#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ADAM32	203102	genome.wustl.edu	37	8	38965217	38965217	+	5'UTR	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr8:38965217C>G	ENST00000379907.4	+	0	50				ADAM32_ENST00000519315.1_5'UTR|ADAM32_ENST00000437682.2_Silent_p.P8P	NM_145004.5	NP_659441	Q8TC27	ADA32_HUMAN	ADAM metallopeptidase domain 32							integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	31		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			GAGCGGCCCCCGGCGTCCGCG	0.706																																																	0																																										SO:0001623	5_prime_UTR_variant	203102			BC026085	CCDS47846.1	8p11.22	2005-08-18	2005-08-18		ENSG00000197140	ENSG00000197140		"""ADAM metallopeptidase domain containing"""	15479	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 32"""			12568724	Standard	NM_145004		Approved		uc003xmt.4	Q8TC27	OTTHUMG00000164071	ENST00000379907.4:c.-78C>G	8.37:g.38965217C>G			Q8TC42	Silent	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B	p.P8	ENST00000379907.4	37	c.24	CCDS47846.1	8																																																																																			ADAM32	-	NULL		0.706	ADAM32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM32	HGNC	protein_coding	OTTHUMT00000377089.1	C	NM_145004		38965217	+1	no_errors	ENST00000437682	ensembl	human	putative	70_37	silent	SNP	0.008	G
AGRN	375790	genome.wustl.edu	37	1	983046	983046	+	Missense_Mutation	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr1:983046G>C	ENST00000379370.2	+	21	3660	c.3610G>C	c.(3610-3612)Gtg>Ctg	p.V1204L		NM_198576.3	NP_940978.2	O00468	AGRIN_HUMAN	agrin	1204	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|clustering of voltage-gated sodium channels (GO:0045162)|extracellular matrix organization (GO:0030198)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuromuscular junction development (GO:0007528)|neurotransmitter receptor metabolic process (GO:0045213)|phototransduction, visible light (GO:0007603)|plasma membrane organization (GO:0007009)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of synaptic growth at neuromuscular junction (GO:0045887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor clustering (GO:0043113)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synapse organization (GO:0050808)	basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acetylcholine receptor regulator activity (GO:0030548)|calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|dystroglycan binding (GO:0002162)|heparan sulfate proteoglycan binding (GO:0043395)|laminin binding (GO:0043236)|sialic acid binding (GO:0033691)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	42	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		CCGCGCCATTGTGGATGTGCA	0.622																																																	0													48.0	52.0	51.0					1																	983046		2203	4300	6503	SO:0001583	missense	375790			XM_372195	CCDS30551.1	1p36.33	2014-09-17		2007-02-16	ENSG00000188157	ENSG00000188157		"""Proteoglycans / Extracellular Matrix : Other"""	329	protein-coding gene	gene with protein product	"""agrin proteoglycan"""	103320				1851019, 12270958	Standard	NM_198576		Approved	AGRIN	uc001ack.2	O00468	OTTHUMG00000040778	ENST00000379370.2:c.3610G>C	1.37:g.983046G>C	ENSP00000368678:p.Val1204Leu		Q5SVA1|Q5SVA2|Q60FE1|Q7KYS8|Q8N4J5|Q96IC1|Q9BTD4	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Agrin_NtA,pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,pfam_EGF_laminin,pfam_SEA,pfam_EG-like_dom,superfamily_TIMP-like_OB-fold,superfamily_ConA-like_lec_gl_sf,smart_FacI_MAC,smart_Fol_N,smart_Prot_inh_Kazal,smart_EG-like_dom,smart_EGF_laminin,smart_SEA,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Agrin_NtA,pfscan_SEA	p.V1204L	ENST00000379370.2	37	c.3610	CCDS30551.1	1	.	.	.	.	.	.	.	.	.	.	G	14.43	2.532152	0.45073	.	.	ENSG00000188157	ENST00000379370	T	0.38401	1.14	3.86	3.86	0.44501	SEA (3);	0.000000	0.56097	U	0.000033	T	0.35770	0.0943	L	0.29908	0.895	0.48830	D	0.999715	P	0.46395	0.877	P	0.51615	0.675	T	0.03969	-1.0988	10	0.30854	T	0.27	-21.7476	12.0411	0.53454	0.0883:0.0:0.9117:0.0	.	1204	O00468	AGRIN_HUMAN	L	1204	ENSP00000368678:V1204L	ENSP00000368678:V1204L	V	+	1	0	AGRN	972909	1.000000	0.71417	0.997000	0.53966	0.715000	0.41141	3.150000	0.50662	2.183000	0.69458	0.550000	0.68814	GTG	AGRN	-	pfam_SEA,smart_SEA,pfscan_SEA		0.622	AGRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGRN	HGNC	protein_coding	OTTHUMT00000097990.2	G	NM_198576		983046	+1	no_errors	ENST00000379370	ensembl	human	known	70_37	missense	SNP	1.000	C
ALDH1A1	216	genome.wustl.edu	37	9	75516138	75516138	+	Missense_Mutation	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr9:75516138G>C	ENST00000297785.3	-	13	1546	c.1492C>G	c.(1492-1494)Cag>Gag	p.Q498E		NM_000689.4	NP_000680.2	P00352	AL1A1_HUMAN	aldehyde dehydrogenase 1 family, member A1	498					cellular aldehyde metabolic process (GO:0006081)|ethanol oxidation (GO:0006069)|positive regulation of Ras GTPase activity (GO:0032320)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|androgen binding (GO:0005497)|Ras GTPase activator activity (GO:0005099)|retinal dehydrogenase activity (GO:0001758)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)	17					Tretinoin(DB00755)|Vitamin A(DB00162)	GAGTTCTTCTGAGAGATTTTC	0.358																																																	0													130.0	123.0	126.0					9																	75516138		2202	4300	6502	SO:0001583	missense	216			K03000	CCDS6644.1	9q21.13	2010-08-05			ENSG00000165092	ENSG00000165092	1.2.1.36, 1.2.1.3	"""Aldehyde dehydrogenases"""	402	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 1"""	100640		PUMB1, ALDH1		1709013	Standard	NM_000689		Approved	RALDH1	uc004ajd.3	P00352	OTTHUMG00000020019	ENST00000297785.3:c.1492C>G	9.37:g.75516138G>C	ENSP00000297785:p.Gln498Glu		O00768|Q5SYR1	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,pfam_Acyl-CoA_reduct_LuxC,superfamily_Ald_DH/histidinol_DH	p.Q498E	ENST00000297785.3	37	c.1492	CCDS6644.1	9	.	.	.	.	.	.	.	.	.	.	G	11.46	1.644952	0.29246	.	.	ENSG00000165092	ENST00000297785	T	0.74421	-0.84	5.64	3.72	0.42706	Aldehyde/histidinol dehydrogenase (1);	0.171047	0.40908	D	0.000981	T	0.51500	0.1678	N	0.02247	-0.625	0.80722	D	1	B	0.09022	0.002	B	0.04013	0.001	T	0.43540	-0.9385	10	0.29301	T	0.29	.	17.4209	0.87515	0.0:0.2817:0.7182:0.0	.	498	P00352	AL1A1_HUMAN	E	498	ENSP00000297785:Q498E	ENSP00000297785:Q498E	Q	-	1	0	ALDH1A1	74705958	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	1.417000	0.34770	1.334000	0.45468	0.650000	0.86243	CAG	ALDH1A1	-	superfamily_Ald_DH/histidinol_DH		0.358	ALDH1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1A1	HGNC	protein_coding	OTTHUMT00000052679.1	G			75516138	-1	no_errors	ENST00000297785	ensembl	human	known	70_37	missense	SNP	0.992	C
ALPK2	115701	genome.wustl.edu	37	18	56203560	56203560	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr18:56203560C>T	ENST00000361673.3	-	5	4072	c.3859G>A	c.(3859-3861)Gaa>Aaa	p.E1287K	RP11-1151B14.4_ENST00000591360.1_RNA	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	1287						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.E1287Q(1)|p.E648Q(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						GGGGCCAATTCAGGCACAACA	0.507																																																	2	Substitution - Missense(2)	lung(2)											132.0	121.0	125.0					18																	56203560		2203	4300	6503	SO:0001583	missense	115701			AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.3859G>A	18.37:g.56203560C>T	ENSP00000354991:p.Glu1287Lys		Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase,pfscan_Ig-like	p.E1287K	ENST00000361673.3	37	c.3859	CCDS11966.2	18	.	.	.	.	.	.	.	.	.	.	C	13.95	2.389563	0.42410	.	.	ENSG00000198796	ENST00000361673	T	0.51071	0.72	5.39	2.2	0.27929	.	1.605380	0.03420	N	0.206117	T	0.41766	0.1173	L	0.38838	1.175	0.09310	N	1	P;B	0.40107	0.703;0.227	B;B	0.40101	0.319;0.034	T	0.31251	-0.9950	10	0.28530	T	0.3	-8.9077	8.3813	0.32472	0.0:0.7287:0.0:0.2713	.	1282;1287	Q86TB3-2;Q86TB3	.;ALPK2_HUMAN	K	1287	ENSP00000354991:E1287K	ENSP00000354991:E1287K	E	-	1	0	ALPK2	54354540	0.000000	0.05858	0.004000	0.12327	0.012000	0.07955	0.021000	0.13489	0.658000	0.30925	0.462000	0.41574	GAA	ALPK2	-	NULL		0.507	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK2	HGNC	protein_coding	OTTHUMT00000256126.1	C	NM_052947		56203560	-1	no_errors	ENST00000361673	ensembl	human	known	70_37	missense	SNP	0.002	T
ALS2CR11	151254	genome.wustl.edu	37	2	202483811	202483811	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr2:202483811C>G	ENST00000286195.3	-	1	87	c.43G>C	c.(43-45)Gat>Cat	p.D15H	ALS2CR11_ENST00000439802.1_Missense_Mutation_p.D15H|ALS2CR11_ENST00000450242.1_Missense_Mutation_p.D15H|ALS2CR11_ENST00000439140.1_Missense_Mutation_p.D15H	NM_152525.5	NP_689738.3	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11	15										NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(11)|ovary(1)|skin(5)|urinary_tract(3)	33						CTGCGGTTATCAAGTGTGCTG	0.607																																																	0													110.0	102.0	105.0					2																	202483811		2203	4300	6503	SO:0001583	missense	151254			AB053313	CCDS2349.1, CCDS54430.1, CCDS54428.1, CCDS54429.1	2q33	2007-12-07			ENSG00000155754	ENSG00000155754			14438	protein-coding gene	gene with protein product						11586298	Standard	NM_152525		Approved	FLJ25351	uc002uyf.3	Q53TS8	OTTHUMG00000132830	ENST00000286195.3:c.43G>C	2.37:g.202483811C>G	ENSP00000286195:p.Asp15His		C9IZH7|E9PGG4|Q8NCN6|Q96LN4	Missense_Mutation	SNP	superfamily_C2_Ca/lipid-bd_dom_CaLB	p.D15H	ENST00000286195.3	37	c.43	CCDS2349.1	2	.	.	.	.	.	.	.	.	.	.	C	12.55	1.971881	0.34754	.	.	ENSG00000155754	ENST00000286195;ENST00000439802;ENST00000439140;ENST00000450242	T;T;T;T	0.53206	0.64;0.63;0.63;0.63	3.34	1.51	0.23008	.	1.411910	0.04998	N	0.468587	T	0.42063	0.1186	L	0.51422	1.61	0.09310	N	1	B;B;B	0.21452	0.02;0.056;0.056	B;B;B	0.17979	0.011;0.02;0.02	T	0.37384	-0.9708	10	0.66056	D	0.02	.	4.8097	0.13337	0.0:0.6559:0.2208:0.1233	.	15;15;15	Q53TS8-2;E9PGG4;Q53TS8	.;.;AL2SA_HUMAN	H	15	ENSP00000286195:D15H;ENSP00000400672:D15H;ENSP00000409937:D15H;ENSP00000399016:D15H	ENSP00000286195:D15H	D	-	1	0	ALS2CR11	202192056	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	0.467000	0.22035	0.424000	0.26061	0.563000	0.77884	GAT	ALS2CR11	-	NULL		0.607	ALS2CR11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ALS2CR11	HGNC	protein_coding	OTTHUMT00000256296.2	C	NM_152525		202483811	-1	no_errors	ENST00000286195	ensembl	human	known	70_37	missense	SNP	0.000	G
AMOTL2	51421	genome.wustl.edu	37	3	134077427	134077427	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr3:134077427C>G	ENST00000422605.2	-	9	2402	c.2236G>C	c.(2236-2238)Gac>Cac	p.D746H	RPL39P5_ENST00000273411.2_RNA|AMOTL2_ENST00000514516.1_Missense_Mutation_p.D804H|AMOTL2_ENST00000249883.5_Missense_Mutation_p.D747H|AMOTL2_ENST00000513145.1_Missense_Mutation_p.D744H			Q9Y2J4	AMOL2_HUMAN	angiomotin like 2	746					hippo signaling (GO:0035329)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|tight junction (GO:0005923)				endometrium(8)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	19						AGAAGGCTGTCAGGCTCCGGT	0.657											OREG0015814	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													38.0	38.0	38.0					3																	134077427		2203	4300	6503	SO:0001583	missense	51421			AF175966	CCDS33860.1, CCDS63783.1, CCDS63784.1	3q21-q22	2008-07-18			ENSG00000114019	ENSG00000114019			17812	protein-coding gene	gene with protein product	"""Leman coiled-coil protein"", ""angiomotin-like protein 2"""	614658					Standard	NM_016201		Approved	LCCP	uc003eqg.1	Q9Y2J4	OTTHUMG00000159777	ENST00000422605.2:c.2236G>C	3.37:g.134077427C>G	ENSP00000409999:p.Asp746His	1607	A8K6F1|B7Z5Q1|E9PHW3|Q53EP1|Q96F99|Q9UKB4	Missense_Mutation	SNP	pfam_Angiomotin_C,prints_Angiomotin	p.D747H	ENST00000422605.2	37	c.2239		3	.	.	.	.	.	.	.	.	.	.	C	13.73	2.323696	0.41096	.	.	ENSG00000114019	ENST00000249883;ENST00000422605;ENST00000514516;ENST00000513145	T;T;T;T	0.18174	2.24;2.24;2.23;2.24	5.37	3.46	0.39613	.	0.911667	0.09551	N	0.786973	T	0.19725	0.0474	L	0.44542	1.39	0.09310	N	1	P;P;P	0.50617	0.899;0.899;0.937	P;P;P	0.48141	0.568;0.568;0.501	T	0.13045	-1.0524	10	0.49607	T	0.09	-23.2987	6.1443	0.20276	0.0:0.677:0.1561:0.1669	.	744;747;804	Q9Y2J4-3;Q9Y2J4-2;E9PHW3	.;.;.	H	747;746;804;744	ENSP00000249883:D747H;ENSP00000409999:D746H;ENSP00000424765:D804H;ENSP00000425475:D744H	ENSP00000249883:D747H	D	-	1	0	AMOTL2	135560117	0.767000	0.28508	0.820000	0.32676	0.476000	0.33039	1.399000	0.34566	1.262000	0.44165	0.655000	0.94253	GAC	AMOTL2	-	NULL		0.657	AMOTL2-014	KNOWN	basic|appris_candidate_longest	protein_coding	AMOTL2	HGNC	protein_coding	OTTHUMT00000358149.1	C	NM_016201		134077427	-1	no_errors	ENST00000249883	ensembl	human	known	70_37	missense	SNP	0.069	G
ANKRD30BL	554226	genome.wustl.edu	37	2	133015216	133015216	+	5'UTR	SNP	C	C	G	rs375798512		TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr2:133015216C>G	ENST00000470729.1	-	0	326				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						AGGCACACCTCTCAGATCGCT	0.667																																																	0																																										SO:0001623	5_prime_UTR_variant	554226					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.-1099G>C	2.37:g.133015216C>G			B8ZZL7	RNA	SNP	-	NULL	ENST00000470729.1	37	NULL		2																																																																																			ANKRD30BL	-	-		0.667	ANKRD30BL-002	KNOWN	basic	processed_transcript	ANKRD30BL	HGNC	protein_coding	OTTHUMT00000331354.1	C	NR_027019		133015216	-1	no_errors	ENST00000470729	ensembl	human	known	70_37	rna	SNP	0.884	G
ANKRD31	256006	genome.wustl.edu	37	5	74491918	74491918	+	Silent	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr5:74491918C>T	ENST00000274361.3	-	7	746	c.555G>A	c.(553-555)gaG>gaA	p.E185E	ANKRD31_ENST00000506364.2_Silent_p.E185E	NM_001164443.1	NP_001157915.1	Q8N7Z5	ANR31_HUMAN	ankyrin repeat domain 31	185										endometrium(1)|kidney(4)	5						CTAAAATCTTCTCTGGCTCTA	0.403																																																	0													95.0	80.0	85.0					5																	74491918		692	1591	2283	SO:0001819	synonymous_variant	256006			AK097510	CCDS47233.1	5q13.3	2013-01-10			ENSG00000145700	ENSG00000145700		"""Ankyrin repeat domain containing"""	26853	protein-coding gene	gene with protein product							Standard	NM_001164443		Approved	FLJ40191	uc003kdo.2	Q8N7Z5	OTTHUMG00000162649	ENST00000274361.3:c.555G>A	5.37:g.74491918C>T				Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E185	ENST00000274361.3	37	c.555		5																																																																																			ANKRD31	-	NULL		0.403	ANKRD31-201	KNOWN	basic|appris_principal	protein_coding	ANKRD31	HGNC	protein_coding		C	NM_001164443		74491918	-1	no_errors	ENST00000274361	ensembl	human	known	70_37	silent	SNP	0.354	T
ARAP3	64411	genome.wustl.edu	37	5	141035268	141035268	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr5:141035268G>A	ENST00000239440.4	-	31	4095	c.4030C>T	c.(4030-4032)Cag>Tag	p.Q1344*	ARAP3_ENST00000513878.1_Nonsense_Mutation_p.Q1006*|ARAP3_ENST00000508305.1_Nonsense_Mutation_p.Q1175*|ARAP3_ENST00000512390.1_5'UTR	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	1344					cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						CCAAACTTCTGACGGGCAAGG	0.602																																																	0													92.0	84.0	87.0					5																	141035268		2203	4300	6503	SO:0001587	stop_gained	64411			AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.4030C>T	5.37:g.141035268G>A	ENSP00000239440:p.Gln1344*		B4DIT1|D3DQE3	Nonsense_Mutation	SNP	pfam_RhoGAP_dom,pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ras-assoc,pfam_SAM_2,pfam_SAM_type1,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.Q1344*	ENST00000239440.4	37	c.4030	CCDS4266.1	5	.	.	.	.	.	.	.	.	.	.	G	43	10.278728	0.99373	.	.	ENSG00000120318	ENST00000508305;ENST00000239440;ENST00000513878	.	.	.	5.66	5.66	0.87406	.	0.055370	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	19.3334	0.94303	0.0:0.0:1.0:0.0	.	.	.	.	X	1175;1344;1006	.	ENSP00000239440:Q1344X	Q	-	1	0	ARAP3	141015452	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.172000	0.94808	2.675000	0.91044	0.655000	0.94253	CAG	ARAP3	-	NULL		0.602	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP3	HGNC	protein_coding	OTTHUMT00000251805.1	G	NM_022481		141035268	-1	no_errors	ENST00000239440	ensembl	human	known	70_37	nonsense	SNP	1.000	A
ATP10A	57194	genome.wustl.edu	37	15	25932912	25932912	+	Missense_Mutation	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr15:25932912G>A	ENST00000356865.6	-	16	3340	c.3229C>T	c.(3229-3231)Cac>Tac	p.H1077Y		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1077					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		CAATGCCCGTGAAGAATCAAG	0.493																																																	0													159.0	147.0	151.0					15																	25932912		2203	4300	6503	SO:0001583	missense	57194			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.3229C>T	15.37:g.25932912G>A	ENSP00000349325:p.His1077Tyr		Q4G0S9|Q969I4	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.H1077Y	ENST00000356865.6	37	c.3229	CCDS32178.1	15	.	.	.	.	.	.	.	.	.	.	G	19.17	3.775457	0.70107	.	.	ENSG00000206190	ENST00000356865;ENST00000555756	T;T	0.74842	-0.88;-0.88	5.52	5.52	0.82312	HAD-like domain (1);	0.000000	0.85682	D	0.000000	D	0.91205	0.7229	H	0.96301	3.8	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93623	0.6949	10	0.87932	D	0	-37.1126	19.4602	0.94914	0.0:0.0:1.0:0.0	.	1077	O60312	AT10A_HUMAN	Y	1077;106	ENSP00000349325:H1077Y;ENSP00000451615:H106Y	ENSP00000349325:H1077Y	H	-	1	0	ATP10A	23484005	1.000000	0.71417	0.712000	0.30502	0.253000	0.25986	9.539000	0.98076	2.590000	0.87494	0.655000	0.94253	CAC	ATP10A	-	tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr		0.493	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10A	HGNC	protein_coding	OTTHUMT00000414830.1	G	NM_024490		25932912	-1	no_errors	ENST00000356865	ensembl	human	known	70_37	missense	SNP	1.000	A
B4GALT4	8702	genome.wustl.edu	37	3	118945761	118945761	+	Silent	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr3:118945761G>A	ENST00000483209.1	-	4	1022	c.381C>T	c.(379-381)ctC>ctT	p.L127L	B4GALT4-AS1_ENST00000470790.1_RNA|B4GALT4_ENST00000467604.1_Silent_p.L127L|B4GALT4_ENST00000359213.3_Silent_p.L127L|B4GALT4_ENST00000460321.1_5'UTR|B4GALT4_ENST00000393765.2_Silent_p.L127L|B4GALT4_ENST00000471675.1_Intron			O60513	B4GT4_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4	127					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|membrane lipid metabolic process (GO:0006643)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)|N-acetyllactosamine synthase activity (GO:0003945)			breast(2)|endometrium(1)|large_intestine(1)|lung(6)|skin(2)|stomach(2)	14				GBM - Glioblastoma multiforme(114;0.222)	N-Acetyl-D-glucosamine(DB00141)	GGTGGGGAACGAGGATGGCGA	0.527																																																	0													125.0	100.0	109.0					3																	118945761		2203	4300	6503	SO:0001819	synonymous_variant	8702			AF022367	CCDS2986.1	3q13.3	2013-02-19			ENSG00000121578	ENSG00000121578		"""Beta 4-glycosyltransferases"""	927	protein-coding gene	gene with protein product		604015				9597550	Standard	NM_003778		Approved	beta4Gal-T4	uc003eci.3	O60513	OTTHUMG00000159358	ENST00000483209.1:c.381C>T	3.37:g.118945761G>A			Q68D68|Q9BSW3|Q9C078	Silent	SNP	pfam_Galactosyl_T_2_met,prints_Galactosyl_T_2_met	p.L127	ENST00000483209.1	37	c.381	CCDS2986.1	3																																																																																			B4GALT4	-	pfam_Galactosyl_T_2_met		0.527	B4GALT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALT4	HGNC	protein_coding	OTTHUMT00000354925.2	G	NM_003778		118945761	-1	no_errors	ENST00000359213	ensembl	human	known	70_37	silent	SNP	1.000	A
BORA	79866	genome.wustl.edu	37	13	73312182	73312182	+	Splice_Site	SNP	G	G	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr13:73312182G>T	ENST00000390667.5	+	5	485		c.e5+1		BORA_ENST00000464754.1_Splice_Site|BORA_ENST00000377815.3_Splice_Site	NM_024808.2	NP_079084.2	Q6PGQ7	BORA_HUMAN	bora, aurora kinase A activator						G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of mitosis (GO:0007088)|regulation of mitotic spindle organization (GO:0060236)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)	protein kinase binding (GO:0019901)										TCCAGTAAATGTGAGTGTACT	0.343																																																	0													106.0	96.0	99.0					13																	73312182		1826	4081	5907	SO:0001630	splice_region_variant	79866			BC025367	CCDS9446.1, CCDS66560.1, CCDS9446.2, CCDS73583.1	13q22.1	2013-08-13	2011-08-09	2011-08-09	ENSG00000136122	ENSG00000136122			24724	protein-coding gene	gene with protein product		610510	"""chromosome 13 open reading frame 34"""	C13orf34		16890155, 18378770, 18566290, 19487276	Standard	NM_001286746		Approved	FLJ22624	uc001viv.1	Q6PGQ7	OTTHUMG00000017068	ENST00000390667.5:c.388+1G>T	13.37:g.73312182G>T			B4DQ30|Q5W0P3|Q5W0P4|Q86YC6|Q96IW9|Q9H640	Splice_Site	SNP	-	e4+1	ENST00000390667.5	37	c.388+1	CCDS9446.1	13	.	.	.	.	.	.	.	.	.	.	G	18.68	3.676668	0.67928	.	.	ENSG00000136122	ENST00000377814;ENST00000377815;ENST00000390667	.	.	.	5.91	5.05	0.67936	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4808	0.75524	0.0671:0.0:0.9329:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BORA	72210183	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	5.384000	0.66225	2.793000	0.96121	0.655000	0.94253	.	BORA	-	-		0.343	BORA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BORA	HGNC	protein_coding	OTTHUMT00000045245.3	G	NM_024808	Intron	73312182	+1	no_errors	ENST00000390667	ensembl	human	known	70_37	splice_site	SNP	1.000	T
BTAF1	9044	genome.wustl.edu	37	10	93773678	93773678	+	Silent	SNP	G	G	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr10:93773678G>T	ENST00000265990.6	+	32	4784	c.4476G>T	c.(4474-4476)ctG>ctT	p.L1492L	BTAF1_ENST00000544642.1_Silent_p.L320L	NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	1492					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				TGGATGCGCTGCACCGCCAAG	0.328																																																	0													99.0	101.0	100.0					10																	93773678		2203	4300	6503	SO:0001819	synonymous_variant	9044			AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.4476G>T	10.37:g.93773678G>T			B4E0W6|O43578	Silent	SNP	pfam_DUF3535,pfam_SNF2_N,pfam_HEAT,pfam_Helicase_C,superfamily_ARM-type_fold,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L1492	ENST00000265990.6	37	c.4476	CCDS7419.1	10																																																																																			BTAF1	-	pfam_SNF2_N		0.328	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTAF1	HGNC	protein_coding	OTTHUMT00000049380.4	G	NM_003972		93773678	+1	no_errors	ENST00000265990	ensembl	human	known	70_37	silent	SNP	0.907	T
DDIAS	220042	genome.wustl.edu	37	11	82644119	82644119	+	Missense_Mutation	SNP	G	G	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr11:82644119G>T	ENST00000533655.1	+	6	1951	c.1739G>T	c.(1738-1740)tGt>tTt	p.C580F	C11orf82_ENST00000329143.3_Missense_Mutation_p.C279F|C11orf82_ENST00000430323.2_Missense_Mutation_p.C580F|C11orf82_ENST00000528759.1_3'UTR|C11orf82_ENST00000525361.1_Intron	NM_145018.3	NP_659455.3	Q8IXT1	DDIAS_HUMAN		580					apoptotic process (GO:0006915)|cellular response to cytokine stimulus (GO:0071345)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to hydroperoxide (GO:0071447)|cellular response to UV (GO:0034644)|hemopoiesis (GO:0030097)|mitotic cell cycle arrest (GO:0071850)|negative regulation of fibroblast apoptotic process (GO:2000270)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	33						TTGAATGGATGTGGAGAAATA	0.308																																																	0													51.0	54.0	53.0					11																	82644119		2203	4300	6503	SO:0001583	missense	220042																														ENST00000533655.1:c.1739G>T	11.37:g.82644119G>T	ENSP00000435421:p.Cys580Phe		Q96LK6|Q9H856	Missense_Mutation	SNP	pfam_Rep_factor-A_C,superfamily_NA-bd_OB-fold-like	p.C580F	ENST00000533655.1	37	c.1739	CCDS8263.1	11	.	.	.	.	.	.	.	.	.	.	G	6.521	0.464342	0.12402	.	.	ENSG00000165490	ENST00000430323;ENST00000533655;ENST00000329143	T;T;T	0.27402	2.0;2.0;1.67	5.62	1.67	0.24075	.	0.562862	0.18444	N	0.141055	T	0.24275	0.0588	L	0.59436	1.845	0.20307	N	0.999911	P	0.39576	0.679	B	0.35813	0.211	T	0.09952	-1.0651	9	.	.	.	.	5.9554	0.19271	0.221:0.1379:0.6411:0.0	.	580	Q8IXT1	NOXIN_HUMAN	F	580;580;279	ENSP00000414687:C580F;ENSP00000435421:C580F;ENSP00000329930:C279F	.	C	+	2	0	C11orf82	82321767	0.001000	0.12720	0.018000	0.16275	0.002000	0.02628	-0.153000	0.10144	0.333000	0.23563	-0.176000	0.13171	TGT	C11orf82	-	NULL		0.308	C11orf82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf82	HGNC	protein_coding	OTTHUMT00000391936.1	G			82644119	+1	no_errors	ENST00000430323	ensembl	human	known	70_37	missense	SNP	0.283	T
C17orf85	55421	genome.wustl.edu	37	17	3716346	3716346	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr17:3716346C>T	ENST00000389005.4	-	13	1882	c.1855G>A	c.(1855-1857)Gag>Aag	p.E619K	C17orf85_ENST00000158149.3_Missense_Mutation_p.E339K	NM_001114118.2	NP_001107590.1	Q53F19	CQ085_HUMAN	chromosome 17 open reading frame 85	619							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (3;0.0725)		CATCAGGACTCTGCCTCTGAA	0.567																																																	0													68.0	71.0	70.0					17																	3716346		2203	4300	6503	SO:0001583	missense	55421				CCDS45578.1	17p13.2	2012-10-23			ENSG00000074356	ENSG00000074356			24612	protein-coding gene	gene with protein product	"""ELG protein"""					11412301	Standard	NM_001114118		Approved	HSA277841, ELG	uc010ckl.2	Q53F19	OTTHUMG00000177672	ENST00000389005.4:c.1855G>A	17.37:g.3716346C>T	ENSP00000373657:p.Glu619Lys		B3KWG7|Q7L406|Q96FK1|Q9NXZ4	Missense_Mutation	SNP	pfam_DUF2414	p.E619K	ENST00000389005.4	37	c.1855	CCDS45578.1	17	.	.	.	.	.	.	.	.	.	.	C	18.27	3.587363	0.66105	.	.	ENSG00000074356	ENST00000389005;ENST00000158149	.	.	.	5.85	5.85	0.93711	.	0.064020	0.64402	D	0.000004	T	0.36608	0.0973	N	0.14661	0.345	0.49130	D	0.999757	P	0.47762	0.9	B	0.36464	0.225	T	0.39272	-0.9622	9	0.56958	D	0.05	-26.0904	18.0364	0.89305	0.0:1.0:0.0:0.0	.	619	Q53F19	CQ085_HUMAN	K	619;339	.	ENSP00000158149:E339K	E	-	1	0	C17orf85	3663095	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.412000	0.73303	2.941000	0.99782	0.655000	0.94253	GAG	C17orf85	-	NULL		0.567	C17orf85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf85	HGNC	protein_coding	OTTHUMT00000438385.1	C	NM_018553		3716346	-1	no_errors	ENST00000389005	ensembl	human	known	70_37	missense	SNP	1.000	T
C1QTNF6	114904	genome.wustl.edu	37	22	37578303	37578303	+	Silent	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr22:37578303C>T	ENST00000337843.2	-	3	837	c.762G>A	c.(760-762)gaG>gaA	p.E254E	C1QTNF6_ENST00000255836.6_Silent_p.E130E|RP1-151B14.6_ENST00000419128.1_RNA|C1QTNF6_ENST00000470655.1_5'UTR|C1QTNF6_ENST00000397110.2_Silent_p.E254E	NM_031910.3	NP_114116.3	Q9BXI9	C1QT6_HUMAN	C1q and tumor necrosis factor related protein 6	235	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				protein heterotrimerization (GO:0070208)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)				breast(1)|large_intestine(2)|lung(6)|stomach(1)|upper_aerodigestive_tract(1)	11						AGATGGCGTTCTCGCGCTGGC	0.652																																																	0													80.0	71.0	74.0					22																	37578303		2203	4300	6503	SO:0001819	synonymous_variant	114904			AF329842	CCDS13943.1	22q13.1	2014-02-21			ENSG00000133466	ENSG00000133466			14343	protein-coding gene	gene with protein product		614910				12975309	Standard	NM_031910		Approved	CTRP6, ZACRP6	uc003aqy.1	Q9BXI9	OTTHUMG00000150538	ENST00000337843.2:c.762G>A	22.37:g.37578303C>T			Q5H9G8|Q6ZRM7	Silent	SNP	pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q,prints_C1q	p.E254	ENST00000337843.2	37	c.762	CCDS13943.1	22																																																																																			C1QTNF6	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q		0.652	C1QTNF6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C1QTNF6	HGNC	protein_coding	OTTHUMT00000318807.1	C	NM_182486		37578303	-1	no_errors	ENST00000337843	ensembl	human	known	70_37	silent	SNP	1.000	T
CFAP74	85452	genome.wustl.edu	37	1	1920084	1920084	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr1:1920084C>G	ENST00000434971.2	-	4	195	c.163G>C	c.(163-165)Gaa>Caa	p.E55Q				Q69YW0	CA222_HUMAN		281										breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|stomach(1)	11	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.82e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.75e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GTATCTAGTTCTTTCACTGAG	0.527																																																	0													87.0	89.0	89.0					1																	1920084		1998	4180	6178	SO:0001583	missense	85452																														ENST00000434971.2:c.163G>C	1.37:g.1920084C>G	ENSP00000408078:p.Glu55Gln			Missense_Mutation	SNP	NULL	p.E55Q	ENST00000434971.2	37	c.163		1	.	.	.	.	.	.	.	.	.	.	c	8.811	0.935257	0.18206	.	.	ENSG00000142609	ENST00000270720;ENST00000378590;ENST00000434971	T;T	0.49720	0.77;0.78	3.69	-0.998	0.10212	.	.	.	.	.	T	0.26376	0.0644	L	0.31294	0.92	0.09310	N	1	B;B	0.33318	0.408;0.408	B;B	0.25987	0.065;0.065	T	0.11567	-1.0582	8	.	.	.	-6.573	3.914	0.09214	0.0:0.4444:0.1813:0.3743	.	55;55	Q9C0B2-2;Q9C0B2	.;K1751_HUMAN	Q	55;46;55	ENSP00000367853:E46Q;ENSP00000408078:E55Q	.	E	-	1	0	C1orf222	1909944	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.350000	0.07721	-0.318000	0.08665	-0.533000	0.04299	GAA	C1orf222	-	NULL		0.527	C1orf222-201	KNOWN	basic	protein_coding	C1orf222	HGNC	protein_coding		C			1920084	-1	no_errors	ENST00000270720	ensembl	human	known	70_37	missense	SNP	0.001	G
C1orf174	339448	genome.wustl.edu	37	1	3807432	3807432	+	Missense_Mutation	SNP	C	C	T	rs140673232		TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr1:3807432C>T	ENST00000361605.3	-	3	417	c.319G>A	c.(319-321)Gag>Aag	p.E107K	C1orf174_ENST00000486765.1_5'UTR	NM_207356.2	NP_997239.2	Q8IYL3	CA174_HUMAN	chromosome 1 open reading frame 174	107						nucleus (GO:0005634)				endometrium(1)|large_intestine(5)|lung(4)|prostate(1)	11	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_cancers(23;5.09e-25)|all_epithelial(116;9.35e-17)|all_lung(118;1.09e-06)|Lung NSC(185;0.000139)|all_neural(13;0.00287)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0219)|all_hematologic(16;0.027)|Colorectal(325;0.0276)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.0743)|Ovarian(437;0.127)		Epithelial(90;1.55e-39)|OV - Ovarian serous cystadenocarcinoma(86;5.99e-23)|GBM - Glioblastoma multiforme(42;2.22e-17)|Colorectal(212;1.08e-05)|COAD - Colon adenocarcinoma(227;5.49e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000365)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.19)		ACGCCAGCCTCGCTGCCTGGA	0.542																																																	0								C	LYS/GLU	2,4404	4.2+/-10.8	0,2,2201	58.0	56.0	57.0		319	3.7	0.0	1	dbSNP_134	57	0,8600		0,0,4300	yes	missense	C1orf174	NM_207356.2	56	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	possibly-damaging	107/244	3807432	2,13004	2203	4300	6503	SO:0001583	missense	339448			BC035643	CCDS53.1	1p36.32	2012-07-25			ENSG00000198912	ENSG00000198912			27915	protein-coding gene	gene with protein product						12477932	Standard	NM_207356		Approved	RP13-531C17.2	uc001alf.3	Q8IYL3	OTTHUMG00000003739	ENST00000361605.3:c.319G>A	1.37:g.3807432C>T	ENSP00000355306:p.Glu107Lys		A8K0C8|A8MUG9|Q5SR20|Q6NX36	Missense_Mutation	SNP	NULL	p.E107K	ENST00000361605.3	37	c.319	CCDS53.1	1	.	.	.	.	.	.	.	.	.	.	C	12.64	2.000097	0.35320	4.54E-4	0.0	ENSG00000198912	ENST00000361605	T	0.06218	3.33	5.56	3.7	0.42460	.	1.047540	0.07462	N	0.900877	T	0.07593	0.0191	L	0.50333	1.59	0.09310	N	1	B	0.27498	0.18	B	0.15484	0.013	T	0.41662	-0.9496	10	0.25751	T	0.34	-7.9702	8.9415	0.35733	0.0:0.8291:0.0:0.1709	.	107	Q8IYL3	CA174_HUMAN	K	107	ENSP00000355306:E107K	ENSP00000355306:E107K	E	-	1	0	C1orf174	3797292	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.050000	0.11904	0.710000	0.31997	0.563000	0.77884	GAG	C1orf174	-	NULL		0.542	C1orf174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf174	HGNC	protein_coding	OTTHUMT00000010539.1	C	NM_207356		3807432	-1	no_errors	ENST00000361605	ensembl	human	known	70_37	missense	SNP	0.003	T
ERICH3	127254	genome.wustl.edu	37	1	75055435	75055435	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr1:75055435C>G	ENST00000326665.5	-	12	2274	c.2056G>C	c.(2056-2058)Gag>Cag	p.E686Q	C1orf173_ENST00000420661.2_Missense_Mutation_p.E489Q|RP4-612J11.1_ENST00000416017.1_RNA	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		686	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CCGGACTTCTCAGATAAACCC	0.443																																																	0													164.0	163.0	163.0					1																	75055435		2203	4300	6503	SO:0001583	missense	127254																														ENST00000326665.5:c.2056G>C	1.37:g.75055435C>G	ENSP00000322609:p.Glu686Gln		Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	NULL	p.E686Q	ENST00000326665.5	37	c.2056	CCDS30755.1	1	.	.	.	.	.	.	.	.	.	.	C	11.39	1.625937	0.28889	.	.	ENSG00000178965	ENST00000326665;ENST00000420661	T;T	0.18810	2.6;2.19	3.97	1.56	0.23342	.	.	.	.	.	T	0.06917	0.0176	L	0.39898	1.24	0.09310	N	1	B;P	0.39480	0.13;0.675	B;B	0.40444	0.149;0.329	T	0.23726	-1.0180	9	0.49607	T	0.09	-1.3933	5.2854	0.15698	0.0:0.6632:0.0:0.3368	.	489;686	Q5RHP9-3;Q5RHP9	.;CA173_HUMAN	Q	686;489	ENSP00000322609:E686Q;ENSP00000398581:E489Q	ENSP00000322609:E686Q	E	-	1	0	C1orf173	74828023	0.000000	0.05858	0.003000	0.11579	0.151000	0.21798	0.488000	0.22371	0.385000	0.24970	0.579000	0.79373	GAG	C1orf173	-	NULL		0.443	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	HGNC	protein_coding	OTTHUMT00000026516.1	C			75055435	-1	no_errors	ENST00000326665	ensembl	human	known	70_37	missense	SNP	0.003	G
LINC00862	554279	genome.wustl.edu	37	1	200312409	200312409	+	lincRNA	SNP	A	A	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr1:200312409A>T	ENST00000367355.1	-	0	679					NR_040064.1		A6NCI5	SIM16_HUMAN	long intergenic non-protein coding RNA 862							integral component of membrane (GO:0016021)											aaatcaacagacattctgcag	0.383																																																	0																																												554279			BC040731		1q32.1	2014-04-09	2013-02-22	2013-02-22	ENSG00000203721	ENSG00000203721		"""Long non-coding RNAs"""	21901	other	unknown			"""chromosome 1 open reading frame 98"", ""small integral membrane protein 16"""	C1orf98, SMIM16			Standard	NR_040064		Approved		uc001gvd.1	A6NCI5	OTTHUMG00000035722		1.37:g.200312409A>T				Splice_Site	SNP	-	e2+2	ENST00000367355.1	37	c.179+2		1	.	.	.	.	.	.	.	.	.	.	A	4.160	0.028232	0.08054	.	.	ENSG00000203721	ENST00000367355	.	.	.	0.563	0.563	0.17296	.	.	.	.	.	T	0.40645	0.1125	.	.	.	0.19945	N	0.999948	.	.	.	.	.	.	T	0.39143	-0.9628	4	0.87932	D	0	.	.	.	.	.	.	.	.	T	81	.	ENSP00000356324:S81T	S	-	1	0	C1orf98	198579032	0.004000	0.15560	0.002000	0.10522	0.002000	0.02628	0.501000	0.22578	0.488000	0.27723	0.477000	0.44152	TCT	C1orf98	-	-		0.383	LINC00862-001	KNOWN	basic	lincRNA	C1orf98	HGNC	lincRNA	OTTHUMT00000086877.1	A	NR_040064		200312409	-1	no_errors	ENST00000367356	ensembl	human	known	70_37	splice_site	SNP	0.002	T
C2orf27A	29798	genome.wustl.edu	37	2	132491337	132491337	+	Intron	SNP	A	A	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr2:132491337A>G	ENST00000355171.4	+	1	274					NM_013310.3	NP_037442.3	Q580R0	CB027_HUMAN	chromosome 2 open reading frame 27A											kidney(1)	1						TTTTATGAATATTATAATTGC	0.308																																																	0																																										SO:0001627	intron_variant	29798			AF038169	CCDS2168.1	2q21.2	2010-05-11	2009-04-02	2009-04-02	ENSG00000197927	ENSG00000197927			25077	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 27"""	C2orf27		9110174, 8619474	Standard	NM_013310		Approved		uc002ttf.1	Q580R0	OTTHUMG00000131666	ENST00000355171.4:c.-248+11116A>G	2.37:g.132491337A>G			O43575|Q2M1X0|Q52M10|Q86XG2	RNA	SNP	-	NULL	ENST00000355171.4	37	NULL	CCDS2168.1	2																																																																																			C2orf27A	-	-		0.308	C2orf27A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf27A	HGNC	protein_coding	OTTHUMT00000254569.4	A	NM_013310		132491337	+1	no_errors	ENST00000463645	ensembl	human	putative	70_37	rna	SNP	0.101	G
CFAP69	79846	genome.wustl.edu	37	7	89936214	89936214	+	Splice_Site	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr7:89936214G>A	ENST00000389297.4	+	20	2516		c.e20-1		C7orf63_ENST00000316089.8_Splice_Site|C7orf63_ENST00000497910.1_Splice_Site	NM_001039706.2|NM_001160138.1	NP_001034795.2|NP_001153610.1	A5D8W1	CG063_HUMAN												breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|prostate(3)	37						TGTTATAACAGATTGGAGAAA	0.259																																																	0													22.0	20.0	21.0					7																	89936214		1762	4008	5770	SO:0001630	splice_region_variant	79846																														ENST00000389297.4:c.2266-1G>A	7.37:g.89936214G>A			A3KMP9|B4DYW6|B4DZP7|B9EIM7|Q6V705|Q8IY89|Q9H7C2	Splice_Site	SNP	-	e20-1	ENST00000389297.4	37	c.2266-1	CCDS43613.2	7	.	.	.	.	.	.	.	.	.	.	G	18.74	3.688734	0.68271	.	.	ENSG00000105792	ENST00000389297;ENST00000316089;ENST00000497910;ENST00000449577	.	.	.	5.68	5.68	0.88126	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7786	0.96409	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C7orf63	89774150	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.159000	0.77483	2.681000	0.91329	0.591000	0.81541	.	C7orf63	-	-		0.259	C7orf63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C7orf63	HGNC	protein_coding	OTTHUMT00000139891.4	G		Intron	89936214	+1	no_errors	ENST00000389297	ensembl	human	known	70_37	splice_site	SNP	1.000	A
