#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ABCD4	5826	genome.wustl.edu	37	14	74753409	74753409	+	Missense_Mutation	SNP	C	C	G	rs387907315		TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr14:74753409C>G	ENST00000356924.4	-	18	1890	c.1747G>C	c.(1747-1749)Gag>Cag	p.E583Q	AC005519.4_ENST00000554532.2_RNA|ABCD4_ENST00000298816.7_Missense_Mutation_p.E479Q	NM_005050.3	NP_005041.1	O14678	ABCD4_HUMAN	ATP-binding cassette, sub-family D (ALD), member 4	583	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cobalamin metabolic process (GO:0009235)|transmembrane transport (GO:0055085)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			cervix(2)|endometrium(3)|kidney(3)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	27				BRCA - Breast invasive adenocarcinoma(234;0.00153)		GGTACCTTCTCAAGGCTCTGC	0.602																																																	0													72.0	58.0	63.0					14																	74753409		2203	4300	6503	SO:0001583	missense	5826			AF009746	CCDS9828.1	14q24	2012-03-14			ENSG00000119688	ENSG00000119688		"""ATP binding cassette transporters / subfamily D"""	68	protein-coding gene	gene with protein product		603214		PXMP1L		9266848, 9302272	Standard	NR_003256		Approved	PMP69, P70R, EST352188	uc001xpr.2	O14678	OTTHUMG00000171207	ENST00000356924.4:c.1747G>C	14.37:g.74753409C>G	ENSP00000349396:p.Glu583Gln		A8K5L7|Q6IAQ0|Q96E75	Missense_Mutation	SNP	pfam_ABC_Ald_N,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.E583Q	ENST00000356924.4	37	c.1747	CCDS9828.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.78|15.78	2.933511|2.933511	0.52866|0.52866	.|.	.|.	ENSG00000119688|ENSG00000119688	ENST00000356924;ENST00000298816|ENST00000555904	D;D|D	0.92545|0.93426	-2.65;-3.06|-3.22	4.94|4.94	4.94|4.94	0.65067|0.65067	ATPase, AAA+ type, core (1);ABC transporter-like (1);|.	0.175703|.	0.49305|.	D|.	0.000160|.	D|D	0.86665|0.86665	0.5987|0.5987	N|N	0.04959|0.04959	-0.14|-0.14	0.52099|0.52099	D|D	0.999947|0.999947	B;B;B|.	0.11235|.	0.004;0.001;0.001|.	B;B;B|.	0.09377|.	0.004;0.003;0.003|.	D|D	0.84395|0.84395	0.0557|0.0557	10|6	0.21540|.	T|.	0.41|.	.|.	14.0206|14.0206	0.64553|0.64553	0.0:0.8489:0.1511:0.0|0.0:0.8489:0.1511:0.0	.|.	479;583;583|.	F8W7M4;A8K5L7;O14678|.	.;.;ABCD4_HUMAN|.	Q|F	583;479|98	ENSP00000349396:E583Q;ENSP00000298816:E479Q|ENSP00000450982:L98F	ENSP00000298816:E479Q|.	E|L	-|-	1|3	0|2	ABCD4|ABCD4	73823162|73823162	0.998000|0.998000	0.40836|0.40836	0.976000|0.976000	0.42696|0.42696	0.968000|0.968000	0.65278|0.65278	3.717000|3.717000	0.54911|0.54911	2.577000|2.577000	0.86979|0.86979	0.585000|0.585000	0.79938|0.79938	GAG|TTG	ABCD4	-	smart_AAA+_ATPase,pfscan_ABC_transporter-like		0.602	ABCD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCD4	HGNC	protein_coding	OTTHUMT00000314382.1	C	NM_005050		74753409	-1	no_errors	ENST00000356924	ensembl	human	known	70_37	missense	SNP	1.000	G
AFP	174	genome.wustl.edu	37	4	74319612	74319612	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr4:74319612G>C	ENST00000395792.2	+	13	1883	c.1783G>C	c.(1783-1785)Gag>Cag	p.E595Q	AFP_ENST00000506820.1_3'UTR|AFP_ENST00000226359.2_Missense_Mutation_p.E595Q	NM_001134.1	NP_001125.1	P02771	FETA_HUMAN	alpha-fetoprotein	595	Albumin 3. {ECO:0000255|PROSITE- ProRule:PRU00769}.				ovulation from ovarian follicle (GO:0001542)|progesterone metabolic process (GO:0042448)|SMAD protein signal transduction (GO:0060395)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|urinary_tract(1)	22	Breast(15;0.00102)		Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CTTTGCTGAAGAGGTACATGC	0.388									Alpha-Fetoprotein, Hereditary Persistence of																																								0													79.0	74.0	76.0					4																	74319612		2203	4300	6503	SO:0001583	missense	174	Familial Cancer Database	HPAFP	V01514	CCDS3556.1	4q13.3	2012-05-16			ENSG00000081051	ENSG00000081051			317	protein-coding gene	gene with protein product		104150		HPAFP			Standard	NM_001134		Approved	FETA	uc003hgz.1	P02771	OTTHUMG00000130011	ENST00000395792.2:c.1783G>C	4.37:g.74319612G>C	ENSP00000379138:p.Glu595Gln		B2RBU3	Missense_Mutation	SNP	pfam_Serum_albumin_N,superfamily_Serum_albumin-like,smart_Serum_albumin_N,pirsf_Serum_albumin_subgr,prints_Alpha-fetoprotein,prints_Serum_albumin	p.E595Q	ENST00000395792.2	37	c.1783	CCDS3556.1	4	.	.	.	.	.	.	.	.	.	.	G	14.05	2.420044	0.42918	.	.	ENSG00000081051	ENST00000395792;ENST00000226359	T;T	0.60548	0.18;0.18	4.8	4.8	0.61643	Serum albumin, conserved site (1);Serum albumin-like (1);Serum albumin, N-terminal (2);	0.062832	0.64402	D	0.000007	T	0.77994	0.4214	M	0.87180	2.865	0.43942	D	0.996603	D;D	0.89917	0.999;1.0	D;D	0.83275	0.994;0.996	T	0.81870	-0.0734	10	0.87932	D	0	.	13.2126	0.59834	0.0:0.0:1.0:0.0	.	437;595	B4DMX4;P02771	.;FETA_HUMAN	Q	595	ENSP00000379138:E595Q;ENSP00000226359:E595Q	ENSP00000226359:E595Q	E	+	1	0	AFP	74538476	1.000000	0.71417	0.956000	0.39512	0.096000	0.18686	5.250000	0.65432	2.485000	0.83878	0.561000	0.74099	GAG	AFP	-	superfamily_Serum_albumin-like,smart_Serum_albumin_N,pirsf_Serum_albumin_subgr,prints_Alpha-fetoprotein		0.388	AFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFP	HGNC	protein_coding	OTTHUMT00000252284.3	G			74319612	+1	no_errors	ENST00000395792	ensembl	human	known	70_37	missense	SNP	0.973	C
AGBL3	340351	genome.wustl.edu	37	7	134800335	134800335	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr7:134800335C>T	ENST00000436302.2	+	16	2567	c.2314C>T	c.(2314-2316)Cca>Tca	p.P772S	C7orf49_ENST00000459937.1_Intron|AGBL3_ENST00000458078.1_Missense_Mutation_p.P827S|AGBL3_ENST00000435976.2_Intron	NM_178563.3	NP_848658.3	Q8NEM8	CBPC3_HUMAN	ATP/GTP binding protein-like 3	853						cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|lung(2)|skin(3)	10						GCTATTCAATCCAAGAACCAA	0.318																																																	0													103.0	84.0	90.0					7																	134800335		692	1591	2283	SO:0001583	missense	340351			BC030651	CCDS47718.1	7q33	2014-06-23			ENSG00000146856	ENSG00000146856			27981	protein-coding gene	gene with protein product							Standard	NM_178563		Approved	MGC32955, CCP3	uc011kpw.2	Q8NEM8	OTTHUMG00000155406	ENST00000436302.2:c.2314C>T	7.37:g.134800335C>T	ENSP00000388275:p.Pro772Ser		B7Z827|Q9H965	Missense_Mutation	SNP	pfam_Peptidase_M14	p.P827S	ENST00000436302.2	37	c.2479	CCDS47718.1	7	.	.	.	.	.	.	.	.	.	.	C	11.09	1.536975	0.27475	.	.	ENSG00000146856	ENST00000436302;ENST00000458078	T;T	0.29142	2.58;1.58	4.99	1.16	0.20824	.	.	.	.	.	T	0.19886	0.0478	L	0.39898	1.24	0.09310	N	1	B	0.20261	0.043	B	0.17098	0.017	T	0.26710	-1.0095	9	0.30078	T	0.28	-1.767	2.1999	0.03920	0.1577:0.5201:0.1525:0.1697	.	772	Q8NEM8-4	.	S	772;827	ENSP00000388275:P772S;ENSP00000395969:P827S	ENSP00000388275:P772S	P	+	1	0	AGBL3	134450875	0.001000	0.12720	0.001000	0.08648	0.064000	0.16182	-0.094000	0.11094	0.106000	0.17784	-1.149000	0.01842	CCA	AGBL3	-	NULL		0.318	AGBL3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	AGBL3	HGNC	protein_coding	OTTHUMT00000376655.1	C	NM_178563		134800335	+1	no_errors	ENST00000458078	ensembl	human	known	70_37	missense	SNP	0.001	T
AGPS	8540	genome.wustl.edu	37	2	178362425	178362425	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr2:178362425C>G	ENST00000264167.4	+	13	1440	c.1294C>G	c.(1294-1296)Ctt>Gtt	p.L432V	AGPS_ENST00000409888.1_Intron	NM_003659.3	NP_003650.1	O00116	ADAS_HUMAN	alkylglycerone phosphate synthase	432					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|lipid biosynthetic process (GO:0008610)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	alkylglycerone-phosphate synthase activity (GO:0008609)|FAD binding (GO:0071949)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0018)|Epithelial(96;0.00919)|all cancers(119;0.0358)			AGGTCATGCTCTTAAACCTCA	0.269																																																	0													48.0	49.0	48.0					2																	178362425		2195	4284	6479	SO:0001583	missense	8540			Y09443	CCDS2275.1	2q	2008-02-05			ENSG00000018510	ENSG00000018510	2.5.1.26		327	protein-coding gene	gene with protein product		603051				9187299, 9553082	Standard	NM_003659		Approved	ADHAPS, ADAS, ALDHPSY, ADPS, ADAP-S	uc002ull.2	O00116	OTTHUMG00000132530	ENST00000264167.4:c.1294C>G	2.37:g.178362425C>G	ENSP00000264167:p.Leu432Val		A5D8U9|Q2TU35	Missense_Mutation	SNP	pfam_FAD-linked_oxidase_C,pfam_Oxid_FAD_bind_N,superfamily_FAD-bd_2,superfamily_FAD-linked_Oxase-like_C	p.L432V	ENST00000264167.4	37	c.1294	CCDS2275.1	2	.	.	.	.	.	.	.	.	.	.	C	22.3	4.276907	0.80580	.	.	ENSG00000018510	ENST00000264167;ENST00000536686	D	0.88664	-2.41	5.12	5.12	0.69794	FAD-linked oxidase-like, C-terminal (1);FAD-linked oxidase, C-terminal (1);	0.124326	0.56097	D	0.000027	D	0.94417	0.8204	M	0.89414	3.03	0.80722	D	1	P	0.50369	0.934	P	0.56216	0.794	D	0.95236	0.8347	10	0.66056	D	0.02	.	18.5216	0.90954	0.0:1.0:0.0:0.0	.	432	O00116	ADAS_HUMAN	V	432;302	ENSP00000264167:L432V	ENSP00000264167:L432V	L	+	1	0	AGPS	178070671	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.249000	0.65427	2.389000	0.81357	0.484000	0.47621	CTT	AGPS	-	pfam_FAD-linked_oxidase_C,superfamily_FAD-linked_Oxase-like_C		0.269	AGPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGPS	HGNC	protein_coding	OTTHUMT00000255730.2	C			178362425	+1	no_errors	ENST00000264167	ensembl	human	known	70_37	missense	SNP	1.000	G
AGTPBP1	23287	genome.wustl.edu	37	9	88272466	88272466	+	Missense_Mutation	SNP	T	T	C			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr9:88272466T>C	ENST00000357081.3	-	10	937	c.793A>G	c.(793-795)Aac>Gac	p.N265D	AGTPBP1_ENST00000337006.4_3'UTR|AGTPBP1_ENST00000491784.1_5'UTR|AGTPBP1_ENST00000376083.3_Missense_Mutation_p.N265D|AGTPBP1_ENST00000376080.1_3'UTR|AGTPBP1_ENST00000376109.3_Missense_Mutation_p.N317D|AGTPBP1_ENST00000376081.4_Intron|AGTPBP1_ENST00000432218.1_Missense_Mutation_p.N103D			Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	265					adult walking behavior (GO:0007628)|C-terminal protein deglutamylation (GO:0035609)|cerebellar Purkinje cell differentiation (GO:0021702)|eye photoreceptor cell differentiation (GO:0001754)|mitochondrion organization (GO:0007005)|neuromuscular process (GO:0050905)|neurotransmitter metabolic process (GO:0042133)|olfactory bulb development (GO:0021772)|protein side chain deglutamylation (GO:0035610)|retina development in camera-type eye (GO:0060041)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(12)|ovary(5)|skin(2)|urinary_tract(3)	44						ATGAGCATGTTTCTATGCCGG	0.368																																																	0													97.0	84.0	89.0					9																	88272466		2203	4300	6503	SO:0001583	missense	23287			AB028958	CCDS6672.1, CCDS75854.1	9q21.33	2014-06-23			ENSG00000135049	ENSG00000135049			17258	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 1"", ""tubulinyl-Tyr carboxypeptidase"", ""carboxypeptidase-tubulin"", ""tyrosine carboxypeptidase"", ""soluble carboxypeptidase"""	606830				11083920	Standard	NM_015239		Approved	KIAA1035, Nna1, CCP1	uc010mqc.3	Q9UPW5	OTTHUMG00000020124	ENST00000357081.3:c.793A>G	9.37:g.88272466T>C	ENSP00000349592:p.Asn265Asp		B4DIT6|B4DRZ8|Q5VV80|Q63HM7|Q658P5|Q6P9D6|Q9H8U6|Q9H9W8|Q9NVK1	Missense_Mutation	SNP	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.N317D	ENST00000357081.3	37	c.949		9	.	.	.	.	.	.	.	.	.	.	T	16.01	3.000531	0.54254	.	.	ENSG00000135049	ENST00000357081;ENST00000376083;ENST00000376109;ENST00000432218	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	5.55	5.55	0.83447	Armadillo-like helical (1);Armadillo-type fold (1);	0.090754	0.85682	D	0.000000	T	0.28433	0.0703	L	0.44542	1.39	0.80722	D	1	P;P;P;P	0.48503	0.763;0.704;0.911;0.692	B;B;P;B	0.44990	0.288;0.15;0.466;0.366	T	0.08700	-1.0709	10	0.72032	D	0.01	-21.7119	6.7503	0.23483	0.1436:0.0:0.2511:0.6054	.	317;265;103;265	Q9UPW5-3;Q9UPW5;B4DHX2;Q9UPW5-2	.;CBPC1_HUMAN;.;.	D	265;265;317;103	ENSP00000349592:N265D;ENSP00000365251:N265D;ENSP00000365277:N317D;ENSP00000402804:N103D	ENSP00000349592:N265D	N	-	1	0	AGTPBP1	87462286	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.639000	0.61361	2.101000	0.63845	0.528000	0.53228	AAC	AGTPBP1	-	superfamily_ARM-type_fold		0.368	AGTPBP1-004	KNOWN	basic	protein_coding	AGTPBP1	HGNC	protein_coding	OTTHUMT00000052893.1	T	NM_015239		88272466	-1	no_errors	ENST00000376109	ensembl	human	known	70_37	missense	SNP	1.000	C
AKAP11	11215	genome.wustl.edu	37	13	42891750	42891750	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr13:42891750C>T	ENST00000025301.2	+	12	5666	c.5491C>T	c.(5491-5493)Cag>Tag	p.Q1831*		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	1831					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		GATTATTCTTCAGTGGCTCAT	0.413																																																	0													118.0	103.0	108.0					13																	42891750		2203	4300	6503	SO:0001587	stop_gained	11215			AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.5491C>T	13.37:g.42891750C>T	ENSP00000025301:p.Gln1831*		O75124|Q9NUK7	Nonsense_Mutation	SNP	NULL	p.Q1831*	ENST00000025301.2	37	c.5491	CCDS9383.1	13	.	.	.	.	.	.	.	.	.	.	C	46	12.902641	0.99705	.	.	ENSG00000023516	ENST00000025301	.	.	.	5.79	5.79	0.91817	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.0424	0.97595	0.0:1.0:0.0:0.0	.	.	.	.	X	1831	.	ENSP00000025301:Q1831X	Q	+	1	0	AKAP11	41789750	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.149000	0.71795	2.725000	0.93324	0.557000	0.71058	CAG	AKAP11	-	NULL		0.413	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP11	HGNC	protein_coding	OTTHUMT00000044700.2	C	NM_016248		42891750	+1	no_errors	ENST00000025301	ensembl	human	known	70_37	nonsense	SNP	1.000	T
CARF	79800	genome.wustl.edu	37	2	203807466	203807466	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr2:203807466C>G	ENST00000402905.3	+	4	403	c.82C>G	c.(82-84)Cta>Gta	p.L28V	CARF_ENST00000545253.1_Intron|WDR12_ENST00000477723.1_Intron|CARF_ENST00000456821.2_Missense_Mutation_p.L16V|CARF_ENST00000444724.1_Missense_Mutation_p.L28V|CARF_ENST00000545262.1_Intron|CARF_ENST00000434998.1_Intron|CARF_ENST00000438828.2_Missense_Mutation_p.L28V|CARF_ENST00000471271.1_3'UTR|CARF_ENST00000414439.1_Intron|CARF_ENST00000428585.1_Intron|CARF_ENST00000320443.8_Missense_Mutation_p.L28V	NM_001104586.1|NM_001282910.1|NM_001282911.1|NM_001282912.1	NP_001098056.1|NP_001269839.1|NP_001269840.1|NP_001269841.1	Q8N187	CARTF_HUMAN	calcium responsive transcription factor	28					cellular response to calcium ion (GO:0071277)|cellular response to potassium ion (GO:0035865)|positive regulation of transcription from RNA polymerase II promoter in response to calcium ion (GO:0061400)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)										ACAAAAGCATCTAATCTGTAT	0.318																																																	0													48.0	44.0	45.0					2																	203807466		1827	4081	5908	SO:0001583	missense	79800			AB053309	CCDS42801.1, CCDS63091.1	2q33.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000138380	ENSG00000138380			14435	protein-coding gene	gene with protein product	"""calcium-response factor"""	607586	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8"""	ALS2CR8		11586298, 11832226	Standard	XM_005246858		Approved	FLJ21579, CaRF, NYD-SP24	uc002uzo.2	Q8N187	OTTHUMG00000154528	ENST00000402905.3:c.82C>G	2.37:g.203807466C>G	ENSP00000384006:p.Leu28Val		B4E1W7|G3V1K7|Q8ND29|Q8WXC0|Q96J78|Q96Q38|Q96Q39|Q9H712	Missense_Mutation	SNP	NULL	p.L28V	ENST00000402905.3	37	c.82	CCDS42801.1	2	.	.	.	.	.	.	.	.	.	.	C	11.26	1.585356	0.28268	.	.	ENSG00000138380	ENST00000402905;ENST00000414490;ENST00000444724;ENST00000414857;ENST00000441569;ENST00000432024;ENST00000443740;ENST00000456821;ENST00000320443;ENST00000438828	.	.	.	5.64	3.84	0.44239	.	0.268793	0.26217	N	0.025657	T	0.25644	0.0624	L	0.52364	1.645	0.21105	N	0.999787	P;B;B	0.35872	0.525;0.027;0.275	B;B;B	0.30495	0.116;0.025;0.116	T	0.15321	-1.0441	9	0.34782	T	0.22	-3.0263	5.2554	0.15544	0.0:0.6533:0.1698:0.1768	.	28;28;28	B4DRP6;Q8N187;F6SXV3	.;AL2S8_HUMAN;.	V	28;28;28;28;28;28;28;16;28;28	.	ENSP00000316224:L28V	L	+	1	2	ALS2CR8	203515711	0.035000	0.19736	0.981000	0.43875	0.896000	0.52359	0.031000	0.13710	1.386000	0.46466	0.563000	0.77884	CTA	ALS2CR8	-	NULL		0.318	CARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALS2CR8	HGNC	protein_coding	OTTHUMT00000335768.5	C	NM_001104586		203807466	+1	no_errors	ENST00000320443	ensembl	human	known	70_37	missense	SNP	0.894	G
AP1S2	8905	genome.wustl.edu	37	X	15849592	15849592	+	Intron	SNP	C	C	G			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chrX:15849592C>G	ENST00000329235.2	-	5	670				AP1S2_ENST00000479184.1_5'UTR|AP1S2_ENST00000380291.1_3'UTR|AP1S2_ENST00000545766.1_3'UTR	NM_001272071.1|NM_003916.3	NP_001259000.1|NP_003907.3	P56377	AP1S2_HUMAN	adaptor-related protein complex 1, sigma 2 subunit						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	AP-type membrane coat adaptor complex (GO:0030119)|coated pit (GO:0005905)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)	protein transporter activity (GO:0008565)			large_intestine(1)	1	Hepatocellular(33;0.183)					AGGATATTTTCTTTCATATGT	0.313																																																	0																																										SO:0001627	intron_variant	8905			AB015320	CCDS14173.1, CCDS75958.1	Xp22	2014-01-31			ENSG00000182287	ENSG00000182287			560	protein-coding gene	gene with protein product		300629	"""mental retardation, X-linked 59"", ""mental retardation, X-linked, syndromic 5"", ""Pettigrew X-linked mental retardation syndrome"""	MRX59, MRXS5, PGS		9733768, 17186471, 23756445	Standard	NM_003916		Approved	SIGMA1B	uc010nex.4	P56377	OTTHUMG00000021186	ENST00000329235.2:c.427-4097G>C	X.37:g.15849592C>G			B4DSU4|O95326|Q9H2N6	RNA	SNP	-	NULL	ENST00000329235.2	37	NULL	CCDS14173.1	X																																																																																			AP1S2	-	-		0.313	AP1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP1S2	HGNC	protein_coding	OTTHUMT00000055893.1	C	NM_003916		15849592	-1	no_errors	ENST00000479184	ensembl	human	known	70_37	rna	SNP	1.000	G
ARFGAP1	55738	genome.wustl.edu	37	20	61919221	61919221	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr20:61919221G>C	ENST00000370283.4	+	13	1357	c.1217G>C	c.(1216-1218)tGg>tCg	p.W406S	ARFGAP1_ENST00000519604.1_Missense_Mutation_p.W361S|ARFGAP1_ENST00000519273.2_Missense_Mutation_p.W293S|ARFGAP1_ENST00000370275.4_3'UTR|ARFGAP1_ENST00000518794.2_3'UTR|ARFGAP1_ENST00000547204.1_Missense_Mutation_p.W340S|MIR4326_ENST00000582203.1_RNA|ARFGAP1_ENST00000353546.3_Missense_Mutation_p.W414S	NM_018209.2	NP_060679.1	Q8N6T3	ARFG1_HUMAN	ADP-ribosylation factor GTPase activating protein 1	406					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|COPI coating of Golgi vesicle (GO:0048205)|endoplasmic reticulum unfolded protein response (GO:0030968)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cytosol (GO:0005829)|Golgi-associated vesicle membrane (GO:0030660)|synapse (GO:0045202)	ARF GTPase activator activity (GO:0008060)|GTPase activator activity (GO:0005096)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|pancreas(1)	13	all_cancers(38;1.59e-09)					AACCAGAACTGGTAGGGCCCA	0.657																																																	0													6.0	6.0	6.0					20																	61919221		2111	4188	6299	SO:0001583	missense	55738			AK001629	CCDS13515.1, CCDS13516.1, CCDS63326.1, CCDS63327.1, CCDS63328.1	20q13.33	2009-11-30	2002-08-20	2002-08-23	ENSG00000101199	ENSG00000101199		"""ADP-ribosylation factor GTPase activating proteins"""	15852	protein-coding gene	gene with protein product		608377	"""ADP-ribosylation factor 1 GTPase activating protein"""	ARF1GAP		11210549	Standard	NM_018209		Approved	FLJ10767, bA261N11.3	uc002yel.3	Q8N6T3	OTTHUMG00000032965	ENST00000370283.4:c.1217G>C	20.37:g.61919221G>C	ENSP00000359306:p.Trp406Ser		B7Z3U0|B7Z8H8|B7ZBI3|E1P5I9|E7EV62|Q6PK71|Q96KC4|Q96T02|Q9NSU3|Q9NVF6|Q9UIL0	Missense_Mutation	SNP	pfam_ArfGAP,smart_ArfGAP,pfscan_ArfGAP,prints_ArfGAP	p.W414S	ENST00000370283.4	37	c.1241	CCDS13515.1	20	.	.	.	.	.	.	.	.	.	.	G	22.1	4.243697	0.79912	.	.	ENSG00000101199	ENST00000370283;ENST00000547204;ENST00000519604;ENST00000519273;ENST00000353546	T;T;T;T;T	0.69926	0.49;-0.2;-0.05;-0.44;0.61	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.75657	0.3879	L	0.36672	1.1	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;1.0;1.0	D;D;D;D	0.91635	0.991;0.998;0.998;0.999	T	0.79042	-0.1965	10	0.87932	D	0	.	17.657	0.88180	0.0:0.0:1.0:0.0	.	293;361;406;414	B7Z8H8;E7EV62;Q8N6T3;Q8N6T3-2	.;.;ARFG1_HUMAN;.	S	406;340;361;293;414	ENSP00000359306:W406S;ENSP00000449800:W340S;ENSP00000430500:W361S;ENSP00000443716:W293S;ENSP00000314615:W414S	ENSP00000314615:W414S	W	+	2	0	ARFGAP1	61389666	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	7.549000	0.82163	2.329000	0.79093	0.448000	0.29417	TGG	ARFGAP1	-	NULL		0.657	ARFGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGAP1	HGNC	protein_coding	OTTHUMT00000080134.3	G	NM_018209		61919221	+1	no_errors	ENST00000353546	ensembl	human	known	70_37	missense	SNP	1.000	C
ARRDC3	57561	genome.wustl.edu	37	5	90670952	90670952	+	Silent	SNP	G	G	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr5:90670952G>T	ENST00000265138.3	-	5	923	c.657C>A	c.(655-657)tcC>tcA	p.S219S	ARRDC3_ENST00000503192.1_5'Flank	NM_020801.2	NP_065852.1	Q96B67	ARRD3_HUMAN	arrestin domain containing 3	219					fat pad development (GO:0060613)|negative regulation of heat generation (GO:0031651)|negative regulation of locomotion involved in locomotory behavior (GO:0090327)|negative regulation of multicellular organismal metabolic process (GO:0044252)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|skin development (GO:0043588)|temperature homeostasis (GO:0001659)	endosome (GO:0005768)|plasma membrane (GO:0005886)	beta-3 adrenergic receptor binding (GO:0031699)			breast(2)|endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	18		all_cancers(142;2.22e-05)|all_epithelial(76;1.58e-07)|all_lung(232;0.000521)|Lung NSC(167;0.000548)|Ovarian(174;0.0798)|Colorectal(57;0.207)		OV - Ovarian serous cystadenocarcinoma(54;4.56e-30)|Epithelial(54;7.55e-26)|all cancers(79;3.63e-22)		CCACCATTCGGGAAGAGCAGT	0.408																																																	0													68.0	61.0	64.0					5																	90670952		2203	4300	6503	SO:0001819	synonymous_variant	57561			AB037797	CCDS34202.1	5q14.3	2013-10-11			ENSG00000113369	ENSG00000113369			29263	protein-coding gene	gene with protein product	"""alpha-arrestin 3"""	612464				10718198, 19605364	Standard	NM_020801		Approved	KIAA1376	uc003kjz.2	Q96B67	OTTHUMG00000162616	ENST00000265138.3:c.657C>A	5.37:g.90670952G>T			A8K6T8|Q9P2H1	Silent	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set	p.S219	ENST00000265138.3	37	c.657	CCDS34202.1	5																																																																																			ARRDC3	-	pfam_Arrestin_C-like,superfamily_Ig_E-set		0.408	ARRDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARRDC3	HGNC	protein_coding	OTTHUMT00000369763.2	G	NM_020801		90670952	-1	no_errors	ENST00000265138	ensembl	human	known	70_37	silent	SNP	1.000	T
ATN1	1822	genome.wustl.edu	37	12	7047952	7047952	+	Silent	SNP	C	C	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr12:7047952C>A	ENST00000356654.4	+	7	3063	c.2826C>A	c.(2824-2826)ctC>ctA	p.L942L	ATN1_ENST00000396684.2_Silent_p.L942L	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	942					cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						AACGAGACCTCCGTGACCGCC	0.652																																																	0													52.0	61.0	58.0					12																	7047952		2203	4300	6503	SO:0001819	synonymous_variant	1822			U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.2826C>A	12.37:g.7047952C>A			Q99495|Q99621|Q9UEK7	Silent	SNP	pfam_Atrophin-like,prints_Atrophin-1	p.L942	ENST00000356654.4	37	c.2826	CCDS31734.1	12																																																																																			ATN1	-	pfam_Atrophin-like		0.652	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATN1	HGNC	protein_coding	OTTHUMT00000401948.2	C	NM_001940		7047952	+1	no_errors	ENST00000356654	ensembl	human	known	70_37	silent	SNP	0.974	A
ATP13A1	57130	genome.wustl.edu	37	19	19756497	19756497	+	Missense_Mutation	SNP	C	C	T	rs563912098		TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr19:19756497C>T	ENST00000357324.6	-	25	3489	c.3463G>A	c.(3463-3465)Gac>Aac	p.D1155N	GMIP_ENST00000587238.1_5'Flank|GMIP_ENST00000203556.4_5'Flank|GMIP_ENST00000445806.2_5'Flank|ATP13A1_ENST00000291503.5_Missense_Mutation_p.D1037N	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	1155						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						CTGTTGAAGTCGGGCGAGGAG	0.632													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16137	0.0		0.0	False		,,,				2504	0.0				Esophageal Squamous(142;920 1789 9047 14684 24777)												0													28.0	26.0	26.0					19																	19756497		2192	4288	6480	SO:0001583	missense	57130			AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.3463G>A	19.37:g.19756497C>T	ENSP00000349877:p.Asp1155Asn		B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_unknown-pump-sp,tigrfam_ATPase_P-typ_ion-transptr	p.D1155N	ENST00000357324.6	37	c.3463	CCDS32970.2	19	.	.	.	.	.	.	.	.	.	.	C	22.2	4.259666	0.80246	.	.	ENSG00000105726	ENST00000291503;ENST00000357324	T;T	0.54675	0.56;0.56	5.49	5.49	0.81192	.	0.092996	0.64402	D	0.000001	T	0.45856	0.1363	L	0.55990	1.75	0.53005	D	0.999969	P;B	0.36222	0.544;0.33	B;B	0.27796	0.038;0.083	T	0.41538	-0.9503	10	0.26408	T	0.33	-21.1338	16.8584	0.86011	0.0:1.0:0.0:0.0	.	1155;1037	Q9HD20;Q9HD20-2	AT131_HUMAN;.	N	1037;1155	ENSP00000291503:D1037N;ENSP00000349877:D1155N	ENSP00000291503:D1037N	D	-	1	0	ATP13A1	19617497	1.000000	0.71417	0.963000	0.40424	0.927000	0.56198	7.354000	0.79424	2.582000	0.87167	0.561000	0.74099	GAC	ATP13A1	-	tigrfam_ATPase_P-typ_unknown-pump-sp		0.632	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A1	HGNC	protein_coding	OTTHUMT00000329005.1	C	NM_020410		19756497	-1	no_errors	ENST00000357324	ensembl	human	known	70_37	missense	SNP	1.000	T
ATRX	546	genome.wustl.edu	37	X	76874309	76874309	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chrX:76874309G>T	ENST00000373344.5	-	21	5627	c.5413C>A	c.(5413-5415)Cac>Aac	p.H1805N	ATRX_ENST00000395603.3_Missense_Mutation_p.H1767N|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1805					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TAGAGAATGTGAGCACGTTTT	0.318			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)											125.0	110.0	115.0					X																	76874309		2203	4295	6498	SO:0001583	missense	546			U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.5413C>A	X.37:g.76874309G>T	ENSP00000362441:p.His1805Asn		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.H1805N	ENST00000373344.5	37	c.5413	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	G	23.2	4.384919	0.82792	.	.	ENSG00000085224	ENST00000373344;ENST00000395603	D;D	0.92299	-3.01;-3.01	5.41	5.41	0.78517	SNF2-related (1);	0.000000	0.85682	U	0.000000	D	0.95943	0.8679	M	0.76170	2.325	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.87578	0.986;0.998	D	0.96345	0.9254	10	0.72032	D	0.01	-5.7347	18.2042	0.89848	0.0:0.0:1.0:0.0	.	1767;1805	P46100-4;P46100	.;ATRX_HUMAN	N	1805;1767	ENSP00000362441:H1805N;ENSP00000378967:H1767N	ENSP00000362441:H1805N	H	-	1	0	ATRX	76760965	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.436000	0.97532	2.237000	0.73441	0.544000	0.68410	CAC	ATRX	-	pfam_SNF2_N		0.318	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	G	NM_000489		76874309	-1	no_errors	ENST00000373344	ensembl	human	known	70_37	missense	SNP	1.000	T
BAHD1	22893	genome.wustl.edu	37	15	40750915	40750915	+	Silent	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr15:40750915G>A	ENST00000416165.1	+	2	323	c.252G>A	c.(250-252)cgG>cgA	p.R84R	BAHD1_ENST00000560846.1_Silent_p.R84R|BAHD1_ENST00000561234.1_Silent_p.R84R	NM_014952.3	NP_055767.3	Q8TBE0	BAHD1_HUMAN	bromo adjacent homology domain containing 1	84					heterochromatin assembly (GO:0031507)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|chromosome (GO:0005694)	chromatin binding (GO:0003682)			NS(1)|endometrium(6)|kidney(3)|large_intestine(3)|lung(10)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	28		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.46e-06)|BRCA - Breast invasive adenocarcinoma(123;0.08)		CCGGTCCCCGGAGTGCAGATG	0.647																																																	0													41.0	44.0	43.0					15																	40750915		2203	4300	6503	SO:0001819	synonymous_variant	22893			AL833923	CCDS10058.1, CCDS73705.1	15q14	2005-11-10			ENSG00000140320	ENSG00000140320			29153	protein-coding gene	gene with protein product		613880				10231032	Standard	XM_005254229		Approved	KIAA0945	uc001zlu.2	Q8TBE0	OTTHUMG00000129982	ENST00000416165.1:c.252G>A	15.37:g.40750915G>A			Q8NDF7|Q9Y2F4	Silent	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.R84	ENST00000416165.1	37	c.252	CCDS10058.1	15																																																																																			BAHD1	-	NULL		0.647	BAHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BAHD1	HGNC	protein_coding	OTTHUMT00000252248.1	G	NM_014952		40750915	+1	no_errors	ENST00000416165	ensembl	human	known	70_37	silent	SNP	0.699	A
BTBD7	55727	genome.wustl.edu	37	14	93709190	93709190	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr14:93709190G>A	ENST00000334746.5	-	11	3135	c.2828C>T	c.(2827-2829)cCg>cTg	p.P943L	BTBD7_ENST00000393170.2_Missense_Mutation_p.P517L|BTBD7_ENST00000554565.1_Missense_Mutation_p.P592L	NM_001002860.2	NP_001002860.2	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7	943					multicellular organismal development (GO:0007275)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(8)|upper_aerodigestive_tract(1)	35		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		ATAGAAATCCGGATATTCCTG	0.468																																																	0													188.0	179.0	182.0					14																	93709190		2203	4300	6503	SO:0001583	missense	55727			AB040958	CCDS32146.1, CCDS32147.1, CCDS73684.1	14q32.13	2013-01-08			ENSG00000011114	ENSG00000011114		"""BTB/POZ domain containing"""	18269	protein-coding gene	gene with protein product		610386				10819331, 11527404	Standard	NM_001289133		Approved	FLJ10648, FUP1	uc001ybo.3	Q9P203	OTTHUMG00000171269	ENST00000334746.5:c.2828C>T	14.37:g.93709190G>A	ENSP00000335615:p.Pro943Leu		A8K5V7|Q69Z05|Q7Z308|Q86TS0|Q9HAA4|Q9NVM0	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.P943L	ENST00000334746.5	37	c.2828	CCDS32146.1	14	.	.	.	.	.	.	.	.	.	.	G	23.2	4.381664	0.82792	.	.	ENSG00000011114	ENST00000334746;ENST00000554565;ENST00000553975;ENST00000393170	T;T	0.52526	0.99;0.66	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.60209	0.2251	L	0.27053	0.805	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	T	0.62506	-0.6840	10	0.87932	D	0	.	20.27	0.98469	0.0:0.0:1.0:0.0	.	517;592;943	E7ERI4;Q9P203-5;Q9P203	.;.;BTBD7_HUMAN	L	943;592;558;517	ENSP00000335615:P943L;ENSP00000451010:P592L	ENSP00000335615:P943L	P	-	2	0	BTBD7	92778943	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	7.017000	0.76399	2.804000	0.96469	0.655000	0.94253	CCG	BTBD7	-	NULL		0.468	BTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD7	HGNC	protein_coding	OTTHUMT00000412701.1	G	NM_001002860		93709190	-1	no_errors	ENST00000334746	ensembl	human	known	70_37	missense	SNP	1.000	A
C12orf40	283461	genome.wustl.edu	37	12	40114701	40114701	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr12:40114701C>T	ENST00000324616.5	+	13	1761	c.1607C>T	c.(1606-1608)tCa>tTa	p.S536L		NM_001031748.2	NP_001026918.2	Q86WS4	CL040_HUMAN	chromosome 12 open reading frame 40	536										breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(6)|prostate(1)|skin(2)	38						GCAAAACTTTCAGGTGACAGG	0.318																																																	0													75.0	76.0	76.0					12																	40114701		1819	4069	5888	SO:0001583	missense	283461			AK097445	CCDS41770.1	12q12	2008-08-04			ENSG00000180116	ENSG00000180116			26846	protein-coding gene	gene with protein product						12477932	Standard	XM_005268806		Approved	FLJ40126	uc001rmc.3	Q86WS4	OTTHUMG00000133567	ENST00000324616.5:c.1607C>T	12.37:g.40114701C>T	ENSP00000317671:p.Ser536Leu		B7WNU1|Q8IXY6|Q8N818|V9HW02	Missense_Mutation	SNP	NULL	p.S536L	ENST00000324616.5	37	c.1607	CCDS41770.1	12	.	.	.	.	.	.	.	.	.	.	C	3.709	-0.059967	0.07317	.	.	ENSG00000180116	ENST00000324616	T	0.44881	0.91	4.75	2.44	0.29823	.	0.819063	0.10506	N	0.666728	T	0.23649	0.0572	N	0.14661	0.345	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.23084	-1.0198	10	0.25751	T	0.34	.	6.5824	0.22602	0.0:0.7107:0.0:0.2893	.	536	Q86WS4	CL040_HUMAN	L	536	ENSP00000317671:S536L	ENSP00000317671:S536L	S	+	2	0	C12orf40	38400968	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	0.779000	0.26746	0.444000	0.26612	0.585000	0.79938	TCA	C12orf40	-	NULL		0.318	C12orf40-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf40	HGNC	protein_coding	OTTHUMT00000257664.2	C	NM_173599		40114701	+1	no_errors	ENST00000324616	ensembl	human	known	70_37	missense	SNP	0.001	T
TMEM260	54916	genome.wustl.edu	37	14	57088329	57088329	+	Missense_Mutation	SNP	T	T	C			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr14:57088329T>C	ENST00000261556.6	+	11	1429	c.1307T>C	c.(1306-1308)aTc>aCc	p.I436T	TMEM260_ENST00000538838.1_Intron|TMEM260_ENST00000536419.1_Intron	NM_017799.3	NP_060269.3	Q9NX78	TM260_HUMAN	transmembrane protein 260	436						integral component of membrane (GO:0016021)											GATGCAATTATCTTACTCAGA	0.398																																																	0													136.0	122.0	126.0					14																	57088329		2203	4300	6503	SO:0001583	missense	54916			AK000399	CCDS9727.2	14q22.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000070269	ENSG00000070269			20185	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 101"""	C14orf101			Standard	XR_245695		Approved	FLJ20392	uc001xcm.3	Q9NX78	OTTHUMG00000152337	ENST00000261556.6:c.1307T>C	14.37:g.57088329T>C	ENSP00000261556:p.Ile436Thr		A8KAN4|B3KPF5|Q86XE1	Missense_Mutation	SNP	pfam_DUF2723	p.I436T	ENST00000261556.6	37	c.1307	CCDS9727.2	14	.	.	.	.	.	.	.	.	.	.	T	15.35	2.806911	0.50421	.	.	ENSG00000070269	ENST00000261556	T	0.36340	1.26	5.23	5.23	0.72850	.	0.160399	0.53938	D	0.000049	T	0.37100	0.0991	L	0.56769	1.78	0.80722	D	1	P	0.36282	0.546	B	0.34180	0.177	T	0.37103	-0.9720	10	0.87932	D	0	-13.1643	15.1113	0.72359	0.0:0.0:0.0:1.0	.	436	Q9NX78	CN101_HUMAN	T	436	ENSP00000261556:I436T	ENSP00000261556:I436T	I	+	2	0	C14orf101	56158082	1.000000	0.71417	1.000000	0.80357	0.653000	0.38743	7.264000	0.78432	1.976000	0.57569	0.533000	0.62120	ATC	C14orf101	-	NULL		0.398	TMEM260-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf101	HGNC	protein_coding	OTTHUMT00000276924.1	T	NM_017799		57088329	+1	no_errors	ENST00000261556	ensembl	human	known	70_37	missense	SNP	1.000	C
C1orf94	84970	genome.wustl.edu	37	1	34667794	34667794	+	Silent	SNP	C	C	G			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr1:34667794C>G	ENST00000488417.1	+	4	1500	c.1380C>G	c.(1378-1380)ctC>ctG	p.L460L	C1orf94_ENST00000373374.3_Silent_p.L270L	NM_001134734.1	NP_001128206.1	Q6P1W5	CA094_HUMAN	chromosome 1 open reading frame 94	460										central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(15)|skin(4)|upper_aerodigestive_tract(2)	32		Myeloproliferative disorder(586;0.0393)				ACCAGCCACTCTGGCTCAACC	0.522																																																	0													181.0	152.0	162.0					1																	34667794		2203	4300	6503	SO:0001819	synonymous_variant	84970			AK123355	CCDS381.1, CCDS44108.1	1p34.3	2012-06-26			ENSG00000142698	ENSG00000142698			28250	protein-coding gene	gene with protein product						12477932	Standard	NM_001134734		Approved	MGC15882	uc001bxt.3	Q6P1W5	OTTHUMG00000004012	ENST00000488417.1:c.1380C>G	1.37:g.34667794C>G			B3KVT1|D3DPR3|E9PJ76|Q96IC8	Silent	SNP	NULL	p.L460	ENST00000488417.1	37	c.1380	CCDS44108.1	1																																																																																			C1orf94	-	NULL		0.522	C1orf94-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf94	HGNC	protein_coding	OTTHUMT00000036845.2	C	NM_032884		34667794	+1	no_errors	ENST00000488417	ensembl	human	known	70_37	silent	SNP	0.986	G
C21orf58	54058	genome.wustl.edu	37	21	47735421	47735421	+	Silent	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr21:47735421C>T	ENST00000291691.7	-	4	1547	c.411G>A	c.(409-411)ctG>ctA	p.L137L	C21orf58_ENST00000397683.1_5'UTR|C21orf58_ENST00000397685.4_Silent_p.L54L|C21orf58_ENST00000397679.1_5'UTR|C21orf58_ENST00000397680.1_5'UTR|C21orf58_ENST00000397682.3_5'UTR	NM_058180.3	NP_478060.2	P58505	CU058_HUMAN	chromosome 21 open reading frame 58	137										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(1)|pancreas(1)	9	Breast(49;0.112)			Colorectal(79;0.239)		TCCTTCTCTTCAGAGCAGTCT	0.587																																																	0													119.0	88.0	98.0					21																	47735421		2203	4300	6503	SO:0001819	synonymous_variant	54058				CCDS13735.1, CCDS68229.1	21q22.3	2008-07-07			ENSG00000160298	ENSG00000160298			1300	protein-coding gene	gene with protein product							Standard	XM_005261149		Approved		uc002zjf.3	P58505	OTTHUMG00000090634	ENST00000291691.7:c.411G>A	21.37:g.47735421C>T			B3KPI1	Silent	SNP	NULL	p.L137	ENST00000291691.7	37	c.411	CCDS13735.1	21																																																																																			C21orf58	-	NULL		0.587	C21orf58-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C21orf58	HGNC	protein_coding	OTTHUMT00000207283.1	C	NM_058180		47735421	-1	no_errors	ENST00000291691	ensembl	human	known	70_37	silent	SNP	0.994	T
C2CD4B	388125	genome.wustl.edu	37	15	62456157	62456157	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr15:62456157G>A	ENST00000380392.3	-	2	1155	c.1027C>T	c.(1027-1029)Cgc>Tgc	p.R343C		NM_001007595.2	NP_001007596.2	A6NLJ0	C2C4B_HUMAN	C2 calcium-dependent domain containing 4B	343	C2.					focal adhesion (GO:0005925)|nucleolus (GO:0005730)				skin(1)	1						TCCCGGCCGCGACCCTCATCC	0.726																																																	0													5.0	6.0	6.0					15																	62456157		2088	4128	6216	SO:0001583	missense	388125			BM023530	CCDS32259.1	15q22.2	2009-09-28	2009-09-28	2009-09-28					33628	protein-coding gene	gene with protein product	"""nuclear localized factor 2"""	610344	"""family with sequence similarity 148, member B"""	FAM148B			Standard	NM_001007595		Approved	NLF2	uc002ahg.2	A6NLJ0		ENST00000380392.3:c.1027C>T	15.37:g.62456157G>A	ENSP00000369755:p.Arg343Cys			Missense_Mutation	SNP	superfamily_C2_Ca/lipid-bd_dom_CaLB	p.R343C	ENST00000380392.3	37	c.1027	CCDS32259.1	15	.	.	.	.	.	.	.	.	.	.	G	8.464	0.855874	0.17106	.	.	ENSG00000205502	ENST00000380392	T	0.80123	-1.34	3.42	3.42	0.39159	.	0.302393	0.31554	N	0.007456	T	0.68787	0.3039	L	0.43152	1.355	0.20074	N	0.999938	B	0.33266	0.404	B	0.31869	0.137	T	0.60959	-0.7159	10	0.45353	T	0.12	.	5.0196	0.14354	0.2555:0.0:0.7445:0.0	.	343	A6NLJ0	C2C4B_HUMAN	C	343	ENSP00000369755:R343C	ENSP00000369755:R343C	R	-	1	0	C2CD4B	60243449	1.000000	0.71417	0.982000	0.44146	0.101000	0.19017	0.803000	0.27083	1.909000	0.55274	0.484000	0.47621	CGC	C2CD4B	-	superfamily_C2_Ca/lipid-bd_dom_CaLB		0.726	C2CD4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2CD4B	HGNC	protein_coding	OTTHUMT00000416117.1	G	NM_001007595		62456157	-1	no_errors	ENST00000380392	ensembl	human	known	70_37	missense	SNP	0.272	A
