ENSG00000138592	ENSG00000138592		"""Ubiquitin-specific peptidases"""	12631	protein-coding gene	gene with protein product		603158	"""ubiquitin specific protease 8"""			12838346, 9582025, 24482476	Standard	NM_005154		Approved	HumORF8, KIAA0055, UBPY, SPG59	uc001zyl.4	P40818	OTTHUMG00000131645	ENST00000396444.3:c.2391C>T	15.37:g.50785054C>T			B4DKA8|Q2TB31|Q7Z3U2|Q86VA0|Q8IWI7	Silent	SNP	pfam_Peptidase_C19,pfam_DUF1873,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,superfamily_WW_Rsp5_WWP,pfscan_Rhodanese-like_dom,pfscan_Peptidase_C19	p.N797	ENST00000396444.3	37	c.2391	CCDS10137.1	15																																																																																			USP8	-	pfam_Peptidase_C19,pfscan_Peptidase_C19		0.363	USP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP8	HGNC	protein_coding	OTTHUMT00000254541.1	C	NM_005154		50785054	+1	no_errors	ENST00000307179	ensembl	human	known	70_37	silent	SNP	1.000	T
VPS37A	137492	genome.wustl.edu	37	8	17137456	17137456	+	Intron	SNP	A	A	C			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr8:17137456A>C	ENST00000324849.4	+	7	1387				VPS37A_ENST00000521829.1_Intron	NM_001145152.1|NM_152415.2	NP_001138624.1|NP_689628.2	Q8NEZ2	VP37A_HUMAN	vacuolar protein sorting 37 homolog A (S. cerevisiae)						cell death (GO:0008219)|endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|membrane organization (GO:0061024)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				autonomic_ganglia(1)|breast(1)|kidney(2)|large_intestine(1)|lung(4)|skin(1)	10				Colorectal(111;0.0553)|COAD - Colon adenocarcinoma(73;0.212)		AGTTAACTAAAGCTGAAAAAT	0.299																																																	0																																										SO:0001627	intron_variant	137492				CCDS6001.1, CCDS47811.1	8p22	2012-06-29	2006-04-04		ENSG00000155975	ENSG00000155975			24928	protein-coding gene	gene with protein product	"""hepatocellular carcinoma related protein 1"""	609927	"""vacuolar protein sorting 37A (yeast)"", ""polyglutamine binding protein 2"""	PQBP2		15240819, 15218037, 22717650	Standard	NM_152415		Approved	FLJ32642, HCRP1, SPG53	uc003wxj.3	Q8NEZ2	OTTHUMG00000130785	ENST00000324849.4:c.714-81A>C	8.37:g.17137456A>C			Q336D5|Q6NW27|Q8N3D7|Q8TBL7|Q96DL9	Missense_Mutation	SNP	superfamily_UBQ-conjugating_enzyme/RWD	p.K313N	ENST00000324849.4	37	c.939	CCDS6001.1	8																																																																																			VPS37A	-	NULL		0.299	VPS37A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS37A	HGNC	protein_coding	OTTHUMT00000253301.2	A	NM_152415		17137456	+1	no_errors	ENST00000520140	ensembl	human	known	70_37	missense	SNP	0.248	C
WT1	7490	genome.wustl.edu	37	11	32456360	32456360	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr11:32456360C>T	ENST00000332351.3	-	1	816	c.532G>A	c.(532-534)Ggg>Agg	p.G178R	WT1-AS_ENST00000478367.1_RNA|WT1-AS_ENST00000459866.1_RNA|WT1-AS_ENST00000494911.1_RNA|WT1-AS_ENST00000395900.1_RNA|WT1-AS_ENST00000525436.1_RNA|WT1_ENST00000448076.3_Missense_Mutation_p.G178R	NM_024424.3|NM_024426.4	NP_077742.2|NP_077744	P19544	WT1_HUMAN	Wilms tumor 1	110					adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			CCGAAGGGCCCGTAGCGACAG	0.697			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome																														yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	0													19.0	20.0	19.0					11																	32456360		2197	4295	6492	SO:0001583	missense	7490	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000332351.3:c.532G>A	11.37:g.32456360C>T	ENSP00000331327:p.Gly178Arg		A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Missense_Mutation	SNP	pfam_Wilms_tumour_N,pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2,prints_Wilms_tumour	p.G178R	ENST00000332351.3	37	c.532	CCDS7878.2	11	.	