C9orf84	158401	genome.wustl.edu	37	9	114454375	114454375	+	Silent	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr9:114454375G>C	ENST00000318737.4	-	25	3818	c.3690C>G	c.(3688-3690)gtC>gtG	p.V1230V	C9orf84_ENST00000394779.3_Silent_p.V1191V|C9orf84_ENST00000374287.3_Silent_p.V1230V|C9orf84_ENST00000394777.4_Silent_p.V1156V	NM_173521.3	NP_775792.3	Q5VXU9	CI084_HUMAN	chromosome 9 open reading frame 84	1230										breast(1)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(10)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						CCAAAGAAAAGACATCTGACT	0.363																																																	0													50.0	55.0	53.0					9																	114454375		2202	4300	6502	SO:0001819	synonymous_variant	158401			AL833535	CCDS6781.3, CCDS43863.1	9q32	2012-03-16			ENSG00000165181	ENSG00000165181			26535	protein-coding gene	gene with protein product							Standard	XM_005251738		Approved	FLJ32779	uc004bfr.3	Q5VXU9	OTTHUMG00000020495	ENST00000318737.4:c.3690C>G	9.37:g.114454375G>C			A2A2V3|Q2M1H8|Q96M73	Silent	SNP	superfamily_RuvA_2-like	p.V1230	ENST00000318737.4	37	c.3690	CCDS6781.3	9																																																																																			C9orf84	-	NULL		0.363	C9orf84-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C9orf84	HGNC	protein_coding	OTTHUMT00000053656.2	G	NM_173521		114454375	-1	no_errors	ENST00000318737	ensembl	human	known	70_37	silent	SNP	1.000	C
CABIN1	23523	genome.wustl.edu	37	22	24487584	24487584	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr22:24487584C>G	ENST00000398319.2	+	24	3958	c.3573C>G	c.(3571-3573)ttC>ttG	p.F1191L	CABIN1_ENST00000263119.5_Missense_Mutation_p.F1191L|CABIN1_ENST00000405822.2_Missense_Mutation_p.F1141L	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1191					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						AGCACTGTTTCACATCAGCAG	0.607																																																	0													85.0	74.0	78.0					22																	24487584		2203	4300	6503	SO:0001583	missense	23523			AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.3573C>G	22.37:g.24487584C>G	ENSP00000381364:p.Phe1191Leu		G5E9F3|Q6PHY0|Q9Y460	Missense_Mutation	SNP	pfam_MEF2_binding,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.F1191L	ENST00000398319.2	37	c.3573	CCDS13823.1	22	.	.	.	.	.	.	.	.	.	.	C	12.61	1.989049	0.35131	.	.	ENSG00000099991	ENST00000263119;ENST00000405822;ENST00000398319	T;T;T	0.29655	1.56;1.56;1.56	4.46	2.34	0.29019	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.31575	0.0801	M	0.73962	2.25	0.80722	D	1	P;P	0.47106	0.89;0.824	B;B	0.40677	0.337;0.182	T	0.11767	-1.0574	10	0.40728	T	0.16	.	9.6956	0.40156	0.0:0.7556:0.0:0.2444	.	1141;1191	G5E9F3;Q9Y6J0	.;CABIN_HUMAN	L	1191;1141;1191	ENSP00000263119:F1191L;ENSP00000384694:F1141L;ENSP00000381364:F1191L	ENSP00000263119:F1191L	F	+	3	2	CABIN1	22817584	1.000000	0.71417	0.705000	0.30386	0.166000	0.22503	1.917000	0.39996	0.602000	0.29896	0.650000	0.86243	TTC	CABIN1	-	NULL		0.607	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CABIN1	HGNC	protein_coding	OTTHUMT00000320161.2	C	NM_012295		24487584	+1	no_errors	ENST00000263119	ensembl	human	known	70_37	missense	SNP	0.999	G
CACUL1	143384	genome.wustl.edu	37	10	120513962	120513962	+	Missense_Mutation	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr10:120513962G>A	ENST00000369151.3	-	1	796	c.313C>T	c.(313-315)Ccc>Tcc	p.P105S	CACUL1_ENST00000340214.4_Missense_Mutation_p.P105S	NM_153810.4	NP_722517.3	Q86Y37	CACL1_HUMAN	CDK2-associated, cullin domain 1	105	Poly-Ala.				G1/S transition of mitotic cell cycle (GO:0000082)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein kinase activity (GO:0045860)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)	protein kinase binding (GO:0019901)										GTGGGGGCGGGGGCCGCCTTG	0.657																																																	0													22.0	26.0	25.0					10																	120513962		1906	4092	5998	SO:0001583	missense	143384			AK097728	CCDS41570.1	10q26.13	2012-06-12	2012-06-12	2012-06-12	ENSG00000151893	ENSG00000151893			23727	protein-coding gene	gene with protein product	"""Cdk-Associated Cullin1"""		"""chromosome 10 open reading frame 46"""	C10orf46		19829063	Standard	NM_153810		Approved	FLJ40409, MGC33215, CAC1	uc001lds.1	Q86Y37	OTTHUMG00000019138	ENST00000369151.3:c.313C>T	10.37:g.120513962G>A	ENSP00000358147:p.Pro105Ser		Q5XPL7|Q8IY11|Q8N7S4	Missense_Mutation	SNP	pfam_Cullin_N,superfamily_Cullin_repeat-like_dom	p.P105S	ENST00000369151.3	37	c.313	CCDS41570.1	10	.	.	.	.	.	.	.	.	.	.	G	12.58	1.982069	0.34942	.	.	ENSG00000151893	ENST00000369151;ENST00000340214	.	.	.	4.71	2.71	0.32032	.	0.761502	0.11985	N	0.510417	T	0.24431	0.0592	N	0.19112	0.55	0.25565	N	0.986952	B	0.27823	0.19	B	0.23018	0.043	T	0.06643	-1.0815	8	.	.	.	-13.8253	8.4434	0.32828	0.0:0.2237:0.5519:0.2244	.	105	Q86Y37	CJ046_HUMAN	S	105	.	.	P	-	1	0	C10orf46	120503952	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	1.108000	0.31123	2.321000	0.78463	0.561000	0.74099	CCC	CACUL1	-	NULL		0.657	CACUL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CACUL1	HGNC	protein_coding	OTTHUMT00000050612.2	G	NM_153810		120513962	-1	no_errors	ENST00000369151	ensembl	human	known	70_37	missense	SNP	0.736	A
CCDC33	80125	genome.wustl.edu	37	15	74625601	74625601	+	Missense_Mutation	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr15:74625601G>C	ENST00000268082.4	+	7	777	c.757G>C	c.(757-759)Gag>Cag	p.E253Q	CCDC33_ENST00000321288.5_Missense_Mutation_p.E863Q|CCDC33_ENST00000558821.1_Intron|CCDC33_ENST00000398814.3_Intron			Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33	849	C2.									breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						AGACTTGACAGAGAGGCTACA	0.632																																																	0													25.0	32.0	30.0					15																	74625601		1989	4152	6141	SO:0001583	missense	80125			BC025689	CCDS42058.1, CCDS42059.1, CCDS73753.1	15q24.1	2009-08-06				ENSG00000140481			26552	protein-coding gene	gene with protein product	"""cancer/testis antigen 61"""					12477932	Standard	NM_025055		Approved	FLJ32855, CT61	uc002axo.4	Q8N5R6		ENST00000268082.4:c.757G>C	15.37:g.74625601G>C	ENSP00000268082:p.Glu253Gln		A8K3U4|A8MPQ6|A8MV61|A8MVU9|B3KQ49|Q8TAX6|Q9H5Q6	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB	p.E863Q	ENST00000268082.4	37	c.2587	CCDS42059.1	15	.	.	.	.	.	.	.	.	.	.	G	15.44	2.835172	0.50951	.	.	ENSG00000140481	ENST00000321288;ENST00000268082	T;T	0.44083	0.93;1.64	4.69	2.75	0.32379	.	0.453672	0.18621	N	0.135878	T	0.26231	0.0640	.	.	.	0.29644	N	0.8445	B;B	0.27997	0.129;0.197	B;B	0.30572	0.117;0.092	T	0.18461	-1.0336	9	0.22109	T	0.4	.	5.9967	0.19497	0.1029:0.1931:0.704:0.0	.	253;863	Q8N5R6-5;C9JFX2	.;.	Q	863;253	ENSP00000325012:E863Q;ENSP00000268082:E253Q	ENSP00000268082:E253Q	E	+	1	0	CCDC33	72412654	0.999000	0.42202	1.000000	0.80357	0.956000	0.61745	0.196000	0.17176	0.550000	0.28991	0.643000	0.83706	GAG	CCDC33	-	NULL		0.632	CCDC33-002	KNOWN	basic|CCDS	protein_coding	CCDC33	HGNC	protein_coding	OTTHUMT00000419494.1	G	NM_182791		74625601	+1	no_errors	ENST00000321288	ensembl	human	known	70_37	missense	SNP	1.000	C
CCNB3	85417	genome.wustl.edu	37	X	50052361	50052361	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chrX:50052361C>G	ENST00000376042.1	+	6	1490	c.1192C>G	c.(1192-1194)Ctg>Gtg	p.L398V	CCNB3_ENST00000348603.2_Intron|CCNB3_ENST00000276014.7_Missense_Mutation_p.L398V|CCNB3_ENST00000376038.1_Intron			Q8WWL7	CCNB3_HUMAN	cyclin B3	398					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					GAGGTCCCGTCTGAAGCCATT	0.468																																																	0													73.0	64.0	67.0					X																	50052361		2203	4300	6503	SO:0001583	missense	85417			AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.1192C>G	X.37:g.50052361C>G	ENSP00000365210:p.Leu398Val		B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C,superfamily_Cyclin-like,smart_Cyclin-like	p.L398V	ENST00000376042.1	37	c.1192	CCDS14331.1	X	.	.	.	.	.	.	.	.	.	.	C	9.598	1.127826	0.20959	.	.	ENSG00000147082	ENST00000376042;ENST00000276014	T;T	0.38887	1.11;1.11	2.43	-4.87	0.03123	.	1024.720000	0.00166	N	0.000000	T	0.34279	0.0892	M	0.65498	2.005	0.09310	N	1	B	0.29862	0.259	B	0.26614	0.071	T	0.07366	-1.0776	9	.	.	.	.	0.2783	0.00241	0.339:0.2651:0.1704:0.2255	.	398	Q8WWL7	CCNB3_HUMAN	V	398	ENSP00000365210:L398V;ENSP00000276014:L398V	.	L	+	1	2	CCNB3	50069101	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.237000	0.08990	-1.606000	0.01591	-0.533000	0.04299	CTG	CCNB3	-	NULL		0.468	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNB3	HGNC	protein_coding	OTTHUMT00000056558.1	C			50052361	+1	no_errors	ENST00000276014	ensembl	human	known	70_37	missense	SNP	0.000	G
CCP110	9738	genome.wustl.edu	37	16	19553321	19553321	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr16:19553321C>G	ENST00000381396.5	+	6	2409	c.2162C>G	c.(2161-2163)tCt>tGt	p.S721C	CCP110_ENST00000396208.2_Missense_Mutation_p.S721C|CCP110_ENST00000396212.2_Missense_Mutation_p.S721C	NM_001199022.1	NP_001185951	O43303	CP110_HUMAN	centriolar coiled coil protein 110kDa	721					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cytokinesis (GO:0032465)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|stomach(3)|urinary_tract(1)	21						ATAAGTGACTCTAGTTTGCTG	0.368																																																	0													134.0	138.0	137.0					16																	19553321		2197	4300	6497	SO:0001583	missense	9738			AB007879	CCDS10579.1, CCDS55992.1	16p12.3	2014-02-20	2011-05-27		ENSG00000103540	ENSG00000103540			24342	protein-coding gene	gene with protein product		609544				9455477, 12361598, 16760425	Standard	NM_014711		Approved	KIAA0419, CP110	uc002dgl.4	O43303	OTTHUMG00000131459	ENST00000381396.5:c.2162C>G	16.37:g.19553321C>G	ENSP00000370803:p.Ser721Cys		B7WP23|O43335|Q68DV9|Q8NE13	Missense_Mutation	SNP	NULL	p.S721C	ENST00000381396.5	37	c.2162	CCDS55992.1	16	.	.	.	.	.	.	.	.	.	.	C	17.15	3.316654	0.60524	.	.	ENSG00000103540	ENST00000396212;ENST00000381396;ENST00000396208	T;T;T	0.20598	2.06;2.06;2.06	5.92	3.9	0.45041	.	0.486350	0.22150	N	0.063921	T	0.31451	0.0797	L	0.55481	1.735	0.25011	N	0.991409	D;D	0.71674	0.998;0.998	D;D	0.63113	0.911;0.911	T	0.16512	-1.0400	10	0.62326	D	0.03	-14.0514	4.1055	0.10035	0.1347:0.5567:0.2206:0.088	.	721;721	O43303;O43303-2	CP110_HUMAN;.	C	721	ENSP00000379515:S721C;ENSP00000370803:S721C;ENSP00000379511:S721C	ENSP00000370803:S721C	S	+	2	0	CCP110	19460822	0.614000	0.27017	0.877000	0.34402	0.936000	0.57629	1.480000	0.35464	2.794000	0.96219	0.650000	0.86243	TCT	CCP110	-	NULL		0.368	CCP110-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCP110	HGNC	protein_coding	OTTHUMT00000254284.2	C	NM_014711		19553321	+1	no_errors	ENST00000381396	ensembl	human	known	70_37	missense	SNP	0.426	G
CDH22	64405	genome.wustl.edu	37	20	44869843	44869843	+	Silent	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr20:44869843G>A	ENST00000372262.3	-	2	709	c.309C>T	c.(307-309)ggC>ggT	p.G103G	CDH22_ENST00000537909.1_Silent_p.G103G	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	103	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				CAGCACCCTCGCCTGAGATGG	0.597																																																	0													73.0	62.0	66.0					20																	44869843		2203	4300	6503	SO:0001819	synonymous_variant	64405			AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.309C>T	20.37:g.44869843G>A			B9EGK7|O43205	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,superfamily_MFS_dom_general_subst_transpt,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G103	ENST00000372262.3	37	c.309	CCDS13395.1	20																																																																																			CDH22	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.597	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH22	HGNC	protein_coding	OTTHUMT00000080491.1	G	NM_021248		44869843	-1	no_errors	ENST00000372262	ensembl	human	known	70_37	silent	SNP	0.958	A
CDHR3	222256	genome.wustl.edu	37	7	105669022	105669022	+	Silent	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr7:105669022C>T	ENST00000317716.9	+	17	2378	c.2298C>T	c.(2296-2298)gtC>gtT	p.V766V	CDHR3_ENST00000470188.1_3'UTR|CDHR3_ENST00000542731.1_Silent_p.V766V|CDHR3_ENST00000478080.1_Silent_p.V678V|CDHR3_ENST00000343407.5_Missense_Mutation_p.R269C	NM_152750.4	NP_689963.2	Q6ZTQ4	CDHR3_HUMAN	cadherin-related family member 3	766					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)	23						AGAGAGACGTCGTGGTGGTGA	0.567																																																	0													62.0	64.0	63.0					7																	105669022		1974	4152	6126	SO:0001819	synonymous_variant	222256			AK126338	CCDS47684.1, CCDS75651.1	7q22.2	2011-07-01			ENSG00000128536	ENSG00000128536		"""Cadherins / Cadherin-related"""	26308	protein-coding gene	gene with protein product		615610					Standard	NM_152750		Approved	FLJ44366, FLJ23834, CDH28	uc003vdl.4	Q6ZTQ4	OTTHUMG00000157520	ENST00000317716.9:c.2298C>T	7.37:g.105669022C>T			Q8TCI7	Missense_Mutation	SNP	superfamily_Cadherin-like,pfscan_Cadherin	p.R269C	ENST00000317716.9	37	c.805	CCDS47684.1	7	.	.	.	.	.	.	.	.	.	.	C	1.476	-0.558571	0.03967	.	.	ENSG00000128536	ENST00000343407;ENST00000466045	T;T	0.78481	-1.18;-0.56	6.08	-12.2	0.00006	.	.	.	.	.	T	0.66982	0.2845	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.67772	-0.5584	8	0.87932	D	0	0.1504	13.8557	0.63524	0.063:0.2904:0.5625:0.0841	.	267	Q6ZTQ4-2	.	C	269;308	ENSP00000341510:R269C;ENSP00000419017:R308C	ENSP00000341510:R269C	R	+	1	0	CDHR3	105456258	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-7.252000	0.00040	-5.760000	0.00009	-2.640000	0.00151	CGT	CDHR3	-	NULL		0.567	CDHR3-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDHR3	HGNC	protein_coding	OTTHUMT00000349025.2	C	NM_152750		105669022	+1	no_errors	ENST00000343407	ensembl	human	known	70_37	missense	SNP	0.000	T
CDK12	51755	genome.wustl.edu	37	17	37681036	37681036	+	Missense_Mutation	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr17:37681036G>C	ENST00000447079.4	+	12	3238	c.3205G>C	c.(3205-3207)Gaa>Caa	p.E1069Q	CDK12_ENST00000430627.2_Missense_Mutation_p.E1069Q	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	1069					mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						TTCTCGAAAAGAAACTACCTC	0.542			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																														Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	0													116.0	116.0	116.0					17																	37681036		2203	4300	6503	SO:0001583	missense	51755			AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.3205G>C	17.37:g.37681036G>C	ENSP00000398880:p.Glu1069Gln		A7E2B2|B4DYX4|B9EIQ6|O94978	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E1069Q	ENST00000447079.4	37	c.3205	CCDS11337.1	17	.	.	.	.	.	.	.	.	.	.	G	20.8	4.047434	0.75846	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	T;T	0.69040	-0.37;-0.34	4.98	4.98	0.66077	.	0.000000	0.44483	D	0.000446	T	0.76256	0.3962	L	0.61218	1.895	0.53688	D	0.999978	P;P;D	0.54207	0.941;0.941;0.965	P;P;P	0.55871	0.478;0.616;0.786	T	0.76929	-0.2777	10	0.48119	T	0.1	-14.2957	18.0521	0.89353	0.0:0.0:1.0:0.0	.	1068;1069;1069	E7EUM9;Q9NYV4;Q9NYV4-2	.;CDK12_HUMAN;.	Q	1069	ENSP00000407720:E1069Q;ENSP00000398880:E1069Q	ENSP00000407720:E1069Q	E	+	1	0	CDK12	34934562	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.263000	0.95617	2.591000	0.87537	0.563000	0.77884	GAA	CDK12	-	NULL		0.542	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK12	HGNC	protein_coding	OTTHUMT00000256941.4	G	NM_016507		37681036	+1	no_errors	ENST00000447079	ensembl	human	known	70_37	missense	SNP	1.000	C
CHRNA3	1136	genome.wustl.edu	37	15	78894297	78894297	+	Silent	SNP	G	G	A	rs144257258		TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr15:78894297G>A	ENST00000326828.5	-	5	1071	c.687C>T	c.(685-687)ccC>ccT	p.P229P	CHRNA3_ENST00000348639.3_Silent_p.P229P	NM_000743.4	NP_000734.2	P32297	ACHA3_HUMAN	cholinergic receptor, nicotinic, alpha 3 (neuronal)	229					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of membrane potential (GO:0042391)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18					Bupropion(DB01156)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)|Varenicline(DB01273)	ATGTGATGTCGGGGTAGATCT	0.547																																																	0								G	,	0,4392		0,0,2196	212.0	175.0	187.0		687,687	-11.8	0.0	15	dbSNP_134	187	1,8585	1.2+/-3.3	0,1,4292	no	coding-synonymous,coding-synonymous	CHRNA3	NM_000743.4,NM_001166694.1	,	0,1,6488	AA,AG,GG		0.0116,0.0,0.0077	,	229/506,229/490	78894297	1,12977	2196	4293	6489	SO:0001819	synonymous_variant	1136				CCDS10305.1, CCDS53964.1	15q24	2012-02-11	2012-02-07		ENSG00000080644	ENSG00000080644		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1957	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 3 (neuronal)"""	118503	"""cholinergic receptor, nicotinic, alpha polypeptide 3"""			2004777	Standard	NM_000743		Approved		uc002bec.3	P32297	OTTHUMG00000143863	ENST00000326828.5:c.687C>T	15.37:g.78894297G>A			Q15823|Q4KMN8|Q86U77|Q96RH3|Q99553|Q9BQ93|Q9BRR4	Silent	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.P229	ENST00000326828.5	37	c.687	CCDS10305.1	15																																																																																			CHRNA3	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel		0.547	CHRNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA3	HGNC	protein_coding	OTTHUMT00000290111.3	G			78894297	-1	no_errors	ENST00000326828	ensembl	human	known	70_37	silent	SNP	0.000	A
CHUK	1147	genome.wustl.edu	37	10	101964375	101964375	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr10:101964375C>G	ENST00000370397.7	-	13	1481	c.1395G>C	c.(1393-1395)atG>atC	p.M465I		NM_001278.3	NP_001269.3	O15111	IKKA_HUMAN	conserved helix-loop-helix ubiquitous kinase	465	Leucine-zipper.				anatomical structure morphogenesis (GO:0009653)|cellular response to tumor necrosis factor (GO:0071356)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|morphogenesis of an epithelial sheet (GO:0002011)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to hydroperoxide (GO:0033194)|response to lipopolysaccharide (GO:0032496)|response to toxic substance (GO:0009636)|response to virus (GO:0009615)|Rho protein signal transduction (GO:0007266)|skeletal muscle contraction (GO:0003009)|striated muscle cell differentiation (GO:0051146)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|scaffold protein binding (GO:0097110)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	27		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)	Acetylcysteine(DB06151)|Aminosalicylic Acid(DB00233)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	AAGTGTTCTTCATTTTTGTTA	0.323																																					Ovarian(159;52 1904 10536 35305 37148)												0													118.0	109.0	112.0					10																	101964375		2203	4300	6503	SO:0001583	missense	1147			AF009225	CCDS7488.1	10q24-q25	2008-08-01			ENSG00000213341	ENSG00000213341			1974	protein-coding gene	gene with protein product		600664		TCF16		7558004, 16902410	Standard	XR_246062		Approved	IKK1, IKK-alpha, IkBKA, NFKBIKA, IKKA	uc001kqp.3	O15111	OTTHUMG00000018899	ENST00000370397.7:c.1395G>C	10.37:g.101964375C>G	ENSP00000359424:p.Met465Ile		O14666|Q13132|Q5W0I4|Q92467	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IKKbetaNEMObind,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.M465I	ENST00000370397.7	37	c.1395	CCDS7488.1	10	.	.	.	.	.	.	.	.	.	.	C	15.03	2.710923	0.48517	.	.	ENSG00000213341	ENST00000370397	T	0.71698	-0.59	5.7	4.78	0.61160	.	0.175374	0.64402	D	0.000009	T	0.60907	0.2305	L	0.46157	1.445	0.38204	D	0.940276	P	0.35328	0.495	B	0.30716	0.119	T	0.61377	-0.7075	10	0.22109	T	0.4	-17.6727	13.7646	0.62988	0.155:0.845:0.0:0.0	.	465	O15111	IKKA_HUMAN	I	465	ENSP00000359424:M465I	ENSP00000359424:M465I	M	-	3	0	CHUK	101954365	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.317000	0.51968	1.391000	0.46566	0.650000	0.86243	ATG	CHUK	-	NULL		0.323	CHUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHUK	HGNC	protein_coding	OTTHUMT00000049836.1	C	NM_001278		101964375	-1	no_errors	ENST00000370397	ensembl	human	known	70_37	missense	SNP	1.000	G
CLVS1	157807	genome.wustl.edu	37	8	62412295	62412295	+	3'UTR	DEL	T	T	-			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr8:62412295delT	ENST00000519846.1	+	0	1731				CLVS1_ENST00000518592.1_3'UTR|CLVS1_ENST00000325897.4_3'UTR|CLVS1_ENST00000518858.1_3'UTR			Q8IUQ0	CLVS1_HUMAN	clavesin 1						lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)			endometrium(3)|kidney(4)|large_intestine(4)|lung(21)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	41						TGAGAGATGCTTTTTTTTTCC	0.438																																																	0																																										SO:0001624	3_prime_UTR_variant	157807			AY094971	CCDS6176.1	8q12.1	2009-10-14	2009-10-14	2009-10-14		ENSG00000177182			23139	protein-coding gene	gene with protein product		611292	"""retinaldehyde binding protein 1-like 1"""	RLBP1L1		16802092, 19651769	Standard	NM_173519		Approved	MGC34646, CRALBPL, C6orf212L	uc003xuh.3	Q8IUQ0		ENST00000519846.1:c.*194T>-	8.37:g.62412295delT			B2R7M5|C8UZT3|Q8NB32	RNA	DEL	-	NULL	ENST00000519846.1	37	NULL	CCDS6176.1	8																																																																																			CLVS1	-	-		0.438	CLVS1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CLVS1	HGNC	protein_coding	OTTHUMT00000378323.1	T	NM_173519		62412295	+1	no_errors	ENST00000518858	ensembl	human	known	70_37	rna	DEL	0.005	-
COBLL1	22837	genome.wustl.edu	37	2	165550784	165550784	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr2:165550784C>G	ENST00000392717.2	-	13	3350	c.3346G>C	c.(3346-3348)Gat>Cat	p.D1116H	COBLL1_ENST00000409184.3_Missense_Mutation_p.D1078H|COBLL1_ENST00000342193.4_Missense_Mutation_p.D1078H|COBLL1_ENST00000375458.2_Missense_Mutation_p.D1040H|COBLL1_ENST00000194871.6_Missense_Mutation_p.D1145H			Q53SF7	COBL1_HUMAN	cordon-bleu WH2 repeat protein-like 1	1116						extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	47						GTTACCTTATCAGACACACCA	0.398																																																	0													100.0	98.0	98.0					2																	165550784		2203	4300	6503	SO:0001583	missense	22837			AB023194	CCDS2223.2, CCDS63045.1	2q24.3	2012-12-07	2012-12-07		ENSG00000082438	ENSG00000082438			23571	protein-coding gene	gene with protein product		610318	"""COBL-like 1"""				Standard	NM_001278458		Approved	KIAA0977	uc002ucp.3	Q53SF7	OTTHUMG00000074019	ENST00000392717.2:c.3346G>C	2.37:g.165550784C>G	ENSP00000376478:p.Asp1116His		A6NMZ3|Q6IQ33|Q7Z3I6|Q9BRH4|Q9UG88|Q9Y2I3	Missense_Mutation	SNP	pfam_Cordon-bleu_domain,pfscan_WH2_dom	p.D1145H	ENST00000392717.2	37	c.3433		2	.	.	.	.	.	.	.	.	.	.	C	18.45	3.625918	0.66901	.	.	ENSG00000082438	ENST00000375458;ENST00000342193;ENST00000409184;ENST00000392717;ENST00000194871	.	.	.	5.95	4.12	0.48240	.	0.370434	0.25657	N	0.029168	T	0.60405	0.2266	M	0.62723	1.935	0.30251	N	0.794062	D;D;D	0.69078	0.993;0.997;0.996	P;P;P	0.61132	0.769;0.867;0.884	T	0.62798	-0.6778	9	0.52906	T	0.07	-4.9534	12.0342	0.53415	0.0:0.8566:0.0:0.1434	.	1116;1145;1078	Q53SF7;B7Z2P5;Q53SF7-2	COBL1_HUMAN;.;.	H	1040;1078;1078;1116;1145	.	ENSP00000194871:D1145H	D	-	1	0	COBLL1	165259030	0.418000	0.25440	0.482000	0.27366	0.017000	0.09413	2.153000	0.42282	0.807000	0.34208	0.655000	0.94253	GAT	COBLL1	-	NULL		0.398	COBLL1-202	KNOWN	basic|appris_candidate	protein_coding	COBLL1	HGNC	protein_coding		C	NM_014900		165550784	-1	no_errors	ENST00000194871	ensembl	human	known	70_37	missense	SNP	0.578	G
CREBBP	1387	genome.wustl.edu	37	16	3786798	3786798	+	Missense_Mutation	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr16:3786798G>C	ENST00000262367.5	-	27	5222	c.4413C>G	c.(4411-4413)atC>atG	p.I1471M	CREBBP_ENST00000382070.3_Missense_Mutation_p.I1433M	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1471	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.|Cys/His-rich.|Interaction with TRERF1.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GACAGGCCCAGATGTGCCCTG	0.507			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																																	Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	0													163.0	138.0	147.0					16																	3786798		2197	4300	6497	SO:0001583	missense	1387			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.4413C>G	16.37:g.3786798G>C	ENSP00000262367:p.Ile1471Met		D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.I1471M	ENST00000262367.5	37	c.4413	CCDS10509.1	16	.	.	.	.	.	.	.	.	.	.	g	14.91	2.676709	0.47886	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070;ENST00000323508	D;D	0.94280	-3.39;-3.39	5.25	1.9	0.25705	.	0.000000	0.85682	D	0.000000	D	0.97084	0.9047	H	0.95850	3.73	0.58432	D	0.999991	D;D	0.71674	0.998;0.998	D;D	0.87578	0.998;0.998	D	0.95639	0.8696	10	0.87932	D	0	-21.9504	7.4588	0.27283	0.0802:0.0:0.6245:0.2953	.	1501;1471	Q4LE28;Q92793	.;CBP_HUMAN	M	1471;1501;1433;60	ENSP00000262367:I1471M;ENSP00000371502:I1433M	ENSP00000262367:I1471M	I	-	3	3	CREBBP	3726799	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.277000	0.33167	0.655000	0.30866	0.561000	0.74099	ATC	CREBBP	-	pfam_Histone_H3-K56_AcTrfase_RTT109		0.507	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBBP	HGNC	protein_coding	OTTHUMT00000251591.2	G	NM_004380		3786798	-1	no_errors	ENST00000262367	ensembl	human	known	70_37	missense	SNP	1.000	C
CSPG4	1464	genome.wustl.edu	37	15	75975192	75975192	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr15:75975192G>T	ENST00000308508.5	-	6	4732	c.4640C>A	c.(4639-4641)tCa>tAa	p.S1547*		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	1547	Gly/Ser-rich (glycosaminoglycan attachment domain).				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						ACCTCTGTGTGAGAACAGCAC	0.731																																																	0													10.0	13.0	12.0					15																	75975192		2182	4266	6448	SO:0001587	stop_gained	1464			X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.4640C>A	15.37:g.75975192G>T	ENSP00000312506:p.Ser1547*		D3DW77|Q92675	Nonsense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	p.S1547*	ENST00000308508.5	37	c.4640	CCDS10284.1	15	.	.	.	.	.	.	.	.	.	.	.	42	9.181289	0.99092	.	.	ENSG00000173546	ENST00000308508	.	.	.	3.95	3.03	0.35002	.	0.687669	0.12109	N	0.498677	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	.	4.1746	0.10346	0.3105:0.0:0.6895:0.0	.	.	.	.	X	1547	.	ENSP00000312506:S1547X	S	-	2	0	CSPG4	73762247	0.775000	0.28604	1.000000	0.80357	0.237000	0.25408	3.997000	0.57016	2.217000	0.71921	0.455000	0.32223	TCA	CSPG4	-	NULL		0.731	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSPG4	HGNC	protein_coding	OTTHUMT00000286472.1	G	NM_001897		75975192	-1	no_errors	ENST00000308508	ensembl	human	known	70_37	nonsense	SNP	0.988	T
CUL4B	8450	genome.wustl.edu	37	X	119678052	119678052	+	Missense_Mutation	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chrX:119678052G>C	ENST00000404115.3	-	9	1545	c.1144C>G	c.(1144-1146)Caa>Gaa	p.Q382E	snoU13_ENST00000605987.1_RNA|CUL4B_ENST00000336592.6_Missense_Mutation_p.Q369E|CUL4B_ENST00000371322.5_Missense_Mutation_p.Q364E	NM_003588.3	NP_003579.3	Q13620	CUL4B_HUMAN	cullin 4B	382					cell cycle (GO:0007049)|histone H2A monoubiquitination (GO:0035518)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of protein catabolic process (GO:0045732)|ubiquitin-dependent protein catabolic process (GO:0006511)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						AAAGAATCTTGATAAATCTGG	0.323																																																	0													58.0	49.0	52.0					X																	119678052		2201	4299	6500	SO:0001583	missense	8450			U58091	CCDS35379.1, CCDS43987.1	Xq23	2011-05-24			ENSG00000158290	ENSG00000158290			2555	protein-coding gene	gene with protein product		300304				8681378	Standard	NM_003588		Approved		uc004esw.3	Q13620	OTTHUMG00000022302	ENST00000404115.3:c.1144C>G	X.37:g.119678052G>C	ENSP00000384109:p.Gln382Glu		B1APK5|B3KVX4|B7Z5K8|Q6PIE4|Q6UP07|Q7Z673|Q9BY37|Q9UEB7|Q9UED7	Missense_Mutation	SNP	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.Q382E	ENST00000404115.3	37	c.1144	CCDS35379.1	X	.	.	.	.	.	.	.	.	.	.	G	10.82	1.457861	0.26161	.	.	ENSG00000158290	ENST00000371322;ENST00000336592;ENST00000404115;ENST00000371323	T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68	5.74	5.74	0.90152	Cullin, N-terminal (1);Cullin repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.55625	0.1932	N	0.13168	0.305	0.80722	D	1	B;B;B	0.16166	0.0;0.016;0.013	B;B;B	0.17433	0.0;0.018;0.01	T	0.51348	-0.8717	9	.	.	.	-11.0531	17.7661	0.88478	0.0:0.0:1.0:0.0	.	186;382;364	Q13620-3;Q13620;Q13620-1	.;CUL4B_HUMAN;.	E	364;369;382;186	ENSP00000360373:Q364E;ENSP00000338919:Q369E;ENSP00000384109:Q382E;ENSP00000360374:Q186E	.	Q	-	1	0	CUL4B	119562080	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.785000	0.99042	2.415000	0.81967	0.600000	0.82982	CAA	CUL4B	-	pfam_Cullin_N,superfamily_Cullin_repeat-like_dom		0.323	CUL4B-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	CUL4B	HGNC	protein_coding	OTTHUMT00000058103.1	G	NM_003588		119678052	-1	no_errors	ENST00000404115	ensembl	human	known	70_37	missense	SNP	1.000	C
DAPK1	1612	genome.wustl.edu	37	9	90301515	90301515	+	Silent	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr9:90301515G>A	ENST00000408954.3	+	21	2609	c.2274G>A	c.(2272-2274)gtG>gtA	p.V758V	DAPK1_ENST00000472284.1_Silent_p.V758V|DAPK1_ENST00000491893.1_Silent_p.V758V|DAPK1_ENST00000358077.5_Silent_p.V758V|DAPK1_ENST00000469640.2_Silent_p.V758V	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	758					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						ACGTGAGTGTGAGGAGCCGCA	0.592									Chronic Lymphocytic Leukemia, Familial Clustering of																																								0													68.0	80.0	76.0					9																	90301515		2129	4252	6381	SO:0001819	synonymous_variant	1612	Familial Cancer Database	Familial CLL	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.2274G>A	9.37:g.90301515G>A			B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_Prot_kinase_cat_dom,prints_Ankyrin_rpt	p.V758	ENST00000408954.3	37	c.2274	CCDS43842.1	9																																																																																			DAPK1	-	NULL		0.592	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DAPK1	HGNC	protein_coding	OTTHUMT00000356843.1	G	NM_004938		90301515	+1	no_errors	ENST00000469640	ensembl	human	known	70_37	silent	SNP	0.993	A
DCUN1D4	23142	genome.wustl.edu	37	4	52709416	52709416	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr4:52709416C>G	ENST00000334635.5	+	1	188	c.8C>G	c.(7-9)tCg>tGg	p.S3W	DCUN1D4_ENST00000381441.3_Missense_Mutation_p.S3W|DCUN1D4_ENST00000513800.1_3'UTR|DCUN1D4_ENST00000381437.4_5'UTR|DCUN1D4_ENST00000451288.2_5'Flank	NM_001040402.1	NP_001035492.1	Q92564	DCNL4_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 4	3						nucleus (GO:0005634)				endometrium(2)|large_intestine(2)|lung(2)|ovary(2)|skin(1)	9			GBM - Glioblastoma multiforme(4;1.93e-11)|LUSC - Lung squamous cell carcinoma(32;0.00654)			AAAATGCACTCGGATGCCGCC	0.726																																																	0													7.0	9.0	8.0					4																	52709416		1792	3522	5314	SO:0001583	missense	23142			D87466	CCDS3487.2, CCDS33982.1, CCDS75123.1	4q11	2013-06-10	2013-06-10		ENSG00000109184	ENSG00000109184			28998	protein-coding gene	gene with protein product		612977	"""DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)"""			15988528	Standard	XM_005265731		Approved	KIAA0276	uc003gze.3	Q92564	OTTHUMG00000128700	ENST00000334635.5:c.8C>G	4.37:g.52709416C>G	ENSP00000334625:p.Ser3Trp		B4DH25|Q7Z3F3|Q7Z6B8	Missense_Mutation	SNP	pfam_PONY_dom	p.S3W	ENST00000334635.5	37	c.8	CCDS33982.1	4	.	.	.	.	.	.	.	.	.	.	c	10.11	1.260856	0.23051	.	.	ENSG00000109184	ENST00000334635;ENST00000381441	.	.	.	4.25	2.51	0.30379	.	1.512270	0.04081	U	0.309678	T	0.36826	0.0981	N	0.08118	0	0.80722	D	1	P;P	0.48640	0.913;0.859	P;P	0.47075	0.465;0.536	T	0.03875	-1.0996	9	0.87932	D	0	.	6.9126	0.24342	0.0:0.7794:0.0:0.2206	.	3;3	Q92564-2;Q92564	.;DCNL4_HUMAN	W	3	.	ENSP00000334625:S3W	S	+	2	0	DCUN1D4	52404173	1.000000	0.71417	0.995000	0.50966	0.962000	0.63368	2.538000	0.45710	0.267000	0.21916	0.454000	0.30748	TCG	DCUN1D4	-	NULL		0.726	DCUN1D4-001	KNOWN	basic|CCDS	protein_coding	DCUN1D4	HGNC	protein_coding	OTTHUMT00000250599.2	C	NM_015115		52709416	+1	no_errors	ENST00000334635	ensembl	human	known	70_37	missense	SNP	1.000	G
DHX38	9785	genome.wustl.edu	37	16	72138925	72138925	+	Splice_Site	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr16:72138925G>C	ENST00000268482.3	+	16	2660		c.e16-1		DHX38_ENST00000536867.1_Intron	NM_014003.3	NP_054722.2	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38						gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(1)|large_intestine(16)|lung(15)|pancreas(1)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	48		Ovarian(137;0.125)				TGCTGTTGCAGACCCCACAGG	0.622																																					Melanoma(97;711 1442 7855 13832 28836)												0													34.0	32.0	33.0					16																	72138925		2198	4300	6498	SO:0001630	splice_region_variant	9785			AF038391	CCDS10907.1	16q22	2008-02-05	2003-06-13	2003-06-20	ENSG00000140829	ENSG00000140829		"""DEAH-boxes"""	17211	protein-coding gene	gene with protein product		605584	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 38"""	DDX38		9524131, 9039502	Standard	NM_014003		Approved	PRP16, KIAA0224, hPrp16, PRPF16	uc002fcb.3	Q92620	OTTHUMG00000137596	ENST00000268482.3:c.2152-1G>C	16.37:g.72138925G>C			B4DVG8|D3DWS7|O75212|Q96HN7	Splice_Site	SNP	-	e15-1	ENST00000268482.3	37	c.2152-1	CCDS10907.1	16	.	.	.	.	.	.	.	.	.	.	G	18.85	3.711335	0.68730	.	.	ENSG00000140829	ENST00000268482	.	.	.	4.69	4.69	0.59074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.7815	0.88524	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DHX38	70696426	1.000000	0.71417	0.996000	0.52242	0.793000	0.44817	8.886000	0.92447	2.597000	0.87782	0.643000	0.83706	.	DHX38	-	-		0.622	DHX38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX38	HGNC	protein_coding	OTTHUMT00000269004.3	G	NM_014003	Intron	72138925	+1	no_errors	ENST00000268482	ensembl	human	known	70_37	splice_site	SNP	1.000	C
DLC1	10395	genome.wustl.edu	37	8	13356682	13356682	+	Nonsense_Mutation	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr8:13356682G>C	ENST00000276297.4	-	2	1308	c.899C>G	c.(898-900)tCa>tGa	p.S300*	DLC1_ENST00000316609.5_Nonsense_Mutation_p.S300*|DLC1_ENST00000511869.1_Nonsense_Mutation_p.S300*	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	300					actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						TTGATGTTGTGAAAAACCACT	0.463																																																	0													196.0	183.0	187.0					8																	13356682		2203	4300	6503	SO:0001587	stop_gained	10395			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.899C>G	8.37:g.13356682G>C	ENSP00000276297:p.Ser300*		B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Nonsense_Mutation	SNP	pfam_START_lipid-bd,pfam_RhoGAP_dom,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,smart_START_lipid-bd,pfscan_START_lipid-bd,pfscan_RhoGAP_dom	p.S300*	ENST00000276297.4	37	c.899	CCDS5989.1	8	.	.	.	.	.	.	.	.	.	.	G	37	6.598005	0.97692	.	.	ENSG00000164741	ENST00000276297;ENST00000316609;ENST00000511869	.	.	.	4.97	3.18	0.36537	.	0.797453	0.10280	N	0.693614	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	11.4785	0.50312	0.1484:0.0:0.8516:0.0	.	.	.	.	X	300	.	ENSP00000276297:S300X	S	-	2	0	DLC1	13401053	1.000000	0.71417	0.998000	0.56505	0.334000	0.28698	3.015000	0.49599	0.816000	0.34421	0.655000	0.94253	TCA	DLC1	-	NULL		0.463	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DLC1	HGNC	protein_coding	OTTHUMT00000207632.2	G	NM_182643, NM_006094		13356682	-1	no_errors	ENST00000276297	ensembl	human	known	70_37	nonsense	SNP	0.999	C
DMP1	1758	genome.wustl.edu	37	4	88584240	88584240	+	Missense_Mutation	SNP	G	G	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr4:88584240G>T	ENST00000339673.6	+	6	1409	c.1310G>T	c.(1309-1311)aGc>aTc	p.S437I	RP11-742B18.1_ENST00000506480.1_RNA|RP11-742B18.1_ENST00000506814.1_RNA|RP11-742B18.1_ENST00000507894.1_RNA|DMP1_ENST00000282479.7_Missense_Mutation_p.S421I	NM_004407.3	NP_004398.1	Q13316	DMP1_HUMAN	dentin matrix acidic phosphoprotein 1	437					biomineral tissue development (GO:0031214)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|positive regulation of cell-substrate adhesion (GO:0010811)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|integrin binding (GO:0005178)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(1)|stomach(1)	32		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.227)		OV - Ovarian serous cystadenocarcinoma(123;0.000516)		CAGTCTCACAGCAGCTCAGCA	0.557																																																	0													55.0	55.0	55.0					4																	88584240		2203	4300	6503	SO:0001583	missense	1758			U34037	CCDS3623.1, CCDS43249.1	4q21	2008-08-29	2008-08-29		ENSG00000152592	ENSG00000152592			2932	protein-coding gene	gene with protein product		600980	"""dentin matrix acidic phosphoprotein"""			8586437, 9177774	Standard	NM_001079911		Approved		uc003hqv.3	Q13316	OTTHUMG00000130598	ENST00000339673.6:c.1310G>T	4.37:g.88584240G>T	ENSP00000340935:p.Ser437Ile		A1L4L3|O43265	Missense_Mutation	SNP	pfam_DMP1	p.S437I	ENST00000339673.6	37	c.1310	CCDS3623.1	4	.	.	.	.	.	.	.	.	.	.	G	10.82	1.459120	0.26248	.	.	ENSG00000152592	ENST00000339673;ENST00000282479	T;T	0.54479	0.57;0.57	5.4	5.4	0.78164	.	0.000000	0.64402	D	0.000001	T	0.73118	0.3546	M	0.76328	2.33	0.54753	D	0.999985	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.76310	-0.3006	10	0.87932	D	0	-15.6548	16.9572	0.86262	0.0:0.0:1.0:0.0	.	421;437	Q13316-2;Q13316	.;DMP1_HUMAN	I	437;421	ENSP00000340935:S437I;ENSP00000282479:S421I	ENSP00000282479:S421I	S	+	2	0	DMP1	88803264	1.000000	0.71417	0.054000	0.19295	0.008000	0.06430	6.190000	0.72057	2.520000	0.84964	0.591000	0.81541	AGC	DMP1	-	pfam_DMP1		0.557	DMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMP1	HGNC	protein_coding	OTTHUMT00000253047.1	G			88584240	+1	no_errors	ENST00000339673	ensembl	human	known	70_37	missense	SNP	0.761	T
