#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ACOT8	10005	genome.wustl.edu	37	20	44485852	44485852	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr20:44485852C>G	ENST00000217455.4	-	1	193	c.103G>C	c.(103-105)Gag>Cag	p.E35Q	ZSWIM3_ENST00000255152.2_5'Flank|ZSWIM3_ENST00000454862.2_5'Flank	NM_005469.3	NP_005460.2	O14734	ACOT8_HUMAN	acyl-CoA thioesterase 8	35					acyl-CoA metabolic process (GO:0006637)|alpha-linolenic acid metabolic process (GO:0036109)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|dicarboxylic acid catabolic process (GO:0043649)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|peroxisome fission (GO:0016559)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|viral process (GO:0016032)	mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|choloyl-CoA hydrolase activity (GO:0033882)|medium-chain acyl-CoA hydrolase activity (GO:0052815)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)			kidney(2)|large_intestine(3)|lung(4)|skin(1)	10		Myeloproliferative disorder(115;0.0122)				TCCAGCGGCTCGAGGTTGAGC	0.677																																																	0													31.0	35.0	33.0					20																	44485852		2203	4300	6503	SO:0001583	missense	10005			AF014404	CCDS13378.1	20q13.12	2012-05-16	2005-09-19	2005-09-19	ENSG00000101473	ENSG00000101473	3.1.2.27	"""Acyl CoA thioesterases"""	15919	protein-coding gene	gene with protein product	"""choloyl-CoA hydrolase"""	608123	"""peroxisomal acyl-CoA thioesterase"", ""peroxisomal acyl-CoA thioesterase 1"""	PTE1		10092594, 9153233, 16103133, 16940157	Standard	NM_005469		Approved	hACTE-III, hTE, PTE-2	uc002xqa.2	O14734	OTTHUMG00000033045	ENST00000217455.4:c.103G>C	20.37:g.44485852C>G	ENSP00000217455:p.Glu35Gln		O15261|Q17RX4	Missense_Mutation	SNP	pfam_Acyl_CoA_thio_II_dom,tigrfam_Acyl_CoA_thio	p.E35Q	ENST00000217455.4	37	c.103	CCDS13378.1	20	.	.	.	.	.	.	.	.	.	.	C	33	5.244984	0.95272	.	.	ENSG00000101473	ENST00000217455;ENST00000426915;ENST00000372531	.	.	.	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.64821	0.2633	N	0.20986	0.625	0.80722	D	1	D;D;D	0.89917	0.979;1.0;0.999	P;D;D	0.70935	0.613;0.971;0.931	T	0.68390	-0.5421	9	0.87932	D	0	.	17.5244	0.87795	0.0:1.0:0.0:0.0	.	35;35;35	E9PRD4;B4DLF4;O14734	.;.;ACOT8_HUMAN	Q	35;33;35	.	ENSP00000217455:E35Q	E	-	1	0	ACOT8	43919259	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.727000	0.68523	2.813000	0.96785	0.561000	0.74099	GAG	ACOT8	-	tigrfam_Acyl_CoA_thio		0.677	ACOT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACOT8	HGNC	protein_coding	OTTHUMT00000080338.2	C	NM_183386		44485852	-1	no_errors	ENST00000217455	ensembl	human	known	70_37	missense	SNP	1.000	G
ACSBG1	23205	genome.wustl.edu	37	15	78471012	78471012	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr15:78471012C>T	ENST00000258873.4	-	11	1851	c.1646G>A	c.(1645-1647)gGt>gAt	p.G549D	ACSBG1_ENST00000541759.1_Missense_Mutation_p.G307D|ACSBG1_ENST00000560817.1_Missense_Mutation_p.G307D	NM_001199377.1|NM_015162.4	NP_001186306.1|NP_055977.3	Q96GR2	ACBG1_HUMAN	acyl-CoA synthetase bubblegum family member 1	549					long-chain fatty acid metabolic process (GO:0001676)|myelination (GO:0042552)|ovarian follicle atresia (GO:0001552)|response to glucocorticoid (GO:0051384)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			endometrium(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	37						GCCAGCATCACCCGTGTGCAG	0.622																																																	0													100.0	66.0	78.0					15																	78471012		2196	4293	6489	SO:0001583	missense	23205			AB014531	CCDS10298.1	15q23-q24	2006-02-09			ENSG00000103740	ENSG00000103740		"""Acyl-CoA synthetase family"""	29567	protein-coding gene	gene with protein product	"""bubblegum"", ""very long-chain acyl-CoA synthetase"", ""lipidosin"""	614362				9734811, 10954726	Standard	NM_015162		Approved	BGM, FLJ30320, MGC14352, BG1, KIAA0631, hBG1, hsBG	uc002bdh.3	Q96GR2	OTTHUMG00000143734	ENST00000258873.4:c.1646G>A	15.37:g.78471012C>T	ENSP00000258873:p.Gly549Asp		B2RB61|O75126|Q76N27|Q9HC26	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.G549D	ENST00000258873.4	37	c.1646	CCDS10298.1	15	.	.	.	.	.	.	.	.	.	.	C	17.29	3.351784	0.61183	.	.	ENSG00000103740	ENST00000258873;ENST00000541759	T;T	0.33654	1.4;1.4	5.48	4.54	0.55810	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.65821	0.2728	M	0.89163	3.01	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.73908	-0.3834	10	0.87932	D	0	-26.0845	14.5791	0.68274	0.147:0.853:0.0:0.0	.	545;549	B7Z2Y6;Q96GR2	.;ACBG1_HUMAN	D	549;307	ENSP00000258873:G549D;ENSP00000439955:G307D	ENSP00000258873:G549D	G	-	2	0	ACSBG1	76258067	1.000000	0.71417	0.014000	0.15608	0.159000	0.22180	7.713000	0.84693	1.274000	0.44362	0.655000	0.94253	GGT	ACSBG1	-	pfam_AMP-dep_Synth/Lig		0.622	ACSBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSBG1	HGNC	protein_coding	OTTHUMT00000289802.2	C	NM_015162		78471012	-1	no_errors	ENST00000258873	ensembl	human	known	70_37	missense	SNP	0.991	T
ADAP2	55803	genome.wustl.edu	37	17	29283385	29283385	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr17:29283385C>T	ENST00000330889.3	+	10	1344	c.1009C>T	c.(1009-1011)Cgg>Tgg	p.R337W	ADAP2_ENST00000580525.1_Missense_Mutation_p.R343W|AC091177.1_ENST00000442757.1_RNA	NM_018404.2	NP_060874.1	Q9NPF8	ADAP2_HUMAN	ArfGAP with dual PH domains 2	337	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				heart development (GO:0007507)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|mitochondrial envelope (GO:0005740)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)	p.?(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	13						CACCCCAGAGCGGAGATTTGT	0.577																																																	1	Unknown(1)	central_nervous_system(1)											87.0	74.0	78.0					17																	29283385		2203	4300	6503	SO:0001583	missense	55803			AJ238994	CCDS11261.1	17q11.2	2013-01-10	2008-09-22	2008-09-22	ENSG00000184060	ENSG00000184060		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	16487	protein-coding gene	gene with protein product		608635	"""centaurin, alpha 2"""	CENTA2			Standard	XM_005258008		Approved		uc002hfx.3	Q9NPF8	OTTHUMG00000132868	ENST00000330889.3:c.1009C>T	17.37:g.29283385C>T	ENSP00000329468:p.Arg337Trp		Q8N4Q6|Q96SD5	Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,smart_ArfGAP,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.R337W	ENST00000330889.3	37	c.1009	CCDS11261.1	17	.	.	.	.	.	.	.	.	.	.	C	9.006	0.981379	0.18812	.	.	ENSG00000184060	ENST00000330889	T	0.40756	1.02	4.94	2.84	0.33178	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.69133	0.3077	M	0.92784	3.345	0.52501	D	0.999951	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.76263	-0.3023	10	0.87932	D	0	.	11.1838	0.48644	0.4571:0.5429:0.0:0.0	.	343;336;337	Q2V6Q1;Q9NPF8-2;Q9NPF8	.;.;ADAP2_HUMAN	W	337	ENSP00000329468:R337W	ENSP00000329468:R337W	R	+	1	2	ADAP2	26307511	0.017000	0.18338	0.131000	0.22000	0.583000	0.36354	0.149000	0.16243	1.305000	0.44909	-0.475000	0.04921	CGG	ADAP2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.577	ADAP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADAP2	HGNC	protein_coding	OTTHUMT00000256346.1	C	NM_018404		29283385	+1	no_errors	ENST00000330889	ensembl	human	known	70_37	missense	SNP	0.776	T
ADAR	103	genome.wustl.edu	37	1	154560627	154560627	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:154560627C>G	ENST00000368474.4	-	11	3192	c.2993G>C	c.(2992-2994)gGa>gCa	p.G998A	ADAR_ENST00000368471.3_Missense_Mutation_p.G703A|ADAR_ENST00000292205.5_Missense_Mutation_p.G1041A	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	998	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		GCGGAGCTTTCCTTGTTTGGG	0.567																																																	0													249.0	226.0	234.0					1																	154560627		2203	4300	6503	SO:0001583	missense	103			BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.2993G>C	1.37:g.154560627C>G	ENSP00000357459:p.Gly998Ala		B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Missense_Mutation	SNP	pfam_A_deamin,pfam_dsRNA_A_deaminase,pfam_Ds-RNA-bd,smart_dsRNA_A_deaminase,smart_Ds-RNA-bd,smart_A_deamin,pfscan_Ds-RNA-bd,pfscan_dsRNA_A_deaminase,pfscan_A_deamin	p.G1041A	ENST00000368474.4	37	c.3122	CCDS1071.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.291754	0.95546	.	.	ENSG00000160710	ENST00000292205;ENST00000368474;ENST00000368471;ENST00000529168	D;D;D;D	0.93763	-3.28;-3.28;-3.28;-3.28	5.58	5.58	0.84498	Adenosine deaminase/editase (3);	0.000000	0.85682	D	0.000000	D	0.96399	0.8825	M	0.76170	2.325	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96286	0.9210	10	0.66056	D	0.02	-23.2228	19.5563	0.95349	0.0:1.0:0.0:0.0	.	953;972;998	P55265-3;P55265-2;P55265	.;.;DSRAD_HUMAN	A	1041;998;703;967	ENSP00000292205:G1041A;ENSP00000357459:G998A;ENSP00000357456:G703A;ENSP00000431794:G967A	ENSP00000292205:G1041A	G	-	2	0	ADAR	152827251	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.245000	0.78237	2.628000	0.89032	0.650000	0.86243	GGA	ADAR	-	pfam_A_deamin,smart_A_deamin,pfscan_A_deamin		0.567	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADAR	HGNC	protein_coding	OTTHUMT00000090691.2	C	NM_001111		154560627	-1	no_errors	ENST00000292205	ensembl	human	known	70_37	missense	SNP	1.000	G
AFAP1L2	84632	genome.wustl.edu	37	10	116054775	116054776	+	3'UTR	INS	-	-	A	rs34269303|rs10627231|rs397730112|rs550504274	byFrequency	TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr10:116054775_116054776insA	ENST00000304129.4	-	0	3511_3512				AFAP1L2_ENST00000491814.1_5'UTR|AFAP1L2_ENST00000369271.3_3'UTR			Q8N4X5	AF1L2_HUMAN	actin filament associated protein 1-like 2						inflammatory response (GO:0006954)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of interleukin-6 production (GO:0032675)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)	protein tyrosine kinase activator activity (GO:0030296)|SH2 domain binding (GO:0042169)|SH3 domain binding (GO:0017124)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|prostate(2)	21		Colorectal(252;0.175)|Breast(234;0.231)		Epithelial(162;0.0219)|all cancers(201;0.0561)		CAACCTGTGttaaaaaaaaaaa	0.376																																																	0																																										SO:0001624	3_prime_UTR_variant	84632			BC024314	CCDS31286.1, CCDS31287.1	10q26.11	2013-01-10	2007-02-07	2007-02-07	ENSG00000169129	ENSG00000169129		"""Pleckstrin homology (PH) domain containing"""	25901	protein-coding gene	gene with protein product		612420	"""KIAA1914"""	KIAA1914		11572484, 17412687	Standard	XM_005270239		Approved	FLJ14564, Em:AC005383.4, XB130	uc001lbn.3	Q8N4X5	OTTHUMG00000019086	ENST00000304129.4:c.*1026->T	10.37:g.116054786_116054786dupA			A8K6P7|B3KVQ8|Q2UZW3|Q8TB54|Q96PX4|Q96SY5	RNA	INS	-	NULL	ENST00000304129.4	37	NULL	CCDS31286.1	10																																																																																			AFAP1L2	-	-		0.376	AFAP1L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFAP1L2	HGNC	protein_coding	OTTHUMT00000050462.1	-	NM_032550		116054776	-1	no_errors	ENST00000491814	ensembl	human	known	70_37	rna	INS	0.222:0.000	A
AIRE	326	genome.wustl.edu	37	21	45711044	45711044	+	Missense_Mutation	SNP	C	C	T	rs139874934		TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr21:45711044C>T	ENST00000291582.5	+	8	1073	c.946C>T	c.(946-948)Cgg>Tgg	p.R316W	AIRE_ENST00000329347.4_Missense_Mutation_p.R109W|AIRE_ENST00000355347.4_Missense_Mutation_p.R109W	NM_000383.3	NP_000374.1	O43918	AIRE_HUMAN	autoimmune regulator	316					humoral immune response (GO:0006959)|immune response (GO:0006955)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|transcription regulatory region DNA binding (GO:0044212)|translation regulator activity (GO:0045182)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|skin(2)|urinary_tract(1)	14				Colorectal(79;0.0806)		CGGCTGCCCTCGGGCCTTCCA	0.687									Autoimmune PolyEndocrinopathy Candidiasis Ectodermal Dystrophy																																								0								C	TRP/ARG,TRP/ARG	0,4406		0,0,2203	55.0	44.0	48.0		946,355	2.6	1.0	21	dbSNP_134	48	2,8596	2.2+/-6.3	0,2,4297	no	missense,missense	AIRE	NM_000383.2,NM_000658.2	101,101	0,2,6500	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging,probably-damaging	316/546,119/349	45711044	2,13002	2203	4299	6502	SO:0001583	missense	326	Familial Cancer Database	APECED	AB006684	CCDS13706.1	21q22.3	2014-09-17	2007-06-20		ENSG00000160224	ENSG00000160224		"""Zinc fingers, PHD-type"""	360	protein-coding gene	gene with protein product	"""autoimmune polyendocrinopathy candidiasis ectodermal dystrophy"""	607358	"""autoimmune regulator (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy)"""	APECED		9398840	Standard	NM_000383		Approved	PGA1, APS1	uc002zei.3	O43918	OTTHUMG00000086921	ENST00000291582.5:c.946C>T	21.37:g.45711044C>T	ENSP00000291582:p.Arg316Trp		B2RP50|O43922|O43932|O75745	Missense_Mutation	SNP	pfam_Sp100,pfam_Znf_PHD-finger,pfam_SAND_dom,superfamily_Znf_FYVE_PHD,superfamily_SAND_dom-like,smart_SAND_dom,smart_Znf_PHD,pfscan_Znf_PHD-finger,pfscan_SAND_dom,prints_AIRE	p.R316W	ENST00000291582.5	37	c.946	CCDS13706.1	21	.	.	.	.	.	.	.	.	.	.	C	20.8	4.056339	0.76074	0.0	2.33E-4	ENSG00000160224	ENST00000291582;ENST00000337909;ENST00000397994;ENST00000355347;ENST00000329347	D;D;D	0.94966	-3.57;-3.57;-3.57	3.62	2.63	0.31362	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.38111	N	0.001814	D	0.97275	0.9109	M	0.94063	3.49	0.45415	D	0.998392	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.96600	0.9444	10	0.87932	D	0	-33.7397	7.6851	0.28536	0.2511:0.7489:0.0:0.0	.	119;316	B2RP50;O43918	.;AIRE_HUMAN	W	316;119;119;109;109	ENSP00000291582:R316W;ENSP00000347505:R109W;ENSP00000331055:R109W	ENSP00000291582:R316W	R	+	1	2	AIRE	44535472	1.000000	0.71417	0.996000	0.52242	0.949000	0.60115	1.831000	0.39141	1.757000	0.51966	0.462000	0.41574	CGG	AIRE	-	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger		0.687	AIRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIRE	HGNC	protein_coding	OTTHUMT00000195842.2	C			45711044	+1	no_errors	ENST00000291582	ensembl	human	known	70_37	missense	SNP	1.000	T
ALG8	79053	genome.wustl.edu	37	11	77823804	77823804	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr11:77823804G>C	ENST00000299626.5	-	8	861	c.790C>G	c.(790-792)Caa>Gaa	p.Q264E	ALG8_ENST00000532552.2_Intron|ALG8_ENST00000376156.3_Missense_Mutation_p.Q264E	NM_024079.4	NP_076984.2	Q9BVK2	ALG8_HUMAN	ALG8, alpha-1,3-glucosyltransferase	264					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-1,3-mannosyltransferase activity (GO:0000033)			NS(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	30	all_cancers(14;3.62e-19)|all_epithelial(13;1.27e-21)|Breast(9;8.51e-17)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;9.66e-25)			GAAAAGACTTGAGGCAGCTGA	0.403																																																	0													63.0	62.0	62.0					11																	77823804		2200	4292	6492	SO:0001583	missense	79053			AJ224875	CCDS8258.1, CCDS41692.1	11q14.1	2013-03-01	2013-03-01		ENSG00000159063	ENSG00000159063	2.4.1.265		23161	protein-coding gene	gene with protein product	"""dolichyl-P-Glc:Glc(1)Man(9)GlcNAc(2)-PP-dolichol alpha- 1->3-glucosyltransferase"""	608103	"""asparagine-linked glycosylation 8 homolog (yeast, alpha-1,3-glucosyltransferase)"", ""asparagine-linked glycosylation 8, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)"""				Standard	XM_005274247		Approved	MGC2840	uc001oza.1	Q9BVK2	OTTHUMG00000166594	ENST00000299626.5:c.790C>G	11.37:g.77823804G>C	ENSP00000299626:p.Gln264Glu		A6NDW6|O60860	Missense_Mutation	SNP	pfam_Glyco_trans_ALG6/ALG8	p.Q264E	ENST00000299626.5	37	c.790	CCDS8258.1	11	.	.	.	.	.	.	.	.	.	.	G	29.5	5.014672	0.93404	.	.	ENSG00000159063	ENST00000299626;ENST00000376156;ENST00000532440;ENST00000525755;ENST00000530454	D;D;D;D;D	0.86230	-2.09;-2.09;-2.09;-2.09;-2.09	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	D	0.95236	0.8455	M	0.91300	3.195	0.80722	D	1	P;D;D	0.89917	0.933;1.0;1.0	P;D;D	0.87578	0.854;0.998;0.998	D	0.95598	0.8660	10	0.72032	D	0.01	-8.9404	19.8002	0.96504	0.0:0.0:1.0:0.0	.	264;264;264	B3KQL8;Q9BVK2;A6NDW6	.;ALG8_HUMAN;.	E	264;264;82;213;265	ENSP00000299626:Q264E;ENSP00000365326:Q264E;ENSP00000433429:Q82E;ENSP00000435467:Q213E;ENSP00000434660:Q265E	ENSP00000299626:Q264E	Q	-	1	0	ALG8	77501452	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.094000	0.94168	2.674000	0.91012	0.655000	0.94253	CAA	ALG8	-	pfam_Glyco_trans_ALG6/ALG8		0.403	ALG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG8	HGNC	protein_coding	OTTHUMT00000390637.1	G	NM_024079		77823804	-1	no_errors	ENST00000299626	ensembl	human	known	70_37	missense	SNP	1.000	C