C19orf68	374920	genome.wustl.edu	37	19	48685630	48685631	+	Intron	INS	-	-	AA	rs540757523|rs11373236|rs56182393	byFrequency	TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr19:48685630_48685631insAA	ENST00000328759.7	+	3	307				CARD8_ENST00000600800.1_5'UTR|ZNF114_ENST00000597695.1_Intron			Q86XI8	CS068_HUMAN	chromosome 19 open reading frame 68						hematopoietic progenitor cell differentiation (GO:0002244)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)											ATTCTTAGTTTAAAAAAAAAAA	0.51																																																	0																																										SO:0001627	intron_variant	22900			BC043386	CCDS74411.1	19q13.32	2008-08-06			ENSG00000185453	ENSG00000185453			34495	protein-coding gene	gene with protein product						12477932	Standard	NM_199341		Approved	LOC374920	uc002pic.3	Q86XI8		ENST00000328759.7:c.276-81->AA	19.37:g.48685639_48685640dupAA				RNA	INS	-	NULL	ENST00000328759.7	37	NULL		19																																																																																			CARD8	-	-		0.510	C19orf68-001	KNOWN	non_canonical_other|basic|appris_principal	protein_coding	CARD8	HGNC	protein_coding	OTTHUMT00000465598.1	-	XM_001713770		48685631	-1	no_errors	ENST00000600800	ensembl	human	known	70_37	rna	INS	0.001:0.000	AA
CDC37	11140	genome.wustl.edu	37	19	10514087	10514087	+	Silent	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr19:10514087G>A	ENST00000222005.2	-	1	122	c.69C>T	c.(67-69)atC>atT	p.I23I	MIR1181_ENST00000408639.1_RNA	NM_007065.3	NP_008996.1	Q16543	CDC37_HUMAN	cell division cycle 37	23					protein targeting (GO:0006605)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	16			OV - Ovarian serous cystadenocarcinoma(20;4.65e-10)|Epithelial(33;6.48e-07)|all cancers(31;2.31e-06)	GBM - Glioblastoma multiforme(1328;0.0318)		TGGCCGTGTCGATGTTGGGGT	0.642																																																	0													78.0	61.0	67.0					19																	10514087		2203	4300	6503	SO:0001819	synonymous_variant	11140			U63131	CCDS12237.1	19p13.2	2013-01-17	2013-01-17		ENSG00000105401	ENSG00000105401			1735	protein-coding gene	gene with protein product	"""CDC37 cell division cycle 37 homolog"", ""Hsp90 co-chaperone Cdc37"", ""CDC37 (cell division cycle 37, S. cerevisiae, homolog)"""	605065	"""CDC37 (cell division cycle 37, S. cerevisiae, homolog)"", ""CDC37 cell division cycle 37 homolog (S. cerevisiae)"", ""cell division cycle 37 homolog (S. cerevisiae)"""			8703009, 8666233	Standard	NM_007065		Approved	P50CDC37	uc002mof.1	Q16543		ENST00000222005.2:c.69C>T	19.37:g.10514087G>A			Q53YA2	Silent	SNP	pfam_Cdc37_Hsp90-bd,pfam_Cdc37_N_dom,pfam_Cdc37_C	p.I23	ENST00000222005.2	37	c.69	CCDS12237.1	19																																																																																			CDC37	-	pfam_Cdc37_N_dom		0.642	CDC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC37	HGNC	protein_coding	OTTHUMT00000451987.1	G	NM_007065		10514087	-1	no_errors	ENST00000222005	ensembl	human	known	70_37	silent	SNP	1.000	A
CHRNB2	1141	genome.wustl.edu	37	1	154548324	154548324	+	Silent	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr1:154548324C>T	ENST00000368476.3	+	6	1689	c.1425C>T	c.(1423-1425)atC>atT	p.I475I		NM_000748.2	NP_000739.1	P17787	ACHB2_HUMAN	cholinergic receptor, nicotinic, beta 2 (neuronal)	475					action potential (GO:0001508)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|central nervous system projection neuron axonogenesis (GO:0021952)|cognition (GO:0050890)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|lateral geniculate nucleus development (GO:0021771)|learning (GO:0007612)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|neurological system process (GO:0050877)|optic nerve morphogenesis (GO:0021631)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|protein heterooligomerization (GO:0051291)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of circadian sleep/wake cycle, REM sleep (GO:0042320)|regulation of dendrite morphogenesis (GO:0048814)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine secretion (GO:0014059)|regulation of synapse assembly (GO:0051963)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|sensory perception of pain (GO:0019233)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)|vestibulocochlear nerve development (GO:0021562)|visual learning (GO:0008542)|visual perception (GO:0007601)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)|ligand-gated ion channel activity (GO:0015276)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|skin(1)|urinary_tract(3)	28	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Dextromethorphan(DB00514)|Galantamine(DB00674)|Nicotine(DB00184)	TTGGCACCATCGGCATGTTCC	0.562																																																	0													330.0	239.0	270.0					1																	154548324		2203	4300	6503	SO:0001819	synonymous_variant	1141			U62437	CCDS1070.1	1q21.3	2012-02-11	2006-02-01		ENSG00000160716	ENSG00000160716		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1962	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 2 (neuronal)"""	118507	"""cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)"""			1505988	Standard	NM_000748		Approved		uc001ffg.3	P17787	OTTHUMG00000037262	ENST00000368476.3:c.1425C>T	1.37:g.154548324C>T			Q9UEH9	Silent	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.I475	ENST00000368476.3	37	c.1425	CCDS1070.1	1																																																																																			CHRNB2	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel		0.562	CHRNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNB2	HGNC	protein_coding	OTTHUMT00000090697.1	C	NM_000748		154548324	+1	no_errors	ENST00000368476	ensembl	human	known	70_37	silent	SNP	0.375	T
CHRNG	1146	genome.wustl.edu	37	2	233407755	233407755	+	Silent	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr2:233407755C>T	ENST00000389494.3	+	7	789	c.768C>T	c.(766-768)tcC>tcT	p.S256S	CHRNG_ENST00000389492.3_Silent_p.S204S	NM_005199.4	NP_005190.4	P07510	ACHG_HUMAN	cholinergic receptor, nicotinic, gamma (muscle)	256					muscle contraction (GO:0006936)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)	p.S256S(1)		breast(2)|endometrium(3)|large_intestine(4)|lung(12)|upper_aerodigestive_tract(1)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;6.39e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00079)|LUSC - Lung squamous cell carcinoma(224;0.00757)|Lung(119;0.0086)	Galantamine(DB00674)	TGCTCATCTCCTCTGTCGCCA	0.602																																																	1	Substitution - coding silent(1)	endometrium(1)											286.0	229.0	249.0					2																	233407755		2203	4300	6503	SO:0001819	synonymous_variant	1146			X01715	CCDS33400.1	2q37.1	2012-10-02	2012-02-07		ENSG00000196811	ENSG00000196811		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1967	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, gamma (muscle)"""	100730	"""cholinergic receptor, nicotinic, gamma"""	ACHRG			Standard	NM_005199		Approved		uc002vsx.1	P07510	OTTHUMG00000153327	ENST00000389494.3:c.768C>T	2.37:g.233407755C>T			B3KWM8|Q14DU4|Q53RG2	Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel	p.S256	ENST00000389494.3	37	c.768	CCDS33400.1	2																																																																																			CHRNG	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM		0.602	CHRNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNG	HGNC	protein_coding	OTTHUMT00000330743.1	C	NM_005199		233407755	+1	no_errors	ENST00000389494	ensembl	human	known	70_37	silent	SNP	1.000	T
CMTM5	116173	genome.wustl.edu	37	14	23847620	23847620	+	Silent	SNP	G	G	A	rs570921659		TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr14:23847620G>A	ENST00000339180.4	+	2	405	c.189G>A	c.(187-189)gcG>gcA	p.A63A	CMTM5_ENST00000342473.4_Intron|CMTM5_ENST00000397227.3_Intron|CMTM5_ENST00000359320.3_Silent_p.A63A|CMTM5_ENST00000382809.2_Silent_p.A63A|CMTM5_ENST00000555731.1_Intron			Q96DZ9	CKLF5_HUMAN	CKLF-like MARVEL transmembrane domain containing 5	63	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(4)|prostate(1)|stomach(1)	8	all_cancers(95;2e-05)			GBM - Glioblastoma multiforme(265;0.0064)|READ - Rectum adenocarcinoma(4;0.0276)|Colorectal(4;0.0382)		TGGCCGCGGCGCTACTGGAGT	0.567													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19696	0.0		0.0	False		,,,				2504	0.0																0													218.0	174.0	189.0					14																	23847620		2203	4300	6503	SO:0001819	synonymous_variant	116173			BC013109	CCDS9598.1, CCDS32050.1, CCDS73617.1, CCDS73618.1, CCDS73619.1	14q11.2	2005-11-08	2005-11-08	2005-11-08	ENSG00000166091	ENSG00000166091			19176	protein-coding gene	gene with protein product		607888	"""chemokine-like factor super family 5"", ""chemokine-like factor superfamily 5"""	CKLFSF5			Standard	NM_138460		Approved	FLJ37521	uc001wjs.3	Q96DZ9	OTTHUMG00000028751	ENST00000339180.4:c.189G>A	14.37:g.23847620G>A			E9PH91|Q5PY48	Silent	SNP	NULL	p.A63	ENST00000339180.4	37	c.189		14																																																																																			CMTM5	-	NULL		0.567	CMTM5-003	KNOWN	basic	protein_coding	CMTM5	HGNC	protein_coding	OTTHUMT00000133708.2	G			23847620	+1	no_errors	ENST00000339180	ensembl	human	known	70_37	silent	SNP	0.021	A
CROCC	9696	genome.wustl.edu	37	1	17282522	17282522	+	Silent	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr1:17282522G>A	ENST00000375541.5	+	25	3804	c.3735G>A	c.(3733-3735)caG>caA	p.Q1245Q		NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		ACAAGGAGCAGAAGCTGGCAC	0.642																																																	0													20.0	19.0	19.0					1																	17282522		2063	4053	6116	SO:0001819	synonymous_variant	9696			AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.3735G>A	1.37:g.17282522G>A				Silent	SNP	superfamily_Prefoldin,superfamily_t-SNARE	p.Q1245	ENST00000375541.5	37	c.3735	CCDS30616.1	1																																																																																			CROCC	-	NULL		0.642	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CROCC	HGNC	protein_coding	OTTHUMT00000006249.2	G	NM_014675		17282522	+1	no_errors	ENST00000375541	ensembl	human	known	70_37	silent	SNP	1.000	A
COL11A1	1301	genome.wustl.edu	37	1	103440391	103440391	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr1:103440391G>T	ENST00000370096.3	-	36	3115	c.2803C>A	c.(2803-2805)Cct>Act	p.P935T	COL11A1_ENST00000358392.2_Missense_Mutation_p.P947T|COL11A1_ENST00000512756.1_Missense_Mutation_p.P819T|COL11A1_ENST00000353414.4_Missense_Mutation_p.P896T	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	935	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.P935T(1)|p.P947T(1)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CTTACAGGAGGGCCTTTTGGT	0.383																																																	2	Substitution - Missense(2)	lung(2)											59.0	67.0	65.0					1																	103440391		2203	4300	6503	SO:0001583	missense	1301			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.2803C>A	1.37:g.103440391G>T	ENSP00000359114:p.Pro935Thr		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C,smart_Laminin_G,smart_Fib_collagen_C	p.P947T	ENST00000370096.3	37	c.2839	CCDS778.1	1	.	.	.	.	.	.	.	.	.	.	G	17.91	3.505207	0.64410	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	5.35	5.35	0.76521	.	0.196102	0.44902	D	0.000411	T	0.55305	0.1912	L	0.60845	1.875	0.80722	D	1	D;D;D;D;D	0.76494	0.998;0.999;0.999;0.998;0.999	D;D;D;D;D	0.80764	0.981;0.991;0.994;0.981;0.991	T	0.58842	-0.7565	10	0.87932	D	0	.	17.6337	0.88116	0.0:0.0:1.0:0.0	.	819;896;947;935;155	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	T	935;947;896;155;819	ENSP00000359114:P935T;ENSP00000351163:P947T;ENSP00000302551:P896T;ENSP00000426533:P819T	ENSP00000302551:P896T	P	-	1	0	COL11A1	103212979	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.814000	0.91968	2.503000	0.84419	0.585000	0.79938	CCT	COL11A1	-	NULL		0.383	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COL11A1	HGNC	protein_coding	OTTHUMT00000029997.1	G	NM_080630		103440391	-1	no_errors	ENST00000358392	ensembl	human	known	70_37	missense	SNP	1.000	T
CRYBA2	1412	genome.wustl.edu	37	2	219855001	219855001	+	Silent	SNP	C	C	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr2:219855001C>A	ENST00000295728.2	-	4	803	c.567G>T	c.(565-567)ctG>ctT	p.L189L	CRYBA2_ENST00000392096.2_Silent_p.L189L|CRYBA2_ENST00000487181.1_5'UTR	NM_057093.1	NP_476434.1	P53672	CRBA2_HUMAN	crystallin, beta A2	189	Beta/gamma crystallin 'Greek key' 4. {ECO:0000255|PROSITE-ProRule:PRU00028}.				lens development in camera-type eye (GO:0002088)		structural constituent of eye lens (GO:0005212)			endometrium(1)|lung(3)|prostate(1)	5		Renal(207;0.0474)		Epithelial(149;9.77e-07)|all cancers(144;0.000167)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGATGGACTGCAGCTGCCCAG	0.602																																																	0													107.0	99.0	102.0					2																	219855001		2203	4300	6503	SO:0001819	synonymous_variant	1412				CCDS2429.1	2q35	2013-02-14			ENSG00000163499	ENSG00000163499			2395	protein-coding gene	gene with protein product		600836				7490092, 12907171	Standard	NM_057093		Approved		uc002vjj.1	P53672	OTTHUMG00000133084	ENST00000295728.2:c.567G>T	2.37:g.219855001C>A			Q4ZFX0|Q9Y562	Silent	SNP	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.L189	ENST00000295728.2	37	c.567	CCDS2429.1	2																																																																																			CRYBA2	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin		0.602	CRYBA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CRYBA2	HGNC	protein_coding	OTTHUMT00000336424.1	C	NM_057093		219855001	-1	no_errors	ENST00000295728	ensembl	human	known	70_37	silent	SNP	1.000	A
BRINP1	1620	genome.wustl.edu	37	9	121929686	121929686	+	Silent	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr9:121929686G>A	ENST00000265922.3	-	8	2423	c.1962C>T	c.(1960-1962)gaC>gaT	p.D654D	BRINP1_ENST00000482797.1_Intron	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	654					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)											ACACCTGCACGTCTGAGATCT	0.582																																																	0													181.0	167.0	172.0					9																	121929686		2203	4300	6503	SO:0001819	synonymous_variant	0			AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.1962C>T	9.37:g.121929686G>A			Q6IPV6|Q6P1A0|Q8WU22	Silent	SNP	pfam_MACPF,smart_MACPF	p.D654	ENST00000265922.3	37	c.1962	CCDS6822.1	9																																																																																			DBC1	-	NULL		0.582	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBC1	HGNC	protein_coding	OTTHUMT00000055440.2	G	NM_014618		121929686	-1	no_errors	ENST00000265922	ensembl	human	known	70_37	silent	SNP	0.920	A
DDHD2	23259	genome.wustl.edu	37	8	38090703	38090703	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr8:38090703C>T	ENST00000397166.2	+	2	716	c.191C>T	c.(190-192)tCa>tTa	p.S64L	DDHD2_ENST00000520272.2_Missense_Mutation_p.S64L	NM_015214.2	NP_056029.2	O94830	DDHD2_HUMAN	DDHD domain containing 2	64	WWE. {ECO:0000255|PROSITE- ProRule:PRU00248}.				cell death (GO:0008219)|lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|microtubule organizing center (GO:0005815)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(1)|urinary_tract(2)	28	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)			TCTGAGGATTCACAGCAGCTG	0.393																																																	0													77.0	75.0	76.0					8																	38090703		2203	4300	6503	SO:0001583	missense	23259			AK056525	CCDS34883.1	8p11.23	2014-03-03	2004-04-05	2004-04-07				"""Sterile alpha motif (SAM) domain containing"""	29106	protein-coding gene	gene with protein product		615003	"""SAM, WWE and DDHD domain containing 1"""	SAMWD1		9872452, 11788596, 19632984, 20932832	Standard	NM_015214		Approved	KIAA0725, SPG54	uc003xlc.3	O94830		ENST00000397166.2:c.191C>T	8.37:g.38090703C>T	ENSP00000380352:p.Ser64Leu		B3KWV2|B3KXB5|Q9H8X7	Missense_Mutation	SNP	pfam_DDHD,pfam_WWE-dom,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_DDHD,pfscan_WWE-dom	p.S64L	ENST00000397166.2	37	c.191	CCDS34883.1	8	.	.	.	.	.	.	.	.	.	.	C	34	5.370231	0.95900	.	.	ENSG00000085788	ENST00000527834;ENST00000397166;ENST00000533100;ENST00000528358;ENST00000532222;ENST00000520272	T;T;T;T;T;T	0.34859	1.34;1.34;1.34;1.34;1.34;1.34	5.86	5.86	0.93980	WWE domain (2);	0.000000	0.64402	D	0.000001	T	0.69949	0.3168	M	0.90977	3.165	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.76132	-0.3071	10	0.87932	D	0	-15.863	18.741	0.91773	0.0:1.0:0.0:0.0	.	64;64	O94830;E9PKE6	DDHD2_HUMAN;.	L	64	ENSP00000432433:S64L;ENSP00000380352:S64L;ENSP00000432678:S64L;ENSP00000433118:S64L;ENSP00000433578:S64L;ENSP00000429932:S64L	ENSP00000380352:S64L	S	+	2	0	DDHD2	38209860	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	6.547000	0.73892	2.778000	0.95560	0.655000	0.94253	TCA	DDHD2	-	pfam_WWE-dom,pfscan_WWE-dom		0.393	DDHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDHD2	HGNC	protein_coding	OTTHUMT00000377251.2	C	XM_291291		38090703	+1	no_errors	ENST00000397166	ensembl	human	known	70_37	missense	SNP	1.000	T
DYNC1H1	1778	genome.wustl.edu	37	14	102493773	102493773	+	Missense_Mutation	SNP	G	G	C	rs568215465		TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr14:102493773G>C	ENST00000360184.4	+	46	9104	c.8940G>C	c.(8938-8940)ttG>ttC	p.L2980F		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	2980	AAA 4. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)	p.L2980F(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						GGACAGTGTTGAGACGTTCTG	0.428																																																	1	Substitution - Missense(1)	lung(1)											118.0	112.0	114.0					14																	102493773		2203	4300	6503	SO:0001583	missense	1778			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.8940G>C	14.37:g.102493773G>C	ENSP00000348965:p.Leu2980Phe		B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.L2980F	ENST00000360184.4	37	c.8940	CCDS9966.1	14	.	.	.	.	.	.	.	.	.	.	G	23.5	4.420470	0.83559	.	.	ENSG00000197102	ENST00000360184	T	0.43688	0.94	6.06	6.06	0.98353	Dynein heavy chain, P-loop containing D4 domain (1);ATPase, AAA+ type, core (1);	0.071171	0.64402	D	0.000016	T	0.68007	0.2954	M	0.77103	2.36	0.80722	D	1	D	0.71674	0.998	D	0.71656	0.974	T	0.67585	-0.5633	10	0.59425	D	0.04	.	20.6397	0.99537	0.0:0.0:1.0:0.0	.	2980	Q14204	DYHC1_HUMAN	F	2980	ENSP00000348965:L2980F	ENSP00000348965:L2980F	L	+	3	2	DYNC1H1	101563526	1.000000	0.71417	0.232000	0.24009	0.924000	0.55760	3.499000	0.53310	2.880000	0.98712	0.650000	0.86243	TTG	DYNC1H1	-	pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase		0.428	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1	G	NM_001376		102493773	+1	no_errors	ENST00000360184	ensembl	human	known	70_37	missense	SNP	1.000	C
DYNC2H1	79659	genome.wustl.edu	37	11	103025519	103025519	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr11:103025519C>T	ENST00000375735.2	+	24	3698	c.3554C>T	c.(3553-3555)tCa>tTa	p.S1185L	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.S1185L|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1185	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		AAATTACAATCAGAGGTTGAC	0.303																																																	0													49.0	43.0	45.0					11																	103025519		1813	4056	5869	SO:0001583	missense	79659			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.3554C>T	11.37:g.103025519C>T	ENSP00000364887:p.Ser1185Leu		O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.S1185L	ENST00000375735.2	37	c.3554	CCDS53701.1	11	.	.	.	.	.	.	.	.	.	.	C	12.38	1.920798	0.33908	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.61627	0.09;0.09	5.56	4.65	0.58169	Dynein heavy chain, domain-2 (1);	0.998738	0.08099	N	0.998182	T	0.49167	0.1541	L	0.43554	1.36	0.26370	N	0.976905	P;B	0.34909	0.475;0.23	B;B	0.33121	0.158;0.098	T	0.39603	-0.9606	10	0.35671	T	0.21	.	7.8789	0.29610	0.2628:0.6568:0.0:0.0805	.	1185;1185	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	L	1185	ENSP00000364887:S1185L;ENSP00000381167:S1185L	ENSP00000364887:S1185L	S	+	2	0	DYNC2H1	102530729	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	2.592000	0.46171	1.385000	0.46445	0.650000	0.86243	TCA	DYNC2H1	-	pfam_Dynein_heavy_dom-2		0.303	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	C	XM_370652		103025519	+1	no_errors	ENST00000398093	ensembl	human	known	70_37	missense	SNP	0.998	T
ENPEP	2028	genome.wustl.edu	37	4	111452388	111452388	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr4:111452388G>C	ENST00000265162.5	+	11	2104	c.1762G>C	c.(1762-1764)Gat>Cat	p.D588H		NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	588					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		ATGGACTGAAGATAATATAAC	0.214																																																	0													29.0	30.0	30.0					4																	111452388		2144	4238	6382	SO:0001583	missense	2028			L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.1762G>C	4.37:g.111452388G>C	ENSP00000265162:p.Asp588His		Q504U2	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.D588H	ENST00000265162.5	37	c.1762	CCDS3691.1	4	.	.	.	.	.	.	.	.	.	.	G	13.96	2.391661	0.42410	.	.	ENSG00000138792	ENST00000265162	T	0.01438	4.89	5.32	3.38	0.38709	.	0.779040	0.12815	N	0.436841	T	0.02610	0.0079	M	0.82630	2.6	0.27978	N	0.936129	P	0.46706	0.883	B	0.39258	0.295	T	0.38394	-0.9663	10	0.59425	D	0.04	.	4.4594	0.11659	0.3813:0.0:0.6187:0.0	.	588	Q07075	AMPE_HUMAN	H	588	ENSP00000265162:D588H	ENSP00000265162:D588H	D	+	1	0	ENPEP	111671837	0.970000	0.33590	0.938000	0.37757	0.643000	0.38383	2.058000	0.41374	1.177000	0.42855	0.563000	0.77884	GAT	ENPEP	-	NULL		0.214	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPEP	HGNC	protein_coding	OTTHUMT00000255747.2	G			111452388	+1	no_errors	ENST00000265162	ensembl	human	known	70_37	missense	SNP	0.838	C
C1ORF220	400798	genome.wustl.edu	37	1	178514730	178514730	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr1:178514730C>T	ENST00000367636.4	+	2	454	c.116C>T	c.(115-117)tCc>tTc	p.S39F	C1orf220_ENST00000521244.1_3'UTR|C1orf220_ENST00000319387.2_3'UTR																							GGTGCTGCCTCCTGGATATCC	0.537																																																	0													84.0	69.0	74.0					1																	178514730		2203	4300	6503	SO:0001583	missense	0																														ENST00000367636.4:c.116C>T	1.37:g.178514730C>T	ENSP00000356608:p.Ser39Phe			Missense_Mutation	SNP	NULL	p.S39F	ENST00000367636.4	37	c.116		1	.	.	.	.	.	.	.	.	.	.	C	3.717	-0.058370	0.07317	.	.	ENSG00000184909	ENST00000367636	T	0.25749	1.78	3.46	-0.64	0.11493	.	.	.	.	.	T	0.11067	0.0270	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.32161	-0.9917	7	.	.	.	.	0.9177	0.01308	0.1862:0.4148:0.1814:0.2176	.	39	Q5T0J3	CA220_HUMAN	F	39	ENSP00000356608:S39F	.	S	+	2	0	AL513013.1	176781353	0.000000	0.05858	0.002000	0.10522	0.000000	0.00434	-0.157000	0.10085	-0.107000	0.12088	-1.824000	0.00597	TCC	C1ORF220	-	NULL		0.537	C1ORF220-201	NOVEL	basic|appris_principal	protein_coding	ENSG00000184909	Uniprot_genename	protein_coding		C			178514730	+1	no_errors	ENST00000367636	ensembl	human	known	70_37	missense	SNP	0.002	T
RPL12P38	645688	genome.wustl.edu	37	17	58511801	58511801	+	RNA	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr17:58511801C>T	ENST00000588627.1	-	0	1556									ribosomal protein L12 pseudogene 38																		GGCAGACAATCATTAACAGTA	0.368																																																	0																																												0					17q23.2	2013-01-23			ENSG00000213228	ENSG00000213228			36838	pseudogene	pseudogene						19123937	Standard	NG_010298		Approved				OTTHUMG00000157897		17.37:g.58511801C>T				RNA	SNP	-	NULL	ENST00000588627.1	37	NULL		17																																																																																			RP11-371B4.2	-	-		0.368	RPL12P38-002	KNOWN	basic	processed_transcript	ENSG00000213228	Clone_based_vega_gene	pseudogene	OTTHUMT00000449464.1	C	NG_010298		58511801	-1	no_errors	ENST00000588627	ensembl	human	known	70_37	rna	SNP	0.175	T
OVOL1	5017	genome.wustl.edu	37	11	65563417	65563417	+	3'UTR	SNP	G	G	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr11:65563417G>T	ENST00000335987.3	+	0	1761				RP11-770G2.5_ENST00000531155.1_RNA|OVOL1_ENST00000532448.1_3'UTR	NM_004561.3	NP_004552.2	O14753	OVOL1_HUMAN	ovo-like zinc finger 1						cytoskeleton organization (GO:0007010)|epidermal cell differentiation (GO:0009913)|germline cell cycle switching, mitotic to meiotic cell cycle (GO:0051729)|kidney development (GO:0001822)|mesoderm development (GO:0007498)|negative regulation of meiotic cell cycle phase transition (GO:1901994)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(2)|upper_aerodigestive_tract(1)	6				READ - Rectum adenocarcinoma(159;0.17)		tgctgtgtgtgtgtgCACGCA	0.478																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC059408	CCDS8112.1	11q13	2013-10-17	2013-10-17		ENSG00000172818	ENSG00000172818		"""Zinc fingers, C2H2-type"""	8525	protein-coding gene	gene with protein product		602313	"""ovo (Drosophila) homolog-like 1"", ""ovo-like 1(Drosophila)"""			9383297	Standard	NM_004561		Approved	HOVO1	uc001ofp.3	O14753	OTTHUMG00000166600	ENST00000335987.3:c.*605G>T	11.37:g.65563417G>T			Q6PCB1	RNA	SNP	-	NULL	ENST00000335987.3	37	NULL	CCDS8112.1	11																																																																																			RP11-770G2.5	-	-		0.478	OVOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000255404	Clone_based_vega_gene	protein_coding	OTTHUMT00000390690.1	G	NM_004561		65563417	-1	no_errors	ENST00000531155	ensembl	human	known	70_37	rna	SNP	0.001	T
DMTN	2039	genome.wustl.edu	37	8	21929890	21929890	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr8:21929890G>T	ENST00000523266.1	+	9	1120	c.658G>T	c.(658-660)Gag>Tag	p.E220*	DMTN_ENST00000358242.3_Nonsense_Mutation_p.E220*|DMTN_ENST00000432128.1_Nonsense_Mutation_p.E220*|DMTN_ENST00000523782.2_Nonsense_Mutation_p.E195*|DMTN_ENST00000265800.5_Nonsense_Mutation_p.E220*|DMTN_ENST00000519907.1_Nonsense_Mutation_p.E220*|DMTN_ENST00000517600.1_Nonsense_Mutation_p.E180*|DMTN_ENST00000443491.2_Nonsense_Mutation_p.E195*|DMTN_ENST00000415253.1_Nonsense_Mutation_p.E220*|DMTN_ENST00000381470.3_Nonsense_Mutation_p.E220*	NM_001978.2	NP_001969.2	Q08495	DEMA_HUMAN	dematin actin binding protein	220	Poly-Glu.				actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|actin filament capping (GO:0051693)|actin filament reorganization (GO:0090527)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cellular response to calcium ion (GO:0071277)|cellular response to cAMP (GO:0071320)|cytoskeleton organization (GO:0007010)|erythrocyte development (GO:0048821)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of blood coagulation (GO:0030194)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of platelet aggregation (GO:1901731)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of wound healing (GO:0090303)|protein complex assembly (GO:0006461)|protein secretion by platelet (GO:0070560)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)|regulation of lamellipodium assembly (GO:0010591)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cell projection membrane (GO:0031253)|cortical cytoskeleton (GO:0030863)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|protein self-association (GO:0043621)|receptor binding (GO:0005102)|spectrin binding (GO:0030507)										GGAAGAGGAGGAGGAGGAAGA	0.587																																																	0													109.0	82.0	91.0					8																	21929890		2203	4299	6502	SO:0001587	stop_gained	2039			U28389	CCDS6020.1, CCDS47820.1, CCDS47821.1	8p21.1	2013-05-03	2013-05-03	2013-05-03	ENSG00000158856	ENSG00000158856			3382	protein-coding gene	gene with protein product		125305	"""erythrocyte membrane protein band 4.9 (dematin)"""	EPB49		8341682, 12011427	Standard	NM_001978		Approved	DMT		Q08495	OTTHUMG00000097087	ENST00000523266.1:c.658G>T	8.37:g.21929890G>T	ENSP00000427866:p.Glu220*		A8K0T5|B3KP70|B3KRH3|E9PEJ0|Q13215|Q9BRE3	Nonsense_Mutation	SNP	pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Villin_headpiece,pfscan_Villin_headpiece	p.E220*	ENST00000523266.1	37	c.658	CCDS6020.1	8	.	.	.	.	.	.	.	.	.	.	G	39	7.773197	0.98480	.	.	ENSG00000158856	ENST00000381470;ENST00000432128;ENST00000443491;ENST00000517600;ENST00000541895;ENST00000265800;ENST00000381455;ENST00000358242;ENST00000415253;ENST00000523266;ENST00000519907	.	.	.	5.15	5.15	0.70609	.	0.454889	0.20622	N	0.088773	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	14.4836	0.67599	0.0:0.0:1.0:0.0	.	.	.	.	X	220;220;195;180;180;220;159;220;220;220;220	.	ENSP00000265800:E220X	E	+	1	0	EPB49	21985836	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.486000	0.45259	2.558000	0.86282	0.563000	0.77884	GAG	EPB49	-	NULL		0.587	DMTN-009	PUTATIVE	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	EPB49	HGNC	protein_coding	OTTHUMT00000375178.1	G	NM_001978		21929890	+1	no_errors	ENST00000265800	ensembl	human	known	70_37	nonsense	SNP	1.000	T
DMTN	2039	genome.wustl.edu	37	8	21929950	21929950	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr8:21929950G>C	ENST00000523266.1	+	9	1180	c.718G>C	c.(718-720)Gaa>Caa	p.E240Q	DMTN_ENST00000358242.3_Missense_Mutation_p.E240Q|DMTN_ENST00000432128.1_Missense_Mutation_p.E240Q|DMTN_ENST00000523782.2_Missense_Mutation_p.E215Q|DMTN_ENST00000265800.5_Missense_Mutation_p.E240Q|DMTN_ENST00000519907.1_Missense_Mutation_p.E240Q|DMTN_ENST00000517600.1_Missense_Mutation_p.E200Q|DMTN_ENST00000443491.2_Missense_Mutation_p.E215Q|DMTN_ENST00000415253.1_Missense_Mutation_p.E240Q|DMTN_ENST00000381470.3_Missense_Mutation_p.E240Q	NM_001978.2	NP_001969.2	Q08495	DEMA_HUMAN	dematin actin binding protein	240	Interaction with RASGRF2.				actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|actin filament capping (GO:0051693)|actin filament reorganization (GO:0090527)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cellular response to calcium ion (GO:0071277)|cellular response to cAMP (GO:0071320)|cytoskeleton organization (GO:0007010)|erythrocyte development (GO:0048821)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of blood coagulation (GO:0030194)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of platelet aggregation (GO:1901731)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of wound healing (GO:0090303)|protein complex assembly (GO:0006461)|protein secretion by platelet (GO:0070560)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)|regulation of lamellipodium assembly (GO:0010591)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cell projection membrane (GO:0031253)|cortical cytoskeleton (GO:0030863)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|protein self-association (GO:0043621)|receptor binding (GO:0005102)|spectrin binding (GO:0030507)										TCAGAGAGAGGAACTCAGTAA	0.592																																																	0													119.0	90.0	100.0					8																	21929950		2201	4300	6501	SO:0001583	missense	2039			U28389	CCDS6020.1, CCDS47820.1, CCDS47821.1	8p21.1	2013-05-03	2013-05-03	2013-05-03	ENSG00000158856	ENSG00000158856			3382	protein-coding gene	gene with protein product		125305	"""erythrocyte membrane protein band 4.9 (dematin)"""	EPB49		8341682, 12011427	Standard	NM_001978		Approved	DMT		Q08495	OTTHUMG00000097087	ENST00000523266.1:c.718G>C	8.37:g.21929950G>C	ENSP00000427866:p.Glu240Gln		A8K0T5|B3KP70|B3KRH3|E9PEJ0|Q13215|Q9BRE3	Missense_Mutation	SNP	pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Villin_headpiece,pfscan_Villin_headpiece	p.E240Q	ENST00000523266.1	37	c.718	CCDS6020.1	8	.	.	.	.	.	.	.	.	.	.	G	10.21	1.286420	0.23478	.	.	ENSG00000158856	ENST00000381470;ENST00000432128;ENST00000443491;ENST00000517600;ENST00000541895;ENST00000265800;ENST00000381455;ENST00000358242;ENST00000415253;ENST00000523266;ENST00000519907	T;T;T;T;T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46;1.46;1.46;1.46;1.46	5.15	5.15	0.70609	.	0.191508	0.42964	D	0.000622	T	0.35038	0.0918	N	0.20685	0.6	0.52099	D	0.999949	D;P;P;P;D;P	0.63880	0.993;0.919;0.919;0.919;0.993;0.884	D;P;B;P;P;P	0.70227	0.968;0.477;0.401;0.477;0.761;0.586	T	0.03566	-1.1024	10	0.07990	T	0.79	.	14.4836	0.67599	0.0:0.0:1.0:0.0	.	179;200;240;215;215;240	E9PD40;B4DI75;Q08495;B3KRH3;E9PEJ0;Q08495-2	.;.;DEMA_HUMAN;.;.;.	Q	240;240;215;200;200;240;179;240;240;240;240	ENSP00000370879:E240Q;ENSP00000416111:E240Q;ENSP00000397904:E215Q;ENSP00000430618:E200Q;ENSP00000265800:E240Q;ENSP00000350977:E240Q;ENSP00000401291:E240Q;ENSP00000427866:E240Q;ENSP00000429377:E240Q	ENSP00000265800:E240Q	E	+	1	0	EPB49	21985896	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.768000	0.74980	2.558000	0.86282	0.563000	0.77884	GAA	EPB49	-	NULL		0.592	DMTN-009	PUTATIVE	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	EPB49	HGNC	protein_coding	OTTHUMT00000375178.1	G	NM_001978		21929950	+1	no_errors	ENST00000265800	ensembl	human	known	70_37	missense	SNP	1.000	C
EPHA4	2043	genome.wustl.edu	37	2	222298944	222298944	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr2:222298944C>T	ENST00000281821.2	-	14	2455	c.2414G>A	c.(2413-2415)aGt>aAt	p.S805N	EPHA4_ENST00000409854.1_Missense_Mutation_p.S805N|EPHA4_ENST00000392071.4_Missense_Mutation_p.S754N|EPHA4_ENST00000409938.1_Missense_Mutation_p.S805N	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	805	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		CCATACATCACTTGCTGATGT	0.448																																																	0													199.0	181.0	187.0					2																	222298944		2203	4300	6503	SO:0001583	missense	2043			L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.2414G>A	2.37:g.222298944C>T	ENSP00000281821:p.Ser805Asn		A8K2P1|B2R601|B7Z6Q8|Q2M380	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S805N	ENST00000281821.2	37	c.2414	CCDS2447.1	2	.	.	.	.	.	.	.	.	.	.	C	35	5.421912	0.96111	.	.	ENSG00000116106	ENST00000281821;ENST00000409854;ENST00000409938;ENST00000392071	D;D;D;D	0.89343	-2.5;-2.5;-2.5;-2.5	5.7	5.7	0.88788	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.080905	0.85682	D	0.000000	D	0.96405	0.8827	H	0.94886	3.595	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97001	0.9729	10	0.87932	D	0	.	19.8381	0.96666	0.0:1.0:0.0:0.0	.	805	P54764	EPHA4_HUMAN	N	805;805;805;754	ENSP00000281821:S805N;ENSP00000386276:S805N;ENSP00000386829:S805N;ENSP00000375923:S754N	ENSP00000281821:S805N	S	-	2	0	EPHA4	222007188	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	5.907000	0.69908	2.692000	0.91855	0.650000	0.86243	AGT	EPHA4	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom		0.448	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA4	HGNC	protein_coding	OTTHUMT00000256836.3	C			222298944	-1	no_errors	ENST00000281821	ensembl	human	known	70_37	missense	SNP	1.000	T
ETV5	2119	genome.wustl.edu	37	3	185774866	185774866	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr3:185774866C>T	ENST00000306376.5	-	11	1453	c.1207G>A	c.(1207-1209)Gag>Aag	p.E403K	ETV5_ENST00000537818.1_Missense_Mutation_p.E445K|ETV5_ENST00000480706.1_5'UTR|ETV5_ENST00000434744.1_Missense_Mutation_p.E403K	NM_004454.2	NP_004445.1	P41161	ETV5_HUMAN	ets variant 5	403					cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|locomotory behavior (GO:0007626)|male germ-line stem cell asymmetric division (GO:0048133)|neuromuscular synaptic transmission (GO:0007274)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of synapse organization (GO:0050807)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	28	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			GTGCATACCTCTTCCGGTTCT	0.478			T	"""TMPRSS2, SCL45A3"""	Prostate																																			Dom	yes		3	3q28	2119	ets variant gene 5		E	0													87.0	83.0	84.0					3																	185774866		2203	4300	6503	SO:0001583	missense	2119			BC007333	CCDS33906.1	3q28	2008-09-12	2008-09-12		ENSG00000244405	ENSG00000244405			3494	protein-coding gene	gene with protein product	"""ets-related molecule"""	601600	"""ets variant gene 5 (ets-related molecule)"""			8152800	Standard	NM_004454		Approved	ERM	uc003fpz.3	P41161	OTTHUMG00000156639	ENST00000306376.5:c.1207G>A	3.37:g.185774866C>T	ENSP00000306894:p.Glu403Lys		A6NH46|B7Z7D7|Q6IBN5	Missense_Mutation	SNP	pfam_ETS_PEA3_N,pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	p.E445K	ENST00000306376.5	37	c.1333	CCDS33906.1	3	.	.	.	.	.	.	.	.	.	.	C	33	5.246834	0.95305	.	.	ENSG00000244405	ENST00000306376;ENST00000434744;ENST00000537818	T;T;T	0.23147	1.92;1.92;1.92	5.69	5.69	0.88448	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.000000	0.85682	D	0.000000	T	0.48241	0.1489	L	0.51422	1.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.40997	-0.9533	10	0.87932	D	0	.	18.5905	0.91210	0.0:1.0:0.0:0.0	.	403;445	P41161;B7Z7D7	ETV5_HUMAN;.	K	403;403;445	ENSP00000306894:E403K;ENSP00000413755:E403K;ENSP00000441737:E445K	ENSP00000306894:E403K	E	-	1	0	ETV5	187257560	1.000000	0.71417	0.997000	0.53966	0.795000	0.44927	7.818000	0.86416	2.691000	0.91804	0.655000	0.94253	GAG	ETV5	-	pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets		0.478	ETV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV5	HGNC	protein_coding	OTTHUMT00000344947.1	C	NM_004454		185774866	-1	no_errors	ENST00000537818	ensembl	human	known	70_37	missense	SNP	1.000	T
FAM126B	285172	genome.wustl.edu	37	2	201846414	201846414	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr2:201846414G>A	ENST00000418596.3	-	12	1359	c.1172C>T	c.(1171-1173)tCt>tTt	p.S391F	AC005037.3_ENST00000332935.6_RNA|AC005037.3_ENST00000413848.1_RNA	NM_173822.3	NP_776183.1	Q8IXS8	F126B_HUMAN	family with sequence similarity 126, member B	391						intracellular (GO:0005622)				endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	16						TTTGATGGCAGAGGCTGTTTC	0.483																																																	0													107.0	106.0	106.0					2																	201846414		2203	4300	6503	SO:0001583	missense	285172			BC039295	CCDS2335.1	2q33.1	2008-10-02			ENSG00000155744	ENSG00000155744			28593	protein-coding gene	gene with protein product						12477932	Standard	NM_173822		Approved	MGC39518, HYCC2	uc002uws.4	Q8IXS8	OTTHUMG00000132823	ENST00000418596.3:c.1172C>T	2.37:g.201846414G>A	ENSP00000393667:p.Ser391Phe		B2RCG7|Q4ZG87|Q53TX6	Missense_Mutation	SNP	pfam_Hyccin	p.S391F	ENST00000418596.3	37	c.1172	CCDS2335.1	2	.	.	.	.	.	.	.	.	.	.	G	11.75	1.732666	0.30684	.	.	ENSG00000155744	ENST00000418596	T	0.78126	-1.15	5.76	4.87	0.63330	.	0.443664	0.24945	N	0.034344	T	0.67951	0.2948	N	0.22421	0.69	0.26354	N	0.977165	B;B	0.33379	0.41;0.41	B;B	0.35510	0.204;0.135	T	0.61946	-0.6958	10	0.42905	T	0.14	-6.4639	15.2464	0.73509	0.0684:0.0:0.9316:0.0	.	197;391	B3KUG1;Q8IXS8	.;F126B_HUMAN	F	391	ENSP00000393667:S391F	ENSP00000393667:S391F	S	-	2	0	FAM126B	201554659	0.987000	0.35691	0.990000	0.47175	0.994000	0.84299	3.690000	0.54713	1.400000	0.46741	0.655000	0.94253	TCT	FAM126B	-	NULL		0.483	FAM126B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM126B	HGNC	protein_coding	OTTHUMT00000256285.3	G	NM_173822		201846414	-1	no_errors	ENST00000418596	ensembl	human	known	70_37	missense	SNP	0.616	A
FAM71C	196472	genome.wustl.edu	37	12	100042400	100042400	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr12:100042400C>G	ENST00000324341.1	+	1	870	c.448C>G	c.(448-450)Ctt>Gtt	p.L150V	ANKS1B_ENST00000329257.7_Intron|ANKS1B_ENST00000547010.1_Intron|ANKS1B_ENST00000547776.2_Intron	NM_153364.3	NP_699195.1	Q8NEG0	FA71C_HUMAN	family with sequence similarity 71, member C	150										breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				OV - Ovarian serous cystadenocarcinoma(2;0.00733)|Epithelial(2;0.0385)|all cancers(2;0.19)		CTCTTTTTATCTTCAGCTGTG	0.468																																																	0													64.0	62.0	63.0					12																	100042400		2203	4300	6503	SO:0001583	missense	196472				CCDS9072.1	12q23.1	2006-02-03				ENSG00000180219			28594	protein-coding gene	gene with protein product						12477932	Standard	NM_153364		Approved	MGC39520	uc001tgn.3	Q8NEG0		ENST00000324341.1:c.448C>G	12.37:g.100042400C>G	ENSP00000315247:p.Leu150Val		B2R6Y6	Missense_Mutation	SNP	pfam_DUF3699	p.L150V	ENST00000324341.1	37	c.448	CCDS9072.1	12	.	.	.	.	.	.	.	.	.	.	C	14.37	2.516500	0.44763	.	.	ENSG00000180219	ENST00000324341	T	0.33438	1.41	3.64	3.64	0.41730	.	0.219650	0.31290	N	0.007905	T	0.59293	0.2183	M	0.91354	3.2	0.80722	D	1	D	0.69078	0.997	D	0.68765	0.96	T	0.67764	-0.5586	9	.	.	.	-9.635	11.1176	0.48270	0.0:1.0:0.0:0.0	.	150	Q8NEG0	FA71C_HUMAN	V	150	ENSP00000315247:L150V	.	L	+	1	0	FAM71C	98566531	0.966000	0.33281	0.341000	0.25589	0.638000	0.38207	3.614000	0.54160	2.318000	0.78349	0.555000	0.69702	CTT	FAM71C	-	pfam_DUF3699		0.468	FAM71C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM71C	HGNC	protein_coding	OTTHUMT00000408458.1	C	NM_153364		100042400	+1	no_errors	ENST00000324341	ensembl	human	known	70_37	missense	SNP	0.602	G