DNAH6	1768	genome.wustl.edu	37	2	84756046	84756046	+	Missense_Mutation	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr2:84756046G>C	ENST00000237449.6	+	3	426	c.418G>C	c.(418-420)Gag>Cag	p.E140Q	DNAH6_ENST00000468661.1_Intron|DNAH6_ENST00000398278.2_Missense_Mutation_p.E140Q|DNAH6_ENST00000389394.3_Missense_Mutation_p.E140Q			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	140	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						GCCCTATGTTGAGGTGTTCTC	0.388																																																	0													117.0	86.0	95.0					2																	84756046		692	1591	2283	SO:0001583	missense	1768			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.418G>C	2.37:g.84756046G>C	ENSP00000237449:p.Glu140Gln		A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.E140Q	ENST00000237449.6	37	c.418	CCDS46348.1	2	.	.	.	.	.	.	.	.	.	.	G	7.357	0.624047	0.14193	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.25250	1.81;1.94;1.81	5.08	3.23	0.37069	.	.	.	.	.	T	0.10852	0.0265	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.35992	-0.9766	9	0.15952	T	0.53	.	4.7332	0.12975	0.2518:0.1635:0.5846:0.0	.	140	Q9C0G6	DYH6_HUMAN	Q	140	ENSP00000374045:E140Q;ENSP00000381326:E140Q;ENSP00000237449:E140Q	ENSP00000237449:E140Q	E	+	1	0	DNAH6	84609557	0.711000	0.27906	0.005000	0.12908	0.050000	0.14768	2.497000	0.45354	0.605000	0.29947	0.511000	0.50034	GAG	DNAH6	-	NULL		0.388	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH6	HGNC	protein_coding	OTTHUMT00000328537.2	G	NM_001370		84756046	+1	no_errors	ENST00000237449	ensembl	human	known	70_37	missense	SNP	0.005	C
DPYSL3	1809	genome.wustl.edu	37	5	146795360	146795360	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr5:146795360C>G	ENST00000398514.3	-	4	761	c.390G>C	c.(388-390)aaG>aaC	p.K130N	DPYSL3_ENST00000343218.5_Missense_Mutation_p.K244N|DPYSL3_ENST00000534907.1_Intron	NM_001387.2	NP_001378.1	Q14195	DPYL3_HUMAN	dihydropyrimidinase-like 3	130					actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cell migration (GO:0030336)|negative regulation of neuron projection development (GO:0010977)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron projection development (GO:0010976)|protein homooligomerization (GO:0051260)|pyrimidine nucleobase catabolic process (GO:0006208)|response to axon injury (GO:0048678)	cell body (GO:0044297)|cytosol (GO:0005829)|extracellular space (GO:0005615)|filamentous actin (GO:0031941)|growth cone (GO:0030426)|lamellipodium (GO:0030027)	chondroitin sulfate binding (GO:0035374)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)|SH3 domain binding (GO:0017124)			breast(2)|endometrium(1)|kidney(4)|large_intestine(6)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACAGCAACTCTTCCCATCAG	0.542																																																	0													245.0	247.0	247.0					5																	146795360		2137	4239	6376	SO:0001583	missense	1809			D78014	CCDS43381.1, CCDS56387.1	5q32	2008-02-05							3015	protein-coding gene	gene with protein product		601168				8973361, 9115293	Standard	NM_001197294		Approved	DRP-3, ULIP, CRMP4	uc003loo.3	Q14195		ENST00000398514.3:c.390G>C	5.37:g.146795360C>G	ENSP00000381526:p.Lys130Asn		B3SXQ8|Q93012	Missense_Mutation	SNP	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.K130N	ENST00000398514.3	37	c.390	CCDS43381.1	5	.	.	.	.	.	.	.	.	.	.	C	24.6	4.544186	0.86022	.	.	ENSG00000113657	ENST00000398514;ENST00000343218	D;D	0.90563	-2.69;-2.69	6.03	6.03	0.97812	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.096550	0.64402	D	0.000001	D	0.93989	0.8075	M	0.69823	2.125	0.80722	D	1	D;P	0.56035	0.974;0.794	P;P	0.62184	0.899;0.474	D	0.93980	0.7257	10	0.87932	D	0	-7.8819	13.7134	0.62682	0.0:0.9301:0.0:0.0699	.	244;130	B3SXQ8;Q14195	.;DPYL3_HUMAN	N	130;244	ENSP00000381526:K130N;ENSP00000343690:K244N	ENSP00000343690:K244N	K	-	3	2	DPYSL3	146775553	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.021000	0.30040	2.861000	0.98227	0.655000	0.94253	AAG	DPYSL3	-	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase		0.542	DPYSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYSL3	HGNC	protein_coding	OTTHUMT00000373421.2	C	NM_001387		146795360	-1	no_errors	ENST00000398514	ensembl	human	known	70_37	missense	SNP	1.000	G
DYM	54808	genome.wustl.edu	37	18	46798640	46798640	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr18:46798640C>T	ENST00000269445.6	-	11	1616	c.1159G>A	c.(1159-1161)Gaa>Aaa	p.E387K	DYM_ENST00000442713.2_Missense_Mutation_p.E197K	NM_017653.3	NP_060123.3	Q7RTS9	DYM_HUMAN	dymeclin	387					bone development (GO:0060348)|Golgi organization (GO:0007030)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	enzyme binding (GO:0019899)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	18						TTCCTTTCTTCAACATGATAC	0.299																																																	0													94.0	86.0	88.0					18																	46798640		2203	4299	6502	SO:0001583	missense	54808			AK000078	CCDS11937.1	18q21.1	2008-03-12			ENSG00000141627	ENSG00000141627			21317	protein-coding gene	gene with protein product		607461					Standard	NM_017653		Approved	FLJ20071, DMC, SMC	uc002ldi.1	Q7RTS9	OTTHUMG00000132659	ENST00000269445.6:c.1159G>A	18.37:g.46798640C>T	ENSP00000269445:p.Glu387Lys		A8K5I8|B2RCF9|B4DKI7|Q3ZTS8|Q6P2P5|Q8N2M0|Q9BVE9|Q9NPU7	Missense_Mutation	SNP	pfam_Dymeclin,superfamily_ARM-type_fold	p.E387K	ENST00000269445.6	37	c.1159	CCDS11937.1	18	.	.	.	.	.	.	.	.	.	.	C	24.0	4.484189	0.84854	.	.	ENSG00000141627	ENST00000442713;ENST00000269445	D;D	0.83419	-1.72;-1.72	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	D	0.89518	0.6738	L	0.58669	1.825	0.80722	D	1	P;D;D	0.69078	0.932;0.997;0.984	P;D;P	0.80764	0.647;0.994;0.802	D	0.89187	0.3548	10	0.45353	T	0.12	-16.6365	18.4338	0.90636	0.0:1.0:0.0:0.0	.	197;209;387	Q7RTS9-2;Q9NXS9;Q7RTS9	.;.;DYM_HUMAN	K	197;387	ENSP00000395942:E197K;ENSP00000269445:E387K	ENSP00000269445:E387K	E	-	1	0	DYM	45052638	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.456000	0.80751	2.359000	0.80004	0.585000	0.79938	GAA	DYM	-	pfam_Dymeclin,superfamily_ARM-type_fold		0.299	DYM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYM	HGNC	protein_coding	OTTHUMT00000255912.3	C	NM_017653		46798640	-1	no_errors	ENST00000269445	ensembl	human	known	70_37	missense	SNP	1.000	T
EHD2	30846	genome.wustl.edu	37	19	48244378	48244378	+	Missense_Mutation	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr19:48244378G>A	ENST00000263277.3	+	6	1572	c.1321G>A	c.(1321-1323)Gag>Aag	p.E441K	EHD2_ENST00000540884.1_3'UTR|EHD2_ENST00000538399.1_Missense_Mutation_p.E305K	NM_014601.3	NP_055416.2	Q9NZN4	EHD2_HUMAN	EH-domain containing 2	441					blood coagulation (GO:0007596)|cortical actin cytoskeleton organization (GO:0030866)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of myoblast fusion (GO:1901741)|protein localization to plasma membrane (GO:0072659)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)			endometrium(3)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	19		all_cancers(25;6.74e-07)|all_lung(116;2.02e-05)|Lung NSC(112;3.77e-05)|all_epithelial(76;4.89e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		OV - Ovarian serous cystadenocarcinoma(262;0.000336)|all cancers(93;0.000415)|Epithelial(262;0.0132)|GBM - Glioblastoma multiforme(486;0.0537)		CTCGGACGACGAGGCCGAGTG	0.657																																																	0													76.0	63.0	67.0					19																	48244378		2203	4299	6502	SO:0001583	missense	30846			AF181263	CCDS12704.1	19q13.3	2014-08-12			ENSG00000024422	ENSG00000024422		"""EF-hand domain containing"""	3243	protein-coding gene	gene with protein product		605890		PAST2		10673336	Standard	NM_014601		Approved		uc002phj.4	Q9NZN4	OTTHUMG00000183266	ENST00000263277.3:c.1321G>A	19.37:g.48244378G>A	ENSP00000263277:p.Glu441Lys		B2RDH9|B4DNU6|Q96CB6	Missense_Mutation	SNP	pfam_Dynamin_GTPase,smart_EPS15_homology,pfscan_EF_HAND_2,pfscan_EPS15_homology	p.E441K	ENST00000263277.3	37	c.1321	CCDS12704.1	19	.	.	.	.	.	.	.	.	.	.	G	14.65	2.597401	0.46318	.	.	ENSG00000024422	ENST00000263277;ENST00000540364;ENST00000538399;ENST00000540884	T;T	0.23348	2.23;1.91	4.13	4.13	0.48395	EF-hand-like domain (1);	0.279758	0.33040	N	0.005353	T	0.20659	0.0497	L	0.37697	1.125	0.80722	D	1	B	0.21452	0.056	B	0.20384	0.029	T	0.04467	-1.0949	9	.	.	.	-19.3214	14.267	0.66126	0.0:0.0:1.0:0.0	.	441	Q9NZN4	EHD2_HUMAN	K	441;431;305;124	ENSP00000263277:E441K;ENSP00000439036:E305K	.	E	+	1	0	EHD2	52936190	1.000000	0.71417	0.975000	0.42487	0.093000	0.18481	7.227000	0.78070	2.024000	0.59613	0.561000	0.74099	GAG	EHD2	-	NULL		0.657	EHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHD2	HGNC	protein_coding	OTTHUMT00000465851.1	G			48244378	+1	no_errors	ENST00000263277	ensembl	human	known	70_37	missense	SNP	1.000	A
AGO4	192670	genome.wustl.edu	37	1	36307229	36307229	+	Missense_Mutation	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr1:36307229G>C	ENST00000373210.3	+	15	2298	c.2053G>C	c.(2053-2055)Gaa>Caa	p.E685Q		NM_017629.3	NP_060099.2	Q9HCK5	AGO4_HUMAN	argonaute RISC catalytic component 4	685	Piwi. {ECO:0000255|HAMAP-Rule:MF_03033}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)										AGCTTGGCCAGAACTAATAGC	0.393																																																	0													96.0	96.0	96.0					1																	36307229		2203	4300	6503	SO:0001583	missense	192670			AB046787	CCDS397.1	1p34	2013-02-15	2013-02-15	2013-02-15	ENSG00000134698	ENSG00000134698		"""Argonaute/PIWI family"""	18424	protein-coding gene	gene with protein product	"""argonaute 4"""	607356	"""eukaryotic translation initiation factor 2C, 4"""	EIF2C4		12906857	Standard	NM_017629		Approved	hAGO4, KIAA1567, FLJ20033	uc001bzj.2	Q9HCK5	OTTHUMG00000004243	ENST00000373210.3:c.2053G>C	1.37:g.36307229G>C	ENSP00000362306:p.Glu685Gln		A7MD27	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ,pfam_DUF1785,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.E685Q	ENST00000373210.3	37	c.2053	CCDS397.1	1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.900924	0.92035	.	.	ENSG00000134698	ENST00000373210	T	0.57907	0.37	5.87	5.87	0.94306	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	D	0.86493	0.5946	H	0.99626	4.665	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92120	0.5703	10	0.87932	D	0	-22.236	20.2181	0.98305	0.0:0.0:1.0:0.0	.	685	Q9HCK5	AGO4_HUMAN	Q	685	ENSP00000362306:E685Q	ENSP00000362306:E685Q	E	+	1	0	EIF2C4	36079816	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.737000	0.98831	2.785000	0.95823	0.655000	0.94253	GAA	EIF2C4	-	pfam_Piwi,superfamily_RNaseH-like_dom,smart_Piwi,pfscan_Piwi		0.393	AGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2C4	HGNC	protein_coding	OTTHUMT00000012213.3	G	NM_017629		36307229	+1	no_errors	ENST00000373210	ensembl	human	known	70_37	missense	SNP	1.000	C
SNORA70	26778	genome.wustl.edu	37	18	3025468	3025468	+	RNA	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr18:3025468G>C	ENST00000516449.1	-	0	96									small nucleolar RNA, H/ACA box 70																		ACCCATACAAGAAACAGGCTG	0.458																																																	0																																												0			Y11164		Xq28	2013-09-05	2006-04-05	2006-04-05	ENSG00000207165	ENSG00000207165		"""ncRNAs / Small nucleolar RNAs : H/ACA box containing"""	10231	non-coding RNA	RNA, small nucleolar			"""RNA, U70 small nucleolar"""	RNU70		9106664, 15199136	Standard	NR_000011		Approved	U70, DXS648E	uc021raw.1				18.37:g.3025468G>C				RNA	SNP	-	NULL	ENST00000516449.1	37	NULL		18																																																																																			SNORA70	-	-		0.458	SNORA70.21-201	NOVEL	basic	snoRNA	ENSG00000252258	RFAM	snoRNA		G	NR_000011		3025468	-1	no_errors	ENST00000516449	ensembl	human	novel	70_37	rna	SNP	0.657	C
ESRRA	2101	genome.wustl.edu	37	11	64082560	64082560	+	Nonsense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr11:64082560C>G	ENST00000405666.1	+	6	1064	c.830C>G	c.(829-831)tCa>tGa	p.S277*	ESRRA_ENST00000000442.6_Nonsense_Mutation_p.S277*|PRDX5_ENST00000265462.4_5'Flank|ESRRA_ENST00000406310.1_Nonsense_Mutation_p.S276*	NM_001282450.1	NP_001269379.1	P11474	ERR1_HUMAN	estrogen-related receptor alpha	277	Ligand binding domain.				cartilage development (GO:0051216)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(4)|lung(8)	14						GCCCAGCGCTCACTGCCACTG	0.647																																																	0													19.0	21.0	21.0					11																	64082560		2124	4235	6359	SO:0001587	stop_gained	2101			X51416, L38487	CCDS41667.1, CCDS60830.1	11q12	2013-01-16			ENSG00000173153	ENSG00000173153		"""Nuclear hormone receptors"""	3471	protein-coding gene	gene with protein product		601998		ESRL1		3267207	Standard	NM_004451		Approved	ERR1, ERRalpha, NR3B1, ERRa	uc001nzq.1	P11474	OTTHUMG00000150641	ENST00000405666.1:c.830C>G	11.37:g.64082560C>G	ENSP00000384851:p.Ser277*		Q14514	Nonsense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.S277*	ENST00000405666.1	37	c.830	CCDS41667.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.37|16.37	3.103783|3.103783	0.56291|0.56291	.|.	.|.	ENSG00000173153|ENSG00000173153	ENST00000545035|ENST00000406310;ENST00000000442;ENST00000539594;ENST00000405666	.|.	.|.	.|.	4.14|4.14	4.14|4.14	0.48551|0.48551	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	T|.	0.69762|.	0.3147|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.79485|.	-0.1784|.	3|.	.|0.87932	.|D	.|0	.|.	14.3272|14.3272	0.66528|0.66528	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	D|X	58|276;277;134;277	.|.	.|ENSP00000000442:S277X	H|S	+|+	1|2	0|0	ESRRA|ESRRA	63839136|63839136	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.975000|0.975000	0.68041|0.68041	7.606000|7.606000	0.82863|0.82863	2.309000|2.309000	0.77851|0.77851	0.462000|0.462000	0.41574|0.41574	CAC|TCA	ESRRA	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core		0.647	ESRRA-003	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	ESRRA	HGNC	protein_coding	OTTHUMT00000319304.1	C	NM_004451		64082560	+1	no_errors	ENST00000000442	ensembl	human	known	70_37	nonsense	SNP	1.000	G
FAM124B	79843	genome.wustl.edu	37	2	225244772	225244772	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr2:225244772C>G	ENST00000409685.3	-	2	1151	c.886G>C	c.(886-888)Gag>Cag	p.E296Q	FAM124B_ENST00000389874.3_3'UTR	NM_001122779.1	NP_001116251.1	Q9H5Z6	F124B_HUMAN	family with sequence similarity 124B	296										endometrium(2)|large_intestine(2)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	16		Renal(207;0.0112)|all_lung(227;0.0126)|Lung NSC(271;0.0161)|all_hematologic(139;0.138)		Epithelial(121;4.4e-10)|all cancers(144;2.02e-07)|Lung(261;0.00766)|LUSC - Lung squamous cell carcinoma(224;0.00825)		TCAGGAAGCTCCAGAGAATGC	0.617																																																	0													27.0	32.0	31.0					2																	225244772		692	1591	2283	SO:0001583	missense	79843			AK075126	CCDS2461.1, CCDS46527.1	2q36.2	2008-02-05			ENSG00000124019	ENSG00000124019			26224	protein-coding gene	gene with protein product						12477932	Standard	NM_001122779		Approved	FLJ22746	uc002vnx.3	Q9H5Z6	OTTHUMG00000133168	ENST00000409685.3:c.886G>C	2.37:g.225244772C>G	ENSP00000386895:p.Glu296Gln		A6NNC7|Q8NBZ4|Q8TAV7	Missense_Mutation	SNP	NULL	p.E296Q	ENST00000409685.3	37	c.886	CCDS46527.1	2	.	.	.	.	.	.	.	.	.	.	C	12.78	2.040860	0.35989	.	.	ENSG00000124019	ENST00000409685	T	0.34472	1.36	5.81	4.01	0.46588	.	.	.	.	.	T	0.37128	0.0992	L	0.27053	0.805	0.21499	N	0.999662	D	0.56746	0.977	P	0.55923	0.787	T	0.09378	-1.0677	9	0.45353	T	0.12	-13.3325	8.1074	0.30894	0.0:0.8222:0.0:0.1778	.	296	Q9H5Z6	F124B_HUMAN	Q	296	ENSP00000386895:E296Q	ENSP00000386895:E296Q	E	-	1	0	FAM124B	224953016	0.007000	0.16637	0.127000	0.21898	0.555000	0.35460	0.866000	0.27954	1.448000	0.47680	0.655000	0.94253	GAG	FAM124B	-	NULL		0.617	FAM124B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM124B	HGNC	protein_coding	OTTHUMT00000330873.1	C	NM_024785		225244772	-1	no_errors	ENST00000409685	ensembl	human	known	70_37	missense	SNP	0.018	G
FAM64A	54478	genome.wustl.edu	37	17	6348471	6348471	+	Missense_Mutation	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr17:6348471G>A	ENST00000250056.8	+	2	124	c.41G>A	c.(40-42)cGg>cAg	p.R14Q	FAM64A_ENST00000571373.1_Missense_Mutation_p.R14Q|FAM64A_ENST00000576056.1_Missense_Mutation_p.R14Q|FAM64A_ENST00000570337.2_Missense_Mutation_p.R14Q|FAM64A_ENST00000572447.1_Missense_Mutation_p.R14Q|FAM64A_ENST00000572595.2_Missense_Mutation_p.R14Q	NM_001195228.1	NP_001182157.1	Q9BSJ6	FA64A_HUMAN	family with sequence similarity 64, member A	14					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				COAD - Colon adenocarcinoma(228;0.141)		TCCGTGCGCCGGAGATCTCTC	0.632																																																	0													26.0	29.0	28.0					17																	6348471		2203	4300	6503	SO:0001583	missense	54478				CCDS32541.1, CCDS56016.1	17p13.2	2013-10-11			ENSG00000129195	ENSG00000129195			25483	protein-coding gene	gene with protein product	"""CALM interacting protein expressed in thymus and spleen"""					19383357, 16491119	Standard	NM_019013		Approved	FLJ10156, FLJ10491, CATS	uc002gcw.2	Q9BSJ6	OTTHUMG00000177832	ENST00000250056.8:c.41G>A	17.37:g.6348471G>A	ENSP00000250056:p.Arg14Gln		Q96CT4|Q9NVV1|Q9NWB5	Missense_Mutation	SNP	pfam_DUF1466	p.R14Q	ENST00000250056.8	37	c.41	CCDS56016.1	17	.	.	.	.	.	.	.	.	.	.	G	15.50	2.851865	0.51270	.	.	ENSG00000129195	ENST00000250056;ENST00000308855	T	0.57436	0.4	4.51	-0.0923	0.13657	.	0.758999	0.11847	N	0.523713	T	0.61098	0.2320	M	0.67953	2.075	0.09310	N	1	D;D	0.89917	0.998;1.0	D;D	0.79108	0.992;0.947	T	0.49934	-0.8886	10	0.24483	T	0.36	-8.6214	3.5764	0.07936	0.196:0.0:0.4627:0.3414	.	14;14	Q9BSJ6;Q9BSJ6-2	FA64A_HUMAN;.	Q	14	ENSP00000250056:R14Q	ENSP00000250056:R14Q	R	+	2	0	FAM64A	6289195	0.048000	0.20356	0.016000	0.15963	0.070000	0.16714	1.398000	0.34554	0.112000	0.17975	-0.181000	0.13052	CGG	FAM64A	-	pfam_DUF1466		0.632	FAM64A-008	KNOWN	basic|CCDS	protein_coding	FAM64A	HGNC	protein_coding	OTTHUMT00000439156.1	G	NM_019013		6348471	+1	no_errors	ENST00000250056	ensembl	human	known	70_37	missense	SNP	0.004	A
FANCB	2187	genome.wustl.edu	37	X	14883161	14883161	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chrX:14883161C>T	ENST00000324138.3	-	2	625	c.472G>A	c.(472-474)Ggc>Agc	p.G158S	FANCB_ENST00000398334.1_Missense_Mutation_p.G158S	NM_152633.2	NP_689846.1	Q8NB91	FANCB_HUMAN	Fanconi anemia, complementation group B	158					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24	Hepatocellular(33;0.183)					ACAACTTTGCCAGTTTGAGAA	0.388								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																								0													72.0	71.0	71.0					X																	14883161		2203	4299	6502	SO:0001583	missense	2187	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK091383	CCDS14161.1	Xp22.2	2014-09-17			ENSG00000181544	ENSG00000181544		"""Fanconi anemia, complementation groups"""	3583	protein-coding gene	gene with protein product		300515				9382107, 15502827	Standard	NM_152633		Approved	FAB, FLJ34064, FAAP95	uc004cwh.1	Q8NB91	OTTHUMG00000021168	ENST00000324138.3:c.472G>A	X.37:g.14883161C>T	ENSP00000326819:p.Gly158Ser		B2RMZ4|Q7Z2U2|Q86XG1	Missense_Mutation	SNP	NULL	p.G158S	ENST00000324138.3	37	c.472	CCDS14161.1	X	.	.	.	.	.	.	.	.	.	.	C	0.120	-1.126516	0.01770	.	.	ENSG00000181544	ENST00000324138;ENST00000398334;ENST00000452869	T;T;T	0.34667	1.35;1.35;1.35	5.52	-0.501	0.12008	.	0.982723	0.08347	N	0.959848	T	0.15305	0.0369	N	0.05383	-0.06	0.09310	N	1	B	0.06786	0.001	B	0.13407	0.009	T	0.26710	-1.0095	10	0.20046	T	0.44	1.2132	2.707	0.05165	0.0989:0.3719:0.2852:0.244	.	158	Q8NB91	FANCB_HUMAN	S	158	ENSP00000326819:G158S;ENSP00000381378:G158S;ENSP00000397849:G158S	ENSP00000326819:G158S	G	-	1	0	FANCB	14793082	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.817000	0.04472	-0.525000	0.06391	-0.994000	0.02522	GGC	FANCB	-	NULL		0.388	FANCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCB	HGNC	protein_coding	OTTHUMT00000055835.1	C	NM_152633		14883161	-1	no_errors	ENST00000324138	ensembl	human	known	70_37	missense	SNP	0.001	T
FBN2	2201	genome.wustl.edu	37	5	127653955	127653955	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr5:127653955C>T	ENST00000508053.1	-	42	5577	c.4603G>A	c.(4603-4605)Gag>Aag	p.E1535K	FBN2_ENST00000262464.4_Missense_Mutation_p.E1535K			P35556	FBN2_HUMAN	fibrillin 2	1535	EGF-like 26; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TCTGCACACTCATCAATATCT	0.423																																																	0													212.0	206.0	208.0					5																	127653955		2203	4300	6503	SO:0001583	missense	2201			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.4603G>A	5.37:g.127653955C>T	ENSP00000424571:p.Glu1535Lys		B4DU01|Q59ES6	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Cadherin-like,smart_EG-like_dom,smart_EGF-like_Ca-bd,pirsf_FBN,pfscan_EG-like_dom	p.E1535K	ENST00000508053.1	37	c.4603	CCDS34222.1	5	.	.	.	.	.	.	.	.	.	.	C	35	5.591783	0.96590	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.98849	-5.18;-5.18	5.16	5.16	0.70880	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000006	D	0.99357	0.9774	M	0.93106	3.38	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.98866	1.0764	10	0.87932	D	0	.	18.82	0.92092	0.0:1.0:0.0:0.0	.	1535	P35556	FBN2_HUMAN	K	1535	ENSP00000262464:E1535K;ENSP00000424571:E1535K	ENSP00000262464:E1535K	E	-	1	0	FBN2	127681854	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.609000	0.82925	2.840000	0.97914	0.655000	0.94253	GAG	FBN2	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EG-like_dom,pirsf_FBN,pfscan_EG-like_dom		0.423	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	HGNC	protein_coding	OTTHUMT00000371618.2	C	NM_001999		127653955	-1	no_errors	ENST00000262464	ensembl	human	known	70_37	missense	SNP	1.000	T
FHOD1	29109	genome.wustl.edu	37	16	67265247	67265247	+	Silent	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr16:67265247G>A	ENST00000258201.4	-	17	2758	c.2511C>T	c.(2509-2511)agC>agT	p.S837S		NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	837	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		GCTCAAAGCCGCTGCTCTGAA	0.587																																																	0													84.0	80.0	81.0					16																	67265247		2198	4300	6498	SO:0001819	synonymous_variant	29109			AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.2511C>T	16.37:g.67265247G>A			Q59F76|Q6Y1F2|Q76MS8|Q8N521	Silent	SNP	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,superfamily_ARM-type_fold,smart_Actin-bd_FH2/DRF_autoreg	p.S837	ENST00000258201.4	37	c.2511	CCDS10834.1	16																																																																																			FHOD1	-	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg		0.587	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FHOD1	HGNC	protein_coding	OTTHUMT00000268844.2	G			67265247	-1	no_errors	ENST00000258201	ensembl	human	known	70_37	silent	SNP	0.874	A
FLG	2312	genome.wustl.edu	37	1	152277071	152277071	+	Nonsense_Mutation	SNP	G	G	A	rs545185518		TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr1:152277071G>A	ENST00000368799.1	-	3	10326	c.10291C>T	c.(10291-10293)Cag>Tag	p.Q3431*	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3431	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATGGTGTCCTGACCCTCTTGG	0.607									Ichthyosis																																								0													252.0	259.0	257.0					1																	152277071		2203	4299	6502	SO:0001587	stop_gained	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.10291C>T	1.37:g.152277071G>A	ENSP00000357789:p.Gln3431*		Q01720|Q5T583|Q9UC71	Nonsense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.Q3431*	ENST00000368799.1	37	c.10291	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	G	49	15.968876	0.99850	.	.	ENSG00000143631	ENST00000368799	.	.	.	4.06	1.94	0.25998	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	.	9.9333	0.41537	0.0:0.4413:0.5587:0.0	.	.	.	.	X	3431	.	ENSP00000357789:Q3431X	Q	-	1	0	FLG	150543695	0.000000	0.05858	0.009000	0.14445	0.031000	0.12232	-0.088000	0.11198	0.818000	0.34468	0.454000	0.30748	CAG	FLG	-	NULL		0.607	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	G	NM_002016		152277071	-1	no_errors	ENST00000368799	ensembl	human	known	70_37	nonsense	SNP	0.001	A
FLG	2312	genome.wustl.edu	37	1	152277550	152277550	+	Missense_Mutation	SNP	G	G	C	rs200552322		TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr1:152277550G>C	ENST00000368799.1	-	3	9847	c.9812C>G	c.(9811-9813)tCc>tGc	p.S3271C	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3271	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGATTGTCTGGAGCGGTCTGC	0.582									Ichthyosis																																								0													310.0	307.0	308.0					1																	152277550		2203	4300	6503	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.9812C>G	1.37:g.152277550G>C	ENSP00000357789:p.Ser3271Cys		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.S3271C	ENST00000368799.1	37	c.9812	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	G	9.591	1.126133	0.20959	.	.	ENSG00000143631	ENST00000368799;ENST00000368796	T	0.00882	5.58	2.67	2.67	0.31697	.	.	.	.	.	T	0.01800	0.0057	M	0.72118	2.19	0.09310	N	1	D	0.76494	0.999	D	0.81914	0.995	T	0.46569	-0.9182	9	0.66056	D	0.02	1.2554	8.9158	0.35581	0.0:0.0:1.0:0.0	.	3271	P20930	FILA_HUMAN	C	3271;209	ENSP00000357789:S3271C	ENSP00000357786:S209C	S	-	2	0	FLG	150544174	0.001000	0.12720	0.002000	0.10522	0.004000	0.04260	0.634000	0.24614	1.493000	0.48517	0.298000	0.19748	TCC	FLG	-	NULL		0.582	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	G	NM_002016		152277550	-1	no_errors	ENST00000368799	ensembl	human	known	70_37	missense	SNP	0.002	C
FOS	2353	genome.wustl.edu	37	14	75747739	75747739	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr14:75747739C>T	ENST00000303562.4	+	4	964	c.755C>T	c.(754-756)tCa>tTa	p.S252L	FOS_ENST00000535987.1_Missense_Mutation_p.S216L|FOS_ENST00000555686.1_Missense_Mutation_p.S138L|FOS_ENST00000555347.1_Missense_Mutation_p.S104L	NM_005252.3	NP_005243.1	P01100	FOS_HUMAN	FBJ murine osteosarcoma viral oncogene homolog	252					aging (GO:0007568)|cellular response to calcium ion (GO:0071277)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hormone stimulus (GO:0032870)|cellular response to reactive oxygen species (GO:0034614)|conditioned taste aversion (GO:0001661)|DNA methylation (GO:0006306)|Fc-epsilon receptor signaling pathway (GO:0038095)|female pregnancy (GO:0007565)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nervous system development (GO:0007399)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to cold (GO:0009409)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to gravity (GO:0009629)|response to light stimulus (GO:0009416)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|skeletal muscle cell differentiation (GO:0035914)|sleep (GO:0030431)|SMAD protein signal transduction (GO:0060395)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	double-stranded DNA binding (GO:0003690)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		all_lung(585;0.0138)|all_epithelial(191;0.0263)|all_neural(303;0.112)		BRCA - Breast invasive adenocarcinoma(234;0.0117)	Nadroparin(DB08813)|Pseudoephedrine(DB00852)	CCCAAGCCCTCAGTGGAACCT	0.597																																																	0													72.0	70.0	71.0					14																	75747739		2203	4300	6503	SO:0001583	missense	2353			K00650	CCDS9841.1	14q24.3	2013-01-10	2009-07-23			ENSG00000170345		"""basic leucine zipper proteins"""	3796	protein-coding gene	gene with protein product		164810	"""v-fos FBJ murine osteosarcoma viral oncogene homolog"""			16123044, 16055710, 15926923	Standard	NM_005252		Approved	c-fos, AP-1	uc001xrn.3	P01100		ENST00000303562.4:c.755C>T	14.37:g.75747739C>T	ENSP00000306245:p.Ser252Leu		A8K4E2|B4DQ65|P18849	Missense_Mutation	SNP	pfam_bZIP,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Fos	p.S252L	ENST00000303562.4	37	c.755	CCDS9841.1	14	.	.	.	.	.	.	.	.	.	.	C	11.44	1.640360	0.29157	.	.	ENSG00000170345	ENST00000303562;ENST00000535987;ENST00000555686;ENST00000555672;ENST00000555347	T;T;T	0.65916	0.42;0.8;-0.18	4.96	4.96	0.65561	.	0.728644	0.13384	N	0.391952	T	0.61578	0.2358	L	0.55990	1.75	0.39307	D	0.965014	B;B	0.20988	0.05;0.03	B;B	0.26770	0.073;0.017	T	0.56902	-0.7902	10	0.22706	T	0.39	-11.3293	18.1844	0.89788	0.0:1.0:0.0:0.0	.	216;252	B4DQ65;P01100	.;FOS_HUMAN	L	252;216;138;102;104	ENSP00000306245:S252L;ENSP00000442268:S216L;ENSP00000452590:S138L	ENSP00000306245:S252L	S	+	2	0	FOS	74817492	0.006000	0.16342	0.954000	0.39281	0.768000	0.43524	1.281000	0.33214	2.459000	0.83118	0.563000	0.77884	TCA	FOS	-	NULL		0.597	FOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOS	HGNC	protein_coding	OTTHUMT00000415044.1	C	NM_005252		75747739	+1	no_errors	ENST00000303562	ensembl	human	known	70_37	missense	SNP	0.976	T
G3BP2	9908	genome.wustl.edu	37	4	76598498	76598498	+	5'UTR	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr4:76598498C>G	ENST00000359707.4	-	0	655				G3BP2_ENST00000502654.1_5'UTR|G3BP2_ENST00000395719.3_5'Flank|G3BP2_ENST00000357854.3_5'UTR	NM_203505.2	NP_987101.1	Q9UN86	G3BP2_HUMAN	GTPase activating protein (SH3 domain) binding protein 2						cytoplasmic sequestering of NF-kappaB (GO:0007253)|mRNA transport (GO:0051028)|Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|receptor signaling complex scaffold activity (GO:0030159)			breast(3)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	27			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			TCCGACAACTCGGAAGCCTCG	0.692																																																	0																																										SO:0001623	5_prime_UTR_variant	9908			AB014560	CCDS3571.1, CCDS3572.1	4q21.1	2013-02-12	2006-11-01		ENSG00000138757	ENSG00000138757		"""RNA binding motif (RRM) containing"""	30291	protein-coding gene	gene with protein product	"""Ras-GTPase activating protein SH3 domain-binding protein 2"""					9734811, 9575347	Standard	NM_203504		Approved	KIAA0660	uc003his.3	Q9UN86	OTTHUMG00000130097	ENST00000359707.4:c.-131G>C	4.37:g.76598498C>G			A8K6X1|O60606|O75149|Q9UPA1	RNA	SNP	-	NULL	ENST00000359707.4	37	NULL	CCDS3571.1	4																																																																																			G3BP2	-	-		0.692	G3BP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	G3BP2	HGNC	protein_coding	OTTHUMT00000252399.2	C	NM_012297		76598498	-1	no_errors	ENST00000502654	ensembl	human	known	70_37	rna	SNP	0.000	G
GALK1	2584	genome.wustl.edu	37	17	73760097	73760097	+	Missense_Mutation	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr17:73760097G>C	ENST00000588479.1	-	2	810	c.236C>G	c.(235-237)tCt>tGt	p.S79C	GALK1_ENST00000437911.1_Missense_Mutation_p.S109C|GALK1_ENST00000225614.2_Missense_Mutation_p.S79C			P51570	GALK1_HUMAN	galactokinase 1	79					carbohydrate metabolic process (GO:0005975)|galactitol metabolic process (GO:0019402)|galactose catabolic process (GO:0019388)|galactose metabolic process (GO:0006012)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|galactose binding (GO:0005534)			endometrium(2)|large_intestine(1)|lung(1)|prostate(1)	5	all_cancers(13;1.5e-07)		all cancers(21;1.03e-06)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			GGCACCCTCAGAGGTGGTGAG	0.652																																																	0													25.0	24.0	24.0					17																	73760097		2202	4300	6502	SO:0001583	missense	2584				CCDS11728.1	17q25.1	2013-09-19			ENSG00000108479	ENSG00000108479	2.7.1.6		4118	protein-coding gene	gene with protein product		604313		GALK		7670469	Standard	NM_000154		Approved		uc002jpk.3	P51570	OTTHUMG00000179832	ENST00000588479.1:c.236C>G	17.37:g.73760097G>C	ENSP00000465930:p.Ser79Cys		B2RC07|B4E1G6	Missense_Mutation	SNP	pfam_GalKase_gal-bd,pfam_GHMP_kinase_C_dom,pfam_GHMP_kinase_N_dom,superfamily_Ribosomal_S5_D2-typ_fold,pirsf_Galactokinase,prints_Mevalonate/galactokinase,prints_Galactokinase,prints_Galkinase,tigrfam_Galactokinase	p.S109C	ENST00000588479.1	37	c.326	CCDS11728.1	17	.	.	.	.	.	.	.	.	.	.	G	13.25	2.181786	0.38511	.	.	ENSG00000108479	ENST00000225614;ENST00000437911;ENST00000375188	D;D	0.84370	-1.84;-1.84	4.77	4.77	0.60923	Ribosomal protein S5 domain 2-type fold (1);Ribosomal protein S5 domain 2-type fold, subgroup (1);	0.386121	0.28488	N	0.015165	D	0.85318	0.5669	M	0.69823	2.125	0.18873	N	0.999988	B;B	0.31274	0.317;0.018	B;B	0.31390	0.129;0.012	T	0.79463	-0.1793	10	0.54805	T	0.06	-6.0452	18.1773	0.89766	0.0:0.0:1.0:0.0	.	79;79	B4E1A8;P51570	.;GALK1_HUMAN	C	79;109;182	ENSP00000225614:S79C;ENSP00000406305:S109C	ENSP00000225614:S79C	S	-	2	0	GALK1	71271692	0.223000	0.23663	0.908000	0.35775	0.829000	0.46940	2.733000	0.47360	2.369000	0.80426	0.655000	0.94253	TCT	GALK1	-	superfamily_Ribosomal_S5_D2-typ_fold,pirsf_Galactokinase,tigrfam_Galactokinase		0.652	GALK1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	GALK1	HGNC	protein_coding	OTTHUMT00000448430.1	G			73760097	-1	no_errors	ENST00000437911	ensembl	human	known	70_37	missense	SNP	0.098	C
GEMIN5	25929	genome.wustl.edu	37	5	154278076	154278076	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr5:154278076C>G	ENST00000285873.7	-	23	3344	c.3269G>C	c.(3268-3270)aGa>aCa	p.R1090T		NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	Q8TEQ6	GEMI5_HUMAN	gem (nuclear organelle) associated protein 5	1090					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|protein complex assembly (GO:0006461)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)|snRNA binding (GO:0017069)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TTGGGCACATCTGAGAGCCAG	0.532																																																	0													103.0	100.0	101.0					5																	154278076		2203	4300	6503	SO:0001583	missense	25929			AK022748	CCDS4330.1	5q34	2013-01-10			ENSG00000082516	ENSG00000082516		"""WD repeat domain containing"""	20043	protein-coding gene	gene with protein product		607005				11714716	Standard	NM_015465		Approved		uc003lvx.3	Q8TEQ6	OTTHUMG00000130189	ENST00000285873.7:c.3269G>C	5.37:g.154278076C>G	ENSP00000285873:p.Arg1090Thr		Q14CV0|Q8WWV4|Q969W4|Q9H9K3|Q9UFI5	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R1090T	ENST00000285873.7	37	c.3269	CCDS4330.1	5	.	.	.	.	.	.	.	.	.	.	C	29.3	4.994485	0.93167	.	.	ENSG00000082516	ENST00000285873	T	0.74737	-0.87	5.63	5.63	0.86233	.	0.123763	0.53938	D	0.000049	D	0.83193	0.5201	M	0.72894	2.215	0.58432	D	0.999996	D;D	0.59357	0.985;0.985	P;P	0.54590	0.756;0.756	D	0.84887	0.0834	10	0.87932	D	0	-5.4676	19.7096	0.96089	0.0:1.0:0.0:0.0	.	1089;1090	B7ZLC9;Q8TEQ6	.;GEMI5_HUMAN	T	1090	ENSP00000285873:R1090T	ENSP00000285873:R1090T	R	-	2	0	GEMIN5	154258269	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	6.911000	0.75746	2.652000	0.90054	0.655000	0.94253	AGA	GEMIN5	-	NULL		0.532	GEMIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GEMIN5	HGNC	protein_coding	OTTHUMT00000252507.1	C			154278076	-1	no_errors	ENST00000285873	ensembl	human	known	70_37	missense	SNP	1.000	G
GOLGA8B	440270	genome.wustl.edu	37	15	34820269	34820269	+	Missense_Mutation	SNP	G	G	A	rs142225671	byFrequency	TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr15:34820269G>A	ENST00000342314.5	-	15	1560	c.1463C>T	c.(1462-1464)gCt>gTt	p.A488V	GOLGA8B_ENST00000438958.2_Missense_Mutation_p.A518V|GOLGA8A_ENST00000543376.1_Intron|GOLGA8B_ENST00000267731.7_Missense_Mutation_p.A488V|MIR1233-2_ENST00000408138.1_RNA	NM_001023567.4	NP_001018861.3	A8MQT2	GOG8B_HUMAN	golgin A8 family, member B	488				A -> V (in Ref. 1; AAF40308, 2; AAF34136 and 4; AAI04801). {ECO:0000305}.		Golgi apparatus (GO:0005794)|membrane (GO:0016020)				endometrium(1)	1		all_lung(180;2.78e-08)		all cancers(64;8.27e-19)|GBM - Glioblastoma multiforme(113;6.98e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		TGCAGCTCCAGCAGCTTCACC	0.682													g|||	3308	0.660543	0.8011	0.5202	5008	,	,		8746	0.7282		0.5686	False		,,,				2504	0.5951																0													1.0	1.0	1.0					15																	34820269		173	685	858	SO:0001583	missense	440270			AF164622	CCDS45211.1	15q14	2011-10-25	2010-02-12		ENSG00000215252	ENSG00000215252			31973	protein-coding gene	gene with protein product		609619	"""golgi autoantigen, golgin subfamily a, 8B"""				Standard	NM_001023567		Approved		uc001ziq.3	A8MQT2	OTTHUMG00000129549	ENST00000342314.5:c.1463C>T	15.37:g.34820269G>A	ENSP00000343064:p.Ala488Val		A6NLZ2|O94937|Q2M3S9|Q9NZG8|Q9NZW0|Q9NZW3	Missense_Mutation	SNP	NULL	p.A518V	ENST00000342314.5	37	c.1553	CCDS45211.1	15	.	.	.	.	.	.	.	.	.	.	g	12.72	2.021891	0.35701	.	.	ENSG00000215252	ENST00000342314;ENST00000267731;ENST00000438958;ENST00000268079	T;T;T	0.13778	3.06;3.06;2.56	1.46	0.503	0.16940	.	.	.	.	.	T	0.23532	0.0569	L	0.46885	1.475	0.45250	P	0.0017409999999999926	B;D;P	0.71674	0.274;0.998;0.569	B;D;P	0.80764	0.188;0.994;0.525	T	0.23583	-1.0184	8	0.44086	T	0.13	.	5.793	0.18371	0.1978:0.0:0.8021:0.0	.	345;488;379	B7ZMK6;A8MQT2;Q659D1	.;GOG8B_HUMAN;.	V	488;488;518;379	ENSP00000343064:A488V;ENSP00000267731:A488V;ENSP00000400063:A518V	ENSP00000267731:A488V	A	-	2	0	GOLGA8B	32607561	0.971000	0.33674	0.977000	0.42913	0.019000	0.09904	1.551000	0.36233	0.183000	0.20059	0.162000	0.16502	GCT	GOLGA8B	-	NULL		0.682	GOLGA8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA8B	HGNC	protein_coding	OTTHUMT00000251739.2	G	NM_001023567		34820269	-1	no_errors	ENST00000438958	ensembl	human	known	70_37	missense	SNP	1.000	A
GP5	2814	genome.wustl.edu	37	3	194118225	194118225	+	Missense_Mutation	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr3:194118225G>C	ENST00000401815.1	-	1	858	c.787C>G	c.(787-789)Ctt>Gtt	p.L263V	GP5_ENST00000323007.3_Missense_Mutation_p.L263V			P40197	GPV_HUMAN	glycoprotein V (platelet)	263					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|negative regulation of platelet activation (GO:0010544)|platelet activation (GO:0030168)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(3)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(14)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	35	all_cancers(143;6.64e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;7.38e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.06e-05)		TGCGAATGAAGAAAGAGCGCA	0.597																																																	0													43.0	49.0	47.0					3																	194118225		2202	4300	6502	SO:0001583	missense	2814			L11238	CCDS3307.1	3q29	2008-02-01			ENSG00000178732	ENSG00000178732		"""CD molecules"""	4443	protein-coding gene	gene with protein product		173511				7690959	Standard	NM_004488		Approved	CD42d	uc003ftv.1	P40197	OTTHUMG00000150345	ENST00000401815.1:c.787C>G	3.37:g.194118225G>C	ENSP00000383931:p.Leu263Val		D1MER9	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.L263V	ENST00000401815.1	37	c.787	CCDS3307.1	3	.	.	.	.	.	.	.	.	.	.	G	11.83	1.754667	0.31046	.	.	ENSG00000178732	ENST00000401815;ENST00000323007	T;T	0.24908	1.83;1.83	4.06	3.17	0.36434	.	0.000000	0.33631	N	0.004717	T	0.30039	0.0752	N	0.20357	0.565	0.09310	N	1	D	0.89917	1.0	D	0.71414	0.973	T	0.20940	-1.0260	10	0.12103	T	0.63	.	13.5954	0.61987	0.0:0.0:0.8427:0.1573	.	263	P40197	GPV_HUMAN	V	263	ENSP00000383931:L263V;ENSP00000319286:L263V	ENSP00000319286:L263V	L	-	1	0	GP5	195599514	0.074000	0.21230	0.050000	0.19076	0.417000	0.31264	1.629000	0.37071	0.960000	0.38005	0.455000	0.32223	CTT	GP5	-	smart_Leu-rich_rpt_typical-subtyp		0.597	GP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GP5	HGNC	protein_coding	OTTHUMT00000317710.1	G	NM_004488		194118225	-1	no_errors	ENST00000323007	ensembl	human	known	70_37	missense	SNP	0.013	C