ALOX15B	247	genome.wustl.edu	37	17	7950658	7950658	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr17:7950658G>C	ENST00000380183.4	+	11	1679	c.1540G>C	c.(1540-1542)Gag>Cag	p.E514Q	ALOX15B_ENST00000380173.2_Missense_Mutation_p.E485Q|ALOX15B_ENST00000572022.1_Missense_Mutation_p.E502Q|ALOX15B_ENST00000573359.1_Intron	NM_001141.2	NP_001132.2	O15296	LX15B_HUMAN	arachidonate 15-lipoxygenase, type B	514	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				apoptotic process (GO:0006915)|arachidonic acid metabolic process (GO:0019369)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipid metabolic process (GO:0006629)|lipoxygenase pathway (GO:0019372)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostate gland development (GO:0030850)|regulation of epithelial cell differentiation (GO:0030856)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	arachidonate 15-lipoxygenase activity (GO:0050473)|arachidonate 8(S)-lipoxygenase activity (GO:0036403)|calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|lipid binding (GO:0008289)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	24						CTGGGTCAGAGAGATCTTCTC	0.552																																																	0													91.0	94.0	93.0					17																	7950658		2203	4300	6503	SO:0001583	missense	247			U78294	CCDS11128.1, CCDS32558.1, CCDS32559.1	17p13.1	2013-03-20	2006-01-16		ENSG00000179593	ENSG00000179593	1.13.11.33	"""Arachidonate lipoxygenases"""	434	protein-coding gene	gene with protein product		603697	"""arachidonate 15-lipoxygenase, second type"""			9177185	Standard	NM_001039130		Approved	15-LOX-2	uc002gju.3	O15296	OTTHUMG00000108181	ENST00000380183.4:c.1540G>C	17.37:g.7950658G>C	ENSP00000369530:p.Glu514Gln		D3DTR2|Q8IYQ2|Q8TEV3|Q8TEV4|Q8TEV5|Q8TEV6|Q9UKM4	Missense_Mutation	SNP	pfam_LipOase_C,pfam_LipOase_LH2,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2,prints_LipOase_mml,prints_LipOase_C	p.E514Q	ENST00000380183.4	37	c.1540	CCDS11128.1	17	.	.	.	.	.	.	.	.	.	.	G	22.7	4.319935	0.81469	.	.	ENSG00000179593	ENST00000380173;ENST00000380183	D;D	0.94758	-3.51;-3.51	3.95	3.95	0.45737	Lipoxygenase, C-terminal (3);	0.217248	0.47093	D	0.000245	D	0.98043	0.9355	H	0.96518	3.835	0.58432	D	0.999991	D;D;D	0.76494	0.999;0.999;0.996	D;D;D	0.75484	0.986;0.976;0.976	D	0.99222	1.0879	10	0.87932	D	0	-27.8311	15.3006	0.73949	0.0:0.0:1.0:0.0	.	502;485;514	B4DNW8;O15296-4;O15296	.;.;LX15B_HUMAN	Q	485;514	ENSP00000369520:E485Q;ENSP00000369530:E514Q	ENSP00000369520:E485Q	E	+	1	0	ALOX15B	7891383	1.000000	0.71417	0.998000	0.56505	0.784000	0.44337	8.994000	0.93529	2.206000	0.71126	0.655000	0.94253	GAG	ALOX15B	-	pfam_LipOase_C,superfamily_LipOase_C		0.552	ALOX15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX15B	HGNC	protein_coding	OTTHUMT00000226985.2	G			7950658	+1	no_errors	ENST00000380183	ensembl	human	known	70_37	missense	SNP	1.000	C
ALPK2	115701	genome.wustl.edu	37	18	56247685	56247685	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr18:56247685G>A	ENST00000361673.3	-	4	536	c.323C>T	c.(322-324)tCa>tTa	p.S108L	ALPK2_ENST00000587399.1_5'Flank	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	108	Ig-like 1.					nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						TGGGTTCTCTGATGAGCACTC	0.438																																																	0													204.0	185.0	191.0					18																	56247685		1954	4152	6106	SO:0001583	missense	115701			AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.323C>T	18.37:g.56247685G>A	ENSP00000354991:p.Ser108Leu		Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase,pfscan_Ig-like	p.S108L	ENST00000361673.3	37	c.323	CCDS11966.2	18	.	.	.	.	.	.	.	.	.	.	G	14.91	2.675258	0.47781	.	.	ENSG00000198796	ENST00000361673	T	0.49720	0.77	5.12	2.31	0.28768	Immunoglobulin-like (1);	.	.	.	.	T	0.30355	0.0762	N	0.25647	0.755	0.09310	N	1	B	0.12630	0.006	B	0.10450	0.005	T	0.22103	-1.0226	9	0.45353	T	0.12	1.23	3.4232	0.07401	0.2505:0.0:0.4296:0.3198	.	108	Q86TB3	ALPK2_HUMAN	L	108	ENSP00000354991:S108L	ENSP00000354991:S108L	S	-	2	0	ALPK2	54398665	0.000000	0.05858	0.000000	0.03702	0.597000	0.36814	0.700000	0.25601	0.305000	0.22832	0.467000	0.42956	TCA	ALPK2	-	pfscan_Ig-like		0.438	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK2	HGNC	protein_coding	OTTHUMT00000256126.1	G	NM_052947		56247685	-1	no_errors	ENST00000361673	ensembl	human	known	70_37	missense	SNP	0.000	A
ARHGEF9	23229	genome.wustl.edu	37	X	62974366	62974366	+	5'UTR	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chrX:62974366C>T	ENST00000253401.6	-	0	627				ARHGEF9_ENST00000374870.4_5'UTR|ARHGEF9_ENST00000374872.1_5'UTR|ARHGEF9_ENST00000437457.2_Intron|ARHGEF9_ENST00000374878.1_Intron|ARHGEF9_ENST00000495564.1_5'UTR	NM_015185.2	NP_056000.1	O43307	ARHG9_HUMAN	Cdc42 guanine nucleotide exchange factor (GEF) 9						apoptotic signaling pathway (GO:0097190)|ion transmembrane transport (GO:0034220)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|skin(1)	35						GGACTCCATTCAGCGCGTTCC	0.483																																																	0																																										SO:0001623	5_prime_UTR_variant	23229			AB007884	CCDS35315.1, CCDS55429.1, CCDS55430.1	Xq11.1	2013-01-10			ENSG00000131089	ENSG00000131089		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14561	protein-coding gene	gene with protein product	"""collybistin"""	300429				10559246, 9455477	Standard	NM_015185		Approved	KIAA0424, PEM-2	uc011mot.2	O43307	OTTHUMG00000021700	ENST00000253401.6:c.-174G>A	X.37:g.62974366C>T			A8K1S8|B4DHC7|F8W7P8|Q5JSL6	RNA	SNP	-	NULL	ENST00000253401.6	37	NULL	CCDS35315.1	X																																																																																			ARHGEF9	-	-		0.483	ARHGEF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF9	HGNC	protein_coding	OTTHUMT00000056937.1	C			62974366	-1	no_errors	ENST00000495564	ensembl	human	known	70_37	rna	SNP	1.000	T
ATL3	25923	genome.wustl.edu	37	11	63403049	63403049	+	Missense_Mutation	SNP	A	A	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr11:63403049A>G	ENST00000398868.3	-	10	1268	c.992T>C	c.(991-993)aTt>aCt	p.I331T	ATL3_ENST00000332645.4_Missense_Mutation_p.I358T|RP11-697H9.2_ENST00000540307.1_RNA|ATL3_ENST00000538786.1_Missense_Mutation_p.I313T	NM_015459.3	NP_056274.3	Q6DD88	ATLA3_HUMAN	atlastin GTPase 3	331					endoplasmic reticulum organization (GO:0007029)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	11						TCCTTGATAAATTTTAATATA	0.308											OREG0021036	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													97.0	90.0	92.0					11																	63403049		1821	4086	5907	SO:0001583	missense	25923				CCDS41663.1, CCDS73309.1	11q13.1	2008-09-17			ENSG00000184743	ENSG00000184743			24526	protein-coding gene	gene with protein product		609369				18270207	Standard	XM_005273891		Approved	DKFZP564J0863	uc001nxk.1	Q6DD88	OTTHUMG00000167854	ENST00000398868.3:c.992T>C	11.37:g.63403049A>G	ENSP00000381844:p.Ile331Thr	1068	Q8N7W5|Q9H8Q5|Q9UFL1	Missense_Mutation	SNP	pfam_Guanylate-bd_N,pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C	p.I358T	ENST00000398868.3	37	c.1073	CCDS41663.1	11	.	.	.	.	.	.	.	.	.	.	A	19.79	3.892829	0.72524	.	.	ENSG00000184743	ENST00000398868;ENST00000332645;ENST00000538786	T;T;T	0.01629	4.72;4.72;4.72	4.78	4.78	0.61160	Guanylate-binding protein, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.12475	0.0303	M	0.87097	2.86	0.80722	D	1	P	0.35628	0.513	P	0.59424	0.857	T	0.00010	-1.2457	10	0.87932	D	0	-19.4355	12.5687	0.56323	1.0:0.0:0.0:0.0	.	331	Q6DD88	ATLA3_HUMAN	T	331;358;313	ENSP00000381844:I331T;ENSP00000329034:I358T;ENSP00000437593:I313T	ENSP00000329034:I358T	I	-	2	0	ATL3	63159625	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	9.317000	0.96327	1.910000	0.55303	0.528000	0.53228	ATT	ATL3	-	pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C		0.308	ATL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATL3	HGNC	protein_coding	OTTHUMT00000396637.1	A	NM_015459		63403049	-1	no_errors	ENST00000332645	ensembl	human	known	70_37	missense	SNP	1.000	G
ATP6V0A4	50617	genome.wustl.edu	37	7	138455977	138455977	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr7:138455977G>A	ENST00000310018.2	-	3	298	c.16C>T	c.(16-18)Cga>Tga	p.R6*	ATP6V0A4_ENST00000483139.1_5'UTR|ATP6V0A4_ENST00000393054.1_Nonsense_Mutation_p.R6*|ATP6V0A4_ENST00000353492.4_Nonsense_Mutation_p.R6*	NM_020632.2|NM_130840.2	NP_065683.2|NP_570855.2	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a4	6					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			NS(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						TCCTCGCTTCGAAACACAGAC	0.433																																																	0			GRCh37	CM065982	ATP6V0A4	M							143.0	140.0	141.0					7																	138455977		2203	4300	6503	SO:0001587	stop_gained	50617			AF245517	CCDS5849.1	7q34	2011-06-09	2006-01-20	2002-05-10	ENSG00000105929	ENSG00000105929		"""ATPases / V-type"""	866	protein-coding gene	gene with protein product		605239	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1B"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 4"", ""ATPase, H+ transporting, lysosomal V0 subunit A4"""	ATP6N1B, ATP6N2, RTA1C		10577919, 10973252	Standard	XM_005250393		Approved	RDRTA2, VPP2, RTADR, a4, Vph1, Stv1	uc003vuf.3	Q9HBG4	OTTHUMG00000157122	ENST00000310018.2:c.16C>T	7.37:g.138455977G>A	ENSP00000308122:p.Arg6*		A4D1R4|A8KA80|Q32M47	Nonsense_Mutation	SNP	pfam_ATPase_V0/A0_a	p.R6*	ENST00000310018.2	37	c.16	CCDS5849.1	7	.	.	.	.	.	.	.	.	.	.	G	39	7.348279	0.98228	.	.	ENSG00000105929	ENST00000310018;ENST00000393054;ENST00000353492	.	.	.	4.76	4.76	0.60689	.	0.000000	0.64402	D	0.000017	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.7712	16.9469	0.86232	0.0:0.0:1.0:0.0	.	.	.	.	X	6	.	ENSP00000308122:R6X	R	-	1	2	ATP6V0A4	138106517	1.000000	0.71417	0.992000	0.48379	0.940000	0.58332	4.051000	0.57412	2.454000	0.82982	0.557000	0.71058	CGA	ATP6V0A4	-	NULL		0.433	ATP6V0A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V0A4	HGNC	protein_coding	OTTHUMT00000347514.1	G	NM_020632		138455977	-1	no_errors	ENST00000310018	ensembl	human	known	70_37	nonsense	SNP	1.000	A
ATP6V0E2	155066	genome.wustl.edu	37	7	149571037	149571037	+	5'Flank	SNP	C	C	T	rs207468794		TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr7:149571037C>T	ENST00000425642.2	+	0	0				ATP6V0E2-AS1_ENST00000488315.1_RNA|ATP6V0E2-AS1_ENST00000461019.1_RNA|ATP6V0E2_ENST00000606024.1_5'Flank|ATP6V0E2_ENST00000464662.1_5'Flank|ATP6V0E2_ENST00000479613.1_5'Flank|ATP6V0E2_ENST00000456496.2_Silent_p.I10I|ATP6V0E2-AS1_ENST00000464939.1_RNA|ATP6V0E2_ENST00000421974.2_Silent_p.I10I			Q8NHE4	VA0E2_HUMAN	ATPase, H+ transporting V0 subunit e2						ATP hydrolysis coupled proton transport (GO:0015991)|cell growth (GO:0016049)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)	ATPase activity, coupled to transmembrane movement of ions (GO:0042625)|hydrogen ion transmembrane transporter activity (GO:0015078)			lung(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.00256)			CCCGGCTGATCGCTTCGGGTG	0.721																																																	0																																										SO:0001631	upstream_gene_variant	155066			AK057700	CCDS47742.1, CCDS55181.1	7q36.1	2010-04-21	2006-10-12	2006-10-12	ENSG00000171130	ENSG00000171130		"""ATPases / V-type"""	21723	protein-coding gene	gene with protein product		611019	"""chromosome 7 open reading frame 32"", ""ATPase, H+ transporting V0 subunit E isoform 2-like (rat)"""	C7orf32, ATP6V0E2L			Standard	XM_005249958		Approved		uc003wgs.3	Q8NHE4	OTTHUMG00000158094		7.37:g.149571037C>T	Exception_encountered		A2T863|A2T8L7|B5MDP5|J3KQW7|Q6MZW1|Q75L47|Q7Z4R7|Q8N7I8	Silent	SNP	pfam_ATPase_V0-cplx_esu	p.I10	ENST00000425642.2	37	c.30		7																																																																																			ATP6V0E2	-	NULL		0.721	ATP6V0E2-010	KNOWN	basic|appris_principal	protein_coding	ATP6V0E2	HGNC	protein_coding	OTTHUMT00000470874.1	C	NM_145230		149571037	+1	no_errors	ENST00000421974	ensembl	human	known	70_37	silent	SNP	0.000	T
BAD	572	genome.wustl.edu	37	11	64039170	64039170	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr11:64039170C>T	ENST00000394532.3	-	2	563	c.293G>A	c.(292-294)cGc>cAc	p.R98H	BAD_ENST00000394531.3_Missense_Mutation_p.A145T|BAD_ENST00000544785.1_Intron|BAD_ENST00000309032.3_Missense_Mutation_p.R98H	NM_004322.3	NP_004313.1	Q92934	BAD_HUMAN	BCL2-associated agonist of cell death	98					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|ADP metabolic process (GO:0046031)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|ATP metabolic process (GO:0046034)|cellular process regulating host cell cycle in response to virus (GO:0060154)|cellular response to chromate (GO:0071247)|cellular response to hypoxia (GO:0071456)|cellular response to lipid (GO:0071396)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nicotine (GO:0071316)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose catabolic process (GO:0006007)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|pore complex assembly (GO:0046931)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic process by virus (GO:0060139)|positive regulation of autophagy (GO:0010508)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of glucokinase activity (GO:0033133)|positive regulation of insulin secretion (GO:0032024)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane potential (GO:0010918)|positive regulation of neuron death (GO:1901216)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of mitochondrial membrane permeability (GO:0046902)|release of cytochrome c from mitochondria (GO:0001836)|response to amino acid (GO:0043200)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hydrogen peroxide (GO:0042542)|response to oleic acid (GO:0034201)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|suppression by virus of host apoptotic process (GO:0019050)|type B pancreatic cell proliferation (GO:0044342)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|lipid binding (GO:0008289)|phospholipid binding (GO:0005543)|protein kinase binding (GO:0019901)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(1)	4						GGGCGCCGAGCGCGAGCGGCC	0.692																																																	0													19.0	18.0	18.0					11																	64039170		2174	4252	6426	SO:0001583	missense	572			AF021792	CCDS8065.1	11q13.1	2014-03-07	2008-08-19		ENSG00000002330	ENSG00000002330			936	protein-coding gene	gene with protein product		603167				8929532	Standard	NM_004322		Approved	BCL2L8, BBC2	uc001nzd.3	Q92934	OTTHUMG00000134302	ENST00000394532.3:c.293G>A	11.37:g.64039170C>T	ENSP00000378040:p.Arg98His		O14803|Q6FH21	Missense_Mutation	SNP	pfam_Bcl-2_BAD	p.R98H	ENST00000394532.3	37	c.293	CCDS8065.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.4|27.4	4.825561|4.825561	0.90955|0.90955	.|.	.|.	ENSG00000002330|ENSG00000002330	ENST00000394531|ENST00000394532;ENST00000540152;ENST00000309032;ENST00000493798;ENST00000492141	.|T;T;T;T	.|0.60548	.|0.18;0.18;0.18;0.18	5.72|5.72	3.78|3.78	0.43462|0.43462	.|.	.|0.124246	.|0.51477	.|D	.|0.000093	T|T	0.60196|0.60196	0.2250|0.2250	M|M	0.61703|0.61703	1.905|1.905	0.80722|0.80722	D|D	1|1	.|D	.|0.61697	.|0.99	.|P	.|0.52031	.|0.688	T|T	0.63019|0.63019	-0.6730|-0.6730	6|10	0.87932|0.72032	D|D	0|0.01	-6.32|-6.32	6.5862|6.5862	0.22622|0.22622	0.1941:0.7158:0.0:0.0901|0.1941:0.7158:0.0:0.0901	.|.	.|98	.|Q92934	.|BAD_HUMAN	T|H	145|98;98;98;13;13	.|ENSP00000378040:R98H;ENSP00000309103:R98H;ENSP00000438975:R13H;ENSP00000439202:R13H	ENSP00000378039:A145T|ENSP00000309103:R98H	A|R	-|-	1|2	0|0	BAD|BAD	63795746|63795746	0.687000|0.687000	0.27671|0.27671	1.000000|1.000000	0.80357|0.80357	0.935000|0.935000	0.57460|0.57460	0.599000|0.599000	0.24089|0.24089	1.340000|1.340000	0.45581|0.45581	0.561000|0.561000	0.74099|0.74099	GCT|CGC	BAD	-	pfam_Bcl-2_BAD		0.692	BAD-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BAD	HGNC	protein_coding	OTTHUMT00000259180.2	C	NM_032989		64039170	-1	no_errors	ENST00000309032	ensembl	human	known	70_37	missense	SNP	0.991	T
BOD1L1	259282	genome.wustl.edu	37	4	13601904	13601904	+	Nonsense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr4:13601904G>C	ENST00000040738.5	-	10	6755	c.6620C>G	c.(6619-6621)tCa>tGa	p.S2207*		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	2207						nucleus (GO:0005634)	DNA binding (GO:0003677)										CTTGCTGGTTGAGGCAAGAGG	0.507																																																	0													72.0	59.0	64.0					4																	13601904		2203	4300	6503	SO:0001587	stop_gained	259282			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.6620C>G	4.37:g.13601904G>C	ENSP00000040738:p.Ser2207*		Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Nonsense_Mutation	SNP	NULL	p.S2207*	ENST00000040738.5	37	c.6620	CCDS3411.2	4	.	.	.	.	.	.	.	.	.	.	G	47	13.287778	0.99732	.	.	ENSG00000038219	ENST00000040738	.	.	.	5.11	5.11	0.69529	.	0.149633	0.31177	N	0.008104	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-1.4868	12.995	0.58642	0.0:0.1622:0.8378:0.0	.	.	.	.	X	2207	.	ENSP00000040738:S2207X	S	-	2	0	BOD1L	13211002	0.999000	0.42202	0.979000	0.43373	0.528000	0.34623	3.372000	0.52387	2.389000	0.81357	0.555000	0.69702	TCA	BOD1L1	-	NULL		0.507	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	HGNC	protein_coding	OTTHUMT00000207321.1	G	NM_148894		13601904	-1	no_errors	ENST00000040738	ensembl	human	known	70_37	nonsense	SNP	0.829	C
BPIFA4P	317716	genome.wustl.edu	37	20	31789434	31789434	+	RNA	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr20:31789434G>C	ENST00000375465.3	+	0	396					NR_026760.1		Q86YQ2	LATH_HUMAN	BPI fold containing family A, member 4, pseudogene							extracellular region (GO:0005576)	lipid binding (GO:0008289)										CGTCTGAGTTGATTGTGCAGT	0.512																																																	0													214.0	187.0	195.0					20																	31789434		692	1591	2283			317716			AY180924		20q11.21	2013-01-24			ENSG00000183566	ENSG00000183566		"""BPI fold containing"""	20469	pseudogene	pseudogene	"""breast cancer and salivary gland expression gene"", ""PLUNC family pseudogene"""	607627				12538848, 21787333	Standard	NR_026760		Approved	BASE	uc002wyq.2	Q86YQ2	OTTHUMG00000032251		20.37:g.31789434G>C				RNA	SNP	-	NULL	ENST00000375465.3	37	NULL		20																																																																																			BPIFA4P	-	-		0.512	BPIFA4P-003	KNOWN	basic	processed_transcript	BPIFA4P	HGNC	pseudogene	OTTHUMT00000469705.1	G	NR_026760		31789434	+1	no_errors	ENST00000375465	ensembl	human	known	70_37	rna	SNP	0.000	C