FAM71E2	284418	genome.wustl.edu	37	19	55873665	55873665	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr19:55873665G>C	ENST00000424985.3	-	3	705	c.512C>G	c.(511-513)gCc>gGc	p.A171G	CTD-2105E13.6_ENST00000591954.3_5'Flank	NM_001145402.1	NP_001138874.1	Q8N5Q1	F71E2_HUMAN	family with sequence similarity 71, member E2	171										NS(1)|breast(3)|endometrium(2)|kidney(1)|skin(1)	8						ATCCAGGGGGGCCGTGCGCGT	0.687																																																	0													10.0	15.0	13.0					19																	55873665		688	1590	2278	SO:0001583	missense	284418			AL834316		19q13.42	2014-04-02	2007-11-20	2007-11-20	ENSG00000180043	ENSG00000180043			25278	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 16"""	C19orf16			Standard	NM_001145402		Approved	DKFZp434G1729	uc002qkr.2	Q8N5Q1	OTTHUMG00000170357	ENST00000424985.3:c.512C>G	19.37:g.55873665G>C	ENSP00000398617:p.Ala171Gly		Q8ND99	Missense_Mutation	SNP	pfam_DUF3699	p.A171G	ENST00000424985.3	37	c.512		19	.	.	.	.	.	.	.	.	.	.	N	11.73	1.727090	0.30593	.	.	ENSG00000180043	ENST00000424985	T	0.12879	2.64	3.63	1.42	0.22433	.	0.839611	0.09702	U	0.766881	T	0.07458	0.0188	N	0.14661	0.345	0.09310	N	1	B	0.30326	0.276	B	0.24974	0.057	T	0.35549	-0.9784	10	0.45353	T	0.12	-10.5682	6.3577	0.21410	0.2494:0.0:0.7506:0.0	.	171	Q8N5Q1	F71E2_HUMAN	G	171	ENSP00000398617:A171G	ENSP00000398617:A171G	A	-	2	0	FAM71E2	60565477	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.124000	0.15728	0.304000	0.22809	0.550000	0.68814	GCC	FAM71E2	-	NULL		0.687	FAM71E2-010	NOVEL	basic|appris_principal	protein_coding	FAM71E2	HGNC	protein_coding	OTTHUMT00000409063.4	G	NM_001145402		55873665	-1	no_errors	ENST00000424985	ensembl	human	novel	70_37	missense	SNP	0.000	C
FANCB	2187	genome.wustl.edu	37	X	14863270	14863270	+	Missense_Mutation	SNP	T	T	C			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chrX:14863270T>C	ENST00000324138.3	-	7	1788	c.1635A>G	c.(1633-1635)atA>atG	p.I545M	FANCB_ENST00000398334.1_Missense_Mutation_p.I545M	NM_152633.2	NP_689846.1	Q8NB91	FANCB_HUMAN	Fanconi anemia, complementation group B	545					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24	Hepatocellular(33;0.183)					CTTCCAATCCTATTTCACATG	0.408								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																								0													99.0	91.0	93.0					X																	14863270		2203	4300	6503	SO:0001583	missense	2187	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK091383	CCDS14161.1	Xp22.2	2014-09-17			ENSG00000181544	ENSG00000181544		"""Fanconi anemia, complementation groups"""	3583	protein-coding gene	gene with protein product		300515				9382107, 15502827	Standard	NM_152633		Approved	FAB, FLJ34064, FAAP95	uc004cwh.1	Q8NB91	OTTHUMG00000021168	ENST00000324138.3:c.1635A>G	X.37:g.14863270T>C	ENSP00000326819:p.Ile545Met		B2RMZ4|Q7Z2U2|Q86XG1	Missense_Mutation	SNP	NULL	p.I545M	ENST00000324138.3	37	c.1635	CCDS14161.1	X	.	.	.	.	.	.	.	.	.	.	T	3.835	-0.035059	0.07543	.	.	ENSG00000181544	ENST00000324138;ENST00000398334;ENST00000452869	.	.	.	5.36	2.83	0.33086	.	0.941646	0.09056	N	0.855082	T	0.25082	0.0609	L	0.29908	0.895	0.09310	N	1	B	0.33512	0.415	B	0.31812	0.136	T	0.19257	-1.0311	9	0.59425	D	0.04	-0.1003	5.2212	0.15370	0.2259:0.0:0.2393:0.5348	.	545	Q8NB91	FANCB_HUMAN	M	545	.	ENSP00000326819:I545M	I	-	3	3	FANCB	14773191	0.000000	0.05858	0.083000	0.20561	0.032000	0.12392	0.108000	0.15396	1.788000	0.52465	0.425000	0.28330	ATA	FANCB	-	NULL		0.408	FANCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCB	HGNC	protein_coding	OTTHUMT00000055835.1	T	NM_152633		14863270	-1	no_errors	ENST00000324138	ensembl	human	known	70_37	missense	SNP	0.051	C
FASTKD5	60493	genome.wustl.edu	37	20	3129658	3129658	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr20:3129658G>A	ENST00000380266.3	-	2	380	c.59C>T	c.(58-60)tCt>tTt	p.S20F	UBOX5_ENST00000217173.2_Intron|UBOX5_ENST00000348031.2_Intron|UBOX5-AS1_ENST00000446537.1_RNA	NM_021826.4	NP_068598.1	Q7L8L6	FAKD5_HUMAN	FAST kinase domains 5	20					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(2)|endometrium(2)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|urinary_tract(2)	19						ACCAAAGGCAGAAGGACTGCA	0.483																																																	0													106.0	100.0	102.0					20																	3129658		2203	4300	6503	SO:0001583	missense	60493			BC007413	CCDS13048.1	20p13	2006-07-07			ENSG00000215251	ENSG00000215251			25790	protein-coding gene	gene with protein product		614272				11347906	Standard	NM_021826		Approved	FLJ13149	uc002whz.4	Q7L8L6	OTTHUMG00000031727	ENST00000380266.3:c.59C>T	20.37:g.3129658G>A	ENSP00000369618:p.Ser20Phe		Q96JN3|Q9H5D1|Q9H8Y3	Missense_Mutation	SNP	pfam_FAST_2,pfam_FAST_Leu-rich,pfam_RAP,smart_RAP	p.S20F	ENST00000380266.3	37	c.59	CCDS13048.1	20	.	.	.	.	.	.	.	.	.	.	G	7.205	0.594169	0.13875	.	.	ENSG00000215251	ENST00000380266	T	0.14144	2.53	5.0	-1.54	0.08584	.	2.549880	0.01630	N	0.023477	T	0.08846	0.0219	N	0.04880	-0.145	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40683	-0.9550	10	0.56958	D	0.05	.	11.3914	0.49817	0.3875:0.0:0.6125:0.0	.	20	Q7L8L6	FAKD5_HUMAN	F	20	ENSP00000369618:S20F	ENSP00000369618:S20F	S	-	2	0	FASTKD5	3077658	0.989000	0.36119	0.018000	0.16275	0.035000	0.12851	1.362000	0.34148	-0.431000	0.07307	-0.672000	0.03802	TCT	FASTKD5	-	NULL		0.483	FASTKD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASTKD5	HGNC	protein_coding	OTTHUMT00000077701.2	G	NM_021826		3129658	-1	no_errors	ENST00000380266	ensembl	human	known	70_37	missense	SNP	0.028	A
FBXW7	55294	genome.wustl.edu	37	4	153245393	153245393	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr4:153245393C>G	ENST00000281708.4	-	11	3027	c.1798G>C	c.(1798-1800)Gat>Cat	p.D600H	FBXW7_ENST00000296555.5_Missense_Mutation_p.D482H|FBXW7_ENST00000263981.5_Missense_Mutation_p.D520H|FBXW7_ENST00000603841.1_Missense_Mutation_p.D600H|FBXW7_ENST00000603548.1_Missense_Mutation_p.D600H|FBXW7_ENST00000393956.3_Missense_Mutation_p.D424H	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	600					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.D600Y(2)|p.D520Y(1)|p.D361Y(1)|p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				ACTGTAGAATCTGCATTCCCA	0.388			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	5	Substitution - Missense(4)|Unknown(1)	large_intestine(4)|haematopoietic_and_lymphoid_tissue(1)											125.0	116.0	119.0					4																	153245393		2203	4300	6503	SO:0001583	missense	55294			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1798G>C	4.37:g.153245393C>G	ENSP00000281708:p.Asp600His		B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom_cyclin-like,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_WD40_repeat,pfscan_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.D600H	ENST00000281708.4	37	c.1798	CCDS3777.1	4	.	.	.	.	.	.	.	.	.	.	C	26.5	4.747294	0.89663	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	D;D;D;D	0.89415	-2.51;-2.51;-2.51;-2.51	5.45	5.45	0.79879	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.96969	0.9010	H	0.98133	4.155	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98335	1.0535	10	0.87932	D	0	-19.794	19.2767	0.94034	0.0:1.0:0.0:0.0	.	424;600;482;520	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	H	600;482;520;424	ENSP00000281708:D600H;ENSP00000296555:D482H;ENSP00000263981:D520H;ENSP00000377528:D424H	ENSP00000263981:D520H	D	-	1	0	FBXW7	153464843	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.547000	0.85894	0.655000	0.94253	GAT	FBXW7	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep		0.388	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW7	HGNC	protein_coding	OTTHUMT00000469956.1	C			153245393	-1	no_errors	ENST00000281708	ensembl	human	known	70_37	missense	SNP	1.000	G
FCHO2	115548	genome.wustl.edu	37	5	72332992	72332992	+	Silent	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr5:72332992G>A	ENST00000430046.2	+	10	980	c.864G>A	c.(862-864)aaG>aaA	p.K288K	FCHO2_ENST00000287761.6_Silent_p.K288K|FCHO2_ENST00000341845.6_Silent_p.K288K|FCHO2_ENST00000512348.1_Silent_p.K255K	NM_001146032.1|NM_138782.2	NP_001139504.1|NP_620137.2	Q0JRZ9	FCHO2_HUMAN	FCH domain only 2	288					clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|membrane invagination (GO:0010324)|protein localization to plasma membrane (GO:0072659)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	17		Lung NSC(167;0.0465)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;4.6e-53)		GGAAAAGAAAGACCTTTGCTT	0.259																																																	0													38.0	39.0	39.0					5																	72332992		1781	4045	5826	SO:0001819	synonymous_variant	115548			AL831971	CCDS47230.1, CCDS54868.1	5q13.2	2005-08-15			ENSG00000157107	ENSG00000157107			25180	protein-coding gene	gene with protein product		613438				15254787	Standard	NM_138782		Approved		uc003kcl.3	Q0JRZ9	OTTHUMG00000162413	ENST00000430046.2:c.864G>A	5.37:g.72332992G>A			A8K6W7|B2RNQ9|B4DHK0|E9PG79|Q0JTJ3|Q96CF5	Silent	SNP	pfam_Muniscin_C-term_mu_dom,pfam_FCH,smart_FCH,pfscan_FCH	p.K288	ENST00000430046.2	37	c.864	CCDS47230.1	5																																																																																			FCHO2	-	NULL		0.259	FCHO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCHO2	HGNC	protein_coding	OTTHUMT00000368795.3	G	XM_291142		72332992	+1	no_errors	ENST00000341845	ensembl	human	known	70_37	silent	SNP	1.000	A
TPRXL	348825	genome.wustl.edu	37	3	13976068	13976068	+	5'Flank	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr3:13976068G>A	ENST00000326972.8	+	0	0				FGD5P1_ENST00000502451.1_RNA			Q17RH7	TPRXL_HUMAN	tetra-peptide repeat homeobox-like											endometrium(1)	1						GGAGGGAGGCGAGGCATGTGG	0.632																																																	0																																										SO:0001631	upstream_gene_variant	100132526			AK092426		3p25.1	2011-06-20			ENSG00000180438	ENSG00000180438		"""Homeoboxes / PRD class"""	32178	pseudogene	pseudogene		611167					Standard	NR_002223		Approved	FLJ35107	uc003byg.3	Q17RH7	OTTHUMG00000155509		3.37:g.13976068G>A	Exception_encountered		Q8NAM5	RNA	SNP	-	NULL	ENST00000326972.8	37	NULL		3																																																																																			FGD5P1	-	-		0.632	TPRXL-001	KNOWN	basic|appris_principal	protein_coding	FGD5P1	HGNC	protein_coding	OTTHUMT00000340434.2	G	NR_002223		13976068	+1	no_errors	ENST00000502451	ensembl	human	known	70_37	rna	SNP	0.034	A
FUT6	2528	genome.wustl.edu	37	19	5832556	5832556	+	Missense_Mutation	SNP	T	T	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr19:5832556T>A	ENST00000318336.4	-	3	1217	c.23A>T	c.(22-24)aAg>aTg	p.K8M	FUT6_ENST00000527106.1_Missense_Mutation_p.K8M|FUT6_ENST00000286955.5_Missense_Mutation_p.K8M|FUT6_ENST00000592563.1_Missense_Mutation_p.K8M|FUT6_ENST00000524754.1_Missense_Mutation_p.K8M	NM_000150.2	NP_000141.1	P51993	FUT6_HUMAN	fucosyltransferase 6 (alpha (1,3) fucosyltransferase)	8					fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			endometrium(2)|kidney(1)|large_intestine(1)|lung(2)	6						CCACTGTGGCTTGGCCGGGCC	0.572																																																	0													28.0	25.0	26.0					19																	5832556		2203	4299	6502	SO:0001583	missense	2528				CCDS12152.1	19p13.3	2013-02-26			ENSG00000156413	ENSG00000156413	2.4.1.65	"""Fucosyltransferases"""	4017	protein-coding gene	gene with protein product	"""alpha-(1,3)-fucosyltransferase"", ""galactoside 3-L-fucosyltransferase"""	136836				1520296, 7782074	Standard	NM_001040701		Approved	FT1A, FCT3A, FucT-VI, FLJ40754	uc002mdh.1	P51993	OTTHUMG00000167335	ENST00000318336.4:c.23A>T	19.37:g.5832556T>A	ENSP00000313398:p.Lys8Met		A6NEX0|D6W637|Q9UND8	Missense_Mutation	SNP	pfam_Glyco_trans_10	p.K8M	ENST00000318336.4	37	c.23	CCDS12152.1	19	.	.	.	.	.	.	.	.	.	.	T	6.079	0.382911	0.11524	.	.	ENSG00000156413	ENST00000524754;ENST00000527106;ENST00000318336;ENST00000286955;ENST00000341530;ENST00000529165;ENST00000531085;ENST00000531199;ENST00000532464;ENST00000528505	T;T;T;T;T;T;T;T;T	0.58506	1.46;1.46;1.46;1.46;0.73;1.07;0.52;0.39;0.33	3.48	2.43	0.29744	.	2.015980	0.03014	U	0.149834	T	0.46268	0.1384	L	0.38175	1.15	0.09310	N	0.999998	P;B	0.35612	0.512;0.098	B;B	0.26094	0.066;0.066	T	0.40572	-0.9556	10	0.59425	D	0.04	.	6.6354	0.22879	0.0:0.13:0.0:0.87	.	8;8	C9J8A2;P51993	.;FUT6_HUMAN	M	8	ENSP00000431708:K8M;ENSP00000432954:K8M;ENSP00000313398:K8M;ENSP00000286955:K8M;ENSP00000436547:K8M;ENSP00000432161:K8M;ENSP00000436413:K8M;ENSP00000431880:K8M;ENSP00000433811:K8M	ENSP00000286955:K8M	K	-	2	0	FUT6	5783556	0.006000	0.16342	0.661000	0.29709	0.045000	0.14185	0.223000	0.17719	0.512000	0.28257	0.358000	0.22013	AAG	FUT6	-	NULL		0.572	FUT6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT6	HGNC	protein_coding	OTTHUMT00000394218.2	T	NM_000150		5832556	-1	no_errors	ENST00000592563	ensembl	human	known	70_37	missense	SNP	0.417	A
GBX2	2637	genome.wustl.edu	37	2	237074513	237074513	+	3'UTR	SNP	G	G	T	rs200772923		TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr2:237074513G>T	ENST00000306318.4	-	0	1488				GBX2_ENST00000551105.1_3'UTR|AC079135.1_ENST00000483218.1_RNA|AC079135.1_ENST00000415226.1_RNA|GBX2_ENST00000465889.1_5'UTR	NM_001485.2	NP_001476.2	P52951	GBX2_HUMAN	gastrulation brain homeobox 2						autonomic nervous system development (GO:0048483)|axon guidance (GO:0007411)|cerebellar granule cell precursor proliferation (GO:0021930)|cerebellum development (GO:0021549)|forebrain neuron development (GO:0021884)|inner ear morphogenesis (GO:0042472)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|patterning of blood vessels (GO:0001569)|rhombomere 2 development (GO:0021568)|thalamus development (GO:0021794)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7		Breast(86;0.00235)|Renal(207;0.00339)|all_hematologic(139;0.00357)|all_lung(227;0.0616)|Acute lymphoblastic leukemia(138;0.0775)|Ovarian(221;0.089)|Lung NSC(271;0.179)		Epithelial(121;4.5e-25)|OV - Ovarian serous cystadenocarcinoma(60;5.16e-11)|BRCA - Breast invasive adenocarcinoma(100;3.4e-05)|Lung(119;0.00195)|LUSC - Lung squamous cell carcinoma(224;0.00471)		CTCGGGTGCGGGGGCTTCTCC	0.572																																																	0													23.0	27.0	25.0					2																	237074513		2198	4287	6485	SO:0001624	3_prime_UTR_variant	2637			AF118452	CCDS2515.1	2q37.2	2012-03-09	2005-12-22		ENSG00000168505	ENSG00000168505		"""Homeoboxes / ANTP class : HOXL subclass"""	4186	protein-coding gene	gene with protein product		601135	"""gastrulation brain homeo box 2"""			9346236, 8838315	Standard	XM_005246071		Approved		uc002vvw.1	P52951	OTTHUMG00000133294	ENST00000306318.4:c.*44C>A	2.37:g.237074513G>T			B2RPH7|O43833|Q53RX5|Q9Y5Y1	RNA	SNP	-	NULL	ENST00000306318.4	37	NULL	CCDS2515.1	2																																																																																			GBX2	-	-		0.572	GBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBX2	HGNC	protein_coding	OTTHUMT00000257078.3	G	NM_001485		237074513	-1	no_errors	ENST00000465889	ensembl	human	putative	70_37	rna	SNP	0.001	T
GPR98	84059	genome.wustl.edu	37	5	90087011	90087011	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr5:90087011C>T	ENST00000405460.2	+	70	14461	c.14365C>T	c.(14365-14367)Cgg>Tgg	p.R4789W	GPR98_ENST00000425867.2_Missense_Mutation_p.R450W	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	4789			R -> W (in USH2C). {ECO:0000269|PubMed:22147658}.		detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TAACATAACCCGGCTTGCTGG	0.448																																																	0													77.0	71.0	73.0					5																	90087011		1921	4130	6051	SO:0001583	missense	84059			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.14365C>T	5.37:g.90087011C>T	ENSP00000384582:p.Arg4789Trp		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.R4789W	ENST00000405460.2	37	c.14365	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	C	20.9	4.065066	0.76187	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.56275	0.47;0.47	5.9	3.03	0.35002	.	0.000000	0.85682	D	0.000000	T	0.73210	0.3558	M	0.83118	2.625	0.42862	D	0.994116	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.928;1.0	T	0.76729	-0.2852	10	0.87932	D	0	.	13.92	0.63926	0.5274:0.4726:0.0:0.0	.	450;4789;450	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	W	4789;4789;450	ENSP00000384582:R4789W;ENSP00000392618:R450W	ENSP00000296619:R4789W	R	+	1	2	GPR98	90122767	0.972000	0.33761	0.999000	0.59377	0.991000	0.79684	0.846000	0.27682	0.340000	0.23745	0.655000	0.94253	CGG	GPR98	-	NULL		0.448	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2	C	NM_032119		90087011	+1	no_errors	ENST00000405460	ensembl	human	known	70_37	missense	SNP	0.999	T
GRIK5	2901	genome.wustl.edu	37	19	42569373	42569373	+	Splice_Site	SNP	A	A	G			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr19:42569373A>G	ENST00000262895.3	-	2	244		c.e2+1		GRIK5_ENST00000593562.1_Splice_Site|GRIK5_ENST00000301218.4_Splice_Site	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5						cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				GGCCCCGCTCACTGGTGTCCG	0.647																																																	0													67.0	62.0	63.0					19																	42569373		2203	4300	6503	SO:0001630	splice_region_variant	2901				CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.244+1T>C	19.37:g.42569373A>G			Q8WWG8	Splice_Site	SNP	-	e2+2	ENST00000262895.3	37	c.244+2	CCDS12595.1	19	.	.	.	.	.	.	.	.	.	.	a	21.6	4.179474	0.78564	.	.	ENSG00000105737	ENST00000262895;ENST00000301218	.	.	.	4.67	4.67	0.58626	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.2852	0.60239	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GRIK5	47261213	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.217000	0.89766	1.968000	0.57251	0.515000	0.50301	.	GRIK5	-	-		0.647	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK5	HGNC	protein_coding	OTTHUMT00000463453.1	A		Intron	42569373	-1	no_errors	ENST00000301218	ensembl	human	known	70_37	splice_site	SNP	1.000	G
HEATR5A	25938	genome.wustl.edu	37	14	31774366	31774366	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr14:31774366C>A	ENST00000389961.3	-	31	4965	c.4966G>T	c.(4966-4968)Gaa>Taa	p.E1656*	HEATR5A_ENST00000439348.1_Nonsense_Mutation_p.E1656*|RP11-596D21.1_ENST00000551799.1_RNA|HEATR5A_ENST00000439727.1_Nonsense_Mutation_p.E1369*|HEATR5A_ENST00000543095.2_Nonsense_Mutation_p.E1662*			Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	1656										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)	26	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		GTTTCCTTTTCAGCAGCCCCA	0.423																																																	0													51.0	49.0	50.0					14																	31774366		1866	4122	5988	SO:0001587	stop_gained	25938			AB037737		14q12	2012-04-19	2007-01-02	2007-01-02	ENSG00000129493	ENSG00000129493			20276	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 125"""	C14orf125			Standard	NM_015473		Approved	DKFZP434I1735	uc001wrf.4	Q86XA9	OTTHUMG00000169043	ENST00000389961.3:c.4966G>T	14.37:g.31774366C>A	ENSP00000374611:p.Glu1656*		Q68DD8|Q6P3S5|Q6P5R9|Q9H8D7|Q9NXB7|Q9P2N0|Q9UFQ3	Nonsense_Mutation	SNP	superfamily_ARM-type_fold	p.E1656*	ENST00000389961.3	37	c.4966		14	.	.	.	.	.	.	.	.	.	.	C	47	13.119693	0.99721	.	.	ENSG00000129493	ENST00000389961;ENST00000439348;ENST00000439727;ENST00000543095	.	.	.	5.92	5.92	0.95590	.	0.098232	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	20.3248	0.98698	0.0:1.0:0.0:0.0	.	.	.	.	X	1656;1656;1369;1662	.	ENSP00000374611:E1656X	E	-	1	0	HEATR5A	30844117	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.625000	0.83145	2.818000	0.97014	0.655000	0.94253	GAA	HEATR5A	-	superfamily_ARM-type_fold		0.423	HEATR5A-201	KNOWN	basic|appris_candidate	protein_coding	HEATR5A	HGNC	protein_coding		C	NM_015473		31774366	-1	no_errors	ENST00000389961	ensembl	human	known	70_37	nonsense	SNP	1.000	A
HELZ2	85441	genome.wustl.edu	37	20	62202569	62202569	+	Intron	SNP	A	A	C			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr20:62202569A>C	ENST00000467148.1	-	2	348				HELZ2_ENST00000479540.1_5'UTR	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator						cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GCCCCGCTCCAAGCTCCTGGG	0.697																																																	0																																										SO:0001627	intron_variant	85441			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.279-348T>G	20.37:g.62202569A>C			Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	RNA	SNP	-	NULL	ENST00000467148.1	37	NULL	CCDS33508.1	20																																																																																			HELZ2	-	-		0.697	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HELZ2	HGNC	protein_coding	OTTHUMT00000354127.1	A	NM_001037335		62202569	-1	no_errors	ENST00000479540	ensembl	human	known	70_37	rna	SNP	0.993	C
HOMER1	9456	genome.wustl.edu	37	5	78742913	78742913	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr5:78742913G>A	ENST00000334082.6	-	4	1792	c.350C>T	c.(349-351)tCa>tTa	p.S117L	HOMER1_ENST00000535690.1_Intron|HOMER1_ENST00000508576.1_Missense_Mutation_p.S117L|HOMER1_ENST00000282260.6_Intron	NM_004272.3	NP_004263.1	Q86YM7	HOME1_HUMAN	homer homolog 1 (Drosophila)	117					behavioral response to cocaine (GO:0048148)|chemical homeostasis within a tissue (GO:0048875)|circadian rhythm (GO:0007623)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of signal transduction (GO:0009967)|protein localization to synapse (GO:0035418)|regulation of calcium ion import (GO:0090279)|regulation of cation channel activity (GO:2001257)|regulation of store-operated calcium entry (GO:2001256)|response to calcium ion (GO:0051592)|response to nicotine (GO:0035094)|skeletal muscle contraction (GO:0003009)|skeletal muscle fiber development (GO:0048741)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell junction (GO:0030054)|costamere (GO:0043034)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|Z disc (GO:0030018)	ion channel binding (GO:0044325)|signaling adaptor activity (GO:0035591)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|prostate(2)|skin(1)	14		Lung NSC(167;0.00131)|all_lung(232;0.00151)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.87e-44)|Epithelial(54;7.07e-41)|all cancers(79;5.5e-36)		CTTCTCTTGTGATTTTTCCTT	0.338																																																	0													169.0	164.0	165.0					5																	78742913		1833	4083	5916	SO:0001583	missense	9456			BC015502	CCDS43335.1, CCDS64188.1, CCDS64189.1	5q14.2	2008-02-05			ENSG00000152413	ENSG00000152413			17512	protein-coding gene	gene with protein product		604798				9808459, 9808458	Standard	NM_004272		Approved	Ves-1, SYN47, HOMER-1B	uc003kfy.4	Q86YM7	OTTHUMG00000134278	ENST00000334082.6:c.350C>T	5.37:g.78742913G>A	ENSP00000334382:p.Ser117Leu		B2R688|O96003|Q86YM5	Missense_Mutation	SNP	pfam_EVH1,smart_EVH1,pfscan_EVH1	p.S117L	ENST00000334082.6	37	c.350	CCDS43335.1	5	.	.	.	.	.	.	.	.	.	.	G	18.30	3.592771	0.66219	.	.	ENSG00000152413	ENST00000334082;ENST00000508576	T;T	0.48522	2.09;0.81	5.82	5.82	0.92795	Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.45657	0.1353	L	0.55990	1.75	0.80722	D	1	P;P	0.39131	0.661;0.54	B;B	0.33339	0.162;0.133	T	0.42396	-0.9454	10	0.40728	T	0.16	-6.7615	20.091	0.97817	0.0:0.0:1.0:0.0	.	117;117	Q86YM7-3;Q86YM7	.;HOME1_HUMAN	L	117	ENSP00000334382:S117L;ENSP00000426651:S117L	ENSP00000334382:S117L	S	-	2	0	HOMER1	78778669	1.000000	0.71417	0.992000	0.48379	0.995000	0.86356	7.944000	0.87722	2.739000	0.93911	0.655000	0.94253	TCA	HOMER1	-	NULL		0.338	HOMER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOMER1	HGNC	protein_coding	OTTHUMT00000258856.1	G	NM_004272		78742913	-1	no_errors	ENST00000334082	ensembl	human	known	70_37	missense	SNP	1.000	A
HPRT1	3251	genome.wustl.edu	37	X	133609305	133609305	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chrX:133609305G>A	ENST00000298556.7	+	3	388	c.229G>A	c.(229-231)Gac>Aac	p.D77N	HPRT1_ENST00000462974.1_3'UTR	NM_000194.2	NP_000185.1	P00492	HPRT_HUMAN	hypoxanthine phosphoribosyltransferase 1	77					adenine salvage (GO:0006168)|central nervous system neuron development (GO:0021954)|cerebral cortex neuron differentiation (GO:0021895)|cytolysis (GO:0019835)|dendrite morphogenesis (GO:0048813)|dopamine metabolic process (GO:0042417)|GMP catabolic process (GO:0046038)|GMP salvage (GO:0032263)|grooming behavior (GO:0007625)|guanine salvage (GO:0006178)|hypoxanthine metabolic process (GO:0046100)|hypoxanthine salvage (GO:0043103)|IMP metabolic process (GO:0046040)|IMP salvage (GO:0032264)|locomotory behavior (GO:0007626)|lymphocyte proliferation (GO:0046651)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of dopamine metabolic process (GO:0045964)|protein homotetramerization (GO:0051289)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside salvage (GO:0006166)|purine-containing compound salvage (GO:0043101)|response to amphetamine (GO:0001975)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	guanine phosphoribosyltransferase activity (GO:0052657)|hypoxanthine phosphoribosyltransferase activity (GO:0004422)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	9	Acute lymphoblastic leukemia(192;0.000127)				Azathioprine(DB00993)|Mercaptopurine(DB01033)|Tioguanine(DB00352)	ATTCTTTGCTGACCTGCTGGA	0.428																																																	0													86.0	77.0	80.0					X																	133609305		2203	4300	6503	SO:0001583	missense	3251			M26434	CCDS14641.1	Xq26.2	2012-10-02	2008-08-01		ENSG00000165704	ENSG00000165704	2.4.2.8		5157	protein-coding gene	gene with protein product	"""Lesch-Nyhan syndrome"""	308000		HPRT		12175903	Standard	NM_000194		Approved	HGPRT	uc004exl.4	P00492	OTTHUMG00000022452	ENST00000298556.7:c.229G>A	X.37:g.133609305G>A	ENSP00000298556:p.Asp77Asn		A6NHF0|B2R8M9	Missense_Mutation	SNP	pfam_PRibTrfase_dom,tigrfam_Hxn_phspho_trans	p.D77N	ENST00000298556.7	37	c.229	CCDS14641.1	X	.	.	.	.	.	.	.	.	.	.	G	29.1	4.974395	0.92919	.	.	ENSG00000165704	ENST00000298556;ENST00000370796	D	0.99867	-7.31	4.68	4.68	0.58851	Phosphoribosyltransferase (1);	0.095715	0.64402	D	0.000001	D	0.99849	0.9930	M	0.92507	3.315	0.80722	D	1	D	0.56521	0.976	P	0.57009	0.811	D	0.96583	0.9432	10	0.62326	D	0.03	-13.9673	16.0028	0.80308	0.0:0.0:1.0:0.0	.	77	P00492	HPRT_HUMAN	N	77	ENSP00000298556:D77N	ENSP00000298556:D77N	D	+	1	0	HPRT1	133436971	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.378000	0.97191	2.057000	0.61298	0.600000	0.82982	GAC	HPRT1	-	pfam_PRibTrfase_dom,tigrfam_Hxn_phspho_trans		0.428	HPRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPRT1	HGNC	protein_coding	OTTHUMT00000058361.1	G	NM_000194		133609305	+1	no_errors	ENST00000298556	ensembl	human	known	70_37	missense	SNP	1.000	A
HSD3B1	3283	genome.wustl.edu	37	1	120056573	120056573	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr1:120056573G>T	ENST00000369413.3	+	4	572	c.427G>T	c.(427-429)Gaa>Taa	p.E143*	HSD3B1_ENST00000528909.1_Nonsense_Mutation_p.E143*|HSD3B1_ENST00000235547.6_Nonsense_Mutation_p.E145*			P14060	3BHS1_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1	143					androgen biosynthetic process (GO:0006702)|estrogen biosynthetic process (GO:0006703)|glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|smooth endoplasmic reticulum membrane (GO:0030868)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|steroid delta-isomerase activity (GO:0004769)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(18)|ovary(2)|prostate(1)|skin(1)	32	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	Trilostane(DB01108)	GAATGGCCATGAAGAAGAGCC	0.517																																																	0													123.0	125.0	124.0					1																	120056573		2203	4300	6503	SO:0001587	stop_gained	3283			S45679	CCDS903.1	1p12	2014-06-03			ENSG00000203857	ENSG00000203857	1.1.1.145, 5.3.3.1	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	5217	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 1"""	109715		HSDB3, HSD3B		2779585, 19027726	Standard	NM_000862		Approved	SDR11E1	uc001ehv.1	P14060	OTTHUMG00000012525	ENST00000369413.3:c.427G>T	1.37:g.120056573G>T	ENSP00000358421:p.Glu143*		A8K691|Q14545|Q8IV65	Nonsense_Mutation	SNP	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_Male_sterile_NAD-bd,pfam_Polysac_CapD-like,pfam_DH_sc/Rdtase_SDR,pfam_dTDP_dehydrorham_reduct,pfam_PKS_KR,pfam_NmrA	p.E145*	ENST00000369413.3	37	c.433	CCDS903.1	1	.	.	.	.	.	.	.	.	.	.	G	15.80	2.941073	0.53079	.	.	ENSG00000203857	ENST00000369413;ENST00000235547;ENST00000528909	.	.	.	3.7	3.7	0.42460	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-7.8551	13.2928	0.60280	0.0:0.0:1.0:0.0	.	.	.	.	X	143;145;143	.	ENSP00000235547:E145X	E	+	1	0	HSD3B1	119858096	1.000000	0.71417	0.055000	0.19348	0.004000	0.04260	7.133000	0.77259	2.033000	0.60031	0.491000	0.48974	GAA	HSD3B1	-	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_Male_sterile_NAD-bd,pfam_dTDP_dehydrorham_reduct		0.517	HSD3B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HSD3B1	HGNC	protein_coding	OTTHUMT00000034993.3	G	NM_000862		120056573	+1	no_errors	ENST00000235547	ensembl	human	known	70_37	nonsense	SNP	0.996	T
IFT57	55081	genome.wustl.edu	37	3	107932819	107932819	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr3:107932819C>T	ENST00000264538.3	-	4	791	c.544G>A	c.(544-546)Gat>Aat	p.D182N		NM_018010.3	NP_060480.1	Q9NWB7	IFT57_HUMAN	intraflagellar transport 57	182					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cilium assembly (GO:0042384)|heart looping (GO:0001947)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|Golgi apparatus (GO:0005794)|intraciliary transport particle B (GO:0030992)|photoreceptor connecting cilium (GO:0032391)	DNA binding (GO:0003677)			kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	14			OV - Ovarian serous cystadenocarcinoma(3;0.0428)|Epithelial(53;0.246)			AATTCTGCATCATCTTCTGCA	0.328																																																	0													229.0	212.0	218.0					3																	107932819		2202	4297	6499	SO:0001583	missense	55081			AK001009	CCDS2951.1	3q13.13	2014-07-03	2014-07-03	2005-11-02	ENSG00000114446	ENSG00000114446		"""Intraflagellar transport homologs"""	17367	protein-coding gene	gene with protein product		606621	"""estrogen-related receptor beta like 1"", ""intraflagellar transport 57 homolog (Chlamydomonas)"""	ESRRBL1			Standard	NM_018010		Approved	FLJ10147, HIPPI, MHS4R2	uc003dwx.4	Q9NWB7	OTTHUMG00000159223	ENST00000264538.3:c.544G>A	3.37:g.107932819C>T	ENSP00000264538:p.Asp182Asn		Q96DA9	Missense_Mutation	SNP	pfam_Intra-flagellar_transport_57,superfamily_t-SNARE	p.D182N	ENST00000264538.3	37	c.544	CCDS2951.1	3	.	.	.	.	.	.	.	.	.	.	C	27.3	4.823156	0.90873	.	.	ENSG00000114446	ENST00000264538	.	.	.	5.77	5.77	0.91146	.	0.161439	0.64402	D	0.000019	T	0.59362	0.2188	L	0.38838	1.175	0.80722	D	1	B	0.33807	0.426	B	0.38755	0.281	T	0.53920	-0.8370	9	0.29301	T	0.29	.	19.9869	0.97352	0.0:1.0:0.0:0.0	.	182	Q9NWB7	IFT57_HUMAN	N	182	.	ENSP00000264538:D182N	D	-	1	0	IFT57	109415509	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.500000	0.60387	2.722000	0.93159	0.655000	0.94253	GAT	IFT57	-	pfam_Intra-flagellar_transport_57		0.328	IFT57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT57	HGNC	protein_coding	OTTHUMT00000353918.1	C	NM_018010		107932819	-1	no_errors	ENST00000264538	ensembl	human	known	70_37	missense	SNP	1.000	T
IGSF8	93185	genome.wustl.edu	37	1	160062257	160062257	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr1:160062257C>T	ENST00000368086.1	-	5	1757	c.1541G>A	c.(1540-1542)gGa>gAa	p.G514E	IGSF8_ENST00000460351.1_5'Flank|IGSF8_ENST00000314485.7_Missense_Mutation_p.G514E			Q969P0	IGSF8_HUMAN	immunoglobulin superfamily, member 8	514	Ig-like C2-type 4.				cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|nervous system development (GO:0007399)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(19)|pancreas(1)|prostate(1)|skin(1)	33	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			GACAGGGCCTCCTCCAGGCCG	0.672																																																	0													31.0	32.0	32.0					1																	160062257		2203	4300	6503	SO:0001583	missense	93185			AF407274	CCDS1195.1	1q23.1	2013-01-11			ENSG00000162729	ENSG00000162729		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	17813	protein-coding gene	gene with protein product		606644				11504738, 11673522	Standard	NM_001206665		Approved	CD81P3, EWI2, PGRL, CD316	uc009wtf.3	Q969P0	OTTHUMG00000024075	ENST00000368086.1:c.1541G>A	1.37:g.160062257C>T	ENSP00000357065:p.Gly514Glu		Q8NG09|Q96DP4|Q9BTG9	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.G514E	ENST00000368086.1	37	c.1541	CCDS1195.1	1	.	.	.	.	.	.	.	.	.	.	C	17.74	3.463564	0.63513	.	.	ENSG00000162729	ENST00000314485;ENST00000368086	T;T	0.04758	3.56;3.56	2.76	2.76	0.32466	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.932533	0.08839	U	0.886174	T	0.05914	0.0154	L	0.41824	1.3	0.44402	D	0.997314	D	0.89917	1.0	D	0.72075	0.976	T	0.51545	-0.8692	10	0.12766	T	0.61	-7.0138	12.3329	0.55049	0.0:1.0:0.0:0.0	.	514	Q969P0	IGSF8_HUMAN	E	514	ENSP00000316664:G514E;ENSP00000357065:G514E	ENSP00000316664:G514E	G	-	2	0	IGSF8	158328881	1.000000	0.71417	0.999000	0.59377	0.969000	0.65631	5.582000	0.67477	1.358000	0.45922	0.400000	0.26472	GGA	IGSF8	-	smart_Ig_sub		0.672	IGSF8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF8	HGNC	protein_coding	OTTHUMT00000060636.1	C	NM_052868		160062257	-1	no_errors	ENST00000314485	ensembl	human	known	70_37	missense	SNP	1.000	T
IPO7	10527	genome.wustl.edu	37	11	9424778	9424778	+	Intron	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr11:9424778C>T	ENST00000379719.3	+	2	226				IPO7_ENST00000533680.1_3'UTR	NM_006391.2	NP_006382.1	O95373	IPO7_HUMAN	importin 7						innate immune response (GO:0045087)|protein import into nucleus (GO:0006606)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)|small GTPase regulator activity (GO:0005083)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		CCTCTTTGATCTGTAATTTTA	0.348																																																	0													66.0	52.0	56.0					11																	9424778		692	1591	2283	SO:0001627	intron_variant	10527			AF098799	CCDS31425.1	11p15.3	2010-12-02	2003-03-11	2003-03-14	ENSG00000205339	ENSG00000205339		"""Importins"""	9852	protein-coding gene	gene with protein product		605586	"""RAN binding protein 7"""	RANBP7		9214382	Standard	NM_006391		Approved	Imp7	uc001mho.3	O95373	OTTHUMG00000165753	ENST00000379719.3:c.85-59C>T	11.37:g.9424778C>T			A6NNM5|B2R786|Q1RMF7|Q9H177|Q9NTE3	RNA	SNP	-	NULL	ENST00000379719.3	37	NULL	CCDS31425.1	11																																																																																			IPO7	-	-		0.348	IPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO7	HGNC	protein_coding	OTTHUMT00000386022.1	C	NM_006391		9424778	+1	no_errors	ENST00000533680	ensembl	human	putative	70_37	rna	SNP	0.014	T
IPO7	10527	genome.wustl.edu	37	11	9450716	9450716	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr11:9450716C>G	ENST00000379719.3	+	14	1706	c.1564C>G	c.(1564-1566)Caa>Gaa	p.Q522E	SNORA23_ENST00000365128.1_RNA|CTD-2371O3.2_ENST00000531111.1_RNA	NM_006391.2	NP_006382.1	O95373	IPO7_HUMAN	importin 7	522					innate immune response (GO:0045087)|protein import into nucleus (GO:0006606)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)|small GTPase regulator activity (GO:0005083)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		CATTGCCCTTCAAGTATTGAT	0.408																																																	0													82.0	79.0	80.0					11																	9450716		2201	4295	6496	SO:0001583	missense	10527			AF098799	CCDS31425.1	11p15.3	2010-12-02	2003-03-11	2003-03-14	ENSG00000205339	ENSG00000205339		"""Importins"""	9852	protein-coding gene	gene with protein product		605586	"""RAN binding protein 7"""	RANBP7		9214382	Standard	NM_006391		Approved	Imp7	uc001mho.3	O95373	OTTHUMG00000165753	ENST00000379719.3:c.1564C>G	11.37:g.9450716C>G	ENSP00000369042:p.Gln522Glu		A6NNM5|B2R786|Q1RMF7|Q9H177|Q9NTE3	Missense_Mutation	SNP	pfam_Importin-beta_N,pfam_Exportin/Importin_Cse1-like,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.Q522E	ENST00000379719.3	37	c.1564	CCDS31425.1	11	.	.	.	.	.	.	.	.	.	.	C	28.6	4.938534	0.92526	.	.	ENSG00000205339	ENST00000379719	T	0.66280	-0.2	5.95	5.95	0.96441	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.81442	0.4823	M	0.87971	2.92	0.80722	D	1	D	0.69078	0.997	D	0.79784	0.993	T	0.76583	-0.2906	10	0.13470	T	0.59	.	20.3932	0.98965	0.0:1.0:0.0:0.0	.	522	O95373	IPO7_HUMAN	E	522	ENSP00000369042:Q522E	ENSP00000369042:Q522E	Q	+	1	0	IPO7	9407292	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	7.818000	0.86416	2.824000	0.97209	0.655000	0.94253	CAA	IPO7	-	superfamily_ARM-type_fold		0.408	IPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO7	HGNC	protein_coding	OTTHUMT00000386022.1	C	NM_006391		9450716	+1	no_errors	ENST00000379719	ensembl	human	known	70_37	missense	SNP	1.000	G
ISLR	3671	genome.wustl.edu	37	15	74467327	74467327	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr15:74467327C>T	ENST00000249842.3	+	2	485	c.128C>T	c.(127-129)tCc>tTc	p.S43F	ISLR_ENST00000395118.1_Missense_Mutation_p.S43F|RP11-665J16.1_ENST00000561647.1_RNA	NM_005545.3	NP_005536.1	O14498	ISLR_HUMAN	immunoglobulin superfamily containing leucine-rich repeat	43	LRRNT.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	20						GACCTAGAATCCGTGCCGCCT	0.657																																																	0													65.0	57.0	60.0					15																	74467327		2198	4297	6495	SO:0001583	missense	3671			AB003184	CCDS10260.1	15q23-q24	2013-01-11			ENSG00000129009	ENSG00000129009		"""Immunoglobulin superfamily / I-set domain containing"""	6133	protein-coding gene	gene with protein product		602059				9325048	Standard	NM_005545		Approved	HsT17563	uc002axh.1	O14498	OTTHUMG00000137623	ENST00000249842.3:c.128C>T	15.37:g.74467327C>T	ENSP00000249842:p.Ser43Phe			Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub2,pfscan_Ig-like	p.S43F	ENST00000249842.3	37	c.128	CCDS10260.1	15	.	.	.	.	.	.	.	.	.	.	C	2.305	-0.359340	0.05138	.	.	ENSG00000129009	ENST00000249842;ENST00000395118	T;T	0.44881	0.91;0.91	4.05	2.01	0.26516	Leucine-rich repeat-containing N-terminal (1);	0.956525	0.08512	U	0.934785	T	0.40743	0.1129	M	0.63169	1.94	0.09310	N	1	B	0.25272	0.122	B	0.24541	0.054	T	0.35400	-0.9790	10	0.51188	T	0.08	.	8.2098	0.31478	0.4485:0.4177:0.1338:0.0	.	43	O14498	ISLR_HUMAN	F	43	ENSP00000249842:S43F;ENSP00000378550:S43F	ENSP00000249842:S43F	S	+	2	0	ISLR	72254380	0.000000	0.05858	0.016000	0.15963	0.017000	0.09413	0.127000	0.15790	0.153000	0.19213	0.313000	0.20887	TCC	ISLR	-	NULL		0.657	ISLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISLR	HGNC	protein_coding	OTTHUMT00000269044.1	C	NM_005545		74467327	+1	no_errors	ENST00000249842	ensembl	human	known	70_37	missense	SNP	0.000	T