GPR123	84435	genome.wustl.edu	37	10	134941990	134941990	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr10:134941990C>T	ENST00000392607.3	+	7	1094	c.658C>T	c.(658-660)Cgg>Tgg	p.R220W	GPR123_ENST00000392606.2_Missense_Mutation_p.R123W|GPR123_ENST00000607359.1_Missense_Mutation_p.R939W	NM_001083909.1	NP_001077378.1	Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	220					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(3)	14		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		GGAGCAGCGGCGGCTGGCGAC	0.711																																																	0													5.0	7.0	6.0					10																	134941990		2086	4105	6191	SO:0001583	missense	84435			AB058731	CCDS41580.1	10q26	2014-08-08			ENSG00000197177	ENSG00000197177		"""-"", ""GPCR / Class B : Orphans"""	13838	protein-coding gene	gene with protein product		612302				12565841	Standard	XM_005252695		Approved	KIAA1828	uc001llw.3	Q86SQ6	OTTHUMG00000019304	ENST00000392607.3:c.658C>T	10.37:g.134941990C>T	ENSP00000376384:p.Arg220Trp		A5HL16|A6NG50|Q5T234|Q86SN7|Q96JJ9	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	p.R124W	ENST00000392607.3	37	c.370	CCDS41580.1	10	.	.	.	.	.	.	.	.	.	.	.	15.03	2.712460	0.48517	.	.	ENSG00000197177	ENST00000368577;ENST00000392607;ENST00000392606	T	0.42131	0.98	4.85	3.81	0.43845	GPCR, family 2-like (1);	0.237436	0.27922	N	0.017317	T	0.65565	0.2703	M	0.84683	2.71	0.53005	D	0.999961	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.992	T	0.70901	-0.4746	10	0.87932	D	0	-43.2234	11.643	0.51244	0.2158:0.7842:0.0:0.0	.	220;939	Q86SQ6;Q86SQ6-1	GP123_HUMAN;.	W	939;220;124	ENSP00000376384:R220W	ENSP00000357566:R939W	R	+	1	2	GPR123	134791980	1.000000	0.71417	1.000000	0.80357	0.069000	0.16628	1.053000	0.30442	2.419000	0.82065	0.491000	0.48974	CGG	GPR123	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like		0.711	GPR123-003	NOVEL	basic|appris_candidate|exp_conf|CCDS	protein_coding	GPR123	HGNC	protein_coding	OTTHUMT00000051113.2	C			134941990	+1	no_errors	ENST00000392606	ensembl	human	putative	70_37	missense	SNP	1.000	T
GPR98	84059	genome.wustl.edu	37	5	89985773	89985773	+	Missense_Mutation	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr5:89985773G>A	ENST00000405460.2	+	30	6682	c.6586G>A	c.(6586-6588)Gaa>Aaa	p.E2196K		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	2196	Calx-beta 15. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TATCTATCCTGAACTGGAAGA	0.408																																																	0													71.0	67.0	68.0					5																	89985773		1839	4091	5930	SO:0001583	missense	84059			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.6586G>A	5.37:g.89985773G>A	ENSP00000384582:p.Glu2196Lys		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.E2196K	ENST00000405460.2	37	c.6586	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	G	35	5.568219	0.96540	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.61274	0.12	5.36	5.36	0.76844	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	T	0.81574	0.4851	M	0.90705	3.14	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85473	0.1174	10	0.87932	D	0	.	19.1187	0.93353	0.0:0.0:1.0:0.0	.	2196	Q8WXG9	GPR98_HUMAN	K	2196	ENSP00000384582:E2196K	ENSP00000296619:E2196K	E	+	1	0	GPR98	90021529	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.525000	0.98039	2.501000	0.84356	0.650000	0.86243	GAA	GPR98	-	pfam_Calx_beta,smart_Calx_beta		0.408	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2	G	NM_032119		89985773	+1	no_errors	ENST00000405460	ensembl	human	known	70_37	missense	SNP	1.000	A
GTF2E1	2960	genome.wustl.edu	37	3	120469678	120469678	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr3:120469678C>G	ENST00000283875.5	+	2	372	c.279C>G	c.(277-279)ttC>ttG	p.F93L		NM_005513.2	NP_005504.2	P29083	T2EA_HUMAN	general transcription factor IIE, polypeptide 1, alpha 56kDa	93	HTH TFE/IIEalpha-type. {ECO:0000255|PROSITE-ProRule:PRU00676}.				gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)	22				GBM - Glioblastoma multiforme(114;0.159)		ACTACTACTTCATCAATTATC	0.403																																																	0													74.0	74.0	74.0					3																	120469678		2203	4300	6503	SO:0001583	missense	2960			S67859	CCDS3002.1	3q21-q24	2010-03-23	2002-08-29		ENSG00000153767	ENSG00000153767		"""General transcription factors"""	4650	protein-coding gene	gene with protein product		189962	"""general transcription factor IIE, polypeptide 1 (alpha subunit, 56kD)"""			1454543, 8162052	Standard	NM_005513		Approved	TFIIE-A, FE	uc003edz.4	P29083	OTTHUMG00000159667	ENST00000283875.5:c.279C>G	3.37:g.120469678C>G	ENSP00000283875:p.Phe93Leu		Q16103	Missense_Mutation	SNP	pfam_TFIIEa/SarR/Rpc3_HTH_dom,pfam_TFIIE_asu_C,pfam_Znf_TFIIB,smart_TFIIE_asu	p.F93L	ENST00000283875.5	37	c.279	CCDS3002.1	3	.	.	.	.	.	.	.	.	.	.	C	19.78	3.891678	0.72524	.	.	ENSG00000153767	ENST00000283875;ENST00000492959	T	0.49720	0.77	6.06	-2.14	0.07123	TFIIEalpha/SarR/Rpc3 HTH domain (1);Transcription factor TFE/TFIIEalpha HTH domain (1);	0.000000	0.85682	D	0.000000	T	0.58991	0.2161	M	0.66939	2.045	0.80722	D	1	D;D	0.56746	0.977;0.977	D;P	0.66716	0.946;0.899	T	0.58668	-0.7596	9	.	.	.	-20.1624	12.2064	0.54355	0.0:0.5258:0.0:0.4742	.	93;93	P29083;Q53F88	T2EA_HUMAN;.	L	93	ENSP00000283875:F93L	.	F	+	3	2	GTF2E1	121952368	0.999000	0.42202	0.993000	0.49108	0.870000	0.49936	0.694000	0.25512	-0.278000	0.09180	-0.290000	0.09829	TTC	GTF2E1	-	pfam_TFIIEa/SarR/Rpc3_HTH_dom,smart_TFIIE_asu		0.403	GTF2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2E1	HGNC	protein_coding	OTTHUMT00000356770.1	C	NM_005513		120469678	+1	no_errors	ENST00000283875	ensembl	human	known	70_37	missense	SNP	0.997	G
HELZ2	85441	genome.wustl.edu	37	20	62196884	62196884	+	Silent	SNP	A	A	G	rs310633	byFrequency	TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr20:62196884A>G	ENST00000467148.1	-	8	3360	c.3291T>C	c.(3289-3291)acT>acC	p.T1097T	HELZ2_ENST00000427522.2_Silent_p.T528T	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	1097					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GCCTGGCGACAGTGTCCAGCA	0.697													G|||	4880	0.974441	0.997	0.9481	5008	,	,		15643	0.999		0.9235	False		,,,				2504	0.9898																0								G	,	4315,61		2127,61,0	23.0	19.0	20.0		3291,1584	-9.3	0.0	20	dbSNP_79	20	7994,592		3728,538,27	no	coding-synonymous,coding-synonymous	PRIC285	NM_001037335.2,NM_033405.3	,	5855,599,27	GG,GA,AA		6.8949,1.394,5.0378	,	1097/2650,528/2081	62196884	12309,653	2188	4293	6481	SO:0001819	synonymous_variant	85441			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.3291T>C	20.37:g.62196884A>G			Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Silent	SNP	pfam_RNase_II/R,smart_RNase_II/R	p.T1097	ENST00000467148.1	37	c.3291	CCDS33508.1	20																																																																																			HELZ2	-	NULL		0.697	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HELZ2	HGNC	protein_coding	OTTHUMT00000354127.1	A	NM_001037335		62196884	-1	no_errors	ENST00000467148	ensembl	human	known	70_37	silent	SNP	0.000	G
HSPA9	3313	genome.wustl.edu	37	5	137904654	137904654	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr5:137904654C>G	ENST00000297185.3	-	5	620	c.495G>C	c.(493-495)caG>caC	p.Q165H	HSPA9_ENST00000501917.2_5'Flank	NM_004134.6	NP_004125.3	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 (mortalin)	165					cellular protein metabolic process (GO:0044267)|negative regulation of apoptotic process (GO:0043066)|protein export from nucleus (GO:0006611)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(1)|kidney(4)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(1)	28			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			ATGCTCCAATCTGACTCGGAG	0.418																																																	0													120.0	115.0	116.0					5																	137904654		2203	4300	6503	SO:0001583	missense	3313			L11066	CCDS4208.1	5q31.1	2011-09-02	2006-10-31	2006-10-31	ENSG00000113013	ENSG00000113013		"""Heat shock proteins / HSP70"""	5244	protein-coding gene	gene with protein product		600548	"""heat shock 70kDa protein 9B (mortalin-2)"""	HSPA9B		7684501	Standard	NM_004134		Approved	GRP75, PBP74, mot-2, mthsp75	uc003ldf.3	P38646	OTTHUMG00000129206	ENST00000297185.3:c.495G>C	5.37:g.137904654C>G	ENSP00000297185:p.Gln165His		B2RCM1|P30036|P31932|Q1HB43|Q53H23|Q6GU03|Q9BWB7|Q9UC56	Missense_Mutation	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,pfam_Carb_kinase_FGGY_C,prints_Hsp_70_fam,tigrfam_Chaperone_DnaK	p.Q165H	ENST00000297185.3	37	c.495	CCDS4208.1	5	.	.	.	.	.	.	.	.	.	.	C	18.36	3.607859	0.66558	.	.	ENSG00000113013	ENST00000297185;ENST00000540484	T	0.01178	5.22	5.21	1.42	0.22433	.	0.000000	0.85682	D	0.000000	T	0.11623	0.0283	H	0.98295	4.195	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.01378	-1.1370	10	0.87932	D	0	-9.4474	10.1545	0.42814	0.0:0.664:0.0:0.336	.	96;165	B7Z1V7;P38646	.;GRP75_HUMAN	H	165;151	ENSP00000297185:Q165H	ENSP00000297185:Q165H	Q	-	3	2	HSPA9	137932553	1.000000	0.71417	0.998000	0.56505	0.869000	0.49853	1.008000	0.29872	0.037000	0.15575	0.655000	0.94253	CAG	HSPA9	-	pfam_Hsp_70_fam,tigrfam_Chaperone_DnaK		0.418	HSPA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA9	HGNC	protein_coding	OTTHUMT00000251285.1	C	NM_004134		137904654	-1	no_errors	ENST00000297185	ensembl	human	known	70_37	missense	SNP	0.995	G
TMEM86A	144110	genome.wustl.edu	37	11	18727641	18727641	+	IGR	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr11:18727641G>A	ENST00000280734.2	+	0	3595				IGSF22_ENST00000510673.1_5'UTR|RP11-1081L13.4_ENST00000527285.1_RNA|IGSF22_ENST00000513874.1_Silent_p.H1211H	NM_153347.1	NP_699178.1	Q8N2M4	TM86A_HUMAN	transmembrane protein 86A							integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|skin(2)	11						AGCGCGGCGCGTGGCGCCAGT	0.716																																																	0													52.0	56.0	55.0					11																	18727641		692	1591	2283	SO:0001628	intergenic_variant	283284			BC035692	CCDS7844.1	11p15.1	2005-10-28				ENSG00000151117			26890	protein-coding gene	gene with protein product							Standard	NM_153347		Approved	FLJ90119	uc001moz.1	Q8N2M4			11.37:g.18727641G>A			Q96AJ0	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.H1211	ENST00000280734.2	37	c.3633	CCDS7844.1	11																																																																																			IGSF22	-	NULL		0.716	TMEM86A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF22	HGNC	protein_coding	OTTHUMT00000387812.1	G	NM_153347		18727641	-1	no_errors	ENST00000513874	ensembl	human	known	70_37	silent	SNP	0.038	A
HTR3B	9177	genome.wustl.edu	37	11	113815388	113815388	+	Missense_Mutation	SNP	G	G	A	rs199833563		TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr11:113815388G>A	ENST00000260191.2	+	8	1258	c.1001G>A	c.(1000-1002)gGa>gAa	p.G334E	HTR3B_ENST00000537778.1_Missense_Mutation_p.G323E	NM_006028.4	NP_006019.1	O95264	5HT3B_HUMAN	5-hydroxytryptamine (serotonin) receptor 3B, ionotropic	334					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ion channel activity (GO:0005216)|serotonin receptor activity (GO:0004993)|serotonin-activated cation-selective channel activity (GO:0005232)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(11)	20		all_cancers(61;6.81e-18)|all_epithelial(67;6.67e-11)|all_hematologic(158;4.67e-05)|Melanoma(852;0.000316)|Acute lymphoblastic leukemia(157;0.000976)|Breast(348;0.0101)|Prostate(24;0.0154)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.04e-06)|Epithelial(105;1.98e-05)|all cancers(92;0.000201)|OV - Ovarian serous cystadenocarcinoma(223;0.151)	Ergoloid mesylate(DB01049)	CAGCGTGGTGGACAGGAGCAG	0.552													G|||	0	0.0	0.0	0.0	5008	,	,		19000	0.0		0.0	False		,,,				2504	0.0																0													223.0	179.0	194.0					11																	113815388		2201	4296	6497	SO:0001583	missense	9177			AF080582	CCDS8364.1	11q23.1	2012-05-22	2012-02-03		ENSG00000149305	ENSG00000149305		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	5298	protein-coding gene	gene with protein product		604654	"""5-hydroxytryptamine (serotonin) receptor 3B"""			9950429, 10521471	Standard	NM_006028		Approved	5-HT3B	uc001pok.3	O95264	OTTHUMG00000168210	ENST00000260191.2:c.1001G>A	11.37:g.113815388G>A	ENSP00000260191:p.Gly334Glu		B0YJ23|Q0VJC3	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_5HT3_rcpt_B,prints_5HT3_rcpt,prints_Neur_channel,prints_5HT3_rcpt_A,tigrfam_Neur_channel	p.G334E	ENST00000260191.2	37	c.1001	CCDS8364.1	11	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	2.216	-0.379475	0.05000	.	.	ENSG00000149305	ENST00000260191;ENST00000537778	D;D	0.83335	-1.71;-1.71	5.11	2.12	0.27331	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.518379	0.17624	N	0.167628	T	0.72763	0.3501	L	0.38531	1.155	0.09310	N	0.999999	B;B	0.14012	0.004;0.009	B;B	0.17433	0.013;0.018	T	0.60434	-0.7264	10	0.44086	T	0.13	-1.0328	7.3196	0.26519	0.2943:0.0:0.7057:0.0	.	323;334	O95264-2;O95264	.;5HT3B_HUMAN	E	334;323	ENSP00000260191:G334E;ENSP00000443118:G323E	ENSP00000260191:G334E	G	+	2	0	HTR3B	113320598	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	0.001000	0.13038	0.155000	0.19261	0.655000	0.94253	GGA	HTR3B	-	superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel		0.552	HTR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR3B	HGNC	protein_coding	OTTHUMT00000398842.1	G	NM_006028		113815388	+1	no_errors	ENST00000260191	ensembl	human	known	70_37	missense	SNP	0.179	A
IL1R2	7850	genome.wustl.edu	37	2	102642604	102642604	+	Missense_Mutation	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr2:102642604G>A	ENST00000332549.3	+	8	1148	c.919G>A	c.(919-921)Gaa>Aaa	p.E307K	IL1R2_ENST00000485335.1_3'UTR|IL1R2_ENST00000393414.2_Missense_Mutation_p.E307K	NM_004633.3	NP_004624.1	P27930	IL1R2_HUMAN	interleukin 1 receptor, type II	307	Ig-like C2-type 3.				cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)			breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)	28						GAACTACATTGAAGTGCCATT	0.348																																					Pancreas(106;189 1628 2302 5133 12295)												0													115.0	112.0	113.0					2																	102642604		2203	4300	6503	SO:0001583	missense	7850			X59770	CCDS2054.1, CCDS58719.1	2q12	2013-01-11			ENSG00000115590	ENSG00000115590		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5994	protein-coding gene	gene with protein product		147811		IL1RB		10191101, 1833184	Standard	NM_004633		Approved	CD121b	uc002tbm.3	P27930	OTTHUMG00000130695	ENST00000332549.3:c.919G>A	2.37:g.102642604G>A	ENSP00000330959:p.Glu307Lys		D3DVJ5|Q6LCE6|Q9UE68	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like,prints_Interleukin-1_rcpt_II,prints_IL1_rcpt_I/II	p.E307K	ENST00000332549.3	37	c.919	CCDS2054.1	2	.	.	.	.	.	.	.	.	.	.	G	23.2	4.384647	0.82792	.	.	ENSG00000115590	ENST00000332549;ENST00000393414	T;T	0.13778	2.56;2.56	5.95	5.08	0.68730	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.064020	0.64402	D	0.000005	T	0.30823	0.0777	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.12863	-1.0531	10	0.12430	T	0.62	.	12.3709	0.55254	0.0786:0.0:0.9214:0.0	.	307	P27930	IL1R2_HUMAN	K	307	ENSP00000330959:E307K;ENSP00000377066:E307K	ENSP00000330959:E307K	E	+	1	0	IL1R2	102009036	1.000000	0.71417	0.961000	0.40146	0.965000	0.64279	5.483000	0.66838	1.532000	0.49169	0.655000	0.94253	GAA	IL1R2	-	pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like,prints_Interleukin-1_rcpt_II		0.348	IL1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1R2	HGNC	protein_coding	OTTHUMT00000253191.1	G	NM_004633		102642604	+1	no_errors	ENST00000332549	ensembl	human	known	70_37	missense	SNP	0.999	A
IKZF2	22807	genome.wustl.edu	37	2	213886824	213886824	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr2:213886824C>G	ENST00000434687.1	-	7	914	c.605G>C	c.(604-606)gGa>gCa	p.G202A	IKZF2_ENST00000413091.3_Missense_Mutation_p.G202A|IKZF2_ENST00000451136.2_Intron|IKZF2_ENST00000342002.2_Missense_Mutation_p.G208A|AC079610.1_ENST00000415387.1_RNA|IKZF2_ENST00000421754.2_Missense_Mutation_p.G176A|IKZF2_ENST00000457361.1_Missense_Mutation_p.G202A|IKZF2_ENST00000374319.4_Missense_Mutation_p.G176A|IKZF2_ENST00000374327.4_Missense_Mutation_p.G57A			Q9UKS7	IKZF2_HUMAN	IKAROS family zinc finger 2 (Helios)	202					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Esophageal squamous(248;0.0559)|Renal(323;0.218)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)		GTAGCTTCGTCCACAGTAGTT	0.483																																																	0													137.0	117.0	124.0					2																	213886824		2203	4300	6503	SO:0001583	missense	22807			AF130863	CCDS2395.1, CCDS46507.1	2q13.1	2013-01-08	2006-08-25	2006-08-25	ENSG00000030419	ENSG00000030419		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13177	protein-coding gene	gene with protein product		606234	"""zinc finger protein, subfamily 1A, 2 (Helios)"""	ZNFN1A2		9512513, 9560339	Standard	NM_001079526		Approved	Helios	uc002vem.3	Q9UKS7	OTTHUMG00000133005	ENST00000434687.1:c.605G>C	2.37:g.213886824C>G	ENSP00000412869:p.Gly202Ala		Q53YJ5|Q6PQC5|Q6PQC6|Q6PQC7|Q6PQC8|Q6PQD0|Q6PQD1|Q8N6S1	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G202A	ENST00000434687.1	37	c.605	CCDS2395.1	2	.	.	.	.	.	.	.	.	.	.	C	33	5.267773	0.95399	.	.	ENSG00000030419	ENST00000457361;ENST00000342002;ENST00000434687;ENST00000374319;ENST00000421754;ENST00000374327;ENST00000413091	T;T;T;T;T;T;T	0.65549	-0.16;-0.16;-0.16;2.01;2.01;0.24;-0.16	5.8	5.8	0.92144	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.78910	0.4358	M	0.62723	1.935	0.80722	D	1	D;D;P;B	0.76494	0.999;0.991;0.569;0.039	D;P;B;B	0.87578	0.998;0.813;0.422;0.096	T	0.79424	-0.1809	10	0.87932	D	0	-5.1298	20.0539	0.97641	0.0:1.0:0.0:0.0	.	176;57;176;202	C9JTM9;F5H8M1;Q9UKS7-2;Q9UKS7	.;.;.;IKZF2_HUMAN	A	202;208;202;176;176;57;202	ENSP00000410447:G202A;ENSP00000342876:G208A;ENSP00000412869:G202A;ENSP00000363439:G176A;ENSP00000399574:G176A;ENSP00000363447:G57A;ENSP00000402334:G202A	ENSP00000342876:G208A	G	-	2	0	IKZF2	213595069	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.965000	0.70387	2.740000	0.93945	0.650000	0.86243	GGA	IKZF2	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.483	IKZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKZF2	HGNC	protein_coding	OTTHUMT00000256593.3	C	NM_016260		213886824	-1	no_errors	ENST00000434687	ensembl	human	known	70_37	missense	SNP	1.000	G
INPP5D	3635	genome.wustl.edu	37	2	233998699	233998699	+	Silent	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr2:233998699G>A	ENST00000359570.5	+	6	675	c.675G>A	c.(673-675)ctG>ctA	p.L225L	INPP5D_ENST00000538935.1_Intron			Q92835	SHIP1_HUMAN	inositol polyphosphate-5-phosphatase, 145kDa	225					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|determination of adult lifespan (GO:0008340)|immunoglobulin mediated immune response (GO:0016064)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of bone resorption (GO:0045779)|negative regulation of immune response (GO:0050777)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of neutrophil differentiation (GO:0045659)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of signal transduction (GO:0009968)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of erythrocyte differentiation (GO:0045648)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|membrane (GO:0016020)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)			central_nervous_system(1)|ovary(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		tgcagatgctgagaactggtg	0.532																																					NSCLC(82;1215 1426 16163 20348 41018)												0																																										SO:0001819	synonymous_variant	3635			U57650	CCDS74672.1	2q37.1	2013-02-14	2002-08-29		ENSG00000168918	ENSG00000168918		"""SH2 domain containing"""	6079	protein-coding gene	gene with protein product		601582	"""inositol polyphosphate-5-phosphatase, 145kD"""			8643691, 8874179	Standard	NM_001017915		Approved	SHIP, hp51CN	uc010zmp.2	Q92835	OTTHUMG00000133688	ENST00000359570.5:c.675G>A	2.37:g.233998699G>A			O00145|Q13544|Q13545|Q6P5A4|Q92656|Q9UE80	Silent	SNP	pfam_Endo/exonuclease/phosphatase,pfam_SH2,superfamily_Endo/exonuclease/phosphatase,smart_SH2,smart_IPPc,pfscan_SH2,prints_SH2	p.L225	ENST00000359570.5	37	c.675		2																																																																																			INPP5D	-	NULL		0.532	INPP5D-201	KNOWN	basic|appris_principal	protein_coding	INPP5D	HGNC	protein_coding		G	NM_001017915		233998699	+1	no_errors	ENST00000359570	ensembl	human	known	70_37	silent	SNP	0.039	A
ITGA2B	3674	genome.wustl.edu	37	17	42463033	42463033	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr17:42463033C>G	ENST00000262407.5	-	4	491	c.460G>C	c.(460-462)Gag>Cag	p.E154Q	ITGA2B_ENST00000377068.3_5'Flank|ITGA2B_ENST00000353281.4_Missense_Mutation_p.E154Q	NM_000419.3	NP_000410.2	P08514	ITA2B_HUMAN	integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)	154					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	extracellular matrix binding (GO:0050840)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			biliary_tract(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.191)	Abciximab(DB00054)|Tirofiban(DB00775)	GGCGTCTTCTCAGCCTCCTCA	0.647																																																	0													30.0	38.0	35.0					17																	42463033		2200	4299	6499	SO:0001583	missense	3674				CCDS32665.1	17q21.32	2014-09-17	2006-02-22			ENSG00000005961		"""CD molecules"", ""Integrins"""	6138	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 93"""	607759	"""integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41B)"""	GP2B			Standard	NM_000419		Approved	CD41B, CD41, PPP1R93	uc002igt.1	P08514		ENST00000262407.5:c.460G>C	17.37:g.42463033C>G	ENSP00000262407:p.Glu154Gln		B2RCY8|O95366|Q14443|Q17R67	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.E154Q	ENST00000262407.5	37	c.460	CCDS32665.1	17	.	.	.	.	.	.	.	.	.	.	C	13.03	2.116648	0.37339	.	.	ENSG00000005961	ENST00000262407;ENST00000353281	D;D	0.85088	-1.94;-1.94	5.55	3.51	0.40186	.	0.473469	0.15607	N	0.253624	T	0.81669	0.4871	L	0.56396	1.775	0.80722	D	1	B	0.20550	0.046	B	0.16289	0.015	T	0.73448	-0.3979	10	0.20519	T	0.43	.	14.0669	0.64837	0.0:0.7119:0.2881:0.0	.	154	P08514	ITA2B_HUMAN	Q	154	ENSP00000262407:E154Q;ENSP00000340536:E154Q	ENSP00000262407:E154Q	E	-	1	0	ITGA2B	39818559	0.358000	0.24947	0.962000	0.40283	0.234000	0.25298	1.402000	0.34600	0.672000	0.31204	0.561000	0.74099	GAG	ITGA2B	-	NULL		0.647	ITGA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA2B	HGNC	protein_coding	OTTHUMT00000439823.1	C			42463033	-1	no_errors	ENST00000262407	ensembl	human	known	70_37	missense	SNP	0.807	G
Unknown	0	genome.wustl.edu	37	GL000209.1	58495	58495	+	IGR	SNP	C	C	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chrGL000209.1:58495C>A								None (None upstream) : None (None downstream)																							AACATCTTCACGCTGTACAAG	0.557																																																	0																																										SO:0001628	intergenic_variant	3813																															GL000209.1.37:g.58495C>A				Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.T59K		37	c.176		GL000209.1																																																																																			KIR3DS1	-	pfam_Immunoglobulin,smart_Ig_sub	0	0.557					KIR3DS1	HGNC			C			58495	+1	no_errors	ENST00000400851	ensembl	human	known	70_37	missense	SNP	NULL	A
KLKB1	3818	genome.wustl.edu	37	4	187153292	187153292	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr4:187153292C>G	ENST00000264690.6	+	3	257	c.70C>G	c.(70-72)Caa>Gaa	p.Q24E	KLKB1_ENST00000513864.1_Missense_Mutation_p.Q24E	NM_000892.3	NP_000883.2	P03952	KLKB1_HUMAN	kallikrein B, plasma (Fletcher factor) 1	24	Apple 1. {ECO:0000255|PROSITE- ProRule:PRU00315}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|plasminogen activation (GO:0031639)|positive regulation of fibrinolysis (GO:0051919)|proteolysis (GO:0006508)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	40		all_cancers(14;1.55e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00664)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.29e-10)|BRCA - Breast invasive adenocarcinoma(30;3.8e-05)|GBM - Glioblastoma multiforme(59;0.000131)|STAD - Stomach adenocarcinoma(60;0.000292)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.168)		ATGTCTGACTCAACTCTATGA	0.398																																																	0													106.0	96.0	100.0					4																	187153292		2203	4300	6503	SO:0001583	missense	3818			M13143	CCDS34120.1	4q35	2008-02-05			ENSG00000164344	ENSG00000164344		"""Kallikreins"""	6371	protein-coding gene	gene with protein product		229000		KLK3		9535413, 3521732	Standard	XM_005262987		Approved		uc003iyy.3	P03952	OTTHUMG00000150347	ENST00000264690.6:c.70C>G	4.37:g.187153292C>G	ENSP00000264690:p.Gln24Glu		A6NH96|B2R8H9|Q17RE8|Q17RE9|Q4W5C3	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_PAN-1_domain,superfamily_Pept_cys/ser_Trypsin-like,smart_Apple,smart_Peptidase_S1_S6,pfscan_Pan_app,pfscan_Peptidase_S1_S6,prints_Apple,prints_Peptidase_S1A	p.Q24E	ENST00000264690.6	37	c.70	CCDS34120.1	4	.	.	.	.	.	.	.	.	.	.	C	10.27	1.303244	0.23736	.	.	ENSG00000164344	ENST00000428196;ENST00000264690;ENST00000513864	D;D;D	0.88818	-2.43;-2.43;-2.43	5.25	4.41	0.53225	Apple domain (2);PAN-1 domain (1);Apple-like (1);	0.085106	0.50627	D	0.000112	D	0.89518	0.6738	L	0.49699	1.58	0.20403	N	0.99991	D	0.58970	0.984	P	0.55508	0.777	T	0.81590	-0.0863	10	0.21540	T	0.41	.	13.1659	0.59571	0.0:0.8393:0.1607:0.0	.	24	P03952	KLKB1_HUMAN	E	24	ENSP00000412366:Q24E;ENSP00000264690:Q24E;ENSP00000424469:Q24E	ENSP00000264690:Q24E	Q	+	1	0	KLKB1	187390286	0.497000	0.26067	0.593000	0.28771	0.089000	0.18198	1.440000	0.35024	1.430000	0.47334	-0.302000	0.09304	CAA	KLKB1	-	pfam_PAN-1_domain,smart_Apple,pfscan_Pan_app		0.398	KLKB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLKB1	HGNC	protein_coding	OTTHUMT00000317732.1	C	NM_000892		187153292	+1	no_errors	ENST00000264690	ensembl	human	known	70_37	missense	SNP	0.516	G
JUP	3728	genome.wustl.edu	37	17	39785217	39785217	+	Intron	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr17:39785217C>G	ENST00000540235.1	-	5	909				KRT42P_ENST00000438131.1_RNA			P14923	PLAK_HUMAN	junction plakoglobin						adherens junction organization (GO:0034332)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell-cell junction organization (GO:0045216)|cellular response to indole-3-methanol (GO:0071681)|cytoskeletal anchoring at plasma membrane (GO:0007016)|desmosome assembly (GO:0002159)|detection of mechanical stimulus (GO:0050982)|ectoderm development (GO:0007398)|endothelial cell-cell adhesion (GO:0071603)|establishment of protein localization to plasma membrane (GO:0090002)|gastrulation (GO:0007369)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|nervous system development (GO:0007399)|oocyte development (GO:0048599)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein heterooligomerization (GO:0051291)|regulation of cell proliferation (GO:0042127)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)|ventricular cardiac muscle cell action potential (GO:0086005)	actin cytoskeleton (GO:0015629)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gamma-catenin-TCF7L2 complex (GO:0071665)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|cadherin binding (GO:0045296)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|structural constituent of cell wall (GO:0005199)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	23		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		aactggtttccaaaagtcctt	0.532																																					Colon(16;42 520 6044 17852 28530)												0																																										SO:0001627	intron_variant	284116			AF233882	CCDS11407.1	17q21	2014-09-17	2004-08-09		ENSG00000173801	ENSG00000173801		"""Armadillo repeat containing"""	6207	protein-coding gene	gene with protein product		173325	"""catenin (cadherin-associated protein), gamma 80kDa"""	CTNNG		1889810, 7604000	Standard	NM_021991		Approved	DP3, PDGB, PKGB, DPIII	uc002hxs.2	P14923	OTTHUMG00000133494	ENST00000540235.1:c.910-5933G>C	17.37:g.39785217C>G			Q15093|Q15151|Q7L3S5|Q86W21|Q9BWC4|Q9HCX9	RNA	SNP	-	NULL	ENST00000540235.1	37	NULL		17																																																																																			KRT42P	-	-		0.532	JUP-201	KNOWN	basic	protein_coding	KRT42P	HGNC	protein_coding		C			39785217	-1	no_errors	ENST00000438131	ensembl	human	known	70_37	rna	SNP	0.311	G
LARP4B	23185	genome.wustl.edu	37	10	890928	890928	+	Silent	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr10:890928G>A	ENST00000316157.3	-	5	538	c.498C>T	c.(496-498)ttC>ttT	p.F166F		NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	166	HTH La-type RNA-binding. {ECO:0000255|PROSITE-ProRule:PRU00332}.				positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						TAGATAAGCAGAATTCCAATG	0.353																																																	0													128.0	120.0	123.0					10																	890928		2203	4300	6503	SO:0001819	synonymous_variant	23185			D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.498C>T	10.37:g.890928G>A			A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Silent	SNP	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,pfscan_Lupus_La_RNA-bd	p.F166	ENST00000316157.3	37	c.498	CCDS31131.1	10																																																																																			LARP4B	-	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,pfscan_Lupus_La_RNA-bd		0.353	LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP4B	HGNC	protein_coding	OTTHUMT00000046395.2	G	NM_015155		890928	-1	no_errors	ENST00000316157	ensembl	human	known	70_37	silent	SNP	1.000	A
LAS1L	81887	genome.wustl.edu	37	X	64741096	64741096	+	Intron	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chrX:64741096G>C	ENST00000374811.3	-	11	1489				LAS1L_ENST00000374804.5_Intron|LAS1L_ENST00000312391.8_Intron|LAS1L_ENST00000374807.5_Intron	NM_031206.4	NP_112483.1	Q9Y4W2	LAS1L_HUMAN	LAS1-like (S. cerevisiae)						rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	33						CAGGGACTAAGAGGGTCTTGG	0.498																																																	0																																										SO:0001627	intron_variant	81887			BC014545	CCDS14381.1, CCDS55433.1, CCDS55434.1	Xq12	2008-02-05			ENSG00000001497	ENSG00000001497			25726	protein-coding gene	gene with protein product						12477932	Standard	NM_031206		Approved	FLJ12525	uc004dwa.2	Q9Y4W2	OTTHUMG00000021720	ENST00000374811.3:c.1448+2343C>G	X.37:g.64741096G>C			A9X410|Q5JXQ0|Q8TEN5|Q9H9V5	RNA	SNP	-	NULL	ENST00000374811.3	37	NULL	CCDS14381.1	X																																																																																			LAS1L	-	-		0.498	LAS1L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAS1L	HGNC	protein_coding	OTTHUMT00000056974.1	G	NM_031206		64741096	-1	no_errors	ENST00000484069	ensembl	human	known	70_37	rna	SNP	0.000	C
LDB1	8861	genome.wustl.edu	37	10	103870840	103870840	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr10:103870840G>A	ENST00000425280.1	-	4	577	c.235C>T	c.(235-237)Cag>Tag	p.Q79*	LDB1_ENST00000490751.1_5'UTR|LDB1_ENST00000361198.5_Nonsense_Mutation_p.Q43*	NM_001113407.1	NP_001106878.1	Q86U70	LDB1_HUMAN	LIM domain binding 1	79					anterior/posterior axis specification (GO:0009948)|cellular component assembly (GO:0022607)|cerebellar Purkinje cell differentiation (GO:0021702)|epithelial structure maintenance (GO:0010669)|gastrulation with mouth forming second (GO:0001702)|hair follicle development (GO:0001942)|head development (GO:0060322)|histone H3-K4 acetylation (GO:0043973)|multicellular organismal development (GO:0007275)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|positive regulation of cell adhesion (GO:0045785)|positive regulation of hemoglobin biosynthetic process (GO:0046985)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription, DNA-templated (GO:0006355)|somatic stem cell maintenance (GO:0035019)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|transcription-dependent tethering of RNA polymerase II gene DNA at nuclear periphery (GO:0000972)|Wnt signaling pathway (GO:0016055)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|enzyme binding (GO:0019899)|LIM domain binding (GO:0030274)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(1)	21		Colorectal(252;0.122)		Epithelial(162;1.11e-07)|all cancers(201;1.82e-06)		GTCCAGTTCTGAAGCCGTTTG	0.522																																																	0													146.0	149.0	148.0					10																	103870840		2203	4300	6503	SO:0001587	stop_gained	8861			AF068652	CCDS7528.1, CCDS44472.1	10q24-q25	2008-08-01			ENSG00000198728	ENSG00000198728			6532	protein-coding gene	gene with protein product	"""carboxy terminal LIM domain protein 2"""	603451				9503020, 9799849	Standard	NM_003893		Approved	NLI, CLIM2	uc009xwz.3	Q86U70	OTTHUMG00000018950	ENST00000425280.1:c.235C>T	10.37:g.103870840G>A	ENSP00000392466:p.Gln79*		B4DUC4|O75479|O96010|Q1EQX1|Q9UGM4	Nonsense_Mutation	SNP	NULL	p.Q79*	ENST00000425280.1	37	c.235	CCDS44472.1	10	.	.	.	.	.	.	.	.	.	.	G	39	7.729291	0.98456	.	.	ENSG00000198728	ENST00000361198;ENST00000425280	.	.	.	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-2.7951	20.0291	0.97531	0.0:0.0:1.0:0.0	.	.	.	.	X	43;79	.	ENSP00000354616:Q43X	Q	-	1	0	LDB1	103860830	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.247000	0.95444	2.838000	0.97847	0.561000	0.74099	CAG	LDB1	-	NULL		0.522	LDB1-201	KNOWN	basic|CCDS	protein_coding	LDB1	HGNC	protein_coding		G	NM_001113407		103870840	-1	no_errors	ENST00000425280	ensembl	human	known	70_37	nonsense	SNP	1.000	A
LHFPL2	10184	genome.wustl.edu	37	5	77784642	77784642	+	3'UTR	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr5:77784642C>G	ENST00000515007.2	-	0	1075				LHFPL2_ENST00000380345.2_3'UTR			Q6ZUX7	LHPL2_HUMAN	lipoma HMGIC fusion partner-like 2							integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	6		all_lung(232;0.000409)|Lung NSC(167;0.00108)|Ovarian(174;0.0107)|Prostate(461;0.218)		OV - Ovarian serous cystadenocarcinoma(54;6.48e-46)|Epithelial(54;8.43e-42)|all cancers(79;1.42e-36)		GGTTAGTTCTCCACTTGACTC	0.458																																																	0																																										SO:0001624	3_prime_UTR_variant	10184			D86961	CCDS4042.1	5q13	2008-02-05			ENSG00000145685	ENSG00000145685			6588	protein-coding gene	gene with protein product		609718				10329012	Standard	NM_005779		Approved	KIAA0206	uc003kfo.3	Q6ZUX7	OTTHUMG00000107579	ENST00000515007.2:c.*78G>C	5.37:g.77784642C>G			B2RMQ6|Q7Z5P0|Q92605	RNA	SNP	-	NULL	ENST00000515007.2	37	NULL	CCDS4042.1	5																																																																																			LHFPL2	-	-		0.458	LHFPL2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LHFPL2	HGNC	protein_coding	OTTHUMT00000369098.2	C	NM_005779		77784642	-1	no_errors	ENST00000502722	ensembl	human	putative	70_37	rna	SNP	0.002	G
USP2-AS1	100499227	genome.wustl.edu	37	11	119369518	119369518	+	RNA	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr11:119369518G>C	ENST00000498979.2	+	0	698				USP2-AS1_ENST00000500970.1_RNA|USP2-AS1_ENST00000578923.1_RNA	NR_034160.1				USP2 antisense RNA 1 (head to head)																		GGGAAGTCTAGTTTGCATTCT	0.468																																																	0																																												100499227					11q23.3	2013-06-06			ENSG00000245248	ENSG00000245248		"""Long non-coding RNAs"""	48673	non-coding RNA	RNA, long non-coding							Standard	NR_034160		Approved	THY1-AS1			OTTHUMG00000166173		11.37:g.119369518G>C				RNA	SNP	-	NULL	ENST00000498979.2	37	NULL		11																																																																																			RP11-305N23.1	-	-		0.468	USP2-AS1-001	KNOWN	basic|exp_conf	antisense	LOC100499227	Clone_based_vega_gene	antisense	OTTHUMT00000388222.2	G			119369518	+1	no_errors	ENST00000498979	ensembl	human	known	70_37	rna	SNP	0.001	C
LOC729218	729218	genome.wustl.edu	37	4	119554781	119554781	+	lincRNA	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr4:119554781C>T	ENST00000567913.2	+	0	4292																											AGGCCCAGCTCCGGCCTCTTG	0.682																																																	0																																												729218																															4.37:g.119554781C>T				RNA	SNP	-	NULL	ENST00000567913.2	37	NULL		4																																																																																			RP11-384K6.6	-	-		0.682	RP11-384K6.6-001	KNOWN	basic	lincRNA	LOC729218	Clone_based_vega_gene	lincRNA	OTTHUMT00000364170.2	C			119554781	+1	no_errors	ENST00000567913	ensembl	human	known	70_37	rna	SNP	0.588	T