BRAF	673	genome.wustl.edu	37	7	140550007	140550007	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr7:140550007C>T	ENST00000288602.6	-	2	204	c.144G>A	c.(142-144)tgG>tgA	p.W48*		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	48					activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)		SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	GTTTGATATTCCACACCTAAA	0.308		61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												Colon(40;35 892 2973 5743 27438)			Dom	yes		7	7q34	673	v-raf murine sarcoma viral oncogene homolog B1	yes	E	0													98.0	104.0	102.0					7																	140550007		2203	4300	6503	SO:0001587	stop_gained	673	Familial Cancer Database	CFC, CFCS	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.144G>A	7.37:g.140550007C>T	ENSP00000288602:p.Trp48*		A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Nonsense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Raf-like_ras-bd,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Kinase-like_dom,smart_Raf-like_ras-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Raf-like_ras-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_DAG/PE-bd	p.W48*	ENST00000288602.6	37	c.144	CCDS5863.1	7	.	.	.	.	.	.	.	.	.	.	C	29.6	5.021759	0.93462	.	.	ENSG00000157764	ENST00000288602	.	.	.	4.89	4.89	0.63831	.	0.056016	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	14.9487	0.71054	0.0:1.0:0.0:0.0	.	.	.	.	X	48	.	ENSP00000288602:W48X	W	-	3	0	BRAF	140196476	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.205000	0.77881	2.268000	0.75426	0.555000	0.69702	TGG	BRAF	-	NULL		0.308	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRAF	HGNC	protein_coding	OTTHUMT00000348886.1	C	NM_004333		140550007	-1	no_errors	ENST00000288602	ensembl	human	known	70_37	nonsense	SNP	1.000	T
C10orf128	170371	genome.wustl.edu	37	10	50375960	50375960	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr10:50375960C>T	ENST00000474718.1	-	2	113	c.91G>A	c.(91-93)Gaa>Aaa	p.E31K	C10orf128_ENST00000470884.1_5'UTR|C10orf128_ENST00000374148.1_Missense_Mutation_p.E31K|C10orf128_ENST00000374151.3_Missense_Mutation_p.E31K|C10orf128_ENST00000374153.2_Missense_Mutation_p.E31K	NM_001010863.1	NP_001010863.1	Q5T292	CJ128_HUMAN	chromosome 10 open reading frame 128	31						integral component of membrane (GO:0016021)				breast(1)|large_intestine(1)|lung(1)	3						GTACCAATTTCAGCCCCAGGG	0.567																																																	0													118.0	124.0	122.0					10																	50375960		1966	4148	6114	SO:0001583	missense	170371			BC031641	CCDS41519.1, CCDS73128.1	10q11.23	2012-06-13			ENSG00000204161	ENSG00000204161			27274	protein-coding gene	gene with protein product						12477932	Standard	NM_001010863		Approved	Em:AC084727.5	uc001jhn.4	Q5T292	OTTHUMG00000018188	ENST00000474718.1:c.91G>A	10.37:g.50375960C>T	ENSP00000417246:p.Glu31Lys		A6XND2|Q5T289|Q5T291	Missense_Mutation	SNP	NULL	p.E31K	ENST00000474718.1	37	c.91	CCDS41519.1	10	.	.	.	.	.	.	.	.	.	.	C	14.34	2.505050	0.44558	.	.	ENSG00000204161	ENST00000374153;ENST00000474718;ENST00000453436;ENST00000374149;ENST00000374151;ENST00000374148	T;T;T;T;T	0.59083	0.33;0.4;0.32;0.29;0.29	4.59	4.59	0.56863	.	.	.	.	.	T	0.65709	0.2717	L	0.32530	0.975	0.09310	N	1	D;D;D;D	0.71674	0.998;0.998;0.979;0.998	D;D;P;D	0.72338	0.948;0.977;0.801;0.929	T	0.57394	-0.7819	9	0.87932	D	0	.	12.7548	0.57328	0.0:1.0:0.0:0.0	.	31;31;31;31	Q5T292-2;Q5T292-3;Q5T292;Q5T292-4	.;.;CJ128_HUMAN;.	K	31;31;23;25;31;31	ENSP00000363268:E31K;ENSP00000417246:E31K;ENSP00000395067:E23K;ENSP00000363266:E31K;ENSP00000363263:E31K	ENSP00000363263:E31K	E	-	1	0	C10orf128	50045966	0.258000	0.24033	0.018000	0.16275	0.025000	0.11179	3.224000	0.51238	2.367000	0.80283	0.650000	0.86243	GAA	C10orf128	-	NULL		0.567	C10orf128-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf128	HGNC	protein_coding	OTTHUMT00000047978.1	C	NM_001010863		50375960	-1	no_errors	ENST00000374151	ensembl	human	known	70_37	missense	SNP	0.038	T
C20orf196	149840	genome.wustl.edu	37	20	5753783	5753783	+	Intron	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr20:5753783C>G	ENST00000303142.6	+	2	265				C20orf196_ENST00000378979.4_Missense_Mutation_p.L62V	NM_152504.2	NP_689717.2	Q8IYI0	CT196_HUMAN	chromosome 20 open reading frame 196											endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)	9						AATAGCAGATCTCTGAGAATG	0.393																																																	0																																										SO:0001627	intron_variant	149840			AK057796	CCDS13091.1	20p12.3	2006-07-07			ENSG00000171984	ENSG00000171984			26318	protein-coding gene	gene with protein product						12477932	Standard	NM_152504		Approved	FLJ25067	uc002wmf.3	Q8IYI0	OTTHUMG00000031813	ENST00000303142.6:c.178+94C>G	20.37:g.5753783C>G			A8K9J3|Q5TGA9|Q96LU1	Missense_Mutation	SNP	NULL	p.L62V	ENST00000303142.6	37	c.184	CCDS13091.1	20	.	.	.	.	.	.	.	.	.	.	C	4.955	0.177450	0.09443	.	.	ENSG00000171984	ENST00000378979	T	0.51817	0.69	4.91	0.743	0.18347	.	.	.	.	.	T	0.38665	0.1049	.	.	.	0.19575	N	0.999969	.	.	.	.	.	.	T	0.42413	-0.9453	6	0.87932	D	0	.	1.4171	0.02304	0.1752:0.4641:0.1699:0.1909	.	.	.	.	V	62	ENSP00000368263:L62V	ENSP00000368263:L62V	L	+	1	0	C20orf196	5701783	0.001000	0.12720	0.005000	0.12908	0.020000	0.10135	-0.184000	0.09698	0.331000	0.23511	-0.226000	0.12346	CTC	C20orf196	-	NULL		0.393	C20orf196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf196	HGNC	protein_coding	OTTHUMT00000077882.2	C	NM_152504		5753783	+1	no_errors	ENST00000378979	ensembl	human	known	70_37	missense	SNP	0.003	G
C20orf195	79025	genome.wustl.edu	37	20	62187653	62187653	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr20:62187653G>C	ENST00000370098.3	+	2	729	c.637G>C	c.(637-639)Gac>Cac	p.D213H	C20orf195_ENST00000370097.1_Missense_Mutation_p.D213H	NM_024059.2	NP_076964.1	Q9BVV2	CT195_HUMAN	chromosome 20 open reading frame 195	213	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					extracellular vesicular exosome (GO:0070062)		p.D213>?(1)		large_intestine(3)|lung(4)	7	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			TGTCGTGTTTGACCGAAAGGC	0.622																																																	1	Complex(1)	large_intestine(1)											101.0	105.0	104.0					20																	62187653		2203	4300	6503	SO:0001583	missense	79025				CCDS13526.1	20q13.33	2014-02-12			ENSG00000125531	ENSG00000125531			28764	protein-coding gene	gene with protein product						12477932	Standard	NM_024059		Approved	MGC5356	uc002yfj.3	Q9BVV2	OTTHUMG00000032980	ENST00000370098.3:c.637G>C	20.37:g.62187653G>C	ENSP00000359116:p.Asp213His			Missense_Mutation	SNP	superfamily_Fibronectin_type3	p.D213H	ENST00000370098.3	37	c.637	CCDS13526.1	20	.	.	.	.	.	.	.	.	.	.	G	16.71	3.198114	0.58126	.	.	ENSG00000125531	ENST00000370098;ENST00000370097	.	.	.	5.47	5.47	0.80525	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000030	T	0.68311	0.2987	L	0.29908	0.895	0.45250	D	0.998255	D	0.89917	1.0	D	0.97110	1.0	T	0.71663	-0.4525	9	0.87932	D	0	-28.1173	19.3082	0.94173	0.0:0.0:1.0:0.0	.	213	Q9BVV2	CT195_HUMAN	H	213	.	ENSP00000359115:D213H	D	+	1	0	C20orf195	61658097	1.000000	0.71417	0.992000	0.48379	0.343000	0.28985	5.313000	0.65798	2.573000	0.86826	0.655000	0.94253	GAC	C20orf195	-	superfamily_Fibronectin_type3		0.622	C20orf195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf195	HGNC	protein_coding	OTTHUMT00000080155.1	G	NM_024059		62187653	+1	no_errors	ENST00000370097	ensembl	human	known	70_37	missense	SNP	1.000	C
ZGRF1	55345	genome.wustl.edu	37	4	113538928	113538928	+	Frame_Shift_Del	DEL	T	T	-			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr4:113538928delT	ENST00000505019.1	-	6	2395	c.2270delA	c.(2269-2271)aatfs	p.N757fs	C4orf21_ENST00000309071.5_Frame_Shift_Del_p.N757fs|C4orf21_ENST00000445203.2_Frame_Shift_Del_p.N726fs	NM_018392.4	NP_060862.3	Q86YA3	ZGRF1_HUMAN		757						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(6)|lung(21)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		AATGTGGGTATTTGATTTATC	0.348																																																	0													89.0	93.0	92.0					4																	113538928		2203	4300	6503	SO:0001589	frameshift_variant	55345																														ENST00000505019.1:c.2270delA	4.37:g.113538928delT	ENSP00000424737:p.Asn757fs		B3KQX2|B4DSN6|B4DYU8|E9PDE1|G5EA02|Q6ZU11|Q9NSW3|Q9NUJ4	Frame_Shift_Del	DEL	pfam_DUF2439,pfam_Znf_GRF	p.N757fs	ENST00000505019.1	37	c.2270		4																																																																																			C4orf21	-	NULL		0.348	C4orf21-003	KNOWN	basic|appris_principal	protein_coding	C4orf21	HGNC	protein_coding	OTTHUMT00000256413.1	T			113538928	-1	no_errors	ENST00000505019	ensembl	human	known	70_37	frame_shift_del	DEL	0.000	-
CABYR	26256	genome.wustl.edu	37	18	21723170	21723170	+	Nonsense_Mutation	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr18:21723170C>G	ENST00000399496.3	+	2	257	c.92C>G	c.(91-93)tCa>tGa	p.S31*	CABYR_ENST00000581397.1_Nonsense_Mutation_p.S31*|CABYR_ENST00000399481.2_Intron|CABYR_ENST00000415309.2_Nonsense_Mutation_p.S31*|CABYR_ENST00000327201.6_Intron|CABYR_ENST00000399499.1_Nonsense_Mutation_p.S31*	NM_012189.2|NM_153769.1	NP_036321.2|NP_722453.1	O75952	CABYR_HUMAN	calcium binding tyrosine-(Y)-phosphorylation regulated	31	RIIa.				epithelial cilium movement (GO:0003351)|sperm capacitation (GO:0048240)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|motile cilium (GO:0031514)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|protein heterodimerization activity (GO:0046982)|SH3 domain binding (GO:0017124)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)	11	all_cancers(21;9.13e-05)|all_epithelial(16;5.49e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0305)|Ovarian(20;0.17)					ACCAACCCATCAAACATCAAC	0.388																																																	0													105.0	100.0	102.0					18																	21723170		2203	4300	6503	SO:0001587	stop_gained	26256			AF088868	CCDS11881.1, CCDS11882.1, CCDS11883.1, CCDS42420.1, CCDS45840.1	18q11.2	2009-08-06	2007-11-22		ENSG00000154040	ENSG00000154040			15569	protein-coding gene	gene with protein product	"""fibrousheathin 2"", ""cancer/testis antigen 88"""	612135				11820818, 17317841, 16139264	Standard	NM_012189		Approved	FSP-2, CBP86, CT88	uc002kux.3	O75952	OTTHUMG00000037365	ENST00000399496.3:c.92C>G	18.37:g.21723170C>G	ENSP00000382419:p.Ser31*		B2R857|Q8WXW5|Q9HAY3|Q9HAY4|Q9HAY5|Q9HCY9	Nonsense_Mutation	SNP	pfam_cAMP_dep_PK_reg_su_I/II_a/b,superfamily_cAMP_dep_PK_reg_su_I/II_a/b,smart_cAMP_dep_PK_reg_su_I/II_a/b	p.S31*	ENST00000399496.3	37	c.92	CCDS42420.1	18	.	.	.	.	.	.	.	.	.	.	C	12.74	2.027528	0.35797	.	.	ENSG00000154040	ENST00000399496;ENST00000415309;ENST00000399499	.	.	.	5.59	3.72	0.42706	.	1.228020	0.05638	N	0.582895	.	.	.	.	.	.	0.20821	N	0.999846	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	0.669	9.824	0.40901	0.2764:0.5898:0.1338:0.0	.	.	.	.	X	31	.	ENSP00000382419:S31X	S	+	2	0	CABYR	19977168	0.001000	0.12720	0.843000	0.33291	0.003000	0.03518	0.222000	0.17699	1.319000	0.45190	0.655000	0.94253	TCA	CABYR	-	pfam_cAMP_dep_PK_reg_su_I/II_a/b,superfamily_cAMP_dep_PK_reg_su_I/II_a/b,smart_cAMP_dep_PK_reg_su_I/II_a/b		0.388	CABYR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CABYR	HGNC	protein_coding	OTTHUMT00000090926.2	C	NM_153770		21723170	+1	no_errors	ENST00000463087	ensembl	human	known	70_37	nonsense	SNP	0.258	G
CAMTA1	23261	genome.wustl.edu	37	1	7309668	7309668	+	Silent	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:7309668C>G	ENST00000303635.7	+	5	627	c.420C>G	c.(418-420)ctC>ctG	p.L140L	CAMTA1_ENST00000439411.2_Silent_p.L140L	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	140					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		ACATGAAACTCAAGGTCCAGG	0.443			T	WWTR1	epitheliod hemangioendothelioma																																			Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	0													107.0	96.0	100.0					1																	7309668		2203	4300	6503	SO:0001819	synonymous_variant	23261			AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.420C>G	1.37:g.7309668C>G			A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Silent	SNP	pfam_CG-1_dom,pfam_IPT_TIG_rcpt,pfam_IQ_motif_EF-hand-BS,superfamily_Ig_E-set,superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS	p.L140	ENST00000303635.7	37	c.420	CCDS30576.1	1																																																																																			CAMTA1	-	pfam_CG-1_dom		0.443	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMTA1	HGNC	protein_coding	OTTHUMT00000003588.3	C	NM_015215		7309668	+1	no_errors	ENST00000303635	ensembl	human	known	70_37	silent	SNP	1.000	G
CARD9	64170	genome.wustl.edu	37	9	139264763	139264763	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr9:139264763C>T	ENST00000371732.5	-	6	1099	c.934G>A	c.(934-936)Gag>Aag	p.E312K	CARD9_ENST00000371734.3_Missense_Mutation_p.E312K|CARD9_ENST00000315908.7_Missense_Mutation_p.E312K|CARD9_ENST00000460290.1_5'Flank	NM_052813.4	NP_434700.2	Q9H257	CARD9_HUMAN	caspase recruitment domain family, member 9	312					defense response to Gram-positive bacterium (GO:0050830)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of apoptotic process (GO:0042981)|regulation of interleukin-2 biosynthetic process (GO:0045076)|regulation of interleukin-6 biosynthetic process (GO:0045408)|regulation of tumor necrosis factor biosynthetic process (GO:0042534)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to fungus (GO:0009620)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)	cytoplasm (GO:0005737)	CARD domain binding (GO:0050700)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)|prostate(3)|skin(1)	15		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;4.58e-06)|Epithelial(140;5.65e-06)		CGTCGGGCCTCGCCCTGGCGG	0.701																																																	0													26.0	31.0	29.0					9																	139264763		2189	4295	6484	SO:0001583	missense	64170			AF311287	CCDS6997.1, CCDS48057.1	9q34	2014-09-17			ENSG00000187796	ENSG00000187796			16391	protein-coding gene	gene with protein product		607212				11053425	Standard	NM_052813		Approved		uc004chg.3	Q9H257	OTTHUMG00000020925	ENST00000371732.5:c.934G>A	9.37:g.139264763C>T	ENSP00000360797:p.Glu312Lys		Q5SXM5|Q5SXM6|Q9H854	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like,pfscan_CARD	p.E312K	ENST00000371732.5	37	c.934	CCDS6997.1	9	.	.	.	.	.	.	.	.	.	.	C	19.75	3.885268	0.72410	.	.	ENSG00000187796	ENST00000371734;ENST00000371732;ENST00000315908	T;T;T	0.37235	1.21;1.21;1.21	4.11	4.11	0.48088	.	0.064020	0.64402	D	0.000012	T	0.37517	0.1006	M	0.76170	2.325	0.80722	D	1	D;P;P	0.55605	0.972;0.859;0.78	B;B;B	0.38954	0.286;0.118;0.055	T	0.47018	-0.9149	10	0.37606	T	0.19	-35.6659	15.0576	0.71927	0.0:1.0:0.0:0.0	.	208;312;312	B4DIK5;Q9H257-2;Q9H257	.;.;CARD9_HUMAN	K	312	ENSP00000360799:E312K;ENSP00000360797:E312K;ENSP00000323719:E312K	ENSP00000323719:E312K	E	-	1	0	CARD9	138384584	0.999000	0.42202	0.872000	0.34217	0.924000	0.55760	4.608000	0.61141	2.124000	0.65301	0.462000	0.41574	GAG	CARD9	-	NULL		0.701	CARD9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD9	HGNC	protein_coding	OTTHUMT00000055053.1	C	NM_052813		139264763	-1	no_errors	ENST00000371732	ensembl	human	known	70_37	missense	SNP	0.999	T
CCDC141	285025	genome.wustl.edu	37	2	179702250	179702250	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr2:179702250C>T	ENST00000420890.2	-	23	3813	c.3696G>A	c.(3694-3696)atG>atA	p.M1232I	CCDC141_ENST00000480419.1_5'UTR|CCDC141_ENST00000295723.5_Missense_Mutation_p.M657I	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	1232										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			CTTCCACCTCCATGTCAGATG	0.572																																																	0													63.0	62.0	62.0					2																	179702250		2203	4300	6503	SO:0001583	missense	285025			AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.3696G>A	2.37:g.179702250C>T	ENSP00000395995:p.Met1232Ile		H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Spectrin_repeat,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.M1232I	ENST00000420890.2	37	c.3696		2	.	.	.	.	.	.	.	.	.	.	C	13.95	2.390300	0.42410	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723	T;T;T	0.47869	0.83;1.41;1.41	5.92	5.05	0.67936	.	0.520028	0.19480	N	0.113239	T	0.36082	0.0954	L	0.53249	1.67	0.30154	N	0.802772	B;P	0.38078	0.418;0.617	B;B	0.30029	0.075;0.11	T	0.51764	-0.8664	10	0.66056	D	0.02	-4.4643	4.9504	0.14011	0.0:0.5867:0.1545:0.2588	.	657;657	Q6ZP82;Q6ZP82-2	CC141_HUMAN;.	I	1232;676;657	ENSP00000395995:M1232I;ENSP00000344627:M676I;ENSP00000295723:M657I	ENSP00000295723:M657I	M	-	3	0	CCDC141	179410495	0.998000	0.40836	1.000000	0.80357	0.966000	0.64601	0.270000	0.18607	1.504000	0.48704	0.650000	0.86243	ATG	CCDC141	-	NULL		0.572	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	CCDC141	HGNC	protein_coding		C	NM_173648		179702250	-1	no_errors	ENST00000420890	ensembl	human	known	70_37	missense	SNP	1.000	T
CCDC40	55036	genome.wustl.edu	37	17	78055562	78055562	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr17:78055562G>C	ENST00000397545.4	+	11	1807	c.1780G>C	c.(1780-1782)Gag>Cag	p.E594Q	CCDC40_ENST00000374877.3_Missense_Mutation_p.E594Q	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	594					axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			GCAGGACACAGAGGATGCCCT	0.652																																																	0													30.0	33.0	32.0					17																	78055562		2088	4207	6295	SO:0001583	missense	55036			AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.1780G>C	17.37:g.78055562G>C	ENSP00000380679:p.Glu594Gln		A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Missense_Mutation	SNP	pfam_E3_ubiquit_lig_BRE1	p.E594Q	ENST00000397545.4	37	c.1780	CCDS42395.1	17	.	.	.	.	.	.	.	.	.	.	G	12.91	2.080097	0.36662	.	.	ENSG00000141519	ENST00000374877;ENST00000397545	T;T	0.57752	0.38;0.38	5.25	5.25	0.73442	.	.	.	.	.	T	0.63510	0.2517	L	0.53249	1.67	0.34390	D	0.694051	D;D	0.71674	0.993;0.998	P;P	0.58820	0.803;0.846	T	0.69895	-0.5021	9	0.32370	T	0.25	-32.9267	15.9389	0.79739	0.0:0.135:0.865:0.0	.	594;377	Q4G0X9;Q4G0X9-3	CCD40_HUMAN;.	Q	594	ENSP00000364011:E594Q;ENSP00000380679:E594Q	ENSP00000364011:E594Q	E	+	1	0	CCDC40	75670157	1.000000	0.71417	0.116000	0.21606	0.005000	0.04900	5.373000	0.66162	2.426000	0.82243	0.655000	0.94253	GAG	CCDC40	-	NULL		0.652	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC40	HGNC	protein_coding	OTTHUMT00000256005.2	G	XM_371082		78055562	+1	no_errors	ENST00000397545	ensembl	human	known	70_37	missense	SNP	0.739	C