.	.	.	.	.	.	.	.	.	C	21.7	4.188474	0.78789	.	.	ENSG00000184937	ENST00000332351;ENST00000452863;ENST00000448076	D;D;D	0.91577	-2.87;-2.87;-2.87	3.24	2.27	0.28462	Wilm&apos (1);s tumour protein, N-terminal (1);	0.000000	0.64402	U	0.000002	D	0.92792	0.7708	L	0.55213	1.73	0.80722	D	1	D;D;D	0.89917	1.0;0.991;1.0	D;D;D	0.97110	1.0;0.934;0.944	D	0.92008	0.5616	10	0.87932	D	0	.	10.6893	0.45862	0.0:0.8053:0.1947:0.0	.	183;110;183	P19544-8;P19544;P19544-7	.;WT1_HUMAN;.	R	178	ENSP00000331327:G178R;ENSP00000415516:G178R;ENSP00000413452:G178R	ENSP00000331327:G178R	G	-	1	0	WT1	32412936	1.000000	0.71417	0.997000	0.53966	0.920000	0.55202	5.545000	0.67237	0.635000	0.30488	0.462000	0.41574	GGG	WT1	-	pfam_Wilms_tumour_N		0.697	WT1-001	KNOWN	non_ATG_start|basic|CCDS	protein_coding	WT1	HGNC	protein_coding	OTTHUMT00000095436.2	C	NM_000378		32456360	-1	no_errors	ENST00000332351	ensembl	human	known	70_37	missense	SNP	1.000	T
ZNF83	55769	genome.wustl.edu	37	19	53117017	53117017	+	Silent	SNP	T	T	G	rs7248435	byFrequency	TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr19:53117017T>G	ENST00000597597.1	-	2	3054	c.801A>C	c.(799-801)ggA>ggC	p.G267G	ZNF83_ENST00000541777.2_Silent_p.G267G|ZNF83_ENST00000301096.3_Silent_p.G267G|ZNF83_ENST00000601257.1_Intron|ZNF83_ENST00000391789.4_Silent_p.G267G|ZNF83_ENST00000544146.1_Silent_p.G267G|ZNF83_ENST00000600714.1_Intron|ZNF83_ENST00000594682.2_3'UTR|ZNF83_ENST00000545872.1_Silent_p.G267G|ZNF83_ENST00000536937.1_Silent_p.G267G			P51522	ZNF83_HUMAN	zinc finger protein 83	267					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		GGAAGACCTTTCCACATACAT	0.403													T|||	1368	0.273163	0.1649	0.4323	5008	,	,		17989	0.497		0.2137	False		,,,				2504	0.137																0								T	,,,,,,,,	384,4022		38,308,1857	84.0	78.0	80.0		801,801,801,801,801,801,801,801,801	0.5	0.1	19	dbSNP_116	80	907,7693		116,675,3509	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ZNF83	NM_001105549.1,NM_001105550.1,NM_001105551.1,NM_001105552.1,NM_001105553.1,NM_001105554.1,NM_001242531.1,NM_001242538.1,NM_018300.3	,,,,,,,,	154,983,5366	GG,GT,TT		10.5465,8.7154,9.9262	,,,,,,,,	267/517,267/517,267/517,267/517,267/489,267/489,267/489,267/489,267/517	53117017	1291,11715	2203	4300	6503	SO:0001819	synonymous_variant	55769			M27877	CCDS12854.1	19q13.3	2013-01-08	2006-05-12			ENSG00000167766		"""Zinc fingers, C2H2-type"""	13158	protein-coding gene	gene with protein product		194558	"""zinc finger protein 83 (HPF1)"", ""zinc finger protein 816B"""	ZNF816B		8088807	Standard	NM_018300		Approved	FLJ11015, HPF1	uc010epy.3	P51522		ENST00000597597.1:c.801A>C	19.37:g.53117017T>G			A8MT75|Q3ZCX0|Q6PI08	Splice_Site	SNP	-	e1+2	ENST00000597597.1	37	c.799+2	CCDS12854.1	19	.	.	.	.	.	.	.	.	.	.	-	0.039	-1.293052	0.01375	0.087154	0.105465	ENSG00000167766	ENST00000434535	.	.	.	1.64	0.536	0.17138	.	.	.	.	.	.	.	.	.	.	.	0.09310	P	0.9999999999998759	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.1646	0.10300	0.0:0.2128:0.3331:0.4541	rs7248435;rs7248435	.	.	.	.	-1	.	.	.	-	.	.	ZNF83	57808829	0.000000	0.05858	0.070000	0.20053	0.008000	0.06430	-3.515000	0.00445	0.214000	0.20742	-0.811000	0.03165	.	ZNF83	-	-		0.403	ZNF83-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF83	HGNC	protein_coding	OTTHUMT00000463700.1	T	NM_018300		53117017	-1	no_errors	ENST00000434535	ensembl	human	known	70_37	splice_site	SNP	0.946	G