LOC81691	81691	genome.wustl.edu	37	16	20838394	20838394	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr16:20838394C>T	ENST00000261377.6	+	9	1045	c.836C>T	c.(835-837)aCg>aTg	p.T279M	AC004381.6_ENST00000348433.6_Missense_Mutation_p.T279M|ERI2_ENST00000564349.1_Intron|AC004381.6_ENST00000564274.1_Missense_Mutation_p.T279M	NM_001199053.1|NM_030941.2	NP_001185982.1|NP_112203.2																					TCGGGAATCACGAAGAAGATT	0.378																																																	0													86.0	85.0	85.0					16																	20838394		2201	4300	6501	SO:0001583	missense	81691																														ENST00000261377.6:c.836C>T	16.37:g.20838394C>T	ENSP00000261377:p.Thr279Met			Missense_Mutation	SNP	pfam_Exonuclease_RNaseT/DNA_pol3,pfam_RRM_dom,superfamily_RNaseH-like_dom,smart_Exonuclease,smart_RRM_dom,pfscan_RRM_dom	p.T279M	ENST00000261377.6	37	c.836	CCDS10591.1	16	.	.	.	.	.	.	.	.	.	.	C	23.0	4.365010	0.82463	.	.	ENSG00000005189	ENST00000348433;ENST00000261377	T;T	0.28255	1.62;1.62	5.22	5.22	0.72569	Exonuclease (1);Exonuclease, RNase T/DNA polymerase III (1);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.71108	0.3301	H	0.97390	3.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.82841	-0.0258	10	0.87932	D	0	-11.8337	17.5583	0.87898	0.0:1.0:0.0:0.0	.	279;279	Q96IC2-2;Q96IC2	.;REXON_HUMAN	M	279	ENSP00000261378:T279M;ENSP00000261377:T279M	ENSP00000261377:T279M	T	+	2	0	AC004381.6	20745895	0.998000	0.40836	0.936000	0.37596	0.985000	0.73830	4.112000	0.57845	2.432000	0.82394	0.655000	0.94253	ACG	AC004381.6	-	pfam_Exonuclease_RNaseT/DNA_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease		0.378	AC004381.6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC81691	Clone_based_vega_gene	protein_coding	OTTHUMT00000254418.2	C			20838394	+1	no_errors	ENST00000261377	ensembl	human	known	70_37	missense	SNP	0.997	T
LRP2	4036	genome.wustl.edu	37	2	170044576	170044576	+	Missense_Mutation	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr2:170044576G>C	ENST00000263816.3	-	49	9517	c.9232C>G	c.(9232-9234)Cac>Gac	p.H3078D		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3078	LDL-receptor class A 25. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TTGAACTCGTGAGGTGGACAC	0.502																																																	0													156.0	128.0	137.0					2																	170044576		2203	4300	6503	SO:0001583	missense	4036				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.9232C>G	2.37:g.170044576G>C	ENSP00000263816:p.His3078Asp		O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.H3078D	ENST00000263816.3	37	c.9232	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	G	8.061	0.768134	0.15983	.	.	ENSG00000081479	ENST00000263816	D	0.94966	-3.57	5.82	4.93	0.64822	.	0.162812	0.56097	D	0.000022	D	0.85124	0.5625	N	0.03608	-0.345	0.80722	D	1	B	0.16603	0.018	B	0.22753	0.041	T	0.80336	-0.1425	10	0.05959	T	0.93	.	16.2637	0.82563	0.0:0.0:0.8662:0.1338	.	3078	P98164	LRP2_HUMAN	D	3078	ENSP00000263816:H3078D	ENSP00000263816:H3078D	H	-	1	0	LRP2	169752822	1.000000	0.71417	0.954000	0.39281	0.001000	0.01503	4.032000	0.57274	1.456000	0.47831	-0.188000	0.12872	CAC	LRP2	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt		0.502	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	G	NM_004525		170044576	-1	no_errors	ENST00000263816	ensembl	human	known	70_37	missense	SNP	0.998	C
LRRC4	64101	genome.wustl.edu	37	7	127669932	127669932	+	Silent	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr7:127669932G>A	ENST00000249363.3	-	2	1019	c.762C>T	c.(760-762)gtC>gtT	p.V254V	SND1_ENST00000354725.3_Intron	NM_022143.4	NP_071426.1	Q9HBW1	LRRC4_HUMAN	leucine rich repeat containing 4	254				QVSLI -> H (in Ref. 2; CAC82651). {ECO:0000305}.	postsynaptic density protein 95 clustering (GO:0097119)|regulation of synapse organization (GO:0050807)|synapse organization (GO:0050808)	cell junction (GO:0030054)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(6)|lung(4)|pancreas(1)|skin(2)	26				Lung(243;0.124)		CAATCAGGCTGACCTGTGAGT	0.542																																																	0													56.0	46.0	49.0					7																	127669932		2202	4299	6501	SO:0001819	synonymous_variant	64101			AF196976	CCDS5799.1	7q31	2013-01-14	2003-11-19		ENSG00000128594	ENSG00000128594		"""Immunoglobulin superfamily / I-set domain containing"""	15586	protein-coding gene	gene with protein product		610486	"""leucine-rich repeat-containing 4"""			12969517	Standard	NM_022143		Approved	NAG14	uc003vmk.3	Q9HBW1	OTTHUMG00000157563	ENST00000249363.3:c.762C>T	7.37:g.127669932G>A			A4D0Y9|Q14DU9|Q6ZMI8|Q96A85	Silent	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.V254	ENST00000249363.3	37	c.762	CCDS5799.1	7																																																																																			LRRC4	-	smart_Leu-rich_rpt_typical-subtyp		0.542	LRRC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC4	HGNC	protein_coding	OTTHUMT00000349170.1	G	NM_022143		127669932	-1	no_errors	ENST00000249363	ensembl	human	known	70_37	silent	SNP	0.995	A
LRRK2	120892	genome.wustl.edu	37	12	40717102	40717102	+	Missense_Mutation	SNP	C	C	T	rs71653641		TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr12:40717102C>T	ENST00000298910.7	+	38	5708	c.5650C>T	c.(5650-5652)Ctc>Ttc	p.L1884F		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1884	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TCCAGAGTTTCTCCTAGGTAA	0.294																																																	0													49.0	52.0	51.0					12																	40717102		2203	4299	6502	SO:0001583	missense	120892			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.5650C>T	12.37:g.40717102C>T	ENSP00000298910:p.Leu1884Phe		A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,tigrfam_Small_GTP-bd_dom	p.L1884F	ENST00000298910.7	37	c.5650	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	C	20.5	3.998851	0.74818	.	.	ENSG00000188906	ENST00000298910	D	0.94000	-3.33	6.16	6.16	0.99307	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.318638	0.33515	N	0.004832	D	0.94883	0.8346	L	0.55213	1.73	0.44214	D	0.997041	P;P	0.46859	0.766;0.885	P;P	0.53722	0.677;0.733	D	0.93399	0.6758	10	0.42905	T	0.14	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	1884;1884	Q17RV3;Q5S007	.;LRRK2_HUMAN	F	1884	ENSP00000298910:L1884F	ENSP00000298910:L1884F	L	+	1	0	LRRK2	39003369	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	2.577000	0.46042	2.937000	0.99478	0.650000	0.86243	CTC	LRRK2	-	superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom		0.294	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1	C	XM_058513		40717102	+1	no_errors	ENST00000298910	ensembl	human	known	70_37	missense	SNP	1.000	T
LRRN2	10446	genome.wustl.edu	37	1	204587429	204587429	+	Silent	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr1:204587429G>A	ENST00000367175.1	-	1	3904	c.1692C>T	c.(1690-1692)ctC>ctT	p.L564L	LRRN2_ENST00000367177.3_Silent_p.L564L|LRRN2_ENST00000367176.3_Silent_p.L564L|LRRN2_ENST00000496057.1_5'Flank|RP11-430C7.4_ENST00000453895.1_RNA			O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2	564					cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|liver(1)|lung(22)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			CCTGGCCCCGGAGGGAGGAGG	0.657																																																	0													66.0	68.0	67.0					1																	204587429		2203	4300	6503	SO:0001819	synonymous_variant	10446			AF030435	CCDS1448.1	1q32.1	2013-01-11	2007-01-31	2007-01-31	ENSG00000170382	ENSG00000170382		"""Immunoglobulin superfamily / I-set domain containing"""	16914	protein-coding gene	gene with protein product	"""leucine rich and ankyrin repeats 1"", ""fibronectin type III, immunoglobulin and leucine rich repeat domain 7"""	605492	"""leucine rich repeat neuronal 5"""	LRRN5		9662332	Standard	NM_006338		Approved	GAC1, LRANK1, FIGLER7	uc001hbf.1	O75325	OTTHUMG00000035989	ENST00000367175.1:c.1692C>T	1.37:g.204587429G>A			B2R624|Q5T0Y0|Q6UXM0|Q8N182	Silent	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L564	ENST00000367175.1	37	c.1692	CCDS1448.1	1																																																																																			LRRN2	-	superfamily_Fibronectin_type3		0.657	LRRN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRN2	HGNC	protein_coding	OTTHUMT00000089894.1	G	NM_006338		204587429	-1	no_errors	ENST00000367175	ensembl	human	known	70_37	silent	SNP	0.913	A
MBTD1	54799	genome.wustl.edu	37	17	49281154	49281154	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr17:49281154C>G	ENST00000586178.1	-	8	1080	c.737G>C	c.(736-738)aGa>aCa	p.R246T	MBTD1_ENST00000415868.1_Missense_Mutation_p.R246T|MBTD1_ENST00000376381.2_Missense_Mutation_p.R246T	NM_017643.2	NP_060113.2	Q05BQ5	MBTD1_HUMAN	mbt domain containing 1	246					chromatin modification (GO:0016568)|embryonic skeletal system development (GO:0048706)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)			CTACTTACTTCTAGGAGGAAC	0.368																																																	0													98.0	99.0	99.0					17																	49281154		2203	4300	6503	SO:0001583	missense	54799			AK000062	CCDS11581.2	17q24.1	2003-01-15			ENSG00000011258	ENSG00000011258			19866	protein-coding gene	gene with protein product							Standard	NM_017643		Approved	SA49P01, FLJ20055	uc002itr.4	Q05BQ5	OTTHUMG00000150442	ENST00000586178.1:c.737G>C	17.37:g.49281154C>G	ENSP00000468304:p.Arg246Thr		Q6ZVU7|Q9NXU1	Missense_Mutation	SNP	pfam_Mbt,smart_Mbt,pfscan_Mbt,pfscan_Znf_FCS	p.R246T	ENST00000586178.1	37	c.737	CCDS11581.2	17	.	.	.	.	.	.	.	.	.	.	c	15.51	2.854420	0.51270	.	.	ENSG00000011258	ENST00000405860;ENST00000415868;ENST00000376381	T;T	0.30182	1.54;1.54	4.84	4.84	0.62591	.	0.099089	0.64402	D	0.000001	T	0.30448	0.0765	L	0.57536	1.79	0.38734	D	0.95373	B;B;B	0.29115	0.233;0.056;0.1	B;B;B	0.27887	0.084;0.029;0.051	T	0.24870	-1.0148	10	0.56958	D	0.05	.	11.5698	0.50826	0.0:0.9177:0.0:0.0823	.	246;246;82	Q05BQ5;Q05BQ5-2;Q05BQ5-3	MBTD1_HUMAN;.;.	T	246	ENSP00000403946:R246T;ENSP00000365561:R246T	ENSP00000365561:R246T	R	-	2	0	MBTD1	46636153	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.876000	0.63079	2.258000	0.74832	0.627000	0.83407	AGA	MBTD1	-	pfam_Mbt		0.368	MBTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBTD1	HGNC	protein_coding	OTTHUMT00000318124.1	C			49281154	-1	no_errors	ENST00000415868	ensembl	human	known	70_37	missense	SNP	1.000	G
MCM9	254394	genome.wustl.edu	37	6	119136454	119136454	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr6:119136454C>T	ENST00000316316.6	-	13	3251	c.2965G>A	c.(2965-2967)Gag>Aag	p.E989K		NM_017696.2	NP_060166.2	Q9NXL9	MCM9_HUMAN	minichromosome maintenance complex component 9	989					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)	MCM8-MCM9 complex (GO:0097362)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.194)		TCCTTTGTCTCACCCTGTGGC	0.527																																																	0																																										SO:0001583	missense	254394			BC031658	CCDS5121.1, CCDS56447.1	6q22.31	2009-11-16	2007-04-04	2007-04-04	ENSG00000111877	ENSG00000111877			21484	protein-coding gene	gene with protein product		610098	"""minichromosome maintenance deficient domain containing 1"", ""chromosome 6 open reading frame 61"""	MCMDC1, C6orf61		16226853, 15850810, 16495042	Standard	NM_153255		Approved	MGC35304, dJ329L24.3, FLJ20170	uc021zeh.1	Q9NXL9	OTTHUMG00000015468	ENST00000316316.6:c.2965G>A	6.37:g.119136454C>T	ENSP00000314505:p.Glu989Lys		B4DR30|B9DI77|Q2KHJ0|Q8N5S5|Q9HCV5	Missense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,pfam_ATPase_dyneun-rel_AAA,superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_DNA-dep_ATPase	p.E989K	ENST00000316316.6	37	c.2965	CCDS56447.1	6	.	.	.	.	.	.	.	.	.	.	C	5.799	0.331780	0.10956	.	.	ENSG00000111877	ENST00000316316;ENST00000243218	T	0.03553	3.89	5.44	-5.48	0.02592	.	.	.	.	.	T	0.00328	0.0010	N	0.01800	-0.715	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.47686	-0.9098	9	0.02654	T	1	.	7.3566	0.26723	0.0:0.3798:0.2149:0.4054	.	989	Q9NXL9	MCM9_HUMAN	K	989;608	ENSP00000314505:E989K	ENSP00000243218:E608K	E	-	1	0	MCM9	119243157	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-5.240000	0.00138	-0.800000	0.04433	-0.878000	0.02970	GAG	MCM9	-	NULL		0.527	MCM9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM9	HGNC	protein_coding	OTTHUMT00000042005.4	C	NM_153255		119136454	-1	no_errors	ENST00000316316	ensembl	human	known	70_37	missense	SNP	0.000	T
MERTK	10461	genome.wustl.edu	37	2	112786126	112786126	+	Missense_Mutation	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr2:112786126G>C	ENST00000295408.4	+	19	2942	c.2685G>C	c.(2683-2685)ttG>ttC	p.L895F	MERTK_ENST00000421804.2_Missense_Mutation_p.L895F|MERTK_ENST00000409780.1_Missense_Mutation_p.L719F			Q12866	MERTK_HUMAN	MER proto-oncogene, tyrosine kinase	895					apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|leukocyte migration (GO:0050900)|natural killer cell differentiation (GO:0001779)|negative regulation of lymphocyte activation (GO:0051250)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of phagocytosis (GO:0050766)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|secretion by cell (GO:0032940)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|rhabdomere (GO:0016028)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(10)	46						CACTGGACTTGAACATCGACC	0.547																																																	0													144.0	141.0	142.0					2																	112786126		2203	4300	6503	SO:0001583	missense	10461			U08023	CCDS2094.1	2q14.1	2014-06-26	2014-06-26		ENSG00000153208	ENSG00000153208		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7027	protein-coding gene	gene with protein product		604705	"""c-mer proto-oncogene tyrosine kinase"""			8086340, 10343112	Standard	XM_005263565		Approved	mer, RP38	uc002thk.1	Q12866	OTTHUMG00000131278	ENST00000295408.4:c.2685G>C	2.37:g.112786126G>C	ENSP00000295408:p.Leu895Phe		Q9HBB4	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Rhodanese-like_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L895F	ENST00000295408.4	37	c.2685	CCDS2094.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.950|7.950	0.744598|0.744598	0.15710|0.15710	.|.	.|.	ENSG00000153208|ENSG00000153208	ENST00000393237|ENST00000295408;ENST00000421804;ENST00000409780;ENST00000449344	.|T;T;T;D	.|0.84516	.|-0.98;-0.98;-0.97;-1.86	5.47|5.47	5.47|5.47	0.80525|0.80525	.|.	.|0.400270	.|0.17992	.|U	.|0.155190	T|T	0.75852|0.75852	0.3906|0.3906	L|L	0.44542|0.44542	1.39|1.39	0.22989|0.22989	N|N	0.99847|0.99847	.|B	.|0.28128	.|0.201	.|B	.|0.24541	.|0.054	T|T	0.60480|0.60480	-0.7255|-0.7255	6|10	0.20519|0.09590	T|T	0.43|0.72	-12.8996|-12.8996	8.6605|8.6605	0.34091|0.34091	0.0782:0.0:0.7696:0.1521|0.0782:0.0:0.7696:0.1521	.|.	.|895	.|Q12866	.|MERTK_HUMAN	Q|F	553|895;895;719;219	.|ENSP00000295408:L895F;ENSP00000389152:L895F;ENSP00000387277:L719F;ENSP00000412660:L219F	ENSP00000376929:E553Q|ENSP00000295408:L895F	E|L	+|+	1|3	0|2	MERTK|MERTK	112502597|112502597	0.855000|0.855000	0.29742|0.29742	0.963000|0.963000	0.40424|0.40424	0.013000|0.013000	0.08279|0.08279	1.748000|1.748000	0.38308|0.38308	2.571000|2.571000	0.86741|0.86741	0.655000|0.655000	0.94253|0.94253	GAA|TTG	MERTK	-	superfamily_Rhodanese-like_dom		0.547	MERTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MERTK	HGNC	protein_coding	OTTHUMT00000254046.2	G			112786126	+1	no_errors	ENST00000295408	ensembl	human	known	70_37	missense	SNP	0.968	C
MEX3B	84206	genome.wustl.edu	37	15	82336662	82336662	+	Missense_Mutation	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr15:82336662G>C	ENST00000329713.4	-	2	984	c.549C>G	c.(547-549)atC>atG	p.I183M	MEX3B_ENST00000558133.1_3'UTR|AC026956.1_ENST00000410589.1_RNA	NM_032246.4	NP_115622.2	Q6ZN04	MEX3B_HUMAN	mex-3 RNA binding family member B	183	KH 2. {ECO:0000255|PROSITE- ProRule:PRU00117}.				protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)	19						GGATGCGCTTGATTGTGGCGC	0.672																																																	0													86.0	86.0	86.0					15																	82336662		2203	4300	6503	SO:0001583	missense	84206			AK131424	CCDS10319.1	15q25.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000183496	ENSG00000183496		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	25297	protein-coding gene	gene with protein product		611008	"""ring finger and KH domain containing 3"", ""mex-3 homolog B (C. elegans)"""	RKHD3		11230166, 17267406	Standard	NM_032246		Approved	DKFZp434J0617, RNF195	uc002bgq.2	Q6ZN04	OTTHUMG00000147356	ENST00000329713.4:c.549C>G	15.37:g.82336662G>C	ENSP00000329918:p.Ile183Met		Q4G0W1|Q8IVG2|Q9H0J0	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom,smart_Znf_RING,pfscan_Znf_RING,pfscan_KH_dom_type_1	p.I183M	ENST00000329713.4	37	c.549	CCDS10319.1	15	.	.	.	.	.	.	.	.	.	.	G	18.50	3.637806	0.67130	.	.	ENSG00000183496	ENST00000329713	T	0.56275	0.47	4.5	3.59	0.41128	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.059089	0.64402	D	0.000003	T	0.71195	0.3311	M	0.84511	2.7	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.73248	-0.4043	10	0.87932	D	0	-27.0497	7.9371	0.29935	0.1909:0.0:0.8091:0.0	.	183	Q6ZN04	MEX3B_HUMAN	M	183	ENSP00000329918:I183M	ENSP00000329918:I183M	I	-	3	3	MEX3B	80123717	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.307000	0.65762	1.121000	0.41925	0.561000	0.74099	ATC	MEX3B	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1		0.672	MEX3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEX3B	HGNC	protein_coding	OTTHUMT00000304000.1	G	XM_290645		82336662	-1	no_errors	ENST00000329713	ensembl	human	known	70_37	missense	SNP	1.000	C
MICA	100507436	genome.wustl.edu	37	6	31378883	31378883	+	Missense_Mutation	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr6:31378883G>C	ENST00000449934.2	+	3	414	c.360G>C	c.(358-360)gaG>gaC	p.E120D	HCP5_ENST00000414046.2_RNA	NM_001177519.1	NP_001170990.1			MHC class I polypeptide-related sequence A											breast(1)|endometrium(3)|kidney(1)	5		Ovarian(999;0.0253)				GGGTCTGTGAGATCCATGAAG	0.552																																																	0													32.0	32.0	32.0					6																	31378883		692	1591	2283	SO:0001583	missense	100507436			L14848	CCDS56412.1, CCDS75421.1	6p21.3	2013-01-11			ENSG00000204520	ENSG00000204520		"""Immunoglobulin superfamily / C1-set domain containing"""	7090	protein-coding gene	gene with protein product		600169				8022771	Standard	NM_000247		Approved	PERB11.1	uc003ntk.1	Q29983	OTTHUMG00000031073	ENST00000449934.2:c.360G>C	6.37:g.31378883G>C	ENSP00000413079:p.Glu120Asp			Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like	p.E120D	ENST00000449934.2	37	c.360	CCDS56412.1	6	.	.	.	.	.	.	.	.	.	.	-	8.668	0.902084	0.17760	.	.	ENSG00000204520	ENST00000364810;ENST00000449934	T	0.00664	5.92	1.94	-0.128	0.13506	.	0.885835	0.09320	N	0.818329	T	0.00412	0.0013	L	0.35854	1.095	0.09310	N	1	D	0.61080	0.989	P	0.60068	0.868	T	0.34950	-0.9808	10	0.02654	T	1	.	3.6867	0.08331	0.1658:0.0:0.5893:0.2449	.	120	Q96QC4	.	D	120	ENSP00000413079:E120D	ENSP00000365394:E120D	E	+	3	2	MICA	31486862	0.163000	0.22920	0.019000	0.16419	0.039000	0.13416	-0.221000	0.09202	0.158000	0.19367	0.306000	0.20318	GAG	MICA	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog		0.552	MICA-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	MICA	HGNC	protein_coding	OTTHUMT00000076101.7	G	NM_001177519		31378883	+1	no_errors	ENST00000364810	ensembl	human	known	70_37	missense	SNP	0.044	C
MMP1	4312	genome.wustl.edu	37	11	102667841	102667841	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr11:102667841C>G	ENST00000315274.6	-	3	470	c.403G>C	c.(403-405)Gag>Cag	p.E135Q	WTAPP1_ENST00000525739.2_RNA	NM_001145938.1|NM_002421.3	NP_001139410.1|NP_002412.1	P03956	MMP1_HUMAN	matrix metallopeptidase 1 (interstitial collagenase)	135	Metalloprotease.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|proteolysis (GO:0006508)|viral process (GO:0016032)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.E135Q(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(18)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	30	all_epithelial(12;0.0127)	all_neural(303;0.000318)|all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.072)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.233)	OV - Ovarian serous cystadenocarcinoma(223;1.82e-07)|Epithelial(105;1.51e-06)|BRCA - Breast invasive adenocarcinoma(274;0.014)	Marimastat(DB00786)	AAGGCTTTCTCAATGGCATGG	0.433																																																	1	Substitution - Missense(1)	lung(1)											138.0	132.0	134.0					11																	102667841		2203	4299	6502	SO:0001583	missense	4312			X54925	CCDS8322.1	11q21-q22	2014-01-30	2005-08-08		ENSG00000196611	ENSG00000196611	3.4.24.7	"""Endogenous ligands"""	7155	protein-coding gene	gene with protein product		120353	"""matrix metalloproteinase 1 (interstitial collagenase)"""	CLG			Standard	NM_002421		Approved		uc001phi.2	P03956	OTTHUMG00000048192	ENST00000315274.6:c.403G>C	11.37:g.102667841C>G	ENSP00000322788:p.Glu135Gln		P08156	Missense_Mutation	SNP	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin/matrixin_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,pirsf_Pept_M10A_matrix_strom,prints_Pept_M10A_matrixin	p.E135Q	ENST00000315274.6	37	c.403	CCDS8322.1	11	.	.	.	.	.	.	.	.	.	.	c	8.031	0.761697	0.15914	.	.	ENSG00000196611	ENST00000315274	T	0.21361	2.01	5.87	-1.44	0.08856	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	1.913740	0.01999	N	0.046147	T	0.10680	0.0261	N	0.13299	0.325	0.09310	N	1	B	0.24823	0.112	B	0.23018	0.043	T	0.14062	-1.0486	10	0.13853	T	0.58	.	2.9777	0.05943	0.1066:0.462:0.2086:0.2227	.	135	P03956	MMP1_HUMAN	Q	135	ENSP00000322788:E135Q	ENSP00000322788:E135Q	E	-	1	0	MMP1	102173051	0.000000	0.05858	0.016000	0.15963	0.936000	0.57629	-2.184000	0.01254	-0.069000	0.12931	0.655000	0.94253	GAG	MMP1	-	pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo,pirsf_Pept_M10A_matrix_strom,prints_Pept_M10A_matrixin		0.433	MMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP1	HGNC	protein_coding	OTTHUMT00000109632.1	C	NM_002421		102667841	-1	no_errors	ENST00000315274	ensembl	human	known	70_37	missense	SNP	0.000	G
MTOR	2475	genome.wustl.edu	37	1	11217277	11217277	+	Missense_Mutation	SNP	C	C	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr1:11217277C>A	ENST00000361445.4	-	30	4477	c.4401G>T	c.(4399-4401)atG>atT	p.M1467I		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	1467	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	TGTTGGTGTCCATTTTCTTGT	0.547																																																	0													186.0	156.0	166.0					1																	11217277		2203	4300	6503	SO:0001583	missense	2475			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.4401G>T	1.37:g.11217277C>A	ENSP00000354558:p.Met1467Ile		Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_DUF3385_TOR,pfam_Rapamycin-bd_dom,pfam_FATC,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,superfamily_Rapamycin-bd_dom,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.M1467I	ENST00000361445.4	37	c.4401	CCDS127.1	1	.	.	.	.	.	.	.	.	.	.	C	10.86	1.469366	0.26423	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.06371	3.31	5.69	3.78	0.43462	PIK-related kinase (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.149713	0.64402	D	0.000011	T	0.03053	0.0090	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.49273	-0.8957	10	0.24483	T	0.36	.	6.3554	0.21398	0.1372:0.6606:0.1322:0.07	.	1467	P42345	MTOR_HUMAN	I	1467	ENSP00000354558:M1467I	ENSP00000354558:M1467I	M	-	3	0	MTOR	11139864	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	1.115000	0.31209	0.721000	0.32231	0.655000	0.94253	ATG	MTOR	-	superfamily_ARM-type_fold,pfscan_PIK_FAT		0.547	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTOR	HGNC	protein_coding	OTTHUMT00000005558.1	C	NM_004958		11217277	-1	no_errors	ENST00000361445	ensembl	human	known	70_37	missense	SNP	1.000	A
MYB	4602	genome.wustl.edu	37	6	135539487	135539487	+	3'UTR	SNP	A	A	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr6:135539487A>G	ENST00000367814.4	+	0	2478				MYB_ENST00000531845.1_3'UTR|MYB_ENST00000525369.1_3'UTR|MYB_ENST00000341911.5_3'UTR|MYB_ENST00000442647.2_3'UTR|MYB_ENST00000316528.8_3'UTR	NM_001161659.1|NM_005375.2	NP_001155131.1|NP_005366.2	P10242	MYB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog						B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|chromatin remodeling (GO:0006338)|embryonic digestive tract development (GO:0048566)|G1/S transition of mitotic cell cycle (GO:0000082)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of T-helper cell differentiation (GO:0045624)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|thymus development (GO:0048538)	nuclear matrix (GO:0016363)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(4)|endometrium(1)|kidney(2)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		ATTAAAAGGTACTCCAGTATT	0.269			T	NFIB	adenoid cystic carcinoma																																			Dom	yes		6	6q22-23	4602	v-myb myeloblastosis viral oncogene homolog		E	0																																										SO:0001624	3_prime_UTR_variant	4602				CCDS5174.1, CCDS47481.1, CCDS47482.1, CCDS55058.1, CCDS55059.1, CCDS55060.1, CCDS55061.1, CCDS55062.1	6q22-q23	2013-07-09	2013-07-09		ENSG00000118513	ENSG00000118513			7545	protein-coding gene	gene with protein product		189990				17599807	Standard	NM_001130172		Approved	c-myb	uc003qfh.3	P10242	OTTHUMG00000015629	ENST00000367814.4:c.*369A>G	6.37:g.135539487A>G			E9PI07|E9PLZ5|E9PNA4|E9PNL6|E9PRS2|P78391|P78392|P78525|P78526|Q14023|Q14024|Q708E4|Q708E7|Q9UE83	RNA	SNP	-	NULL	ENST00000367814.4	37	NULL	CCDS5174.1	6																																																																																			MYB	-	-		0.269	MYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYB	HGNC	protein_coding	OTTHUMT00000042347.4	A			135539487	+1	no_errors	ENST00000531845	ensembl	human	known	70_37	rna	SNP	1.000	G
NACAP1	83955	genome.wustl.edu	37	8	102381883	102381883	+	RNA	DEL	A	A	-	rs199821234		TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr8:102381883delA	ENST00000419462.1	+	0	1295					NR_002182.1		Q9BZK3	NACP1_HUMAN	nascent-polypeptide-associated complex alpha polypeptide pseudogene 1																		TTGTTGGATGAAAAAAAAAAG	0.323																																																	0																																												83955			AF315951		8q22.3	2007-04-20				ENSG00000228224			24688	pseudogene	pseudogene							Standard	NR_002182		Approved	FKSG17	uc003ykc.1	Q9BZK3			8.37:g.102381883delA				RNA	DEL	-	NULL	ENST00000419462.1	37	NULL		8																																																																																			NACAP1	-	-		0.323	NACAP1-001	KNOWN	basic	processed_transcript	NACAP1	HGNC	pseudogene	OTTHUMT00000380521.1	A	NR_002182		102381883	+1	no_errors	ENST00000419462	ensembl	human	known	70_37	rna	DEL	0.879	-
NEFH	4744	genome.wustl.edu	37	22	29879485	29879485	+	Silent	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr22:29879485G>A	ENST00000310624.6	+	2	1038	c.1005G>A	c.(1003-1005)ctG>ctA	p.L335L		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	335	Coil 2B.|Rod.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.L335L(1)		cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						TGGAGGCACTGAAAAGCACCA	0.612																																																	1	Substitution - coding silent(1)	lung(1)											109.0	88.0	95.0					22																	29879485		2203	4300	6503	SO:0001819	synonymous_variant	4744				CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1005G>A	22.37:g.29879485G>A			B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	pfam_F,pfam_DUF1388	p.L335	ENST00000310624.6	37	c.1005	CCDS13858.1	22																																																																																			NEFH	-	pfam_F		0.612	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEFH	HGNC	protein_coding	OTTHUMT00000321553.2	G	NM_021076		29879485	+1	no_errors	ENST00000310624	ensembl	human	known	70_37	silent	SNP	0.993	A
NFX1	4799	genome.wustl.edu	37	9	33366761	33366761	+	Silent	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr9:33366761C>T	ENST00000379540.3	+	22	3236	c.3174C>T	c.(3172-3174)gtC>gtT	p.V1058V	NFX1_ENST00000463421.1_3'UTR	NM_002504.4	NP_002495.2	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	1058	R3H. {ECO:0000255|PROSITE- ProRule:PRU00382}.				inflammatory response (GO:0006954)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		ATGTGGTGGTCACTGCCATCA	0.532																																																	0													89.0	70.0	77.0					9																	33366761		2203	4300	6503	SO:0001819	synonymous_variant	4799			U19759	CCDS6538.1, CCDS6539.1, CCDS6540.1	9p12	2013-12-13			ENSG00000086102	ENSG00000086102			7803	protein-coding gene	gene with protein product		603255				7964459, 2511169	Standard	NM_002504		Approved	NFX2, MGC20369, Tex42, TEG-42	uc003zsq.3	Q12986	OTTHUMG00000019772	ENST00000379540.3:c.3174C>T	9.37:g.33366761C>T			A8K6H8|Q5VXW6|Q96EL5|Q9BXI1	Silent	SNP	pfam_Znf_NFX1,pfam_R3H_ss-bd,smart_Znf_RING,smart_Znf_NFX1,smart_R3H_ss-bd,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_R3H_ss-bd	p.V1058	ENST00000379540.3	37	c.3174	CCDS6538.1	9																																																																																			NFX1	-	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd		0.532	NFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFX1	HGNC	protein_coding	OTTHUMT00000052069.1	C			33366761	+1	no_errors	ENST00000379540	ensembl	human	known	70_37	silent	SNP	1.000	T
NLRX1	79671	genome.wustl.edu	37	11	119050625	119050625	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr11:119050625C>G	ENST00000409109.1	+	7	2482	c.1895C>G	c.(1894-1896)tCt>tGt	p.S632C	NLRX1_ENST00000409991.1_Missense_Mutation_p.S632C|NLRX1_ENST00000409265.4_Missense_Mutation_p.S632C|NLRX1_ENST00000292199.2_Missense_Mutation_p.S632C|NLRX1_ENST00000525863.1_Missense_Mutation_p.S632C	NM_001282144.1	NP_001269073.1	Q86UT6	NLRX1_HUMAN	NLR family member X1	632	Required for the repression of MAVS- induced interferon signaling.				innate immune response (GO:0045087)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|viral process (GO:0016032)	mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)			cervix(1)|endometrium(2)|kidney(2)|lung(10)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	22	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		GGGCTTCTCTCTGCCCACAAC	0.622																																																	0													48.0	52.0	50.0					11																	119050625		2200	4295	6495	SO:0001583	missense	79671			AB094095	CCDS8416.1	11q23.3	2007-02-07			ENSG00000160703	ENSG00000160703		"""Nucleotide-binding domain and leucine rich repeat containing"""	29890	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat containing X1"", ""NOD-like receptor X1"", ""NLR family, X1"""	611947				12766759	Standard	XM_005271669		Approved	NOD9, CLR11.3	uc001pvw.3	Q86UT6	OTTHUMG00000154476	ENST00000409109.1:c.1895C>G	11.37:g.119050625C>G	ENSP00000387334:p.Ser632Cys		A8K6Q1|B3KPK2|B3KTA2|Q7RTR3|Q96D51|Q9H724	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase	p.S632C	ENST00000409109.1	37	c.1895	CCDS8416.1	11	.	.	.	.	.	.	.	.	.	.	C	19.46	3.832712	0.71258	.	.	ENSG00000160703	ENST00000409991;ENST00000292199;ENST00000409265;ENST00000409109;ENST00000525863	T;T;T;T;T	0.72725	-0.57;-0.57;-0.68;-0.57;-0.68	5.33	5.33	0.75918	.	0.000000	0.64402	D	0.000001	T	0.77391	0.4123	L	0.27053	0.805	0.42026	D	0.991009	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.985	T	0.79713	-0.1688	10	0.56958	D	0.05	.	19.0214	0.92917	0.0:1.0:0.0:0.0	.	632;632	Q86UT6-2;Q86UT6	.;NLRX1_HUMAN	C	632	ENSP00000386851:S632C;ENSP00000292199:S632C;ENSP00000386858:S632C;ENSP00000387334:S632C;ENSP00000433442:S632C	ENSP00000292199:S632C	S	+	2	0	NLRX1	118555835	1.000000	0.71417	0.989000	0.46669	0.953000	0.61014	5.747000	0.68689	2.503000	0.84419	0.561000	0.74099	TCT	NLRX1	-	NULL		0.622	NLRX1-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NLRX1	HGNC	protein_coding	OTTHUMT00000335403.1	C	NM_170722		119050625	+1	no_errors	ENST00000292199	ensembl	human	known	70_37	missense	SNP	1.000	G
NTMT1	28989	genome.wustl.edu	37	9	132395004	132395004	+	Missense_Mutation	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr9:132395004G>C	ENST00000372486.1	+	2	371	c.22G>C	c.(22-24)Gac>Cac	p.D8H	NTMT1_ENST00000459968.2_Missense_Mutation_p.D8H|NTMT1_ENST00000482347.1_Intron|NTMT1_ENST00000372480.1_Missense_Mutation_p.D8H|NTMT1_ENST00000486391.2_3'UTR|NTMT1_ENST00000372481.3_Missense_Mutation_p.D8H|NTMT1_ENST00000372483.4_Missense_Mutation_p.D8H			Q9BV86	NTM1A_HUMAN	N-terminal Xaa-Pro-Lys N-methyltransferase 1	8					chromosome segregation (GO:0007059)|N-terminal peptidyl-proline dimethylation (GO:0018016)|N-terminal peptidyl-serine dimethylation (GO:0035572)|N-terminal peptidyl-serine trimethylation (GO:0035573)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein methyltransferase activity (GO:0008276)										GGTGATAGAAGACGAGAAGCA	0.562																																																	0													163.0	125.0	138.0					9																	132395004		2203	4300	6503	SO:0001583	missense	28989			AF110776	CCDS35160.1, CCDS69682.1, CCDS75918.1	9q34.2	2012-11-05	2012-06-12	2012-06-12	ENSG00000148335	ENSG00000148335	2.1.1.n5		23373	protein-coding gene	gene with protein product		613560	"""chromosome 9 open reading frame 32"", ""methyltransferase like 11A"""	C9orf32, METTL11A		20481588	Standard	XM_005251939		Approved	AD-003, HOMT1A	uc004byd.1	Q9BV86	OTTHUMG00000020785	ENST00000372486.1:c.22G>C	9.37:g.132395004G>C	ENSP00000361564:p.Asp8His		A8K4J2|A8K8G7|Q5SZB9|Q9UI28	Missense_Mutation	SNP	pfam_DUF858_MeTrfase_lik,pfam_Methyltransf_11,pfam_Methyltransf_12,pfam_UbiE/COQ5_MeTrFase,pfam_O_MeTrfase_2,pirsf_DUF858_MeTrfase_lik	p.D8H	ENST00000372486.1	37	c.22	CCDS35160.1	9	.	.	.	.	.	.	.	.	.	.	G	19.96	3.923819	0.73213	.	.	ENSG00000148335	ENST00000372486;ENST00000372483;ENST00000372481;ENST00000372480	T;T;T;T	0.27402	1.67;1.67;1.67;1.67	5.3	5.3	0.74995	.	0.122013	0.52532	D	0.000072	T	0.46870	0.1415	M	0.70108	2.13	0.58432	D	0.999997	D;P	0.59767	0.986;0.79	P;P	0.56163	0.793;0.572	T	0.46359	-0.9197	10	0.56958	D	0.05	-1.5562	11.9931	0.53186	0.0843:0.0:0.9157:0.0	.	8;8	Q9BV86-2;Q9BV86	.;NTM1A_HUMAN	H	8	ENSP00000361564:D8H;ENSP00000361561:D8H;ENSP00000361559:D8H;ENSP00000361558:D8H	ENSP00000361558:D8H	D	+	1	0	METTL11A	131434825	1.000000	0.71417	0.398000	0.26321	0.627000	0.37826	6.591000	0.74090	2.483000	0.83821	0.561000	0.74099	GAC	NTMT1	-	pfam_DUF858_MeTrfase_lik,pirsf_DUF858_MeTrfase_lik		0.562	NTMT1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NTMT1	HGNC	protein_coding	OTTHUMT00000054589.1	G	NM_014064		132395004	+1	no_errors	ENST00000372480	ensembl	human	known	70_37	missense	SNP	0.990	C
NUP160	23279	genome.wustl.edu	37	11	47858549	47858549	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr11:47858549C>T	ENST00000378460.2	-	6	878	c.832G>A	c.(832-834)Gac>Aac	p.D278N	NUP160_ENST00000532747.1_Silent_p.*99*|NUP160_ENST00000530326.1_Missense_Mutation_p.D164N|NUP160_ENST00000528071.1_Missense_Mutation_p.D164N	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	278					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						GGCGACTGGTCACCCCTAAAA	0.378																																																	0													136.0	117.0	124.0					11																	47858549		2201	4298	6499	SO:0001583	missense	23279			D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.832G>A	11.37:g.47858549C>T	ENSP00000367721:p.Asp278Asn		B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Missense_Mutation	SNP	pfam_Nucleoporin_Nup160	p.D278N	ENST00000378460.2	37	c.832	CCDS31484.1	11	.	.	.	.	.	.	.	.	.	.	C	34	5.328195	0.95733	.	.	ENSG00000030066	ENST00000378460;ENST00000426372;ENST00000530326;ENST00000528071	T;T;T	0.44482	0.92;0.92;0.92	5.69	5.69	0.88448	.	0.179255	0.48286	D	0.000197	T	0.52125	0.1715	M	0.63428	1.95	0.80722	D	1	P	0.45283	0.855	P	0.49387	0.609	T	0.36792	-0.9733	10	0.16896	T	0.51	.	19.8113	0.96547	0.0:1.0:0.0:0.0	.	278	Q12769	NU160_HUMAN	N	278;28;164;164	ENSP00000367721:D278N;ENSP00000433590:D164N;ENSP00000432367:D164N	ENSP00000367721:D278N	D	-	1	0	NUP160	47815125	1.000000	0.71417	0.996000	0.52242	0.865000	0.49528	6.860000	0.75473	2.690000	0.91761	0.655000	0.94253	GAC	NUP160	-	pfam_Nucleoporin_Nup160		0.378	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP160	HGNC	protein_coding	OTTHUMT00000390239.2	C	NM_015231		47858549	-1	no_errors	ENST00000378460	ensembl	human	known	70_37	missense	SNP	1.000	T
ODAM	54959	genome.wustl.edu	37	4	71063015	71063015	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr4:71063015C>G	ENST00000396094.2	+	3	166	c.118C>G	c.(118-120)Caa>Gaa	p.Q40E		NM_017855.3	NP_060325.3	A1E959	ODAM_HUMAN	odontogenic, ameloblast asssociated	40					biomineral tissue development (GO:0031214)|odontogenesis of dentin-containing tooth (GO:0042475)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|fibril (GO:0043205)|nucleus (GO:0005634)				NS(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(8)|ovary(3)|skin(2)	20						TAATAATGGTCAACTTTTGCC	0.269																																																	0													111.0	103.0	105.0					4																	71063015		1803	4059	5862	SO:0001583	missense	54959			AK000520	CCDS3536.2	4q13.3	2010-11-23			ENSG00000109205	ENSG00000109205			26043	protein-coding gene	gene with protein product		614843				14647039	Standard	NM_017855		Approved	APin, FLJ20513	uc003hfc.3	A1E959	OTTHUMG00000129406	ENST00000396094.2:c.118C>G	4.37:g.71063015C>G	ENSP00000379401:p.Gln40Glu		Q8WWE5|Q9NWZ9	Missense_Mutation	SNP	NULL	p.Q40E	ENST00000396094.2	37	c.118	CCDS3536.2	4	.	.	.	.	.	.	.	.	.	.	C	2.663	-0.279388	0.05642	.	.	ENSG00000109205	ENST00000396094;ENST00000510709	T	0.47177	0.85	4.68	2.78	0.32641	.	.	.	.	.	T	0.39937	0.1097	L	0.46157	1.445	0.09310	N	0.999998	B	0.22683	0.073	B	0.24701	0.055	T	0.35375	-0.9791	9	0.54805	T	0.06	0.1808	7.2434	0.26109	0.1951:0.6162:0.1886:0.0	.	40	A1E959	ODAM_HUMAN	E	40;26	ENSP00000379401:Q40E	ENSP00000379401:Q40E	Q	+	1	0	ODAM	71097604	0.250000	0.23951	0.660000	0.29694	0.013000	0.08279	0.608000	0.24223	1.318000	0.45170	0.591000	0.81541	CAA	ODAM	-	NULL		0.269	ODAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODAM	HGNC	protein_coding	OTTHUMT00000251562.1	C	NM_017855		71063015	+1	no_errors	ENST00000396094	ensembl	human	known	70_37	missense	SNP	0.451	G
OGFOD3	79701	genome.wustl.edu	37	17	80352367	80352367	+	Intron	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr17:80352367C>T	ENST00000313056.5	-	9	975				OGFOD3_ENST00000578287.1_5'Flank|OGFOD3_ENST00000329197.5_Silent_p.P292P	NM_024648.2|NM_175902.4	NP_078924.1|NP_787098.3	Q6PK18	OGFD3_HUMAN	2-oxoglutarate and iron-dependent oxygenase domain containing 3							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)										CACTGGCTCTCGGTCCATTAA	0.567																																																	0													95.0	93.0	93.0					17																	80352367		2203	4300	6503	SO:0001627	intron_variant	79701			BC023602	CCDS11811.1, CCDS11812.1	17q25.3	2012-10-23	2012-10-23	2012-10-23	ENSG00000181396	ENSG00000181396			26174	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 101"""	C17orf101		12477932	Standard	NM_175902		Approved	FLJ22222	uc002keu.2	Q6PK18		ENST00000313056.5:c.824-1957G>A	17.37:g.80352367C>T			C9JDC8|Q8IZ37|Q9H6J2	Silent	SNP	smart_Pro_4_hyd_alph	p.P292	ENST00000313056.5	37	c.876	CCDS11811.1	17																																																																																			OGFOD3	-	smart_Pro_4_hyd_alph		0.567	OGFOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OGFOD3	HGNC	protein_coding	OTTHUMT00000442895.1	C	NM_175902		80352367	-1	no_errors	ENST00000329197	ensembl	human	known	70_37	silent	SNP	0.007	T