CCKAR	886	genome.wustl.edu	37	4	26491813	26491813	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr4:26491813G>A	ENST00000295589.3	-	1	271	c.77C>T	c.(76-78)aCg>aTg	p.T26M		NM_000730.2	NP_000721.1	P32238	CCKAR_HUMAN	cholecystokinin A receptor	26					axonogenesis (GO:0007409)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|feeding behavior (GO:0007631)|forebrain development (GO:0030900)|neuron migration (GO:0001764)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|response to nutrient (GO:0007584)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cholecystokinin receptor activity (GO:0004951)			NS(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|pancreas(1)|skin(1)	29		Breast(46;0.0503)			Ceruletide(DB00403)	GCAGAAAAGCGTCTCATTTTC	0.478																																																	0													117.0	98.0	105.0					4																	26491813		2203	4300	6503	SO:0001583	missense	886			L19315	CCDS3438.1	4p15.2	2013-09-20			ENSG00000163394	ENSG00000163394		"""GPCR / Class A : Cholecystokinin receptors"""	1570	protein-coding gene	gene with protein product		118444					Standard	NM_000730		Approved		uc003gse.1	P32238	OTTHUMG00000128567	ENST00000295589.3:c.77C>T	4.37:g.26491813G>A	ENSP00000295589:p.Thr26Met		B2R9Z5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_CholecystokininA_recpt_N,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Cholcy_rcpt_A,prints_Cholcskin_rcpt,prints_GPCR_Rhodpsn,prints_Gastrin_rcpt,prints_NPY_rcpt	p.T26M	ENST00000295589.3	37	c.77	CCDS3438.1	4	.	.	.	.	.	.	.	.	.	.	G	19.86	3.905855	0.72868	.	.	ENSG00000163394	ENST00000295589	T	0.40476	1.03	5.27	5.27	0.74061	Cholecystokinin A receptor, N-terminal (2);	0.083505	0.50627	D	0.000118	T	0.61924	0.2386	M	0.65975	2.015	0.43207	D	0.995065	D	0.89917	1.0	D	0.68765	0.96	T	0.62483	-0.6845	10	0.49607	T	0.09	.	16.0815	0.81007	0.0:0.0:1.0:0.0	.	26	P32238	CCKAR_HUMAN	M	26	ENSP00000295589:T26M	ENSP00000295589:T26M	T	-	2	0	CCKAR	26100911	1.000000	0.71417	0.958000	0.39756	0.970000	0.65996	5.851000	0.69481	2.477000	0.83638	0.655000	0.94253	ACG	CCKAR	-	pfam_CholecystokininA_recpt_N,prints_Cholcy_rcpt_A		0.478	CCKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCKAR	HGNC	protein_coding	OTTHUMT00000250418.2	G			26491813	-1	no_errors	ENST00000295589	ensembl	human	known	70_37	missense	SNP	0.995	A
CCT6P1	643253	genome.wustl.edu	37	7	65224225	65224225	+	RNA	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr7:65224225G>A	ENST00000442266.1	+	0	862				SNORA15_ENST00000384058.1_RNA					chaperonin containing TCP1, subunit 6 (zeta) pseudogene 1																		CTGACTGCTTGAGACATGCAG	0.378																																																	0																																												643253			BC052238, BC073761		7q11.21	2010-06-29	2008-09-22	2008-09-22	ENSG00000228409	ENSG00000228409			33094	pseudogene	pseudogene			"""chaperonin containing TCP1, subunit 6A (zeta 1) pseudogene 1"""	CCT6AP1			Standard	NR_003110		Approved		uc003tug.3		OTTHUMG00000156733		7.37:g.65224225G>A				RNA	SNP	-	NULL	ENST00000442266.1	37	NULL		7																																																																																			CCT6P1	-	-		0.378	CCT6P1-003	KNOWN	basic	processed_transcript	CCT6P1	HGNC	pseudogene	OTTHUMT00000345507.1	G	NR_003110		65224225	+1	no_errors	ENST00000442266	ensembl	human	known	70_37	rna	SNP	1.000	A
CELSR1	9620	genome.wustl.edu	37	22	46931242	46931242	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr22:46931242G>T	ENST00000262738.3	-	1	1825	c.1826C>A	c.(1825-1827)tCc>tAc	p.S609Y	CELSR1_ENST00000395964.1_Missense_Mutation_p.S609Y|CELSR1_ENST00000497509.1_5'Flank	NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	609	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CAGAAAGGTGGAGGCCGTGTC	0.642																																																	0													25.0	27.0	26.0					22																	46931242		2202	4299	6501	SO:0001583	missense	9620			AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.1826C>A	22.37:g.46931242G>T	ENSP00000262738:p.Ser609Tyr		O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.S609Y	ENST00000262738.3	37	c.1826	CCDS14076.1	22	.	.	.	.	.	.	.	.	.	.	G	9.026	0.986007	0.18889	.	.	ENSG00000075275	ENST00000262738;ENST00000395964	T;T	0.54479	0.57;0.57	4.92	3.9	0.45041	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.51568	0.1682	L	0.49126	1.545	0.09310	N	1	P	0.47034	0.889	P	0.46543	0.52	T	0.41998	-0.9477	9	0.56958	D	0.05	.	9.3266	0.37997	0.0:0.1777:0.6739:0.1485	.	609	Q9NYQ6	CELR1_HUMAN	Y	609	ENSP00000262738:S609Y;ENSP00000379293:S609Y	ENSP00000262738:S609Y	S	-	2	0	CELSR1	45309906	0.500000	0.26091	0.002000	0.10522	0.144000	0.21451	3.879000	0.56138	1.055000	0.40461	0.462000	0.41574	TCC	CELSR1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.642	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR1	HGNC	protein_coding	OTTHUMT00000318037.1	G	NM_014246		46931242	-1	no_errors	ENST00000262738	ensembl	human	known	70_37	missense	SNP	0.112	T
C19orf44	84167	genome.wustl.edu	37	19	16631642	16631642	+	3'UTR	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr19:16631642C>T	ENST00000221671.3	+	0	2908				CHERP_ENST00000198939.6_Silent_p.R743R|CHERP_ENST00000544299.1_5'UTR|CTD-3222D19.2_ENST00000409035.1_Intron|CHERP_ENST00000546361.2_Silent_p.R732R	NM_032207.2	NP_115583.1	Q9H6X5	CS044_HUMAN	chromosome 19 open reading frame 44											endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	16						TTTACCTGTTCCTCTTCTCCT	0.592																																																	0													85.0	96.0	92.0					19																	16631642		1998	4160	6158	SO:0001624	3_prime_UTR_variant	10523			AK025395	CCDS12345.1, CCDS74306.1	19p13.11	2011-11-24			ENSG00000105072	ENSG00000105072			26141	protein-coding gene	gene with protein product						12477932	Standard	NM_032207		Approved	FLJ21742	uc002neh.1	Q9H6X5		ENST00000221671.3:c.*778C>T	19.37:g.16631642C>T			Q8N6Y7	Silent	SNP	pfam_Surp,pfam_G_patch_dom,pfam_RNA_pol_II-bd,superfamily_Surp,superfamily_ENTH_VHS,smart_Surp,smart_G_patch_dom,pfscan_Surp,pfscan_G_patch_dom	p.R732	ENST00000221671.3	37	c.2196	CCDS12345.1	19																																																																																			CHERP	-	NULL		0.592	C19orf44-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHERP	HGNC	protein_coding	OTTHUMT00000461218.1	C	NM_032207		16631642	-1	no_errors	ENST00000546361	ensembl	human	known	70_37	silent	SNP	1.000	T
CHKB	1120	genome.wustl.edu	37	22	51019907	51019907	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr22:51019907G>C	ENST00000406938.2	-	4	740	c.523C>G	c.(523-525)Cat>Gat	p.H175D	CHKB-AS1_ENST00000380711.3_RNA|CHKB_ENST00000463053.1_5'UTR|CPT1B_ENST00000360719.2_5'Flank|CHKB-CPT1B_ENST00000453634.1_5'Flank|CPT1B_ENST00000440709.1_5'Flank|CPT1B_ENST00000434492.2_5'Flank|CHKB-CPT1B_ENST00000452668.1_5'Flank|CPT1B_ENST00000457250.1_5'Flank	NM_005198.4	NP_005189.2	Q9Y259	CHKB_HUMAN	choline kinase beta	175					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|choline kinase activity (GO:0004103)|ethanolamine kinase activity (GO:0004305)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|ovary(3)|skin(1)|urinary_tract(1)	15		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;4.04e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.79e-74)|Epithelial(4;6.17e-70)|GBM - Glioblastoma multiforme(4;5.68e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.205)	Choline(DB00122)	TCCATGCCATGAAATTGCGCC	0.567																																																	0													64.0	54.0	57.0					22																	51019907		2203	4300	6503	SO:0001583	missense	1120			AB029886	CCDS14099.1	22q13.33	2011-02-16	2004-04-19	2004-04-19	ENSG00000100288	ENSG00000100288			1938	protein-coding gene	gene with protein product		612395	"""choline kinase-like"""	CHKL		9224698, 15003397	Standard	NM_005198		Approved	CHETK	uc003bmv.3	Q9Y259	OTTHUMG00000150275	ENST00000406938.2:c.523C>G	22.37:g.51019907G>C	ENSP00000384400:p.His175Asp		A0PJM6|Q13388	Missense_Mutation	SNP	pfam_Aminoglycoside_PTrfase,pfam_DUF227,superfamily_Kinase-like_dom	p.H175D	ENST00000406938.2	37	c.523	CCDS14099.1	22	.	.	.	.	.	.	.	.	.	.	G	28.2	4.902243	0.92035	.	.	ENSG00000100288	ENST00000406938	T	0.81247	-1.47	4.94	4.94	0.65067	Protein kinase-like domain (1);Choline/ethanolamine kinase (1);	0.000000	0.85682	D	0.000000	D	0.93058	0.7790	H	0.97158	3.95	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95082	0.8214	10	0.87932	D	0	-12.3199	15.6847	0.77400	0.0:0.0:1.0:0.0	.	175	Q9Y259	CHKB_HUMAN	D	175	ENSP00000384400:H175D	ENSP00000384400:H175D	H	-	1	0	CHKB	49366773	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	9.293000	0.96082	2.552000	0.86080	0.561000	0.74099	CAT	CHKB	-	pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom		0.567	CHKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHKB	HGNC	protein_coding	OTTHUMT00000317267.3	G	NM_005198		51019907	-1	no_errors	ENST00000406938	ensembl	human	known	70_37	missense	SNP	1.000	C
CIDEC	63924	genome.wustl.edu	37	3	9911955	9911955	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr3:9911955C>T	ENST00000336832.2	-	4	398	c.259G>A	c.(259-261)Gaa>Aaa	p.E87K	CIDEC_ENST00000430427.1_Missense_Mutation_p.E97K|CIDEC_ENST00000383817.1_Intron|CIDEC_ENST00000455015.1_Missense_Mutation_p.E13K|CIDEC_ENST00000443115.1_Intron|CIDEC_ENST00000423850.1_Missense_Mutation_p.E13K	NM_001199552.1|NM_001199623.1|NM_022094.3	NP_001186481.1|NP_001186552.1|NP_071377.2	Q96AQ7	CIDEC_HUMAN	cell death-inducing DFFA-like effector c	87	CIDE-N. {ECO:0000255|PROSITE- ProRule:PRU00447}.				apoptotic process (GO:0006915)|execution phase of apoptosis (GO:0097194)|lipid particle organization (GO:0034389)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|lipid particle (GO:0005811)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(1)|lung(2)|ovary(1)|skin(1)	8	Medulloblastoma(99;0.227)					GTGCCATCTTCCTCCAGCACC	0.557																																																	0													66.0	65.0	65.0					3																	9911955		2203	4300	6503	SO:0001583	missense	63924				CCDS2587.1, CCDS56239.1, CCDS74897.1	3p25	2004-07-26			ENSG00000187288	ENSG00000187288			24229	protein-coding gene	gene with protein product		612120				12429024	Standard	NM_001199623		Approved	CIDE-3, FLJ20871, Fsp27	uc021wsw.1	Q96AQ7	OTTHUMG00000128522	ENST00000336832.2:c.259G>A	3.37:g.9911955C>T	ENSP00000338642:p.Glu87Lys		C9JMN7|Q67DW9|Q9GZY9	Missense_Mutation	SNP	pfam_CAD,smart_CAD,pfscan_CAD	p.E87K	ENST00000336832.2	37	c.259	CCDS2587.1	3	.	.	.	.	.	.	.	.	.	.	C	28.3	4.904194	0.92035	.	.	ENSG00000187288	ENST00000336832;ENST00000455015;ENST00000423850;ENST00000430427	T;T;T;T	0.51325	0.71;0.71;0.71;0.71	6.07	4.31	0.51392	Caspase-activated nuclease CIDE-N (3);	0.047005	0.85682	N	0.000000	T	0.72011	0.3408	M	0.89715	3.055	0.80722	D	1	B;D	0.89917	0.142;1.0	B;D	0.97110	0.214;1.0	T	0.76069	-0.3094	10	0.72032	D	0.01	-11.1065	11.0138	0.47677	0.0:0.8499:0.0:0.1501	.	87;97	Q96AQ7;C9JMN7	CIDEC_HUMAN;.	K	87;13;13;97	ENSP00000338642:E87K;ENSP00000392975:E13K;ENSP00000400649:E13K;ENSP00000408631:E97K	ENSP00000338642:E87K	E	-	1	0	CIDEC	9886955	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.523000	0.60545	0.917000	0.36895	0.655000	0.94253	GAA	CIDEC	-	pfam_CAD,smart_CAD,pfscan_CAD		0.557	CIDEC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CIDEC	HGNC	protein_coding	OTTHUMT00000250334.1	C	NM_022094		9911955	-1	no_errors	ENST00000336832	ensembl	human	known	70_37	missense	SNP	1.000	T
CIZ1	25792	genome.wustl.edu	37	9	130950164	130950164	+	Silent	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr9:130950164G>C	ENST00000393608.1	-	4	538	c.336C>G	c.(334-336)ctC>ctG	p.L112L	CIZ1_ENST00000325721.8_Intron|CIZ1_ENST00000372938.5_Silent_p.L112L|CIZ1_ENST00000357558.5_Silent_p.L112L|CIZ1_ENST00000372948.3_Silent_p.L112L|CIZ1_ENST00000372954.1_Intron|CIZ1_ENST00000541172.1_Silent_p.L11L|CIZ1_ENST00000277465.4_Silent_p.L112L|CIZ1_ENST00000476727.2_5'UTR|CIZ1_ENST00000538431.1_Silent_p.L112L	NM_012127.2	NP_036259.2	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1	112					maintenance of protein location in nucleus (GO:0051457)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|liver(1)|lung(9)|ovary(3)|prostate(2)|urinary_tract(2)	35						tgggcatggtgagaccggcag	0.383																																																	0													105.0	93.0	97.0					9																	130950164		2203	4300	6503	SO:0001819	synonymous_variant	25792			AB030835	CCDS6894.1, CCDS48033.1, CCDS48034.1, CCDS75910.1	9q34.1	2012-10-05			ENSG00000148337	ENSG00000148337			16744	protein-coding gene	gene with protein product		611420				10529385	Standard	NM_001131015		Approved	LSFR1, ZNF356	uc011mas.2	Q9ULV3	OTTHUMG00000020735	ENST00000393608.1:c.336C>G	9.37:g.130950164G>C			A8K9J8|B4E131|B7ZAS8|Q5SYW3|Q5SYW5|Q8WU72|Q9H868|Q9NYM8|Q9UHK4|Q9Y3F9|Q9Y3G0	Silent	SNP	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like,pfscan_Znf_C2H2_matrin	p.L112	ENST00000393608.1	37	c.336	CCDS6894.1	9																																																																																			CIZ1	-	NULL		0.383	CIZ1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CIZ1	HGNC	protein_coding	OTTHUMT00000054399.1	G	NM_012127		130950164	-1	no_errors	ENST00000538431	ensembl	human	known	70_37	silent	SNP	1.000	C
CLIC5	53405	genome.wustl.edu	37	6	46047621	46047621	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr6:46047621C>T	ENST00000185206.6	-	1	511	c.359G>A	c.(358-360)tGc>tAc	p.C120Y		NM_001114086.1	NP_001107558.1	Q9NZA1	CLIC5_HUMAN	chloride intracellular channel 5	120					auditory receptor cell stereocilium organization (GO:0060088)|chloride transport (GO:0006821)|diet induced thermogenesis (GO:0002024)|female pregnancy (GO:0007565)|neuromuscular process controlling balance (GO:0050885)|protein localization (GO:0008104)|sensory perception of sound (GO:0007605)|transport (GO:0006810)	actin cytoskeleton (GO:0015629)|chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|stereocilium (GO:0032420)	voltage-gated chloride channel activity (GO:0005247)			endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	13						TTCTGCTGCGCAGAGTTGCTG	0.517																																																	0													61.0	58.0	59.0					6																	46047621		692	1591	2283	SO:0001583	missense	53405			AF216941	CCDS4914.1, CCDS47438.1, CCDS59022.1	6p12.3	2014-03-14			ENSG00000112782	ENSG00000112782		"""Ion channels / Chloride channels : Intracellular"""	13517	protein-coding gene	gene with protein product		607293				10793131	Standard	NM_001114086		Approved		uc003oxv.3	Q9NZA1	OTTHUMG00000014775	ENST00000185206.6:c.359G>A	6.37:g.46047621C>T	ENSP00000185206:p.Cys120Tyr		B3KUF1|Q5T4Z0|Q8NBY3|Q96JT5|Q9BWZ0	Missense_Mutation	SNP	superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,prints_Int_Cl_channel,tigrfam_Int_Cl_channel	p.C120Y	ENST00000185206.6	37	c.359	CCDS47438.1	6	.	.	.	.	.	.	.	.	.	.	C	8.400	0.841641	0.16963	.	.	ENSG00000112782	ENST00000185206	T	0.19532	2.14	4.51	-3.85	0.04243	.	2.518560	0.01469	N	0.016209	T	0.02494	0.0076	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29305	-1.0016	10	0.20046	T	0.44	.	5.8363	0.18609	0.1466:0.2254:0.0:0.628	.	120	Q9NZA1	CLIC5_HUMAN	Y	120	ENSP00000185206:C120Y	ENSP00000185206:C120Y	C	-	2	0	CLIC5	46155580	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-3.805000	0.00362	-0.973000	0.03555	-0.140000	0.14226	TGC	CLIC5	-	NULL		0.517	CLIC5-002	KNOWN	basic|CCDS	protein_coding	CLIC5	HGNC	protein_coding	OTTHUMT00000040761.1	C			46047621	-1	no_errors	ENST00000185206	ensembl	human	known	70_37	missense	SNP	0.000	T
CNGA3	1261	genome.wustl.edu	37	2	99006149	99006149	+	Missense_Mutation	SNP	G	G	A	rs373542579		TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr2:99006149G>A	ENST00000272602.2	+	5	517	c.478G>A	c.(478-480)Gtg>Atg	p.V160M	CNGA3_ENST00000436404.2_Missense_Mutation_p.V142M|CNGA3_ENST00000393504.1_Missense_Mutation_p.V160M|CNGA3_ENST00000409937.1_Missense_Mutation_p.V164M			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	160					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						GGATGCGATCGTGGTGGACCC	0.522																																																	0								G	MET/VAL,MET/VAL	0,4406		0,0,2203	168.0	154.0	158.0		424,478	3.8	0.6	2		158	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CNGA3	NM_001079878.1,NM_001298.2	21,21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	142/677,160/695	99006149	1,13005	2203	4300	6503	SO:0001583	missense	1261			S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.478G>A	2.37:g.99006149G>A	ENSP00000272602:p.Val160Met		E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Missense_Mutation	SNP	pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.V160M	ENST00000272602.2	37	c.478	CCDS2034.1	2	.	.	.	.	.	.	.	.	.	.	G	10.51	1.371141	0.24771	0.0	1.16E-4	ENSG00000144191	ENST00000393504;ENST00000436404;ENST00000272602;ENST00000409937	D;D;D;D	0.98060	-4.6;-4.56;-4.6;-4.69	4.72	3.84	0.44239	.	0.118540	0.56097	N	0.000023	D	0.97225	0.9093	M	0.85859	2.78	0.34968	D	0.752868	P;D;D	0.61080	0.939;0.97;0.989	B;B;P	0.45232	0.393;0.393;0.474	D	0.99289	1.0898	10	0.66056	D	0.02	.	11.8959	0.52656	0.0868:0.0:0.9132:0.0	.	164;142;160	E9PF93;Q4VAP7;Q16281	.;.;CNGA3_HUMAN	M	160;142;160;164	ENSP00000377140:V160M;ENSP00000410070:V142M;ENSP00000272602:V160M;ENSP00000386761:V164M	ENSP00000272602:V160M	V	+	1	0	CNGA3	98372581	1.000000	0.71417	0.625000	0.29200	0.029000	0.11900	3.609000	0.54117	1.207000	0.43291	-0.379000	0.06801	GTG	CNGA3	-	NULL		0.522	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNGA3	HGNC	protein_coding	OTTHUMT00000252986.1	G	NM_001298		99006149	+1	no_errors	ENST00000272602	ensembl	human	known	70_37	missense	SNP	0.893	A