ZRANB2	9406	genome.wustl.edu	37	1	71542532	71542533	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr1:71542532_71542533insT	ENST00000370920.3	-	4	547_548	c.246_247insA	c.(244-249)agatcafs	p.S83fs	ZRANB2_ENST00000254821.6_Frame_Shift_Ins_p.S83fs	NM_203350.2	NP_976225.1	O95218	ZRAB2_HUMAN	zinc finger, RAN-binding domain containing 2	83					mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|ovary(2)|stomach(1)	15						TTACACTCTGATCTTCTGGCCC	0.272																																																	0																																										SO:0001589	frameshift_variant	9406			AF065391	CCDS659.1, CCDS660.1	1p31	2008-02-05	2006-06-28	2006-06-28	ENSG00000132485	ENSG00000132485		"""Zinc fingers, RAN-binding domain containing"""	13058	protein-coding gene	gene with protein product		604347	"""zinc finger protein 265"""	ZNF265		9931435	Standard	NM_005455		Approved	ZIS, ZIS1, ZIS2	uc001dft.3	O95218	OTTHUMG00000009660	ENST00000370920.3:c.247dupA	1.37:g.71542533_71542533dupT	ENSP00000359958:p.Ser83fs		D3DQ75|Q53GS3|Q59F92|Q5VV33|Q5VV34|Q8IXN6|Q9UP63	Frame_Shift_Ins	INS	pfam_Znf_RanBP2,smart_Znf_RanBP2,pirsf_UCP037956_Znf_RanB2,pfscan_Znf_RanBP2	p.S82fs	ENST00000370920.3	37	c.247_246	CCDS659.1	1																																																																																			ZRANB2	-	pfam_Znf_RanBP2,smart_Znf_RanBP2,pirsf_UCP037956_Znf_RanB2,pfscan_Znf_RanBP2		0.272	ZRANB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZRANB2	HGNC	protein_coding	OTTHUMT00000026636.1	-	NM_203350		71542533	-1	no_errors	ENST00000370920	ensembl	human	known	70_37	frame_shift_ins	INS	1.000:1.000	T
ZRANB2	9406	genome.wustl.edu	37	1	71542534	71542534	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KH-01A-21D-A22X-09	TCGA-DG-A2KH-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f012de18-28d4-4214-a883-8b0a74c598a0	cb6f6e3d-2272-47da-98ad-6bfe2ee8e25e	g.chr1:71542534C>T	ENST00000370920.3	-	4	546	c.245G>A	c.(244-246)aGa>aAa	p.R82K	ZRANB2_ENST00000254821.6_Missense_Mutation_p.R82K	NM_203350.2	NP_976225.1	O95218	ZRAB2_HUMAN	zinc finger, RAN-binding domain containing 2	82					mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|ovary(2)|stomach(1)	15						ACACTCTGATCTTCTGGCCCA	0.269																																																	0													111.0	114.0	113.0					1																	71542534		2202	4297	6499	SO:0001583	missense	9406			AF065391	CCDS659.1, CCDS660.1	1p31	2008-02-05	2006-06-28	2006-06-28	ENSG00000132485	ENSG00000132485		"""Zinc fingers, RAN-binding domain containing"""	13058	protein-coding gene	gene with protein product		604347	"""zinc finger protein 265"""	ZNF265		9931435	Standard	NM_005455		Approved	ZIS, ZIS1, ZIS2	uc001dft.3	O95218	OTTHUMG00000009660	ENST00000370920.3:c.245G>A	1.37:g.71542534C>T	ENSP00000359958:p.Arg82Lys		D3DQ75|Q53GS3|Q59F92|Q5VV33|Q5VV34|Q8IXN6|Q9UP63	Missense_Mutation	SNP	pfam_Znf_RanBP2,smart_Znf_RanBP2,pirsf_UCP037956_Znf_RanB2,pfscan_Znf_RanBP2	p.R82K	ENST00000370920.3	37	c.245	CCDS659.1	1	.	.	.	.	.	.	.	.	.	.	C	19.26	3.792649	0.70452	.	.	ENSG00000132485	ENST00000370920;ENST00000254821	D;D	0.82167	-1.58;-1.58	5.27	4.35	0.52113	Zinc finger, RanBP2-type (4);	0.000000	0.85682	D	0.000000	D	0.92293	0.7555	H	0.95745	3.715	0.58432	D	0.999998	B;D	0.76494	0.041;0.999	B;D	0.76071	0.065;0.987	D	0.94421	0.7641	10	0.72032	D	0.01	.	14.8431	0.70240	0.1452:0.8548:0.0:0.0	.	82;82	O95218;O95218-2	ZRAB2_HUMAN;.	K	82	ENSP00000359958:R82K;ENSP00000254821:R82K	ENSP00000254821:R82K	R	-	2	0	ZRANB2	71315122	1.000000	0.71417	1.000000	0.80357	0.424000	0.31475	7.439000	0.80444	1.210000	0.43336	-0.518000	0.04402	AGA	ZRANB2	-	pfam_Znf_RanBP2,smart_Znf_RanBP2,pirsf_UCP037956_Znf_RanB2,pfscan_Znf_RanBP2		0.269	ZRANB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZRANB2	HGNC	protein_coding	OTTHUMT00000026636.1	C	NM_203350		71542534	-1	no_errors	ENST00000370920	ensembl	human	known	70_37	missense	SNP	1.000	T