OTUD1	220213	genome.wustl.edu	37	10	23729371	23729371	+	Missense_Mutation	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr10:23729371G>A	ENST00000376495.3	+	1	1174	c.985G>A	c.(985-987)Gtg>Atg	p.V329M		NM_001145373.2	NP_001138845.1	Q5VV17	OTUD1_HUMAN	OTU deubiquitinase 1	329	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				protein K63-linked deubiquitination (GO:0070536)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)	5						CAGCAAGACGGTGTATGGGGA	0.582																																																	0													47.0	51.0	50.0					10																	23729371		692	1591	2283	SO:0001583	missense	220213			AK096389	CCDS44366.1	10p12.31	2014-02-24	2014-02-24		ENSG00000165312	ENSG00000165312		"""OTU domain containing"""	27346	protein-coding gene	gene with protein product		612022	"""OTU domain containing 1"""	OTDC1		23827681	Standard	NM_001145373		Approved	DUBA7	uc001irr.2	Q5VV17	OTTHUMG00000017819	ENST00000376495.3:c.985G>A	10.37:g.23729371G>A	ENSP00000365678:p.Val329Met			Missense_Mutation	SNP	pfam_OTU,pfscan_OTU	p.V329M	ENST00000376495.3	37	c.985	CCDS44366.1	10	.	.	.	.	.	.	.	.	.	.	G	12.65	2.001913	0.35320	.	.	ENSG00000165312	ENST00000376495	T	0.47869	0.83	4.54	2.6	0.31112	Ovarian tumour, otubain (2);	0.390642	0.23298	U	0.049708	T	0.34542	0.0901	L	0.44542	1.39	0.33694	D	0.613663	P	0.35077	0.483	B	0.34038	0.174	T	0.44877	-0.9299	10	0.40728	T	0.16	-15.8266	6.288	0.21043	0.157:0.2844:0.5586:0.0	.	329	Q5VV17	OTUD1_HUMAN	M	329	ENSP00000365678:V329M	ENSP00000365678:V329M	V	+	1	0	OTUD1	23769377	0.999000	0.42202	0.904000	0.35570	0.866000	0.49608	2.946000	0.49050	0.861000	0.35504	0.655000	0.94253	GTG	OTUD1	-	pfam_OTU,pfscan_OTU		0.582	OTUD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUD1	HGNC	protein_coding	OTTHUMT00000047215.1	G	XM_166659		23729371	+1	no_errors	ENST00000376495	ensembl	human	known	70_37	missense	SNP	0.997	A
PARL	55486	genome.wustl.edu	37	3	183585786	183585786	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr3:183585786C>T	ENST00000317096.4	-	2	248	c.188G>A	c.(187-189)cGa>cAa	p.R63Q	PARL_ENST00000435888.1_Missense_Mutation_p.R63Q|PARL_ENST00000311101.5_Missense_Mutation_p.R63Q	NM_018622.5	NP_061092.3	Q9H300	PARL_HUMAN	presenilin associated, rhomboid-like	63					membrane protein proteolysis (GO:0033619)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|proteolysis (GO:0006508)|regulation of protein targeting to mitochondrion (GO:1903214)|regulation of reactive oxygen species metabolic process (GO:2000377)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(3)|liver(1)|lung(6)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	17	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.21e-41)|Epithelial(37;1.34e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			GTCTGATCTTCGAGGTTCAAC	0.423																																																	0													119.0	108.0	112.0					3																	183585786		2203	4300	6503	SO:0001583	missense	55486			AF116692	CCDS3248.1, CCDS33897.1	3q27.3	2008-02-05		2006-02-28	ENSG00000175193	ENSG00000175193			18253	protein-coding gene	gene with protein product	"""rhomboid 7 homolog 1 (Drosophila)"""	607858		PSARL			Standard	XM_005247587		Approved	PRO2207, PSARL1, RHBDS1	uc003fmd.3	Q9H300	OTTHUMG00000156890	ENST00000317096.4:c.188G>A	3.37:g.183585786C>T	ENSP00000325421:p.Arg63Gln		Q96CQ4|Q9BTJ6|Q9P1E3	Missense_Mutation	SNP	pfam_Peptidase_S54_rhomboid_dom	p.R63Q	ENST00000317096.4	37	c.188	CCDS3248.1	3	.	.	.	.	.	.	.	.	.	.	C	16.37	3.104920	0.56291	.	.	ENSG00000175193	ENST00000317096;ENST00000311101;ENST00000435888	T;T;T	0.75154	-0.91;-0.91;-0.91	5.19	4.32	0.51571	.	0.307997	0.30011	N	0.010628	T	0.59729	0.2215	L	0.46157	1.445	0.36447	D	0.865878	P;P	0.49862	0.871;0.929	B;B	0.33454	0.156;0.164	T	0.67829	-0.5569	10	0.51188	T	0.08	-6.171	8.1468	0.31117	0.0:0.8168:0.0:0.1832	.	63;63	Q9H300-2;Q9H300	.;PARL_HUMAN	Q	63	ENSP00000325421:R63Q;ENSP00000310676:R63Q;ENSP00000402137:R63Q	ENSP00000310676:R63Q	R	-	2	0	PARL	185068480	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.692000	0.37731	1.314000	0.45095	0.655000	0.94253	CGA	PARL	-	NULL		0.423	PARL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARL	HGNC	protein_coding	OTTHUMT00000346465.1	C	NM_018622		183585786	-1	no_errors	ENST00000317096	ensembl	human	known	70_37	missense	SNP	1.000	T
PARP1	142	genome.wustl.edu	37	1	226551836	226551836	+	Intron	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr1:226551836G>A	ENST00000366794.5	-	20	2802				PARP1_ENST00000490921.1_Intron	NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1						base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		gctgttcactgagtgccaact	0.458								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																																									0																																										SO:0001627	intron_variant	142			BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.2659-65C>T	1.37:g.226551836G>A			B1ANJ4|Q8IUZ9	RNA	SNP	-	NULL	ENST00000366794.5	37	NULL	CCDS1554.1	1																																																																																			PARP1	-	-		0.458	PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP1	HGNC	protein_coding	OTTHUMT00000091519.1	G	NM_001618		226551836	-1	no_errors	ENST00000463968	ensembl	human	known	70_37	rna	SNP	0.001	A
PCDHA1	56147	genome.wustl.edu	37	5	140167072	140167072	+	Silent	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr5:140167072C>T	ENST00000504120.2	+	1	1197	c.1197C>T	c.(1195-1197)tcC>tcT	p.S399S	PCDHA1_ENST00000378133.3_Silent_p.S399S|PCDHA1_ENST00000394633.3_Silent_p.S399S	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	399	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCTGGTGTCCACCTTCAAGA	0.617																																																	0													138.0	123.0	128.0					5																	140167072		2203	4300	6503	SO:0001819	synonymous_variant	56147			AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.1197C>T	5.37:g.140167072C>T			O75288|Q9NRT7	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.S399	ENST00000504120.2	37	c.1197	CCDS54913.1	5																																																																																			PCDHA1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.617	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHA1	HGNC	protein_coding	OTTHUMT00000389127.1	C	NM_018900		140167072	+1	no_errors	ENST00000504120	ensembl	human	known	70_37	silent	SNP	0.945	T
PCP2	126006	genome.wustl.edu	37	19	7696665	7696665	+	Silent	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr19:7696665G>C	ENST00000311069.5	-	4	611	c.321C>G	c.(319-321)ctC>ctG	p.L107L	PET100_ENST00000594797.1_3'UTR|CTD-3214H19.4_ENST00000595866.1_Intron|XAB2_ENST00000534844.1_5'Flank|XAB2_ENST00000358368.4_5'Flank|CTD-3214H19.6_ENST00000601797.1_RNA|PCP2_ENST00000598935.1_Silent_p.L91L	NM_174895.1	NP_777555.1	Q8IVA1	PCP2_HUMAN	Purkinje cell protein 2	107					rhodopsin mediated signaling pathway (GO:0016056)	neuronal cell body (GO:0043025)	GTPase regulator activity (GO:0030695)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|urinary_tract(1)	2						GTTGGGGACTGAGGGTCCCAG	0.677																																																	0													62.0	58.0	59.0					19																	7696665		2202	4290	6492	SO:0001819	synonymous_variant	126006			BC025387	CCDS32893.1, CCDS62521.1	19p13.3	2008-02-05				ENSG00000174788			30209	protein-coding gene	gene with protein product						12477932	Standard	NM_174895		Approved	MGC41903, GPSM4	uc031rjd.1	Q8IVA1		ENST00000311069.5:c.321C>G	19.37:g.7696665G>C			M0R2R7|Q3KRG7	Silent	SNP	pfam_GoLoco_motif,smart_GoLoco_motif,pfscan_GoLoco_motif	p.L107	ENST00000311069.5	37	c.321	CCDS32893.1	19																																																																																			PCP2	-	NULL		0.677	PCP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCP2	HGNC	protein_coding	OTTHUMT00000461026.2	G	XM_058956		7696665	-1	no_errors	ENST00000311069	ensembl	human	known	70_37	silent	SNP	1.000	C
PDCD4	27250	genome.wustl.edu	37	10	112642770	112642770	+	Missense_Mutation	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr10:112642770G>C	ENST00000280154.7	+	4	630	c.356G>C	c.(355-357)gGa>gCa	p.G119A	PDCD4_ENST00000393104.2_Missense_Mutation_p.G108A	NM_001199492.1|NM_014456.4	NP_001186421.1|NP_055271.2	Q53EL6	PDCD4_HUMAN	programmed cell death 4 (neoplastic transformation inhibitor)	119					apoptotic process (GO:0006915)|cell aging (GO:0007569)|negative regulation of cell cycle (GO:0045786)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	13		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.000526)|all cancers(201;0.00794)|BRCA - Breast invasive adenocarcinoma(275;0.125)		GGTGGTGCAGGAGGCAAAGGT	0.398																																					Ovarian(115;1498 1603 9363 40056 40885)												0													154.0	142.0	146.0					10																	112642770		2203	4300	6503	SO:0001583	missense	27250			U83908	CCDS7567.1, CCDS44478.1	10q24	2008-08-01			ENSG00000150593	ENSG00000150593			8763	protein-coding gene	gene with protein product	"""nuclear antigen H731"""	608610				9759869	Standard	NM_014456		Approved	H731	uc001kzh.3	Q53EL6	OTTHUMG00000019048	ENST00000280154.7:c.356G>C	10.37:g.112642770G>C	ENSP00000280154:p.Gly119Ala		B2RCV4|B5ME91|O15501|Q5VZS6|Q6PJI5|Q8TAR5|Q99834	Missense_Mutation	SNP	pfam_Initiation_fac_eIF4g_MI,superfamily_ARM-type_fold,smart_Initiation_fac_eIF4g_MI	p.G119A	ENST00000280154.7	37	c.356	CCDS7567.1	10	.	.	.	.	.	.	.	.	.	.	G	29.3	4.998177	0.93227	.	.	ENSG00000150593	ENST00000280154;ENST00000393104;ENST00000444997	T;T;T	0.63255	0.25;0.27;-0.03	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.82075	0.4958	M	0.83953	2.67	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.981;0.998;0.997	D	0.83738	0.0202	10	0.72032	D	0.01	-19.0005	19.8113	0.96547	0.0:0.0:1.0:0.0	.	105;119;108	B4DKX4;Q53EL6;B5ME91	.;PDCD4_HUMAN;.	A	119;108;105	ENSP00000280154:G119A;ENSP00000376816:G108A;ENSP00000394668:G105A	ENSP00000280154:G119A	G	+	2	0	PDCD4	112632760	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.690000	0.91761	0.655000	0.94253	GGA	PDCD4	-	NULL		0.398	PDCD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCD4	HGNC	protein_coding	OTTHUMT00000050361.1	G	NM_014456		112642770	+1	no_errors	ENST00000280154	ensembl	human	known	70_37	missense	SNP	1.000	C
PDE8A	5151	genome.wustl.edu	37	15	85669515	85669515	+	Silent	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr15:85669515G>A	ENST00000310298.4	+	21	2415	c.2163G>A	c.(2161-2163)ctG>ctA	p.L721L	PDE8A_ENST00000394553.1_Silent_p.L721L|PDE8A_ENST00000339708.5_Silent_p.L675L|PDE8A_ENST00000557957.1_Silent_p.L649L			O60658	PDE8A_HUMAN	phosphodiesterase 8A	721	Catalytic. {ECO:0000250}.				cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|phosphorelay signal transduction system (GO:0000160)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	25	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)		Caffeine(DB00201)|Ketotifen(DB00920)	AACGAATGCTGATTAAATGTG	0.443																																																	0													111.0	103.0	105.0					15																	85669515		2203	4299	6502	SO:0001819	synonymous_variant	5151			AF056490	CCDS10336.1, CCDS10337.1, CCDS58397.1	15q25.3	2008-05-14			ENSG00000073417	ENSG00000073417	3.1.4.17	"""Phosphodiesterases"""	8793	protein-coding gene	gene with protein product		602972				9618252	Standard	NM_001243137		Approved	HsT19550	uc002blh.3	O60658	OTTHUMG00000148670	ENST00000310298.4:c.2163G>A	15.37:g.85669515G>A			B3KXE6|H0YMZ7|Q6P9H3|Q969I1|Q96PC9|Q96PD0|Q96PD1|Q96T71|Q9UMB7|Q9UMC3	Silent	SNP	pfam_PDEase_catalytic_dom,pfam_Sig_transdc_resp-reg_receiver,pfam_PAS_fold,pfam_PAS_4,superfamily_CheY-like_superfamily,smart_HD/PDEase_dom,pfscan_PAS,prints_PDEase,tigrfam_PAS	p.L721	ENST00000310298.4	37	c.2163	CCDS10336.1	15																																																																																			PDE8A	-	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom		0.443	PDE8A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDE8A	HGNC	protein_coding	OTTHUMT00000309018.1	G	NM_002605		85669515	+1	no_errors	ENST00000310298	ensembl	human	known	70_37	silent	SNP	1.000	A
PEPD	5184	genome.wustl.edu	37	19	33904546	33904546	+	Silent	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr19:33904546G>A	ENST00000244137.7	-	10	708	c.675C>T	c.(673-675)ctC>ctT	p.L225L	PEPD_ENST00000436370.3_Silent_p.L161L|PEPD_ENST00000397032.4_Silent_p.L184L	NM_000285.3	NP_000276.2	P12955	PEPD_HUMAN	peptidase D	225					cellular amino acid metabolic process (GO:0006520)|collagen catabolic process (GO:0030574)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)	aminopeptidase activity (GO:0004177)|dipeptidase activity (GO:0016805)|manganese ion binding (GO:0030145)|metallocarboxypeptidase activity (GO:0004181)			endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)	17	Esophageal squamous(110;0.137)					AGTGCTCGAAGAGGCTGCAGG	0.682																																																	0													23.0	32.0	29.0					19																	33904546		2113	4214	6327	SO:0001819	synonymous_variant	5184			BC015027	CCDS42544.1, CCDS54244.1, CCDS54245.1	19q13.11	2008-02-05				ENSG00000124299	3.4.13.9		8840	protein-coding gene	gene with protein product	"""prolidase"""	613230				2925654, 1972707	Standard	NM_000285		Approved		uc002nur.4	P12955		ENST00000244137.7:c.675C>T	19.37:g.33904546G>A			A8K3Z1|A8K416|A8K696|A8MX47|B4DDB7|B4DGJ1|E9PCE8|Q8TBN9|Q9BT75	Silent	SNP	pfam_Pept_M24_structural-domain,pfam_Aminopep_P_N,superfamily_Pept_M24_structural-domain	p.L225	ENST00000244137.7	37	c.675	CCDS42544.1	19																																																																																			PEPD	-	pfam_Pept_M24_structural-domain,superfamily_Pept_M24_structural-domain		0.682	PEPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEPD	HGNC	protein_coding	OTTHUMT00000451432.3	G	NM_000285		33904546	-1	no_errors	ENST00000244137	ensembl	human	known	70_37	silent	SNP	1.000	A
PHTF2	57157	genome.wustl.edu	37	7	77538189	77538189	+	Silent	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr7:77538189G>A	ENST00000248550.7	+	7	601	c.525G>A	c.(523-525)ctG>ctA	p.L175L	PHTF2_ENST00000416283.2_Silent_p.L141L|PHTF2_ENST00000424760.1_Silent_p.L137L|PHTF2_ENST00000422959.2_Silent_p.L141L|PHTF2_ENST00000275575.7_Silent_p.L137L|PHTF2_ENST00000415251.2_Silent_p.L137L|PHTF2_ENST00000307305.8_Silent_p.L137L|PHTF2_ENST00000454592.1_3'UTR|PHTF2_ENST00000450574.1_Silent_p.L141L			Q8N3S3	PHTF2_HUMAN	putative homeodomain transcription factor 2	175					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	19						CGATATGGCTGATGCTGCTCC	0.438																																																	0													83.0	81.0	82.0					7																	77538189		1940	4144	6084	SO:0001819	synonymous_variant	57157			AL136883	CCDS47621.1, CCDS47622.1, CCDS47623.1, CCDS47624.1	7q11.23-q21	2008-02-01			ENSG00000006576	ENSG00000006576			13411	protein-coding gene	gene with protein product						10729229	Standard	NM_020432		Approved	DKFZp434D166	uc003ugq.4	Q8N3S3	OTTHUMG00000155557	ENST00000248550.7:c.525G>A	7.37:g.77538189G>A			A0JP04|A0JP05|A4D1C2|E9PEE3|G5E9H7|Q6NW35|Q8TBW4|Q9H099	Silent	SNP	pfam_TF_homeodomain_male	p.L175	ENST00000248550.7	37	c.525		7																																																																																			PHTF2	-	pfam_TF_homeodomain_male		0.438	PHTF2-006	KNOWN	basic	protein_coding	PHTF2	HGNC	protein_coding	OTTHUMT00000340638.2	G	NM_020432		77538189	+1	no_errors	ENST00000248550	ensembl	human	known	70_37	silent	SNP	0.996	A
PI4KAP2	375133	genome.wustl.edu	37	22	21834057	21834057	+	RNA	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr22:21834057C>G	ENST00000450651.1	-	0	1239							A4QPH2	PI4P2_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha pseudogene 2						phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)		kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			endometrium(3)|urinary_tract(1)	4						CCTTCTTTTTCAAGTTCACTA	0.428																																																	0													13.0	11.0	11.0					22																	21834057		691	1568	2259			375133					22q11.21	2014-03-20	2007-08-14		ENSG00000183506	ENSG00000183506			33577	pseudogene	pseudogene							Standard	NR_003700		Approved		uc011aie.1	A4QPH2	OTTHUMG00000150827		22.37:g.21834057C>G			Q6ICJ0|Q6ZT68|Q8WUK7	RNA	SNP	-	NULL	ENST00000450651.1	37	NULL		22																																																																																			PI4KAP2	-	-		0.428	PI4KAP2-005	KNOWN	basic	processed_transcript	PI4KAP2	HGNC	pseudogene	OTTHUMT00000334908.1	C			21834057	-1	no_errors	ENST00000450651	ensembl	human	known	70_37	rna	SNP	1.000	G
PLOD3	8985	genome.wustl.edu	37	7	100853820	100853820	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr7:100853820C>T	ENST00000223127.3	-	13	1891	c.1493G>A	c.(1492-1494)cGa>cAa	p.R498Q		NM_001084.4	NP_001075.1	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3	498					basement membrane assembly (GO:0070831)|cellular protein modification process (GO:0006464)|cellular response to hormone stimulus (GO:0032870)|collagen fibril organization (GO:0030199)|endothelial cell morphogenesis (GO:0001886)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|lung morphogenesis (GO:0060425)|neural tube development (GO:0021915)|protein localization (GO:0008104)|vasodilation (GO:0042311)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen galactosyltransferase activity (GO:0050211)|procollagen glucosyltransferase activity (GO:0033823)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	31	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)	CACCTTGTCTCGAAAGCTCTT	0.632																																																	0													96.0	78.0	85.0					7																	100853820		2203	4300	6503	SO:0001583	missense	8985			AF046889	CCDS5715.1	7q22.1	2011-08-24			ENSG00000106397	ENSG00000106397	1.14.11.4		9083	protein-coding gene	gene with protein product	"""lysyl hydroxlase 3"""	603066				9724729, 9582318	Standard	NM_001084		Approved	LH3	uc003uyd.3	O60568	OTTHUMG00000157111	ENST00000223127.3:c.1493G>A	7.37:g.100853820C>T	ENSP00000223127:p.Arg498Gln		B2R6W6|Q540C3	Missense_Mutation	SNP	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.R498Q	ENST00000223127.3	37	c.1493	CCDS5715.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.2|20.2	3.949177|3.949177	0.73787|0.73787	.|.	.|.	ENSG00000106397|ENSG00000106397	ENST00000454310|ENST00000223127	.|D	.|0.85773	.|-2.03	4.52|4.52	4.52|4.52	0.55395|0.55395	.|.	.|0.000000	.|0.64402	.|D	.|0.000005	D|D	0.89931|0.89931	0.6858|0.6858	M|M	0.73962|0.73962	2.25|2.25	0.41527|0.41527	D|D	0.988433|0.988433	.|D;D	.|0.69078	.|0.997;0.997	.|P;P	.|0.57425	.|0.722;0.82	D|D	0.91482|0.91482	0.5205|0.5205	5|10	.|0.66056	.|D	.|0.02	-22.253|-22.253	14.7466|14.7466	0.69494|0.69494	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|125;498	.|Q9UG85;O60568	.|.;PLOD3_HUMAN	K|Q	73|498	.|ENSP00000223127:R498Q	.|ENSP00000223127:R498Q	E|R	-|-	1|2	0|0	PLOD3|PLOD3	100640540|100640540	0.996000|0.996000	0.38824|0.38824	0.990000|0.990000	0.47175|0.47175	0.258000|0.258000	0.26162|0.26162	5.741000|5.741000	0.68638|0.68638	2.077000|2.077000	0.62373|0.62373	0.462000|0.462000	0.41574|0.41574	GAG|CGA	PLOD3	-	NULL		0.632	PLOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLOD3	HGNC	protein_coding	OTTHUMT00000347470.1	C			100853820	-1	no_errors	ENST00000223127	ensembl	human	known	70_37	missense	SNP	0.659	T
PNLDC1	154197	genome.wustl.edu	37	6	160222178	160222178	+	Missense_Mutation	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr6:160222178G>C	ENST00000610273.1	+	3	306	c.135G>C	c.(133-135)aaG>aaC	p.K45N	PNLDC1_ENST00000609334.1_3'UTR|PNLDC1_ENST00000392167.3_Missense_Mutation_p.K56N	NM_001271862.1|NM_173516.1	NP_001258791.1|NP_775787.1	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain containing 1	45						integral component of membrane (GO:0016021)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	31		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		GGTATCTAAAGACCCGTCAGA	0.433																																																	0													234.0	218.0	224.0					6																	160222178		2203	4300	6503	SO:0001583	missense	154197			AK097559	CCDS5271.1, CCDS5271.2, CCDS64561.1	6q25.3	2008-02-05			ENSG00000146453	ENSG00000146453			21185	protein-coding gene	gene with protein product							Standard	NM_001271862		Approved	FLJ40240, dJ195P10.2	uc003qsy.2	Q8NA58	OTTHUMG00000015941	ENST00000610273.1:c.135G>C	6.37:g.160222178G>C	ENSP00000476448:p.Lys45Asn		Q5TAP7|Q8N7X5	Missense_Mutation	SNP	pfam_RNase_CAF1,superfamily_RNaseH-like_dom	p.K45N	ENST00000610273.1	37	c.135	CCDS5271.1	6	.	.	.	.	.	.	.	.	.	.	G	17.68	3.450557	0.63290	.	.	ENSG00000146453	ENST00000275275;ENST00000392167	T;T	0.23950	1.88;1.88	5.3	5.3	0.74995	Ribonuclease H-like (1);	0.000000	0.64402	D	0.000006	T	0.36936	0.0985	M	0.69358	2.11	0.36411	D	0.863727	D;D	0.89917	0.999;1.0	D;D	0.91635	0.986;0.999	T	0.18085	-1.0348	10	0.41790	T	0.15	.	11.6481	0.51273	0.0813:0.0:0.9187:0.0	.	56;45	Q8NA58-2;Q8NA58	.;PNDC1_HUMAN	N	45;56	ENSP00000275275:K45N;ENSP00000376007:K56N	ENSP00000275275:K45N	K	+	3	2	PNLDC1	160142168	1.000000	0.71417	0.973000	0.42090	0.661000	0.39034	2.912000	0.48782	2.495000	0.84180	0.650000	0.86243	AAG	PNLDC1	-	pfam_RNase_CAF1,superfamily_RNaseH-like_dom		0.433	PNLDC1-201	KNOWN	basic|CCDS	protein_coding	PNLDC1	HGNC	protein_coding		G	NM_173516		160222178	+1	no_errors	ENST00000275275	ensembl	human	known	70_37	missense	SNP	0.994	C
PNMAL1	55228	genome.wustl.edu	37	19	46974175	46974175	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr19:46974175C>G	ENST00000313683.10	-	2	423	c.118G>C	c.(118-120)Gag>Cag	p.E40Q	PNMAL1_ENST00000602246.1_Missense_Mutation_p.E40Q|PNMAL1_ENST00000438932.2_Missense_Mutation_p.E40Q	NM_001103149.1|NM_018215.3	NP_001096619.1|NP_060685.2	Q86V59	PNML1_HUMAN	paraneoplastic Ma antigen family-like 1	40										cervix(1)|endometrium(2)|large_intestine(8)|lung(8)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000166)|all cancers(93;0.0014)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		aaggtctcctcaatttctgcc	0.537																																																	0													80.0	68.0	72.0					19																	46974175		2203	4300	6503	SO:0001583	missense	55228			BC026026	CCDS33059.1, CCDS46124.1	19q13.32	2014-02-12	2012-02-09			ENSG00000182013		"""Paraneoplastic Ma antigens"""	25578	protein-coding gene	gene with protein product			"""PNMA-like 1"""			12477932	Standard	NM_018215		Approved	KIAA1183L, FLJ10781	uc002peq.4	Q86V59		ENST00000313683.10:c.118G>C	19.37:g.46974175C>G	ENSP00000318131:p.Glu40Gln		A8K2F3|Q5U638|Q8N3H4|Q9NVE8	Missense_Mutation	SNP	NULL	p.E40Q	ENST00000313683.10	37	c.118	CCDS33059.1	19	.	.	.	.	.	.	.	.	.	.	C	19.00	3.742600	0.69418	.	.	ENSG00000182013	ENST00000438932;ENST00000313683;ENST00000417103	T;T	0.10573	2.86;2.86	3.94	3.94	0.45596	.	0.000000	0.41396	D	0.000895	T	0.19644	0.0472	L	0.35644	1.08	0.32221	N	0.575195	D;D	0.89917	1.0;0.987	D;D	0.83275	0.996;0.927	T	0.02533	-1.1145	10	0.21014	T	0.42	-19.8272	11.7787	0.52001	0.0:1.0:0.0:0.0	.	40;40	Q86V59-2;Q86V59	.;PNML1_HUMAN	Q	40	ENSP00000410273:E40Q;ENSP00000318131:E40Q	ENSP00000318131:E40Q	E	-	1	0	PNMAL1	51666015	0.953000	0.32496	0.943000	0.38184	0.961000	0.63080	2.094000	0.41719	2.491000	0.84063	0.655000	0.94253	GAG	PNMAL1	-	NULL		0.537	PNMAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PNMAL1	HGNC	protein_coding	OTTHUMT00000403929.1	C	NM_018215		46974175	-1	no_errors	ENST00000313683	ensembl	human	known	70_37	missense	SNP	0.944	G
PSMC3	5702	genome.wustl.edu	37	11	47447758	47447758	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr11:47447758C>T	ENST00000298852.3	-	1	230	c.73G>A	c.(73-75)Gag>Aag	p.E25K	PSMC3_ENST00000530912.1_Missense_Mutation_p.E25K|PSMC3_ENST00000602866.1_Missense_Mutation_p.E9K	NM_002804.4	NP_002795.2	P17980	PRS6A_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 3	25					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of RNA biosynthetic process (GO:2001141)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(4)|urinary_tract(1)	17				Lung(87;0.0932)|BRCA - Breast invasive adenocarcinoma(625;0.13)		GTGCCCACCTCGGCCTCATCC	0.647																																																	0													22.0	18.0	19.0					11																	47447758		2160	4237	6397	SO:0001583	missense	5702			M34079	CCDS7935.1	11p11.2	2010-04-21			ENSG00000165916	ENSG00000165916		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9549	protein-coding gene	gene with protein product		186852				9048938, 9473509	Standard	NM_002804		Approved	TBP1, TBP-1	uc001nfh.2	P17980	OTTHUMG00000167692	ENST00000298852.3:c.73G>A	11.37:g.47447758C>T	ENSP00000298852:p.Glu25Lys		B2R8V1|Q3B757|Q3B865|Q53HU5|Q6GPG8|Q6IBS1|Q96HD3	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_AAA+_ATPase,tigrfam_26S_Psome_P45	p.E25K	ENST00000298852.3	37	c.73	CCDS7935.1	11	.	.	.	.	.	.	.	.	.	.	C	23.6	4.430056	0.83776	.	.	ENSG00000165916	ENST00000298852;ENST00000530912;ENST00000526993;ENST00000531653;ENST00000528362	D;D	0.95690	-3.51;-3.78	4.88	4.88	0.63580	.	2.454000	0.01258	N	0.009080	D	0.90978	0.7163	N	0.08118	0	0.58432	D	0.999997	B;B	0.15473	0.004;0.013	B;B	0.08055	0.001;0.003	T	0.59182	-0.7502	10	0.16896	T	0.51	-34.2341	16.0015	0.80297	0.0:1.0:0.0:0.0	.	25;25	E9PM69;P17980	.;PRS6A_HUMAN	K	25;25;9;9;9	ENSP00000298852:E25K;ENSP00000433097:E25K	ENSP00000298852:E25K	E	-	1	0	PSMC3	47404334	0.995000	0.38212	0.968000	0.41197	0.928000	0.56348	4.196000	0.58407	2.537000	0.85549	0.563000	0.77884	GAG	PSMC3	-	NULL		0.647	PSMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSMC3	HGNC	protein_coding	OTTHUMT00000395660.2	C	NM_002804		47447758	-1	no_errors	ENST00000298852	ensembl	human	known	70_37	missense	SNP	0.990	T
RAB11FIP4	84440	genome.wustl.edu	37	17	29857424	29857424	+	Silent	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr17:29857424C>G	ENST00000325874.8	+	14	1963	c.1734C>G	c.(1732-1734)ctC>ctG	p.L578L	RAB11FIP4_ENST00000394744.2_Silent_p.L476L	NM_032932.3	NP_116321.2	Q86YS3	RFIP4_HUMAN	RAB11 family interacting protein 4 (class II)	578	FIP-RBD. {ECO:0000255|PROSITE- ProRule:PRU00844}.|Necessary for interaction with RAB11A, subcellular location, homo- or heterooligomerization.				cytokinesis (GO:0000910)|transport (GO:0006810)|viral process (GO:0016032)	cleavage furrow (GO:0032154)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|midbody (GO:0030496)|recycling endosome membrane (GO:0055038)	ADP-ribosylation factor binding (GO:0030306)|calcium ion binding (GO:0005509)|protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(10;3.62e-13)|all_epithelial(10;0.000387)|all_lung(9;0.0132)|Breast(31;0.014)|all_hematologic(16;0.015)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0259)|Ovarian(249;0.0423)|Lung NSC(157;0.066)				CAAAAAACCTCTTTGCTGCCC	0.547																																																	0													101.0	103.0	102.0					17																	29857424		2203	4300	6503	SO:0001819	synonymous_variant	84440			AB058724	CCDS11267.1	17q11.2	2013-01-10			ENSG00000131242	ENSG00000131242		"""EF-hand domain containing"""	30267	protein-coding gene	gene with protein product		611999				11347906, 11468690	Standard	NM_032932		Approved	RAB11-FIP4, KIAA1821, MGC11316, FLJ00131	uc002hgn.1	Q86YS3	OTTHUMG00000132787	ENST00000325874.8:c.1734C>G	17.37:g.29857424C>G			Q52LI1|Q8N829|Q8NDT7|Q969D8	Silent	SNP	pfam_Rab-bd_FIP-RBD,pfscan_EF_HAND_2	p.L578	ENST00000325874.8	37	c.1734	CCDS11267.1	17																																																																																			RAB11FIP4	-	NULL		0.547	RAB11FIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB11FIP4	HGNC	protein_coding	OTTHUMT00000256195.2	C	NM_032932		29857424	+1	no_errors	ENST00000325874	ensembl	human	known	70_37	silent	SNP	1.000	G
RAB17	64284	genome.wustl.edu	37	2	238494054	238494054	+	Intron	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr2:238494054G>A	ENST00000264601.3	-	2	787				RAB17_ENST00000409822.1_Intron|RAB17_ENST00000416106.1_5'UTR|RAB17_ENST00000538644.1_Intron|RAB17_ENST00000409576.1_Intron	NM_022449.3	NP_071894.1	Q9H0T7	RAB17_HUMAN	RAB17, member RAS oncogene family						cilium assembly (GO:0042384)|endocytic recycling (GO:0032456)|establishment of melanosome localization (GO:0032401)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|melanosome transport (GO:0032402)|protein transport (GO:0015031)|regulation of dendrite development (GO:0050773)|regulation of filopodium assembly (GO:0051489)|regulation of synapse assembly (GO:0051963)|small GTPase mediated signal transduction (GO:0007264)|transcytosis (GO:0045056)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|dendrite (GO:0030425)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|melanosome (GO:0042470)|neuronal cell body (GO:0043025)|recycling endosome (GO:0055037)|recycling endosome membrane (GO:0055038)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(1)	4		Renal(207;0.00272)|Breast(86;0.00297)|all_hematologic(139;0.182)|Ovarian(221;0.221)		Epithelial(121;9.36e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.26e-10)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000354)|Lung(119;0.011)|LUSC - Lung squamous cell carcinoma(224;0.026)		GCAGCCTGCAGATGCCCCATA	0.532																																					Colon(56;987 1029 6466 13943 27336)												0																																										SO:0001627	intron_variant	64284			AK022600	CCDS2520.1	2q37.3	2008-05-23			ENSG00000124839	ENSG00000124839		"""RAB, member RAS oncogene"""	16523	protein-coding gene	gene with protein product		602206				9624171	Standard	NM_022449		Approved		uc002vwz.2	Q9H0T7	OTTHUMG00000133299	ENST00000264601.3:c.157+586C>T	2.37:g.238494054G>A			Q53QV6|Q6IA73|Q6PJZ0|Q9BVU1|Q9H9U9	RNA	SNP	-	NULL	ENST00000264601.3	37	NULL	CCDS2520.1	2																																																																																			RAB17	-	-		0.532	RAB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB17	HGNC	protein_coding	OTTHUMT00000257084.2	G			238494054	-1	no_errors	ENST00000416106	ensembl	human	putative	70_37	rna	SNP	0.002	A
RALGAPB	57148	genome.wustl.edu	37	20	37182681	37182681	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr20:37182681C>G	ENST00000262879.6	+	22	3618	c.3334C>G	c.(3334-3336)Ctc>Gtc	p.L1112V	RALGAPB_ENST00000397038.1_Missense_Mutation_p.L890V|RALGAPB_ENST00000397040.1_Missense_Mutation_p.L1112V|RALGAPB_ENST00000397042.3_Missense_Mutation_p.L1108V			Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit (non-catalytic)	1112					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)|Ral protein signal transduction (GO:0032484)|regulation of exocyst localization (GO:0060178)		protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(29)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						CCGCCTTTTTCTCTCACACTT	0.423																																																	0													82.0	87.0	85.0					20																	37182681		2203	4300	6503	SO:0001583	missense	57148			AB033045	CCDS13305.1, CCDS63272.1	20q11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000170471	ENSG00000170471			29221	protein-coding gene	gene with protein product			"""KIAA1219"""	KIAA1219		19520869	Standard	XM_005260462		Approved	DKFZp781M2411, RalGAPbeta	uc002xiw.3	Q86X10	OTTHUMG00000140270	ENST00000262879.6:c.3334C>G	20.37:g.37182681C>G	ENSP00000262879:p.Leu1112Val		A2A2E8|A2A2E9|Q5TG31|Q8N3D1|Q8WWC0|Q9H3X8|Q9UJR1|Q9ULK1|Q9Y3G9	Missense_Mutation	SNP	superfamily_ARM-type_fold,pfscan_Rap_GAP	p.L1112V	ENST00000262879.6	37	c.3334	CCDS13305.1	20	.	.	.	.	.	.	.	.	.	.	C	22.1	4.246462	0.80024	.	.	ENSG00000170471	ENST00000262879;ENST00000397042;ENST00000397038;ENST00000397040;ENST00000438490	D;D;D;D;D	0.93763	-3.28;-3.28;-3.28;-3.28;-3.28	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	D	0.96645	0.8905	M	0.76170	2.325	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.80764	0.994;0.994	D	0.96725	0.9535	10	0.72032	D	0.01	.	19.6277	0.95684	0.0:1.0:0.0:0.0	.	1108;1112	A2A2E9;Q86X10	.;RLGPB_HUMAN	V	1112;1108;890;1112;940	ENSP00000262879:L1112V;ENSP00000380235:L1108V;ENSP00000380231:L890V;ENSP00000380233:L1112V;ENSP00000416646:L940V	ENSP00000262879:L1112V	L	+	1	0	RALGAPB	36616095	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.757000	0.68766	2.648000	0.89879	0.650000	0.86243	CTC	RALGAPB	-	NULL		0.423	RALGAPB-001	KNOWN	basic|CCDS	protein_coding	RALGAPB	HGNC	protein_coding	OTTHUMT00000079191.1	C	NM_020336		37182681	+1	no_errors	ENST00000262879	ensembl	human	known	70_37	missense	SNP	1.000	G
ROR2	4920	genome.wustl.edu	37	9	94519831	94519831	+	Silent	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr9:94519831C>G	ENST00000375708.3	-	3	384	c.186G>C	c.(184-186)ctG>ctC	p.L62L	ROR2_ENST00000375715.1_5'UTR|ROR2_ENST00000550066.1_5'UTR	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	62	Ig-like C2-type.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						CCAGAAAATTCAGAAAGTAAC	0.542																																																	0													36.0	33.0	34.0					9																	94519831		2203	4300	6503	SO:0001819	synonymous_variant	4920			M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.186G>C	9.37:g.94519831C>G			Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Kringle,pfam_Frizzled_dom,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Kringle-like,superfamily_Frizzled_dom,smart_Ig_sub,smart_Ig_sub2,smart_Kringle,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_rcpt_ROR,pfscan_Frizzled_dom,pfscan_Kringle,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L62	ENST00000375708.3	37	c.186	CCDS6691.1	9																																																																																			ROR2	-	pirsf_Tyr_kinase_rcpt_ROR,pfscan_Ig-like		0.542	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROR2	HGNC	protein_coding	OTTHUMT00000053040.1	C			94519831	-1	no_errors	ENST00000375708	ensembl	human	known	70_37	silent	SNP	1.000	G
RRAD	6236	genome.wustl.edu	37	16	66956094	66956094	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr16:66956094C>T	ENST00000299759.6	-	5	1062	c.812G>A	c.(811-813)cGa>cAa	p.R271Q	RRAD_ENST00000420652.1_Missense_Mutation_p.R271Q			P55042	RAD_HUMAN	Ras-related associated with diabetes	271					small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|kidney(4)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|urinary_tract(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0862)|Epithelial(162;0.198)		AAGGCTCTCTCGCCTCCGGGT	0.607																																																	0													96.0	76.0	83.0					16																	66956094		2200	4300	6500	SO:0001583	missense	6236			L24564	CCDS10824.1	16q22	2014-05-09			ENSG00000166592	ENSG00000166592			10446	protein-coding gene	gene with protein product		179503				7859947	Standard	NM_004165		Approved	REM3, RAD	uc002eqo.2	P55042	OTTHUMG00000137511	ENST00000299759.6:c.812G>A	16.37:g.66956094C>T	ENSP00000299759:p.Arg271Gln		Q96F39	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,pirsf_Small_GTPase_GEM/REM/Rad,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R271Q	ENST00000299759.6	37	c.812	CCDS10824.1	16	.	.	.	.	.	.	.	.	.	.	C	36	5.798422	0.96960	.	.	ENSG00000166592	ENST00000420652;ENST00000299759	T;T	0.68025	-0.3;-0.3	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.81833	0.4906	M	0.75264	2.295	0.80722	D	1	D	0.89917	1.0	D	0.64237	0.923	T	0.82440	-0.0456	10	0.72032	D	0.01	.	20.328	0.98708	0.0:1.0:0.0:0.0	.	271	P55042	RAD_HUMAN	Q	271	ENSP00000388744:R271Q;ENSP00000299759:R271Q	ENSP00000299759:R271Q	R	-	2	0	RRAD	65513595	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	7.484000	0.81180	2.802000	0.96397	0.561000	0.74099	CGA	RRAD	-	pirsf_Small_GTPase_GEM/REM/Rad		0.607	RRAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRAD	HGNC	protein_coding	OTTHUMT00000268830.1	C	NM_004165		66956094	-1	no_errors	ENST00000299759	ensembl	human	known	70_37	missense	SNP	1.000	T
RTL1	388015	genome.wustl.edu	37	14	101348765	101348765	+	Silent	SNP	C	C	T	rs554881658		TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr14:101348765C>T	ENST00000534062.1	-	1	2419	c.2361G>A	c.(2359-2361)gtG>gtA	p.V787V	MIR136_ENST00000385207.1_RNA|MIR127_ENST00000384876.1_RNA|MIR431_ENST00000385266.1_RNA|MIR433_ENST00000384837.1_RNA|MIR432_ENST00000606207.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	787					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						TGTTCAGTTTCACCCCTTTGG	0.552													C|||	1	0.000199681	0.0	0.0	5008	,	,		22227	0.0		0.0	False		,,,				2504	0.001																0													183.0	170.0	174.0					14																	101348765		692	1591	2283	SO:0001819	synonymous_variant	388015				CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.2361G>A	14.37:g.101348765C>T			E9PKS8	Silent	SNP	pfam_Retrotrans_gag,superfamily_Peptidase_aspartic	p.V787	ENST00000534062.1	37	c.2361	CCDS53910.1	14																																																																																			RTL1	-	NULL		0.552	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTL1	HGNC	protein_coding	OTTHUMT00000395127.1	C	NM_001134888		101348765	-1	no_errors	ENST00000534062	ensembl	human	known	70_37	silent	SNP	0.058	T
SCN7A	6332	genome.wustl.edu	37	2	167289236	167289236	+	Silent	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr2:167289236C>T	ENST00000409855.1	-	15	2310	c.2184G>A	c.(2182-2184)gtG>gtA	p.V728V		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	728					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	TAAATGAGCTCACCAATGCCA	0.323																																																	0													28.0	26.0	26.0					2																	167289236		1855	4096	5951	SO:0001819	synonymous_variant	6332			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.2184G>A	2.37:g.167289236C>T				Missense_Mutation	SNP	pfam_Ion_trans_dom	p.E760K	ENST00000409855.1	37	c.2278	CCDS46442.1	2																																																																																			SCN7A	-	NULL		0.323	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	HGNC	protein_coding	OTTHUMT00000333745.1	C			167289236	-1	no_errors	ENST00000424326	ensembl	human	known	70_37	missense	SNP	0.999	T