CNTRL	11064	genome.wustl.edu	37	9	123907225	123907225	+	Silent	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr9:123907225G>A	ENST00000373855.1	+	21	3416	c.3156G>A	c.(3154-3156)caG>caA	p.Q1052Q	CNTRL_ENST00000373850.1_Silent_p.Q500Q|CNTRL_ENST00000238341.5_Silent_p.Q1052Q|CNTRL_ENST00000373847.1_Silent_p.Q500Q			Q7Z7A1	CNTRL_HUMAN	centriolin	1052					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						TCCTCAGGCAGAAGGGGGAGC	0.493																																																	0													81.0	83.0	82.0					9																	123907225		2203	4300	6503	SO:0001819	synonymous_variant	11064			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.3156G>A	9.37:g.123907225G>A			A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Silent	SNP	pfam_Leu-rich_rpt,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Leu-rich_rpt_typical-subtyp	p.Q1052	ENST00000373855.1	37	c.3156	CCDS35118.1	9																																																																																			CNTRL	-	NULL		0.493	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTRL	HGNC	protein_coding	OTTHUMT00000250216.1	G	NM_007018		123907225	+1	no_errors	ENST00000238341	ensembl	human	known	70_37	silent	SNP	0.854	A
COL12A1	1303	genome.wustl.edu	37	6	75812365	75812365	+	Missense_Mutation	SNP	T	T	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr6:75812365T>G	ENST00000322507.8	-	56	8672	c.8363A>C	c.(8362-8364)cAg>cCg	p.Q2788P	COL12A1_ENST00000416123.2_Missense_Mutation_p.Q2712P|COL12A1_ENST00000511023.1_5'Flank|COL12A1_ENST00000483888.2_Missense_Mutation_p.Q2788P|COL12A1_ENST00000345356.6_Missense_Mutation_p.Q1624P	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	2788	Collagen-like 1.|Triple-helical region (COL2) with 1 imperfection.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TGGAGGACCCTGGGGGCCTGG	0.498																																																	0													57.0	56.0	56.0					6																	75812365		1822	4084	5906	SO:0001583	missense	1303			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.8363A>C	6.37:g.75812365T>G	ENSP00000325146:p.Gln2788Pro		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.Q2788P	ENST00000322507.8	37	c.8363	CCDS43482.1	6	.	.	.	.	.	.	.	.	.	.	T	15.87	2.961471	0.53400	.	.	ENSG00000111799	ENST00000322507;ENST00000425443;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	D;D;D;D;D	0.95885	-3.84;-3.84;-3.84;-3.84;-3.84	5.29	5.29	0.74685	.	0.122525	0.51477	D	0.000092	D	0.91429	0.7295	N	0.04132	-0.27	0.37985	D	0.93371	D;D	0.76494	0.996;0.999	P;D	0.64506	0.836;0.926	D	0.94111	0.7371	10	0.49607	T	0.09	.	13.8125	0.63273	0.0:0.0:0.0:1.0	.	1624;2788	Q99715-2;Q99715	.;COCA1_HUMAN	P	2788;426;2712;1624;2712;2788	ENSP00000325146:Q2788P;ENSP00000399812:Q426P;ENSP00000305147:Q1624P;ENSP00000412864:Q2712P;ENSP00000421216:Q2788P	ENSP00000325146:Q2788P	Q	-	2	0	COL12A1	75869085	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.584000	0.46102	1.997000	0.58415	0.482000	0.46254	CAG	COL12A1	-	pfam_Collagen		0.498	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	T	NM_004370		75812365	-1	no_errors	ENST00000322507	ensembl	human	known	70_37	missense	SNP	1.000	G
CROCCP2	84809	genome.wustl.edu	37	1	16945294	16945294	+	lincRNA	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:16945294C>T	ENST00000412962.1	-	0	2225				RP5-1182A14.5_ENST00000607700.1_lincRNA			Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											GTGAGAGGTTCCGAGGCACAA	0.453																																																	0																																												84809			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16945294C>T			Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-		0.453	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	C	NR_026752.1		16945294	-1	no_errors	ENST00000412962	ensembl	human	known	70_37	rna	SNP	0.136	T
CTSG	1511	genome.wustl.edu	37	14	25044601	25044601	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr14:25044601G>A	ENST00000216336.2	-	2	109	c.73C>T	c.(73-75)Cgg>Tgg	p.R25W		NM_001911.2	NP_001902.1	P08311	CATG_HUMAN	cathepsin G	25	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|defense response to fungus (GO:0050832)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|negative regulation of growth of symbiont in host (GO:0044130)|neutrophil mediated killing of gram-positive bacterium (GO:0070946)|positive regulation of immune response (GO:0050778)|proteolysis (GO:0006508)|response to lipopolysaccharide (GO:0032496)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	heparin binding (GO:0008201)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)|urinary_tract(1)	25				GBM - Glioblastoma multiforme(265;0.0269)		CTGCTCTCCCGGCCTCCGATG	0.572																																																	0													99.0	102.0	101.0					14																	25044601		2203	4300	6503	SO:0001583	missense	1511			M16117	CCDS9631.1	14q12	2013-02-25			ENSG00000100448	ENSG00000100448		"""Cathepsins"", ""Endogenous ligands"""	2532	protein-coding gene	gene with protein product		116830				2569462	Standard	NM_001911		Approved	CG	uc001wpq.3	P08311	OTTHUMG00000140182	ENST00000216336.2:c.73C>T	14.37:g.25044601G>A	ENSP00000216336:p.Arg25Trp		Q6IBJ6|Q9UCA5|Q9UCU6	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.R25W	ENST00000216336.2	37	c.73	CCDS9631.1	14	.	.	.	.	.	.	.	.	.	.	G	17.60	3.429663	0.62844	.	.	ENSG00000100448	ENST00000216336	D	0.89552	-2.53	5.38	4.43	0.53597	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	1.439540	0.04960	N	0.461848	D	0.90642	0.7065	L	0.28400	0.85	0.23923	N	0.996451	D	0.60575	0.988	P	0.61722	0.893	T	0.80641	-0.1292	10	0.66056	D	0.02	.	10.8868	0.46972	0.0:0.0:0.8127:0.1873	.	25	P08311	CATG_HUMAN	W	25	ENSP00000216336:R25W	ENSP00000216336:R25W	R	-	1	2	CTSG	24114441	0.253000	0.23982	0.956000	0.39512	0.444000	0.32077	0.550000	0.23345	2.687000	0.91594	0.655000	0.94253	CGG	CTSG	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6		0.572	CTSG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSG	HGNC	protein_coding	OTTHUMT00000276536.2	G	NM_001911		25044601	-1	no_errors	ENST00000216336	ensembl	human	known	70_37	missense	SNP	0.934	A
CYP21A2	1589	genome.wustl.edu	37	6	32008517	32008517	+	Silent	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr6:32008517G>A	ENST00000418967.2	+	9	1349	c.1191G>A	c.(1189-1191)acG>acA	p.T397T	CYP21A2_ENST00000435122.2_Silent_p.T367T	NM_000500.7	NP_000491.4	P08686	CP21A_HUMAN	cytochrome P450, family 21, subfamily A, polypeptide 2	396					glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 21-monooxygenase activity (GO:0004509)|steroid binding (GO:0005496)|steroid hydroxylase activity (GO:0008395)			NS(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	11					Ketoconazole(DB01026)	TGGATGAGACGGTCTGGGAGA	0.642																																					Melanoma(174;1669 1998 3915 34700 46447)												0													9.0	12.0	10.0					6																	32008517		1362	2486	3848	SO:0001819	synonymous_variant	1589			X58906	CCDS4735.1, CCDS47406.1	6p21.3	2014-09-17	2003-01-14		ENSG00000231852	ENSG00000231852	1.14.99.10	"""Cytochrome P450s"""	2600	protein-coding gene	gene with protein product	"""Steroid 21-monooxygenase"""	613815	"""cytochrome P450, subfamily XXIA (steroid 21-hydroxylase, congenital adrenal hyperplasia), polypeptide 2"""	CYP21, CYP21B			Standard	NM_000500		Approved	P450c21B, CA21H, CPS1, CAH1	uc021yvd.1	P08686	OTTHUMG00000031069	ENST00000418967.2:c.1191G>A	6.37:g.32008517G>A			A2BHY6|P04033|Q01204|Q08AG8|Q16749|Q16806|Q5ST44|Q96NU8	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.T397	ENST00000418967.2	37	c.1191	CCDS4735.1	6																																																																																			CYP21A2	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_B		0.642	CYP21A2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP21A2	HGNC	protein_coding	OTTHUMT00000268768.2	G	NM_000500		32008517	+1	no_errors	ENST00000418967	ensembl	human	known	70_37	silent	SNP	0.000	A
CUL9	23113	genome.wustl.edu	37	6	43153970	43153970	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr6:43153970C>T	ENST00000252050.4	+	4	1112	c.1028C>T	c.(1027-1029)tCa>tTa	p.S343L	CUL9_ENST00000372647.2_Missense_Mutation_p.S343L|CUL9_ENST00000354495.3_Missense_Mutation_p.S343L	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	343					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						CCCTACATTTCAGGCCCCAGC	0.602																																																	0													92.0	93.0	92.0					6																	43153970		2203	4300	6503	SO:0001583	missense	23113			AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.1028C>T	6.37:g.43153970C>T	ENSP00000252050:p.Ser343Leu		O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	pfam_Cullin_N,pfam_CPH_domain,pfam_Znf_C6HC,pfam_APC_su10/DOC_dom,superfamily_Galactose-bd-like,superfamily_Cullin_homology,superfamily_ARM-type_fold,superfamily_UBA-like,smart_Cullin_neddylation_domain,smart_Znf_C6HC,pfscan_Znf_RING,pfscan_Cullin_homology	p.S343L	ENST00000252050.4	37	c.1028	CCDS4890.1	6	.	.	.	.	.	.	.	.	.	.	C	14.28	2.488419	0.44249	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.74947	-0.89;-0.89;-0.79	5.5	4.62	0.57501	.	0.523860	0.21539	N	0.072936	T	0.56934	0.2019	L	0.47716	1.5	0.09310	N	1	B;B;P	0.48998	0.146;0.146;0.918	B;B;B	0.41236	0.038;0.038;0.351	T	0.58521	-0.7622	10	0.72032	D	0.01	-5.8674	13.7075	0.62648	0.0:0.9259:0.0:0.0741	.	343;343;343	E9PEZ1;Q8IWT3;Q05C85	.;CUL9_HUMAN;.	L	343	ENSP00000252050:S343L;ENSP00000346490:S343L;ENSP00000361730:S343L	ENSP00000252050:S343L	S	+	2	0	CUL9	43261948	0.259000	0.24043	0.889000	0.34880	0.614000	0.37383	3.536000	0.53582	2.587000	0.87381	0.467000	0.42956	TCA	CUL9	-	NULL		0.602	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL9	HGNC	protein_coding	OTTHUMT00000040582.2	C	NM_015089		43153970	+1	no_errors	ENST00000252050	ensembl	human	known	70_37	missense	SNP	0.034	T
CYP3A7	1551	genome.wustl.edu	37	7	99311102	99311102	+	Silent	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr7:99311102C>T	ENST00000336374.2	-	9	857	c.855G>A	c.(853-855)gaG>gaA	p.E285E	AC069294.1_ENST00000408560.1_RNA	NM_000765.3	NP_000756.2	P24462	CP3A7_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 7	285					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)			autonomic_ganglia(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	32	Lung NSC(181;0.0144)|Esophageal squamous(72;0.0166)|all_lung(186;0.0228)				Alfentanil(DB00802)|Alprazolam(DB00404)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amlodipine(DB00381)|Aprepitant(DB00673)|Aripiprazole(DB01238)|Astemizole(DB00637)|Atorvastatin(DB01076)|Buprenorphine(DB00921)|Buspirone(DB00490)|Caffeine(DB00201)|Carbamazepine(DB00564)|Chloramphenicol(DB00446)|Chlorphenamine(DB01114)|Cilostazol(DB01166)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clotrimazole(DB00257)|Cocaine(DB00907)|Codeine(DB00318)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diltiazem(DB00343)|Docetaxel(DB01248)|Dolutegravir(DB08930)|Domperidone(DB01184)|Eplerenone(DB00700)|Erythromycin(DB00199)|Estradiol(DB00783)|Ethosuximide(DB00593)|Ethylmorphine(DB01466)|Felodipine(DB01023)|Fentanyl(DB00813)|Finasteride(DB01216)|Fluconazole(DB00196)|Fluticasone Propionate(DB00588)|Fluvoxamine(DB00176)|Gestodene(DB06730)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ifosfamide(DB01181)|Iloperidone(DB04946)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lercanidipine(DB00528)|Levomethadyl Acetate(DB01227)|Lidocaine(DB00281)|Lovastatin(DB00227)|Methadone(DB00333)|Midazolam(DB00683)|Mifepristone(DB00834)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nifedipine(DB01115)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norfloxacin(DB01059)|Ondansetron(DB00904)|Oxazepam(DB00842)|Oxycodone(DB00497)|Paclitaxel(DB01229)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Praziquantel(DB01058)|Progesterone(DB00396)|Propranolol(DB00571)|Quetiapine(DB01224)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Rifapentine(DB01201)|Risperidone(DB00734)|Ritonavir(DB00503)|Salmeterol(DB00938)|Saquinavir(DB01232)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sorafenib(DB00398)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Temsirolimus(DB06287)|Testosterone(DB00624)|Trazodone(DB00656)|Tretinoin(DB00755)|Triazolam(DB00897)|Verapamil(DB00661)|Vincristine(DB00541)|Voriconazole(DB00582)|Zalcitabine(DB00943)|Zaleplon(DB00962)|Ziprasidone(DB00246)|Zolpidem(DB00425)	CTTTGTGGGTCTCAGAGTCTT	0.433																																																	0													108.0	103.0	105.0					7																	99311102		2203	4300	6503	SO:0001819	synonymous_variant	1551			AF315325	CCDS5673.1	7q21-q22.1	2007-12-14	2003-01-14		ENSG00000160870	ENSG00000160870		"""Cytochrome P450s"""	2640	protein-coding gene	gene with protein product		605340	"""cytochrome P450, subfamily IIIA, polypeptide 7"""			2722762	Standard	NM_000765		Approved	CP37, P450-HFLA		P24462	OTTHUMG00000156726	ENST00000336374.2:c.855G>A	7.37:g.99311102C>T			A4D288|Q9H241	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_CYP3A,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-II,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_B	p.E285	ENST00000336374.2	37	c.855	CCDS5673.1	7																																																																																			CYP3A7	-	pfam_Cyt_P450,superfamily_Cyt_P450		0.433	CYP3A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP3A7	HGNC	protein_coding	OTTHUMT00000345484.1	C			99311102	-1	no_errors	ENST00000336374	ensembl	human	known	70_37	silent	SNP	0.000	T
DENND4C	55667	genome.wustl.edu	37	9	19372056	19372056	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr9:19372056G>A	ENST00000380432.2	+	28	4940	c.4907G>A	c.(4906-4908)gGa>gAa	p.G1636E	DENND4C_ENST00000602925.1_Missense_Mutation_p.G1872E|RP11-513M16.7_ENST00000609609.1_RNA|DENND4C_ENST00000434457.2_Missense_Mutation_p.G1921E			Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C	1636					cellular response to insulin stimulus (GO:0032869)|positive regulation of Rab GTPase activity (GO:0032851)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)	cytosol (GO:0005829)|insulin-responsive compartment (GO:0032593)|plasma membrane (GO:0005886)|retromer complex (GO:0030904)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(8)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						AATGAATATGGAATTGCATAC	0.368																																																	0													86.0	96.0	92.0					9																	19372056		2203	4300	6503	SO:0001583	missense	55667			AK000693	CCDS6491.2, CCDS6491.3	9p22.1	2012-10-03	2006-01-27	2006-01-27	ENSG00000137145	ENSG00000137145		"""DENN/MADD domain containing"""	26079	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 55B"", ""chromosome 9 open reading frame 55"""	C9orf55B, C9orf55		12906859	Standard	NM_017925		Approved	FLJ20686, bA513M16.3	uc031tcw.1	Q5VZ89	OTTHUMG00000019627	ENST00000380432.2:c.4907G>A	9.37:g.19372056G>A	ENSP00000369797:p.Gly1636Glu		A2A3R1|A2A3R2|A2A3R3|A2A3R9|Q6AI48|Q6ZUB3|Q8NCY7|Q9H6N4|Q9NUT1|Q9NWA5|Q9NWT3	Missense_Mutation	SNP	pfam_DENN_dom,pfam_dDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.G1636E	ENST00000380432.2	37	c.4907		9	.	.	.	.	.	.	.	.	.	.	G	12.62	1.993138	0.35131	.	.	ENSG00000137145	ENST00000380437;ENST00000307015;ENST00000540671;ENST00000380432;ENST00000361024	T;T	0.20598	2.06;2.06	5.46	3.1	0.35709	.	0.378221	0.28921	N	0.013718	T	0.09202	0.0227	N	0.04508	-0.205	0.29077	N	0.882958	B;B	0.06786	0.0;0.001	B;B	0.10450	0.005;0.001	T	0.25572	-1.0128	9	.	.	.	-4.592	11.0891	0.48104	0.2048:0.0:0.7952:0.0	.	966;1636	B7Z660;Q5VZ89	.;DEN4C_HUMAN	E	1636;1109;966;1109;633	ENSP00000305795:G1109E;ENSP00000443804:G966E	.	G	+	2	0	DENND4C	19362056	0.999000	0.42202	1.000000	0.80357	0.994000	0.84299	1.606000	0.36826	0.631000	0.30412	0.591000	0.81541	GGA	DENND4C	-	NULL		0.368	DENND4C-201	KNOWN	basic	protein_coding	DENND4C	HGNC	protein_coding		G	NM_017925		19372056	+1	no_errors	ENST00000380437	ensembl	human	known	70_37	missense	SNP	1.000	A
DIS3L2	129563	genome.wustl.edu	37	2	233201339	233201339	+	Nonstop_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr2:233201339G>C	ENST00000409307.1	+	20	2657	c.2657G>C	c.(2656-2658)tGa>tCa	p.*886S	DIS3L2_ENST00000325385.7_Nonstop_Mutation_p.*886S|DIS3L2_ENST00000273009.6_Intron					DIS3 like 3'-5' exoribonuclease 2											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		AGCACCAGCTGAGCTCCACCA	0.637																																																	0													11.0	17.0	15.0					2																	233201339		2014	4163	6177	SO:0001578	stop_lost	129563			BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000409307.1:c.2657G>C	2.37:g.233201339G>C	ENSP00000386799:p.*886Serext*?			Nonstop_Mutation	SNP	pfam_RNase_II/R,smart_RNase_II/R	p.*886S	ENST00000409307.1	37	c.2657	CCDS42834.1	2	.	.	.	.	.	.	.	.	.	.	G	7.748	0.702716	0.15172	.	.	ENSG00000144535	ENST00000325385;ENST00000409307	.	.	.	2.07	-0.32	0.12721	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.4238	0.07402	0.0:0.2496:0.3935:0.3569	.	.	.	.	S	886	.	.	X	+	2	2	DIS3L2	232909583	0.001000	0.12720	0.001000	0.08648	0.028000	0.11728	0.182000	0.16900	-0.079000	0.12707	0.306000	0.20318	TGA	DIS3L2	-	NULL		0.637	DIS3L2-015	KNOWN	basic|appris_principal|CCDS	protein_coding	DIS3L2	HGNC	protein_coding	OTTHUMT00000330988.1	G	NM_152383		233201339	+1	no_errors	ENST00000325385	ensembl	human	known	70_37	nonstop	SNP	0.001	C