KCNJ6	3763	genome.wustl.edu	37	21	39086857	39086857	+	Silent	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr21:39086857C>T	ENST00000609713.1	-	3	1192	c.603G>A	c.(601-603)gaG>gaA	p.E201E	KCNJ6-IT1_ENST00000435001.1_RNA|KCNJ6_ENST00000288309.6_Silent_p.E201E	NM_002240.3	NP_002231.1	P48051	KCNJ6_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 6	201					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22					Halothane(DB01159)	AGACCAGGGTCTCTGCCCTCT	0.483																																					Pancreas(48;379 1118 2936 19024 28214)												0													56.0	55.0	56.0					21																	39086857		1936	4162	6098	SO:0001819	synonymous_variant	3763			U24660	CCDS42927.1	21q22.1	2011-07-05			ENSG00000157542	ENSG00000157542		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6267	protein-coding gene	gene with protein product		600877		KCNJ7		7796919, 16382105	Standard	NM_002240		Approved	Kir3.2, GIRK2, KATP2, BIR1, hiGIRK2	uc002ywo.3	P48051	OTTHUMG00000086667	ENST00000609713.1:c.603G>A	21.37:g.39086857C>T			Q3MJ74|Q53WW6	Silent	SNP	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir3.2	p.E201	ENST00000609713.1	37	c.603	CCDS42927.1	21																																																																																			KCNJ6	-	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir		0.483	KCNJ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ6	HGNC	protein_coding	OTTHUMT00000194828.2	C	NM_002240		39086857	-1	no_errors	ENST00000288309	ensembl	human	known	70_37	silent	SNP	1.000	T
KCNQ1	3784	genome.wustl.edu	37	11	2797249	2797249	+	Silent	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr11:2797249C>T	ENST00000155840.5	+	13	1758	c.1650C>T	c.(1648-1650)ctC>ctT	p.L550L	KCNQ1_ENST00000335475.5_Silent_p.L423L	NM_000218.2	NP_000209.2	P51787	KCNQ1_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 1	550					atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|cardiovascular system development (GO:0072358)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|gene silencing (GO:0016458)|male gonad development (GO:0008584)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of insulin secretion (GO:0046676)|positive regulation of gastric acid secretion (GO:0060454)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	basolateral plasma membrane (GO:0016323)|early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)|zymogen granule membrane (GO:0042589)	calmodulin binding (GO:0005516)|delayed rectifier potassium channel activity (GO:0005251)|ion channel binding (GO:0044325)|outward rectifier potassium channel activity (GO:0015271)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|protein phosphatase 1 binding (GO:0008157)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)	21		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)	AGGGCCACCTCAACCTCATGG	0.642																																																	0													76.0	58.0	64.0					11																	2797249		2195	4288	6483	SO:0001819	synonymous_variant	3784			AF000571	CCDS7736.1	11p15.5	2014-09-17			ENSG00000053918	ENSG00000053918		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6294	protein-coding gene	gene with protein product	"""Jervell and Lange-Nielsen syndrome 1"""	607542		LQT, KCNA9		8528244, 16382104	Standard	NM_181798		Approved	Kv7.1, KCNA8, KVLQT1, JLNS1, LQT1	uc001lwn.3	P51787	OTTHUMG00000009900	ENST00000155840.5:c.1650C>T	11.37:g.2797249C>T			O00347|O60607|O94787|Q14D14|Q7Z6G9|Q92960|Q9UMN8|Q9UMN9	Silent	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ion_trans_dom,pfam_Ion_trans_2,prints_K_chnl_volt-dep_KCQN1,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.L550	ENST00000155840.5	37	c.1650	CCDS7736.1	11																																																																																			KCNQ1	-	pfam_K_chnl_volt-dep_KCNQ_C		0.642	KCNQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNQ1	HGNC	protein_coding	OTTHUMT00000027382.2	C	NM_000218		2797249	+1	no_errors	ENST00000155840	ensembl	human	known	70_37	silent	SNP	1.000	T
KDM2B	84678	genome.wustl.edu	37	12	121880462	121880462	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr12:121880462C>T	ENST00000377071.4	-	19	2854	c.2782G>A	c.(2782-2784)Gag>Aag	p.E928K	KDM2B_ENST00000542973.1_Missense_Mutation_p.E296K|KDM2B_ENST00000377069.4_Missense_Mutation_p.E859K|KDM2B_ENST00000536437.1_Intron	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	928					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						TTCTTCTCCTCCGGGCCCTCG	0.677																																																	0													19.0	21.0	20.0					12																	121880462		1999	4161	6160	SO:0001583	missense	84678			AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.2782G>A	12.37:g.121880462C>T	ENSP00000366271:p.Glu928Lys		A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Missense_Mutation	SNP	pfam_Znf_CXXC,pfam_F-box_dom_cyclin-like,pfam_JmjC_dom,superfamily_Znf_FYVE_PHD,smart_JmjC_dom,smart_Znf_PHD,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.E928K	ENST00000377071.4	37	c.2782	CCDS41850.1	12	.	.	.	.	.	.	.	.	.	.	C	18.29	3.590579	0.66219	.	.	ENSG00000089094	ENST00000397480;ENST00000542973;ENST00000377069;ENST00000377071;ENST00000540043;ENST00000261824	T;T;T	0.25414	2.13;2.46;1.8	5.72	5.72	0.89469	.	0.199500	0.34802	N	0.003679	T	0.22437	0.0541	L	0.42245	1.32	0.80722	D	1	P;B;B;B	0.34522	0.455;0.001;0.361;0.0	B;B;B;B	0.32211	0.142;0.001;0.079;0.001	T	0.02138	-1.1207	10	0.35671	T	0.21	-27.9828	13.1112	0.59275	0.0:0.9271:0.0:0.0729	.	368;928;859;371	B7ZB05;Q8NHM5;A8MRS1;B4DSN4	.;KDM2B_HUMAN;.;.	K	916;296;859;928;371;931	ENSP00000437821:E296K;ENSP00000366269:E859K;ENSP00000366271:E928K	ENSP00000261824:E931K	E	-	1	0	KDM2B	120364845	0.757000	0.28394	0.958000	0.39756	0.918000	0.54935	1.212000	0.32394	2.698000	0.92095	0.655000	0.94253	GAG	KDM2B	-	NULL		0.677	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KDM2B	HGNC	protein_coding	OTTHUMT00000402132.2	C	NM_032590		121880462	-1	no_errors	ENST00000377071	ensembl	human	known	70_37	missense	SNP	0.985	T
KIAA0754	643314	genome.wustl.edu	37	1	39876478	39876478	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr1:39876478C>T	ENST00000530275.1	+	1	328	c.133C>T	c.(133-135)Cat>Tat	p.H45Y	MACF1_ENST00000361689.2_Intron|MACF1_ENST00000567887.1_Intron|MACF1_ENST00000564288.1_Intron|MACF1_ENST00000372915.3_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000289893.4_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	45	13 X 13 AA approximate tandem repeat of P-T-S-P-A-A-A-V-P-T-P-E-E.									central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AAGTTCTGGTCATTTGGACCA	0.433																																																	0													48.0	49.0	49.0					1																	39876478		1878	4110	5988	SO:0001583	missense	643314					1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.133C>T	1.37:g.39876478C>T	ENSP00000431179:p.His45Tyr		E9PMC2|Q6ZSB2	Missense_Mutation	SNP	NULL	p.H45Y	ENST00000530275.1	37	c.133		1	.	.	.	.	.	.	.	.	.	.	C	15.48	2.846733	0.51164	.	.	ENSG00000255103	ENST00000530275	T	0.25912	1.77	4.59	4.59	0.56863	.	.	.	.	.	T	0.33933	0.0880	N	0.24115	0.695	0.20403	N	0.999906	D	0.69078	0.997	D	0.63793	0.918	T	0.12477	-1.0546	9	0.87932	D	0	.	11.6846	0.51479	0.1764:0.8236:0.0:0.0	.	45	O94854	K0754_HUMAN	Y	45	ENSP00000431179:H45Y	ENSP00000431179:H45Y	H	+	1	0	RP4-562N20.1	39649065	0.090000	0.21635	1.000000	0.80357	0.952000	0.60782	1.453000	0.35167	2.098000	0.63641	0.555000	0.69702	CAT	KIAA0754	-	NULL		0.433	KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	KIAA0754	HGNC	protein_coding	OTTHUMT00000392100.1	C	NM_015038		39876478	+1	no_errors	ENST00000530275	ensembl	human	known	70_37	missense	SNP	0.985	T
KIAA0754	643314	genome.wustl.edu	37	1	39877325	39877325	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr1:39877325C>T	ENST00000530275.1	+	1	1175	c.980C>T	c.(979-981)tCa>tTa	p.S327L	MACF1_ENST00000361689.2_Intron|MACF1_ENST00000567887.1_Intron|MACF1_ENST00000564288.1_Intron|MACF1_ENST00000372915.3_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000289893.4_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	327										central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GACACAGACTCAGTGCAGATG	0.448											OREG0013393	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													145.0	140.0	141.0					1																	39877325		1932	4148	6080	SO:0001583	missense	643314					1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.980C>T	1.37:g.39877325C>T	ENSP00000431179:p.Ser327Leu	889	E9PMC2|Q6ZSB2	Missense_Mutation	SNP	NULL	p.S327L	ENST00000530275.1	37	c.980		1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.976028	0.92982	.	.	ENSG00000255103	ENST00000530275	D	0.86497	-2.13	5.14	5.14	0.70334	.	.	.	.	.	D	0.90048	0.6892	L	0.27053	0.805	0.31874	N	0.619335	D	0.89917	1.0	D	0.91635	0.999	D	0.90686	0.4609	9	0.87932	D	0	.	18.626	0.91338	0.0:1.0:0.0:0.0	.	327	O94854	K0754_HUMAN	L	327	ENSP00000431179:S327L	ENSP00000431179:S327L	S	+	2	0	RP4-562N20.1	39649912	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.069000	0.71209	2.398000	0.81561	0.655000	0.94253	TCA	KIAA0754	-	NULL		0.448	KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	KIAA0754	HGNC	protein_coding	OTTHUMT00000392100.1	C	NM_015038		39877325	+1	no_errors	ENST00000530275	ensembl	human	known	70_37	missense	SNP	1.000	T
KRTAP4-8	728224	genome.wustl.edu	37	17	39254141	39254141	+	Missense_Mutation	SNP	G	G	A	rs565841925		TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr17:39254141G>A	ENST00000333822.4	-	1	252	c.196C>T	c.(196-198)Cgc>Tgc	p.R66C		NM_031960.2	NP_114166.1	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4-8	66	25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)	11						CAGCTGGGGCGACAGCAGGTG	0.657													T|||	1	0.000199681	0.0	0.0	5008	,	,		13243	0.0		0.0	False		,,,				2504	0.001																0													6.0	9.0	8.0					17																	39254141		631	1468	2099	SO:0001583	missense	728224			AJ406940	CCDS45674.1	17q21.2	2013-06-25			ENSG00000204880	ENSG00000204880		"""Keratin associated proteins"""	17230	protein-coding gene	gene with protein product						11279113	Standard	NM_031960		Approved	KAP4.8	uc010wfo.2	Q9BYQ9	OTTHUMG00000133580	ENST00000333822.4:c.196C>T	17.37:g.39254141G>A	ENSP00000328444:p.Arg66Cys		A8MSH3	Missense_Mutation	SNP	pfam_Keratin-assoc	p.R66C	ENST00000333822.4	37	c.196	CCDS45674.1	17	.	.	.	.	.	.	.	.	.	.	.	13.51	2.258826	0.39896	.	.	ENSG00000204880	ENST00000333822;ENST00000332991	T	0.01516	4.81	3.65	-0.372	0.12520	.	2.056800	0.03377	U	0.199853	T	0.02342	0.0072	M	0.72479	2.2	0.09310	N	1	P	0.38767	0.646	B	0.25759	0.063	T	0.43507	-0.9387	10	0.59425	D	0.04	.	2.2459	0.04031	0.1018:0.1594:0.3305:0.4083	.	66	Q9BYQ9	KRA48_HUMAN	C	66	ENSP00000328444:R66C	ENSP00000414561:R66C	R	-	1	0	KRTAP4-8	36507667	0.000000	0.05858	0.001000	0.08648	0.442000	0.32017	-0.381000	0.07417	-0.316000	0.08690	0.449000	0.29647	CGC	KRTAP4-8	-	pfam_Keratin-assoc		0.657	KRTAP4-8-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	KRTAP4-8	HGNC	protein_coding	OTTHUMT00000257684.1	G	NM_031960		39254141	-1	no_errors	ENST00000333822	ensembl	human	known	70_37	missense	SNP	0.001	A
LOC400499	400499	genome.wustl.edu	37	16	11556106	11556106	+	Silent	SNP	C	C	T	rs552632415		TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr16:11556106C>T	ENST00000344649.3	-	12	1589	c.57G>A	c.(55-57)gcG>gcA	p.A19A																								CCTCCAGCTGCGCCTGGAACC	0.667													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17688	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001819	synonymous_variant	101060360																														ENST00000344649.3:c.57G>A	16.37:g.11556106C>T				Silent	SNP	NULL	p.A19	ENST00000344649.3	37	c.57		16																																																																																			CTD-3088G3.8	-	NULL		0.667	CTD-3088G3.8-201	KNOWN	basic|appris_principal	protein_coding	LOC101060360	Clone_based_vega_gene	protein_coding		C			11556106	-1	no_errors	ENST00000344649	ensembl	human	known	70_37	silent	SNP	0.909	T
LRP6	4040	genome.wustl.edu	37	12	12318043	12318043	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr12:12318043G>C	ENST00000261349.4	-	8	1808	c.1732C>G	c.(1732-1734)Cta>Gta	p.L578V	LRP6_ENST00000543091.1_Missense_Mutation_p.L578V	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	578	Beta-propeller 2.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				GTAGCCTTTAGGCCCATGAGG	0.443																																																	0													148.0	136.0	140.0					12																	12318043		2203	4300	6503	SO:0001583	missense	4040			AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.1732C>G	12.37:g.12318043G>C	ENSP00000261349:p.Leu578Val		Q17RZ2	Missense_Mutation	SNP	pfam_LDLR_classB_rpt,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDLR_classB_rpt,smart_EG-like_dom,smart_LDrepeatLR_classA_rpt,pirsf_Low_density_Lipo_rcpt-rel_p5/6,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.L578V	ENST00000261349.4	37	c.1732	CCDS8647.1	12	.	.	.	.	.	.	.	.	.	.	G	14.08	2.428079	0.43122	.	.	ENSG00000070018	ENST00000261349;ENST00000543091	D;D	0.93547	-3.24;-3.24	5.12	4.23	0.50019	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.48767	D	0.000171	D	0.93973	0.8070	L	0.42686	1.345	0.58432	D	0.999999	D;B	0.67145	0.996;0.021	D;B	0.72625	0.978;0.056	D	0.92029	0.5632	10	0.29301	T	0.29	.	11.1903	0.48681	0.1498:0.0:0.8502:0.0	.	578;578	F5H7J9;O75581	.;LRP6_HUMAN	V	578	ENSP00000261349:L578V;ENSP00000442472:L578V	ENSP00000261349:L578V	L	-	1	2	LRP6	12209310	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.834000	0.62774	1.289000	0.44618	0.460000	0.39030	CTA	LRP6	-	pirsf_Low_density_Lipo_rcpt-rel_p5/6		0.443	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP6	HGNC	protein_coding	OTTHUMT00000400137.1	G			12318043	-1	no_errors	ENST00000261349	ensembl	human	known	70_37	missense	SNP	1.000	C
MAGEC3	139081	genome.wustl.edu	37	X	140984602	140984602	+	Intron	SNP	C	C	G			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chrX:140984602C>G	ENST00000298296.1	+	7	1123				MAGEC3_ENST00000443323.2_Intron|MAGEC3_ENST00000544766.1_Missense_Mutation_p.S55C|MAGEC3_ENST00000483584.1_3'UTR|MAGEC3_ENST00000409007.1_Missense_Mutation_p.S55C|MAGEC3_ENST00000536088.1_Missense_Mutation_p.S55C	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3											NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					ccctcctcctcttccttgtcc	0.517																																																	0													120.0	72.0	88.0					X																	140984602		2203	4300	6503	SO:0001627	intron_variant	139081			AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.1124-66C>G	X.37:g.140984602C>G			Q3SYA7|Q5JZ43|Q9BZ80	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.S55C	ENST00000298296.1	37	c.164	CCDS14676.1	X	.	.	.	.	.	.	.	.	.	.	c	5.296	0.239989	0.10023	.	.	ENSG00000165509	ENST00000536088;ENST00000544766;ENST00000409007	T;T;T	0.04502	3.61;3.61;3.61	1.32	-0.803	0.10886	.	.	.	.	.	T	0.05456	0.0144	.	.	.	0.09310	N	1	D	0.67145	0.996	P	0.46172	0.506	T	0.31971	-0.9924	8	0.72032	D	0.01	.	4.0234	0.09677	0.0:0.4934:0.0:0.5066	.	55	Q3SYA7	.	C	55	ENSP00000441107:S55C;ENSP00000440444:S55C;ENSP00000386566:S55C	ENSP00000386566:S55C	S	+	2	0	MAGEC3	140812268	0.000000	0.05858	0.005000	0.12908	0.056000	0.15407	-0.759000	0.04761	-0.408000	0.07565	0.363000	0.22086	TCT	MAGEC3	-	NULL		0.517	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC3	HGNC	protein_coding	OTTHUMT00000058606.1	C	NM_138702		140984602	+1	no_errors	ENST00000536088	ensembl	human	known	70_37	missense	SNP	0.005	G
MAP3K5	4217	genome.wustl.edu	37	6	137041602	137041602	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr6:137041602G>C	ENST00000359015.4	-	2	934	c.574C>G	c.(574-576)Ctg>Gtg	p.L192V		NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	192					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)	p.L192V(1)		NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		AGTGACTGCAGAGAGTCCGAG	0.443																																																	1	Substitution - Missense(1)	urinary_tract(1)											207.0	176.0	186.0					6																	137041602		2203	4300	6503	SO:0001583	missense	4217			U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.574C>G	6.37:g.137041602G>C	ENSP00000351908:p.Leu192Val		A6NIA0|B4DGB2|Q5THN3|Q99461	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L192V	ENST00000359015.4	37	c.574	CCDS5179.1	6	.	.	.	.	.	.	.	.	.	.	G	17.30	3.355951	0.61293	.	.	ENSG00000197442	ENST00000359015;ENST00000367768	T	0.10099	2.91	6.17	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.18130	0.0435	L	0.49350	1.555	0.80722	D	1	P;D;D	0.89917	0.877;1.0;0.999	P;D;D	0.87578	0.627;0.998;0.994	T	0.01039	-1.1472	10	0.46703	T	0.11	.	15.327	0.74172	0.0663:0.0:0.9337:0.0	.	272;37;192	Q59GL6;B4DF67;Q99683	.;.;M3K5_HUMAN	V	192;272	ENSP00000351908:L192V	ENSP00000351908:L192V	L	-	1	2	MAP3K5	137083295	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	3.761000	0.55242	1.620000	0.50308	0.655000	0.94253	CTG	MAP3K5	-	NULL		0.443	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K5	HGNC	protein_coding	OTTHUMT00000042383.1	G			137041602	-1	no_errors	ENST00000359015	ensembl	human	known	70_37	missense	SNP	1.000	C
MARK2	2011	genome.wustl.edu	37	11	63668148	63668149	+	Splice_Site	DNP	GA	GA	CT			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G|A	G|A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr11:63668148_63668149GA>CT	ENST00000509502.2	+	9	1250_1251	c.787_788GA>CT	c.(787-789)GAg>CTg	p.E263L	MARK2_ENST00000508192.1_Splice_Site_p.E296L|MARK2_ENST00000408948.3_Splice_Site_p.E263L|MARK2_ENST00000361128.5_Splice_Site_p.E296L|MARK2_ENST00000377809.4_Splice_Site_p.E296L|MARK2_ENST00000350490.7_Splice_Site_p.E296L|MARK2_ENST00000402010.2_Splice_Site_p.E296L|MARK2_ENST00000513765.2_Splice_Site_p.E263L|MARK2_ENST00000315032.8_Splice_Site_p.E296L|MARK2_ENST00000502399.3_Splice_Site_p.E296L|MARK2_ENST00000425897.2_Splice_Site_p.E263L|MARK2_ENST00000413835.2_Splice_Site_p.E296L|MARK2_ENST00000377810.3_Splice_Site_p.E263L	NM_017490.3	NP_059672.2			MAP/microtubule affinity-regulating kinase 2											autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33						AGGCACTTTAGAGGTGAGCAGT	0.51																																																	0																																										SO:0001630	splice_region_variant	2011			BC008771	CCDS8051.1, CCDS41665.1, CCDS8051.2, CCDS53649.1, CCDS53650.1, CCDS53651.1	11q13.1	2013-06-27	2002-07-26	2002-08-01	ENSG00000072518	ENSG00000072518			3332	protein-coding gene	gene with protein product	"""ELKL motif kinase 1"", ""serine/threonine kinase"", ""protein-serine/threonine kinase"", ""Ser/Thr protein kinase PAR-1B"""	600526	"""ELKL motif kinase"""	EMK1		9730619, 10516437	Standard	NM_017490		Approved	PAR-1, Par1b, PAR-1B	uc001nxw.3	Q7KZI7	OTTHUMG00000160504	Exception_encountered	11.37:g.63668148_63668149delinsCT				Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase-assoc_KA1,superfamily_Kinase-like_dom,superfamily_Kinase-assoc_KA1,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E296Q|p.E296V	ENST00000509502.2	37	c.886|c.887	CCDS41665.1	11																																																																																			MARK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.510	MARK2-003	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	MARK2	HGNC	protein_coding	OTTHUMT00000360862.2	G|A	NM_017490	Missense_Mutation	63668148|63668149	+1	no_errors	ENST00000402010	ensembl	human	known	70_37	missense	SNP	1.000	C|T
MAS1	4142	genome.wustl.edu	37	6	160328132	160328132	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr6:160328132G>C	ENST00000252660.4	+	1	159	c.145G>C	c.(145-147)Gag>Cag	p.E49Q		NM_002377.2	NP_002368.1	P04201	MAS_HUMAN	MAS1 proto-oncogene, G protein-coupled receptor	49					activation of NF-kappaB-inducing kinase activity (GO:0007250)|anatomical structure morphogenesis (GO:0009653)|cell proliferation (GO:0008283)|cellular response to peptide hormone stimulus (GO:0071375)|G-protein coupled receptor signaling pathway (GO:0007186)|hippocampus development (GO:0021766)|male gonad development (GO:0008584)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of inositol phosphate biosynthetic process (GO:0060732)|protein kinase C signaling (GO:0070528)|regulation of inflammatory response (GO:0050727)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	angiotensin receptor activity (GO:0001595)|angiotensin type II receptor activity (GO:0004945)|G-protein coupled receptor activity (GO:0004930)|peptide binding (GO:0042277)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	23		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.44e-18)|BRCA - Breast invasive adenocarcinoma(81;5.6e-06)		GGGGTTTGTTGAGAATGGGAT	0.517																																																	0													212.0	205.0	207.0					6																	160328132		2203	4300	6503	SO:0001583	missense	4142			M13150	CCDS5272.1	6q24-q27	2014-06-26	2014-06-26		ENSG00000130368	ENSG00000130368		"""GPCR / Class A : Orphans"""	6899	protein-coding gene	gene with protein product		165180	"""MAS1 oncogene"""				Standard	NM_002377		Approved		uc003qsz.3	P04201	OTTHUMG00000015944	ENST00000252660.4:c.145G>C	6.37:g.160328132G>C	ENSP00000252660:p.Glu49Gln		E1P5B3|Q2TBC9|Q6FG47	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Proto-oncogene_Mas,prints_GPCR_Rhodpsn	p.E49Q	ENST00000252660.4	37	c.145	CCDS5272.1	6	.	.	.	.	.	.	.	.	.	.	G	13.08	2.129816	0.37630	.	.	ENSG00000130368	ENST00000252660	T	0.09538	2.97	5.72	4.83	0.62350	GPCR, rhodopsin-like superfamily (1);	0.222885	0.30809	N	0.008827	T	0.11665	0.0284	N	0.22421	0.69	0.39355	D	0.965821	D	0.64830	0.994	D	0.65323	0.934	T	0.08493	-1.0719	10	0.87932	D	0	.	15.7284	0.77780	0.0:0.1369:0.8631:0.0	.	49	P04201	MAS_HUMAN	Q	49	ENSP00000252660:E49Q	ENSP00000252660:E49Q	E	+	1	0	MAS1	160248122	0.994000	0.37717	0.392000	0.26245	0.076000	0.17211	4.195000	0.58400	1.380000	0.46344	0.655000	0.94253	GAG	MAS1	-	pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM		0.517	MAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAS1	HGNC	protein_coding	OTTHUMT00000042930.2	G	NM_002377		160328132	+1	no_errors	ENST00000252660	ensembl	human	known	70_37	missense	SNP	0.881	C
MEGF8	1954	genome.wustl.edu	37	19	42880215	42880215	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr19:42880215C>G	ENST00000251268.6	+	42	7826	c.7826C>G	c.(7825-7827)tCg>tGg	p.S2609W	MEGF8_ENST00000334370.4_Missense_Mutation_p.S2542W|MEGF8_ENST00000378073.4_Missense_Mutation_p.S203W	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	2609					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				GCCCTCAAGTCGAGCCGCTTC	0.687																																																	0													51.0	51.0	51.0					19																	42880215		2203	4298	6501	SO:0001583	missense	1954			AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.7826C>G	19.37:g.42880215C>G	ENSP00000251268:p.Ser2609Trp		A8KAY0|O75097	Missense_Mutation	SNP	pfam_CUB,pfam_EGF_laminin,pfam_Plexin_repeat,superfamily_Gal_Oxase/kelch_b-propeller,superfamily_CUB,superfamily_Plexin-like_fold,smart_CUB,smart_EG-like_dom,smart_Plexin-like,smart_EGF-like_Ca-bd,smart_EGF_laminin,pfscan_CUB,pfscan_EG-like_dom,pfscan_EGF_laminin	p.S2609W	ENST00000251268.6	37	c.7826		19	.	.	.	.	.	.	.	.	.	.	C	22.8	4.336971	0.81801	.	.	ENSG00000105429	ENST00000334370;ENST00000251268;ENST00000378073	T;T	0.23950	1.88;1.88	4.8	4.8	0.61643	.	0.000000	0.64402	D	0.000002	T	0.46444	0.1393	L	0.50333	1.59	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.984;0.983;0.995	T	0.45906	-0.9229	10	0.87932	D	0	-27.615	17.029	0.86456	0.0:1.0:0.0:0.0	.	203;2609;2542	F5GZG7;Q7Z7M0;Q7Z7M0-2	.;MEGF8_HUMAN;.	W	2542;2609;203	ENSP00000334219:S2542W;ENSP00000251268:S2609W	ENSP00000251268:S2609W	S	+	2	0	MEGF8	47572055	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.035000	0.76517	2.395000	0.81488	0.561000	0.74099	TCG	MEGF8	-	NULL		0.687	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	MEGF8	HGNC	protein_coding	OTTHUMT00000463854.1	C	NM_001410		42880215	+1	no_errors	ENST00000251268	ensembl	human	known	70_37	missense	SNP	1.000	G
METTL5	29081	genome.wustl.edu	37	2	170668947	170668947	+	Intron	SNP	G	G	C			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr2:170668947G>C	ENST00000260953.5	-	6	908				METTL5_ENST00000409837.1_Intron|METTL5_ENST00000409340.1_Intron|METTL5_ENST00000410097.1_Missense_Mutation_p.A204G|METTL5_ENST00000392640.2_Intron|METTL5_ENST00000409965.1_Intron|METTL5_ENST00000308099.3_Intron	NM_014168.2	NP_054887.2	Q9NRN9	METL5_HUMAN	methyltransferase like 5								methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)			breast(2)|central_nervous_system(1)|large_intestine(5)|lung(1)|prostate(1)	10						ATGTAGACCAGCCAAAATCAA	0.433																																																	0													155.0	157.0	156.0					2																	170668947		2203	4300	6503	SO:0001627	intron_variant	29081			AF201938	CCDS33320.1	2q31.1	2011-01-28			ENSG00000138382	ENSG00000138382			25006	protein-coding gene	gene with protein product						11042152	Standard	XM_005246478		Approved	HSPC133	uc002ufn.3	Q9NRN9	OTTHUMG00000154117	ENST00000260953.5:c.591+19C>G	2.37:g.170668947G>C			D3DPC9|Q9NVX1	Missense_Mutation	SNP	pfam_Small_mtfrase_dom,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_RNA_methylase_dom,pfam_RNA_MeTrfase_RsmD,pfam_RNA_cap_Gua-N2-MeTrfase,pfam_Methyltransf_11	p.A204G	ENST00000260953.5	37	c.611	CCDS33320.1	2	.	.	.	.	.	.	.	.	.	.	G	7.276	0.608090	0.14002	.	.	ENSG00000138382	ENST00000410097	.	.	.	3.86	0.917	0.19380	.	.	.	.	.	T	0.29288	0.0729	.	.	.	0.09310	N	1	B	0.20261	0.043	B	0.17433	0.018	T	0.27020	-1.0086	7	0.72032	D	0.01	.	5.8497	0.18685	0.3773:0.0:0.6227:0.0	.	204	B8ZZC8	.	G	204	.	ENSP00000387056:A204G	A	-	2	0	METTL5	170377193	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.500000	0.22562	0.170000	0.19704	-0.229000	0.12294	GCT	METTL5	-	NULL		0.433	METTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	METTL5	HGNC	protein_coding	OTTHUMT00000333957.1	G	NM_014168		170668947	-1	no_errors	ENST00000410097	ensembl	human	putative	70_37	missense	SNP	0.000	C
MICA	100507436	genome.wustl.edu	37	6	31380161	31380161	+	Frame_Shift_Del	DEL	G	G	-	rs41293539|rs547446871|rs138201170	byFrequency	TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr6:31380161delG	ENST00000449934.2	+	5	1006	c.952delG	c.(952-954)ggcfs	p.G318fs	HCP5_ENST00000414046.2_RNA	NM_001177519.1	NP_001170990.1			MHC class I polypeptide-related sequence A											breast(1)|endometrium(3)|kidney(1)	5		Ovarian(999;0.0253)				TGTTGCTGCTGGCTGCTGCTA	0.453													?|GG|G|unsure	1026	0.204872	0.0537	0.2824	5008	,	,		19280	0.3869		0.1272	False		,,,				2504	0.2464																0													218.0	178.0	190.0					6																	31380161		692	1576	2268	SO:0001589	frameshift_variant	100507436			L14848	CCDS56412.1, CCDS75421.1	6p21.3	2013-01-11			ENSG00000204520	ENSG00000204520		"""Immunoglobulin superfamily / C1-set domain containing"""	7090	protein-coding gene	gene with protein product		600169				8022771	Standard	NM_000247		Approved	PERB11.1	uc003ntk.1	Q29983	OTTHUMG00000031073	ENST00000449934.2:c.952delG	6.37:g.31380161delG	ENSP00000413079:p.Gly318fs			Frame_Shift_Del	DEL	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like	p.G318fs	ENST00000449934.2	37	c.952	CCDS56412.1	6																																																																																			MICA	-	NULL		0.453	MICA-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	MICA	HGNC	protein_coding	OTTHUMT00000076101.7	G	NM_001177519		31380161	+1	no_errors	ENST00000364810	ensembl	human	known	70_37	frame_shift_del	DEL	0.000	-
MKL1	57591	genome.wustl.edu	37	22	40816412	40816412	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr22:40816412C>T	ENST00000355630.3	-	11	1640	c.1050G>A	c.(1048-1050)atG>atA	p.M350I	MKL1_ENST00000407029.1_Missense_Mutation_p.M350I|MKL1_ENST00000402042.1_Missense_Mutation_p.M300I|MKL1_ENST00000396617.3_Missense_Mutation_p.M350I	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1	350	SAP. {ECO:0000255|PROSITE- ProRule:PRU00186}.				negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						CATGTACCTTCATGTCGTCCA	0.652			T	RBM15	acute megakaryocytic leukemia																																			Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	0													46.0	48.0	47.0					22																	40816412		2203	4299	6502	SO:0001583	missense	57591			AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146	ENST00000355630.3:c.1050G>A	22.37:g.40816412C>T	ENSP00000347847:p.Met350Ile		Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Missense_Mutation	SNP	pfam_RPEL_repeat,pfam_SAP_DNA-bd,smart_RPEL_repeat,smart_SAP_DNA-bd,pfscan_RPEL_repeat,pfscan_SAP_DNA-bd	p.M350I	ENST00000355630.3	37	c.1050	CCDS14003.1	22	.	.	.	.	.	.	.	.	.	.	C	24.1	4.490398	0.84962	.	.	ENSG00000196588	ENST00000355630;ENST00000396617;ENST00000402042;ENST00000407029	T;T;T;T	0.50813	0.76;0.73;0.78;0.76	4.98	4.98	0.66077	DNA-binding SAP (4);	0.185534	0.56097	D	0.000021	T	0.73353	0.3576	M	0.86953	2.85	0.54753	D	0.999984	D;D;D	0.54964	0.959;0.969;0.969	P;D;D	0.70227	0.626;0.968;0.968	T	0.77680	-0.2497	10	0.59425	D	0.04	-37.6929	18.4514	0.90704	0.0:1.0:0.0:0.0	.	300;350;350	B0QY83;E7ER32;Q969V6	.;.;MKL1_HUMAN	I	350;350;300;350	ENSP00000347847:M350I;ENSP00000379861:M350I;ENSP00000385584:M300I;ENSP00000385835:M350I	ENSP00000347847:M350I	M	-	3	0	MKL1	39146358	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	3.103000	0.50298	2.598000	0.87819	0.561000	0.74099	ATG	MKL1	-	pfam_SAP_DNA-bd,smart_SAP_DNA-bd,pfscan_SAP_DNA-bd		0.652	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKL1	HGNC	protein_coding	OTTHUMT00000321522.1	C	NM_020831		40816412	-1	no_errors	ENST00000355630	ensembl	human	known	70_37	missense	SNP	1.000	T
MOCS1	4337	genome.wustl.edu	37	6	39883833	39883833	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr6:39883833C>G	ENST00000340692.5	-	4	565	c.562G>C	c.(562-564)Gag>Cag	p.E188Q	MOCS1_ENST00000373175.4_Missense_Mutation_p.E159Q|MOCS1_ENST00000373186.4_Missense_Mutation_p.E188Q|MOCS1_ENST00000373195.3_Missense_Mutation_p.E101Q|MOCS1_ENST00000432280.2_Missense_Mutation_p.E159Q|MOCS1_ENST00000373188.2_Missense_Mutation_p.E188Q|MOCS1_ENST00000308559.7_Missense_Mutation_p.E188Q|MOCS1_ENST00000425303.2_Missense_Mutation_p.E188Q			Q9NZB8	MOCS1_HUMAN	molybdenum cofactor synthesis 1	188	Molybdenum cofactor biosynthesis protein A.				Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|molybdopterin synthase complex (GO:0019008)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|cyclic pyranopterin monophosphate synthase activity (GO:0061597)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)	p.E188Q(2)		central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	21	Ovarian(28;0.0355)|Colorectal(47;0.196)					ACAATGAACTCAAACTTGGCA	0.607																																					NSCLC(84;861 1413 23785 24908 42279)|Melanoma(182;611 2047 9114 11847 26639)												2	Substitution - Missense(2)	pancreas(2)											41.0	32.0	35.0					6																	39883833		2203	4300	6503	SO:0001583	missense	4337			AJ224328	CCDS4846.1, CCDS43460.1	6p21.2	2012-05-08			ENSG00000124615	ENSG00000124615			7190	protein-coding gene	gene with protein product		603707				9731530, 10053004	Standard	NM_001075098		Approved	MOCOD	uc003opb.3	Q9NZB8	OTTHUMG00000014656	ENST00000340692.5:c.562G>C	6.37:g.39883833C>G	ENSP00000344794:p.Glu188Gln		B3KPT7|B4DTP1|O14940|O14941|O75710|Q5J7W0|Q5TCE1|Q5TCE2|Q5TCE6|Q5TCE9|Q5TCF0|Q5TCF1|Q8N418|Q9NZB7|Q9UEM1	Missense_Mutation	SNP	pfam_Mopterin_CF_biosynth-C_dom,pfam_Mob_synth_C,pfam_rSAM,superfamily_Mopterin_CF_biosynth-C_dom,smart_Elp3/MiaB/NifB,tigrfam_MoaA,tigrfam_Mo_CF_biosynth-C	p.E188Q	ENST00000340692.5	37	c.562		6	.	.	.	.	.	.	.	.	.	.	C	15.25	2.778289	0.49786	.	.	ENSG00000124615	ENST00000373186;ENST00000308559;ENST00000373175;ENST00000373188;ENST00000373195;ENST00000340692;ENST00000425303;ENST00000432280	D;D;D;D;D;D;D;D	0.92099	-2.97;-2.97;-2.97;-2.97;-2.97;-2.97;-2.97;-2.97	5.67	5.67	0.87782	Elongator protein 3/MiaB/NifB (1);Aldolase-type TIM barrel (1);Radical SAM (1);	0.000000	0.85682	D	0.000000	D	0.91071	0.7190	L	0.31578	0.945	0.80722	D	1	D;P;P;P;D	0.54601	0.959;0.917;0.943;0.929;0.967	P;P;P;P;P	0.59487	0.835;0.721;0.823;0.771;0.858	D	0.89631	0.3855	9	.	.	.	-35.6192	19.3581	0.94422	0.0:1.0:0.0:0.0	.	188;188;188;188;188	Q9NZB8-2;Q9NZB8-5;Q9NZB8;Q9NZB8-8;Q9NZB8-6	.;.;MOCS1_HUMAN;.;.	Q	188;188;159;188;101;188;188;159	ENSP00000362282:E188Q;ENSP00000309843:E188Q;ENSP00000362270:E159Q;ENSP00000362284:E188Q;ENSP00000362291:E101Q;ENSP00000344794:E188Q;ENSP00000416478:E188Q;ENSP00000410809:E159Q	.	E	-	1	0	MOCS1	39991811	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.783000	0.85696	2.675000	0.91044	0.650000	0.86243	GAG	MOCS1	-	pfam_rSAM,smart_Elp3/MiaB/NifB,tigrfam_MoaA		0.607	MOCS1-005	KNOWN	basic|appris_candidate_longest	protein_coding	MOCS1	HGNC	protein_coding	OTTHUMT00000040476.2	C	NM_005943		39883833	-1	no_errors	ENST00000340692	ensembl	human	known	70_37	missense	SNP	1.000	G
MSH2	4436	genome.wustl.edu	37	2	47630504	47630504	+	Missense_Mutation	SNP	C	C	G	rs372189599		TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr2:47630504C>G	ENST00000233146.2	+	1	397	c.174C>G	c.(172-174)ttC>ttG	p.F58L	MSH2_ENST00000406134.1_Missense_Mutation_p.F58L|MSH2_ENST00000543555.1_5'UTR	NM_000251.2	NP_000242.1	P43246	MSH2_HUMAN	mutS homolog 2	58					ATP catabolic process (GO:0006200)|B cell differentiation (GO:0030183)|B cell mediated immunity (GO:0019724)|cell cycle arrest (GO:0007050)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|intra-S DNA damage checkpoint (GO:0031573)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|isotype switching (GO:0045190)|maintenance of DNA repeat elements (GO:0043570)|male gonad development (GO:0008584)|meiotic gene conversion (GO:0006311)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reciprocal meiotic recombination (GO:0045128)|oxidative phosphorylation (GO:0006119)|positive regulation of helicase activity (GO:0051096)|postreplication repair (GO:0006301)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSalpha complex (GO:0032301)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|guanine/thymine mispair binding (GO:0032137)|heteroduplex DNA loop binding (GO:0000404)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|Y-form DNA binding (GO:0000403)	p.0?(2)|p.?(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(5)|large_intestine(50)|lung(18)|ovary(5)|prostate(2)|skin(3)|small_intestine(1)|stomach(2)|urinary_tract(1)	112		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GGGAGGTGTTCAAGACCCAGG	0.706			"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian"""	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p22-p21	4436	mutS homolog 2 (E. coli)		E	3	Whole gene deletion(2)|Unknown(1)	haematopoietic_and_lymphoid_tissue(3)											10.0	13.0	12.0					2																	47630504		2193	4287	6480	SO:0001583	missense	4436	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U03911	CCDS1834.1, CCDS58709.1	2p21	2014-09-17	2013-09-12		ENSG00000095002	ENSG00000095002			7325	protein-coding gene	gene with protein product		609309	"""mutS (E. coli) homolog 2 (colon cancer, nonpolyposis type 1)"", ""mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)"""	COCA1		8484120, 9843200	Standard	NM_000251		Approved	HNPCC, HNPCC1	uc002rvy.2	P43246	OTTHUMG00000128861	ENST00000233146.2:c.174C>G	2.37:g.47630504C>G	ENSP00000233146:p.Phe58Leu		B4E2Z2|O75488	Missense_Mutation	SNP	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mismatch_repair_MutS_connt,pfam_DNA_mismatch_repair_MutS-lik_N,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,superfamily_DNA_mismatch_repair_MutS_connt,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C,pirsf_DNA_mismatch_repair_MSH2	p.F58L	ENST00000233146.2	37	c.174	CCDS1834.1	2	.	.	.	.	.	.	.	.	.	.	c	35	5.476556	0.96291	.	.	ENSG00000095002	ENST00000233146;ENST00000406134;ENST00000419559;ENST00000432737;ENST00000453755;ENST00000448533;ENST00000394792	D;D	0.88664	-2.41;-2.41	5.46	3.64	0.41730	DNA mismatch repair protein MutS-like, N-terminal (1);	0.054446	0.85682	D	0.000000	D	0.93677	0.7980	M	0.81614	2.55	0.80722	D	1	D;P;D	0.89917	1.0;0.76;1.0	D;P;D	0.83275	0.996;0.484;0.992	D	0.93886	0.7175	10	0.72032	D	0.01	-13.3245	11.5733	0.50848	0.0:0.8483:0.0:0.1517	.	58;58;58	E7EQQ1;E9PHA6;P43246	.;.;MSH2_HUMAN	L	58	ENSP00000233146:F58L;ENSP00000384199:F58L	ENSP00000233146:F58L	F	+	3	2	MSH2	47484008	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.500000	0.53318	1.318000	0.45170	-0.168000	0.13345	TTC	MSH2	-	pfam_DNA_mismatch_repair_MutS-lik_N,pirsf_DNA_mismatch_repair_MSH2		0.706	MSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSH2	HGNC	protein_coding	OTTHUMT00000250805.3	C			47630504	+1	no_errors	ENST00000233146	ensembl	human	known	70_37	missense	SNP	1.000	G
MTHFR	4524	genome.wustl.edu	37	1	11861360	11861360	+	Missense_Mutation	SNP	C	C	T	rs577135269		TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr1:11861360C>T	ENST00000376592.1	-	2	461	c.333G>A	c.(331-333)atG>atA	p.M111I	MTHFR_ENST00000376583.3_Missense_Mutation_p.M152I|MTHFR_ENST00000376590.3_Missense_Mutation_p.M111I|MTHFR_ENST00000376585.1_Missense_Mutation_p.M152I			P42898	MTHR_HUMAN	methylenetetrahydrofolate reductase (NAD(P)H)	111					blood circulation (GO:0008015)|cellular amino acid metabolic process (GO:0006520)|folic acid metabolic process (GO:0046655)|homocysteine metabolic process (GO:0050667)|methionine biosynthetic process (GO:0009086)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to vitamin B2 (GO:0033274)|S-adenosylmethionine metabolic process (GO:0046500)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|neuron projection (GO:0043005)	flavin adenine dinucleotide binding (GO:0050660)|methylenetetrahydrofolate reductase (NAD(P)H) activity (GO:0004489)|modified amino acid binding (GO:0072341)|NADP binding (GO:0050661)	p.M111I(1)		NS(4)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Benazepril(DB00542)|Cyanocobalamin(DB00115)|Fluorouracil(DB00544)|Folic Acid(DB00158)|L-Methionine(DB00134)|Menadione(DB00170)|Methotrexate(DB00563)|Riboflavin(DB00140)|Tetrahydrofolic acid(DB00116)	TGCTGGCGATCATCATGGAGG	0.612																																																	1	Substitution - Missense(1)	NS(1)											99.0	85.0	90.0					1																	11861360		2203	4300	6503	SO:0001583	missense	4524			BC053509	CCDS137.1	1p36.3	2014-09-17	2010-05-04		ENSG00000177000	ENSG00000177000	1.5.1.20		7436	protein-coding gene	gene with protein product		607093	"""5,10-methylenetetrahydrofolate reductase (NADPH)"""			7920641	Standard	NM_005957		Approved		uc001atc.2	P42898	OTTHUMG00000002277	ENST00000376592.1:c.333G>A	1.37:g.11861360C>T	ENSP00000365777:p.Met111Ile		B2R7A6|Q5SNW6|Q5SNW9|Q7Z6M6|Q8IU73|Q9UQR2	Missense_Mutation	SNP	pfam_Mehydrof_redctse,tigrfam_Fadh2_euk	p.M152I	ENST00000376592.1	37	c.456	CCDS137.1	1	.	.	.	.	.	.	.	.	.	.	C	14.68	2.608748	0.46527	.	.	ENSG00000177000	ENST00000376592;ENST00000376583;ENST00000376590;ENST00000376585;ENST00000418034	D;D;D;D;D	0.91792	-2.91;-2.91;-2.91;-2.91;-2.91	5.66	1.25	0.21368	.	0.367956	0.36444	N	0.002598	T	0.80204	0.4580	N	0.12182	0.205	0.37028	D	0.896541	B;B	0.02656	0.0;0.0	B;B	0.06405	0.0;0.002	T	0.69745	-0.5062	10	0.18710	T	0.47	.	7.8308	0.29342	0.2981:0.3442:0.3577:0.0	.	111;152	P42898;Q5SNW6	MTHR_HUMAN;.	I	111;152;111;152;111	ENSP00000365777:M111I;ENSP00000365767:M152I;ENSP00000365775:M111I;ENSP00000365770:M152I;ENSP00000405082:M111I	ENSP00000365767:M152I	M	-	3	0	MTHFR	11783947	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	1.403000	0.34612	0.685000	0.31468	0.549000	0.68633	ATG	MTHFR	-	pfam_Mehydrof_redctse,tigrfam_Fadh2_euk		0.612	MTHFR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MTHFR	HGNC	protein_coding	OTTHUMT00000006538.1	C	NM_005957		11861360	-1	no_errors	ENST00000376583	ensembl	human	known	70_37	missense	SNP	1.000	T