SCRT1	83482	genome.wustl.edu	37	8	145556955	145556955	+	Missense_Mutation	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr8:145556955G>C	ENST00000332135.4	-	2	1050	c.939C>G	c.(937-939)ttC>ttG	p.F313L		NM_031309.4	NP_112599.2	Q9BWW7	SCRT1_HUMAN	scratch family zinc finger 1	313					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neuron migration (GO:2001222)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|upper_aerodigestive_tract(1)	3	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;1.35e-39)|all cancers(56;1.37e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			ACTTGAGCGCGAAGCTCTTCT	0.657																																																	0													23.0	25.0	24.0					8																	145556955		2203	4295	6498	SO:0001583	missense	83482			BC014675	CCDS6421.1	8q24.3	2013-10-09	2013-10-09		ENSG00000170616	ENSG00000261678		"""Zinc fingers, C2H2-type"""	15950	protein-coding gene	gene with protein product		605858	"""scratch (drosophila homolog) 1, zinc finger protein"", ""scratch homolog 1, zinc finger protein (Drosophila)"""			11274425	Standard	NM_031309		Approved	DKFZp547F072, ZNF898	uc003zbw.1	Q9BWW7	OTTHUMG00000165229	ENST00000332135.4:c.939C>G	8.37:g.145556955G>C	ENSP00000331692:p.Phe313Leu		A8MX66|Q96C52	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F313L	ENST00000332135.4	37	c.939	CCDS6421.1	8	.	.	.	.	.	.	.	.	.	.	G	14.41	2.525837	0.44969	.	.	ENSG00000170616	ENST00000332135	D	0.83591	-1.74	2.55	1.66	0.24008	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	U	0.000006	D	0.88097	0.6345	M	0.74258	2.255	0.48830	D	0.999717	D	0.76494	0.999	D	0.78314	0.991	D	0.85766	0.1352	10	0.87932	D	0	-20.9211	7.1563	0.25639	0.1488:0.0:0.8512:0.0	.	313	Q9BWW7	SCRT1_HUMAN	L	313	ENSP00000331692:F313L	ENSP00000331692:F313L	F	-	3	2	SCRT1	145527763	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	2.136000	0.42121	0.262000	0.21774	-0.657000	0.03884	TTC	SCRT1	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.657	SCRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCRT1	HGNC	protein_coding	OTTHUMT00000382800.2	G	NM_031309		145556955	-1	no_errors	ENST00000332135	ensembl	human	known	70_37	missense	SNP	1.000	C
SHMT2	6472	genome.wustl.edu	37	12	57628084	57628084	+	Silent	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr12:57628084C>G	ENST00000328923.3	+	12	1907	c.1455C>G	c.(1453-1455)ctC>ctG	p.L485L	SHMT2_ENST00000414700.3_Silent_p.L464L|SHMT2_ENST00000553474.1_Silent_p.L464L|SHMT2_ENST00000557487.1_Silent_p.L475L|SHMT2_ENST00000449049.3_Silent_p.L464L|SHMT2_ENST00000393827.4_Silent_p.L389L	NM_001166356.1|NM_005412.5	NP_001159828.1|NP_005403.2	P34897	GLYM_HUMAN	serine hydroxymethyltransferase 2 (mitochondrial)	485					glycine biosynthetic process from serine (GO:0019264)|L-serine biosynthetic process (GO:0006564)|one-carbon metabolic process (GO:0006730)|positive regulation of cell proliferation (GO:0008284)|protein homotetramerization (GO:0051289)|tetrahydrofolate interconversion (GO:0035999)	extracellular vesicular exosome (GO:0070062)|microtubule cytoskeleton (GO:0015630)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|chromatin binding (GO:0003682)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15					Glycine(DB00145)|Tetrahydrofolic acid(DB00116)	TGGCCAACCTCAGGCAACGGG	0.527																																					Esophageal Squamous(150;1369 2416 49071 49364)												0													115.0	114.0	114.0					12																	57628084		2203	4300	6503	SO:0001819	synonymous_variant	6472			AK223555	CCDS8934.1, CCDS53805.1, CCDS55837.1	12q12-q14	2006-03-27				ENSG00000182199	2.1.2.1		10852	protein-coding gene	gene with protein product		138450		SHMT		8999870	Standard	NM_005412		Approved		uc001snf.2	P34897		ENST00000328923.3:c.1455C>G	12.37:g.57628084C>G			B7Z9F1|E7EQ19|E7EU43|O00740|Q8N1A5	Silent	SNP	pfam_Ser_HO-MeTrfase,superfamily_PyrdxlP-dep_Trfase_major_dom,pirsf_Ser_HO-MeTrfase	p.L485	ENST00000328923.3	37	c.1455	CCDS8934.1	12																																																																																			SHMT2	-	superfamily_PyrdxlP-dep_Trfase_major_dom,pirsf_Ser_HO-MeTrfase		0.527	SHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHMT2	HGNC	protein_coding	OTTHUMT00000412525.2	C	NM_005412		57628084	+1	no_errors	ENST00000328923	ensembl	human	known	70_37	silent	SNP	1.000	G
SIRT5	23408	genome.wustl.edu	37	6	13595753	13595753	+	Missense_Mutation	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr6:13595753G>C	ENST00000606117.1	+	6	816	c.520G>C	c.(520-522)Gag>Cag	p.E174Q	SIRT5_ENST00000359782.3_Missense_Mutation_p.E174Q|SIRT5_ENST00000397350.2_Missense_Mutation_p.E66Q|SIRT5_ENST00000379262.4_Missense_Mutation_p.E174Q	NM_012241.4	NP_036373.1			sirtuin 5											breast(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	11	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.117)	Epithelial(50;0.176)			AGTTGTGGCTGAGAATTACAA	0.348																																																	0													183.0	179.0	180.0					6																	13595753		2203	4300	6503	SO:0001583	missense	23408			AF083110	CCDS4526.1, CCDS4527.1, CCDS54966.1, CCDS56398.1	6p23	2010-08-05	2010-06-25		ENSG00000124523	ENSG00000124523			14933	protein-coding gene	gene with protein product		604483	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 5"", ""sirtuin (silent mating type information regulation 2 homolog) 5 (S. cerevisiae)"""			10381378	Standard	NM_012241		Approved		uc003nay.3	Q9NXA8	OTTHUMG00000014278	ENST00000606117.1:c.520G>C	6.37:g.13595753G>C	ENSP00000476228:p.Glu174Gln			Missense_Mutation	SNP	pfam_Sirtuin,pfscan_Ssirtuin_cat_dom	p.E174Q	ENST00000606117.1	37	c.520	CCDS4526.1	6	.	.	.	.	.	.	.	.	.	.	G	11.24	1.579846	0.28180	.	.	ENSG00000124523	ENST00000359782;ENST00000379262;ENST00000397350;ENST00000379250	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	5.78	4.91	0.64330	.	0.318213	0.36703	N	0.002455	T	0.17109	0.0411	L	0.33710	1.025	0.38443	D	0.946767	B;B;B	0.18461	0.003;0.003;0.028	B;B;B	0.14578	0.006;0.011;0.01	T	0.05209	-1.0899	10	0.20046	T	0.44	-47.6268	15.1197	0.72432	0.0683:0.0:0.9317:0.0	.	174;174;174	F5H5Z9;Q9NXA8;Q9NXA8-2	.;SIRT5_HUMAN;.	Q	174;174;66;174	ENSP00000352830:E174Q;ENSP00000368564:E174Q;ENSP00000380509:E66Q;ENSP00000368552:E174Q	ENSP00000352830:E174Q	E	+	1	0	SIRT5	13703732	0.964000	0.33143	0.913000	0.36048	0.930000	0.56654	2.889000	0.48601	1.451000	0.47736	0.585000	0.79938	GAG	SIRT5	-	pfam_Sirtuin,pfscan_Ssirtuin_cat_dom		0.348	SIRT5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRT5	HGNC	protein_coding	OTTHUMT00000039908.2	G			13595753	+1	no_errors	ENST00000379250	ensembl	human	known	70_37	missense	SNP	0.988	C
SKAP2	8935	genome.wustl.edu	37	7	26883654	26883654	+	Missense_Mutation	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr7:26883654G>A	ENST00000345317.2	-	4	615	c.302C>T	c.(301-303)tCt>tTt	p.S101F	SKAP2_ENST00000539623.1_5'UTR	NM_003930.3	NP_003921.2	O75563	SKAP2_HUMAN	src kinase associated phosphoprotein 2	101					B cell activation (GO:0042113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of signal transduction (GO:0009967)|protein complex assembly (GO:0006461)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(3)	17						CATACCATCAGAGGGGGCTTC	0.423																																																	0													193.0	190.0	191.0					7																	26883654		2203	4300	6503	SO:0001583	missense	8935				CCDS5400.1	7p15.2	2013-01-10	2006-09-28	2006-09-28	ENSG00000005020	ENSG00000005020		"""Pleckstrin homology (PH) domain containing"""	15687	protein-coding gene	gene with protein product		605215	"""src family associated phosphoprotein 2"""	SCAP2		9837776, 9755858	Standard	NM_003930		Approved	RA70, SKAP-HOM, SKAP55R, SAPS	uc003syc.3	O75563	OTTHUMG00000023495	ENST00000345317.2:c.302C>T	7.37:g.26883654G>A	ENSP00000005587:p.Ser101Phe		A4D173|Q53GP6|Q75MK6|Q75MZ4|Q9UBZ3|Q9UED8	Missense_Mutation	SNP	pfam_Pleckstrin_homology,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,prints_SH3_domain	p.S101F	ENST00000345317.2	37	c.302	CCDS5400.1	7	.	.	.	.	.	.	.	.	.	.	G	12.45	1.941416	0.34283	.	.	ENSG00000005020	ENST00000345317;ENST00000535331;ENST00000432747	T;T	0.13657	2.57;2.57	5.57	5.57	0.84162	.	0.394746	0.28572	N	0.014880	T	0.09379	0.0231	N	0.22421	0.69	0.80722	D	1	P;B	0.35383	0.498;0.121	B;B	0.27500	0.08;0.07	T	0.13282	-1.0515	10	0.49607	T	0.09	-4.8231	13.0875	0.59149	0.0:0.0:0.7194:0.2806	.	86;101	B7Z5N4;O75563	.;SKAP2_HUMAN	F	101;86;86	ENSP00000005587:S101F;ENSP00000408163:S86F	ENSP00000005587:S101F	S	-	2	0	SKAP2	26850179	1.000000	0.71417	0.989000	0.46669	0.379000	0.30106	1.600000	0.36762	2.618000	0.88619	0.585000	0.79938	TCT	SKAP2	-	NULL		0.423	SKAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKAP2	HGNC	protein_coding	OTTHUMT00000214128.1	G			26883654	-1	no_errors	ENST00000345317	ensembl	human	known	70_37	missense	SNP	0.996	A
SLC25A33	84275	genome.wustl.edu	37	1	9630370	9630370	+	Silent	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr1:9630370C>T	ENST00000302692.6	+	4	579	c.369C>T	c.(367-369)ttC>ttT	p.F123F		NM_032315.2	NP_115691.1	Q9BSK2	S2533_HUMAN	solute carrier family 25 (pyrimidine nucleotide carrier), member 33	123					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|kidney(1)|lung(4)|prostate(1)|skin(1)	9	all_lung(157;0.246)	all_epithelial(116;1.16e-18)|all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Breast(348;0.00191)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.01e-08)|COAD - Colon adenocarcinoma(227;1.44e-05)|Kidney(185;0.000262)|KIRC - Kidney renal clear cell carcinoma(229;0.000957)|BRCA - Breast invasive adenocarcinoma(304;0.0019)|STAD - Stomach adenocarcinoma(132;0.00355)|READ - Rectum adenocarcinoma(331;0.0419)		ATGGCATTTTCGTGCCTAACA	0.398																																																	0													170.0	155.0	160.0					1																	9630370		2203	4298	6501	SO:0001819	synonymous_variant	84275			AF495714	CCDS103.1	1p36.22	2013-05-22	2012-03-29		ENSG00000171612	ENSG00000171612		"""Solute carriers"""	29681	protein-coding gene	gene with protein product		610816	"""solute carrier family 25, member 33"""			14715278, 16949250	Standard	XM_005263503		Approved	MGC4399, BMSC-MCP, PNC1	uc001apw.3	Q9BSK2	OTTHUMG00000001322	ENST00000302692.6:c.369C>T	1.37:g.9630370C>T				Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.F123	ENST00000302692.6	37	c.369	CCDS103.1	1																																																																																			SLC25A33	-	superfamily_Mt_carrier_dom		0.398	SLC25A33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A33	HGNC	protein_coding	OTTHUMT00000003851.2	C	NM_032315		9630370	+1	no_errors	ENST00000302692	ensembl	human	known	70_37	silent	SNP	0.992	T
SLC28A3	64078	genome.wustl.edu	37	9	86900261	86900261	+	Splice_Site	SNP	G	G	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr9:86900261G>T	ENST00000376238.4	-	14	1695	c.1646C>A	c.(1645-1647)tCa>tAa	p.S549*	SLC28A3_ENST00000537648.1_Splice_Site_p.S480*|RP11-380F14.2_ENST00000419815.1_RNA	NM_001199633.1|NM_022127.2	NP_001186562.1|NP_071410.1	Q9HAS3	S28A3_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 3	549					pyrimidine nucleoside transport (GO:0015864)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|purine-specific nucleoside:sodium symporter activity (GO:0015390)|pyrimidine- and adenine-specific:sodium symporter activity (GO:0015389)			endometrium(2)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31					Adenosine(DB00640)|Cladribine(DB00242)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Ribavirin(DB00811)	TTTACTCACTGATATATATTG	0.388																																					Ovarian(106;425 1539 34835 42413 43572)												0													69.0	70.0	70.0					9																	86900261		2203	4300	6503	SO:0001630	splice_region_variant	64078			AF305210	CCDS6670.1	9q21.33	2013-07-17	2013-07-17		ENSG00000197506	ENSG00000197506		"""Solute carriers"""	16484	protein-coding gene	gene with protein product		608269	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 3"""			11032837	Standard	NM_001199633		Approved	CNT3	uc010mpz.3	Q9HAS3	OTTHUMG00000020117	ENST00000376238.4:c.1647+1C>A	9.37:g.86900261G>T			A8K9Y4|B1AML0|B2RA51|B4E2S8|F5GYE3	Nonsense_Mutation	SNP	pfam_Nucleos_tra2_C,pfam_Nuclsd_transpt2,pfam_Nucleoside_recog_Gate,tigrfam_C_nuclsd_transpt_met_bac	p.S549*	ENST00000376238.4	37	c.1646	CCDS6670.1	9	.	.	.	.	.	.	.	.	.	.	G	29.1	4.978364	0.92982	.	.	ENSG00000197506	ENST00000376238;ENST00000537648	.	.	.	5.74	5.74	0.90152	.	0.056707	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.0915	16.522	0.84319	0.0:0.1305:0.8695:0.0	.	.	.	.	X	549;480	.	ENSP00000365413:S549X	S	-	2	0	SLC28A3	86090081	1.000000	0.71417	0.999000	0.59377	0.123000	0.20343	5.483000	0.66838	2.873000	0.98535	0.561000	0.74099	TCA	SLC28A3	-	pfam_Nucleos_tra2_C,tigrfam_C_nuclsd_transpt_met_bac		0.388	SLC28A3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC28A3	HGNC	protein_coding	OTTHUMT00000052874.1	G	NM_022127	Nonsense_Mutation	86900261	-1	no_errors	ENST00000376238	ensembl	human	known	70_37	nonsense	SNP	0.997	T
SLC35F1	222553	genome.wustl.edu	37	6	118606347	118606347	+	Splice_Site	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr6:118606347G>A	ENST00000360388.4	+	7	1049	c.848G>A	c.(847-849)gGa>gAa	p.G283E		NM_001029858.3	NP_001025029.2	Q5T1Q4	S35F1_HUMAN	solute carrier family 35, member F1	283					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(3)|kidney(1)|large_intestine(7)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(226;0.217)		CTTCCCCCAGGACTGCTCTAC	0.522											OREG0017635	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													185.0	188.0	187.0					6																	118606347		2203	4300	6503	SO:0001630	splice_region_variant	222553			BC028615	CCDS34524.1	6q22.31	2013-05-22			ENSG00000196376	ENSG00000196376		"""Solute carriers"""	21483	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 169"""	C6orf169			Standard	NM_001029858		Approved	dJ230I3.1	uc003pxx.4	Q5T1Q4	OTTHUMG00000015460	ENST00000360388.4:c.848-1G>A	6.37:g.118606347G>A		1489	E1P564|Q1RMG1|Q4G0U9|Q4G167|Q6N007	Missense_Mutation	SNP	pfam_DUF914_euk,pfam_DMT	p.G283E	ENST00000360388.4	37	c.848	CCDS34524.1	6	.	.	.	.	.	.	.	.	.	.	G	19.56	3.850052	0.71603	.	.	ENSG00000196376	ENST00000360388	.	.	.	4.82	4.82	0.62117	.	0.118100	0.56097	D	0.000029	T	0.73760	0.3628	M	0.69523	2.12	0.58432	D	0.999997	D	0.63880	0.993	D	0.70487	0.969	T	0.72697	-0.4215	8	.	.	.	.	18.4576	0.90727	0.0:0.0:1.0:0.0	.	283	Q5T1Q4	S35F1_HUMAN	E	283	.	.	G	+	2	0	SLC35F1	118713040	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.189000	0.65098	2.667000	0.90743	0.655000	0.94253	GGA	SLC35F1	-	pfam_DUF914_euk,pfam_DMT		0.522	SLC35F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35F1	HGNC	protein_coding	OTTHUMT00000041991.2	G	XM_167044	Missense_Mutation	118606347	+1	no_errors	ENST00000360388	ensembl	human	known	70_37	missense	SNP	0.998	A
SLC6A17	388662	genome.wustl.edu	37	1	110734776	110734776	+	Silent	SNP	C	C	T	rs151171218		TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr1:110734776C>T	ENST00000331565.4	+	7	1532	c.1047C>T	c.(1045-1047)ctC>ctT	p.L349L		NM_001010898.2	NP_001010898.1	Q9H1V8	S6A17_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 17	349					alanine transport (GO:0032328)|glycine transport (GO:0015816)|leucine transport (GO:0015820)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		TGGCCACCCTCGTGGTGTTTG	0.532													c|||	1	0.000199681	0.0008	0.0	5008	,	,		22228	0.0		0.0	False		,,,				2504	0.0																0								T		4,4402	8.1+/-20.4	0,4,2199	175.0	119.0	138.0		1047	-1.2	1.0	1	dbSNP_134	138	0,8600		0,0,4300	no	coding-synonymous	SLC6A17	NM_001010898.2		0,4,6499	TT,TC,CC		0.0,0.0908,0.0308		349/728	110734776	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	388662				CCDS30799.1	1p13.2	2013-07-19	2013-07-19		ENSG00000197106	ENSG00000197106		"""Solute carriers"""	31399	protein-coding gene	gene with protein product		610299	"""solute carrier family 6 (neurotransmitter transporter), member 17"", ""solute carrier family 6, member 17"""				Standard	NM_001010898		Approved		uc009wfq.3	Q9H1V8	OTTHUMG00000011761	ENST00000331565.4:c.1047C>T	1.37:g.110734776C>T			A6NEA8|A8K1R7|B9EIR5|Q5T5Q9	Silent	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_orphan	p.L349	ENST00000331565.4	37	c.1047	CCDS30799.1	1																																																																																			SLC6A17	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport		0.532	SLC6A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A17	HGNC	protein_coding	OTTHUMT00000032550.2	C	XM_371280		110734776	+1	no_errors	ENST00000331565	ensembl	human	known	70_37	silent	SNP	0.983	T
SLCO2A1	6578	genome.wustl.edu	37	3	133698338	133698338	+	Missense_Mutation	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr3:133698338G>C	ENST00000310926.4	-	2	494	c.221C>G	c.(220-222)tCc>tGc	p.S74C	SLCO2A1_ENST00000478651.1_5'UTR|SLCO2A1_ENST00000493729.1_Missense_Mutation_p.S74C	NM_005630.2	NP_005621.2	Q92959	SO2A1_HUMAN	solute carrier organic anion transporter family, member 2A1	74					lipid transport (GO:0006869)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid transporter activity (GO:0005319)|prostaglandin transmembrane transporter activity (GO:0015132)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|skin(2)|stomach(2)	30					Alprostadil(DB00770)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Furosemide(DB00695)|Iloprost(DB01088)|Phenobarbital(DB01174)|Pyruvic acid(DB00119)	ATTCAAGCTGGAAATGAGACC	0.552																																																	0													150.0	146.0	148.0					3																	133698338		2203	4300	6503	SO:0001583	missense	6578				CCDS3084.1	3q21	2013-05-22	2003-11-25	2003-11-26	ENSG00000174640	ENSG00000174640		"""Solute carriers"""	10955	protein-coding gene	gene with protein product		601460	"""solute carrier family 21 (prostaglandin transporter), member 2"", ""matrin F/G 1"""	SLC21A2, MATR1		8787677, 9618293	Standard	NM_005630		Approved	PGT, OATP2A1	uc003eqa.4	Q92959	OTTHUMG00000159745	ENST00000310926.4:c.221C>G	3.37:g.133698338G>C	ENSP00000311291:p.Ser74Cys		Q86V98|Q8IUN2	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.S74C	ENST00000310926.4	37	c.221	CCDS3084.1	3	.	.	.	.	.	.	.	.	.	.	G	24.6	4.544426	0.86022	.	.	ENSG00000174640	ENST00000310926;ENST00000493729	T;T	0.59772	0.24;0.24	5.06	5.06	0.68205	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.114234	0.64402	D	0.000006	T	0.79941	0.4533	M	0.87682	2.9	0.40347	D	0.979094	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.83410	0.0027	10	0.52906	T	0.07	.	18.4279	0.90615	0.0:0.0:1.0:0.0	.	74;74;74	B7Z8J8;E7EU40;Q92959	.;.;SO2A1_HUMAN	C	74	ENSP00000311291:S74C;ENSP00000418893:S74C	ENSP00000311291:S74C	S	-	2	0	SLCO2A1	135181028	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.430000	0.97488	2.351000	0.79841	0.561000	0.74099	TCC	SLCO2A1	-	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter		0.552	SLCO2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO2A1	HGNC	protein_coding	OTTHUMT00000357131.1	G	NM_005630		133698338	-1	no_errors	ENST00000310926	ensembl	human	known	70_37	missense	SNP	1.000	C
SMARCD1	6602	genome.wustl.edu	37	12	50484356	50484356	+	Silent	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr12:50484356C>T	ENST00000394963.4	+	9	1514	c.1116C>T	c.(1114-1116)atC>atT	p.I372I	SMARCD1_ENST00000381513.4_Silent_p.I372I|SMARCD1_ENST00000548573.1_Silent_p.I170I	NM_003076.4	NP_003067.3			SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1											NS(1)|breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	18						AACCTATCATCATTAATCATG	0.493																																																	0													111.0	101.0	104.0					12																	50484356		2203	4300	6503	SO:0001819	synonymous_variant	6602			U66617	CCDS8797.2, CCDS8798.2	12q13-q14	2008-08-05			ENSG00000066117	ENSG00000066117			11106	protein-coding gene	gene with protein product		601735				8804307, 9693044, 12917342	Standard	NM_003076		Approved	BAF60A, Rsc6p, CRACD1	uc001rvx.4	Q96GM5	OTTHUMG00000150194	ENST00000394963.4:c.1116C>T	12.37:g.50484356C>T				Silent	SNP	pfam_SWIB_MDM2_domain,superfamily_SWIB_MDM2_domain,smart_SWIB_domain	p.I372	ENST00000394963.4	37	c.1116	CCDS8797.2	12																																																																																			SMARCD1	-	superfamily_SWIB_MDM2_domain		0.493	SMARCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCD1	HGNC	protein_coding	OTTHUMT00000316759.2	C	NM_003076		50484356	+1	no_errors	ENST00000394963	ensembl	human	known	70_37	silent	SNP	1.000	T
SP2	6668	genome.wustl.edu	37	17	45993695	45993695	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr17:45993695C>G	ENST00000376741.4	+	3	395	c.258C>G	c.(256-258)atC>atG	p.I86M	AC003665.1_ENST00000451140.2_RNA|AC003665.1_ENST00000411573.2_RNA|AC003665.1_ENST00000585280.1_RNA|AC003665.1_ENST00000433001.1_RNA	NM_003110.5	NP_003101.3	Q02086	SP2_HUMAN	Sp2 transcription factor	86					cardiovascular system development (GO:0072358)|embryonic organ development (GO:0048568)|fibroblast proliferation (GO:0048144)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	13						GCTTTGGAATCTTGTCCTCCA	0.552																																																	0													102.0	105.0	104.0					17																	45993695		2203	4300	6503	SO:0001583	missense	6668				CCDS11521.2	17q21.3-q22	2013-01-08			ENSG00000167182	ENSG00000167182		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11207	protein-coding gene	gene with protein product		601801				1341900, 9730617	Standard	NM_003110		Approved	KIAA0048	uc002imk.3	Q02086	OTTHUMG00000150196	ENST00000376741.4:c.258C>G	17.37:g.45993695C>G	ENSP00000365931:p.Ile86Met		A6NK74	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.I86M	ENST00000376741.4	37	c.258	CCDS11521.2	17	.	.	.	.	.	.	.	.	.	.	C	12.59	1.982186	0.34942	.	.	ENSG00000167182	ENST00000376741;ENST00000322172	T	0.15139	2.45	5.29	3.26	0.37387	.	0.180613	0.49305	D	0.000142	T	0.13841	0.0335	L	0.54323	1.7	0.40973	D	0.984711	P	0.34780	0.468	B	0.27500	0.08	T	0.06770	-1.0808	10	0.72032	D	0.01	.	6.9826	0.24711	0.0:0.6967:0.1434:0.1599	.	86	Q02086	SP2_HUMAN	M	86;79	ENSP00000365931:I86M	ENSP00000316942:I79M	I	+	3	3	SP2	43348694	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.821000	0.48065	1.457000	0.47850	0.467000	0.42956	ATC	SP2	-	NULL		0.552	SP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SP2	HGNC	protein_coding	OTTHUMT00000316777.1	C	NM_003110		45993695	+1	no_errors	ENST00000376741	ensembl	human	known	70_37	missense	SNP	1.000	G
SP2	6668	genome.wustl.edu	37	17	45993703	45993703	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr17:45993703C>T	ENST00000376741.4	+	3	403	c.266C>T	c.(265-267)tCc>tTc	p.S89F	AC003665.1_ENST00000451140.2_RNA|AC003665.1_ENST00000411573.2_RNA|AC003665.1_ENST00000585280.1_RNA|AC003665.1_ENST00000433001.1_RNA	NM_003110.5	NP_003101.3	Q02086	SP2_HUMAN	Sp2 transcription factor	89					cardiovascular system development (GO:0072358)|embryonic organ development (GO:0048568)|fibroblast proliferation (GO:0048144)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	13						ATCTTGTCCTCCAAAGGAAAT	0.542																																																	0													101.0	104.0	103.0					17																	45993703		2203	4300	6503	SO:0001583	missense	6668				CCDS11521.2	17q21.3-q22	2013-01-08			ENSG00000167182	ENSG00000167182		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11207	protein-coding gene	gene with protein product		601801				1341900, 9730617	Standard	NM_003110		Approved	KIAA0048	uc002imk.3	Q02086	OTTHUMG00000150196	ENST00000376741.4:c.266C>T	17.37:g.45993703C>T	ENSP00000365931:p.Ser89Phe		A6NK74	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S89F	ENST00000376741.4	37	c.266	CCDS11521.2	17	.	.	.	.	.	.	.	.	.	.	C	20.2	3.956727	0.73902	.	.	ENSG00000167182	ENST00000376741;ENST00000322172	T	0.10960	2.82	5.29	4.32	0.51571	.	0.063531	0.64402	D	0.000006	T	0.23330	0.0564	L	0.58101	1.795	0.46901	D	0.999241	D	0.67145	0.996	P	0.57548	0.823	T	0.01081	-1.1458	10	0.87932	D	0	.	12.8811	0.58017	0.0:0.9203:0.0:0.0797	.	89	Q02086	SP2_HUMAN	F	89;82	ENSP00000365931:S89F	ENSP00000316942:S82F	S	+	2	0	SP2	43348702	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.046000	0.76592	1.457000	0.47850	0.467000	0.42956	TCC	SP2	-	NULL		0.542	SP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SP2	HGNC	protein_coding	OTTHUMT00000316777.1	C	NM_003110		45993703	+1	no_errors	ENST00000376741	ensembl	human	known	70_37	missense	SNP	1.000	T
SRGAP1	57522	genome.wustl.edu	37	12	64536255	64536255	+	Missense_Mutation	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr12:64536255G>A	ENST00000355086.3	+	22	3585	c.3061G>A	c.(3061-3063)Gag>Aag	p.E1021K	SRGAP1_ENST00000543397.1_Missense_Mutation_p.E958K|SRGAP1_ENST00000357825.3_Missense_Mutation_p.E998K	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	1021					axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)	p.E1021Q(1)		breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		CAGGAGCTCCGAGCCTCAGAT	0.567																																																	1	Substitution - Missense(1)	breast(1)											128.0	102.0	111.0					12																	64536255		2203	4300	6503	SO:0001583	missense	57522			AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.3061G>A	12.37:g.64536255G>A	ENSP00000347198:p.Glu1021Lys		Q9H8A3|Q9P2P2	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FCH,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Fuc/Ara_isomerase_C,smart_FCH,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.E1021K	ENST00000355086.3	37	c.3061	CCDS8967.1	12	.	.	.	.	.	.	.	.	.	.	G	17.43	3.386935	0.61956	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	T;T;T	0.33216	1.42;1.42;1.42	6.04	6.04	0.98038	.	0.000000	0.35378	U	0.003260	T	0.28200	0.0696	L	0.50333	1.59	0.80722	D	1	P;P	0.40970	0.734;0.625	B;B	0.28305	0.041;0.088	T	0.04268	-1.0964	9	.	.	.	.	20.5948	0.99439	0.0:0.0:1.0:0.0	.	1021;958	Q7Z6B7;G5EA48	SRGP1_HUMAN;.	K	1021;998;958	ENSP00000347198:E1021K;ENSP00000350480:E998K;ENSP00000437948:E958K	.	E	+	1	0	SRGAP1	62822522	1.000000	0.71417	0.992000	0.48379	0.022000	0.10575	7.905000	0.87416	2.873000	0.98535	0.563000	0.77884	GAG	SRGAP1	-	NULL		0.567	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRGAP1	HGNC	protein_coding	OTTHUMT00000400896.1	G			64536255	+1	no_errors	ENST00000355086	ensembl	human	known	70_37	missense	SNP	1.000	A
SRGAP3	9901	genome.wustl.edu	37	3	9057375	9057375	+	Missense_Mutation	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr3:9057375G>C	ENST00000383836.3	-	15	2146	c.1719C>G	c.(1717-1719)atC>atG	p.I573M	SRGAP3_ENST00000433332.3_5'UTR|SRGAP3_ENST00000360413.3_Missense_Mutation_p.I549M|SRGAP3-AS1_ENST00000414633.1_RNA	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	573	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)		SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		CGACTGAATTGATATCTCGTT	0.413			T	RAF1	pilocytic astrocytoma																																			Dom	yes		3	3p25.3	9901	SLIT-ROBO Rho GTPase activating protein 3		M	0													97.0	99.0	98.0					3																	9057375		2203	4300	6503	SO:0001583	missense	9901			AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.1719C>G	3.37:g.9057375G>C	ENSP00000373347:p.Ile573Met		Q8IX13|Q8IZV8	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FCH,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_FCH,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.I573M	ENST00000383836.3	37	c.1719	CCDS2572.1	3	.	.	.	.	.	.	.	.	.	.	G	13.52	2.260334	0.39995	.	.	ENSG00000196220	ENST00000383836;ENST00000360413	T;T	0.48201	0.82;1.82	5.29	4.3	0.51218	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.57725	0.2073	L	0.59912	1.85	0.47698	D	0.999491	D;D	0.64830	0.994;0.994	D;D	0.78314	0.991;0.984	T	0.54715	-0.8252	10	0.30854	T	0.27	.	6.5135	0.22234	0.2662:0.0:0.7338:0.0	.	549;573	O43295-2;O43295	.;SRGP2_HUMAN	M	573;549	ENSP00000373347:I573M;ENSP00000353587:I549M	ENSP00000353587:I549M	I	-	3	3	SRGAP3	9032375	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	0.975000	0.29449	2.455000	0.83008	0.655000	0.94253	ATC	SRGAP3	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom		0.413	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRGAP3	HGNC	protein_coding	OTTHUMT00000207137.3	G			9057375	-1	no_errors	ENST00000383836	ensembl	human	known	70_37	missense	SNP	1.000	C
SSR2	6746	genome.wustl.edu	37	1	155979343	155979343	+	Silent	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr1:155979343C>T	ENST00000295702.4	-	6	611	c.540G>A	c.(538-540)acG>acA	p.T180T	SSR2_ENST00000496742.1_3'UTR|SSR2_ENST00000480567.1_Silent_p.T180T|SSR2_ENST00000529008.1_3'UTR	NM_003145.3	NP_003136.1	P43308	SSRB_HUMAN	signal sequence receptor, beta (translocon-associated protein beta)	180					cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|stomach(1)	10	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					AGTTCTTCTTCGTTTTGGGAG	0.532																																																	0													127.0	112.0	117.0					1																	155979343		2203	4300	6503	SO:0001819	synonymous_variant	6746			BC000341	CCDS1126.1	1q21-q23	2008-02-05			ENSG00000163479	ENSG00000163479			11324	protein-coding gene	gene with protein product		600867				7789174	Standard	NM_003145		Approved	TLAP, TRAPB	uc001fmx.3	P43308	OTTHUMG00000017456	ENST00000295702.4:c.540G>A	1.37:g.155979343C>T			B2R9K9|D3DVA7|Q53HI0|Q5VY95|Q5VY96|Q6IB31|Q9BWE4	Silent	SNP	pfam_TRAP_beta,pirsf_TRAP_beta	p.T180	ENST00000295702.4	37	c.540	CCDS1126.1	1																																																																																			SSR2	-	pirsf_TRAP_beta		0.532	SSR2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SSR2	HGNC	protein_coding	OTTHUMT00000046172.2	C	NM_003145		155979343	-1	no_errors	ENST00000295702	ensembl	human	known	70_37	silent	SNP	0.819	T
STAMBPL1	57559	genome.wustl.edu	37	10	90668531	90668531	+	Missense_Mutation	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr10:90668531G>C	ENST00000371926.3	+	4	1279	c.321G>C	c.(319-321)atG>atC	p.M107I	STAMBPL1_ENST00000371927.3_Missense_Mutation_p.M107I|STAMBPL1_ENST00000371924.1_Missense_Mutation_p.M107I	NM_020799.3	NP_065850.1	Q96FJ0	STALP_HUMAN	STAM binding protein-like 1	107						membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(2)|endometrium(1)|large_intestine(2)|liver(2)|lung(2)|ovary(1)|skin(1)	11		Colorectal(252;0.0381)		Colorectal(12;6.38e-05)|COAD - Colon adenocarcinoma(12;7.75e-05)		AGGATATTATGAAGGTATTGT	0.403																																																	0													164.0	147.0	153.0					10																	90668531		2203	4300	6503	SO:0001583	missense	57559			AB037794	CCDS7391.1	10q23.32	2006-11-08			ENSG00000138134	ENSG00000138134			24105	protein-coding gene	gene with protein product	"""associated molecule with the SH3 domain of STAM (AMSH) like protein"", ""associated molecule with the SH3 domain of STAM (AMSH) - Family Protein"""	612352				12810066, 12943674	Standard	NM_020799		Approved	AMSH-LP, KIAA1373, AMSH-FP, FLJ31524, ALMalpha, bA399O19.2	uc001kfk.4	Q96FJ0	OTTHUMG00000018702	ENST00000371926.3:c.321G>C	10.37:g.90668531G>C	ENSP00000360994:p.Met107Ile		B3KPA7|Q5T9N4|Q5T9N9|Q7Z420|Q9P2H4	Missense_Mutation	SNP	pfam_JAB1_Mov34_MPN_PAD1,smart_JAB1_Mov34_MPN_PAD1	p.M107I	ENST00000371926.3	37	c.321	CCDS7391.1	10	.	.	.	.	.	.	.	.	.	.	G	10.05	1.245169	0.22796	.	.	ENSG00000138134	ENST00000371926;ENST00000371927;ENST00000371924	T;T;T	0.22336	1.98;1.96;1.98	5.86	2.98	0.34508	.	0.161948	0.64402	N	0.000002	T	0.09598	0.0236	N	0.16478	0.41	0.80722	D	1	B;B	0.10296	0.002;0.003	B;B	0.15052	0.012;0.002	T	0.22800	-1.0206	10	0.21014	T	0.42	-0.9507	2.195	0.03908	0.149:0.1309:0.4508:0.2693	.	107;107	Q96FJ0-2;Q96FJ0	.;STALP_HUMAN	I	107	ENSP00000360994:M107I;ENSP00000360995:M107I;ENSP00000360992:M107I	ENSP00000360992:M107I	M	+	3	0	STAMBPL1	90658511	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	1.459000	0.35234	0.376000	0.24707	-0.311000	0.09066	ATG	STAMBPL1	-	NULL		0.403	STAMBPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAMBPL1	HGNC	protein_coding	OTTHUMT00000049283.1	G	NM_020799		90668531	+1	no_errors	ENST00000371927	ensembl	human	known	70_37	missense	SNP	0.996	C
SUPT16H	11198	genome.wustl.edu	37	14	21829300	21829300	+	Silent	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr14:21829300G>A	ENST00000216297.2	-	16	2204	c.1866C>T	c.(1864-1866)ttC>ttT	p.F622F		NM_007192.3	NP_009123.1	Q9Y5B9	SP16H_HUMAN	suppressor of Ty 16 homolog (S. cerevisiae)	622					DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|nucleosome disassembly (GO:0006337)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)		TAATAATTCGGAAAGCATTCT	0.408																																																	0													121.0	115.0	117.0					14																	21829300		2203	4300	6503	SO:0001819	synonymous_variant	11198			AF152961	CCDS9569.1	14q11.1	2008-08-13	2001-11-28		ENSG00000092201	ENSG00000092201			11465	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 140 kDa subunit"""	605012	"""suppressor of Ty (S.cerevisiae) 16 homolog"""			9489704, 11239457	Standard	NM_007192		Approved	FACT, FACTP140, SPT16/CDC68, FLJ14010, FLJ10857, CDC68	uc001wao.2	Q9Y5B9	OTTHUMG00000029685	ENST00000216297.2:c.1866C>T	14.37:g.21829300G>A			Q6GMT8|Q6P2F1|Q6PJM1|Q9NRX0	Silent	SNP	pfam_FACT_Spt16p,pfam_Pept_M24_structural-domain,pfam_DUF1747,superfamily_Pept_M24_structural-domain	p.F622	ENST00000216297.2	37	c.1866	CCDS9569.1	14																																																																																			SUPT16H	-	pfam_FACT_Spt16p		0.408	SUPT16H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUPT16H	HGNC	protein_coding	OTTHUMT00000074025.2	G			21829300	-1	no_errors	ENST00000216297	ensembl	human	known	70_37	silent	SNP	0.994	A
TAP2	6891	genome.wustl.edu	37	6	32805352	32805352	+	Silent	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr6:32805352G>C	ENST00000452392.2	-	3	743	c.570C>G	c.(568-570)gcC>gcG	p.A190A	TAP2_ENST00000374899.4_Silent_p.A190A|TAP2_ENST00000374897.2_Silent_p.A190A			Q9UDX4	S14L3_HUMAN	transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)	0	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)									Vitamin E(DB00163)	AGATGGCACTGGCAAAGGCAT	0.488																																																	0													94.0	81.0	85.0					6																	32805352		2203	4300	6503	SO:0001819	synonymous_variant	6891			M74447	CCDS4755.1	6p21.3	2014-09-17			ENSG00000204267	ENSG00000204267		"""ATP binding cassette transporters / subfamily B"""	44	protein-coding gene	gene with protein product		170261		ABCB3		1529427, 1946428, 16395595	Standard	NM_001290043		Approved	PSF2, RING11, D6S217E	uc003ocd.3	Q03519	OTTHUMG00000031068	ENST00000452392.2:c.570C>G	6.37:g.32805352G>C			E7EN74|E9PE57|Q495V8|Q495W0|Q495W1	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,prints_ABC_B3,prints_ABC_B2,tigrfam_Ag_transporter2	p.A190	ENST00000452392.2	37	c.570		6																																																																																			TAP2	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1,prints_ABC_B3,tigrfam_Ag_transporter2		0.488	TAP2-001	NOVEL	mRNA_end_NF|cds_end_NF|basic|appris_principal|readthrough_transcript|exp_conf	protein_coding	TAP2	HGNC	protein_coding	OTTHUMT00000361828.1	G	NM_000544		32805352	-1	no_errors	ENST00000374897	ensembl	human	known	70_37	silent	SNP	0.639	C
TBC1D10B	26000	genome.wustl.edu	37	16	30371123	30371123	+	Missense_Mutation	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr16:30371123G>C	ENST00000409939.3	-	5	1391	c.1311C>G	c.(1309-1311)atC>atG	p.I437M		NM_015527.3	NP_056342.3	Q4KMP7	TB10B_HUMAN	TBC1 domain family, member 10B	437	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			endometrium(2)|kidney(1)|lung(2)|urinary_tract(1)	6			Colorectal(24;0.193)			CAGGCCGGTAGATGGTGTAGG	0.662																																																	0													56.0	48.0	51.0					16																	30371123		2196	4295	6491	SO:0001583	missense	26000			BC063112	CCDS10676.2	16p11.2	2013-07-09			ENSG00000169221	ENSG00000169221			24510	protein-coding gene	gene with protein product		613620				20404108	Standard	NM_015527		Approved	DKFZP434P1750, Rab27A-GAPbeta, FLJ13130, EPI64B	uc002dxt.3	Q4KMP7	OTTHUMG00000132396	ENST00000409939.3:c.1311C>G	16.37:g.30371123G>C	ENSP00000386538:p.Ile437Met		B9A6L0|Q6IN54|Q6P530|Q71RG7|Q86VC5|Q9H8Z2|Q9NUN6|Q9UFP2	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.I437M	ENST00000409939.3	37	c.1311	CCDS10676.2	16	.	.	.	.	.	.	.	.	.	.	G	19.04	3.750844	0.69533	.	.	ENSG00000169221	ENST00000409939	T	0.04551	3.6	5.09	4.14	0.48551	Rab-GAP/TBC domain (4);	0.161469	0.41500	D	0.000865	T	0.12561	0.0305	L	0.46567	1.45	0.43175	D	0.994988	D	0.63046	0.992	D	0.67900	0.954	T	0.01182	-1.1426	10	0.72032	D	0.01	.	8.3567	0.32335	0.0848:0.156:0.7592:0.0	.	437	Q4KMP7	TB10B_HUMAN	M	437	ENSP00000386538:I437M	ENSP00000386538:I437M	I	-	3	3	TBC1D10B	30278624	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.954000	0.49113	1.171000	0.42768	0.456000	0.33151	ATC	TBC1D10B	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom		0.662	TBC1D10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D10B	HGNC	protein_coding	OTTHUMT00000255527.3	G	NM_015527		30371123	-1	no_errors	ENST00000409939	ensembl	human	known	70_37	missense	SNP	1.000	C