DLC1	10395	genome.wustl.edu	37	8	12943362	12943362	+	Silent	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr8:12943362G>A	ENST00000276297.4	-	18	4954	c.4545C>T	c.(4543-4545)ttC>ttT	p.F1515F	DLC1_ENST00000358919.2_Silent_p.F1078F|DLC1_ENST00000510318.1_5'UTR|DLC1_ENST00000512044.2_Silent_p.F1112F|DLC1_ENST00000520226.1_Silent_p.F1004F	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	1515	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						TCTGGTTACTGAAGGAATCCC	0.433																																																	0													205.0	182.0	190.0					8																	12943362		2203	4300	6503	SO:0001819	synonymous_variant	10395			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.4545C>T	8.37:g.12943362G>A			B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Silent	SNP	pfam_START_lipid-bd,pfam_RhoGAP_dom,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,smart_START_lipid-bd,pfscan_START_lipid-bd,pfscan_RhoGAP_dom	p.F1515	ENST00000276297.4	37	c.4545	CCDS5989.1	8																																																																																			DLC1	-	pfam_START_lipid-bd,smart_START_lipid-bd		0.433	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DLC1	HGNC	protein_coding	OTTHUMT00000207632.2	G	NM_182643, NM_006094		12943362	-1	no_errors	ENST00000276297	ensembl	human	known	70_37	silent	SNP	0.997	A
DLGAP4	22839	genome.wustl.edu	37	20	35155325	35155325	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr20:35155325G>A	ENST00000373907.2	+	12	3069	c.2870G>A	c.(2869-2871)cGc>cAc	p.R957H	DLGAP4_ENST00000373913.3_Missense_Mutation_p.R954H|DLGAP4_ENST00000340491.4_Missense_Mutation_p.R418H|DLGAP4_ENST00000475894.1_3'UTR|DLGAP4_ENST00000339266.5_Missense_Mutation_p.R957H|DLGAP4_ENST00000401952.2_Missense_Mutation_p.R954H|RP5-977B1.7_ENST00000425233.1_RNA|RP5-977B1.7_ENST00000433238.1_RNA|RP5-977B1.7_ENST00000439595.1_RNA			Q9Y2H0	DLGP4_HUMAN	discs, large (Drosophila) homolog-associated protein 4	957					cell-cell signaling (GO:0007267)	membrane (GO:0016020)|synapse (GO:0045202)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(20)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				CAGGAGGCCCGCAAGAGACTC	0.647																																																	0													24.0	29.0	27.0					20																	35155325		2203	4298	6501	SO:0001583	missense	22839			AF088030	CCDS13274.1, CCDS13275.1	20q11.23	2010-02-05			ENSG00000080845	ENSG00000080845			24476	protein-coding gene	gene with protein product						9115257	Standard	XM_005260329		Approved	DAP4, KIAA0964, SAPAP4	uc010zvp.2	Q9Y2H0	OTTHUMG00000032390	ENST00000373907.2:c.2870G>A	20.37:g.35155325G>A	ENSP00000363014:p.Arg957His		E1P5T5|Q5QPG4|Q5T2Y4|Q5T2Y5|Q9H137|Q9H138|Q9H1L7	Missense_Mutation	SNP	pfam_GKAP	p.R957H	ENST00000373907.2	37	c.2870		20	.	.	.	.	.	.	.	.	.	.	G	33	5.271000	0.95429	.	.	ENSG00000080845	ENST00000373913;ENST00000401952;ENST00000373907;ENST00000339266;ENST00000340491	T;T;T;T;T	0.25250	1.81;1.81;1.81;1.81;1.81	5.8	5.8	0.92144	.	0.053823	0.64402	D	0.000001	T	0.62417	0.2426	M	0.91561	3.22	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;1.0	T	0.70033	-0.4983	10	0.87932	D	0	.	19.0445	0.93013	0.0:0.0:1.0:0.0	.	418;957;954	Q9Y2H0-3;Q9Y2H0;Q9Y2H0-1	.;DLGP4_HUMAN;.	H	954;954;957;957;418	ENSP00000363023:R954H;ENSP00000384954:R954H;ENSP00000363014:R957H;ENSP00000341633:R957H;ENSP00000345700:R418H	ENSP00000341633:R957H	R	+	2	0	DLGAP4	34588739	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.792000	0.99085	2.746000	0.94184	0.563000	0.77884	CGC	DLGAP4	-	pfam_GKAP		0.647	DLGAP4-007	KNOWN	basic|appris_candidate_longest	protein_coding	DLGAP4	HGNC	protein_coding	OTTHUMT00000079025.2	G	NM_014902		35155325	+1	no_errors	ENST00000339266	ensembl	human	known	70_37	missense	SNP	1.000	A
DMRTC2	63946	genome.wustl.edu	37	19	42351527	42351527	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr19:42351527C>T	ENST00000269945.3	+	2	82	c.31C>T	c.(31-33)Cac>Tac	p.H11Y	DMRTC2_ENST00000596827.1_Missense_Mutation_p.H11Y|LYPD4_ENST00000330743.3_5'Flank|LYPD4_ENST00000601246.1_5'Flank|DMRTC2_ENST00000602098.1_3'UTR	NM_001040283.1	NP_001035373.1	Q8IXT2	DMRTD_HUMAN	DMRT-like family C2	11					male meiosis I (GO:0007141)|positive regulation of histone H3-K9 dimethylation (GO:1900111)|positive regulation of histone H3-K9 trimethylation (GO:1900114)|sex differentiation (GO:0007548)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|XY body (GO:0001741)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	10						TGCTGGCTACCACTGCCCCTT	0.632																																																	0													91.0	92.0	92.0					19																	42351527		2203	4300	6503	SO:0001583	missense	63946			AJ291669	CCDS33034.1	19q13.2	2008-07-16				ENSG00000142025			13911	protein-coding gene	gene with protein product		614806				11863363	Standard	NM_001040283		Approved		uc002ors.3	Q8IXT2		ENST00000269945.3:c.31C>T	19.37:g.42351527C>T	ENSP00000269945:p.His11Tyr		Q8N6Q2|Q96M39|Q96SD4	Missense_Mutation	SNP	pfam_DM_DNA-bd,superfamily_DM_DNA-bd,smart_DM_DNA-bd,pfscan_DM_DNA-bd	p.H11Y	ENST00000269945.3	37	c.31	CCDS33034.1	19	.	.	.	.	.	.	.	.	.	.	C	9.245	1.039290	0.19669	.	.	ENSG00000142025	ENST00000269945	.	.	.	4.54	4.54	0.55810	.	0.614436	0.14556	N	0.312353	T	0.31420	0.0796	L	0.29908	0.895	0.29534	N	0.852567	P;P	0.39282	0.576;0.666	B;B	0.37650	0.188;0.255	T	0.08973	-1.0696	9	0.20046	T	0.44	-10.1997	13.5035	0.61471	0.0:1.0:0.0:0.0	.	11;11	B4DX56;Q8IXT2	.;DMRTD_HUMAN	Y	11	.	ENSP00000269945:H11Y	H	+	1	0	DMRTC2	47043367	0.075000	0.21258	0.971000	0.41717	0.403000	0.30841	0.391000	0.20784	2.472000	0.83506	0.561000	0.74099	CAC	DMRTC2	-	NULL		0.632	DMRTC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMRTC2	HGNC	protein_coding	OTTHUMT00000463045.1	C	NM_001040283		42351527	+1	no_errors	ENST00000269945	ensembl	human	known	70_37	missense	SNP	0.975	T
DNAH1	25981	genome.wustl.edu	37	3	52402868	52402868	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr3:52402868G>A	ENST00000420323.2	+	37	6138	c.5877G>A	c.(5875-5877)atG>atA	p.M1959I		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1959	AAA 2. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TTGAGAACATGAACACGGTGC	0.562																																																	0													128.0	134.0	132.0					3																	52402868		2129	4249	6378	SO:0001583	missense	25981			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.5877G>A	3.37:g.52402868G>A	ENSP00000401514:p.Met1959Ile		B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA	p.M1959I	ENST00000420323.2	37	c.5877	CCDS46842.1	3	.	.	.	.	.	.	.	.	.	.	G	32	5.127831	0.94473	.	.	ENSG00000114841	ENST00000420323	T	0.36520	1.25	4.93	4.93	0.64822	.	0.000000	0.53938	D	0.000054	T	0.73938	0.3651	H	0.96720	3.87	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.83909	0.0294	10	0.87932	D	0	.	18.3341	0.90282	0.0:0.0:1.0:0.0	.	1959	C9JXH6	.	I	1959	ENSP00000401514:M1959I	ENSP00000401514:M1959I	M	+	3	0	DNAH1	52377908	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.538000	0.98072	2.567000	0.86603	0.563000	0.77884	ATG	DNAH1	-	pfam_ATPase_dyneun-rel_AAA		0.562	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH1	HGNC	protein_coding	OTTHUMT00000350816.1	G	NM_015512		52402868	+1	no_errors	ENST00000420323	ensembl	human	known	70_37	missense	SNP	1.000	A
DNAH1	25981	genome.wustl.edu	37	3	52404213	52404213	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr3:52404213G>T	ENST00000420323.2	+	39	6487	c.6226G>T	c.(6226-6228)Gac>Tac	p.D2076Y		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	2076					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CAAGCTGCTGGACTGCTTCTT	0.572																																																	0													80.0	87.0	84.0					3																	52404213		2144	4253	6397	SO:0001583	missense	25981			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.6226G>T	3.37:g.52404213G>T	ENSP00000401514:p.Asp2076Tyr		B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA	p.D2076Y	ENST00000420323.2	37	c.6226	CCDS46842.1	3	.	.	.	.	.	.	.	.	.	.	G	20.8	4.056619	0.76074	.	.	ENSG00000114841	ENST00000420323	T	0.25912	1.77	4.53	4.53	0.55603	.	0.531623	0.16845	N	0.197163	T	0.41811	0.1175	M	0.87682	2.9	0.80722	D	1	P	0.41748	0.761	B	0.41646	0.362	T	0.56214	-0.8016	10	0.66056	D	0.02	.	17.4509	0.87592	0.0:0.0:1.0:0.0	.	2076	C9JXH6	.	Y	2076	ENSP00000401514:D2076Y	ENSP00000401514:D2076Y	D	+	1	0	DNAH1	52379253	1.000000	0.71417	0.959000	0.39883	0.940000	0.58332	8.465000	0.90383	2.361000	0.80049	0.491000	0.48974	GAC	DNAH1	-	NULL		0.572	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH1	HGNC	protein_coding	OTTHUMT00000350816.1	G	NM_015512		52404213	+1	no_errors	ENST00000420323	ensembl	human	known	70_37	missense	SNP	1.000	T
DNAH1	25981	genome.wustl.edu	37	3	52404241	52404241	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr3:52404241G>C	ENST00000420323.2	+	39	6515	c.6254G>C	c.(6253-6255)aGa>aCa	p.R2085T		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	2085					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TTTCTGCCTAGAGAGGTACAG	0.567																																																	0													67.0	70.0	69.0					3																	52404241		2115	4237	6352	SO:0001583	missense	25981			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.6254G>C	3.37:g.52404241G>C	ENSP00000401514:p.Arg2085Thr		B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA	p.R2085T	ENST00000420323.2	37	c.6254	CCDS46842.1	3	.	.	.	.	.	.	.	.	.	.	G	6.626	0.483929	0.12581	.	.	ENSG00000114841	ENST00000420323	T	0.22539	1.95	4.53	-4.54	0.03452	.	1.139980	0.06556	N	0.745838	T	0.10937	0.0267	N	0.19112	0.55	0.19300	N	0.999979	B	0.06786	0.001	B	0.04013	0.001	T	0.39881	-0.9592	10	0.13108	T	0.6	.	8.5072	0.33195	0.6606:0.0:0.2085:0.1309	.	2085	C9JXH6	.	T	2085	ENSP00000401514:R2085T	ENSP00000401514:R2085T	R	+	2	0	DNAH1	52379281	0.010000	0.17322	0.046000	0.18839	0.975000	0.68041	-0.195000	0.09546	-0.826000	0.04284	0.491000	0.48974	AGA	DNAH1	-	NULL		0.567	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH1	HGNC	protein_coding	OTTHUMT00000350816.1	G	NM_015512		52404241	+1	no_errors	ENST00000420323	ensembl	human	known	70_37	missense	SNP	0.001	C
DPPA3	359787	genome.wustl.edu	37	12	7868017	7868018	+	Missense_Mutation	DNP	TC	TC	GT			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	T|C	T|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr12:7868017_7868018TC>GT	ENST00000345088.2	+	2	438_439	c.321_322TC>GT	c.(319-324)gtTCgt>gtGTgt	p.R108C		NM_199286.2	NP_954980.1	Q6W0C5	DPPA3_HUMAN	developmental pluripotency associated 3	108					chromatin modification (GO:0016568)|embryonic cleavage (GO:0040016)|negative regulation of DNA demethylation (GO:1901536)|protection of DNA demethylation of female pronucleus (GO:0044726)|regulation of genetic imprinting (GO:2000653)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(2)	8				Kidney(36;0.0887)		TCGGCGGAGTTCGTACGGTATG	0.48																																																	0																																										SO:0001583	missense	359787			AY317075	CCDS8582.1	12p13.31	2012-10-02			ENSG00000187569	ENSG00000187569			19199	protein-coding gene	gene with protein product		608408					Standard	NM_199286		Approved	Stella	uc001qtf.3	Q6W0C5	OTTHUMG00000168434	Exception_encountered	12.37:g.7868017_7868018delinsGT	ENSP00000339250:p.Arg108Cys		Q0P5U3|Q6JZS6	Silent|Missense_Mutation	SNP	NULL	p.V107|p.R108C	ENST00000345088.2	37	c.321|c.322	CCDS8582.1	12																																																																																			DPPA3	-	NULL		0.480	DPPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPPA3	HGNC	protein_coding	OTTHUMT00000399718.1	T|C	NM_199286		7868017|7868018	+1	no_errors	ENST00000345088	ensembl	human	known	70_37	silent|missense	SNP	0.000	G|T
DST	667	genome.wustl.edu	37	6	56481855	56481855	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr6:56481855G>T	ENST00000370765.6	-	24	6517	c.6410C>A	c.(6409-6411)aCc>aAc	p.T2137N	DST_ENST00000312431.6_Intron|DST_ENST00000370769.4_Intron|DST_ENST00000370754.5_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000244364.6_Intron|DST_ENST00000361203.3_Intron|DST_ENST00000446842.2_Intron|DST_ENST00000370788.2_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	1894					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TGCAATTGAGGTGGCTTTCGT	0.418																																																	0													50.0	51.0	51.0					6																	56481855		2203	4300	6503	SO:0001583	missense	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.6410C>A	6.37:g.56481855G>T	ENSP00000359801:p.Thr2137Asn		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Plectin_repeat,pfam_Spectrin_repeat,superfamily_Ig/albumin-bd,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.T2137N	ENST00000370765.6	37	c.6410	CCDS4959.1	6	.	.	.	.	.	.	.	.	.	.	G	16.92	3.254303	0.59212	.	.	ENSG00000151914	ENST00000370765	T	0.68181	-0.31	5.77	4.89	0.63831	.	.	.	.	.	T	0.41096	0.1144	.	.	.	0.09310	N	0.999995	P	0.35793	0.521	B	0.33121	0.158	T	0.40194	-0.9576	7	0.23302	T	0.38	.	16.4672	0.84083	0.0:0.0:0.8676:0.1324	.	2137	Q03001-3	.	N	2137	ENSP00000359801:T2137N	ENSP00000359801:T2137N	T	-	2	0	DST	56589814	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.885000	0.56182	1.557000	0.49525	0.650000	0.86243	ACC	DST	-	smart_Plectin_repeat		0.418	DST-010	KNOWN	basic|CCDS	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041027.2	G	NM_001723		56481855	-1	no_errors	ENST00000370765	ensembl	human	known	70_37	missense	SNP	1.000	T
DUSP8	1850	genome.wustl.edu	37	11	1580137	1580137	+	Silent	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr11:1580137C>T	ENST00000397374.3	-	4	646	c.519G>A	c.(517-519)caG>caA	p.Q173Q	DUSP8_ENST00000528778.1_5'UTR|DUSP8_ENST00000331588.4_Silent_p.Q173Q	NM_004420.2	NP_004411.2	Q13202	DUS8_HUMAN	dual specificity phosphatase 8	173	Tyrosine-protein phosphatase.				inactivation of MAPK activity (GO:0000188)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|lung(2)|prostate(1)|urinary_tract(1)	5		all_epithelial(84;0.000134)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000621)|Lung(200;0.0687)|LUSC - Lung squamous cell carcinoma(625;0.0825)		GGACGTCCTTCTGCGAGCCCA	0.652																																																	0													132.0	111.0	118.0					11																	1580137		2202	4299	6501	SO:0001819	synonymous_variant	1850				CCDS7724.1	11p15.5	2011-06-09			ENSG00000184545	ENSG00000184545		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3074	protein-coding gene	gene with protein product	"""serine/threonine specific protein phosphatase"", ""H1 phosphatase, vaccinia virus homolog"""	602038	"""chromosome 11 open reading frame 81"""	C11orf81		7561881, 9192849	Standard	NM_004420		Approved	HVH-5, HB5, FLJ42958	uc001lts.2	Q13202	OTTHUMG00000133348	ENST00000397374.3:c.519G>A	11.37:g.1580137C>T			Q86SS8	Silent	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP	p.Q173	ENST00000397374.3	37	c.519	CCDS7724.1	11																																																																																			DUSP8	-	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Dual-sp_phosphatase_subgr_cat		0.652	DUSP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP8	HGNC	protein_coding	OTTHUMT00000257178.3	C	NM_004420		1580137	-1	no_errors	ENST00000331588	ensembl	human	known	70_37	silent	SNP	1.000	T
DUSP8	1850	genome.wustl.edu	37	11	1580215	1580215	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr11:1580215C>T	ENST00000397374.3	-	4	568	c.441G>A	c.(439-441)atG>atA	p.M147I	DUSP8_ENST00000528778.1_5'UTR|DUSP8_ENST00000331588.4_Missense_Mutation_p.M147I	NM_004420.2	NP_004411.2	Q13202	DUS8_HUMAN	dual specificity phosphatase 8	147					inactivation of MAPK activity (GO:0000188)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|lung(2)|prostate(1)|urinary_tract(1)	5		all_epithelial(84;0.000134)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000621)|Lung(200;0.0687)|LUSC - Lung squamous cell carcinoma(625;0.0825)		GGGAGAGGCTCATGGGTAGCA	0.657																																																	0													58.0	49.0	52.0					11																	1580215		2201	4299	6500	SO:0001583	missense	1850				CCDS7724.1	11p15.5	2011-06-09			ENSG00000184545	ENSG00000184545		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3074	protein-coding gene	gene with protein product	"""serine/threonine specific protein phosphatase"", ""H1 phosphatase, vaccinia virus homolog"""	602038	"""chromosome 11 open reading frame 81"""	C11orf81		7561881, 9192849	Standard	NM_004420		Approved	HVH-5, HB5, FLJ42958	uc001lts.2	Q13202	OTTHUMG00000133348	ENST00000397374.3:c.441G>A	11.37:g.1580215C>T	ENSP00000380530:p.Met147Ile		Q86SS8	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP	p.M147I	ENST00000397374.3	37	c.441	CCDS7724.1	11	.	.	.	.	.	.	.	.	.	.	C	10.76	1.441494	0.25900	.	.	ENSG00000184545	ENST00000397374;ENST00000331588	T;T	0.02177	4.41;4.41	4.34	3.42	0.39159	.	0.060594	0.64402	U	0.000004	T	0.02342	0.0072	L	0.44542	1.39	0.35517	D	0.801116	B	0.29378	0.243	B	0.23275	0.045	T	0.45775	-0.9238	10	0.49607	T	0.09	.	7.5112	0.27575	0.1636:0.7517:0.0:0.0847	.	147	Q13202	DUS8_HUMAN	I	147	ENSP00000380530:M147I;ENSP00000329539:M147I	ENSP00000329539:M147I	M	-	3	0	DUSP8	1536791	1.000000	0.71417	1.000000	0.80357	0.173000	0.22820	2.771000	0.47670	1.047000	0.40274	-0.275000	0.10095	ATG	DUSP8	-	NULL		0.657	DUSP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP8	HGNC	protein_coding	OTTHUMT00000257178.3	C	NM_004420		1580215	-1	no_errors	ENST00000331588	ensembl	human	known	70_37	missense	SNP	1.000	T