MTMR3	8897	genome.wustl.edu	37	22	30415483	30415483	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr22:30415483G>C	ENST00000401950.2	+	17	2177	c.1835G>C	c.(1834-1836)aGa>aCa	p.R612T	MTMR3_ENST00000351488.3_Missense_Mutation_p.R612T|CTA-85E5.10_ENST00000429350.1_RNA|MTMR3_ENST00000323630.5_Missense_Mutation_p.R476T|CTA-85E5.10_ENST00000453743.2_RNA|MTMR3_ENST00000333027.3_Missense_Mutation_p.R612T|MTMR3_ENST00000406629.1_Missense_Mutation_p.R612T	NM_021090.3	NP_066576.1	Q13615	MTMR3_HUMAN	myotubularin related protein 3	612					peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|large_intestine(3)|ovary(2)|skin(8)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			CCAAAGACTAGATCATACGAC	0.502																																																	0													56.0	58.0	58.0					22																	30415483		2203	4300	6503	SO:0001583	missense	8897			U58034	CCDS13870.1, CCDS13871.1, CCDS46682.1	22q12.2	2011-06-09			ENSG00000100330	ENSG00000100330		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7451	protein-coding gene	gene with protein product		603558				8640223, 9736772	Standard	NM_153050		Approved	KIAA0371, ZFYVE10, FYVE-DSP1	uc003agv.4	Q13615	OTTHUMG00000151278	ENST00000401950.2:c.1835G>C	22.37:g.30415483G>C	ENSP00000384651:p.Arg612Thr		A5PL26|A7MD32|Q9NYN5|Q9NYN6|Q9UDX6|Q9UEG3	Missense_Mutation	SNP	pfam_Myotub-related,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Tyr_Pase_cat,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.R612T	ENST00000401950.2	37	c.1835	CCDS13870.1	22	.	.	.	.	.	.	.	.	.	.	G	23.2	4.388263	0.82902	.	.	ENSG00000100330	ENST00000401950;ENST00000333027;ENST00000323630;ENST00000351488;ENST00000406629	D;D;D;D;D	0.95342	-3.48;-3.45;-3.68;-3.51;-3.45	5.75	5.75	0.90469	.	0.054754	0.64402	D	0.000001	D	0.97383	0.9144	M	0.80982	2.52	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.98;0.999	D	0.97702	1.0185	10	0.87932	D	0	.	18.948	0.92628	0.0:0.0:1.0:0.0	.	612;612;612	Q13615-3;Q13615;Q13615-2	.;MTMR3_HUMAN;.	T	612;612;476;612;612	ENSP00000384651:R612T;ENSP00000331649:R612T;ENSP00000318070:R476T;ENSP00000307271:R612T;ENSP00000384077:R612T	ENSP00000318070:R476T	R	+	2	0	MTMR3	28745483	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	9.238000	0.95380	2.716000	0.92895	0.655000	0.94253	AGA	MTMR3	-	NULL		0.502	MTMR3-001	KNOWN	basic|CCDS	protein_coding	MTMR3	HGNC	protein_coding	OTTHUMT00000322066.1	G	NM_021090		30415483	+1	no_errors	ENST00000401950	ensembl	human	known	70_37	missense	SNP	1.000	C
MUC4	4585	genome.wustl.edu	37	3	195515215	195515215	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr3:195515215G>T	ENST00000463781.3	-	2	3695	c.3236C>A	c.(3235-3237)tCc>tAc	p.S1079Y	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S1079Y|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	511					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGATGCTGAGGAAAGGCTGGT	0.562																																																	0													25.0	16.0	19.0					3																	195515215		692	1588	2280	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3236C>A	3.37:g.195515215G>T	ENSP00000417498:p.Ser1079Tyr		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.S1079Y	ENST00000463781.3	37	c.3236	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	-	5.793	0.330573	0.10956	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32272	1.47;1.46	1.0	-1.56	0.08532	.	.	.	.	.	T	0.29126	0.0724	N	0.19112	0.55	0.09310	N	1	P	0.52842	0.956	D	0.64237	0.923	T	0.16394	-1.0404	8	.	.	.	.	3.8384	0.08903	0.1912:0.2491:0.5598:0.0	.	1079	E7ESK3	.	Y	1079	ENSP00000417498:S1079Y;ENSP00000420243:S1079Y	.	S	-	2	0	MUC4	196999610	.	.	0.000000	0.03702	0.018000	0.09664	.	.	-0.496000	0.06650	0.064000	0.15345	TCC	MUC4	-	NULL		0.562	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	G	NM_018406		195515215	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	missense	SNP	0.000	T
NAA60	79903	genome.wustl.edu	37	16	3533366	3533366	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr16:3533366C>T	ENST00000407558.4	+	6	644	c.341C>T	c.(340-342)tCc>tTc	p.S114F	NAA60_ENST00000360862.5_Missense_Mutation_p.S49F|NAA60_ENST00000577013.1_Intron|NAA60_ENST00000414063.2_Missense_Mutation_p.S114F|NAA60_ENST00000610180.1_Missense_Mutation_p.S114F|NAA60_ENST00000570551.1_3'UTR|LA16c-306E5.3_ENST00000574423.2_RNA|NAA60_ENST00000575076.1_Missense_Mutation_p.S114F|NAA60_ENST00000424546.2_Missense_Mutation_p.S121F|NAA60_ENST00000572942.1_Intron|NAA60_ENST00000572584.1_Missense_Mutation_p.S114F|NAA60_ENST00000576916.1_Intron|NAA60_ENST00000570819.1_Intron|NAA60_ENST00000421765.3_Intron|NAA60_ENST00000608722.1_Missense_Mutation_p.S114F|NAA60_ENST00000573580.1_Missense_Mutation_p.S49F|NAA60_ENST00000608993.1_Missense_Mutation_p.S49F			Q9H7X0	NAA60_HUMAN	N(alpha)-acetyltransferase 60, NatF catalytic subunit	114	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|histone H4 acetylation (GO:0043967)|N-terminal peptidyl-methionine acetylation (GO:0017196)|nucleosome assembly (GO:0006334)	Golgi membrane (GO:0000139)	H4 histone acetyltransferase activity (GO:0010485)|peptide alpha-N-acetyltransferase activity (GO:0004596)			breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(1)	7						CCCCAAGGTTCCCTCTTACTT	0.493																																																	0													72.0	71.0	72.0					16																	3533366		1993	4165	6158	SO:0001583	missense	79903				CCDS45396.1	16p13.3	2012-07-13	2011-08-02	2011-08-02	ENSG00000122390	ENSG00000122390	2.3.1.48, 2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	25875	protein-coding gene	gene with protein product		614246	"""N-acetyltransferase 15 (GCN5-related, putative)"""	NAT15		12975309, 21750686	Standard	NM_001083600		Approved	FLJ14154	uc010btm.3	Q9H7X0	OTTHUMG00000150268	ENST00000407558.4:c.341C>T	16.37:g.3533366C>T	ENSP00000385903:p.Ser114Phe		B3KRQ0|B4DLZ0|B4DPZ8|B4DYC4|D3DUC2|E7EQ65|Q6IA31|Q6UX26	Missense_Mutation	SNP	pfam_GNAT_dom,pfam_FR47,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.S114F	ENST00000407558.4	37	c.341	CCDS45396.1	16	.	.	.	.	.	.	.	.	.	.	c	15.04	2.714668	0.48622	.	.	ENSG00000122390	ENST00000424546;ENST00000407558;ENST00000414063;ENST00000360862	T;T;T;T	0.25912	1.77;1.77;1.77;1.77	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.57021	0.2025	M	0.82433	2.59	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.996	T	0.61671	-0.7015	10	0.87932	D	0	-7.491	18.6509	0.91430	0.0:1.0:0.0:0.0	.	121;114	B4DLZ0;Q9H7X0	.;NAA60_HUMAN	F	121;114;114;49	ENSP00000401237:S121F;ENSP00000385903:S114F;ENSP00000393224:S114F;ENSP00000354108:S49F	ENSP00000354108:S49F	S	+	2	0	NAA60	3473367	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.403000	0.79983	2.725000	0.93324	0.552000	0.68991	TCC	NAA60	-	pfam_GNAT_dom,pfam_FR47,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom		0.493	NAA60-001	KNOWN	NMD_exception|non_canonical_U12|basic|appris_principal|CCDS	protein_coding	NAA60	HGNC	protein_coding	OTTHUMT00000317235.2	C	NM_024845		3533366	+1	no_errors	ENST00000407558	ensembl	human	known	70_37	missense	SNP	1.000	T
NAA60	79903	genome.wustl.edu	37	16	3533522	3533522	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr16:3533522C>G	ENST00000407558.4	+	6	800	c.497C>G	c.(496-498)tCc>tGc	p.S166C	NAA60_ENST00000360862.5_Missense_Mutation_p.S101C|NAA60_ENST00000577013.1_Intron|NAA60_ENST00000414063.2_Missense_Mutation_p.S166C|NAA60_ENST00000610180.1_Missense_Mutation_p.S166C|NAA60_ENST00000570551.1_3'UTR|LA16c-306E5.3_ENST00000574423.2_RNA|NAA60_ENST00000575076.1_Missense_Mutation_p.S166C|NAA60_ENST00000424546.2_Missense_Mutation_p.S173C|NAA60_ENST00000572942.1_Intron|NAA60_ENST00000572584.1_Missense_Mutation_p.S166C|NAA60_ENST00000576916.1_Intron|NAA60_ENST00000570819.1_Intron|NAA60_ENST00000421765.3_Intron|NAA60_ENST00000608722.1_Missense_Mutation_p.S166C|NAA60_ENST00000573580.1_Missense_Mutation_p.S101C|NAA60_ENST00000608993.1_Missense_Mutation_p.S101C			Q9H7X0	NAA60_HUMAN	N(alpha)-acetyltransferase 60, NatF catalytic subunit	166	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|histone H4 acetylation (GO:0043967)|N-terminal peptidyl-methionine acetylation (GO:0017196)|nucleosome assembly (GO:0006334)	Golgi membrane (GO:0000139)	H4 histone acetyltransferase activity (GO:0010485)|peptide alpha-N-acetyltransferase activity (GO:0004596)			breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(1)	7						TATTACTACTCCATTCGAGGG	0.478																																																	0													143.0	147.0	146.0					16																	3533522		2009	4174	6183	SO:0001583	missense	79903				CCDS45396.1	16p13.3	2012-07-13	2011-08-02	2011-08-02	ENSG00000122390	ENSG00000122390	2.3.1.48, 2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	25875	protein-coding gene	gene with protein product		614246	"""N-acetyltransferase 15 (GCN5-related, putative)"""	NAT15		12975309, 21750686	Standard	NM_001083600		Approved	FLJ14154	uc010btm.3	Q9H7X0	OTTHUMG00000150268	ENST00000407558.4:c.497C>G	16.37:g.3533522C>G	ENSP00000385903:p.Ser166Cys		B3KRQ0|B4DLZ0|B4DPZ8|B4DYC4|D3DUC2|E7EQ65|Q6IA31|Q6UX26	Missense_Mutation	SNP	pfam_GNAT_dom,pfam_FR47,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.S166C	ENST00000407558.4	37	c.497	CCDS45396.1	16	.	.	.	.	.	.	.	.	.	.	C	21.3	4.133687	0.77662	.	.	ENSG00000122390	ENST00000424546;ENST00000407558;ENST00000414063;ENST00000360862	T;T;T;T	0.55052	0.54;0.82;0.82;0.94	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.66616	0.2807	M	0.76170	2.325	0.80722	D	1	D;P	0.62365	0.991;0.926	P;P	0.52672	0.706;0.497	T	0.68697	-0.5340	10	0.51188	T	0.08	0.4878	18.6699	0.91507	0.0:1.0:0.0:0.0	.	173;166	B4DLZ0;Q9H7X0	.;NAA60_HUMAN	C	173;166;166;101	ENSP00000401237:S173C;ENSP00000385903:S166C;ENSP00000393224:S166C;ENSP00000354108:S101C	ENSP00000354108:S101C	S	+	2	0	NAA60	3473523	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.406000	0.80017	2.733000	0.93635	0.561000	0.74099	TCC	NAA60	-	superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom		0.478	NAA60-001	KNOWN	NMD_exception|non_canonical_U12|basic|appris_principal|CCDS	protein_coding	NAA60	HGNC	protein_coding	OTTHUMT00000317235.2	C	NM_024845		3533522	+1	no_errors	ENST00000407558	ensembl	human	known	70_37	missense	SNP	1.000	G
NCF1	653361	genome.wustl.edu	37	7	74191962	74191962	+	Intron	SNP	G	G	A	rs374969926		TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr7:74191962G>A	ENST00000289473.4	+	2	223				NCF1_ENST00000443956.3_3'UTR	NM_000265.4	NP_000256.4	P14598	NCF1_HUMAN	neutrophil cytosolic factor 1						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular defense response (GO:0006968)|hydrogen peroxide biosynthetic process (GO:0050665)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|leukotriene metabolic process (GO:0006691)|negative regulation of smooth muscle contraction (GO:0045986)|neutrophil mediated killing of fungus (GO:0070947)|neutrophil mediated killing of gram-positive bacterium (GO:0070946)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|protein targeting to membrane (GO:0006612)|respiratory burst (GO:0045730)|respiratory burst involved in defense response (GO:0002679)|response to yeast (GO:0001878)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of membrane (GO:0019898)|Golgi apparatus (GO:0005794)|NADPH oxidase complex (GO:0043020)|neuronal cell body (GO:0043025)|phagolysosome (GO:0032010)|rough endoplasmic reticulum (GO:0005791)	electron carrier activity (GO:0009055)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|SH3 domain binding (GO:0017124)|superoxide-generating NADPH oxidase activity (GO:0016175)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|skin(3)	10					Dextromethorphan(DB00514)	tgcagtgcaggggcgcaatca	0.552																																																	0																																										SO:0001627	intron_variant	653361			M25665	CCDS34657.1	7q11.23	2014-09-17	2008-07-31		ENSG00000158517	ENSG00000158517			7660	protein-coding gene	gene with protein product	"""NADPH oxidase organizer 2"", ""chronic granulomatous disease, autosomal 1"""	608512	"""neutrophil cytosolic factor 1 (47kD, chronic granulomatous disease, autosomal 1)"""				Standard	NM_000265		Approved	p47phox, NOXO2, NCF1A, SH3PXD1A	uc022aft.1	P14598	OTTHUMG00000149965	ENST00000289473.4:c.153+269G>A	7.37:g.74191962G>A			A6NEH2|A8K7S9|O43842|Q2PP07|Q53FR5|Q9BU90|Q9BXI7|Q9BXI8|Q9UDV9|Q9UMU2	RNA	SNP	-	NULL	ENST00000289473.4	37	NULL	CCDS34657.1	7																																																																																			NCF1	-	-		0.552	NCF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCF1	HGNC	protein_coding	OTTHUMT00000314560.1	G	NM_000265		74191962	+1	no_errors	ENST00000443956	ensembl	human	known	70_37	rna	SNP	0.998	A
NFATC2	4773	genome.wustl.edu	37	20	50139798	50139798	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr20:50139798C>T	ENST00000396009.3	-	2	1201	c.982G>A	c.(982-984)Gac>Aac	p.D328N	NFATC2_ENST00000609507.1_Missense_Mutation_p.D109N|NFATC2_ENST00000414705.1_Missense_Mutation_p.D308N|NFATC2_ENST00000610033.1_Missense_Mutation_p.D109N|NFATC2_ENST00000609943.1_Missense_Mutation_p.D308N|NFATC2_ENST00000371564.3_Missense_Mutation_p.D328N	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	328					B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					GGCGAGGGGTCAGGGCTGGTC	0.692																																																	0													24.0	32.0	29.0					20																	50139798		2201	4290	6491	SO:0001583	missense	4773			U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.982G>A	20.37:g.50139798C>T	ENSP00000379330:p.Asp328Asn		B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Missense_Mutation	SNP	pfam_RHD,pfam_IPT_TIG_rcpt,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT_TIG_rcpt,pfscan_RHD,prints_NFAT	p.D328N	ENST00000396009.3	37	c.982	CCDS13437.1	20	.	.	.	.	.	.	.	.	.	.	C	18.08	3.542966	0.65198	.	.	ENSG00000101096	ENST00000371564;ENST00000396009;ENST00000371567;ENST00000414705	T;T;T	0.20598	2.06;2.06;2.08	5.67	5.67	0.87782	.	0.173594	0.52532	D	0.000068	T	0.46814	0.1412	M	0.70595	2.14	0.37774	D	0.926795	D;D;B;D	0.69078	0.984;0.997;0.381;0.984	P;P;B;P	0.62885	0.53;0.908;0.126;0.724	T	0.50833	-0.8781	10	0.87932	D	0	-28.4676	19.7746	0.96386	0.0:1.0:0.0:0.0	.	308;308;328;328	B5B2N9;B5B2P2;Q13469;B5B2N8	.;.;NFAC2_HUMAN;.	N	328;328;109;308	ENSP00000360619:D328N;ENSP00000379330:D328N;ENSP00000396471:D308N	ENSP00000360619:D328N	D	-	1	0	NFATC2	49573205	1.000000	0.71417	0.522000	0.27862	0.514000	0.34195	5.925000	0.70062	2.680000	0.91292	0.305000	0.20034	GAC	NFATC2	-	NULL		0.692	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NFATC2	HGNC	protein_coding	OTTHUMT00000079730.2	C	NM_012340		50139798	-1	no_errors	ENST00000396009	ensembl	human	known	70_37	missense	SNP	0.992	T
NISCH	11188	genome.wustl.edu	37	3	52514409	52514409	+	Intron	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr3:52514409C>T	ENST00000479054.1	+	14	1600				NISCH_ENST00000345716.4_Intron|NISCH_ENST00000488380.1_Silent_p.F542F|NISCH_ENST00000420808.2_Intron			Q9Y2I1	NISCH_HUMAN	nischarin						actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|glucose metabolic process (GO:0006006)|negative regulation of cell migration (GO:0030336)|norepinephrine secretion (GO:0048243)|Rac protein signal transduction (GO:0016601)|regulation of blood pressure (GO:0008217)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled amine receptor activity (GO:0008227)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	33				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	Tizanidine(DB00697)	GCACCTGCTTCCAACAGGGTC	0.637																																																	0																																										SO:0001627	intron_variant	11188			AF082516	CCDS33767.1, CCDS63651.1, CCDS63652.1	3p21.1	2008-07-18			ENSG00000010322	ENSG00000010322			18006	protein-coding gene	gene with protein product	"""imidazoline receptor candidate"", ""I-1 receptor candidate protein"", ""imidazoline receptor antisera selected"""	615507				11912194, 10882231	Standard	NM_007184		Approved	KIAA0975, I-1, IRAS	uc003ded.4	Q9Y2I1	OTTHUMG00000158571	ENST00000479054.1:c.1528+98C>T	3.37:g.52514409C>T			C9J245|Q6PGP3|Q6PIB4|Q7L8M3|Q7Z2X6|Q9UES6|Q9UEU4|Q9UFW3	Silent	SNP	pfam_Phox,pfam_Leu-rich_rpt,superfamily_Phox,smart_Phox,pfscan_Phox	p.F542	ENST00000479054.1	37	c.1626	CCDS33767.1	3																																																																																			NISCH	-	NULL		0.637	NISCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NISCH	HGNC	protein_coding	OTTHUMT00000351357.1	C	NM_007184		52514409	+1	no_errors	ENST00000488380	ensembl	human	known	70_37	silent	SNP	0.019	T
NRXN3	9369	genome.wustl.edu	37	14	79454458	79454458	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr14:79454458C>T	ENST00000554719.1	+	12	2608	c.2117C>T	c.(2116-2118)tCt>tTt	p.S706F	NRXN3_ENST00000335750.5_Missense_Mutation_p.S706F	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	0					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		TCTATGACCTCTTATTCTGGA	0.438																																																	0													167.0	155.0	159.0					14																	79454458		2203	4300	6503	SO:0001583	missense	9369			AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.2117C>T	14.37:g.79454458C>T	ENSP00000451648:p.Ser706Phe		A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Laminin_G	p.S1068F	ENST00000554719.1	37	c.3203	CCDS9870.1	14	.	.	.	.	.	.	.	.	.	.	C	17.57	3.423552	0.62733	.	.	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000554719;ENST00000335750	T;T	0.63913	-0.07;-0.07	5.84	5.84	0.93424	Concanavalin A-like lectin/glucanase (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	T	0.80914	0.4715	.	.	.	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.79669	-0.1707	8	.	.	.	.	20.1386	0.98045	0.0:1.0:0.0:0.0	.	1079;706	Q9Y4C0;Q9Y4C0-3	NRX3A_HUMAN;.	F	1079;1068;706;706	ENSP00000451648:S706F;ENSP00000338349:S706F	.	S	+	2	0	NRXN3	78524211	1.000000	0.71417	0.179000	0.23059	0.093000	0.18481	7.788000	0.85771	2.767000	0.95098	0.561000	0.74099	TCT	NRXN3	-	superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,pfscan_EG-like_dom		0.438	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRXN3	HGNC	protein_coding	OTTHUMT00000413787.1	C	NM_001105250		79454458	+1	no_errors	ENST00000554738	ensembl	human	known	70_37	missense	SNP	0.999	T
NUP107	57122	genome.wustl.edu	37	12	69083385	69083385	+	Nonsense_Mutation	SNP	C	C	G			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr12:69083385C>G	ENST00000229179.4	+	3	505	c.173C>G	c.(172-174)tCa>tGa	p.S58*	NUP107_ENST00000378905.2_5'UTR|NUP107_ENST00000539906.1_Missense_Mutation_p.H20D|RP11-637A17.2_ENST00000500695.2_lincRNA	NM_020401.2	NP_065134.1	P57740	NU107_HUMAN	nucleoporin 107kDa	58					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|structural constituent of nuclear pore (GO:0017056)		NUP107/LGR5(2)	breast(3)|endometrium(4)|kidney(4)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(2)	39	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)			ACTCCTAGCTCATTTCGACAG	0.313																																																	0													104.0	102.0	102.0					12																	69083385		2203	4300	6503	SO:0001587	stop_gained	57122			AK055629	CCDS8985.1	12q14	2004-03-19			ENSG00000111581	ENSG00000111581			29914	protein-coding gene	gene with protein product		607617				12552102, 12705868	Standard	XM_005269037		Approved	NUP84	uc001suf.3	P57740	OTTHUMG00000169265	ENST00000229179.4:c.173C>G	12.37:g.69083385C>G	ENSP00000229179:p.Ser58*		B4DZ67|Q6PJE1	Nonsense_Mutation	SNP	pfam_Nup84_Nup100	p.S58*	ENST00000229179.4	37	c.173	CCDS8985.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	38|38	6.998013|6.998013	0.97990|0.97990	.|.	.|.	ENSG00000111581|ENSG00000111581	ENST00000539906|ENST00000229179	.|.	.|.	.|.	5.45|5.45	4.57|4.57	0.56435|0.56435	.|.	.|0.195503	.|0.46442	.|D	.|0.000286	T|.	0.60715|.	0.2290|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	B|.	0.16166|.	0.016|.	B|.	0.14023|.	0.01|.	T|.	0.58983|.	-0.7539|.	6|.	.|.	.|.	.|.	-9.8195|-9.8195	10.3125|10.3125	0.43716|0.43716	0.0:0.909:0.0:0.091|0.0:0.909:0.0:0.091	.|.	20|.	B4DZ67|.	.|.	D|X	20|58	.|.	.|.	H|S	+|+	1|2	0|0	NUP107|NUP107	67369652|67369652	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	2.458000|2.458000	0.45014|0.45014	1.443000|1.443000	0.47586|0.47586	0.655000|0.655000	0.94253|0.94253	CAT|TCA	NUP107	-	NULL		0.313	NUP107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP107	HGNC	protein_coding	OTTHUMT00000403195.1	C	NM_020401		69083385	+1	no_errors	ENST00000229179	ensembl	human	known	70_37	nonsense	SNP	1.000	G
NYNRIN	57523	genome.wustl.edu	37	14	24886651	24886651	+	Nonstop_Mutation	SNP	G	G	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr14:24886651G>T	ENST00000382554.3	+	9	6014	c.5696G>T	c.(5695-5697)tGa>tTa	p.*1899L		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	0					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						TTGGAGCAGTGAGCGGGAGCA	0.647																																																	0													7.0	7.0	7.0					14																	24886651		1901	4096	5997	SO:0001578	stop_lost	57523			AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.5696G>T	14.37:g.24886651G>T	ENSP00000371994:p.*1899Leuext*109		Q6P153|Q86TR3|Q9HAC4	Nonstop_Mutation	SNP	pfam_RNase_Zc3h12,superfamily_RNaseH-like_dom,pfscan_Integrase_cat-core	p.*1899L	ENST00000382554.3	37	c.5696	CCDS45090.1	14	.	.	.	.	.	.	.	.	.	.	G	10.35	1.324650	0.24080	.	.	ENSG00000205978	ENST00000382554	.	.	.	4.31	3.42	0.39159	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.5761	0.33598	0.1044:0.0:0.8956:0.0	.	.	.	.	L	1899	.	.	X	+	2	2	NYNRIN	23956491	1.000000	0.71417	0.987000	0.45799	0.480000	0.33159	1.207000	0.32333	1.410000	0.46936	0.563000	0.77884	TGA	NYNRIN	-	NULL		0.647	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NYNRIN	HGNC	protein_coding	OTTHUMT00000412939.1	G			24886651	+1	no_errors	ENST00000382554	ensembl	human	known	70_37	nonstop	SNP	0.992	T
OR2J1	442185	genome.wustl.edu	37	6	29069355	29069355	+	Silent	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr6:29069355C>T	ENST00000377171.3	+	1	970	c.636C>T	c.(634-636)ctC>ctT	p.L212L				Q9GZK6	OR2J1_HUMAN	olfactory receptor, family 2, subfamily J, member 1 (gene/pseudogene)	212						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|lung(6)	7						TCATACCTCTCATCCTCATCC	0.493																																																	0																																										SO:0001819	synonymous_variant	442185					6p22.2-p21.31	2012-08-09	2011-08-30	2004-05-28	ENSG00000204702	ENSG00000204702		"""GPCR / Class A : Olfactory receptors"""	8259	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily J, member 1 pseudogene"", ""olfactory receptor, family 2, subfamily J, member 1"""	OR2J1P			Standard	NG_004683		Approved	OR6-5, hs6M1-4, dJ80I19.2		Q9GZK6	OTTHUMG00000031280	ENST00000377171.3:c.636C>T	6.37:g.29069355C>T			A2AAS1|B0V1T2|Q9GZK1	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.L212	ENST00000377171.3	37	c.636		6																																																																																			OR2J1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.493	OR2J1-001	KNOWN	basic|appris_principal	protein_coding	OR2J1	HGNC	protein_coding	OTTHUMT00000076612.2	C	NG_004683		29069355	+1	no_errors	ENST00000377171	ensembl	human	known	70_37	silent	SNP	0.000	T
OXSR1	9943	genome.wustl.edu	37	3	38265307	38265307	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr3:38265307G>A	ENST00000446845.1	+	7	977	c.605G>A	c.(604-606)cGt>cAt	p.R202H	OXSR1_ENST00000311806.3_Missense_Mutation_p.R202H					oxidative stress responsive 1											skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		TTGCAGGTCCGTGGTTATGAT	0.413																																																	0													99.0	99.0	99.0					3																	38265307		2203	4300	6503	SO:0001583	missense	9943			AB017642	CCDS2675.1	3p22.2	2013-05-17	2013-05-17	2004-11-26	ENSG00000172939	ENSG00000172939			8508	protein-coding gene	gene with protein product		604046	"""oxidative-stress responsive 1"""	OSR1		10083736	Standard	XM_005265638		Approved	KIAA1101	uc003chy.3	O95747	OTTHUMG00000131084	ENST00000446845.1:c.605G>A	3.37:g.38265307G>A	ENSP00000415851:p.Arg202His			Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R202H	ENST00000446845.1	37	c.605		3	.	.	.	.	.	.	.	.	.	.	G	13.78	2.339935	0.41398	.	.	ENSG00000172939	ENST00000446845;ENST00000311806	T;T	0.66815	-0.23;-0.23	5.3	5.3	0.74995	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.194570	0.42294	D	0.000722	T	0.72732	0.3497	L	0.42529	1.33	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.72338	0.977;0.958	T	0.65109	-0.6248	10	0.02654	T	1	-9.683	18.307	0.90185	0.0:0.0:1.0:0.0	.	202;202	C9JIG9;O95747	.;OXSR1_HUMAN	H	202	ENSP00000415851:R202H;ENSP00000311713:R202H	ENSP00000311713:R202H	R	+	2	0	OXSR1	38240311	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.565000	0.82337	2.658000	0.90341	0.655000	0.94253	CGT	OXSR1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.413	OXSR1-004	NOVEL	basic|exp_conf	protein_coding	OXSR1	HGNC	protein_coding	OTTHUMT00000342708.1	G	NM_005109		38265307	+1	no_errors	ENST00000311806	ensembl	human	known	70_37	missense	SNP	1.000	A
P2RY10	27334	genome.wustl.edu	37	X	78216864	78216864	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chrX:78216864G>A	ENST00000171757.2	+	4	1127	c.847G>A	c.(847-849)Gca>Aca	p.A283T	P2RY10_ENST00000544091.1_Missense_Mutation_p.A283T	NM_014499.2	NP_055314.1	O00398	P2Y10_HUMAN	purinergic receptor P2Y, G-protein coupled, 10	283						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(22)|ovary(3)|skin(2)	42						TGTCCGAATCGCACTGTATTT	0.413																																																	0																																										SO:0001583	missense	27334			AF000545	CCDS14442.1	Xq21.1	2012-08-23			ENSG00000078589	ENSG00000078589		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	19906	protein-coding gene	gene with protein product		300529				11004484, 9755289	Standard	NM_014499		Approved	P2Y10	uc004edf.3	O00398	OTTHUMG00000021896	ENST00000171757.2:c.847G>A	X.37:g.78216864G>A	ENSP00000171757:p.Ala283Thr		D3DTE5|Q4VBN7|Q86V16	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_P2_purnocptor	p.A283T	ENST00000171757.2	37	c.847	CCDS14442.1	X	.	.	.	.	.	.	.	.	.	.	G	0.016	-1.535416	0.00942	.	.	ENSG00000078589	ENST00000544091;ENST00000171757	T;T	0.36520	1.25;1.25	4.99	-0.698	0.11280	GPCR, rhodopsin-like superfamily (1);	0.629100	0.16694	N	0.203419	T	0.13884	0.0336	N	0.04787	-0.16	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.14839	-1.0458	10	0.31617	T	0.26	.	4.5107	0.11910	0.5191:0.0:0.3362:0.1447	.	283	O00398	P2Y10_HUMAN	T	283	ENSP00000443138:A283T;ENSP00000171757:A283T	ENSP00000171757:A283T	A	+	1	0	P2RY10	78103520	0.012000	0.17670	0.046000	0.18839	0.037000	0.13140	0.815000	0.27253	-0.343000	0.08351	-0.361000	0.07541	GCA	P2RY10	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.413	P2RY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY10	HGNC	protein_coding	OTTHUMT00000057323.1	G			78216864	+1	no_errors	ENST00000171757	ensembl	human	known	70_37	missense	SNP	0.003	A
PCDH19	57526	genome.wustl.edu	37	X	99662118	99662118	+	Missense_Mutation	SNP	A	A	G			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chrX:99662118A>G	ENST00000373034.4	-	1	3153	c.1478T>C	c.(1477-1479)gTg>gCg	p.V493A	PCDH19_ENST00000255531.7_Missense_Mutation_p.V493A|PCDH19_ENST00000420881.2_Missense_Mutation_p.V493A	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	493	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						CTGCGACGGCACGATCTGGTA	0.587																																																	0													85.0	87.0	86.0					X																	99662118		2128	4226	6354	SO:0001583	missense	57526			AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.1478T>C	X.37:g.99662118A>G	ENSP00000362125:p.Val493Ala		B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V493A	ENST00000373034.4	37	c.1478	CCDS55462.1	X	.	.	.	.	.	.	.	.	.	.	A	12.96	2.093955	0.36952	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.51574	0.7;0.7;0.7	5.64	4.49	0.54785	Cadherin (4);Cadherin-like (1);	0.120895	0.56097	D	0.000028	T	0.35422	0.0931	L	0.33093	0.98	0.58432	D	0.999997	B;B;B	0.19935	0.04;0.003;0.004	B;B;B	0.23419	0.046;0.017;0.029	T	0.14587	-1.0467	10	0.27785	T	0.31	.	10.1303	0.42674	0.9212:0.0:0.0788:0.0	.	493;493;493	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	A	493	ENSP00000400327:V493A;ENSP00000362125:V493A;ENSP00000255531:V493A	ENSP00000255531:V493A	V	-	2	0	PCDH19	99548774	1.000000	0.71417	0.995000	0.50966	0.989000	0.77384	7.531000	0.81973	1.882000	0.54519	0.417000	0.27973	GTG	PCDH19	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.587	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH19	HGNC	protein_coding	OTTHUMT00000057479.2	A	NM_020766		99662118	-1	no_errors	ENST00000373034	ensembl	human	known	70_37	missense	SNP	1.000	G
PCNT	5116	genome.wustl.edu	37	21	47783729	47783729	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr21:47783729C>A	ENST00000359568.5	+	14	2596	c.2489C>A	c.(2488-2490)tCa>tAa	p.S830*	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	830					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					GACCTCACTTCAGACGACGCC	0.657																																																	0													70.0	79.0	76.0					21																	47783729		2203	4300	6503	SO:0001587	stop_gained	5116			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.2489C>A	21.37:g.47783729C>A	ENSP00000352572:p.Ser830*		O43152|Q7Z7C9	Nonsense_Mutation	SNP	pfam_PACT_domain	p.S830*	ENST00000359568.5	37	c.2489	CCDS33592.1	21	.	.	.	.	.	.	.	.	.	.	C	37	6.386539	0.97524	.	.	ENSG00000160299	ENST00000359568	.	.	.	5.11	0.0344	0.14183	.	1.257680	0.06158	N	0.675524	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	.	2.2276	0.03988	0.1276:0.257:0.387:0.2283	.	.	.	.	X	830	.	ENSP00000352572:S830X	S	+	2	0	PCNT	46608157	0.006000	0.16342	0.011000	0.14972	0.000000	0.00434	0.446000	0.21694	0.181000	0.19994	-0.218000	0.12543	TCA	PCNT	-	NULL		0.657	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNT	HGNC	protein_coding	OTTHUMT00000207336.1	C	NM_006031		47783729	+1	no_errors	ENST00000359568	ensembl	human	known	70_37	nonsense	SNP	0.000	A
PCSK1	5122	genome.wustl.edu	37	5	95761604	95761604	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr5:95761604C>G	ENST00000311106.3	-	3	553	c.316G>C	c.(316-318)Gaa>Caa	p.E106Q	PCSK1_ENST00000508626.1_Missense_Mutation_p.E59Q|CTD-2337A12.1_ENST00000502645.2_RNA	NM_000439.4|NM_001177876.1	NP_000430.3|NP_001171347.1	P29120	NEC1_HUMAN	proprotein convertase subtilisin/kexin type 1	106					cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|metabolic process (GO:0008152)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of insulin secretion (GO:0050796)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)	p.E106Q(1)		NS(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	36		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;3.44e-16)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TTACTTCTTTCTTTTTCATAC	0.373																																																	1	Substitution - Missense(1)	ovary(1)											174.0	156.0	162.0					5																	95761604		2203	4300	6503	SO:0001583	missense	5122				CCDS4081.1, CCDS54881.1	5q15-q21	2008-07-18			ENSG00000175426	ENSG00000175426			8743	protein-coding gene	gene with protein product	"""prohormone convertase 3"", ""prohormone convertase 1"", ""neuroendocrine convertase 1"", ""proprotein convertase 1"""	162150		NEC1		1765368	Standard	NM_000439		Approved	PC1, PC3, SPC3	uc003kls.2	P29120	OTTHUMG00000122089	ENST00000311106.3:c.316G>C	5.37:g.95761604C>G	ENSP00000308024:p.Glu106Gln		B7Z8T7|E9PHA1|P78478|Q92532	Missense_Mutation	SNP	pfam_Peptidase_S8/S53,pfam_PrprotnconvertsP,pfam_Proho_convert,superfamily_Peptidase_S8/S53,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.E106Q	ENST00000311106.3	37	c.316	CCDS4081.1	5	.	.	.	.	.	.	.	.	.	.	C	1.190	-0.635451	0.03584	.	.	ENSG00000175426	ENST00000311106;ENST00000508626;ENST00000509190	T;T;T	0.66815	-0.07;-0.23;2.31	5.63	3.74	0.42951	.	0.301186	0.40818	N	0.001017	T	0.40839	0.1133	N	0.05487	-0.04	0.27306	N	0.957449	B	0.16166	0.016	B	0.09377	0.004	T	0.18681	-1.0329	10	0.33141	T	0.24	-21.7589	6.4665	0.21985	0.0:0.6577:0.1483:0.194	.	106	P29120	NEC1_HUMAN	Q	106;59;106	ENSP00000308024:E106Q;ENSP00000421600:E59Q;ENSP00000427294:E106Q	ENSP00000308024:E106Q	E	-	1	0	PCSK1	95787360	0.998000	0.40836	0.999000	0.59377	0.174000	0.22865	0.580000	0.23803	1.519000	0.48950	-0.136000	0.14681	GAA	PCSK1	-	NULL		0.373	PCSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK1	HGNC	protein_coding	OTTHUMT00000242851.1	C	NM_000439		95761604	-1	no_errors	ENST00000311106	ensembl	human	known	70_37	missense	SNP	0.997	G
PDE4DIP	9659	genome.wustl.edu	37	1	144874776	144874776	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr1:144874776G>C	ENST00000369354.3	-	30	5021	c.4832C>G	c.(4831-4833)tCt>tGt	p.S1611C	AL138796.1_ENST00000582173.1_RNA|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.S1611C|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.S1567C|RP4-791M13.5_ENST00000531288.1_RNA|PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.S1747C|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.S1747C			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1611	NBPF. {ECO:0000255|PROSITE- ProRule:PRU00647}.				cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		AGACAGGAAAGAGGTGCTGCT	0.542			T	PDGFRB	MPD																																			Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0													270.0	256.0	261.0					1																	144874776		2203	4296	6499	SO:0001583	missense	9659			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.4832C>G	1.37:g.144874776G>C	ENSP00000358360:p.Ser1611Cys		A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	pfam_Spindle_assoc,superfamily_ARM-type_fold	p.S1611C	ENST00000369354.3	37	c.4832	CCDS30824.1	1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.239454	0.79800	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359	T;T;T;T;T	0.02579	4.24;4.41;4.4;4.36;4.38	5.91	5.0	0.66597	DUF1220 (2);	.	.	.	.	T	0.07593	0.0191	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.994;0.999	T	0.03077	-1.1075	9	0.87932	D	0	.	14.3418	0.66633	0.0:0.0:0.8508:0.1492	.	1567;1611	Q5VU43-3;Q5VU43	.;MYOME_HUMAN	C	1567;1611;1611;1747;1747	ENSP00000327209:S1567C;ENSP00000358360:S1611C;ENSP00000358363:S1611C;ENSP00000435654:S1747C;ENSP00000358366:S1747C	ENSP00000327209:S1567C	S	-	2	0	PDE4DIP	143586133	1.000000	0.71417	0.998000	0.56505	0.953000	0.61014	9.169000	0.94788	1.497000	0.48584	0.650000	0.86243	TCT	PDE4DIP	-	NULL		0.542	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000038858.2	G	NM_022359		144874776	-1	no_errors	ENST00000369356	ensembl	human	known	70_37	missense	SNP	1.000	C
PDIA4	9601	genome.wustl.edu	37	7	148702242	148702242	+	Missense_Mutation	SNP	A	A	G			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr7:148702242A>G	ENST00000286091.4	-	9	1745	c.1513T>C	c.(1513-1515)Ttc>Ctc	p.F505L		NM_004911.4	NP_004902.1	P13667	PDIA4_HUMAN	protein disulfide isomerase family A, member 4	505	Thioredoxin 3. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein secretion (GO:0009306)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)			large_intestine(6)|lung(15)|ovary(2)|prostate(1)	24	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00385)			CCTTTTTTGAAAGCAGTGACA	0.607																																																	0													121.0	120.0	120.0					7																	148702242		2203	4300	6503	SO:0001583	missense	9601			BC001928	CCDS5893.1	7q35	2009-11-20	2005-06-29		ENSG00000155660	ENSG00000155660	5.3.4.1	"""Protein disulfide isomerases"""	30167	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 4"""			2549034, 2002068	Standard	NM_004911		Approved	ERP70, ERP72	uc003wff.2	P13667	OTTHUMG00000150248	ENST00000286091.4:c.1513T>C	7.37:g.148702242A>G	ENSP00000286091:p.Phe505Leu		A8K4K6|Q549T6	Missense_Mutation	SNP	pirsf_Protein_diS-isomerase_A4,pfam_Thioredoxin_domain,pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Thioredoxin,prints_Calsequestrin,tigrfam_Prot_disulphide_isomerase,tigrfam_Disulphide_isomerase	p.F505L	ENST00000286091.4	37	c.1513	CCDS5893.1	7	.	.	.	.	.	.	.	.	.	.	A	15.73	2.920422	0.52653	.	.	ENSG00000155660	ENST00000286091	T	0.20598	2.06	5.57	5.57	0.84162	Thioredoxin-like fold (3);	0.000000	0.85682	D	0.000000	T	0.14527	0.0351	N	0.25825	0.765	0.80722	D	1	P	0.38167	0.621	B	0.29942	0.109	T	0.05666	-1.0871	10	0.32370	T	0.25	.	15.7239	0.77736	1.0:0.0:0.0:0.0	.	505	P13667	PDIA4_HUMAN	L	505	ENSP00000286091:F505L	ENSP00000286091:F505L	F	-	1	0	PDIA4	148333175	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	9.003000	0.93577	2.116000	0.64780	0.533000	0.62120	TTC	PDIA4	-	pirsf_Protein_diS-isomerase_A4,superfamily_Thioredoxin-like_fold,tigrfam_Prot_disulphide_isomerase		0.607	PDIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDIA4	HGNC	protein_coding	OTTHUMT00000317077.1	A	NM_004911		148702242	-1	no_errors	ENST00000286091	ensembl	human	known	70_37	missense	SNP	1.000	G
PDILT	204474	genome.wustl.edu	37	16	20380946	20380946	+	Silent	SNP	G	G	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr16:20380946G>T	ENST00000302451.4	-	8	1232	c.984C>A	c.(982-984)gtC>gtA	p.V328V		NM_174924.1	NP_777584.1	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis expressed	328					cell migration (GO:0016477)|cell redox homeostasis (GO:0045454)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|spermatid development (GO:0007286)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(33)|prostate(3)|skin(1)|urinary_tract(1)	61						CGACCTCTGTGACCCGGAAGT	0.458																																																	0													174.0	167.0	170.0					16																	20380946		2203	4300	6503	SO:0001819	synonymous_variant	204474				CCDS10584.1	16p12.3	2011-11-10	2009-02-23		ENSG00000169340	ENSG00000169340		"""Protein disulfide isomerases"""	27338	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 7"", ""protein disulfide isomerase-like protein of the testis"""					15475357	Standard	NM_174924		Approved	PDIA7	uc002dhc.1	Q8N807	OTTHUMG00000131487	ENST00000302451.4:c.984C>A	16.37:g.20380946G>T			Q8IVQ5	Silent	SNP	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.V328	ENST00000302451.4	37	c.984	CCDS10584.1	16																																																																																			PDILT	-	superfamily_Thioredoxin-like_fold		0.458	PDILT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDILT	HGNC	protein_coding	OTTHUMT00000254332.1	G	NM_174924		20380946	-1	no_errors	ENST00000302451	ensembl	human	known	70_37	silent	SNP	0.058	T
PHF20L1	51105	genome.wustl.edu	37	8	133837520	133837520	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr8:133837520G>T	ENST00000395386.2	+	14	1947	c.1648G>T	c.(1648-1650)Gaa>Taa	p.E550*	PHF20L1_ENST00000220847.7_5'UTR|CTC-137K3.1_ENST00000602328.1_RNA|PHF20L1_ENST00000395390.2_Nonsense_Mutation_p.E525*	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1	550	Lys-rich.						zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			Taagagaaaagaaaaagataa	0.318																																																	0													28.0	28.0	28.0					8																	133837520		2077	4255	6332	SO:0001587	stop_gained	51105			AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.1648G>T	8.37:g.133837520G>T	ENSP00000378784:p.Glu550*		A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	Nonsense_Mutation	SNP	pfam_DUF3776,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Tudor,smart_Tudor-like_plant	p.E550*	ENST00000395386.2	37	c.1648	CCDS6367.2	8	.	.	.	.	.	.	.	.	.	.	G	35	5.503359	0.96371	.	.	ENSG00000129292	ENST00000395386;ENST00000395390	.	.	.	5.66	5.66	0.87406	.	0.863832	0.09570	U	0.784300	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	-15.4612	15.2396	0.73458	0.0:0.0:1.0:0.0	.	.	.	.	X	550;525	.	ENSP00000378784:E550X	E	+	1	0	PHF20L1	133906702	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.008000	0.63991	2.669000	0.90835	0.655000	0.94253	GAA	PHF20L1	-	NULL		0.318	PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	PHF20L1	HGNC	protein_coding	OTTHUMT00000308949.3	G	NM_016018		133837520	+1	no_errors	ENST00000395386	ensembl	human	putative	70_37	nonsense	SNP	1.000	T