TENM2	57451	genome.wustl.edu	37	5	167626875	167626875	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr5:167626875C>T	ENST00000518659.1	+	17	3208	c.3169C>T	c.(3169-3171)Cat>Tat	p.H1057Y	TENM2_ENST00000520394.1_Missense_Mutation_p.H825Y|TENM2_ENST00000545108.1_Missense_Mutation_p.H1057Y|TENM2_ENST00000519204.1_Missense_Mutation_p.H936Y|TENM2_ENST00000403607.2_Missense_Mutation_p.H881Y	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1057					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										CCAGGTTCTTCATGAAGAAAT	0.488																																																	0													163.0	157.0	159.0					5																	167626875		1931	4150	6081	SO:0001583	missense	57451			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.3169C>T	5.37:g.167626875C>T	ENSP00000429430:p.His1057Tyr		Q9ULU2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Quino_amine_DH_bsu,superfamily_ConA-like_lec_gl_sf,superfamily_Cytokine_IL1-like,smart_EG-like_dom,smart_EGF-like_Ca-bd,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.H1057Y	ENST00000518659.1	37	c.3169		5	.	.	.	.	.	.	.	.	.	.	C	21.5	4.158291	0.78114	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.89552	-2.07;-2.05;-2.17;-2.51;-2.53	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	D	0.93475	0.7918	M	0.67953	2.075	0.58432	D	0.999998	D;D;D	0.65815	0.995;0.991;0.962	D;P;D	0.66716	0.938;0.869;0.946	D	0.93421	0.6777	10	0.49607	T	0.09	.	18.4354	0.90643	0.0:1.0:0.0:0.0	.	1057;1057;825	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	Y	1057;1057;936;825;881	ENSP00000429430:H1057Y;ENSP00000438635:H1057Y;ENSP00000428964:H936Y;ENSP00000427874:H825Y;ENSP00000384905:H881Y	ENSP00000384905:H881Y	H	+	1	0	ODZ2	167559453	1.000000	0.71417	0.999000	0.59377	0.966000	0.64601	7.818000	0.86416	2.338000	0.79540	0.561000	0.74099	CAT	TENM2	-	superfamily_ConA-like_lec_gl_sf		0.488	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	TENM2	HGNC	protein_coding	OTTHUMT00000376096.1	C	NM_001122679		167626875	+1	no_errors	ENST00000518659	ensembl	human	known	70_37	missense	SNP	1.000	T
TMED5	50999	genome.wustl.edu	37	1	93620280	93620280	+	Missense_Mutation	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr1:93620280G>C	ENST00000370282.3	-	4	1122	c.637C>G	c.(637-639)Caa>Gaa	p.Q213E	TMED5_ENST00000479918.1_3'UTR|TMED5_ENST00000483033.1_5'UTR	NM_016040.4	NP_057124.3	Q9Y3A6	TMED5_HUMAN	transmembrane emp24 protein transport domain containing 5	213					Golgi ribbon formation (GO:0090161)|protein transport (GO:0015031)	cis-Golgi network (GO:0005801)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	6		all_lung(203;0.0223)|Lung NSC(277;0.071)|Melanoma(281;0.147)|Glioma(108;0.188)		all cancers(265;0.00108)|GBM - Glioblastoma multiforme(16;0.00407)|Epithelial(280;0.0797)		ATATAAACTTGAATGGCTGAC	0.353																																																	0													147.0	134.0	138.0					1																	93620280		2203	4300	6503	SO:0001583	missense	50999			BC070051	CCDS743.1, CCDS53342.1	1p22.1	2013-09-19			ENSG00000117500	ENSG00000117500			24251	protein-coding gene	gene with protein product						10810093	Standard	NM_016040		Approved	CGI-100	uc001dpn.3	Q9Y3A6	OTTHUMG00000010162	ENST00000370282.3:c.637C>G	1.37:g.93620280G>C	ENSP00000359305:p.Gln213Glu		B1AKT4|B2R703|D3DT38|Q96AX8	Missense_Mutation	SNP	pfam_GOLD,superfamily_GOLD,pfscan_GOLD	p.Q213E	ENST00000370282.3	37	c.637	CCDS743.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.304075	0.95601	.	.	ENSG00000117500	ENST00000370282;ENST00000535517	T	0.31247	1.5	6.02	6.02	0.97574	GOLD (1);	0.000000	0.85682	D	0.000000	T	0.66742	0.2820	H	0.95328	3.655	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75918	-0.3148	10	0.87932	D	0	-16.1467	20.5407	0.99260	0.0:0.0:1.0:0.0	.	213	Q9Y3A6	TMED5_HUMAN	E	213;162	ENSP00000359305:Q213E	ENSP00000359305:Q213E	Q	-	1	0	TMED5	93392868	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.672000	0.98629	2.865000	0.98341	0.655000	0.94253	CAA	TMED5	-	pfam_GOLD		0.353	TMED5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMED5	HGNC	protein_coding	OTTHUMT00000028076.3	G	NM_016040		93620280	-1	no_errors	ENST00000370282	ensembl	human	known	70_37	missense	SNP	1.000	C
TRIO	7204	genome.wustl.edu	37	5	14485296	14485296	+	Missense_Mutation	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr5:14485296G>A	ENST00000344204.4	+	47	6800	c.6776G>A	c.(6775-6777)cGg>cAg	p.R2259Q	TRIO_ENST00000537187.1_Missense_Mutation_p.R2259Q	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	2259	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					CCAAGTGTCCGGCAAACTTGG	0.403																																																	0													123.0	118.0	119.0					5																	14485296		2203	4300	6503	SO:0001583	missense	7204			AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.6776G>A	5.37:g.14485296G>A	ENSP00000339299:p.Arg2259Gln		D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	pfam_DH-domain,pfam_Prot_kinase_cat_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,superfamily_Capsid/spike_ssDNA_virus,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.R2259Q	ENST00000344204.4	37	c.6776	CCDS3883.1	5	.	.	.	.	.	.	.	.	.	.	G	19.58	3.853673	0.71719	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000513206	T;T	0.12361	2.69;2.69	5.34	4.47	0.54385	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.123877	0.56097	D	0.000035	T	0.10809	0.0264	L	0.42245	1.32	0.49299	D	0.999771	B;P	0.42692	0.252;0.787	B;B	0.30251	0.089;0.113	T	0.07809	-1.0753	10	0.40728	T	0.16	.	13.9719	0.64245	0.0727:0.0:0.9273:0.0	.	2259;2259	O75962-5;O75962	.;TRIO_HUMAN	Q	2259;2259;1946	ENSP00000339299:R2259Q;ENSP00000446348:R2259Q	ENSP00000339299:R2259Q	R	+	2	0	TRIO	14538296	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	9.869000	0.99810	1.260000	0.44134	-0.142000	0.14014	CGG	TRIO	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.403	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIO	HGNC	protein_coding	OTTHUMT00000253711.2	G	NM_007118		14485296	+1	no_errors	ENST00000344204	ensembl	human	known	70_37	missense	SNP	1.000	A
TROAP	10024	genome.wustl.edu	37	12	49719924	49719924	+	Missense_Mutation	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr12:49719924G>C	ENST00000257909.3	+	6	775	c.699G>C	c.(697-699)gaG>gaC	p.E233D	RP11-161H23.9_ENST00000553259.1_RNA|TROAP_ENST00000551245.1_Missense_Mutation_p.E233D|TROAP_ENST00000547923.1_5'Flank	NM_005480.3	NP_005471.3	Q12815	TROAP_HUMAN	trophinin associated protein	233					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	32						TAAGAAGGGAGACAGCTGGCA	0.532																																																	0													95.0	98.0	97.0					12																	49719924		2203	4300	6503	SO:0001583	missense	10024			U04810	CCDS8784.1, CCDS41779.1, CCDS61117.1	12q13.12	2012-10-17	2012-10-17		ENSG00000135451	ENSG00000135451			12327	protein-coding gene	gene with protein product	"""tastin"""	603872				7758945	Standard	NM_005480		Approved	TASTIN	uc001rtx.4	Q12815	OTTHUMG00000169486	ENST00000257909.3:c.699G>C	12.37:g.49719924G>C	ENSP00000257909:p.Glu233Asp		F8VSF9|Q6PJU7|Q8N5B2	Missense_Mutation	SNP	NULL	p.E233D	ENST00000257909.3	37	c.699	CCDS8784.1	12	.	.	.	.	.	.	.	.	.	.	G	11.76	1.734636	0.30774	.	.	ENSG00000135451	ENST00000551245;ENST00000550346;ENST00000257909;ENST00000547807	.	.	.	4.13	3.22	0.36961	.	0.611313	0.15322	N	0.268474	T	0.42988	0.1227	L	0.31926	0.97	0.80722	D	1	P;B	0.40476	0.718;0.021	B;B	0.41764	0.366;0.022	T	0.28235	-1.0050	9	0.39692	T	0.17	-0.2608	9.9847	0.41835	0.0:0.2058:0.7942:0.0	.	233;233	F8W130;Q12815	.;TROAP_HUMAN	D	233;116;233;233	.	ENSP00000257909:E233D	E	+	3	2	TROAP	48006191	1.000000	0.71417	0.999000	0.59377	0.966000	0.64601	1.618000	0.36954	1.321000	0.45227	-0.175000	0.13238	GAG	TROAP	-	NULL		0.532	TROAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TROAP	HGNC	protein_coding	OTTHUMT00000404300.1	G	NM_005480		49719924	+1	no_errors	ENST00000257909	ensembl	human	known	70_37	missense	SNP	0.999	C
TSR1	55720	genome.wustl.edu	37	17	2236281	2236281	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr17:2236281C>T	ENST00000301364.5	-	7	2358	c.1279G>A	c.(1279-1281)Gag>Aag	p.E427K	SNORD91A_ENST00000390861.1_RNA	NM_018128.4	NP_060598.3	Q2NL82	TSR1_HUMAN	TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)	427	Glu-rich.				ribosome assembly (GO:0042255)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	20						ATAAAATCCTCATGTTCCATA	0.443																																																	0													175.0	158.0	163.0					17																	2236281		2203	4300	6503	SO:0001583	missense	55720			AK026565	CCDS32525.1	17p13.3	2006-04-20	2006-04-20			ENSG00000167721			25542	protein-coding gene	gene with protein product		611214	"""TSR1, 20S rRNA accumulation, homolog (yeast)"""			10718198	Standard	NM_018128		Approved	FLJ10534	uc002fuj.3	Q2NL82		ENST00000301364.5:c.1279G>A	17.37:g.2236281C>T	ENSP00000301364:p.Glu427Lys		Q8WUY5|Q9NVT0|Q9P2E6	Missense_Mutation	SNP	pfam_BMS1_TSR1_C,pfam_AARP2CN,superfamily_Transl_elong_init/rib_B-barrel,smart_AARP2CN	p.E427K	ENST00000301364.5	37	c.1279	CCDS32525.1	17	.	.	.	.	.	.	.	.	.	.	C	15.98	2.992087	0.54041	.	.	ENSG00000167721	ENST00000301364	T	0.12774	2.65	4.6	4.6	0.57074	.	0.715092	0.13344	N	0.394904	T	0.18341	0.0440	M	0.73598	2.24	0.53005	D	0.999962	P	0.36683	0.565	B	0.32980	0.156	T	0.12372	-1.0550	10	0.15952	T	0.53	-10.1594	16.1379	0.81502	0.0:1.0:0.0:0.0	.	427	Q2NL82	TSR1_HUMAN	K	427	ENSP00000301364:E427K	ENSP00000301364:E427K	E	-	1	0	TSR1	2183031	1.000000	0.71417	0.963000	0.40424	0.884000	0.51177	3.964000	0.56780	2.380000	0.81148	0.557000	0.71058	GAG	TSR1	-	NULL		0.443	TSR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TSR1	HGNC	protein_coding	OTTHUMT00000438180.2	C	NM_018128		2236281	-1	no_errors	ENST00000301364	ensembl	human	known	70_37	missense	SNP	0.998	T
UBXN1	51035	genome.wustl.edu	37	11	62444225	62444225	+	Intron	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr11:62444225C>T	ENST00000301935.5	-	8	1011				UBXN1_ENST00000533000.1_Intron|UBXN1_ENST00000529640.1_Intron|UBXN1_ENST00000524762.1_5'Flank|UBXN1_ENST00000294119.2_Missense_Mutation_p.G302R			Q04323	UBXN1_HUMAN	UBX domain protein 1						negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)	Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	ATPase binding (GO:0051117)|K6-linked polyubiquitin binding (GO:0071796)|polyubiquitin binding (GO:0031593)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			endometrium(5)|lung(12)	17						CCTCCTTTTCCTAGGCATGCC	0.512																																																	0													154.0	148.0	150.0					11																	62444225		2202	4299	6501	SO:0001627	intron_variant	51035				CCDS8029.1, CCDS66105.1, CCDS73307.1	11q23	2014-02-12	2008-07-25		ENSG00000162191	ENSG00000162191		"""UBX domain containing"""	18402	protein-coding gene	gene with protein product	"""SAPK substrate protein 1"""					12838346, 20351172	Standard	NM_001286078		Approved	LOC51035, 2B28, UBXD10, SAKS1	uc001nuj.3	Q04323	OTTHUMG00000167580	ENST00000301935.5:c.844+59G>A	11.37:g.62444225C>T			Q9BV93|Q9BVV5	Missense_Mutation	SNP	pfam_UBX,pfam_UBA/transl_elong_EF1B_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,smart_UBX,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_UBX	p.G302R	ENST00000301935.5	37	c.904		11	.	.	.	.	.	.	.	.	.	.	C	4.906	0.168292	0.09339	.	.	ENSG00000162191	ENST00000294119	T	0.27256	1.68	5.24	1.96	0.26148	.	1.876030	0.02425	N	0.082999	T	0.20700	0.0498	.	.	.	0.27880	N	0.939708	B	0.02656	0.0	B	0.09377	0.004	T	0.27157	-1.0082	9	0.87932	D	0	-4.1276	3.7957	0.08738	0.4213:0.4433:0.0:0.1354	.	302	Q04323-2	.	R	302	ENSP00000294119:G302R	ENSP00000294119:G302R	G	-	1	0	UBXN1	62200801	0.018000	0.18449	0.008000	0.14137	0.062000	0.15995	1.673000	0.37534	0.262000	0.21774	0.655000	0.94253	GGA	UBXN1	-	NULL		0.512	UBXN1-002	KNOWN	basic|appris_candidate_longest	protein_coding	UBXN1	HGNC	protein_coding	OTTHUMT00000395153.1	C	NM_015853		62444225	-1	no_errors	ENST00000294119	ensembl	human	known	70_37	missense	SNP	0.032	T
UPF1	5976	genome.wustl.edu	37	19	18976135	18976135	+	Missense_Mutation	SNP	G	G	C			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr19:18976135G>C	ENST00000599848.1	+	21	3137	c.2928G>C	c.(2926-2928)caG>caC	p.Q976H	UPF1_ENST00000262803.5_Missense_Mutation_p.Q965H			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	976					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						CCCATGACCAGATTGGCATGA	0.587																																																	0													61.0	48.0	52.0					19																	18976135		2203	4300	6503	SO:0001583	missense	5976			AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.2928G>C	19.37:g.18976135G>C	ENSP00000470142:p.Gln976His		O00239|O43343|Q86Z25|Q92842	Missense_Mutation	SNP	pfam_RNA-helicase_UPF1_UPF2-interct,pfam_Helicase/UvrB_dom	p.Q976H	ENST00000599848.1	37	c.2928		19	.	.	.	.	.	.	.	.	.	.	g	15.29	2.790974	0.50102	.	.	ENSG00000005007	ENST00000262803	D	0.89746	-2.56	4.87	3.81	0.43845	.	0.000000	0.85682	D	0.000000	D	0.82449	0.5039	L	0.34521	1.04	0.80722	D	1	B;B	0.11235	0.002;0.004	B;B	0.13407	0.004;0.009	T	0.76961	-0.2765	10	0.45353	T	0.12	-32.5035	11.0668	0.47980	0.097:0.0:0.903:0.0	.	976;965	Q92900;Q92900-2	RENT1_HUMAN;.	H	965	ENSP00000262803:Q965H	ENSP00000262803:Q965H	Q	+	3	2	UPF1	18837135	1.000000	0.71417	0.991000	0.47740	0.931000	0.56810	6.380000	0.73158	1.008000	0.39264	0.550000	0.68814	CAG	UPF1	-	NULL		0.587	UPF1-002	KNOWN	basic	protein_coding	UPF1	HGNC	protein_coding	OTTHUMT00000464684.1	G	NM_002911		18976135	+1	no_errors	ENST00000599848	ensembl	human	known	70_37	missense	SNP	1.000	C
VPS13B	157680	genome.wustl.edu	37	8	100523624	100523624	+	Missense_Mutation	SNP	G	G	T	rs140797231		TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr8:100523624G>T	ENST00000358544.2	+	29	4703	c.4592G>T	c.(4591-4593)gGt>gTt	p.G1531V	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Missense_Mutation_p.G1506V	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	1531					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AAATCTCCTGGTCAGCCCATG	0.343																																					Colon(161;2205 2542 7338 31318)												0													48.0	46.0	47.0					8																	100523624		2203	4300	6503	SO:0001583	missense	157680			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.4592G>T	8.37:g.100523624G>T	ENSP00000351346:p.Gly1531Val		C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.G1531V	ENST00000358544.2	37	c.4592	CCDS6280.1	8	.	.	.	.	.	.	.	.	.	.	G	19.17	3.776360	0.70107	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.68765	-0.34;-0.35	5.36	5.36	0.76844	.	0.059044	0.64402	D	0.000003	T	0.75759	0.3893	L	0.43152	1.355	0.80722	D	1	D;D;D	0.76494	0.989;0.996;0.999	P;D;D	0.66497	0.836;0.944;0.927	T	0.72060	-0.4404	10	0.32370	T	0.25	.	19.4366	0.94798	0.0:0.0:1.0:0.0	.	1530;1506;1531	Q7Z7G8-6;Q7Z7G8-2;Q7Z7G8	.;.;VP13B_HUMAN	V	1506;1531	ENSP00000349685:G1506V;ENSP00000351346:G1531V	ENSP00000349685:G1506V	G	+	2	0	VPS13B	100592800	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.537000	0.98070	2.669000	0.90835	0.585000	0.79938	GGT	VPS13B	-	NULL		0.343	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	HGNC	protein_coding	OTTHUMT00000277138.1	G	NM_184042		100523624	+1	no_errors	ENST00000358544	ensembl	human	known	70_37	missense	SNP	1.000	T
WDR87	83889	genome.wustl.edu	37	19	38380730	38380730	+	Missense_Mutation	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr19:38380730G>A	ENST00000303868.5	-	6	3688	c.3464C>T	c.(3463-3465)tCt>tTt	p.S1155F	WDR87_ENST00000447313.2_Missense_Mutation_p.S1194F	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	1155										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						TTTCTCTTGAGAATCAACATC	0.443																																																	0													153.0	109.0	122.0					19																	38380730		692	1591	2283	SO:0001583	missense	83889			AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.3464C>T	19.37:g.38380730G>A	ENSP00000368025:p.Ser1155Phe		Q9BWV9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Quinolinate_PRibosylTrfase_C,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S1194F	ENST00000303868.5	37	c.3581	CCDS46063.1	19	.	.	.	.	.	.	.	.	.	.	G	4.781	0.145270	0.09134	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.10668	2.85;2.85	3.43	-0.027	0.13928	.	7.930160	0.00531	U	0.000202	T	0.07638	0.0192	L	0.44542	1.39	0.09310	N	1	P;P	0.39964	0.697;0.697	B;B	0.28784	0.094;0.094	T	0.32745	-0.9895	10	0.15952	T	0.53	0.0706	4.1318	0.10152	0.1161:0.0:0.4737:0.4102	.	1155;1194	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	F	1194;1155	ENSP00000405012:S1194F;ENSP00000368025:S1155F	ENSP00000368025:S1155F	S	-	2	0	WDR87	43072570	0.000000	0.05858	0.001000	0.08648	0.081000	0.17604	-0.444000	0.06854	0.094000	0.17404	-0.577000	0.04142	TCT	WDR87	-	superfamily_ARM-type_fold		0.443	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR87	HGNC	protein_coding	OTTHUMT00000314628.2	G	XM_940478		38380730	-1	no_errors	ENST00000447313	ensembl	human	known	70_37	missense	SNP	0.001	A
XKRX	402415	genome.wustl.edu	37	X	100177950	100177950	+	Missense_Mutation	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chrX:100177950C>T	ENST00000372956.2	-	2	1040	c.436G>A	c.(436-438)Gag>Aag	p.E146K	XKRX_ENST00000468904.1_Intron|XKRX_ENST00000328526.5_Missense_Mutation_p.E159K			Q6PP77	XKR2_HUMAN	XK, Kell blood group complex subunit-related, X-linked	146						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(3)	22						AGCACCTCCTCGCCATCTATT	0.532																																																	0													188.0	159.0	169.0					X																	100177950		2203	4300	6503	SO:0001583	missense	402415			AY589511	CCDS14476.1, CCDS14476.2	Xq22	2008-02-05	2006-01-12		ENSG00000182489	ENSG00000182489			29845	protein-coding gene	gene with protein product		300684	"""X Kell blood group precursor-related, X-linked"""				Standard	NM_212559		Approved	XPLAC, XKR2	uc004egn.2	Q6PP77	OTTHUMG00000022010	ENST00000372956.2:c.436G>A	X.37:g.100177950C>T	ENSP00000362047:p.Glu146Lys		B2RNN6|B4DKU2|Q5H9J6	Missense_Mutation	SNP	pfam_Transport_prot_XK	p.E159K	ENST00000372956.2	37	c.475	CCDS14476.2	X	.	.	.	.	.	.	.	.	.	.	C	13.17	2.157745	0.38119	.	.	ENSG00000182489	ENST00000328526;ENST00000372956	T;T	0.63255	-0.03;-0.02	5.93	-1.18	0.09617	.	0.790735	0.12176	N	0.492570	T	0.38957	0.1060	N	0.14661	0.345	0.18873	N	0.999989	B	0.25441	0.126	B	0.19391	0.025	T	0.18713	-1.0328	10	0.29301	T	0.29	-1.1008	9.0848	0.36574	0.0985:0.2891:0.54:0.0723	.	146	Q6PP77	XKR2_HUMAN	K	159;146	ENSP00000327570:E159K;ENSP00000362047:E146K	ENSP00000327570:E159K	E	-	1	0	XKRX	100064606	0.063000	0.20901	0.993000	0.49108	0.993000	0.82548	0.677000	0.25262	-0.060000	0.13132	-0.368000	0.07277	GAG	XKRX	-	pfam_Transport_prot_XK		0.532	XKRX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKRX	HGNC	protein_coding	OTTHUMT00000057501.3	C	NM_212559		100177950	-1	no_errors	ENST00000328526	ensembl	human	known	70_37	missense	SNP	0.319	T
ZAN	7455	genome.wustl.edu	37	7	100389622	100389622	+	RNA	SNP	G	G	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr7:100389622G>T	ENST00000348028.3	+	0	7728				ZAN_ENST00000546292.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000538115.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			ACAAGGGGCGGAGCTGGGCCT	0.657																																																	0													21.0	26.0	24.0					7																	100389622		2042	4194	6236			7455			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100389622G>T			A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Nonsense_Mutation	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl_sf,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.E2521*	ENST00000348028.3	37	c.7561		7	.	.	.	.	.	.	.	.	.	.	g	46	12.088491	0.99635	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	.	.	.	3.12	-1.03	0.10102	.	2.325720	0.02103	N	0.054108	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	.	2.8247	0.05482	0.3643:0.0:0.4154:0.2203	.	.	.	.	X	2521	.	ENSP00000445091:E2521X	E	+	1	0	ZAN	100227558	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.773000	0.26661	-0.236000	0.09753	0.550000	0.68814	GAG	ZAN	-	NULL		0.657	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	HGNC	polymorphic_pseudogene	OTTHUMT00000347214.1	G	NM_003386		100389622	+1	no_errors	ENST00000546292	ensembl	human	known	70_37	nonsense	SNP	0.000	T
ZBTB10	65986	genome.wustl.edu	37	8	81399769	81399769	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr8:81399769C>G	ENST00000430430.1	+	2	1503	c.724C>G	c.(724-726)Cta>Gta	p.L242V	ZBTB10_ENST00000426744.2_Missense_Mutation_p.L242V|Y_RNA_ENST00000605948.1_RNA|ZBTB10_ENST00000379091.4_Intron|ZBTB10_ENST00000455036.3_Missense_Mutation_p.L242V	NM_001277145.1	NP_001264074.1	Q96DT7	ZBT10_HUMAN	zinc finger and BTB domain containing 10	242					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(4)	20	all_cancers(3;1.68e-09)|all_epithelial(4;5.13e-11)|Lung NSC(7;1.75e-07)|all_lung(9;7.38e-07)|Breast(3;2.96e-06)		BRCA - Breast invasive adenocarcinoma(6;0.000434)|Epithelial(68;0.00486)|all cancers(69;0.0296)			GCCCAAGTCTCTAATGCAGAA	0.622																																																	0													29.0	32.0	31.0					8																	81399769		1997	4171	6168	SO:0001583	missense	65986			AK022814	CCDS47880.1, CCDS64920.1	8q13-q21.1	2013-01-09			ENSG00000205189	ENSG00000205189		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	30953	protein-coding gene	gene with protein product						12477932	Standard	NM_001105539		Approved	RINZF, FLJ12752	uc003ybx.5	Q96DT7	OTTHUMG00000155016	ENST00000430430.1:c.724C>G	8.37:g.81399769C>G	ENSP00000387462:p.Leu242Val		A4FVD0|Q86W96|Q8IXI9|Q96MH9	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.L242V	ENST00000430430.1	37	c.724	CCDS47880.1	8	.	.	.	.	.	.	.	.	.	.	C	14.39	2.521130	0.44866	.	.	ENSG00000205189	ENST00000430430;ENST00000455036;ENST00000426744;ENST00000519370	T;T;T	0.11821	2.75;2.75;2.74	4.52	2.72	0.32119	.	0.000000	0.51477	D	0.000091	T	0.20007	0.0481	N	0.24115	0.695	0.39559	D	0.969095	D;D;D	0.76494	0.999;0.999;0.999	P;P;D	0.66602	0.883;0.883;0.945	T	0.02081	-1.1217	10	0.87932	D	0	.	10.9107	0.47108	0.0:0.8448:0.0:0.1552	.	98;242;242	A8E4L4;Q96DT7;Q96DT7-2	.;ZBT10_HUMAN;.	V	242;242;242;70	ENSP00000387462:L242V;ENSP00000412036:L242V;ENSP00000416134:L242V	ENSP00000416134:L242V	L	+	1	2	ZBTB10	81562324	1.000000	0.71417	0.939000	0.37840	0.162000	0.22319	2.190000	0.42630	0.514000	0.28300	-0.150000	0.13652	CTA	ZBTB10	-	NULL		0.622	ZBTB10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZBTB10	HGNC	protein_coding	OTTHUMT00000338055.2	C	NM_023929		81399769	+1	no_errors	ENST00000426744	ensembl	human	known	70_37	missense	SNP	1.000	G
ZC3H11A	9877	genome.wustl.edu	37	1	203797541	203797541	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr1:203797541C>G	ENST00000545588.1	+	4	4116	c.289C>G	c.(289-291)Ccg>Gcg	p.P97A	ZC3H11A_ENST00000332127.4_Missense_Mutation_p.P97A|ZC3H11A_ENST00000367214.1_Missense_Mutation_p.P97A|ZC3H11A_ENST00000367212.3_Missense_Mutation_p.P97A|ZC3H11A_ENST00000367210.1_Missense_Mutation_p.P97A	NM_001271675.1	NP_001258604.1	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A	97					poly(A)+ mRNA export from nucleus (GO:0016973)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			TTTCCTACCTCCGAGCAAAAG	0.358																																																	0													46.0	43.0	44.0					1																	203797541		2203	4300	6503	SO:0001583	missense	9877				CCDS30978.1	1q32.1	2012-07-05	2005-06-02	2005-06-02	ENSG00000058673	ENSG00000058673		"""Zinc fingers, CCCH-type domain containing"""	29093	protein-coding gene	gene with protein product		613513	"""zinc finger CCCH-type domain containing 11A"""	ZC3HDC11A		9734811	Standard	NM_014827		Approved	KIAA0663	uc001hac.3	O75152	OTTHUMG00000035909	ENST00000545588.1:c.289C>G	1.37:g.203797541C>G	ENSP00000438527:p.Pro97Ala		Q6AHY4|Q6AHY9|Q6AW79|Q6AWA1|Q6PJK4|Q86XZ7	Missense_Mutation	SNP	smart_Znf_CCCH	p.P97A	ENST00000545588.1	37	c.289	CCDS30978.1	1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.305987	0.81247	.	.	ENSG00000058673	ENST00000453771;ENST00000367214;ENST00000537080;ENST00000367212;ENST00000332127;ENST00000545588;ENST00000367210	T;T;T;T;T	0.59083	0.29;0.29;0.29;0.29;0.29	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.72510	0.3469	L	0.56769	1.78	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.70200	-0.4937	10	0.34782	T	0.22	-11.2135	17.4792	0.87668	0.0:1.0:0.0:0.0	.	97	O75152	ZC11A_HUMAN	A	97;97;43;97;97;97;97	ENSP00000356183:P97A;ENSP00000356181:P97A;ENSP00000333253:P97A;ENSP00000438527:P97A;ENSP00000356179:P97A	ENSP00000333253:P97A	P	+	1	0	ZC3H11A	202064164	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.420000	0.80191	2.472000	0.83506	0.655000	0.94253	CCG	ZC3H11A	-	NULL		0.358	ZC3H11A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H11A	HGNC	protein_coding	OTTHUMT00000087471.3	C	NM_014827		203797541	+1	no_errors	ENST00000332127	ensembl	human	known	70_37	missense	SNP	1.000	G
ZEB2	9839	genome.wustl.edu	37	2	145157221	145157221	+	Silent	SNP	G	G	A	rs587780994		TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr2:145157221G>A	ENST00000558170.2	-	8	2717	c.1533C>T	c.(1531-1533)gtC>gtT	p.V511V	ZEB2_ENST00000303660.4_Silent_p.V511V|ZEB2_ENST00000539609.3_Silent_p.V487V|ZEB2_ENST00000409487.3_Silent_p.V511V	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	511					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		CCGGAAGACCGACAGGCGGAA	0.423																																					Melanoma(33;1235 1264 5755 16332)												0													65.0	69.0	67.0					2																	145157221		2203	4300	6503	SO:0001819	synonymous_variant	9839			AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.1533C>T	2.37:g.145157221G>A			A0JP09|B7Z2P2|F5H814|Q9UED1	Silent	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Znf_C2H2	p.V511	ENST00000558170.2	37	c.1533	CCDS2186.1	2																																																																																			ZEB2	-	NULL		0.423	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZEB2	HGNC	protein_coding	OTTHUMT00000254778.5	G	NM_014795		145157221	-1	no_errors	ENST00000303660	ensembl	human	known	70_37	silent	SNP	0.888	A
ZC3H15	55854	genome.wustl.edu	37	2	187373329	187373329	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr2:187373329G>T	ENST00000337859.6	+	10	1377	c.1150G>T	c.(1150-1152)Gaa>Taa	p.E384*		NM_018471.2	NP_060941.2	Q8WU90	ZC3HF_HUMAN	zinc finger CCCH-type containing 15	384					cytokine-mediated signaling pathway (GO:0019221)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|skin(1)	15			OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Epithelial(96;0.0922)|all cancers(119;0.233)			AAGTGACTTGGAAGAGGACAA	0.408																																																	0													149.0	151.0	150.0					2																	187373329		1876	4114	5990	SO:0001587	stop_gained	55854				CCDS42791.1	2q32.1	2012-07-05			ENSG00000065548	ENSG00000065548		"""Zinc fingers, CCCH-type domain containing"""	29528	protein-coding gene	gene with protein product	"""likely ortholog of mouse immediate early response, erythropoietin 4"""					10880228	Standard	NM_018471		Approved	LEREPO4	uc002upo.3	Q8WU90	OTTHUMG00000154251	ENST00000337859.6:c.1150G>T	2.37:g.187373329G>T	ENSP00000338788:p.Glu384*		B4DMW2|D3DPG7|Q5QTQ4|Q8WZ06|Q9NUZ3|Q9NZ37|Q9P079	Nonsense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.E384*	ENST00000337859.6	37	c.1150	CCDS42791.1	2	.	.	.	.	.	.	.	.	.	.	G	36	5.947984	0.97134	.	.	ENSG00000065548	ENST00000337859;ENST00000536434	.	.	.	5.77	5.77	0.91146	.	0.365850	0.30437	N	0.009630	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-14.1022	17.7667	0.88480	0.0:0.0:1.0:0.0	.	.	.	.	X	384	.	ENSP00000338788:E384X	E	+	1	0	ZC3H15	187081574	1.000000	0.71417	0.998000	0.56505	0.843000	0.47879	5.666000	0.68059	2.724000	0.93272	0.650000	0.86243	GAA	ZC3H15	-	NULL		0.408	ZC3H15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H15	HGNC	protein_coding	OTTHUMT00000334547.2	G	NM_018471		187373329	+1	no_errors	ENST00000337859	ensembl	human	known	70_37	nonsense	SNP	1.000	T
ZFHX4	79776	genome.wustl.edu	37	8	77768238	77768238	+	Silent	SNP	C	C	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr8:77768238C>T	ENST00000521891.2	+	10	9529	c.9081C>T	c.(9079-9081)ttC>ttT	p.F3027F	ZFHX4_ENST00000050961.6_Silent_p.F2982F|ZFHX4_ENST00000455469.2_Silent_p.F2982F|ZFHX4_ENST00000518282.1_Silent_p.F3001F	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2982					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ATCACATTTTCTCCAAACAGC	0.527										HNSCC(33;0.089)																																							0													62.0	61.0	62.0					8																	77768238		1958	4144	6102	SO:0001819	synonymous_variant	79776				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.9081C>T	8.37:g.77768238C>T			G3V138|Q18PS0|Q6ZN20	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.F3027	ENST00000521891.2	37	c.9081	CCDS47878.2	8																																																																																			ZFHX4	-	smart_Znf_U1,smart_Znf_C2H2-like		0.527	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	C	NM_024721		77768238	+1	no_errors	ENST00000521891	ensembl	human	known	70_37	silent	SNP	1.000	T
ZNF106	64397	genome.wustl.edu	37	15	42734469	42734469	+	Missense_Mutation	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr15:42734469G>A	ENST00000263805.4	-	7	3822	c.3496C>T	c.(3496-3498)Cat>Tat	p.H1166Y	ZNF106_ENST00000565380.1_Missense_Mutation_p.H394Y|ZNF106_ENST00000565611.1_Missense_Mutation_p.H351Y	NM_001284306.1|NM_001284307.1|NM_022473.1	NP_001271235.1|NP_001271236.1|NP_071918.1	Q9H2Y7	ZN106_HUMAN	zinc finger protein 106	1166					insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GGAGACACATGGGAAGATGGA	0.512																																																	0													119.0	110.0	113.0					15																	42734469		2203	4299	6502	SO:0001583	missense	64397			AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000263805.4:c.3496C>T	15.37:g.42734469G>A	ENSP00000263805:p.His1166Tyr		B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_Znf_C2H2-like,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.H1166Y	ENST00000263805.4	37	c.3496	CCDS32208.1	15	.	.	.	.	.	.	.	.	.	.	G	15.18	2.755923	0.49362	.	.	ENSG00000103994	ENST00000263805;ENST00000434903	T	0.56941	0.43	5.03	5.03	0.67393	.	0.077372	0.52532	D	0.000077	T	0.55305	0.1912	L	0.44542	1.39	0.28878	N	0.894563	P;D;B	0.61080	0.475;0.989;0.347	B;P;B	0.53912	0.043;0.737;0.043	T	0.56056	-0.8042	10	0.62326	D	0.03	-17.8285	11.0775	0.48040	0.0874:0.0:0.9126:0.0	.	394;1166;394	E9PE29;Q9H2Y7;B4DZ40	.;ZF106_HUMAN;.	Y	1166;394	ENSP00000263805:H1166Y	ENSP00000263805:H1166Y	H	-	1	0	ZFP106	40521761	1.000000	0.71417	0.995000	0.50966	0.854000	0.48673	2.641000	0.46587	2.595000	0.87683	0.655000	0.94253	CAT	ZFP106	-	NULL		0.512	ZNF106-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP106	HGNC	protein_coding	OTTHUMT00000422587.1	G	NM_022473		42734469	-1	no_errors	ENST00000263805	ensembl	human	known	70_37	missense	SNP	0.997	A
ZNF366	167465	genome.wustl.edu	37	5	71740119	71740119	+	Splice_Site	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr5:71740119C>G	ENST00000318442.5	-	5	2190		c.e5-1		RP11-389C8.2_ENST00000564956.1_RNA	NM_152625.1	NP_689838.1	Q8N895	ZN366_HUMAN	zinc finger protein 366						negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|estrogen receptor binding (GO:0030331)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	35		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		CTTCCCAGACCTGCAAGAGCA	0.582																																																	0													28.0	33.0	32.0					5																	71740119		2165	4274	6439	SO:0001630	splice_region_variant	167465			AK097115	CCDS4015.1	5q13.1	2013-01-08			ENSG00000178175	ENSG00000178175		"""Zinc fingers, C2H2-type"""	18316	protein-coding gene	gene with protein product		610159					Standard	NM_152625		Approved	FLJ39796	uc003kce.1	Q8N895	OTTHUMG00000100965	ENST00000318442.5:c.1700-1G>C	5.37:g.71740119C>G			Q5HYI9|Q7RTV4	Splice_Site	SNP	-	e4-1	ENST00000318442.5	37	c.1700-1	CCDS4015.1	5	.	.	.	.	.	.	.	.	.	.	C	11.67	1.707289	0.30322	.	.	ENSG00000178175	ENST00000318442	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZNF366	71775875	1.000000	0.71417	0.998000	0.56505	0.053000	0.15095	6.165000	0.71891	2.941000	0.99782	0.655000	0.94253	.	ZNF366	-	-		0.582	ZNF366-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF366	HGNC	protein_coding	OTTHUMT00000218574.3	C		Intron	71740119	-1	no_errors	ENST00000318442	ensembl	human	known	70_37	splice_site	SNP	1.000	G
ZNF598	90850	genome.wustl.edu	37	16	2049698	2049698	+	Missense_Mutation	SNP	G	G	T			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr16:2049698G>T	ENST00000563630.1	-	9	1929	c.1687C>A	c.(1687-1689)Ccg>Acg	p.P563T	ZNF598_ENST00000431526.1_Missense_Mutation_p.P618T|AC005606.15_ENST00000567515.1_lincRNA|ZNF598_ENST00000562103.1_Missense_Mutation_p.P563T			Q86UK7	ZN598_HUMAN	zinc finger protein 598	618							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						GGAGCTTCCGGGGCCTGCAAA	0.657																																																	0													13.0	17.0	16.0					16																	2049698		1789	3976	5765	SO:0001583	missense	90850			BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000563630.1:c.1687C>A	16.37:g.2049698G>T	ENSP00000455882:p.Pro563Thr		Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	superfamily_PAH,smart_Znf_C2H2-like,pfscan_Znf_RING	p.P618T	ENST00000563630.1	37	c.1852		16	.	.	.	.	.	.	.	.	.	.	.	1.159	-0.644288	0.03531	.	.	ENSG00000167962	ENST00000431526	T	0.18338	2.22	4.17	3.22	0.36961	.	0.445621	0.25971	N	0.027130	T	0.16514	0.0397	L	0.56769	1.78	0.29847	N	0.828732	B	0.25904	0.137	B	0.25140	0.058	T	0.11616	-1.0580	10	0.19147	T	0.46	-0.99	11.0955	0.48141	0.0905:0.0:0.9095:0.0	.	618	Q86UK7	ZN598_HUMAN	T	618	ENSP00000411409:P618T	ENSP00000411409:P618T	P	-	1	0	ZNF598	1989699	0.280000	0.24249	0.145000	0.22337	0.071000	0.16799	1.378000	0.34328	0.986000	0.38683	0.650000	0.86243	CCG	ZNF598	-	NULL		0.657	ZNF598-001	NOVEL	basic	protein_coding	ZNF598	HGNC	protein_coding	OTTHUMT00000434439.1	G	NM_178167		2049698	-1	no_errors	ENST00000431526	ensembl	human	known	70_37	missense	SNP	0.648	T
ZNF598	90850	genome.wustl.edu	37	16	2050434	2050434	+	Missense_Mutation	SNP	G	G	A			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr16:2050434G>A	ENST00000563630.1	-	8	1327	c.1085C>T	c.(1084-1086)tCg>tTg	p.S362L	ZNF598_ENST00000431526.1_Missense_Mutation_p.S417L|AC005606.15_ENST00000567515.1_lincRNA|ZNF598_ENST00000562103.1_Missense_Mutation_p.S362L			Q86UK7	ZN598_HUMAN	zinc finger protein 598	417							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						GCCTGTCACCGAGAAGGCTTC	0.647																																																	0													52.0	63.0	60.0					16																	2050434		1943	4129	6072	SO:0001583	missense	90850			BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000563630.1:c.1085C>T	16.37:g.2050434G>A	ENSP00000455882:p.Ser362Leu		Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	superfamily_PAH,smart_Znf_C2H2-like,pfscan_Znf_RING	p.S417L	ENST00000563630.1	37	c.1250		16	.	.	.	.	.	.	.	.	.	.	.	11.30	1.597359	0.28445	.	.	ENSG00000167962	ENST00000431526	T	0.17054	2.3	4.53	3.54	0.40534	.	0.478425	0.24527	N	0.037756	T	0.13243	0.0321	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18999	-1.0319	10	0.59425	D	0.04	-0.5147	11.4138	0.49941	0.0:0.0:0.8182:0.1818	.	417	Q86UK7	ZN598_HUMAN	L	417	ENSP00000411409:S417L	ENSP00000411409:S417L	S	-	2	0	ZNF598	1990435	0.005000	0.15991	0.003000	0.11579	0.008000	0.06430	1.325000	0.33724	1.161000	0.42604	0.467000	0.42956	TCG	ZNF598	-	NULL		0.647	ZNF598-001	NOVEL	basic	protein_coding	ZNF598	HGNC	protein_coding	OTTHUMT00000434439.1	G	NM_178167		2050434	-1	no_errors	ENST00000431526	ensembl	human	known	70_37	missense	SNP	0.004	A
ZNF48	197407	genome.wustl.edu	37	16	30409681	30409681	+	Silent	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chr16:30409681C>G	ENST00000320159.2	+	2	1486	c.1110C>G	c.(1108-1110)ctC>ctG	p.L370L	SEPT1_ENST00000570039.1_5'Flank	NM_001214906.1|NM_001214907.1|NM_001214909.1|NM_152652.2	NP_001201835.1|NP_001201836.1|NP_001201838.1|NP_689865.2	Q96MX3	ZNF48_HUMAN	zinc finger protein 48	370					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)|pancreas(1)|skin(1)	21						CCTTCAGCCTCAGCTCCACCC	0.652																																																	0													105.0	66.0	79.0					16																	30409681		2197	4300	6497	SO:0001819	synonymous_variant	197407			M88358, AK056313	CCDS10679.1, CCDS73868.1	16p11.2	2013-01-08			ENSG00000180035	ENSG00000180035		"""Zinc fingers, C2H2-type"""	13114	protein-coding gene	gene with protein product			"""zinc finger protein 553"""	ZNF553		1505991	Standard	NM_152652		Approved	DKFZp762K013, FLJ31751, MGC43952	uc021tgi.1	Q96MX3	OTTHUMG00000048195	ENST00000320159.2:c.1110C>G	16.37:g.30409681C>G			Q15920|Q4G0R3|Q69YP3|Q96IL9	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L370	ENST00000320159.2	37	c.1110	CCDS10679.1	16																																																																																			ZNF48	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.652	ZNF48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF48	HGNC	protein_coding	OTTHUMT00000255549.2	C	NM_152652		30409681	+1	no_errors	ENST00000320159	ensembl	human	known	70_37	silent	SNP	1.000	G
ZNF645	158506	genome.wustl.edu	37	X	22291649	22291649	+	Missense_Mutation	SNP	C	C	G			TCGA-DG-A2KM-01A-11D-A17W-09	TCGA-DG-A2KM-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4b1c779c-a2a3-46f1-bbea-845afa302761	83a1e958-4f39-443b-a1b1-4712d0460aa0	g.chrX:22291649C>G	ENST00000323684.1	+	1	585	c.541C>G	c.(541-543)Cca>Gca	p.P181A		NM_152577.3	NP_689790.1	Q8N7E2	ZN645_HUMAN	zinc finger protein 645	181					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(4)|large_intestine(8)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	27						AAGCTATATTCCACCAGAACA	0.473																																																	0													134.0	109.0	118.0					X																	22291649		2203	4300	6503	SO:0001583	missense	158506			AK098601	CCDS14205.1	Xp22.11	2014-01-21			ENSG00000175809	ENSG00000175809			26371	protein-coding gene	gene with protein product							Standard	NM_152577		Approved	FLJ25735, HAKAIL, CT138	uc004dai.2	Q8N7E2	OTTHUMG00000021242	ENST00000323684.1:c.541C>G	X.37:g.22291649C>G	ENSP00000323348:p.Pro181Ala		A0AV29|A0AV31|E3SBK4|Q6DJY9	Missense_Mutation	SNP	pfscan_Znf_RING,pfscan_Znf_C2H2	p.P181A	ENST00000323684.1	37	c.541	CCDS14205.1	X	.	.	.	.	.	.	.	.	.	.	C	8.718	0.913568	0.17907	.	.	ENSG00000175809	ENST00000323684	T	0.33865	1.39	3.42	1.64	0.23874	.	0.363846	0.22557	U	0.058514	T	0.40196	0.1107	L	0.45137	1.4	0.09310	N	1	D	0.54207	0.965	P	0.58077	0.832	T	0.13098	-1.0522	10	0.41790	T	0.15	.	6.8217	0.23861	0.0:0.7477:0.0:0.2523	.	181	Q8N7E2	ZN645_HUMAN	A	181	ENSP00000323348:P181A	ENSP00000323348:P181A	P	+	1	0	ZNF645	22201570	0.001000	0.12720	0.001000	0.08648	0.006000	0.05464	0.912000	0.28597	0.314000	0.23086	-0.191000	0.12829	CCA	ZNF645	-	NULL		0.473	ZNF645-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF645	HGNC	protein_coding	OTTHUMT00000056037.1	C	NM_152577		22291649	+1	no_errors	ENST00000323684	ensembl	human	known	70_37	missense	SNP	0.000	G