EFTUD2	9343	genome.wustl.edu	37	17	42949823	42949823	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr17:42949823C>T	ENST00000426333.2	-	11	1282	c.985G>A	c.(985-987)Gac>Aac	p.D329N	EFTUD2_ENST00000402521.3_Missense_Mutation_p.D294N|EFTUD2_ENST00000591382.1_Missense_Mutation_p.D329N|EFTUD2_ENST00000592576.1_Missense_Mutation_p.D319N	NM_001142605.1|NM_001258354.1|NM_004247.3	NP_001136077.1|NP_001245283.1|NP_004238.3	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain containing 2	329	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	32		Prostate(33;0.109)				CCAAAGGTGTCGGCATAGATC	0.542																																					Ovarian(10;65 485 10258 29980 30707)												0													179.0	172.0	174.0					17																	42949823		2203	4300	6503	SO:0001583	missense	9343			D21163	CCDS11489.1, CCDS45707.1, CCDS59295.1	17q21.31	2014-08-12			ENSG00000108883	ENSG00000108883			30858	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 116 kD"""	603892				9233818	Standard	NM_004247		Approved	U5-116KD, Snrp116, Snu114, SNRNP116	uc002ihn.2	Q15029	OTTHUMG00000179865	ENST00000426333.2:c.985G>A	17.37:g.42949823C>T	ENSP00000392094:p.Asp329Asn		B4DK30|B4DMC0|D3DX58|K7EJ81|Q9BUR0	Missense_Mutation	SNP	pfam_EF_GTP-bd_dom,pfam_Transl_elong_EFG/EF2_IV,pfam_Transl_elong_EFG/EF2_C,pfam_Transl_elong_EFTu/EF1A_2,pfam_MIRO-like,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Transl_elong_init/rib_B-barrel,superfamily_Elongation_fac_G/III/V,smart_Transl_elong_EFG/EF2_IV,smart_Transl_elong_EFG/EF2_C,prints_EF_GTP-bd_dom,tigrfam_Small_GTP-bd_dom	p.D329N	ENST00000426333.2	37	c.985	CCDS11489.1	17	.	.	.	.	.	.	.	.	.	.	C	20.2	3.947340	0.73672	.	.	ENSG00000108883	ENST00000426333;ENST00000262414;ENST00000402521	T;T	0.77098	-1.07;-1.07	6.16	6.16	0.99307	Protein synthesis factor, GTP-binding (1);	0.000000	0.85682	D	0.000000	T	0.77143	0.4087	L	0.52905	1.665	0.80722	D	1	B;B	0.18166	0.026;0.026	B;B	0.18263	0.021;0.021	T	0.69606	-0.5100	10	0.46703	T	0.11	-16.2074	20.8598	0.99761	0.0:1.0:0.0:0.0	.	319;329	B4DMC0;Q15029	.;U5S1_HUMAN	N	329;319;294	ENSP00000392094:D329N;ENSP00000385873:D294N	ENSP00000262414:D319N	D	-	1	0	EFTUD2	40305349	1.000000	0.71417	0.984000	0.44739	0.780000	0.44128	7.818000	0.86416	2.937000	0.99478	0.650000	0.86243	GAC	EFTUD2	-	pfam_EF_GTP-bd_dom		0.542	EFTUD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EFTUD2	HGNC	protein_coding	OTTHUMT00000448672.1	C	NM_004247		42949823	-1	no_errors	ENST00000426333	ensembl	human	known	70_37	missense	SNP	1.000	T
AGO4	192670	genome.wustl.edu	37	1	36297122	36297122	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:36297122C>T	ENST00000373210.3	+	8	1188	c.943C>T	c.(943-945)Ctt>Ttt	p.L315F		NM_017629.3	NP_060099.2	Q9HCK5	AGO4_HUMAN	argonaute RISC catalytic component 4	315	PAZ. {ECO:0000255|HAMAP-Rule:MF_03033}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)										ATACCCCCATCTTCCCTGTCT	0.383																																																	0													106.0	107.0	107.0					1																	36297122		2203	4300	6503	SO:0001583	missense	192670			AB046787	CCDS397.1	1p34	2013-02-15	2013-02-15	2013-02-15	ENSG00000134698	ENSG00000134698		"""Argonaute/PIWI family"""	18424	protein-coding gene	gene with protein product	"""argonaute 4"""	607356	"""eukaryotic translation initiation factor 2C, 4"""	EIF2C4		12906857	Standard	NM_017629		Approved	hAGO4, KIAA1567, FLJ20033	uc001bzj.2	Q9HCK5	OTTHUMG00000004243	ENST00000373210.3:c.943C>T	1.37:g.36297122C>T	ENSP00000362306:p.Leu315Phe		A7MD27	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ,pfam_DUF1785,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.L315F	ENST00000373210.3	37	c.943	CCDS397.1	1	.	.	.	.	.	.	.	.	.	.	C	19.67	3.870893	0.72065	.	.	ENSG00000134698	ENST00000373210	T	0.25749	1.78	5.55	5.55	0.83447	Argonaute/Dicer protein, PAZ (4);	0.000000	0.85682	D	0.000000	T	0.60209	0.2251	M	0.88512	2.96	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.65076	-0.6256	10	0.51188	T	0.08	-4.8907	19.5182	0.95174	0.0:1.0:0.0:0.0	.	315	Q9HCK5	AGO4_HUMAN	F	315	ENSP00000362306:L315F	ENSP00000362306:L315F	L	+	1	0	EIF2C4	36069709	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.439000	0.44846	2.603000	0.88011	0.655000	0.94253	CTT	EIF2C4	-	pfam_PAZ,superfamily_PAZ,smart_PAZ,pfscan_PAZ		0.383	AGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2C4	HGNC	protein_coding	OTTHUMT00000012213.3	C	NM_017629		36297122	+1	no_errors	ENST00000373210	ensembl	human	known	70_37	missense	SNP	1.000	T
AGO4	192670	genome.wustl.edu	37	1	36297445	36297445	+	Silent	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:36297445C>T	ENST00000373210.3	+	9	1274	c.1029C>T	c.(1027-1029)atC>atT	p.I343I		NM_017629.3	NP_060099.2	Q9HCK5	AGO4_HUMAN	argonaute RISC catalytic component 4	343					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)										AGCGATGTATCAAGAAGCTCA	0.433																																																	0													85.0	85.0	85.0					1																	36297445		2203	4300	6503	SO:0001819	synonymous_variant	192670			AB046787	CCDS397.1	1p34	2013-02-15	2013-02-15	2013-02-15	ENSG00000134698	ENSG00000134698		"""Argonaute/PIWI family"""	18424	protein-coding gene	gene with protein product	"""argonaute 4"""	607356	"""eukaryotic translation initiation factor 2C, 4"""	EIF2C4		12906857	Standard	NM_017629		Approved	hAGO4, KIAA1567, FLJ20033	uc001bzj.2	Q9HCK5	OTTHUMG00000004243	ENST00000373210.3:c.1029C>T	1.37:g.36297445C>T			A7MD27	Silent	SNP	pfam_Piwi,pfam_PAZ,pfam_DUF1785,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.I343	ENST00000373210.3	37	c.1029	CCDS397.1	1																																																																																			EIF2C4	-	pfam_PAZ,superfamily_PAZ,smart_PAZ		0.433	AGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2C4	HGNC	protein_coding	OTTHUMT00000012213.3	C	NM_017629		36297445	+1	no_errors	ENST00000373210	ensembl	human	known	70_37	silent	SNP	0.826	T
ENO3	2027	genome.wustl.edu	37	17	4856159	4856159	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr17:4856159G>A	ENST00000323997.6	+	3	287	c.155G>A	c.(154-156)gGa>gAa	p.G52E	ENO3_ENST00000518175.1_Missense_Mutation_p.G52E|ENO3_ENST00000519584.1_Missense_Mutation_p.G52E	NM_001976.4|NM_053013.3	NP_001967.3|NP_443739.3	P13929	ENOB_HUMAN	enolase 3 (beta, muscle)	52					aging (GO:0007568)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|response to drug (GO:0042493)|skeletal muscle tissue regeneration (GO:0043403)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|phosphopyruvate hydratase complex (GO:0000015)|plasma membrane (GO:0005886)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			cervix(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)	15						CTAAGAGACGGAGACAAAGGC	0.587																																																	0													33.0	33.0	33.0					17																	4856159		2203	4300	6503	SO:0001583	missense	2027			X16504	CCDS11062.1, CCDS54070.1	17p13.2	2013-09-19	2004-11-22		ENSG00000108515	ENSG00000108515	4.2.1.11		3354	protein-coding gene	gene with protein product		131370	"""enolase 3, (beta, muscle)"""				Standard	NM_001976		Approved		uc002gab.4	P13929	OTTHUMG00000099394	ENST00000323997.6:c.155G>A	17.37:g.4856159G>A	ENSP00000324105:p.Gly52Glu		B4DUI6|B4DUM6|D3DTL2|E7ENK8|Q96AE2	Missense_Mutation	SNP	pfam_Enolase_C,pfam_Enolase_N,pfam_MeAsp_NH4-lyase_C,pirsf_Enolase,prints_Enolase,tigrfam_Enolase	p.G52E	ENST00000323997.6	37	c.155	CCDS11062.1	17	.	.	.	.	.	.	.	.	.	.	G	23.2	4.383786	0.82792	.	.	ENSG00000108515	ENST00000522798;ENST00000519602;ENST00000323997;ENST00000522249;ENST00000519584;ENST00000518175	T;T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49;1.49	4.72	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.43765	0.1262	M	0.71206	2.165	0.51233	D	0.999913	B;B	0.22080	0.064;0.045	B;B	0.38921	0.096;0.285	T	0.47142	-0.9140	10	0.59425	D	0.04	.	15.2036	0.73159	0.0:0.0:1.0:0.0	.	52;52	P13929-3;D3DTL2	.;.	E	52	ENSP00000428502:G52E;ENSP00000430055:G52E;ENSP00000324105:G52E;ENSP00000428811:G52E;ENSP00000430636:G52E;ENSP00000431087:G52E	ENSP00000324105:G52E	G	+	2	0	ENO3	4796905	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	2.961000	0.49168	2.460000	0.83146	0.655000	0.94253	GGA	ENO3	-	pfam_Enolase_N,pirsf_Enolase,tigrfam_Enolase		0.587	ENO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENO3	HGNC	protein_coding	OTTHUMT00000216851.2	G			4856159	+1	no_errors	ENST00000323997	ensembl	human	known	70_37	missense	SNP	1.000	A
ENO3	2027	genome.wustl.edu	37	17	4856627	4856627	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr17:4856627G>A	ENST00000323997.6	+	5	433	c.301G>A	c.(301-303)Gag>Aag	p.E101K	ENO3_ENST00000518175.1_Missense_Mutation_p.E101K|ENO3_ENST00000519584.1_Intron	NM_001976.4|NM_053013.3	NP_001967.3|NP_443739.3	P13929	ENOB_HUMAN	enolase 3 (beta, muscle)	101					aging (GO:0007568)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|response to drug (GO:0042493)|skeletal muscle tissue regeneration (GO:0043403)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|phosphopyruvate hydratase complex (GO:0000015)|plasma membrane (GO:0005886)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			cervix(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)	15						AGATGGGACCGAGAATAAGTG	0.502																																																	0													117.0	121.0	120.0					17																	4856627		2203	4300	6503	SO:0001583	missense	2027			X16504	CCDS11062.1, CCDS54070.1	17p13.2	2013-09-19	2004-11-22		ENSG00000108515	ENSG00000108515	4.2.1.11		3354	protein-coding gene	gene with protein product		131370	"""enolase 3, (beta, muscle)"""				Standard	NM_001976		Approved		uc002gab.4	P13929	OTTHUMG00000099394	ENST00000323997.6:c.301G>A	17.37:g.4856627G>A	ENSP00000324105:p.Glu101Lys		B4DUI6|B4DUM6|D3DTL2|E7ENK8|Q96AE2	Missense_Mutation	SNP	pfam_Enolase_C,pfam_Enolase_N,pfam_MeAsp_NH4-lyase_C,pirsf_Enolase,prints_Enolase,tigrfam_Enolase	p.E101K	ENST00000323997.6	37	c.301	CCDS11062.1	17	.	.	.	.	.	.	.	.	.	.	G	33	5.227650	0.95173	.	.	ENSG00000108515	ENST00000522798;ENST00000519602;ENST00000323997;ENST00000522249;ENST00000518175	T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.48352	0.1495	M	0.73319	2.225	0.80722	D	1	D;D	0.61697	0.982;0.99	P;P	0.52710	0.707;0.707	T	0.49570	-0.8926	10	0.87932	D	0	-1.4986	17.6204	0.88079	0.0:0.0:1.0:0.0	.	8;101	D3DTL4;D3DTL2	.;.	K	101	ENSP00000428502:E101K;ENSP00000430055:E101K;ENSP00000324105:E101K;ENSP00000428811:E101K;ENSP00000431087:E101K	ENSP00000324105:E101K	E	+	1	0	ENO3	4797373	1.000000	0.71417	0.972000	0.41901	0.969000	0.65631	9.813000	0.99286	2.837000	0.97791	0.655000	0.94253	GAG	ENO3	-	pfam_Enolase_N,pirsf_Enolase,tigrfam_Enolase		0.502	ENO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENO3	HGNC	protein_coding	OTTHUMT00000216851.2	G			4856627	+1	no_errors	ENST00000323997	ensembl	human	known	70_37	missense	SNP	1.000	A
ENO3	2027	genome.wustl.edu	37	17	4857069	4857069	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr17:4857069G>A	ENST00000323997.6	+	6	505	c.373G>A	c.(373-375)Gag>Aag	p.E125K	ENO3_ENST00000518175.1_Missense_Mutation_p.E125K|ENO3_ENST00000519584.1_Missense_Mutation_p.E82K	NM_001976.4|NM_053013.3	NP_001967.3|NP_443739.3	P13929	ENOB_HUMAN	enolase 3 (beta, muscle)	125					aging (GO:0007568)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|response to drug (GO:0042493)|skeletal muscle tissue regeneration (GO:0043403)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|phosphopyruvate hydratase complex (GO:0000015)|plasma membrane (GO:0005886)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			cervix(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)	15						GGGAGCAGCTGAGAAGGGGGT	0.612																																																	0													108.0	97.0	101.0					17																	4857069		2203	4300	6503	SO:0001583	missense	2027			X16504	CCDS11062.1, CCDS54070.1	17p13.2	2013-09-19	2004-11-22		ENSG00000108515	ENSG00000108515	4.2.1.11		3354	protein-coding gene	gene with protein product		131370	"""enolase 3, (beta, muscle)"""				Standard	NM_001976		Approved		uc002gab.4	P13929	OTTHUMG00000099394	ENST00000323997.6:c.373G>A	17.37:g.4857069G>A	ENSP00000324105:p.Glu125Lys		B4DUI6|B4DUM6|D3DTL2|E7ENK8|Q96AE2	Missense_Mutation	SNP	pfam_Enolase_C,pfam_Enolase_N,pfam_MeAsp_NH4-lyase_C,pirsf_Enolase,prints_Enolase,tigrfam_Enolase	p.E125K	ENST00000323997.6	37	c.373	CCDS11062.1	17	.	.	.	.	.	.	.	.	.	.	G	19.53	3.845314	0.71603	.	.	ENSG00000108515	ENST00000522798;ENST00000519602;ENST00000323997;ENST00000522249;ENST00000519584;ENST00000518175	T;T;T;T;T;T	0.53423	1.54;1.54;1.54;1.54;0.62;1.54	5.55	4.56	0.56223	.	0.000000	0.85682	D	0.000000	T	0.46795	0.1411	M	0.63428	1.95	0.58432	D	0.999999	B;B;B	0.18013	0.002;0.025;0.003	B;B;B	0.21546	0.018;0.035;0.02	T	0.46162	-0.9211	10	0.52906	T	0.07	-2.8613	12.7954	0.57556	0.0808:0.0:0.9192:0.0	.	82;32;125	P13929-3;D3DTL4;D3DTL2	.;.;.	K	125;125;125;125;82;125	ENSP00000428502:E125K;ENSP00000430055:E125K;ENSP00000324105:E125K;ENSP00000428811:E125K;ENSP00000430636:E82K;ENSP00000431087:E125K	ENSP00000324105:E125K	E	+	1	0	ENO3	4797815	1.000000	0.71417	0.968000	0.41197	0.994000	0.84299	7.925000	0.87563	1.453000	0.47775	0.655000	0.94253	GAG	ENO3	-	pfam_Enolase_N,pirsf_Enolase,tigrfam_Enolase		0.612	ENO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENO3	HGNC	protein_coding	OTTHUMT00000216851.2	G			4857069	+1	no_errors	ENST00000323997	ensembl	human	known	70_37	missense	SNP	0.998	A
ENO3	2027	genome.wustl.edu	37	17	4857102	4857102	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr17:4857102G>A	ENST00000323997.6	+	6	538	c.406G>A	c.(406-408)Gat>Aat	p.D136N	ENO3_ENST00000518175.1_Missense_Mutation_p.D136N|ENO3_ENST00000519584.1_Missense_Mutation_p.D93N	NM_001976.4|NM_053013.3	NP_001967.3|NP_443739.3	P13929	ENOB_HUMAN	enolase 3 (beta, muscle)	136					aging (GO:0007568)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|response to drug (GO:0042493)|skeletal muscle tissue regeneration (GO:0043403)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|phosphopyruvate hydratase complex (GO:0000015)|plasma membrane (GO:0005886)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			cervix(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)	15						CCACATCGCAGATCTCGCTGG	0.642																																																	0													110.0	97.0	101.0					17																	4857102		2203	4300	6503	SO:0001583	missense	2027			X16504	CCDS11062.1, CCDS54070.1	17p13.2	2013-09-19	2004-11-22		ENSG00000108515	ENSG00000108515	4.2.1.11		3354	protein-coding gene	gene with protein product		131370	"""enolase 3, (beta, muscle)"""				Standard	NM_001976		Approved		uc002gab.4	P13929	OTTHUMG00000099394	ENST00000323997.6:c.406G>A	17.37:g.4857102G>A	ENSP00000324105:p.Asp136Asn		B4DUI6|B4DUM6|D3DTL2|E7ENK8|Q96AE2	Missense_Mutation	SNP	pfam_Enolase_C,pfam_Enolase_N,pfam_MeAsp_NH4-lyase_C,pirsf_Enolase,prints_Enolase,tigrfam_Enolase	p.D136N	ENST00000323997.6	37	c.406	CCDS11062.1	17	.	.	.	.	.	.	.	.	.	.	G	19.15	3.771945	0.69992	.	.	ENSG00000108515	ENST00000522798;ENST00000519602;ENST00000323997;ENST00000522249;ENST00000519584;ENST00000518175	T;T;T;T;T;T	0.52983	1.56;1.56;1.56;1.56;0.64;1.56	5.55	4.56	0.56223	.	0.000000	0.85682	D	0.000000	T	0.40839	0.1133	L	0.35487	1.065	0.80722	D	1	B;P;B	0.43701	0.018;0.815;0.007	B;B;B	0.42798	0.105;0.398;0.021	T	0.37454	-0.9705	10	0.56958	D	0.05	-18.9658	12.7954	0.57556	0.0808:0.0:0.9192:0.0	.	93;43;136	P13929-3;D3DTL4;D3DTL2	.;.;.	N	136;136;136;136;93;136	ENSP00000428502:D136N;ENSP00000430055:D136N;ENSP00000324105:D136N;ENSP00000428811:D136N;ENSP00000430636:D93N;ENSP00000431087:D136N	ENSP00000324105:D136N	D	+	1	0	ENO3	4797848	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.925000	0.87563	1.453000	0.47775	0.655000	0.94253	GAT	ENO3	-	pirsf_Enolase,tigrfam_Enolase		0.642	ENO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENO3	HGNC	protein_coding	OTTHUMT00000216851.2	G			4857102	+1	no_errors	ENST00000323997	ensembl	human	known	70_37	missense	SNP	1.000	A
LILRP2	79166	genome.wustl.edu	37	19	55224638	55224638	+	RNA	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr19:55224638C>T	ENST00000413439.1	+	0	1810									leukocyte immunoglobulin-like receptor pseudogene 2																		ATCTCATCCGCGTGGCTGTGG	0.572																																					Ovarian(107;788 1543 20399 31552 46707)												0																																												0			AF072100		19q13.4	2010-02-17			ENSG00000240258	ENSG00000170858		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"""	15497	pseudogene	pseudogene						10941842	Standard	NR_003061		Approved	ILT10, CD85m	uc002qgs.1		OTTHUMG00000065886		19.37:g.55224638C>T				RNA	SNP	-	NULL	ENST00000413439.1	37	NULL		19																																																																																			AC006293.3	-	-		0.572	LILRP2-002	KNOWN	basic	processed_transcript	ENSG00000170858	Clone_based_vega_gene	pseudogene	OTTHUMT00000141240.2	C	NM_024317		55224638	+1	no_errors	ENST00000413439	ensembl	human	known	70_37	rna	SNP	0.039	T
LOC728660	728660	genome.wustl.edu	37	X	139099965	139099965	+	lincRNA	SNP	A	A	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chrX:139099965A>G	ENST00000417426.1	+	0	351																											AAAAATCGGAAGAGCAAGCAC	0.433																																																	0																																												0																															X.37:g.139099965A>G				RNA	SNP	-	NULL	ENST00000417426.1	37	NULL		X																																																																																			RP11-364B14.1	-	-		0.433	RP11-364B14.1-001	KNOWN	basic	lincRNA	ENSG00000233145	Clone_based_vega_gene	lincRNA	OTTHUMT00000058573.1	A			139099965	+1	no_errors	ENST00000417426	ensembl	human	known	70_37	rna	SNP	0.001	G
CAPN9	10753	genome.wustl.edu	37	1	230931123	230931123	+	Intron	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:230931123G>C	ENST00000271971.2	+	18	2100				RP11-99J16__A.2_ENST00000452640.1_RNA|RP11-99J16__A.2_ENST00000428480.1_RNA|CAPN9_ENST00000366666.2_Intron|CAPN9_ENST00000354537.1_Intron|RP11-99J16__A.2_ENST00000412344.1_RNA|CAPN9_ENST00000480004.1_Intron	NM_006615.2	NP_006606.1	O14815	CAN9_HUMAN	calpain 9						digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	25	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)				TAATGGCAAAGATAGACCACA	0.562																																																	0																																										SO:0001627	intron_variant	0			AF022799	CCDS1586.1, CCDS31053.1	1q42.11-q42.3	2013-01-10	2004-11-11		ENSG00000135773	ENSG00000135773		"""EF-hand domain containing"""	1486	protein-coding gene	gene with protein product	"""novel calpain large subunit-4"""	606401	"""calpain 9 (nCL-4)"""			9524069, 10835488	Standard	XM_005273010		Approved	nCL-4, GC36	uc001htz.1	O14815	OTTHUMG00000037779	ENST00000271971.2:c.1987+98G>C	1.37:g.230931123G>C			B1APS1|B1AQI0|Q9NS74	RNA	SNP	-	NULL	ENST00000271971.2	37	NULL	CCDS1586.1	1																																																																																			RP11-99J16__A.2	-	-		0.562	CAPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000244137	Clone_based_vega_gene	protein_coding	OTTHUMT00000092179.1	G	NM_006615		230931123	-1	no_errors	ENST00000412344	ensembl	human	putative	70_37	rna	SNP	0.000	C