PHKB	5257	genome.wustl.edu	37	16	47630322	47630322	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr16:47630322G>A	ENST00000323584.5	+	13	1267	c.1243G>A	c.(1243-1245)Gac>Aac	p.D415N	PHKB_ENST00000566044.1_Missense_Mutation_p.D408N|PHKB_ENST00000299167.8_Missense_Mutation_p.D415N|PHKB_ENST00000455779.1_Missense_Mutation_p.D408N	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	415					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				TGTGCCAGCTGACTTTGTAGA	0.343																																																	0													78.0	83.0	82.0					16																	47630322		2201	4300	6501	SO:0001583	missense	5257				CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.1243G>A	16.37:g.47630322G>A	ENSP00000313504:p.Asp415Asn		Q8N4T5	Missense_Mutation	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.D415N	ENST00000323584.5	37	c.1243	CCDS10729.1	16	.	.	.	.	.	.	.	.	.	.	G	24.4	4.526787	0.85706	.	.	ENSG00000102893	ENST00000299167;ENST00000455779;ENST00000323584	D;D	0.90133	-2.62;-2.62	5.73	5.73	0.89815	Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.000000	0.85682	D	0.000000	D	0.91078	0.7192	M	0.73372	2.23	0.80722	D	1	B;B	0.24092	0.097;0.029	B;B	0.27715	0.082;0.011	D	0.87741	0.2585	10	0.49607	T	0.09	-16.2618	19.9002	0.96983	0.0:0.0:1.0:0.0	.	415;408	Q93100;Q93100-4	KPBB_HUMAN;.	N	408;408;415	ENSP00000414345:D408N;ENSP00000313504:D415N	ENSP00000299167:D408N	D	+	1	0	PHKB	46187823	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.591000	0.98241	2.709000	0.92574	0.655000	0.94253	GAC	PHKB	-	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like		0.343	PHKB-002	KNOWN	basic|CCDS	protein_coding	PHKB	HGNC	protein_coding	OTTHUMT00000430413.1	G			47630322	+1	no_errors	ENST00000299167	ensembl	human	known	70_37	missense	SNP	1.000	A
PINX1	54984	genome.wustl.edu	37	8	10623360	10623360	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr8:10623360C>T	ENST00000314787.3	-	7	657	c.538G>A	c.(538-540)Gag>Aag	p.E180K	SOX7_ENST00000554914.1_Intron|PINX1_ENST00000519088.1_Missense_Mutation_p.G154E|CTD-2135J3.3_ENST00000506149.2_RNA|PINX1_ENST00000426190.2_Missense_Mutation_p.G152E|CTD-2135J3.3_ENST00000519568.1_RNA|SOX7_ENST00000553390.1_Intron	NM_017884.4	NP_060354.4	Q96BK5	PINX1_HUMAN	PIN2/TERF1 interacting, telomerase inhibitor 1	180					mitotic metaphase plate congression (GO:0007080)|negative regulation of cell proliferation (GO:0008285)|negative regulation of telomerase activity (GO:0051974)|regulation of telomerase activity (GO:0051972)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)|nucleolus (GO:0005730)|spindle (GO:0005819)	telomerase inhibitor activity (GO:0010521)|telomeric RNA binding (GO:0070034)			kidney(2)|large_intestine(4)|lung(8)|ovary(1)|skin(2)	17				Kidney(29;0.0595)|COAD - Colon adenocarcinoma(149;0.105)|KIRC - Kidney renal clear cell carcinoma(542;0.201)		GCAAAGTACTCCTGGATGGTG	0.547																																																	0													155.0	160.0	158.0					8																	10623360		2016	4188	6204	SO:0001583	missense	54984			AF418553	CCDS47801.1, CCDS64825.1	8p23	2013-01-28				ENSG00000254093		"""G patch domain containing"""	30046	protein-coding gene	gene with protein product	"""PIN2 interacting protein 1"", ""liver-related putative tumor suppressor"""	606505				11003615, 11701125	Standard	NM_001284356		Approved	PinX1, LPTL, LPTS, FLJ20565, MGC8850		Q96BK5		ENST00000314787.3:c.538G>A	8.37:g.10623360C>T	ENSP00000318966:p.Glu180Lys		B2R9B1|Q548A5|Q6QWG9|Q7Z7J8|Q96QD7|Q9HBU7|Q9NWW2	Missense_Mutation	SNP	pfam_G_patch_dom,smart_G_patch_dom,pfscan_G_patch_dom	p.E180K	ENST00000314787.3	37	c.538	CCDS47801.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	31|31	5.074863|5.074863	0.94000|0.94000	.|.	.|.	ENSG00000254093|ENSG00000254093	ENST00000314787;ENST00000524114|ENST00000426190;ENST00000519088	T|.	0.11277|.	2.79|.	5.8|5.8	5.8|5.8	0.92144|0.92144	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.69052|0.69052	0.3068|0.3068	M|M	0.80183|0.80183	2.485|2.485	0.31269|0.31269	N|N	0.692027|0.692027	D|D	0.71674|0.64830	0.998|0.994	P|P	0.62089|0.60886	0.898|0.88	T|T	0.68224|0.68224	-0.5465|-0.5465	10|8	0.72032|0.14656	D|T	0.01|0.56	.|.	15.5632|15.5632	0.76266|0.76266	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	180|154	Q96BK5|Q96BK5-2	PINX1_HUMAN|.	K|E	180;190|152;154	ENSP00000318966:E180K|.	ENSP00000318966:E180K|ENSP00000411396:G152E	E|G	-|-	1|2	0|0	PINX1|PINX1	10660770|10660770	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.828000|0.828000	0.46876|0.46876	4.758000|4.758000	0.62220|0.62220	2.735000|2.735000	0.93741|0.93741	0.655000|0.655000	0.94253|0.94253	GAG|GGA	PINX1	-	NULL		0.547	PINX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PINX1	HGNC	protein_coding	OTTHUMT00000375683.1	C	NM_017884		10623360	-1	no_errors	ENST00000314787	ensembl	human	known	70_37	missense	SNP	1.000	T
PLCL1	5334	genome.wustl.edu	37	2	198949616	198949616	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr2:198949616C>T	ENST00000428675.1	+	2	1773	c.1375C>T	c.(1375-1377)Cga>Tga	p.R459*	PLCL1_ENST00000437704.2_Nonsense_Mutation_p.R361*	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	459	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	CCTTTGTAATCGAAATAACAT	0.388																																																	0													55.0	53.0	54.0					2																	198949616		2203	4300	6503	SO:0001587	stop_gained	5334			D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.1375C>T	2.37:g.198949616C>T	ENSP00000402861:p.Arg459*		Q3MJ90|Q53SD3|Q7Z3S3	Nonsense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.R459*	ENST00000428675.1	37	c.1375	CCDS2326.2	2	.	.	.	.	.	.	.	.	.	.	C	35	5.480855	0.96307	.	.	ENSG00000115896	ENST00000428675;ENST00000437704	.	.	.	5.94	1.58	0.23477	.	0.000000	0.56097	D	0.000024	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1098	0.81255	0.561:0.439:0.0:0.0	.	.	.	.	X	459;361	.	.	R	+	1	2	PLCL1	198657861	0.998000	0.40836	0.993000	0.49108	0.959000	0.62525	1.908000	0.39907	-0.021000	0.14009	-0.397000	0.06425	CGA	PLCL1	-	pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom		0.388	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL1	HGNC	protein_coding	OTTHUMT00000340210.1	C	NM_006226		198949616	+1	no_errors	ENST00000428675	ensembl	human	known	70_37	nonsense	SNP	0.998	T
PLCL2	23228	genome.wustl.edu	37	3	17052521	17052521	+	Silent	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr3:17052521G>A	ENST00000418129.2	+	2	1770	c.1305G>A	c.(1303-1305)ctG>ctA	p.L435L	PLCL2_ENST00000432376.1_Silent_p.L435L|PLCL2_ENST00000396755.2_Silent_p.L435L|PLCL2_ENST00000460467.1_3'UTR	NM_001144382.1	NP_001137854.1	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2	561	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				B cell proliferation involved in immune response (GO:0002322)|B-1a B cell differentiation (GO:0002337)|gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|negative regulation of B cell receptor signaling pathway (GO:0050859)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GABA receptor binding (GO:0050811)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	43						CAGATGTCCTGAAAGGGAAAA	0.408																																																	0													39.0	40.0	39.0					3																	17052521		2203	4300	6503	SO:0001819	synonymous_variant	23228			AB029015	CCDS33713.1, CCDS74911.1	3p25.3-p25.1	2008-03-18	2002-02-18	2002-02-22	ENSG00000154822	ENSG00000154822			9064	protein-coding gene	gene with protein product		614276	"""phospholipase C, epsilon 2"""	PLCE2		10470851	Standard	NM_015184		Approved	KIAA1092	uc011awd.2	Q9UPR0	OTTHUMG00000155467	ENST00000418129.2:c.1305G>A	3.37:g.17052521G>A			A8K5V4|Q8N498|Q9H8L0|Q9UFP9	Silent	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.L435	ENST00000418129.2	37	c.1305	CCDS33713.1	3																																																																																			PLCL2	-	pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom,prints_Pinositol_PLipase_C		0.408	PLCL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL2	HGNC	protein_coding	OTTHUMT00000340250.3	G			17052521	+1	no_errors	ENST00000418129	ensembl	human	known	70_37	silent	SNP	1.000	A
PLEKHD1	400224	genome.wustl.edu	37	14	69967306	69967306	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr14:69967306C>G	ENST00000322564.7	+	3	468	c.256C>G	c.(256-258)Ctg>Gtg	p.L86V		NM_001161498.1	NP_001154970.1	A6NEE1	PLHD1_HUMAN	pleckstrin homology domain containing, family D (with coiled-coil domains) member 1	86	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.									breast(1)|endometrium(1)|kidney(2)	4						CGTCATCCCTCTGGGGGGCTG	0.612																																																	0													51.0	56.0	55.0					14																	69967306		692	1591	2283	SO:0001583	missense	400224			AK126770	CCDS53903.1	14q24.1	2013-01-10	2011-05-04		ENSG00000175985	ENSG00000175985		"""Pleckstrin homology (PH) domain containing"""	20148	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family D (with M protein repeats) member 1"""				Standard	NM_001161498		Approved	UPF0639	uc010ttf.1	A6NEE1		ENST00000322564.7:c.256C>G	14.37:g.69967306C>G	ENSP00000317175:p.Leu86Val		B9EJC2	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.L86V	ENST00000322564.7	37	c.256	CCDS53903.1	14	.	.	.	.	.	.	.	.	.	.	C	17.93	3.508186	0.64410	.	.	ENSG00000175985	ENST00000322564	D	0.82984	-1.67	5.08	5.08	0.68730	.	.	.	.	.	D	0.89550	0.6747	M	0.61703	1.905	0.43494	D	0.995739	D	0.69078	0.997	D	0.76071	0.987	D	0.88950	0.3386	8	.	.	.	.	17.2593	0.87065	0.0:1.0:0.0:0.0	.	86	B9EJC2	.	V	86	ENSP00000317175:L86V	.	L	+	1	2	PLEKHD1	69037059	1.000000	0.71417	1.000000	0.80357	0.769000	0.43574	1.551000	0.36233	2.375000	0.81037	0.561000	0.74099	CTG	PLEKHD1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.612	PLEKHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHD1	HGNC	protein_coding	OTTHUMT00000412451.2	C	NM_001161498		69967306	+1	no_errors	ENST00000322564	ensembl	human	known	70_37	missense	SNP	1.000	G
PLXNA1	5361	genome.wustl.edu	37	3	126733114	126733114	+	Missense_Mutation	SNP	G	G	A	rs577744672		TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr3:126733114G>A	ENST00000393409.2	+	11	2500	c.2500G>A	c.(2500-2502)Gag>Aag	p.E834K	PLXNA1_ENST00000251772.4_Missense_Mutation_p.E811K	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	834					axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		GTGCGTGGCCGAGCGCCGCTG	0.701													g|||	1	0.000199681	0.0008	0.0	5008	,	,		11528	0.0		0.0	False		,,,				2504	0.0																0													9.0	11.0	10.0					3																	126733114		2184	4262	6446	SO:0001583	missense	5361			X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.2500G>A	3.37:g.126733114G>A	ENSP00000377061:p.Glu834Lys			Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semaphorin/CD100_Ag,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.E834K	ENST00000393409.2	37	c.2500	CCDS33847.2	3	.	.	.	.	.	.	.	.	.	.	g	20.1	3.932239	0.73442	.	.	ENSG00000114554	ENST00000393409;ENST00000251772	T;T	0.17370	2.28;2.28	3.39	3.39	0.38822	.	2.749940	0.01480	N	0.016659	T	0.37073	0.0990	M	0.89414	3.03	0.43317	D	0.995339	P	0.35192	0.489	B	0.37239	0.244	T	0.50800	-0.8785	10	0.42905	T	0.14	.	14.9389	0.70978	0.0:0.0:1.0:0.0	.	834	Q9UIW2	PLXA1_HUMAN	K	834;811	ENSP00000377061:E834K;ENSP00000251772:E811K	ENSP00000251772:E811K	E	+	1	0	PLXNA1	128215804	1.000000	0.71417	0.926000	0.36857	0.850000	0.48378	7.385000	0.79763	1.908000	0.55244	0.486000	0.48141	GAG	PLXNA1	-	pfam_Plexin_repeat,superfamily_Plexin-like_fold,smart_Plexin-like		0.701	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA1	HGNC	protein_coding	OTTHUMT00000356451.1	G	NM_032242		126733114	+1	no_errors	ENST00000393409	ensembl	human	known	70_37	missense	SNP	0.996	A
POLR1C	9533	genome.wustl.edu	37	6	43489001	43489001	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr6:43489001G>A	ENST00000372389.3	+	9	1092	c.1004G>A	c.(1003-1005)cGc>cAc	p.R335H	POLR1C_ENST00000304004.3_Intron|POLR1C_ENST00000372344.2_Missense_Mutation_p.R285H|RP3-337H4.9_ENST00000607571.1_RNA	NM_203290.2	NP_976035.1	O15160	RPAC1_HUMAN	polymerase (RNA) I polypeptide C, 30kDa	335					gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			kidney(1)|large_intestine(2)|lung(1)|prostate(1)	5	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|all cancers(41;0.00511)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			AAGTGCCGGCGCTTCTTGGAT	0.542																																																	0													103.0	102.0	102.0					6																	43489001		2203	4300	6503	SO:0001583	missense	9533			AF008442	CCDS4901.1	6p21.1	2013-01-21			ENSG00000171453	ENSG00000171453		"""RNA polymerase subunits"""	20194	protein-coding gene	gene with protein product		610060				11042152, 12446911	Standard	NM_203290		Approved	RPA40, RPA39, RPA5, RPAC1	uc003ovn.3	O15160	OTTHUMG00000014739	ENST00000372389.3:c.1004G>A	6.37:g.43489001G>A	ENSP00000361465:p.Arg335His		O75395|Q5JTE3	Missense_Mutation	SNP	pfam_DNA-dir_RNA_pol_insert,pfam_DNA-dir_RNA_pol_dimersation,superfamily_DNA-dir_RNA_pol_RBP11-like,superfamily_DNA-dir_RNA_pol_insert,smart_DNA-dir_RNA_pol_RpoA/D/Rpb3	p.R335H	ENST00000372389.3	37	c.1004	CCDS4901.1	6	.	.	.	.	.	.	.	.	.	.	G	15.51	2.854779	0.51376	.	.	ENSG00000171453	ENST00000372389;ENST00000372373;ENST00000372344	D;D	0.82984	-1.67;-1.67	5.18	5.18	0.71444	DNA-directed RNA polymerase, RpoA/D/Rpb3-type (1);DNA-directed RNA polymerase, dimerisation (1);DNA-directed RNA polymerase, RBP11-like (1);	0.106321	0.64402	D	0.000008	T	0.75752	0.3892	M	0.76938	2.355	0.80722	D	1	B	0.14012	0.009	B	0.08055	0.003	T	0.75792	-0.3193	10	0.45353	T	0.12	-7.5969	13.0465	0.58928	0.0775:0.0:0.9225:0.0	.	335	O15160	RPAC1_HUMAN	H	335;199;285	ENSP00000361465:R335H;ENSP00000361419:R285H	ENSP00000361419:R285H	R	+	2	0	POLR1C	43596979	1.000000	0.71417	0.998000	0.56505	0.873000	0.50193	3.889000	0.56212	2.408000	0.81797	0.650000	0.86243	CGC	POLR1C	-	pfam_DNA-dir_RNA_pol_dimersation,superfamily_DNA-dir_RNA_pol_RBP11-like,smart_DNA-dir_RNA_pol_RpoA/D/Rpb3		0.542	POLR1C-008	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1C	HGNC	protein_coding	OTTHUMT00000040652.3	G	NM_004875		43489001	+1	no_errors	ENST00000372389	ensembl	human	known	70_37	missense	SNP	1.000	A
POMGNT1	55624	genome.wustl.edu	37	1	46657736	46657736	+	Intron	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr1:46657736C>T	ENST00000371984.3	-	17	1697				POMGNT1_ENST00000485714.1_5'UTR|POMGNT1_ENST00000371992.1_Intron|POMGNT1_ENST00000535522.1_Intron|POMGNT1_ENST00000371986.3_Intron|POMGNT1_ENST00000396420.3_Intron	NM_017739.3	NP_060209	Q8WZA1	PMGT1_HUMAN	protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-)						protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity (GO:0047223)			breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(166;0.155)					gactgtcatgccacactgtGC	0.507																																																	0													53.0	43.0	47.0					1																	46657736		2203	4300	6503	SO:0001627	intron_variant	55624				CCDS531.1, CCDS57995.1	1p34.1	2014-09-17	2013-07-31		ENSG00000085998	ENSG00000085998	2.4.1.-	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	19139	protein-coding gene	gene with protein product	"""protein O-mannose beta-1,2-N-acetylglucosaminyltransferase"""	606822	"""muscle-eye-brain disease"", ""protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase"""	MEB		11742540, 12788071	Standard	NM_017739		Approved	FLJ20277, MGAT1.2, LGMD2O	uc001cpg.3	Q8WZA1	OTTHUMG00000007604	ENST00000371984.3:c.1539+33G>A	1.37:g.46657736C>T			D3DQ16|Q5VST2|Q5VST3|Q9BV55|Q9H9L8|Q9NXF9|Q9NYF7	RNA	SNP	-	NULL	ENST00000371984.3	37	NULL	CCDS531.1	1																																																																																			POMGNT1	-	-		0.507	POMGNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMGNT1	HGNC	protein_coding	OTTHUMT00000020146.1	C	NM_017739		46657736	-1	no_errors	ENST00000463030	ensembl	human	known	70_37	rna	SNP	0.003	T
PTK6	5753	genome.wustl.edu	37	20	62163883	62163883	+	Silent	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr20:62163883G>A	ENST00000217185.2	-	5	855	c.828C>T	c.(826-828)ctC>ctT	p.L276L	PTK6_ENST00000542869.1_Silent_p.L175L	NM_005975.3	NP_005966.1	Q13882	PTK6_HUMAN	protein tyrosine kinase 6	276	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|intestinal epithelial cell differentiation (GO:0060575)|negative regulation of growth (GO:0045926)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of neuron projection development (GO:0010976)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|ruffle (GO:0001726)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(1)|lung(5)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	15	all_cancers(38;2.51e-11)		Epithelial(9;1.5e-08)|all cancers(9;8.67e-08)|BRCA - Breast invasive adenocarcinoma(10;6.43e-06)		Vandetanib(DB05294)	ACTCACCGCGGAGCAGCTCCA	0.652																																																	0													64.0	58.0	60.0					20																	62163883		2203	4300	6503	SO:0001819	synonymous_variant	5753			U61412	CCDS13524.1, CCDS74750.1	20q13.3	2013-02-18	2013-02-18		ENSG00000101213	ENSG00000101213	2.7.10.1	"""SH2 domain containing"""	9617	protein-coding gene	gene with protein product		602004	"""PTK6 protein tyrosine kinase 6"""			8247543, 9284935	Standard	NM_005975		Approved	BRK	uc002yfg.4	Q13882	OTTHUMG00000033039	ENST00000217185.2:c.828C>T	20.37:g.62163883G>A			B2RCR3|B4DW46|Q58F01	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.L276	ENST00000217185.2	37	c.828	CCDS13524.1	20																																																																																			PTK6	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom		0.652	PTK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTK6	HGNC	protein_coding	OTTHUMT00000080313.1	G			62163883	-1	no_errors	ENST00000217185	ensembl	human	known	70_37	silent	SNP	0.971	A
PXDNL	137902	genome.wustl.edu	37	8	52721742	52721742	+	Splice_Site	SNP	G	G	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr8:52721742G>T	ENST00000356297.4	-	1	263	c.163C>A	c.(163-165)Cta>Ata	p.L55I	PXDNL_ENST00000543296.1_Splice_Site_p.L55I|RP11-11C20.3_ENST00000605991.1_lincRNA	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	55					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				TGAACTTACAGAACTGTGGTC	0.502																																																	0													142.0	137.0	139.0					8																	52721742		2006	4193	6199	SO:0001630	splice_region_variant	137902				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.164+1C>A	8.37:g.52721742G>T			B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like,prints_Haem_peroxidase_animal_subgr	p.L55I	ENST00000356297.4	37	c.163	CCDS47855.1	8	.	.	.	.	.	.	.	.	.	.	G	10.83	1.461082	0.26248	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.78595	-1.19;-1.19	4.57	2.54	0.30619	.	.	.	.	.	T	0.74435	0.3716	M	0.66378	2.025	0.25893	N	0.983448	B	0.33612	0.419	B	0.34242	0.178	T	0.64453	-0.6404	9	0.54805	T	0.06	.	9.5757	0.39457	0.0:0.0:0.5568:0.4432	.	55	A1KZ92	PXDNL_HUMAN	I	55	ENSP00000348645:L55I;ENSP00000444865:L55I	ENSP00000348645:L55I	L	-	1	2	PXDNL	52884295	1.000000	0.71417	0.368000	0.25939	0.030000	0.12068	1.023000	0.30065	0.327000	0.23409	0.650000	0.86243	CTA	PXDNL	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp		0.502	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDNL	HGNC	protein_coding	OTTHUMT00000377905.1	G	NM_144651	Missense_Mutation	52721742	-1	no_errors	ENST00000356297	ensembl	human	known	70_37	missense	SNP	0.995	T
RAB40AL	282808	genome.wustl.edu	37	X	102192891	102192891	+	Silent	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chrX:102192891C>T	ENST00000218249.5	+	1	692	c.645C>T	c.(643-645)ccC>ccT	p.P215P	LL0XNC01-237H1.3_ENST00000413528.1_RNA	NM_001031834.1	NP_001027004.1	P0C0E4	RB40L_HUMAN	RAB40A, member RAS oncogene family-like	215	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			endometrium(4)|large_intestine(2)|lung(3)|ovary(3)	12						TCCCGCTCCCCATTGCCTTAA	0.602																																																	0													156.0	127.0	137.0					X																	102192891		2203	4300	6503	SO:0001819	synonymous_variant	282808			BC101169	CCDS35353.1	Xq22.2	2008-02-05			ENSG00000102128	ENSG00000102128			25410	protein-coding gene	gene with protein product	"""Ras like GTPase"""	300405					Standard	NM_001031834		Approved	RAR2, RLGP	uc004ejs.3	P0C0E4	OTTHUMG00000022084	ENST00000218249.5:c.645C>T	X.37:g.102192891C>T			Q495H3	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_SOCS_C,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,smart_SOCS_C,pfscan_SOCS_C,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.P215	ENST00000218249.5	37	c.645	CCDS35353.1	X																																																																																			RAB40AL	-	pfam_SOCS_C,smart_Ran_GTPase,smart_SOCS_C,pfscan_SOCS_C		0.602	RAB40AL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB40AL	HGNC	protein_coding	OTTHUMT00000057679.1	C	NM_001031834		102192891	+1	no_errors	ENST00000218249	ensembl	human	known	70_37	silent	SNP	1.000	T
RECK	8434	genome.wustl.edu	37	9	36065608	36065608	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr9:36065608G>T	ENST00000377966.3	+	6	958	c.392G>T	c.(391-393)aGa>aTa	p.R131I	RECK_ENST00000479053.1_3'UTR	NM_021111.2	NP_066934.1	O95980	RECK_HUMAN	reversion-inducing-cysteine-rich protein with kazal motifs	131	5 X Knot repeats.				blood vessel maturation (GO:0001955)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)	anchored component of membrane (GO:0031225)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			AAAGTTTGCAGAAAAGAATAT	0.264																																																	0													64.0	68.0	66.0					9																	36065608		2202	4282	6484	SO:0001583	missense	8434			E13833	CCDS6597.1	9p13.3	2008-05-15			ENSG00000122707	ENSG00000122707			11345	protein-coding gene	gene with protein product		605227		ST15		9789069	Standard	NM_021111		Approved	hRECK	uc003zyv.3	O95980	OTTHUMG00000019898	ENST00000377966.3:c.392G>T	9.37:g.36065608G>T	ENSP00000367202:p.Arg131Ile		B2RNS1|Q5W0K6|Q8WX37	Missense_Mutation	SNP	pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,superfamily_Prot_inh_PMP,smart_Prot_inh_Kazal	p.R131I	ENST00000377966.3	37	c.392	CCDS6597.1	9	.	.	.	.	.	.	.	.	.	.	G	23.4	4.413254	0.83449	.	.	ENSG00000122707	ENST00000377966	T	0.54279	0.58	6.06	6.06	0.98353	.	0.048653	0.85682	D	0.000000	T	0.65533	0.2700	L	0.36672	1.1	0.80722	D	1	P;P;D	0.64830	0.828;0.868;0.994	B;B;D	0.74348	0.284;0.4;0.983	T	0.65853	-0.6067	10	0.87932	D	0	-21.4263	18.1336	0.89610	0.0:0.0:1.0:0.0	.	131;131;131	B2RCE6;O95980;Q6P9E2	.;RECK_HUMAN;.	I	131	ENSP00000367202:R131I	ENSP00000367202:R131I	R	+	2	0	RECK	36055608	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.436000	0.59948	2.880000	0.98712	0.650000	0.86243	AGA	RECK	-	NULL		0.264	RECK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RECK	HGNC	protein_coding	OTTHUMT00000052409.1	G			36065608	+1	no_errors	ENST00000377966	ensembl	human	known	70_37	missense	SNP	1.000	T
RELN	5649	genome.wustl.edu	37	7	103138565	103138565	+	Silent	SNP	C	C	G			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr7:103138565C>G	ENST00000428762.1	-	54	8961	c.8802G>C	c.(8800-8802)gtG>gtC	p.V2934V	CTB-107G13.1_ENST00000422488.1_RNA|RELN_ENST00000424685.2_Silent_p.V2934V|RELN_ENST00000343529.5_Silent_p.V2934V	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2934					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CCGCTTGTCTCACAGTGGATC	0.423																																					NSCLC(146;835 1944 15585 22231 52158)												0													124.0	116.0	119.0					7																	103138565		2203	4300	6503	SO:0001819	synonymous_variant	5649				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.8802G>C	7.37:g.103138565C>G			A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Neuraminidase,superfamily_Growth_fac_rcpt,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Reeler_dom	p.V2934	ENST00000428762.1	37	c.8802	CCDS47680.1	7																																																																																			RELN	-	superfamily_Neuraminidase		0.423	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	C	NM_005045		103138565	-1	no_errors	ENST00000424685	ensembl	human	known	70_37	silent	SNP	0.999	G
ACSBG2	81616	genome.wustl.edu	37	19	6176278	6176278	+	Intron	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr19:6176278C>T	ENST00000586696.1	+	8	1014				ACSBG2_ENST00000588485.1_Intron|ACSBG2_ENST00000591403.1_Intron|ACSBG2_ENST00000591741.1_Intron|ACSBG2_ENST00000252669.5_Intron|ACSBG2_ENST00000588304.1_Intron			Q5FVE4	ACBG2_HUMAN	acyl-CoA synthetase bubblegum family member 2						cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid metabolic process (GO:0001676)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(3)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GGTCCTTACTCGATCTTACCT	0.493																																																	0																																										SO:0001627	intron_variant	5990				CCDS12159.1, CCDS74269.1	19p13.3	2012-10-02			ENSG00000130377	ENSG00000130377		"""Acyl-CoA synthetase family"""	24174	protein-coding gene	gene with protein product	"""bubblegum related protein"""	614363				11230166	Standard	XM_005259653		Approved	BGR, PRTD-NY3, DKFZp434K1635	uc002meh.1	Q5FVE4	OTTHUMG00000180754	ENST00000586696.1:c.739-962C>T	19.37:g.6176278C>T			B3KSF2|Q6UWJ3|Q7Z5A0|Q8WW03|Q96M36|Q9BYZ3|Q9H0C4	RNA	SNP	-	NULL	ENST00000586696.1	37	NULL	CCDS12159.1	19																																																																																			RFX2	-	-		0.493	ACSBG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX2	HGNC	protein_coding	OTTHUMT00000452898.1	C	NM_030924		6176278	-1	no_errors	ENST00000589712	ensembl	human	known	70_37	rna	SNP	0.475	T
ACSBG2	81616	genome.wustl.edu	37	19	6176353	6176353	+	Intron	SNP	C	C	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr19:6176353C>A	ENST00000586696.1	+	8	1014				ACSBG2_ENST00000588485.1_Intron|ACSBG2_ENST00000591403.1_Intron|ACSBG2_ENST00000591741.1_Intron|ACSBG2_ENST00000252669.5_Intron|ACSBG2_ENST00000588304.1_Intron			Q5FVE4	ACBG2_HUMAN	acyl-CoA synthetase bubblegum family member 2						cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid metabolic process (GO:0001676)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(3)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AGATGTCCATCATCTGTGCTG	0.522																																																	0																																										SO:0001627	intron_variant	5990				CCDS12159.1, CCDS74269.1	19p13.3	2012-10-02			ENSG00000130377	ENSG00000130377		"""Acyl-CoA synthetase family"""	24174	protein-coding gene	gene with protein product	"""bubblegum related protein"""	614363				11230166	Standard	XM_005259653		Approved	BGR, PRTD-NY3, DKFZp434K1635	uc002meh.1	Q5FVE4	OTTHUMG00000180754	ENST00000586696.1:c.739-887C>A	19.37:g.6176353C>A			B3KSF2|Q6UWJ3|Q7Z5A0|Q8WW03|Q96M36|Q9BYZ3|Q9H0C4	RNA	SNP	-	NULL	ENST00000586696.1	37	NULL	CCDS12159.1	19																																																																																			RFX2	-	-		0.522	ACSBG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX2	HGNC	protein_coding	OTTHUMT00000452898.1	C	NM_030924		6176353	-1	no_errors	ENST00000585324	ensembl	human	known	70_37	rna	SNP	1.000	A
RINT1	60561	genome.wustl.edu	37	7	105177056	105177056	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr7:105177056G>T	ENST00000257700.2	+	3	364	c.133G>T	c.(133-135)Gaa>Taa	p.E45*		NM_021930.4	NP_068749.3	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	45					G2 DNA damage checkpoint (GO:0031572)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						ACAAGTCAGTGAAGGTACAGA	0.328																																																	0													194.0	196.0	195.0					7																	105177056		2203	4300	6503	SO:0001587	stop_gained	60561			AF317622	CCDS34726.1	7q22.2	2007-05-03			ENSG00000135249	ENSG00000135249			21876	protein-coding gene	gene with protein product		610089				11096100, 15029241	Standard	NM_021930		Approved	FLJ11785, RINT-1	uc003vda.1	Q6NUQ1	OTTHUMG00000157400	ENST00000257700.2:c.133G>T	7.37:g.105177056G>T	ENSP00000257700:p.Glu45*		Q75MG9|Q75MH0|Q96IW8|Q9H229|Q9HAD9	Nonsense_Mutation	SNP	pfam_RINT1_TIP1	p.E45*	ENST00000257700.2	37	c.133	CCDS34726.1	7	.	.	.	.	.	.	.	.	.	.	G	21.6	4.170218	0.78452	.	.	ENSG00000135249	ENST00000257700	.	.	.	5.2	-1.63	0.08345	.	0.786235	0.12175	N	0.492672	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	-8.773	6.7318	0.23387	0.374:0.3112:0.3149:0.0	.	.	.	.	X	45	.	ENSP00000257700:E45X	E	+	1	0	RINT1	104964292	0.166000	0.22962	0.005000	0.12908	0.964000	0.63967	0.417000	0.21214	-0.040000	0.13580	0.491000	0.48974	GAA	RINT1	-	NULL		0.328	RINT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RINT1	HGNC	protein_coding	OTTHUMT00000348686.1	G	NM_021930		105177056	+1	no_errors	ENST00000257700	ensembl	human	known	70_37	nonsense	SNP	0.001	T
RSPH6A	81492	genome.wustl.edu	37	19	46313965	46313965	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr19:46313965C>T	ENST00000221538.3	-	2	926	c.784G>A	c.(784-786)Gac>Aac	p.D262N	RSPH6A_ENST00000600188.1_5'UTR|RSPH6A_ENST00000597055.1_Missense_Mutation_p.D262N	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	262						intracellular (GO:0005622)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						ATCTCGGGGTCGTCCCGCAGC	0.632																																																	0													95.0	80.0	85.0					19																	46313965		2203	4300	6503	SO:0001583	missense	81492			AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.784G>A	19.37:g.46313965C>T	ENSP00000221538:p.Asp262Asn		Q53FE2|Q6PEZ9	Missense_Mutation	SNP	pfam_Radial_spoke	p.D262N	ENST00000221538.3	37	c.784	CCDS12675.1	19	.	.	.	.	.	.	.	.	.	.	C	14.52	2.560895	0.45590	.	.	ENSG00000104941	ENST00000221538	T	0.16897	2.31	4.82	4.82	0.62117	.	0.574735	0.19810	N	0.105554	T	0.29914	0.0748	M	0.61703	1.905	0.35067	D	0.762127	D	0.57571	0.98	P	0.51999	0.687	T	0.26950	-1.0088	10	0.36615	T	0.2	0.4844	15.8574	0.78989	0.0:1.0:0.0:0.0	.	262	Q9H0K4	RSH6A_HUMAN	N	262	ENSP00000221538:D262N	ENSP00000221538:D262N	D	-	1	0	RSPH6A	51005805	0.951000	0.32395	0.996000	0.52242	0.777000	0.43975	2.883000	0.48554	2.689000	0.91719	0.650000	0.86243	GAC	RSPH6A	-	pfam_Radial_spoke		0.632	RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH6A	HGNC	protein_coding	OTTHUMT00000461657.1	C			46313965	-1	no_errors	ENST00000221538	ensembl	human	known	70_37	missense	SNP	0.995	T
RUSC1	23623	genome.wustl.edu	37	1	155295080	155295080	+	Intron	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr1:155295080G>A	ENST00000368352.5	+	5	1684				RUSC1_ENST00000462780.1_3'UTR|RUSC1-AS1_ENST00000443642.1_RNA|RUSC1_ENST00000292254.4_Intron|RUSC1_ENST00000368347.4_Intron|RUSC1_ENST00000368349.4_Intron|RUSC1-AS1_ENST00000450199.1_RNA|RUSC1_ENST00000368354.3_Intron	NM_001105203.1	NP_001098673.1	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1						positive regulation of signal transduction (GO:0009967)|protein polyubiquitination (GO:0000209)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(2)|skin(1)|urinary_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			GGGATCTCTGGAGCCATCGGC	0.682											OREG0013860	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													13.0	14.0	14.0					1																	155295080		2196	4296	6492	SO:0001627	intron_variant	23623			AB026894	CCDS1112.1, CCDS41410.1, CCDS41411.1, CCDS41412.1	1q21-q22	2011-04-28			ENSG00000160753	ENSG00000160753			17153	protein-coding gene	gene with protein product						10760598	Standard	NM_001105203		Approved	NESCA	uc001fkj.2	Q9BVN2	OTTHUMG00000013910	ENST00000368352.5:c.1534-27G>A	1.37:g.155295080G>A		1769	B3KWM9|Q5T9U9|Q5T9V0|Q5T9V1|Q5T9V2|Q9UPY4|Q9Y4T5	RNA	SNP	-	NULL	ENST00000368352.5	37	NULL	CCDS41410.1	1																																																																																			RUSC1	-	-		0.682	RUSC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RUSC1	HGNC	protein_coding	OTTHUMT00000039071.1	G			155295080	+1	no_errors	ENST00000462780	ensembl	human	known	70_37	rna	SNP	0.001	A
SCN2A	6326	genome.wustl.edu	37	2	166165187	166165187	+	Missense_Mutation	SNP	C	C	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr2:166165187C>A	ENST00000375437.2	+	5	778	c.488C>A	c.(487-489)aCa>aAa	p.T163K	SCN2A_ENST00000357398.3_Missense_Mutation_p.T163K|SCN2A_ENST00000283256.6_Missense_Mutation_p.T163K|SCN2A_ENST00000375427.2_Missense_Mutation_p.T163K	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	163					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TATACCTTTACAGGAATTTAT	0.308																																																	0													68.0	74.0	72.0					2																	166165187		2199	4296	6495	SO:0001583	missense	6326			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.488C>A	2.37:g.166165187C>A	ENSP00000364586:p.Thr163Lys		A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.T163K	ENST00000375437.2	37	c.488	CCDS33314.1	2	.	.	.	.	.	.	.	.	.	.	C	19.90	3.912114	0.72983	.	.	ENSG00000136531	ENST00000424833;ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D;D	0.98849	-5.18;-5.18;-5.18;-5.18;-5.18	5.57	5.57	0.84162	Ion transport (1);	0.000000	0.64402	D	0.000001	D	0.99548	0.9838	H	0.98238	4.18	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97971	1.0343	10	0.87932	D	0	.	19.9066	0.97010	0.0:1.0:0.0:0.0	.	163;163	Q99250-2;Q99250	.;SCN2A_HUMAN	K	163	ENSP00000406454:T163K;ENSP00000364586:T163K;ENSP00000349973:T163K;ENSP00000283256:T163K;ENSP00000364576:T163K	ENSP00000283256:T163K	T	+	2	0	SCN2A	165873433	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.785000	0.95823	0.650000	0.86243	ACA	SCN2A	-	pfam_Ion_trans_dom		0.308	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	HGNC	protein_coding	OTTHUMT00000102659.2	C	NM_021007		166165187	+1	no_errors	ENST00000283256	ensembl	human	known	70_37	missense	SNP	1.000	A
SCUBE1	80274	genome.wustl.edu	37	22	43608440	43608440	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr22:43608440C>A	ENST00000360835.4	-	17	2338	c.2212G>T	c.(2212-2214)Gag>Tag	p.E738*	Z82214.3_ENST00000420269.1_RNA	NM_173050.3	NP_766638.2	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	738					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|post-embryonic development (GO:0009791)|protein homooligomerization (GO:0051260)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(4)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_neural(38;0.0414)|Ovarian(80;0.07)				CCTTTAGCCTCGCAGTCCTGG	0.677																																																	0													78.0	61.0	67.0					22																	43608440		2124	4147	6271	SO:0001587	stop_gained	80274				CCDS14048.1	22q13	2008-07-01			ENSG00000159307	ENSG00000159307			13441	protein-coding gene	gene with protein product		611746				11087664	Standard	NM_173050		Approved		uc003bdt.2	Q8IWY4	OTTHUMG00000150679	ENST00000360835.4:c.2212G>T	22.37:g.43608440C>A	ENSP00000354080:p.Glu738*		Q5R336	Nonsense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_EG-like_dom,pfam_CUB,superfamily_CUB,superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EG-like_dom,smart_CUB,pfscan_CUB,pfscan_EG-like_dom	p.E738*	ENST00000360835.4	37	c.2212	CCDS14048.1	22	.	.	.	.	.	.	.	.	.	.	C	38	7.158647	0.98103	.	.	ENSG00000159307	ENST00000360835;ENST00000381243	.	.	.	4.12	4.12	0.48240	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	16.93	0.86188	0.0:1.0:0.0:0.0	.	.	.	.	X	738;368	.	ENSP00000354080:E738X	E	-	1	0	SCUBE1	41938384	1.000000	0.71417	0.819000	0.32651	0.197000	0.23852	7.204000	0.77872	2.286000	0.76751	0.655000	0.94253	GAG	SCUBE1	-	superfamily_Growth_fac_rcpt,smart_EG-like_dom		0.677	SCUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCUBE1	HGNC	protein_coding	OTTHUMT00000319582.3	C	NM_173050		43608440	-1	no_errors	ENST00000360835	ensembl	human	known	70_37	nonsense	SNP	1.000	A
SEPHS2	22928	genome.wustl.edu	37	16	30455997	30455997	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr16:30455997G>A	ENST00000478753.2	-	1	1505	c.1052C>T	c.(1051-1053)gCt>gTt	p.A351V	SEPHS2_ENST00000542752.1_Missense_Mutation_p.A294V|SEPHS2_ENST00000500504.2_Missense_Mutation_p.A351V			Q99611	SPS2_HUMAN	selenophosphate synthetase 2	351					selenocysteine biosynthetic process (GO:0016260)		ATP binding (GO:0005524)|selenide, water dikinase activity (GO:0004756)			breast(3)|cervix(1)|kidney(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	10						GCTGACGGCAGCCATCTTGGC	0.478																																					Esophageal Squamous(81;1142 1261 11202 24614 35697)												0													85.0	80.0	82.0					16																	30455997		1896	4131	6027	SO:0001583	missense	22928			BC002381		16p11.2	2013-02-15			ENSG00000179918	ENSG00000179918			19686	protein-coding gene	gene with protein product		606218				10608886	Standard	NM_012248		Approved	SPS2, SPS2b	uc021tgl.1	Q99611	OTTHUMG00000176988	ENST00000478753.2:c.1052C>T	16.37:g.30455997G>A	ENSP00000418669:p.Ala351Val		Q9BUQ2	Missense_Mutation	SNP	pfam_AIR_synth_C_dom,pfam_AIR_synth_N_dom,superfamily_AIR_synth_C_dom,superfamily_PurM_N-like,pirsf_SelD,tigrfam_SelD	p.A294V	ENST00000478753.2	37	c.881		16	.	.	.	.	.	.	.	.	.	.	G	13.21	2.169765	0.38315	.	.	ENSG00000179918	ENST00000478753;ENST00000542752;ENST00000418751;ENST00000500504	T;T;T	0.18338	2.22;2.22;2.22	5.28	3.29	0.37713	AIR synthase-related protein, C-terminal (2);	0.115652	0.56097	N	0.000022	T	0.15262	0.0368	L	0.45352	1.415	0.80722	D	1	B;B	0.14438	0.01;0.004	B;B	0.24006	0.05;0.008	T	0.05099	-1.0906	10	0.31617	T	0.26	-7.9343	10.3951	0.44196	0.1635:0.0:0.8365:0.0	.	351;294	Q99611;F5H8F9	SPS2_HUMAN;.	V	351;294;302;351	ENSP00000418669:A351V;ENSP00000443601:A294V;ENSP00000426234:A351V	ENSP00000390233:A302V	A	-	2	0	SEPHS2	30363498	1.000000	0.71417	0.957000	0.39632	0.984000	0.73092	5.589000	0.67523	0.718000	0.32166	0.655000	0.94253	GCT	SEPHS2	-	pfam_AIR_synth_C_dom,superfamily_AIR_synth_C_dom,pirsf_SelD,tigrfam_SelD		0.478	SEPHS2-001	KNOWN	basic|seleno	protein_coding	SEPHS2	HGNC	protein_coding	OTTHUMT00000109640.11	G	NM_012248		30455997	-1	no_errors	ENST00000542752	ensembl	human	known	70_37	missense	SNP	0.997	A
LGI3	203190	genome.wustl.edu	37	8	22017204	22017204	+	5'Flank	SNP	C	C	G	rs8192336	byFrequency	TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr8:22017204C>G	ENST00000306317.2	-	0	0				SFTPC_ENST00000318561.3_5'Flank|SFTPC_ENST00000524255.1_5'Flank|SFTPC_ENST00000521315.1_5'Flank|SFTPC_ENST00000520605.1_5'Flank|LGI3_ENST00000424267.2_5'Flank|SFTPC_ENST00000437090.2_5'Flank|SFTPC_ENST00000522880.1_3'UTR|SFTPC_ENST00000522109.1_5'Flank	NM_139278.2	NP_644807.1	Q8N145	LGI3_HUMAN	leucine-rich repeat LGI family, member 3						exocytosis (GO:0006887)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|extracellular region (GO:0005576)|neuron projection (GO:0043005)|synaptic vesicle (GO:0008021)	catalytic activity (GO:0003824)			endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	17				Colorectal(74;0.00189)|COAD - Colon adenocarcinoma(73;0.0612)|READ - Rectum adenocarcinoma(644;0.0999)		AGATCCCTCTCCCAGCACCCA	0.592																																																	0																																										SO:0001631	upstream_gene_variant	6440			AJ487518	CCDS6025.1	8p21.2	2008-07-28			ENSG00000168481	ENSG00000168481			18711	protein-coding gene	gene with protein product		608302				12023020, 18628660	Standard	NM_139278		Approved		uc003xav.3	Q8N145	OTTHUMG00000131599		8.37:g.22017204C>G	Exception_encountered		A5PLP2|Q86TL4|Q8N296	RNA	SNP	-	NULL	ENST00000306317.2	37	NULL	CCDS6025.1	8																																																																																			SFTPC	-	-		0.592	LGI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFTPC	HGNC	protein_coding	OTTHUMT00000254482.1	C			22017204	+1	no_errors	ENST00000524318	ensembl	human	known	70_37	rna	SNP	0.013	G
SLC22A24	283238	genome.wustl.edu	37	11	62886681	62886681	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr11:62886681C>G	ENST00000417740.1	-	3	1074	c.633G>C	c.(631-633)atG>atC	p.M211I	SLC22A24_ENST00000326192.5_Missense_Mutation_p.M211I	NM_001136506.2	NP_001129978.2	Q8N4F4	S22AO_HUMAN	solute carrier family 22, member 24	211					ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				kidney(1)|stomach(1)	2						CCAAAATAGTCATGGTGGAGA	0.423																																																	0													109.0	98.0	101.0					11																	62886681		692	1591	2283	SO:0001583	missense	283238				CCDS73308.1	11q12.3	2013-05-22			ENSG00000197658	ENSG00000197658		"""Solute carriers"""	28542	protein-coding gene	gene with protein product		611698				17714910	Standard	NM_001136506		Approved	MGC34821, NET46	uc021qkp.1	Q8N4F4	OTTHUMG00000165372	ENST00000417740.1:c.633G>C	11.37:g.62886681C>G	ENSP00000396586:p.Met211Ile			Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.M211I	ENST00000417740.1	37	c.633		11	.	.	.	.	.	.	.	.	.	.	C	7.322	0.617107	0.14129	.	.	ENSG00000197658	ENST00000417740;ENST00000531535;ENST00000326192	T;T	0.73897	-0.79;0.33	3.86	-4.18	0.03846	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.357947	0.28203	N	0.016206	T	0.51261	0.1664	L	0.38733	1.17	0.09310	N	1	B;B	0.10296	0.002;0.003	B;B	0.17098	0.017;0.01	T	0.29518	-1.0009	10	0.22109	T	0.4	.	1.6031	0.02679	0.1457:0.212:0.1455:0.4969	.	211;211	Q8N4F4;C9JC66	S22AO_HUMAN;.	I	211	ENSP00000396586:M211I;ENSP00000321549:M211I	ENSP00000321549:M211I	M	-	3	0	SLC22A24	62643257	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.199000	0.03032	-0.751000	0.04734	-0.499000	0.04595	ATG	SLC22A24	-	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.423	SLC22A24-003	PUTATIVE	non_canonical_polymorphism|basic|appris_principal|exp_conf	protein_coding	SLC22A24	HGNC	protein_coding	OTTHUMT00000383747.1	C	NM_173586		62886681	-1	no_errors	ENST00000326192	ensembl	human	known	70_37	missense	SNP	0.000	G
SLC22A24	283238	genome.wustl.edu	37	11	62886759	62886759	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr11:62886759G>C	ENST00000417740.1	-	3	996	c.555C>G	c.(553-555)atC>atG	p.I185M	SLC22A24_ENST00000326192.5_Missense_Mutation_p.I185M	NM_001136506.2	NP_001129978.2	Q8N4F4	S22AO_HUMAN	solute carrier family 22, member 24	185					ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				kidney(1)|stomach(1)	2						AGGTGTTAGAGATGGCCAGCT	0.443																																																	0													161.0	147.0	151.0					11																	62886759		692	1591	2283	SO:0001583	missense	283238				CCDS73308.1	11q12.3	2013-05-22			ENSG00000197658	ENSG00000197658		"""Solute carriers"""	28542	protein-coding gene	gene with protein product		611698				17714910	Standard	NM_001136506		Approved	MGC34821, NET46	uc021qkp.1	Q8N4F4	OTTHUMG00000165372	ENST00000417740.1:c.555C>G	11.37:g.62886759G>C	ENSP00000396586:p.Ile185Met			Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.I185M	ENST00000417740.1	37	c.555		11	.	.	.	.	.	.	.	.	.	.	G	14.98	2.697245	0.48202	.	.	ENSG00000197658	ENST00000417740;ENST00000531535;ENST00000326192	T;T	0.80738	-1.41;0.18	3.86	-0.336	0.12658	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.444589	0.24052	U	0.041997	D	0.86669	0.5988	M	0.80422	2.495	0.09310	N	1	B;D	0.89917	0.443;1.0	P;D	0.77557	0.525;0.99	T	0.77574	-0.2537	10	0.56958	D	0.05	.	7.9133	0.29803	0.3856:0.0:0.6144:0.0	.	185;185	Q8N4F4;C9JC66	S22AO_HUMAN;.	M	185	ENSP00000396586:I185M;ENSP00000321549:I185M	ENSP00000321549:I185M	I	-	3	3	SLC22A24	62643335	0.000000	0.05858	0.000000	0.03702	0.548000	0.35241	-1.190000	0.03058	-0.248000	0.09583	0.501000	0.49751	ATC	SLC22A24	-	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.443	SLC22A24-003	PUTATIVE	non_canonical_polymorphism|basic|appris_principal|exp_conf	protein_coding	SLC22A24	HGNC	protein_coding	OTTHUMT00000383747.1	G	NM_173586		62886759	-1	no_errors	ENST00000326192	ensembl	human	known	70_37	missense	SNP	0.028	C
SLC27A4	10999	genome.wustl.edu	37	9	131118060	131118060	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr9:131118060G>C	ENST00000300456.4	+	12	1876	c.1759G>C	c.(1759-1761)Gag>Cag	p.E587Q	SLC27A4_ENST00000372870.1_Missense_Mutation_p.E181Q	NM_005094.3	NP_005085.2	Q6P1M0	S27A4_HUMAN	solute carrier family 27 (fatty acid transporter), member 4	587					fatty acid transport (GO:0015908)|lipid metabolic process (GO:0006629)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty acid transport (GO:0015909)|medium-chain fatty acid transport (GO:0001579)|response to nutrient (GO:0007584)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)|very long-chain fatty acid catabolic process (GO:0042760)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	fatty acid transporter activity (GO:0015245)|long-chain fatty acid-CoA ligase activity (GO:0004467)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			autonomic_ganglia(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(2)	13						CCTCCTGCCTGAGCTGCACAA	0.617																																					Pancreas(107;1554 2241 10946 12953)												0													87.0	75.0	79.0					9																	131118060		2203	4300	6503	SO:0001583	missense	10999			AF055899	CCDS6899.1	9q34.13	2013-05-22			ENSG00000167114	ENSG00000167114		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10998	protein-coding gene	gene with protein product		604194				9878842	Standard	NM_005094		Approved	FATP4, ACSVL4	uc004but.3	Q6P1M0	OTTHUMG00000020746	ENST00000300456.4:c.1759G>C	9.37:g.131118060G>C	ENSP00000300456:p.Glu587Gln		A8K2F7|O95186|Q96G53	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.E587Q	ENST00000300456.4	37	c.1759	CCDS6899.1	9	.	.	.	.	.	.	.	.	.	.	G	13.67	2.305983	0.40795	.	.	ENSG00000167114	ENST00000372870;ENST00000300456	T;T	0.59083	0.29;0.29	4.8	3.91	0.45181	.	0.050842	0.85682	N	0.000000	T	0.46367	0.1389	L	0.38649	1.16	0.58432	D	0.999999	B;B	0.18968	0.032;0.004	B;B	0.22753	0.041;0.006	T	0.34304	-0.9834	10	0.26408	T	0.33	-25.7355	12.2047	0.54345	0.0821:0.0:0.9179:0.0	.	181;587	Q96G53;Q6P1M0	.;S27A4_HUMAN	Q	181;587	ENSP00000361961:E181Q;ENSP00000300456:E587Q	ENSP00000300456:E587Q	E	+	1	0	SLC27A4	130157881	0.727000	0.28069	0.998000	0.56505	0.982000	0.71751	0.716000	0.25836	1.250000	0.43966	0.563000	0.77884	GAG	SLC27A4	-	NULL		0.617	SLC27A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC27A4	HGNC	protein_coding	OTTHUMT00000054432.2	G			131118060	+1	no_errors	ENST00000300456	ensembl	human	known	70_37	missense	SNP	1.000	C
SLC37A1	54020	genome.wustl.edu	37	21	43959704	43959704	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr21:43959704G>C	ENST00000352133.2	+	6	1415	c.433G>C	c.(433-435)Ggc>Cgc	p.G145R	SLC37A1_ENST00000398341.3_Missense_Mutation_p.G145R			P57057	GLPT_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 1	145					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	transporter activity (GO:0005215)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(3)	15						CGCCCTGTTCGGCTTAGGGTA	0.537																																																	0													116.0	99.0	104.0					21																	43959704		2203	4300	6503	SO:0001583	missense	54020			AJ269529	CCDS13689.1	21q22.3	2013-07-17	2013-07-17		ENSG00000160190	ENSG00000160190		"""Solute carriers"""	11024	protein-coding gene	gene with protein product		608094	"""solute carrier family 37 (glycerol-3-phosphate transporter), member 1"""			11112347	Standard	NM_018964		Approved		uc002zbi.3	P57057	OTTHUMG00000086803	ENST00000352133.2:c.433G>C	21.37:g.43959704G>C	ENSP00000344648:p.Gly145Arg		D3DSJ7|Q9HAQ1	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.G145R	ENST00000352133.2	37	c.433	CCDS13689.1	21	.	.	.	.	.	.	.	.	.	.	G	20.4	3.978802	0.74360	.	.	ENSG00000160190	ENST00000398341;ENST00000352133	T;T	0.62232	0.04;0.04	4.8	4.8	0.61643	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.84982	0.5593	H	0.94306	3.52	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	D	0.89885	0.4033	10	0.87932	D	0	-14.285	17.8856	0.88852	0.0:0.0:1.0:0.0	.	145	P57057	GLPT_HUMAN	R	145	ENSP00000381383:G145R;ENSP00000344648:G145R	ENSP00000344648:G145R	G	+	1	0	SLC37A1	42832773	1.000000	0.71417	0.910000	0.35882	0.410000	0.31052	9.496000	0.97967	2.223000	0.72356	0.555000	0.69702	GGC	SLC37A1	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.537	SLC37A1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC37A1	HGNC	protein_coding	OTTHUMT00000195377.1	G			43959704	+1	no_errors	ENST00000352133	ensembl	human	known	70_37	missense	SNP	1.000	C
SLC4A7	9497	genome.wustl.edu	37	3	27427470	27427470	+	Silent	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr3:27427470G>A	ENST00000295736.5	-	23	3448	c.3378C>T	c.(3376-3378)ttC>ttT	p.F1126F	SLC4A7_ENST00000437179.1_Silent_p.F1007F|SLC4A7_ENST00000388777.4_Silent_p.F676F|SLC4A7_ENST00000454389.1_Silent_p.F1135F|SLC4A7_ENST00000455077.1_Silent_p.F1007F|SLC4A7_ENST00000435667.2_Silent_p.F1011F|SLC4A7_ENST00000440156.1_Silent_p.F1122F|SLC4A7_ENST00000445684.1_Silent_p.F1122F|SLC4A7_ENST00000425128.2_3'UTR|SLC4A7_ENST00000428386.1_Silent_p.F1002F|SLC4A7_ENST00000446700.1_Silent_p.F1118F	NM_003615.4	NP_003606.3	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 7	1126					auditory receptor cell development (GO:0060117)|bicarbonate transport (GO:0015701)|cochlear nucleus development (GO:0021747)|ion transport (GO:0006811)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal cell programmed cell death (GO:0046666)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(9)|ovary(4)|skin(1)	38					Sodium bicarbonate(DB01390)	CTCTCTTCGTGAAACACAGGT	0.338																																																	0													122.0	130.0	127.0					3																	27427470		2203	4300	6503	SO:0001819	synonymous_variant	9497			AB012130	CCDS33721.1, CCDS58819.1, CCDS58820.1	3p24.1	2013-05-22			ENSG00000033867	ENSG00000033867		"""Solute carriers"""	11033	protein-coding gene	gene with protein product		603353		SLC4A6		10198178, 9610397	Standard	NM_003615		Approved	NBC3, SBC2	uc003cdv.4	Q9Y6M7	OTTHUMG00000155679	ENST00000295736.5:c.3378C>T	3.37:g.27427470G>A			A6NIA8|B2CI53|B5M449|B5M451|B5M452|B5M453|B6DY52|B6DY53|C9JST9|D3K174|D3K175|O60350|Q6AHZ9|Q9HC88|Q9UIB9	Silent	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,tigrfam_HCO3_transpt_euk	p.F1135	ENST00000295736.5	37	c.3405	CCDS33721.1	3																																																																																			SLC4A7	-	tigrfam_HCO3_transpt_euk		0.338	SLC4A7-001	KNOWN	basic|CCDS	protein_coding	SLC4A7	HGNC	protein_coding	OTTHUMT00000341230.2	G	NM_003615		27427470	-1	no_errors	ENST00000454389	ensembl	human	known	70_37	silent	SNP	0.998	A
SLC4A7	9497	genome.wustl.edu	37	3	27427485	27427485	+	Silent	SNP	G	G	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr3:27427485G>T	ENST00000295736.5	-	23	3433	c.3363C>A	c.(3361-3363)ctC>ctA	p.L1121L	SLC4A7_ENST00000437179.1_Silent_p.L1002L|SLC4A7_ENST00000388777.4_Silent_p.L671L|SLC4A7_ENST00000454389.1_Silent_p.L1130L|SLC4A7_ENST00000455077.1_Silent_p.L1002L|SLC4A7_ENST00000435667.2_Silent_p.L1006L|SLC4A7_ENST00000440156.1_Silent_p.L1117L|SLC4A7_ENST00000445684.1_Silent_p.L1117L|SLC4A7_ENST00000425128.2_3'UTR|SLC4A7_ENST00000428386.1_Silent_p.L997L|SLC4A7_ENST00000446700.1_Silent_p.L1113L	NM_003615.4	NP_003606.3	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 7	1121					auditory receptor cell development (GO:0060117)|bicarbonate transport (GO:0015701)|cochlear nucleus development (GO:0021747)|ion transport (GO:0006811)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal cell programmed cell death (GO:0046666)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(9)|ovary(4)|skin(1)	38					Sodium bicarbonate(DB01390)	ACAGGTCCATGAGTTTGCGCA	0.343																																																	0													117.0	126.0	123.0					3																	27427485		2203	4300	6503	SO:0001819	synonymous_variant	9497			AB012130	CCDS33721.1, CCDS58819.1, CCDS58820.1	3p24.1	2013-05-22			ENSG00000033867	ENSG00000033867		"""Solute carriers"""	11033	protein-coding gene	gene with protein product		603353		SLC4A6		10198178, 9610397	Standard	NM_003615		Approved	NBC3, SBC2	uc003cdv.4	Q9Y6M7	OTTHUMG00000155679	ENST00000295736.5:c.3363C>A	3.37:g.27427485G>T			A6NIA8|B2CI53|B5M449|B5M451|B5M452|B5M453|B6DY52|B6DY53|C9JST9|D3K174|D3K175|O60350|Q6AHZ9|Q9HC88|Q9UIB9	Silent	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,tigrfam_HCO3_transpt_euk	p.L1130	ENST00000295736.5	37	c.3390	CCDS33721.1	3																																																																																			SLC4A7	-	tigrfam_HCO3_transpt_euk		0.343	SLC4A7-001	KNOWN	basic|CCDS	protein_coding	SLC4A7	HGNC	protein_coding	OTTHUMT00000341230.2	G	NM_003615		27427485	-1	no_errors	ENST00000454389	ensembl	human	known	70_37	silent	SNP	0.999	T
SNAPC4	6621	genome.wustl.edu	37	9	139292753	139292753	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr9:139292753G>C	ENST00000298532.2	-	1	496	c.128C>G	c.(127-129)gCa>gGa	p.A43G		NM_003086.2	NP_003077.2			small nuclear RNA activating complex, polypeptide 4, 190kDa											biliary_tract(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	33		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		GGGCTTACCTGCTTCAGAATC	0.552																																																	0													108.0	111.0	110.0					9																	139292753		2203	4300	6503	SO:0001583	missense	6621			AF032387	CCDS6998.1	9q34.3	2008-07-21	2002-08-29		ENSG00000165684	ENSG00000165684			11137	protein-coding gene	gene with protein product		602777	"""small nuclear RNA activating complex, polypeptide 4, 190kD"""			9418884	Standard	XM_005266096		Approved	SNAP190, PTFalpha, FLJ13451	uc004chh.3	Q5SXM2	OTTHUMG00000020929	ENST00000298532.2:c.128C>G	9.37:g.139292753G>C	ENSP00000298532:p.Ala43Gly			Missense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.A43G	ENST00000298532.2	37	c.128	CCDS6998.1	9	.	.	.	.	.	.	.	.	.	.	g	9.765	1.171214	0.21621	.	.	ENSG00000165684	ENST00000298532	T	0.32753	1.44	4.18	3.25	0.37280	.	1.177410	0.05996	N	0.646926	T	0.32971	0.0847	M	0.63428	1.95	0.24486	N	0.994328	B	0.26445	0.149	B	0.23716	0.048	T	0.27938	-1.0059	10	0.30854	T	0.27	-10.7631	9.2203	0.37373	0.0:0.0:0.606:0.394	.	43	Q5SXM2	SNPC4_HUMAN	G	43	ENSP00000298532:A43G	ENSP00000298532:A43G	A	-	2	0	SNAPC4	138412574	0.461000	0.25783	0.650000	0.29550	0.480000	0.33159	0.424000	0.21330	1.065000	0.40693	0.651000	0.88453	GCA	SNAPC4	-	NULL		0.552	SNAPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAPC4	HGNC	protein_coding	OTTHUMT00000055071.1	G	NM_003086		139292753	-1	no_errors	ENST00000298532	ensembl	human	known	70_37	missense	SNP	0.842	C
SON	6651	genome.wustl.edu	37	21	34922769	34922769	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr21:34922769C>G	ENST00000356577.4	+	3	1707	c.1232C>G	c.(1231-1233)aCc>aGc	p.T411S	SON_ENST00000381692.2_Intron|SON_ENST00000381679.4_Missense_Mutation_p.T411S|SON_ENST00000290239.6_Missense_Mutation_p.T411S|SON_ENST00000300278.4_Missense_Mutation_p.T411S	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	411					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						CCCTCTGCTACCCCGGTGCCA	0.672																																																	0													37.0	43.0	41.0					21																	34922769		2203	4300	6503	SO:0001583	missense	6651			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.1232C>G	21.37:g.34922769C>G	ENSP00000348984:p.Thr411Ser		D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	pfam_G_patch_dom,superfamily_WD40_repeat_dom,smart_G_patch_dom,pfscan_G_patch_dom,pfscan_Ds-RNA-bd	p.T411S	ENST00000356577.4	37	c.1232	CCDS13629.1	21	.	.	.	.	.	.	.	.	.	.	C	18.76	3.691687	0.68271	.	.	ENSG00000159140	ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679	T;T;T;T	0.16597	2.47;2.51;2.52;2.33	5.44	4.56	0.56223	.	0.103138	0.43747	N	0.000533	T	0.29158	0.0725	L	0.32530	0.975	0.24345	N	0.99494	D;D;D	0.67145	0.994;0.996;0.99	D;D;D	0.77557	0.977;0.99;0.987	T	0.04796	-1.0926	10	0.51188	T	0.08	.	12.2956	0.54844	0.0:0.9168:0.0:0.0832	.	411;411;411	P18583;P18583-3;P18583-6	SON_HUMAN;.;.	S	411	ENSP00000348984:T411S;ENSP00000290239:T411S;ENSP00000300278:T411S;ENSP00000371095:T411S	ENSP00000290239:T411S	T	+	2	0	SON	33844639	0.001000	0.12720	0.999000	0.59377	0.944000	0.59088	1.144000	0.31565	1.443000	0.47586	0.491000	0.48974	ACC	SON	-	NULL		0.672	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SON	HGNC	protein_coding	OTTHUMT00000140978.2	C	NM_138927		34922769	+1	no_errors	ENST00000356577	ensembl	human	known	70_37	missense	SNP	0.862	G
SPESP1	246777	genome.wustl.edu	37	15	69238196	69238196	+	Missense_Mutation	SNP	C	C	T	rs111627351		TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr15:69238196C>T	ENST00000310673.3	+	2	477	c.323C>T	c.(322-324)cCg>cTg	p.P108L	NOX5_ENST00000455873.3_Intron|NOX5_ENST00000260364.5_Intron|NOX5_ENST00000448182.3_Intron|SPESP1_ENST00000560188.1_3'UTR|RP11-809H16.2_ENST00000557966.1_RNA	NM_145658.3	NP_663633.1	Q6UW49	SPESP_HUMAN	sperm equatorial segment protein 1	108					acrosome reaction (GO:0007340)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organismal development (GO:0007275)	acrosomal vesicle (GO:0001669)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|prostate(1)|skin(1)|urinary_tract(1)	19						GGCTTCACACCGGAAATAGGA	0.403																																																	0													65.0	65.0	65.0					15																	69238196		2200	4298	6498	SO:0001583	missense	246777			AF275321	CCDS10230.1	15q22.31	2011-04-15				ENSG00000258484			15570	protein-coding gene	gene with protein product		609399				12773409	Standard	NM_145658		Approved	SP-ESP	uc002arn.2	Q6UW49		ENST00000310673.3:c.323C>T	15.37:g.69238196C>T	ENSP00000312284:p.Pro108Leu		Q8NG22|Q8WVH8	Missense_Mutation	SNP	NULL	p.P108L	ENST00000310673.3	37	c.323	CCDS10230.1	15	.	.	.	.	.	.	.	.	.	.	C	0.187	-1.057208	0.01965	.	.	ENSG00000258484	ENST00000310673	T	0.20598	2.06	5.21	-1.74	0.08056	.	1.241020	0.06240	N	0.690176	T	0.06188	0.0160	N	0.02539	-0.55	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.34750	-0.9816	10	0.02654	T	1	0.557	5.0442	0.14475	0.1463:0.405:0.0:0.4487	.	108	Q6UW49	SPESP_HUMAN	L	108	ENSP00000312284:P108L	ENSP00000312284:P108L	P	+	2	0	SPESP1	67025250	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.595000	0.05727	-0.226000	0.09899	-0.345000	0.07892	CCG	SPESP1	-	NULL		0.403	SPESP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPESP1	HGNC	protein_coding	OTTHUMT00000257125.1	C	NM_145658		69238196	+1	no_errors	ENST00000310673	ensembl	human	known	70_37	missense	SNP	0.000	T
SPIN3	169981	genome.wustl.edu	37	X	57021344	57021344	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chrX:57021344G>A	ENST00000374919.3	-	2	359	c.37C>T	c.(37-39)Cgg>Tgg	p.R13W		NM_001010862.2	NP_001010862.2	Q5JUX0	SPIN3_HUMAN	spindlin family, member 3	13					gamete generation (GO:0007276)			p.R13W(2)		central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)	4						GTCCTGGACCGCTGCCCTGCA	0.562																																																	2	Substitution - Missense(2)	large_intestine(2)											38.0	39.0	38.0					X																	57021344		2060	4174	6234	SO:0001583	missense	169981			AL832091	CCDS43963.1	Xp11.22	2008-02-05			ENSG00000204271	ENSG00000204271			27272	protein-coding gene	gene with protein product							Standard	NM_001010862		Approved		uc004dux.1	Q5JUX0	OTTHUMG00000021677	ENST00000374919.3:c.37C>T	X.37:g.57021344G>A	ENSP00000364054:p.Arg13Trp		B2RUW3|B7Z8W2|Q8N5D9	Missense_Mutation	SNP	pfam_Spin_Ssty	p.R13W	ENST00000374919.3	37	c.37	CCDS43963.1	X	.	.	.	.	.	.	.	.	.	.	G	15.76	2.928182	0.52759	.	.	ENSG00000204271	ENST00000374919;ENST00000374915	T	0.48836	0.8	2.45	1.54	0.23209	.	.	.	.	.	T	0.44201	0.1282	L	0.33485	1.01	0.31742	N	0.635653	D	0.69078	0.997	P	0.53313	0.723	T	0.52026	-0.8630	9	0.87932	D	0	-1.0089	6.5679	0.22523	0.0:0.0:0.4886:0.5114	.	13	Q5JUX0	SPIN3_HUMAN	W	13	ENSP00000364054:R13W	ENSP00000364050:R13W	R	-	1	2	SPIN3	57038069	0.055000	0.20627	0.550000	0.28217	0.077000	0.17291	0.385000	0.20685	0.445000	0.26639	0.600000	0.82982	CGG	SPIN3	-	NULL		0.562	SPIN3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SPIN3	HGNC	protein_coding	OTTHUMT00000056908.1	G	XM_093024		57021344	-1	no_errors	ENST00000374919	ensembl	human	known	70_37	missense	SNP	0.872	A
SPNS2	124976	genome.wustl.edu	37	17	4439674	4439674	+	Silent	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr17:4439674C>T	ENST00000329078.3	+	11	1770	c.1560C>T	c.(1558-1560)ctC>ctT	p.L520L		NM_001124758.1	NP_001118230.1	Q8IVW8	SPNS2_HUMAN	spinster homolog 2 (Drosophila)	520					B cell homeostasis (GO:0001782)|bone development (GO:0060348)|lymph node development (GO:0048535)|lymphocyte migration (GO:0072676)|regulation of eye pigmentation (GO:0048073)|regulation of humoral immune response (GO:0002920)|sphingolipid metabolic process (GO:0006665)|sphingosine-1-phosphate signaling pathway (GO:0003376)|T cell homeostasis (GO:0043029)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	sphingolipid transporter activity (GO:0046624)			large_intestine(3)|lung(1)|prostate(1)|skin(1)	6						TGTTCTTCCTCGCCACTGCGC	0.677																																																	0													90.0	75.0	79.0					17																	4439674		1568	3582	5150	SO:0001819	synonymous_variant	124976			BC041772	CCDS42237.1	17p13.2	2008-12-15				ENSG00000183018			26992	protein-coding gene	gene with protein product		612584				12815463	Standard	NM_001124758		Approved		uc002fxx.2	Q8IVW8		ENST00000329078.3:c.1560C>T	17.37:g.4439674C>T			B9A1T3	Silent	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.L520	ENST00000329078.3	37	c.1560	CCDS42237.1	17																																																																																			SPNS2	-	superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.677	SPNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPNS2	HGNC	protein_coding	OTTHUMT00000438802.1	C			4439674	+1	no_errors	ENST00000329078	ensembl	human	known	70_37	silent	SNP	0.083	T
SPTA1	6708	genome.wustl.edu	37	1	158582665	158582665	+	Missense_Mutation	SNP	T	T	C			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr1:158582665T>C	ENST00000368147.4	-	51	7256	c.7076A>G	c.(7075-7077)aAt>aGt	p.N2359S	SPTA1_ENST00000485680.1_5'Flank	NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2359	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TTGGAAGGCATTCTCTATTTC	0.458																																																	0													125.0	121.0	123.0					1																	158582665		1948	4150	6098	SO:0001583	missense	6708			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.7076A>G	1.37:g.158582665T>C	ENSP00000357129:p.Asn2359Ser		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_HAND_2,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.N2359S	ENST00000368147.4	37	c.7076	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	T	0.194	-1.050345	0.01981	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.41400	1.0;1.0	5.39	-0.748	0.11087	EF-hand, Ca insensitive (1);EF-hand-like domain (1);	0.478727	0.15541	N	0.256935	T	0.06781	0.0173	N	0.16066	0.365	0.27257	N	0.958726	B	0.14012	0.009	B	0.16722	0.016	T	0.43196	-0.9406	10	0.02654	T	1	.	12.5063	0.55984	0.0:0.656:0.0:0.344	.	2359	P02549	SPTA1_HUMAN	S	2359;2356	ENSP00000357130:N2359S;ENSP00000357129:N2356S	ENSP00000357129:N2356S	N	-	2	0	SPTA1	156849289	1.000000	0.71417	0.119000	0.21687	0.461000	0.32589	1.265000	0.33027	-0.239000	0.09710	-0.256000	0.11100	AAT	SPTA1	-	pfam_EF-hand_Ca_insen		0.458	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	T	NM_003126		158582665	-1	no_errors	ENST00000368148	ensembl	human	known	70_37	missense	SNP	0.773	C
SSPO	23145	genome.wustl.edu	37	7	149481978	149481978	+	RNA	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr7:149481978C>T	ENST00000378016.2	+	0	2766							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CAGGGGCATTCTGCCCCAGGG	0.612																																																	0													58.0	62.0	61.0					7																	149481978		2019	4180	6199			23145			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149481978C>T			Q76B61	RNA	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			SSPO	-	-		0.612	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		C			149481978	+1	no_errors	ENST00000262089	ensembl	human	known	70_37	rna	SNP	0.997	T
STK33	65975	genome.wustl.edu	37	11	8414079	8414079	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr11:8414079G>A	ENST00000447869.1	-	12	2441	c.1523C>T	c.(1522-1524)tCc>tTc	p.S508F	STK33_ENST00000534493.1_Missense_Mutation_p.S467F|STK33_ENST00000358872.3_Missense_Mutation_p.S321F|STK33_ENST00000396672.1_Missense_Mutation_p.S508F|STK33_ENST00000473980.1_5'UTR|STK33_ENST00000315204.1_Missense_Mutation_p.S508F|STK33_ENST00000396673.1_Missense_Mutation_p.S442F			Q9BYT3	STK33_HUMAN	serine/threonine kinase 33	508					protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|skin(3)	23				Epithelial(150;2.13e-06)|BRCA - Breast invasive adenocarcinoma(625;0.239)		TTTGGTTCTGGACAGGGCGCC	0.483																																																	0													204.0	200.0	201.0					11																	8414079		2201	4296	6497	SO:0001583	missense	65975			AJ303380	CCDS7789.1, CCDS73253.1, CCDS73254.1	11p15.3	2010-03-10			ENSG00000130413	ENSG00000130413			14568	protein-coding gene	gene with protein product		607670				11738831	Standard	NM_030906		Approved		uc001mgj.1	Q9BYT3	OTTHUMG00000140275	ENST00000447869.1:c.1523C>T	11.37:g.8414079G>A	ENSP00000416750:p.Ser508Phe		Q658S6|Q8NEF5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S508F	ENST00000447869.1	37	c.1523	CCDS7789.1	11	.	.	.	.	.	.	.	.	.	.	G	7.731	0.699301	0.15106	.	.	ENSG00000130413	ENST00000447869;ENST00000315204;ENST00000396672;ENST00000358872;ENST00000396673;ENST00000444064;ENST00000534493	T;T;T;T;T;T;T	0.71103	-0.46;-0.46;-0.46;-0.54;-0.53;-0.22;-0.47	6.17	3.96	0.45880	.	0.904529	0.09413	N	0.805442	T	0.53642	0.1809	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.42949	-0.9421	10	0.41790	T	0.15	.	8.3238	0.32145	0.2463:0.0:0.7537:0.0	.	508	Q9BYT3	STK33_HUMAN	F	508;508;508;321;442;197;467	ENSP00000416750:S508F;ENSP00000320754:S508F;ENSP00000379905:S508F;ENSP00000351743:S321F;ENSP00000379906:S442F;ENSP00000415688:S197F;ENSP00000436418:S467F	ENSP00000320754:S508F	S	-	2	0	STK33	8370655	0.535000	0.26370	0.199000	0.23439	0.086000	0.17979	2.253000	0.43205	0.672000	0.31204	0.655000	0.94253	TCC	STK33	-	NULL		0.483	STK33-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	STK33	HGNC	protein_coding	OTTHUMT00000276819.2	G	NM_030906		8414079	-1	no_errors	ENST00000315204	ensembl	human	known	70_37	missense	SNP	0.147	A
SUPT16H	11198	genome.wustl.edu	37	14	21821725	21821725	+	Splice_Site	SNP	C	C	G			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr14:21821725C>G	ENST00000216297.2	-	25	3259		c.e25-1			NM_007192.3	NP_009123.1	Q9Y5B9	SP16H_HUMAN	suppressor of Ty 16 homolog (S. cerevisiae)						DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|nucleosome disassembly (GO:0006337)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)		TTAGAATAGTCTGGAAGAAAA	0.363																																																	0													86.0	87.0	87.0					14																	21821725		2203	4300	6503	SO:0001630	splice_region_variant	11198			AF152961	CCDS9569.1	14q11.1	2008-08-13	2001-11-28		ENSG00000092201	ENSG00000092201			11465	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 140 kDa subunit"""	605012	"""suppressor of Ty (S.cerevisiae) 16 homolog"""			9489704, 11239457	Standard	NM_007192		Approved	FACT, FACTP140, SPT16/CDC68, FLJ14010, FLJ10857, CDC68	uc001wao.2	Q9Y5B9	OTTHUMG00000029685	ENST00000216297.2:c.2921-1G>C	14.37:g.21821725C>G			Q6GMT8|Q6P2F1|Q6PJM1|Q9NRX0	Splice_Site	SNP	-	e25-1	ENST00000216297.2	37	c.2921-1	CCDS9569.1	14	.	.	.	.	.	.	.	.	.	.	C	20.9	4.070078	0.76301	.	.	ENSG00000092201	ENST00000216297	.	.	.	4.91	4.91	0.64330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.2967	0.87172	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SUPT16H	20891565	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	4.712000	0.61888	2.426000	0.82243	0.650000	0.86243	.	SUPT16H	-	-		0.363	SUPT16H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUPT16H	HGNC	protein_coding	OTTHUMT00000074025.2	C		Intron	21821725	-1	no_errors	ENST00000216297	ensembl	human	known	70_37	splice_site	SNP	1.000	G
SYF2	25949	genome.wustl.edu	37	1	25551554	25551554	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr1:25551554G>A	ENST00000236273.4	-	6	530	c.505C>T	c.(505-507)Cat>Tat	p.H169Y	SYF2_ENST00000354361.3_Missense_Mutation_p.H127Y	NM_015484.4	NP_056299.1	O95926	SYF2_HUMAN	SYF2 pre-mRNA-splicing factor	169					embryonic organ development (GO:0048568)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|mitotic G2 DNA damage checkpoint (GO:0007095)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(1)|lung(4)	6		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.5e-26)|Colorectal(126;2.54e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000455)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00145)|GBM - Glioblastoma multiforme(114;0.00443)|READ - Rectum adenocarcinoma(331;0.0936)|Lung(427;0.201)		TGTGTTCCATGAAGAAGACTA	0.373																																																	0													174.0	150.0	158.0					1																	25551554		2203	4300	6503	SO:0001583	missense	25949			AF273089	CCDS258.1, CCDS259.1	1p36.11	2013-08-21	2013-08-21	2005-09-14	ENSG00000117614	ENSG00000117614			19824	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 29"""	607090	"""CCNDBP1 interactor"", ""SYF2 homolog, RNA splicing factor (S. cerevisiae)"""	CBPIN		11118353	Standard	NM_207170		Approved	p29, DKFZp564O2082, NTC31, fSAP29	uc001bjt.1	O95926	OTTHUMG00000043610	ENST00000236273.4:c.505C>T	1.37:g.25551554G>A	ENSP00000236273:p.His169Tyr		Q5TH73	Missense_Mutation	SNP	pfam_mRNA_splic_SYF2	p.H169Y	ENST00000236273.4	37	c.505	CCDS259.1	1	.	.	.	.	.	.	.	.	.	.	G	12.91	2.080891	0.36758	.	.	ENSG00000117614	ENST00000236273;ENST00000354361	T;T	0.39787	1.06;1.07	5.63	5.63	0.86233	.	0.139890	0.64402	D	0.000004	T	0.25717	0.0626	N	0.12569	0.235	0.80722	D	1	B;B	0.11235	0.004;0.001	B;B	0.17979	0.02;0.004	T	0.12243	-1.0555	10	0.02654	T	1	-15.6774	18.6919	0.91586	0.0:0.0:1.0:0.0	.	169;169	B2RBX8;O95926	.;SYF2_HUMAN	Y	169;127	ENSP00000236273:H169Y;ENSP00000346330:H127Y	ENSP00000236273:H169Y	H	-	1	0	SYF2	25424141	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.349000	0.66010	2.824000	0.97209	0.592000	0.82586	CAT	SYF2	-	pfam_mRNA_splic_SYF2		0.373	SYF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYF2	HGNC	protein_coding	OTTHUMT00000101962.1	G	NM_015484		25551554	-1	no_errors	ENST00000236273	ensembl	human	known	70_37	missense	SNP	1.000	A
SYNE3	161176	genome.wustl.edu	37	14	95932372	95932372	+	Missense_Mutation	SNP	C	C	G	rs542535872	byFrequency	TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr14:95932372C>G	ENST00000334258.5	-	3	537	c.523G>C	c.(523-525)Gag>Cag	p.E175Q	SYNE3_ENST00000557275.1_Missense_Mutation_p.E175Q|SYNE3_ENST00000553340.1_Missense_Mutation_p.E175Q	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	175					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)			breast(1)|endometrium(2)|lung(25)	28						GCTGCCTCCTCCAGCAGCCGG	0.632																																																	0													76.0	69.0	71.0					14																	95932372		2203	4300	6503	SO:0001583	missense	161176			AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.523G>C	14.37:g.95932372C>G	ENSP00000334308:p.Glu175Gln		A6H8H3|Q86SX5|Q8N7G8	Missense_Mutation	SNP	pfam_KASH,pfam_Spectrin_repeat,superfamily_Retrov_capsid_C,smart_Spectrin/alpha-actinin,pfscan_KASH	p.E175Q	ENST00000334258.5	37	c.523	CCDS9935.1	14	.	.	.	.	.	.	.	.	.	.	c	22.9	4.349409	0.82132	.	.	ENSG00000176438	ENST00000334258;ENST00000557275;ENST00000553340	T;T;T	0.36340	1.26;1.26;1.26	4.12	4.12	0.48240	.	0.000000	0.38778	N	0.001569	T	0.53384	0.1793	M	0.64997	1.995	0.50313	D	0.999869	D;D;D	0.63046	0.992;0.987;0.987	P;P;P	0.61003	0.882;0.799;0.765	T	0.55630	-0.8111	10	0.41790	T	0.15	-23.79	16.4126	0.83723	0.0:1.0:0.0:0.0	.	175;175;175	Q6ZMZ3-2;Q6ZMZ3-3;Q6ZMZ3	.;.;SYNE3_HUMAN	Q	175	ENSP00000334308:E175Q;ENSP00000450562:E175Q;ENSP00000450774:E175Q	ENSP00000334308:E175Q	E	-	1	0	C14orf49	95002125	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.289000	0.78701	1.828000	0.53243	0.298000	0.19748	GAG	SYNE3	-	NULL		0.632	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE3	HGNC	protein_coding	OTTHUMT00000420529.2	C	NM_152592		95932372	-1	no_errors	ENST00000334258	ensembl	human	known	70_37	missense	SNP	1.000	G
TAGAP	117289	genome.wustl.edu	37	6	159457435	159457435	+	Silent	SNP	C	C	T	rs200549687		TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr6:159457435C>T	ENST00000367066.3	-	10	1951	c.1620G>A	c.(1618-1620)ccG>ccA	p.P540P	RP1-111C20.4_ENST00000606466.1_RNA|RP1-111C20.4_ENST00000607796.1_RNA|RP1-111C20.4_ENST00000606470.1_RNA|RP1-111C20.4_ENST00000607391.1_RNA|TAGAP_ENST00000326965.6_Silent_p.P362P	NM_001278733.1|NM_054114.3	NP_001265662.1|NP_473455.2	Q8N103	TAGAP_HUMAN	T-cell activation RhoGTPase activating protein	540					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|autonomic_ganglia(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(2)|skin(1)	23		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-16)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		TGACACCCCTCGGGACGTGGT	0.562																																																	0													51.0	56.0	54.0					6																	159457435		2203	4300	6503	SO:0001819	synonymous_variant	117289			AF385429	CCDS5261.1, CCDS5262.1, CCDS5263.1	6q25.3	2011-09-07	2008-03-25		ENSG00000164691	ENSG00000164691		"""Rho GTPase activating proteins"""	15669	protein-coding gene	gene with protein product		609667	"""T-cell activation GTPase activating protein"""			16375659, 18311140, 18356936	Standard	NM_152133		Approved	FLJ32631, IDDM21, ARHGAP47	uc003qrz.3	Q8N103	OTTHUMG00000015923	ENST00000367066.3:c.1620G>A	6.37:g.159457435C>T			Q2NKM8|Q8NI40|Q96KZ2|Q96QA2	Silent	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.P540	ENST00000367066.3	37	c.1620	CCDS5261.1	6																																																																																			TAGAP	-	NULL		0.562	TAGAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TAGAP	HGNC	protein_coding	OTTHUMT00000042890.1	C	NM_054114		159457435	-1	no_errors	ENST00000367066	ensembl	human	known	70_37	silent	SNP	0.017	T
TCN2	6948	genome.wustl.edu	37	22	31006924	31006924	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr22:31006924G>A	ENST00000215838.3	+	2	625	c.131G>A	c.(130-132)cGg>cAg	p.R44Q	TCN2_ENST00000405742.3_Missense_Mutation_p.R44Q|TCN2_ENST00000407817.3_Missense_Mutation_p.R44Q			P20062	TCO2_HUMAN	transcobalamin II	44					cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	cobalamin binding (GO:0031419)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|prostate(2)|urinary_tract(1)	22					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGGATGGACCGGCTTTCCCTG	0.527																																																	0													175.0	165.0	168.0					22																	31006924		2203	4300	6503	SO:0001583	missense	6948				CCDS13881.1, CCDS54519.1	22q12.2	2014-09-17	2010-05-11		ENSG00000185339	ENSG00000185339			11653	protein-coding gene	gene with protein product	"""macrocytic anemia"""	613441	"""transcobalamin II; macrocytic anemia"""			1708393, 7742531	Standard	NM_000355		Approved	D22S676, D22S750, TC2	uc003aip.2	P20062	OTTHUMG00000151095	ENST00000215838.3:c.131G>A	22.37:g.31006924G>A	ENSP00000215838:p.Arg44Gln		Q96FD4|Q9BVI8|Q9UCI5|Q9UCI6|Q9UDM0	Missense_Mutation	SNP	pfam_Cbl-bd_transpt_euk,superfamily_Terpenoid_cyclase/PrenylTrfase	p.R44Q	ENST00000215838.3	37	c.131	CCDS13881.1	22	.	.	.	.	.	.	.	.	.	.	G	12.31	1.898393	0.33535	.	.	ENSG00000185339	ENST00000215838;ENST00000423350;ENST00000405742;ENST00000407817	T;T;T;T	0.35421	1.32;1.32;1.32;1.31	6.16	-12.3	0.00002	.	2.265590	0.01230	N	0.008324	T	0.18045	0.0433	L	0.41824	1.3	0.19945	N	0.999944	B;B;B	0.32604	0.233;0.377;0.377	B;B;B	0.17722	0.019;0.011;0.011	T	0.02505	-1.1149	10	0.11182	T	0.66	-0.0542	6.889	0.24218	0.1445:0.0715:0.5409:0.2431	.	44;44;44	Q96FD4;B5MBX2;P20062	.;.;TCO2_HUMAN	Q	44	ENSP00000215838:R44Q;ENSP00000411529:R44Q;ENSP00000385914:R44Q;ENSP00000384914:R44Q	ENSP00000215838:R44Q	R	+	2	0	TCN2	29336924	0.000000	0.05858	0.007000	0.13788	0.731000	0.41821	-1.149000	0.03182	-2.750000	0.00375	-1.316000	0.01300	CGG	TCN2	-	pfam_Cbl-bd_transpt_euk		0.527	TCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCN2	HGNC	protein_coding	OTTHUMT00000321282.2	G	NM_000355		31006924	+1	no_errors	ENST00000215838	ensembl	human	known	70_37	missense	SNP	0.000	A
TNK2	10188	genome.wustl.edu	37	3	195594534	195594534	+	Missense_Mutation	SNP	C	C	T	rs143850445		TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr3:195594534C>T	ENST00000333602.6	-	12	3207	c.2590G>A	c.(2590-2592)Gag>Aag	p.E864K	TNK2_ENST00000428187.1_Missense_Mutation_p.E896K|TNK2_ENST00000381916.2_Missense_Mutation_p.E942K|TNK2_ENST00000392400.1_Missense_Mutation_p.E864K	NM_005781.4	NP_005772.3	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2	864	EBD domain. {ECO:0000250}.|Pro-rich.			Missing (in Ref. 4; AAH08884). {ECO:0000305}.	cell surface receptor signaling pathway (GO:0007166)|endocytosis (GO:0006897)|negative regulation of catalytic activity (GO:0043086)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of clathrin-mediated endocytosis (GO:2000369)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endosome (GO:0005768)|Grb2-EGFR complex (GO:0070436)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|WW domain binding (GO:0050699)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|ovary(3)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	29	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	GATGGTCGCTCGGGCAGCAAG	0.682																																																	0								C	LYS/GLU,LYS/GLU	1,4403		0,1,2201	31.0	30.0	30.0		2824,2590	5.3	0.9	3	dbSNP_134	30	0,8582		0,0,4291	no	missense,missense	TNK2	NM_001010938.1,NM_005781.4	56,56	0,1,6492	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	942/1087,864/1039	195594534	1,12985	2202	4291	6493	SO:0001583	missense	10188			L13738	CCDS33927.1, CCDS33928.1	3q29	2013-09-02			ENSG00000061938	ENSG00000061938			19297	protein-coding gene	gene with protein product	"""activated Cdc42-associated kinase 1"""	606994				8497321, 14506255	Standard	XM_006713460		Approved	p21cdc42Hs, ACK, ACK1	uc003fvt.1	Q07912	OTTHUMG00000155737	ENST00000333602.6:c.2590G>A	3.37:g.195594534C>T	ENSP00000329425:p.Glu864Lys		Q6ZMQ0|Q8N6U7|Q96H59	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_GTPase_binding,pfam_Inhibitor_Mig-6,superfamily_Kinase-like_dom,superfamily_SH3_domain,superfamily_SAM/pointed,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E942K	ENST00000333602.6	37	c.2824	CCDS33928.1	3	.	.	.	.	.	.	.	.	.	.	C	16.45	3.127384	0.56721	2.27E-4	0.0	ENSG00000061938	ENST00000333602;ENST00000381916;ENST00000416152;ENST00000428187;ENST00000392400	T;T;T;T;T	0.78816	-1.17;-1.21;2.62;-1.2;-1.17	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	D	0.84606	0.5509	L	0.54323	1.7	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.80764	0.981;0.994;0.986;0.991	T	0.80754	-0.1241	10	0.19590	T	0.45	.	17.5128	0.87765	0.0:1.0:0.0:0.0	.	864;942;896;389	Q07912;Q07912-3;C9J1X3;B3KXJ4	ACK1_HUMAN;.;.;.	K	864;942;431;896;864	ENSP00000329425:E864K;ENSP00000371341:E942K;ENSP00000398614:E431K;ENSP00000392546:E896K;ENSP00000376201:E864K	ENSP00000329425:E864K	E	-	1	0	TNK2	197078931	1.000000	0.71417	0.948000	0.38648	0.005000	0.04900	7.358000	0.79466	2.469000	0.83416	0.561000	0.74099	GAG	TNK2	-	NULL		0.682	TNK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TNK2	HGNC	protein_coding	OTTHUMT00000341437.3	C	NM_005781		195594534	-1	no_errors	ENST00000381916	ensembl	human	known	70_37	missense	SNP	1.000	T
TOP3A	7156	genome.wustl.edu	37	17	18181558	18181558	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr17:18181558G>A	ENST00000321105.5	-	18	2472	c.2258C>T	c.(2257-2259)tCa>tTa	p.S753L	TOP3A_ENST00000542570.1_Missense_Mutation_p.S658L|TOP3A_ENST00000540524.1_Missense_Mutation_p.S283L	NM_004618.3	NP_004609.1	Q13472	TOP3A_HUMAN	topoisomerase (DNA) III alpha	753					DNA topological change (GO:0006265)|meiotic nuclear division (GO:0007126)	chromosome (GO:0005694)|nucleus (GO:0005634)|PML body (GO:0016605)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(2)|urinary_tract(1)	36						GGGGCCCCCTGAAAATCTCAG	0.632																																																	0													32.0	38.0	36.0					17																	18181558		2202	4298	6500	SO:0001583	missense	7156			U43431	CCDS11194.1	17p12-p11.2	2014-02-18			ENSG00000177302	ENSG00000177302			11992	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 7"""	601243		TOP3		9450867	Standard	NM_004618		Approved	ZGRF7	uc002gsx.1	Q13472	OTTHUMG00000059391	ENST00000321105.5:c.2258C>T	17.37:g.18181558G>A	ENSP00000321636:p.Ser753Leu		A8KA61|B4DK80|D3DXC7|Q13473	Missense_Mutation	SNP	pfam_Topo_IA_cen,pfam_Znf_GRF,pfam_Toprim_domain,pfam_Topo_IA_Znf,superfamily_Topo_IA_core_domain,superfamily_Znf_CCHC,smart_Toprim_domain,smart_Topo_IA_2,smart_Topo_IA_DNA-bd,prints_Topo_IA	p.S753L	ENST00000321105.5	37	c.2258	CCDS11194.1	17	.	.	.	.	.	.	.	.	.	.	G	6.434	0.448193	0.12223	.	.	ENSG00000177302	ENST00000321105;ENST00000540524;ENST00000542570	T;T;T	0.11495	3.14;2.77;3.13	5.55	3.56	0.40772	.	0.389692	0.27912	N	0.017341	T	0.06462	0.0166	L	0.27053	0.805	0.21105	N	0.999788	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.002	T	0.39440	-0.9614	10	0.12430	T	0.62	-2.0769	7.3999	0.26958	0.1916:0.0:0.8084:0.0	.	658;753	B4DK80;Q13472	.;TOP3A_HUMAN	L	753;283;658	ENSP00000321636:S753L;ENSP00000446425:S283L;ENSP00000442336:S658L	ENSP00000321636:S753L	S	-	2	0	TOP3A	18122283	0.967000	0.33354	0.022000	0.16811	0.213000	0.24496	1.847000	0.39299	1.345000	0.45676	0.549000	0.68633	TCA	TOP3A	-	NULL		0.632	TOP3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOP3A	HGNC	protein_coding	OTTHUMT00000132052.2	G			18181558	-1	no_errors	ENST00000321105	ensembl	human	known	70_37	missense	SNP	0.505	A
UBE2R2	54926	genome.wustl.edu	37	9	33922757	33922757	+	IGR	SNP	G	G	C			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr9:33922757G>C	ENST00000263228.3	+	0	4075				UBAP2_ENST00000379238.1_Missense_Mutation_p.F1064L|UBAP2_ENST00000379239.4_Missense_Mutation_p.F797L|UBAP2_ENST00000449054.1_Missense_Mutation_p.F1064L|UBAP2_ENST00000539807.1_Missense_Mutation_p.F819L|UBAP2_ENST00000379235.1_Missense_Mutation_p.F303L|UBAP2_ENST00000360802.1_Missense_Mutation_p.F1064L	NM_017811.3	NP_060281.2	Q712K3	UB2R2_HUMAN	ubiquitin-conjugating enzyme E2R 2						protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	8			LUSC - Lung squamous cell carcinoma(29;0.0176)	GBM - Glioblastoma multiforme(74;0.188)		AGATGTGTAGGAATGGTGGGG	0.652																																																	0													64.0	73.0	70.0					9																	33922757		2203	4300	6503	SO:0001628	intergenic_variant	55833			AK000426	CCDS6546.1	9p11.2	2008-02-05			ENSG00000107341	ENSG00000107341		"""Ubiquitin-conjugating enzymes E2"""	19907	protein-coding gene	gene with protein product		612506				12037680	Standard	XM_005251496		Approved	UBC3B, CDC34B, FLJ20419, MGC10481	uc003ztm.3	Q712K3	OTTHUMG00000019797		9.37:g.33922757G>C			D3DRL5|Q9NX64	Missense_Mutation	SNP	pfam_DUF3697_Uba2,pfam_UBA/transl_elong_EF1B_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk	p.F1064L	ENST00000263228.3	37	c.3192	CCDS6546.1	9	.	.	.	.	.	.	.	.	.	.	G	10.73	1.432772	0.25813	.	.	ENSG00000137073	ENST00000379238;ENST00000449054;ENST00000360802;ENST00000431417;ENST00000379235;ENST00000379239;ENST00000539807;ENST00000351580	T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96	5.65	2.79	0.32731	.	0.000000	0.85682	D	0.000000	T	0.42494	0.1205	M	0.78049	2.395	0.80722	D	1	B;B;B;B	0.14805	0.011;0.011;0.006;0.004	B;B;B;B	0.16722	0.016;0.016;0.009;0.004	T	0.37126	-0.9719	10	0.66056	D	0.02	-12.4199	8.3611	0.32359	0.3785:0.0:0.6215:0.0	.	819;797;973;1064	F5H2U4;A6NCA8;F5H2C8;Q5T6F2	.;.;.;UBAP2_HUMAN	L	1064;1064;1064;973;303;797;819;498	ENSP00000368540:F1064L;ENSP00000416932:F1064L;ENSP00000354039:F1064L;ENSP00000368537:F303L;ENSP00000368541:F797L;ENSP00000439329:F819L	ENSP00000259602:F498L	F	-	3	2	UBAP2	33912757	1.000000	0.71417	0.321000	0.25320	0.080000	0.17528	2.587000	0.46128	0.458000	0.26988	-0.768000	0.03414	TTC	UBAP2	-	NULL		0.652	UBE2R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBAP2	HGNC	protein_coding	OTTHUMT00000052118.1	G	NM_017811		33922757	-1	no_errors	ENST00000360802	ensembl	human	known	70_37	missense	SNP	1.000	C
UCKL1	54963	genome.wustl.edu	37	20	62572366	62572366	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr20:62572366G>C	ENST00000354216.6	-	10	1095	c.1053C>G	c.(1051-1053)atC>atG	p.I351M	UCKL1_ENST00000369892.3_Missense_Mutation_p.I351M|MIR647_ENST00000384823.1_RNA|MIR1914_ENST00000607800.1_RNA|UCKL1_ENST00000358711.3_Missense_Mutation_p.L368V|UCKL1_ENST00000369908.5_Missense_Mutation_p.I336M	NM_017859.3	NP_060329.2	Q9NWZ5	UCKL1_HUMAN	uridine-cytidine kinase 1-like 1	351					CTP salvage (GO:0044211)|UMP salvage (GO:0044206)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|uridine kinase activity (GO:0004849)			endometrium(3)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	8	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					TGGAGTAGAAGATGAACTCGT	0.662																																																	0													52.0	46.0	48.0					20																	62572366		2194	4299	6493	SO:0001583	missense	54963			AK000524	CCDS13547.1, CCDS54479.1	20q13.33	2012-09-20	2004-07-13	2004-07-13	ENSG00000198276	ENSG00000198276			15938	protein-coding gene	gene with protein product		610866	"""uridine kinase-like 1"""	URKL1			Standard	NM_017859		Approved	FLJ20517	uc010gkn.3	Q9NWZ5	OTTHUMG00000033003	ENST00000354216.6:c.1053C>G	20.37:g.62572366G>C	ENSP00000346155:p.Ile351Met		B7Z8N2|Q5JWV0|Q70AQ5|Q8N524|Q9H3Z2	Missense_Mutation	SNP	pfam_PRK/URK,pfam_CPT,prints_Uridine_kinase,prints_PRK,tigrfam_Uridine_kinase	p.I351M	ENST00000354216.6	37	c.1053	CCDS13547.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.3|21.3	4.121179|4.121179	0.77436|0.77436	.|.	.|.	ENSG00000198276|ENSG00000198276	ENST00000354216;ENST00000369892;ENST00000369908;ENST00000430743|ENST00000358711	.|.	.|.	.|.	5.27|5.27	0.855|0.855	0.19013|0.19013	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.58061|0.58061	0.2096|0.2096	M|M	0.84511|0.84511	2.7|2.7	0.21105|0.21105	N|N	0.999782|0.999782	D;D|.	0.89917|.	1.0;0.998|.	D;D|.	0.71414|.	0.973;0.923|.	T|T	0.52961|0.52961	-0.8505|-0.8505	9|6	0.87932|0.87932	D|D	0|0	-36.3999|-36.3999	6.0565|6.0565	0.19815|0.19815	0.2885:0.0:0.5831:0.1284|0.2885:0.0:0.5831:0.1284	.|.	336;351|.	B7Z8N2;Q9NWZ5|.	.;UCKL1_HUMAN|.	M|V	351;351;336;16|368	.|.	ENSP00000346155:I351M|ENSP00000351546:L368V	I|L	-|-	3|1	3|0	UCKL1|UCKL1	62042810|62042810	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.975000|0.975000	0.68041|0.68041	1.066000|1.066000	0.30604|0.30604	0.588000|0.588000	0.29660|0.29660	0.555000|0.555000	0.69702|0.69702	ATC|CTT	UCKL1	-	NULL		0.662	UCKL1-001	KNOWN	basic|CCDS	protein_coding	UCKL1	HGNC	protein_coding	OTTHUMT00000080236.1	G	NM_017859		62572366	-1	no_errors	ENST00000354216	ensembl	human	known	70_37	missense	SNP	1.000	C
UFSP1	402682	genome.wustl.edu	37	7	100486556	100486556	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr7:100486556G>T	ENST00000388761.2	-	1	783	c.337C>A	c.(337-339)Caa>Aaa	p.Q113K		NM_001015072.3	NP_001015072.2	Q6NVU6	UFSP1_HUMAN	UFM1-specific peptidase 1 (non-functional)	113						extracellular vesicular exosome (GO:0070062)	thiolester hydrolase activity (GO:0016790)|UFM1 hydrolase activity (GO:0071567)			lung(1)|stomach(1)	2	Lung NSC(181;0.041)|all_lung(186;0.0581)					CTCACCTCTTGCCAGCCCACC	0.582																																																	0													132.0	121.0	125.0					7																	100486556		2203	4300	6503	SO:0001583	missense	402682			AF312032	CCDS34710.1	7q22.1	2008-03-25			ENSG00000176125	ENSG00000176125			33821	protein-coding gene	gene with protein product		611481				17182609, 18321862	Standard	NM_001015072		Approved	UFSP	uc003uxc.4	Q6NVU6	OTTHUMG00000159662	ENST00000388761.2:c.337C>A	7.37:g.100486556G>T	ENSP00000373413:p.Gln113Lys		A4D2E4|A8K8V2|B6ZDG6|Q9BXP6	Missense_Mutation	SNP	pfam_Peptidase_C78_UfSP1/2	p.Q113K	ENST00000388761.2	37	c.337	CCDS34710.1	7	.	.	.	.	.	.	.	.	.	.	G	3.191	-0.165782	0.06461	.	.	ENSG00000176125	ENST00000388761	T	0.25250	1.81	5.19	-0.381	0.12485	.	0.568480	0.15431	N	0.262729	T	0.07324	0.0185	N	0.02391	-0.57	0.23524	N	0.997491	B	0.02656	0.0	B	0.04013	0.001	T	0.39014	-0.9634	10	0.02654	T	1	-20.1137	8.4016	0.32590	0.0747:0.0:0.3867:0.5386	.	113	Q6NVU6	UFSP1_HUMAN	K	113	ENSP00000373413:Q113K	ENSP00000373413:Q113K	Q	-	1	0	UFSP1	100324492	0.833000	0.29383	0.033000	0.17914	0.171000	0.22731	1.099000	0.31013	-0.293000	0.08986	-0.237000	0.12165	CAA	UFSP1	-	pfam_Peptidase_C78_UfSP1/2		0.582	UFSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UFSP1	HGNC	protein_coding	OTTHUMT00000356751.1	G	NM_001015072		100486556	-1	no_errors	ENST00000388761	ensembl	human	known	70_37	missense	SNP	0.138	T
USP51	158880	genome.wustl.edu	37	X	55514505	55514505	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chrX:55514505C>T	ENST00000500968.3	-	2	950	c.868G>A	c.(868-870)Gat>Aat	p.D290N	USP51_ENST00000586165.1_Intron	NM_201286.3	NP_958443.1	Q70EK9	UBP51_HUMAN	ubiquitin specific peptidase 51	290					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	30						TATACATAATCCTTACACATG	0.343																																																	0													96.0	86.0	90.0					X																	55514505		2203	4300	6503	SO:0001583	missense	158880			BF741256	CCDS14370.1	Xp11	2009-03-19	2005-08-08		ENSG00000247746	ENSG00000247746		"""Ubiquitin-specific peptidases"""	23086	protein-coding gene	gene with protein product			"""ubiquitin specific protease 51"""			12838346	Standard	NM_201286		Approved		uc004dun.2	Q70EK9	OTTHUMG00000021656	ENST00000500968.3:c.868G>A	X.37:g.55514505C>T	ENSP00000423333:p.Asp290Asn		Q8IWJ8	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Znf_UBP,pfscan_Znf_UBP,pfscan_Peptidase_C19	p.D290N	ENST00000500968.3	37	c.868	CCDS14370.1	X	.	.	.	.	.	.	.	.	.	.	.	18.81	3.702361	0.68501	.	.	ENSG00000247746	ENST00000500968	T	0.49432	0.78	3.19	3.19	0.36642	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, UBP-type (2);	0.000000	0.85682	U	0.000000	T	0.72922	0.3521	M	0.92169	3.28	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79680	-0.1702	10	0.87932	D	0	.	11.5852	0.50914	0.0:1.0:0.0:0.0	.	290	Q70EK9	UBP51_HUMAN	N	290	ENSP00000423333:D290N	ENSP00000423333:D290N	D	-	1	0	USP51	55531230	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.669000	0.61575	1.869000	0.54173	0.508000	0.49915	GAT	USP51	-	pfam_Znf_UBP,pfscan_Znf_UBP		0.343	USP51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP51	HGNC	protein_coding	OTTHUMT00000056871.2	C	NM_201286		55514505	-1	no_errors	ENST00000500968	ensembl	human	known	70_37	missense	SNP	1.000	T
VPREB1	7441	genome.wustl.edu	37	22	22599619	22599619	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr22:22599619C>G	ENST00000403807.3	+	2	447	c.308C>G	c.(307-309)tCt>tGt	p.S103C	VPREB1_ENST00000302273.2_Missense_Mutation_p.S102C			P12018	VPREB_HUMAN	pre-B lymphocyte 1	103	Framework-3.|Ig-like V-type.									large_intestine(1)|liver(1)|lung(6)|skin(1)	9	all_hematologic(9;0.0312)|Acute lymphoblastic leukemia(84;0.155)	all_cancers(3;3.14e-14)|Acute lymphoblastic leukemia(3;2.97e-57)|all_hematologic(3;5.9e-52)		READ - Rectum adenocarcinoma(21;0.145)		TTGAGCATCTCTGAGCTGCAG	0.562																																																	0													33.0	37.0	36.0					22																	22599619		2202	4300	6502	SO:0001583	missense	7441			M34927	CCDS13798.1	22q11.2	2014-05-16	2008-09-12		ENSG00000169575	ENSG00000169575		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	12709	protein-coding gene	gene with protein product		605141				3139558	Standard	NM_007128		Approved	VpreB, CD179A	uc002zvx.1	P12018	OTTHUMG00000151042	ENST00000403807.3:c.308C>G	22.37:g.22599619C>G	ENSP00000385361:p.Ser103Cys		B5MCG2	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.S103C	ENST00000403807.3	37	c.308	CCDS13798.1	22	.	.	.	.	.	.	.	.	.	.	c	15.34	2.803750	0.50315	.	.	ENSG00000169575	ENST00000403807;ENST00000302273	T;T	0.68624	-0.34;-0.34	3.91	2.79	0.32731	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin V-set, subgroup (1);Immunoglobulin-like fold (1);	0.326955	0.22603	N	0.057939	D	0.83903	0.5355	H	0.96301	3.8	0.24516	N	0.994182	D	0.57257	0.979	P	0.62740	0.906	T	0.75127	-0.3427	10	0.87932	D	0	.	9.6346	0.39800	0.0:0.6605:0.3395:0.0	.	103	P12018	VPREB_HUMAN	C	103;102	ENSP00000385361:S103C;ENSP00000304590:S102C	ENSP00000304590:S102C	S	+	2	0	VPREB1	20929619	0.005000	0.15991	0.724000	0.30704	0.011000	0.07611	1.487000	0.35540	2.204000	0.70986	0.650000	0.86243	TCT	VPREB1	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like		0.562	VPREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPREB1	HGNC	protein_coding	OTTHUMT00000321101.1	C			22599619	+1	no_errors	ENST00000403807	ensembl	human	known	70_37	missense	SNP	0.641	G
VPS8	23355	genome.wustl.edu	37	3	184550510	184550510	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr3:184550510G>C	ENST00000437079.3	+	4	427	c.256G>C	c.(256-258)Gat>Cat	p.D86H	VPS8_ENST00000436792.2_Missense_Mutation_p.D86H|VPS8_ENST00000424463.2_Missense_Mutation_p.D86H|VPS8_ENST00000446204.2_Missense_Mutation_p.D86H|VPS8_ENST00000287546.4_Missense_Mutation_p.D86H	NM_001009921.2	NP_001009921.1	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog (S. cerevisiae)	86							zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			TATTCTTGAGGATCCTACATT	0.338																																																	0													125.0	115.0	118.0					3																	184550510		1879	4114	5993	SO:0001583	missense	23355			AK056661	CCDS46972.1	3q27.2	2006-07-07	2006-07-07	2006-07-07	ENSG00000156931	ENSG00000156931			29122	protein-coding gene	gene with protein product			"""KIAA0804"""	KIAA0804		9872452	Standard	NM_001009921		Approved	FLJ32099	uc003fpb.1	Q8N3P4	OTTHUMG00000156707	ENST00000437079.3:c.256G>C	3.37:g.184550510G>C	ENSP00000397879:p.Asp86His		A8K8Q8|B9EIQ1|C9JB61|O94896|Q63HP2|Q9BVP9|Q9H9B0	Missense_Mutation	SNP	superfamily_Quinonprotein_ADH-like,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Znf_RING,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D86H	ENST00000437079.3	37	c.256	CCDS46971.1	3	.	.	.	.	.	.	.	.	.	.	G	24.9	4.582550	0.86748	.	.	ENSG00000156931	ENST00000287546;ENST00000437079;ENST00000436792;ENST00000446204;ENST00000422105;ENST00000424463;ENST00000441141;ENST00000445089	T;T;T;T;T;T;T;T	0.20200	2.09;2.09;2.09;2.09;2.09;2.09;2.09;2.09	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.36220	0.0959	L	0.27053	0.805	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.987;0.988	T	0.06716	-1.0811	10	0.52906	T	0.07	-13.4742	18.5904	0.91210	0.0:0.0:1.0:0.0	.	86;86;86	Q8N3P4-2;C9JP71;Q8N3P4-3	.;.;.	H	86	ENSP00000287546:D86H;ENSP00000397879:D86H;ENSP00000404704:D86H;ENSP00000405483:D86H;ENSP00000415161:D86H;ENSP00000389480:D86H;ENSP00000409957:D86H;ENSP00000416150:D86H	ENSP00000287546:D86H	D	+	1	0	VPS8	186033204	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.321000	0.89997	2.688000	0.91661	0.591000	0.81541	GAT	VPS8	-	NULL		0.338	VPS8-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS8	HGNC	protein_coding		G	NM_015303		184550510	+1	no_errors	ENST00000287546	ensembl	human	known	70_37	missense	SNP	1.000	C
WWP2	11060	genome.wustl.edu	37	16	69974027	69974027	+	3'UTR	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr16:69974027G>A	ENST00000359154.2	+	0	2898				WWP2_ENST00000448661.1_3'UTR|WWP2_ENST00000568684.1_3'UTR|WWP2_ENST00000356003.2_3'UTR|WWP2_ENST00000544162.1_3'UTR	NM_001270454.1|NM_007014.4	NP_001257383.1|NP_008945.2	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase 2						cellular protein modification process (GO:0006464)|negative regulation of gene expression (GO:0010629)|negative regulation of protein transport (GO:0051224)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transporter activity (GO:0032410)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			breast(4)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CCCCCGACCCGCGGATGGCAG	0.612																																																	0																																										SO:0001624	3_prime_UTR_variant	11060			BC013645	CCDS10885.1, CCDS58475.1, CCDS58476.1, CCDS58477.1	16q22.1	2008-02-05			ENSG00000198373	ENSG00000198373			16804	protein-coding gene	gene with protein product		602308				9169421, 12167593	Standard	NM_007014		Approved	AIP2	uc002exv.2	O00308	OTTHUMG00000137573	ENST00000359154.2:c.*184G>A	16.37:g.69974027G>A			A6NEP1|B2R706|B4DTL5|F5H213|H3BRF3|I3RSG8|Q6ZTQ5|Q96CZ2|Q9BWN6	RNA	SNP	-	NULL	ENST00000359154.2	37	NULL	CCDS10885.1	16																																																																																			WWP2	-	-		0.612	WWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWP2	HGNC	protein_coding	OTTHUMT00000268954.1	G	NM_007014		69974027	+1	no_errors	ENST00000544162	ensembl	human	known	70_37	rna	SNP	0.000	A
ZBTB47	92999	genome.wustl.edu	37	3	42700666	42700666	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr3:42700666G>C	ENST00000232974.6	+	2	1100	c.819G>C	c.(817-819)caG>caC	p.Q273H	ZBTB47_ENST00000457842.3_5'UTR|ZBTB47_ENST00000505904.1_5'UTR			Q9UFB7	ZBT47_HUMAN	zinc finger and BTB domain containing 47	273	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(2)|lung(3)|ovary(1)	13				KIRC - Kidney renal clear cell carcinoma(284;0.216)		ACGGGCTGCAGAGACACTCgg	0.657																																																	0													20.0	29.0	26.0					3																	42700666		692	1591	2283	SO:0001583	missense	92999			AB033016	CCDS46805.1, CCDS46805.2	3p22.1	2013-01-08	2006-09-19	2006-09-19	ENSG00000114853	ENSG00000114853		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26955	protein-coding gene	gene with protein product			"""zinc finger protein 651"""	ZNF651		10574461	Standard	NM_145166		Approved	KIAA1190, DKFZp434N0615	uc003clu.2	Q9UFB7	OTTHUMG00000156207	ENST00000232974.6:c.819G>C	3.37:g.42700666G>C	ENSP00000232974:p.Gln273His		H7BXD3|Q6ZSY6|Q8WTY8|Q9ULN0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.Q273H	ENST00000232974.6	37	c.819	CCDS46805.2	3	.	.	.	.	.	.	.	.	.	.	G	8.894	0.954807	0.18431	.	.	ENSG00000114853	ENST00000232974;ENST00000542870	T	0.70749	-0.51	4.08	2.28	0.28536	.	1.036150	0.07612	N	0.925472	T	0.65450	0.2692	N	0.22421	0.69	0.80722	D	1	D	0.56521	0.976	P	0.53266	0.722	T	0.55970	-0.8056	10	0.40728	T	0.16	-15.373	6.2535	0.20861	0.2402:0.1355:0.6243:0.0	.	273	F5H6L2	.	H	273	ENSP00000232974:Q273H	ENSP00000232974:Q273H	Q	+	3	2	ZBTB47	42675670	0.986000	0.35501	1.000000	0.80357	0.093000	0.18481	1.093000	0.30939	0.489000	0.27749	0.542000	0.68232	CAG	ZBTB47	-	NULL		0.657	ZBTB47-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB47	HGNC	protein_coding	OTTHUMT00000343485.3	G	NM_145166		42700666	+1	no_errors	ENST00000232974	ensembl	human	known	70_37	missense	SNP	0.863	C
ZBTB47	92999	genome.wustl.edu	37	3	42701164	42701164	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr3:42701164G>C	ENST00000232974.6	+	2	1598	c.1317G>C	c.(1315-1317)caG>caC	p.Q439H	ZBTB47_ENST00000457842.3_Missense_Mutation_p.Q63H|ZBTB47_ENST00000505904.1_5'UTR			Q9UFB7	ZBT47_HUMAN	zinc finger and BTB domain containing 47	439					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(2)|lung(3)|ovary(1)	13				KIRC - Kidney renal clear cell carcinoma(284;0.216)		ATCCATGCCAGAAGTGCCCAC	0.622																																																	0													37.0	45.0	42.0					3																	42701164		2082	4237	6319	SO:0001583	missense	92999			AB033016	CCDS46805.1, CCDS46805.2	3p22.1	2013-01-08	2006-09-19	2006-09-19	ENSG00000114853	ENSG00000114853		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26955	protein-coding gene	gene with protein product			"""zinc finger protein 651"""	ZNF651		10574461	Standard	NM_145166		Approved	KIAA1190, DKFZp434N0615	uc003clu.2	Q9UFB7	OTTHUMG00000156207	ENST00000232974.6:c.1317G>C	3.37:g.42701164G>C	ENSP00000232974:p.Gln439His		H7BXD3|Q6ZSY6|Q8WTY8|Q9ULN0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.Q439H	ENST00000232974.6	37	c.1317	CCDS46805.2	3	.	.	.	.	.	.	.	.	.	.	G	7.314	0.615566	0.14129	.	.	ENSG00000114853	ENST00000232974;ENST00000542870;ENST00000457842	T;T	0.77229	-1.08;-1.08	4.13	4.13	0.48395	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.264554	0.36002	N	0.002860	T	0.72463	0.3463	N	0.25094	0.71	0.41596	D	0.988829	P	0.40731	0.728	P	0.46110	0.504	T	0.76399	-0.2973	10	0.49607	T	0.09	-47.5098	16.5902	0.84763	0.0:0.0:1.0:0.0	.	63	Q9UFB7	ZBT47_HUMAN	H	439;338;63	ENSP00000232974:Q439H;ENSP00000411491:Q63H	ENSP00000232974:Q439H	Q	+	3	2	ZBTB47	42676168	1.000000	0.71417	1.000000	0.80357	0.134000	0.20937	3.226000	0.51254	2.125000	0.65367	0.557000	0.71058	CAG	ZBTB47	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.622	ZBTB47-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB47	HGNC	protein_coding	OTTHUMT00000343485.3	G	NM_145166		42701164	+1	no_errors	ENST00000232974	ensembl	human	known	70_37	missense	SNP	1.000	C
ZCCHC11	23318	genome.wustl.edu	37	1	52926861	52926861	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr1:52926861G>T	ENST00000371544.3	-	19	3528	c.3266C>A	c.(3265-3267)gCa>gAa	p.A1089E	ZCCHC11_ENST00000371541.1_5'Flank|ZCCHC11_ENST00000257177.4_Missense_Mutation_p.A1089E	NM_001009881.2|NM_015269.2	NP_001009881.1|NP_056084.1	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11	1089					cytokine production (GO:0001816)|miRNA catabolic process (GO:0010587)|miRNA metabolic process (GO:0010586)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|pre-miRNA processing (GO:0031054)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|RNA 3'-end processing (GO:0031123)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(17)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	58						ATCAATAGCTGCATAAGTAGC	0.279																																																	0													107.0	107.0	107.0					1																	52926861		2203	4289	6492	SO:0001583	missense	23318			D83776	CCDS30715.1, CCDS30716.1	1p32.3	2014-03-05			ENSG00000134744	ENSG00000134744		"""Zinc fingers, CCHC domain containing"""	28981	protein-coding gene	gene with protein product	"""TUTase4"""	613692				8724849, 12239557	Standard	NM_015269		Approved	KIAA0191, PAPD3, TUT4	uc001cty.2	Q5TAX3	OTTHUMG00000008200	ENST00000371544.3:c.3266C>A	1.37:g.52926861G>T	ENSP00000360599:p.Ala1089Glu		A2RRP0|B7Z8J5|D3DQ35|Q12764|Q5TAX2|Q5TAX4|Q86XZ3	Missense_Mutation	SNP	pfam_PAP_assoc,pfam_Znf_CCHC,pfam_Nucleotidyltransferase,superfamily_Znf_CCHC,smart_Znf_CCHC,pfscan_Znf_CCHC	p.A1089E	ENST00000371544.3	37	c.3266	CCDS30716.1	1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.987944	0.93106	.	.	ENSG00000134744	ENST00000257177;ENST00000371544;ENST00000528642;ENST00000484723	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.72890	0.3517	M	0.88704	2.975	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.87578	0.968;0.998	T	0.76285	-0.3015	10	0.87932	D	0	.	20.5948	0.99439	0.0:0.0:1.0:0.0	.	848;1089	E9PKX1;Q5TAX3	.;TUT4_HUMAN	E	1089;1089;1018;848	ENSP00000257177:A1089E;ENSP00000360599:A1089E;ENSP00000433486:A1018E;ENSP00000435256:A848E	ENSP00000257177:A1089E	A	-	2	0	ZCCHC11	52699449	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.604000	0.82830	2.873000	0.98535	0.563000	0.77884	GCA	ZCCHC11	-	NULL		0.279	ZCCHC11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZCCHC11	HGNC	protein_coding	OTTHUMT00000022462.1	G	XM_038288		52926861	-1	no_errors	ENST00000257177	ensembl	human	known	70_37	missense	SNP	1.000	T
ZEB2	9839	genome.wustl.edu	37	2	145157027	145157027	+	Missense_Mutation	SNP	T	T	C			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr2:145157027T>C	ENST00000558170.2	-	8	2911	c.1727A>G	c.(1726-1728)aAc>aGc	p.N576S	ZEB2_ENST00000303660.4_Missense_Mutation_p.N576S|ZEB2_ENST00000539609.3_Missense_Mutation_p.N552S|ZEB2_ENST00000409487.3_Missense_Mutation_p.N576S	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	576					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)	p.N576S(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		AGTGGATATGTTGTGGTTCTC	0.383																																					Melanoma(33;1235 1264 5755 16332)												1	Substitution - Missense(1)	lung(1)											199.0	200.0	200.0					2																	145157027		2203	4300	6503	SO:0001583	missense	9839			AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.1727A>G	2.37:g.145157027T>C	ENSP00000454157:p.Asn576Ser		A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Znf_C2H2	p.N576S	ENST00000558170.2	37	c.1727	CCDS2186.1	2	.	.	.	.	.	.	.	.	.	.	T	5.042	0.193492	0.09599	.	.	ENSG00000169554	ENST00000539609;ENST00000303660;ENST00000409487;ENST00000427902	T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08	5.74	-4.46	0.03536	.	0.549745	0.22268	N	0.062307	T	0.47911	0.1471	N	0.02539	-0.55	0.32074	N	0.593976	B;B;B;B	0.15473	0.013;0.002;0.0;0.0	B;B;B;B	0.17979	0.02;0.002;0.0;0.002	T	0.34502	-0.9826	10	0.19147	T	0.46	-1.1236	13.6597	0.62359	0.0:0.5289:0.0:0.4711	.	552;441;575;576	F5H814;Q53TD9;A0JP08;O60315	.;.;.;ZEB2_HUMAN	S	552;576;576;576	ENSP00000443792:N552S;ENSP00000302501:N576S;ENSP00000386854:N576S;ENSP00000395496:N576S	ENSP00000302501:N576S	N	-	2	0	ZEB2	144873497	0.994000	0.37717	0.888000	0.34837	0.949000	0.60115	0.433000	0.21477	-0.883000	0.03982	-0.256000	0.11100	AAC	ZEB2	-	NULL		0.383	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZEB2	HGNC	protein_coding	OTTHUMT00000254778.5	T	NM_014795		145157027	-1	no_errors	ENST00000303660	ensembl	human	known	70_37	missense	SNP	0.869	C
ZFR	51663	genome.wustl.edu	37	5	32355672	32355672	+	3'UTR	DEL	T	T	-	rs377173878		TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr5:32355672delT	ENST00000265069.8	-	0	3521				ZFR_ENST00000510369.1_5'UTR	NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein						multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		TCGGAGCACATTTTTTTTTTT	0.328																																																	0																																										SO:0001624	3_prime_UTR_variant	51663			AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.*194A>-	5.37:g.32355672delT			B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	RNA	DEL	-	NULL	ENST00000265069.8	37	NULL	CCDS34139.1	5																																																																																			ZFR	-	-		0.328	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFR	HGNC	protein_coding	OTTHUMT00000366586.1	T			32355672	-1	no_errors	ENST00000510369	ensembl	human	known	70_37	rna	DEL	0.003	-
ZNF385D	79750	genome.wustl.edu	37	3	22414020	22414020	+	5'UTR	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr3:22414020G>A	ENST00000494118.1	-	0	103							Q9H6B1	Z385D_HUMAN	zinc finger protein 385D							nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(1)|prostate(1)|skin(4)	46						TCCTGCTGGCGGCCGCCCGGC	0.692																																																	0																																										SO:0001623	5_prime_UTR_variant	79750			BC007212	CCDS2636.1	3p24.3	2012-10-05	2007-12-06	2007-12-06	ENSG00000151789	ENSG00000151789			26191	protein-coding gene	gene with protein product			"""zinc finger protein 659"""	ZNF659		12477932	Standard	NM_024697		Approved	FLJ22419	uc003cce.3	Q9H6B1	OTTHUMG00000130484	ENST00000494118.1:c.-947C>T	3.37:g.22414020G>A				RNA	SNP	-	NULL	ENST00000494118.1	37	NULL		3																																																																																			ZNF385D	-	-		0.692	ZNF385D-008	KNOWN	basic	processed_transcript	ZNF385D	HGNC	protein_coding	OTTHUMT00000340810.1	G	NM_024697		22414020	-1	no_errors	ENST00000494108	ensembl	human	known	70_37	rna	SNP	0.178	A
ZNF440	126070	genome.wustl.edu	37	19	11942452	11942452	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr19:11942452G>C	ENST00000304060.5	+	4	625	c.461G>C	c.(460-462)aGa>aCa	p.R154T		NM_152357.2	NP_689570.2	Q8IYI8	ZN440_HUMAN	zinc finger protein 440	154					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(9)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						AAAGCCTTCAGATACCGCCCC	0.398																																																	0													133.0	135.0	134.0					19																	11942452		2203	4300	6503	SO:0001583	missense	126070			AK095252	CCDS42503.1	19p13.13	2013-01-08	2006-08-14	2006-08-14	ENSG00000171295	ENSG00000171295		"""Zinc fingers, C2H2-type"", ""-"""	20874	protein-coding gene	gene with protein product							Standard	NM_152357		Approved	FLJ37933	uc002msp.1	Q8IYI8	OTTHUMG00000156403	ENST00000304060.5:c.461G>C	19.37:g.11942452G>C	ENSP00000305373:p.Arg154Thr		Q8N1R9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R154T	ENST00000304060.5	37	c.461	CCDS42503.1	19	.	.	.	.	.	.	.	.	.	.	g	0.054	-1.240489	0.01493	.	.	ENSG00000171295	ENST00000304060;ENST00000457526;ENST00000427505;ENST00000414255	T;T;T;T	0.27402	1.67;2.51;2.49;5.67	0.724	-1.45	0.08828	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.14356	0.0347	N	0.13327	0.33	0.09310	N	1	B	0.20887	0.049	B	0.16722	0.016	T	0.23833	-1.0177	9	0.20519	T	0.43	.	5.5593	0.17133	0.2087:0.4637:0.3275:0.0	.	154	Q8IYI8	ZN440_HUMAN	T	154;32;157;156	ENSP00000305373:R154T;ENSP00000404425:R32T;ENSP00000393489:R157T;ENSP00000411974:R156T	ENSP00000305373:R154T	R	+	2	0	ZNF440	11803452	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.643000	0.00204	-2.204000	0.00743	-1.021000	0.02439	AGA	ZNF440	-	pfscan_Znf_C2H2		0.398	ZNF440-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF440	HGNC	protein_coding	OTTHUMT00000344508.1	G	NM_152357		11942452	+1	no_errors	ENST00000304060	ensembl	human	known	70_37	missense	SNP	0.000	C
ZNF462	58499	genome.wustl.edu	37	9	109691939	109691939	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr9:109691939G>T	ENST00000277225.5	+	3	6035	c.5746G>T	c.(5746-5748)Gag>Tag	p.E1916*	ZNF462_ENST00000441147.2_Nonsense_Mutation_p.E761*|ZNF462_ENST00000542028.1_5'Flank|ZNF462_ENST00000457913.1_Nonsense_Mutation_p.E1916*			Q96JM2	ZN462_HUMAN	zinc finger protein 462	1916					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						CATTCACAATGAGGAATTCCA	0.488																																																	0													119.0	108.0	111.0					9																	109691939		2203	4300	6503	SO:0001587	stop_gained	58499			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.5746G>T	9.37:g.109691939G>T	ENSP00000277225:p.Glu1916*		Q5T0T4|Q8N408	Nonsense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E1916*	ENST00000277225.5	37	c.5746	CCDS35096.1	9	.	.	.	.	.	.	.	.	.	.	G	48	14.281953	0.99788	.	.	ENSG00000148143	ENST00000277225;ENST00000457913;ENST00000374686;ENST00000441147	.	.	.	5.92	5.92	0.95590	.	0.047684	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	20.3206	0.98668	0.0:0.0:1.0:0.0	.	.	.	.	X	1916;1916;799;761	.	ENSP00000277225:E1916X	E	+	1	0	ZNF462	108731760	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.460000	0.80816	2.813000	0.96785	0.561000	0.74099	GAG	ZNF462	-	pfscan_Znf_C2H2		0.488	ZNF462-001	KNOWN	basic|CCDS	protein_coding	ZNF462	HGNC	protein_coding	OTTHUMT00000053532.2	G	NM_021224		109691939	+1	no_errors	ENST00000457913	ensembl	human	known	70_37	nonsense	SNP	1.000	T
ZNF611	81856	genome.wustl.edu	37	19	53208777	53208777	+	Nonsense_Mutation	SNP	T	T	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr19:53208777T>A	ENST00000319783.1	-	7	1847	c.1531A>T	c.(1531-1533)Aaa>Taa	p.K511*	ZNF611_ENST00000543227.1_Nonsense_Mutation_p.K511*|ZNF611_ENST00000453741.2_Nonsense_Mutation_p.K442*|ZNF611_ENST00000595798.1_Nonsense_Mutation_p.K442*|ZNF611_ENST00000602046.1_5'Flank|ZNF611_ENST00000540744.1_Nonsense_Mutation_p.K511*|ZNF611_ENST00000602162.1_Nonsense_Mutation_p.K442*	NM_030972.3	NP_112234.3	Q8N823	ZN611_HUMAN	zinc finger protein 611	511					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(262;0.0233)|GBM - Glioblastoma multiforme(134;0.04)		TCATCACATTTGTAAGGTTGC	0.358																																																	0													105.0	106.0	105.0					19																	53208777		2203	4300	6503	SO:0001587	stop_gained	81856			AK091389	CCDS12855.1, CCDS54312.1	19q13.42	2013-01-08			ENSG00000213020	ENSG00000213020		"""Zinc fingers, C2H2-type"", ""-"""	28766	protein-coding gene	gene with protein product						12477932	Standard	NM_030972		Approved	MGC5384	uc010ydq.2	Q8N823	OTTHUMG00000154908	ENST00000319783.1:c.1531A>T	19.37:g.53208777T>A	ENSP00000322427:p.Lys511*		B3KRD5|Q69YG9	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K511*	ENST00000319783.1	37	c.1531	CCDS12855.1	19	.	.	.	.	.	.	.	.	.	.	.	26.8	4.772464	0.90108	.	.	ENSG00000213020	ENST00000543227;ENST00000540744;ENST00000453741;ENST00000319783	.	.	.	1.51	0.422	0.16457	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	2.2452	0.04030	0.2519:0.1839:0.0:0.5642	.	.	.	.	X	511;511;442;511	.	ENSP00000322427:K511X	K	-	1	0	ZNF611	57900589	0.000000	0.05858	0.038000	0.18304	0.013000	0.08279	-2.577000	0.00909	0.661000	0.30985	0.172000	0.16884	AAA	ZNF611	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.358	ZNF611-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF611	HGNC	protein_coding	OTTHUMT00000337612.1	T	NM_030972		53208777	-1	no_errors	ENST00000319783	ensembl	human	known	70_37	nonsense	SNP	0.010	A
ZNF813	126017	genome.wustl.edu	37	19	53993829	53993829	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr19:53993829G>A	ENST00000396403.4	+	4	471	c.343G>A	c.(343-345)Gaa>Aaa	p.E115K	ZNF813_ENST00000396421.4_Intron	NM_001004301.3	NP_001004301.2	Q6ZN06	ZN813_HUMAN	zinc finger protein 813	115					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		ACCCATGACAGAAATCAAAAA	0.393																																																	0													147.0	151.0	149.0					19																	53993829		2203	4300	6503	SO:0001583	missense	126017			AK091460	CCDS46172.1	19q13.41	2013-01-08			ENSG00000198346	ENSG00000198346		"""Zinc fingers, C2H2-type"", ""-"""	33257	protein-coding gene	gene with protein product							Standard	NM_001004301		Approved	FLJ16542	uc002qbu.2	Q6ZN06	OTTHUMG00000158309	ENST00000396403.4:c.343G>A	19.37:g.53993829G>A	ENSP00000379684:p.Glu115Lys			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E115K	ENST00000396403.4	37	c.343	CCDS46172.1	19	.	.	.	.	.	.	.	.	.	.	G	0.007	-1.968540	0.00457	.	.	ENSG00000198346	ENST00000468450;ENST00000396403;ENST00000490956	T;T;T	0.05513	4.18;3.43;5.05	0.467	-0.934	0.10428	.	.	.	.	.	T	0.01835	0.0058	N	0.02830	-0.485	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.42085	-0.9472	8	0.09338	T	0.73	.	.	.	.	.	115	Q6ZN06	ZN813_HUMAN	K	62;115;146	ENSP00000419821:E62K;ENSP00000379684:E115K;ENSP00000418289:E146K	ENSP00000379684:E115K	E	+	1	0	ZNF813	58685641	.	.	0.002000	0.10522	0.027000	0.11550	.	.	-1.779000	0.01280	-1.021000	0.02439	GAA	ZNF813	-	NULL		0.393	ZNF813-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF813	HGNC	protein_coding	OTTHUMT00000350638.1	G	NM_001004301		53993829	+1	no_errors	ENST00000396403	ensembl	human	known	70_37	missense	SNP	0.002	A
ZNF773	374928	genome.wustl.edu	37	19	58016764	58016764	+	Silent	SNP	G	G	T	rs567946429		TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr19:58016764G>T	ENST00000282292.4	+	3	398	c.258G>T	c.(256-258)ctG>ctT	p.L86L	ZNF773_ENST00000598770.1_Silent_p.L85L|ZNF773_ENST00000593916.1_Silent_p.L85L|ZNF773_ENST00000599847.1_Silent_p.L86L	NM_198542.1	NP_940944.1	Q6PK81	ZN773_HUMAN	zinc finger protein 773	86	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)		CAGCCATACTGAGAGGTACTT	0.502																																																	0													133.0	125.0	128.0					19																	58016764		2203	4300	6503	SO:0001819	synonymous_variant	374928			BC005167	CCDS33134.1	19q13.43	2013-01-08	2006-12-15	2006-12-15		ENSG00000152439		"""Zinc fingers, C2H2-type"", ""-"""	30487	protein-coding gene	gene with protein product			"""zinc finger protein 419B"""	ZNF419B		12477932	Standard	NM_198542		Approved	MGC4728	uc002qox.3	Q6PK81		ENST00000282292.4:c.258G>T	19.37:g.58016764G>T			Q96DL8	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L86	ENST00000282292.4	37	c.258	CCDS33134.1	19																																																																																			ZNF773	-	pfscan_Krueppel-associated_box		0.502	ZNF773-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF773	HGNC	protein_coding	OTTHUMT00000466475.1	G	NM_198542		58016764	+1	no_errors	ENST00000282292	ensembl	human	known	70_37	silent	SNP	0.000	T
ZNF814	730051	genome.wustl.edu	37	19	58400174	58400174	+	5'UTR	SNP	A	A	G			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr19:58400174A>G	ENST00000435989.2	-	0	231				ZNF814_ENST00000597807.1_5'UTR|ZNF814_ENST00000596604.1_5'UTR|ZNF814_ENST00000597342.1_5'UTR|ZNF814_ENST00000595295.1_5'UTR|ZNF814_ENST00000600634.1_5'UTR|CTD-2583A14.9_ENST00000602124.1_3'UTR|ZNF814_ENST00000597832.1_5'UTR	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814						regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						CAGCCATCGAACCACGTGGTT	0.617																																																	0													54.0	61.0	59.0					19																	58400174		692	1591	2283	SO:0001623	5_prime_UTR_variant	730051				CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.-4T>C	19.37:g.58400174A>G			A6NF35	RNA	SNP	-	NULL	ENST00000435989.2	37	NULL	CCDS46212.1	19																																																																																			ZNF814	-	-		0.617	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF814	HGNC	protein_coding	OTTHUMT00000466976.1	A	XM_001725708		58400174	-1	no_errors	ENST00000594629	ensembl	human	known	70_37	rna	SNP	0.002	G
ZNF883	169834	genome.wustl.edu	37	9	115760342	115760342	+	lincRNA	SNP	C	C	G			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr9:115760342C>G	ENST00000427548.1	-	0	1471							P0CG24	ZN883_HUMAN	zinc finger protein 883						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										CATAAGGTTTCTCTCCAGTAT	0.353																																																	0													61.0	68.0	66.0					9																	115760342		2193	4295	6488			169834			AK095843		9q32	2010-07-23			ENSG00000228623	ENSG00000228623		"""Zinc fingers, C2H2-type"""	27271	protein-coding gene	gene with protein product							Standard	NM_001101338		Approved		uc011lwy.2	P0CG24	OTTHUMG00000020514		9.37:g.115760342C>G				RNA	SNP	-	NULL	ENST00000427548.1	37	NULL		9																																																																																			ZNF883	-	-		0.353	ZNF883-001	KNOWN	basic	lincRNA	ZNF883	HGNC	lincRNA	OTTHUMT00000053704.1	C	NM_001101338		115760342	-1	no_errors	ENST00000427548	ensembl	human	known	70_37	rna	SNP	1.000	G
ZSCAN4	201516	genome.wustl.edu	37	19	58187558	58187558	+	Silent	SNP	G	G	A			TCGA-EK-A2R7-01A-11D-A18J-09	TCGA-EK-A2R7-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c7ae530e-5804-4f7e-9618-d2c8d5b7d8c9	d4ff9f4c-d8b8-4842-98a8-9e36caab1e3c	g.chr19:58187558G>A	ENST00000318203.5	+	3	742	c.45G>A	c.(43-45)gaG>gaA	p.E15E		NM_152677.2	NP_689890.1	Q8NAM6	ZSCA4_HUMAN	zinc finger and SCAN domain containing 4	15					telomere maintenance via telomere lengthening (GO:0010833)|transcription, DNA-templated (GO:0006351)	nuclear chromosome, telomeric region (GO:0000784)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(5)|liver(2)|lung(17)|ovary(1)|skin(1)|stomach(1)	30		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AACCATCCGAGAATAATCTTG	0.388																																																	0													63.0	62.0	62.0					19																	58187558		2203	4300	6503	SO:0001819	synonymous_variant	201516			AK092424	CCDS12958.1	19q13.43	2013-01-08	2004-11-01	2004-11-02		ENSG00000180532		"""-"", ""Zinc fingers, C2H2-type"""	23709	protein-coding gene	gene with protein product		613419	"""zinc finger protein 494"""	ZNF494			Standard	NM_152677		Approved	FLJ35105	uc002qpu.3	Q8NAM6		ENST00000318203.5:c.45G>A	19.37:g.58187558G>A			Q3MIQ2	Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E15	ENST00000318203.5	37	c.45	CCDS12958.1	19																																																																																			ZSCAN4	-	NULL		0.388	ZSCAN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN4	HGNC	protein_coding	OTTHUMT00000466812.1	G	NM_152677		58187558	+1	no_errors	ENST00000318203	ensembl	human	known	70_37	silent	SNP	0.000	A