ENTHD2	146705	genome.wustl.edu	37	17	79211199	79211199	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr17:79211199C>T	ENST00000300714.3	-	2	166	c.109G>A	c.(109-111)Gaa>Aaa	p.E37K	ENTHD2_ENST00000575961.1_5'Flank|C17orf89_ENST00000431388.2_5'Flank|ENTHD2_ENST00000374769.2_5'UTR	NM_144679.2	NP_653280.1	Q96N21	AP4AT_HUMAN	ENTH domain containing 2	37	ENTH.					cytoplasmic vesicle (GO:0031410)											GCAATCTCTTCAAACAGGTAG	0.552																																																	0													70.0	57.0	62.0					17																	79211199		2200	4297	6497	SO:0001583	missense	146705			AK056090	CCDS11779.1	17q25.3	2012-07-18	2012-07-18	2012-07-18	ENSG00000167302	ENSG00000167302			26458	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 56"""	C17orf56			Standard	NM_144679		Approved	FLJ31528	uc002jzu.2	Q96N21	OTTHUMG00000177866	ENST00000300714.3:c.109G>A	17.37:g.79211199C>T	ENSP00000300714:p.Glu37Lys		Q6ZQU0|Q6ZSQ9	Missense_Mutation	SNP	pfam_Epsin_dom_N,superfamily_ENTH_VHS	p.E37K	ENST00000300714.3	37	c.109	CCDS11779.1	17	.	.	.	.	.	.	.	.	.	.	C	17.17	3.321541	0.60634	.	.	ENSG00000167302	ENST00000300714	T	0.42131	0.98	5.03	5.03	0.67393	Epsin domain, N-terminal (1);ENTH/VHS (2);	0.053822	0.64402	D	0.000001	T	0.63510	0.2517	M	0.78049	2.395	0.80722	D	1	D	0.61080	0.989	P	0.60117	0.869	T	0.67998	-0.5525	10	0.56958	D	0.05	-19.7255	17.9732	0.89119	0.0:1.0:0.0:0.0	.	37	Q96N21	CQ056_HUMAN	K	37	ENSP00000300714:E37K	ENSP00000300714:E37K	E	-	1	0	C17orf56	76825794	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.427000	0.52785	2.336000	0.79503	0.651000	0.88453	GAA	ENTHD2	-	pfam_Epsin_dom_N,superfamily_ENTH_VHS		0.552	ENTHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTHD2	HGNC	protein_coding	OTTHUMT00000439315.1	C	NM_144679		79211199	-1	no_errors	ENST00000300714	ensembl	human	known	70_37	missense	SNP	1.000	T
EP300	2033	genome.wustl.edu	37	22	41545822	41545822	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr22:41545822C>T	ENST00000263253.7	+	14	3656	c.2437C>T	c.(2437-2439)Cag>Tag	p.Q813*		NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	813					apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						TCCAGGGTCTCAGGGGAGCCA	0.493			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																															Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	0													67.0	54.0	58.0					22																	41545822		2203	4300	6503	SO:0001587	stop_gained	2033	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.2437C>T	22.37:g.41545822C>T	ENSP00000263253:p.Gln813*		B1AKC2	Nonsense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.Q813*	ENST00000263253.7	37	c.2437	CCDS14010.1	22	.	.	.	.	.	.	.	.	.	.	C	50	16.278370	0.99859	.	.	ENSG00000100393	ENST00000263253	.	.	.	6.08	6.08	0.98989	.	0.000000	0.46758	D	0.000266	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	-8.2535	16.0764	0.80971	0.0:0.8669:0.1331:0.0	.	.	.	.	X	813	.	ENSP00000263253:Q813X	Q	+	1	0	EP300	39875768	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.706000	0.54830	2.894000	0.99253	0.591000	0.81541	CAG	EP300	-	NULL		0.493	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EP300	HGNC	protein_coding	OTTHUMT00000320600.1	C	NM_001429		41545822	+1	no_errors	ENST00000263253	ensembl	human	known	70_37	nonsense	SNP	1.000	T
EPHA4	2043	genome.wustl.edu	37	2	222283898	222283898	+	3'UTR	SNP	G	G	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr2:222283898G>T	ENST00000281821.2	-	0	5196				EPHA4_ENST00000469354.1_5'UTR	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4						adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		GTTGGCTGGAGTTTGGTATAC	0.428																																																	0																																										SO:0001624	3_prime_UTR_variant	2043			L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.*2194C>A	2.37:g.222283898G>T			A8K2P1|B2R601|B7Z6Q8|Q2M380	RNA	SNP	-	NULL	ENST00000281821.2	37	NULL	CCDS2447.1	2																																																																																			EPHA4	-	-		0.428	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA4	HGNC	protein_coding	OTTHUMT00000256836.3	G			222283898	-1	no_errors	ENST00000469354	ensembl	human	putative	70_37	rna	SNP	1.000	T
ERCC6L2	375748	genome.wustl.edu	37	9	98717083	98717083	+	Intron	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr9:98717083G>C	ENST00000288985.7	+	13	2185				ERCC6L2_ENST00000466840.1_Intron|ERCC6L2_ENST00000437817.1_Intron	NM_001010895.2	NP_001010895.1	Q5T890	ER6L2_HUMAN	excision repair cross-complementation group 6-like 2						DNA repair (GO:0006281)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)										GAATGGAAGTGAGAATGCAGT	0.488																																																	0																																										SO:0001627	intron_variant	375748			BC022957	CCDS35072.1	9q22.32	2014-03-07	2014-03-07	2012-03-30	ENSG00000182150	ENSG00000182150			26922	protein-coding gene	gene with protein product		615667	"""chromosome 9 open reading frame 102"", ""excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2"""	C9orf102			Standard	NM_001010895		Approved	FLJ37706, RAD26L	uc004avt.4	Q5T890	OTTHUMG00000020289	ENST00000288985.7:c.1881-1113G>C	9.37:g.98717083G>C			A4D997|B2RTP8|Q49AM9|Q5T892|Q8N663|Q8N9D0|Q9NPM7	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,smart_Helicase_C,pfscan_Helicase_C	p.E334Q	ENST00000288985.7	37	c.1000	CCDS35072.1	9	.	.	.	.	.	.	.	.	.	.	G	10.91	1.484698	0.26598	.	.	ENSG00000182150	ENST00000405401	.	.	.	3.33	0.481	0.16809	.	.	.	.	.	T	0.37019	0.0988	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.34950	-0.9808	5	0.62326	D	0.03	.	5.2506	0.15519	0.3939:0.0:0.6061:0.0	.	.	.	.	Q	334	.	ENSP00000384241:E334Q	E	+	1	0	C9orf102	97756904	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-0.505000	0.06367	0.101000	0.17610	0.467000	0.42956	GAG	ERCC6L2	-	pfscan_Helicase_C		0.488	ERCC6L2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ERCC6L2	HGNC	protein_coding	OTTHUMT00000053247.2	G	NM_001010895		98717083	+1	no_errors	ENST00000456993	ensembl	human	known	70_37	missense	SNP	0.000	C
ESPNL	339768	genome.wustl.edu	37	2	239010706	239010706	+	Missense_Mutation	SNP	C	C	T	rs372806468		TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr2:239010706C>T	ENST00000343063.3	+	2	682	c.419C>T	c.(418-420)cCg>cTg	p.P140L	ESPNL_ENST00000409169.1_Missense_Mutation_p.P140L	NM_194312.2	NP_919288.2	Q6ZVH7	ESPNL_HUMAN	espin-like	140										endometrium(1)|lung(8)|pancreas(2)|skin(2)	13		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		GGAGCCCGGCCGCTGCACCAC	0.706													C|||	1	0.000199681	0.0	0.0	5008	,	,		13280	0.0		0.0	False		,,,				2504	0.001																0								C	LEU/PRO	1,4357		0,1,2178	10.0	12.0	11.0		419	4.6	0.7	2		11	0,8530		0,0,4265	no	missense	ESPNL	NM_194312.2	98	0,1,6443	TT,TC,CC		0.0,0.0229,0.0078	probably-damaging	140/1006	239010706	1,12887	2179	4265	6444	SO:0001583	missense	339768			AK124559	CCDS2525.1	2q37.3	2013-01-10			ENSG00000144488	ENSG00000144488		"""Ankyrin repeat domain containing"""	27937	protein-coding gene	gene with protein product						12975309	Standard	NM_194312		Approved	FLJ42568	uc002vxq.4	Q6ZVH7	OTTHUMG00000133335	ENST00000343063.3:c.419C>T	2.37:g.239010706C>T	ENSP00000339115:p.Pro140Leu		Q66K27|Q6ZVG1|Q8IVU2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.P140L	ENST00000343063.3	37	c.419	CCDS2525.1	2	.	.	.	.	.	.	.	.	.	.	C	18.13	3.555584	0.65425	2.29E-4	0.0	ENSG00000144488	ENST00000343063;ENST00000409169	T;T	0.71698	-0.59;-0.59	4.62	4.62	0.57501	Ankyrin repeat-containing domain (4);	0.095896	0.41194	U	0.000926	D	0.84938	0.5583	M	0.84511	2.7	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87589	0.2489	10	0.72032	D	0.01	-35.8831	14.3981	0.67025	0.0:1.0:0.0:0.0	.	140	Q6ZVH7	ESPNL_HUMAN	L	140	ENSP00000339115:P140L;ENSP00000386577:P140L	ENSP00000339115:P140L	P	+	2	0	ESPNL	238675445	1.000000	0.71417	0.726000	0.30738	0.046000	0.14306	7.041000	0.76558	2.123000	0.65237	0.484000	0.47621	CCG	ESPNL	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.706	ESPNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESPNL	HGNC	protein_coding	OTTHUMT00000257164.2	C	NM_194312		239010706	+1	no_errors	ENST00000343063	ensembl	human	known	70_37	missense	SNP	0.966	T
ESRP2	80004	genome.wustl.edu	37	16	68265116	68265116	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr16:68265116C>T	ENST00000565858.1	-	12	1792	c.1706G>A	c.(1705-1707)cGc>cAc	p.R569H	RP11-96D1.11_ENST00000571197.1_RNA|ESRP2_ENST00000473183.2_Missense_Mutation_p.R559H	NM_024939.2	NP_079215.2	Q9H6T0	ESRP2_HUMAN	epithelial splicing regulatory protein 2	569					mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)	16						CATGCCACTGCGGCCCAAGGT	0.632																																																	0													70.0	60.0	64.0					16																	68265116		2198	4300	6498	SO:0001583	missense	80004			AK025571	CCDS10863.1	16q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000103067	ENSG00000103067		"""RNA binding motif (RRM) containing"""	26152	protein-coding gene	gene with protein product		612960	"""RNA binding motif protein 35B"""	RBM35B		12477932	Standard	NM_024939		Approved	FLJ21918	uc002evq.1	Q9H6T0	OTTHUMG00000137557	ENST00000565858.1:c.1706G>A	16.37:g.68265116C>T	ENSP00000454554:p.Arg569His		Q8N6H8|Q8WZ15|Q9H6I4	Missense_Mutation	SNP	superfamily_RNaseH-like_dom,smart_RRM_dom	p.R569H	ENST00000565858.1	37	c.1706		16	.	.	.	.	.	.	.	.	.	.	C	21.2	4.108068	0.77096	.	.	ENSG00000103067	ENST00000473183	T	0.11604	2.76	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.18425	0.0442	M	0.66939	2.045	0.80722	D	1	P;P	0.49185	0.92;0.548	B;B	0.41571	0.315;0.36	T	0.00865	-1.1535	10	0.62326	D	0.03	-16.4107	20.0368	0.97565	0.0:1.0:0.0:0.0	.	569;559	Q9H6T0;Q9H6T0-2	ESRP2_HUMAN;.	H	559	ENSP00000418748:R559H	ENSP00000418748:R559H	R	-	2	0	ESRP2	66822617	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.770000	0.85390	2.735000	0.93741	0.563000	0.77884	CGC	ESRP2	-	NULL		0.632	ESRP2-004	KNOWN	basic|appris_candidate_longest	protein_coding	ESRP2	HGNC	protein_coding	OTTHUMT00000433083.1	C	NM_024939		68265116	-1	no_errors	ENST00000565858	ensembl	human	known	70_37	missense	SNP	1.000	T
EVX1	2128	genome.wustl.edu	37	7	27285668	27285668	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr7:27285668C>T	ENST00000496902.4	+	3	1334	c.848C>T	c.(847-849)tCg>tTg	p.S283L	EVX1-AS_ENST00000519218.1_RNA|EVX1_ENST00000535619.1_Missense_Mutation_p.S101L|EVX1-AS_ENST00000517726.1_RNA|EVX1_ENST00000222761.3_3'UTR			P49640	EVX1_HUMAN	even-skipped homeobox 1	283					embryo development ending in birth or egg hatching (GO:0009792)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|liver(1)|lung(10)|prostate(1)|skin(1)	14						CCCTACTACTCGCCGGTGGGC	0.746																																																	0													8.0	11.0	10.0					7																	27285668		2124	4177	6301	SO:0001583	missense	2128				CCDS5413.1	7p15.2	2012-03-09	2007-02-15		ENSG00000106038	ENSG00000106038		"""Homeoboxes / ANTP class : HOXL subclass"""	3506	protein-coding gene	gene with protein product		142996	"""eve, even-skipped homeobox homolog 1 (Drosophila)"""			1684419	Standard	XM_005249640		Approved		uc003szd.1	P49640	OTTHUMG00000023093	ENST00000496902.4:c.848C>T	7.37:g.27285668C>T	ENSP00000419266:p.Ser283Leu		A4D199|B4DQJ0	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.S283L	ENST00000496902.4	37	c.848	CCDS5413.1	7	.	.	.	.	.	.	.	.	.	.	C	20.8	4.054065	0.75960	.	.	ENSG00000106038	ENST00000496902;ENST00000535619	D;D	0.92545	-2.91;-3.06	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	D	0.92430	0.7597	M	0.70595	2.14	0.58432	D	0.999999	D	0.53312	0.959	P	0.44860	0.462	D	0.93142	0.6542	10	0.54805	T	0.06	-17.1194	18.4512	0.90704	0.0:1.0:0.0:0.0	.	283	P49640	EVX1_HUMAN	L	283;101	ENSP00000419266:S283L;ENSP00000446458:S101L	ENSP00000419266:S283L	S	+	2	0	EVX1	27252193	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	7.323000	0.79105	2.342000	0.79632	0.462000	0.41574	TCG	EVX1	-	NULL		0.746	EVX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVX1	HGNC	protein_coding	OTTHUMT00000358750.3	C			27285668	+1	no_errors	ENST00000496902	ensembl	human	known	70_37	missense	SNP	1.000	T
EXOC5	10640	genome.wustl.edu	37	14	57675407	57675407	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr14:57675407G>C	ENST00000413566.2	-	18	2406	c.2047C>G	c.(2047-2049)Ctg>Gtg	p.L683V	EXOC5_ENST00000340918.7_Missense_Mutation_p.L618V	NM_006544.3	NP_006535.1	O00471	EXOC5_HUMAN	exocyst complex component 5	683					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|vesicle docking (GO:0048278)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(3)|endometrium(1)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	22						TTCTTGTCCAGATTAGCAAGT	0.408																																																	0													137.0	137.0	137.0					14																	57675407		1859	4101	5960	SO:0001583	missense	10640			U85946	CCDS45111.1	14q22.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000070367	ENSG00000070367			10696	protein-coding gene	gene with protein product		604469	"""SEC10 (S. cerevisiae)-like 1"", ""SEC10-like 1 (S. cerevisiae)"""	SEC10L1		9119050	Standard	XM_005267272		Approved	SEC10, SEC10P	uc001xct.3	O00471	OTTHUMG00000171309	ENST00000413566.2:c.2047C>G	14.37:g.57675407G>C	ENSP00000389934:p.Leu683Val		B2R6C5	Missense_Mutation	SNP	pfam_Sec10-like	p.L683V	ENST00000413566.2	37	c.2047	CCDS45111.1	14	.	.	.	.	.	.	.	.	.	.	G	24.0	4.487971	0.84854	.	.	ENSG00000070367	ENST00000413566;ENST00000340918	T;T	0.48201	0.83;0.82	5.49	4.6	0.57074	.	0.000000	0.85682	D	0.000000	T	0.61726	0.2370	L	0.48986	1.54	0.80722	D	1	D;D	0.69078	0.996;0.997	D;D	0.85130	0.994;0.997	T	0.60475	-0.7256	10	0.39692	T	0.17	-4.5562	13.9283	0.63978	0.0728:0.0:0.9272:0.0	.	618;683	F8W9B8;O00471	.;EXOC5_HUMAN	V	683;618	ENSP00000389934:L683V;ENSP00000342100:L618V	ENSP00000342100:L618V	L	-	1	2	EXOC5	56745160	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.763000	0.68818	1.317000	0.45149	0.585000	0.79938	CTG	EXOC5	-	pfam_Sec10-like		0.408	EXOC5-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	EXOC5	HGNC	protein_coding	OTTHUMT00000412905.1	G	NM_006544		57675407	-1	no_errors	ENST00000413566	ensembl	human	known	70_37	missense	SNP	1.000	C
EZR	7430	genome.wustl.edu	37	6	159188508	159188508	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr6:159188508C>T	ENST00000367075.3	-	13	1549	c.1381G>A	c.(1381-1383)Gag>Aag	p.E461K	EZR_ENST00000337147.7_Missense_Mutation_p.E461K|MIR3918_ENST00000581555.1_RNA|EZR_ENST00000392177.4_Missense_Mutation_p.E429K	NM_001111077.1	NP_001104547.1	P15311	EZRI_HUMAN	ezrin	461	Interaction with SCYL3.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of endothelial barrier (GO:0061028)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|filopodium assembly (GO:0046847)|leukocyte cell-cell adhesion (GO:0007159)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|receptor internalization (GO:0031623)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|astrocyte projection (GO:0097449)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell tip (GO:0051286)|ciliary basal body (GO:0036064)|cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|microspike (GO:0044393)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|Schwann cell microvillus (GO:0097454)|T-tubule (GO:0030315)|uropod (GO:0001931)|vesicle (GO:0031982)	actin filament binding (GO:0051015)|cell adhesion molecule binding (GO:0050839)|poly(A) RNA binding (GO:0044822)		EZR/ROS1(4)	breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	15		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		TGCAGCTCCTCCTTGGTCTTC	0.572			T	ROS1	NSCLC																																			Dom	yes		6	6q25.3	7430	ezrin		E	0													57.0	58.0	58.0					6																	159188508		2203	4300	6503	SO:0001583	missense	7430			AF187552	CCDS5258.1	6q25.3	2010-12-10	2007-11-29	2007-11-29	ENSG00000092820	ENSG00000092820		"""A-kinase anchor proteins"""	12691	protein-coding gene	gene with protein product	"""cytovillin 2"""	123900	"""villin 2 (ezrin)"""	VIL2			Standard	NM_003379		Approved		uc003qrt.4	P15311	OTTHUMG00000015917	ENST00000367075.3:c.1381G>A	6.37:g.159188508C>T	ENSP00000356042:p.Glu461Lys		E1P5A8|P23714|Q4VX75|Q96CU8|Q9NSJ4	Missense_Mutation	SNP	pirsf_ERM,pfam_ERM_C,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,superfamily_Moesin,smart_Band_41_domain,pfscan_FERM_domain,prints_Ez/rad/moesin,prints_Band_41_fam	p.E461K	ENST00000367075.3	37	c.1381	CCDS5258.1	6	.	.	.	.	.	.	.	.	.	.	C	18.54	3.646910	0.67358	.	.	ENSG00000092820	ENST00000337147;ENST00000367075;ENST00000392177	D;D;D	0.82526	-1.62;-1.62;-1.62	5.33	5.33	0.75918	Ezrin/radixin/moesin, C-terminal (1);	0.140816	0.64402	D	0.000006	D	0.84379	0.5459	M	0.78049	2.395	0.53688	D	0.999974	P;B	0.37731	0.607;0.155	P;B	0.45794	0.493;0.201	D	0.84217	0.0459	10	0.39692	T	0.17	.	19.0116	0.92875	0.0:1.0:0.0:0.0	.	429;461	E7EQR4;P15311	.;EZRI_HUMAN	K	461;461;429	ENSP00000338934:E461K;ENSP00000356042:E461K;ENSP00000376016:E429K	ENSP00000338934:E461K	E	-	1	0	EZR	159108496	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	4.819000	0.62664	2.489000	0.83994	0.462000	0.41574	GAG	EZR	-	pirsf_ERM,pfam_ERM_C		0.572	EZR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EZR	HGNC	protein_coding	OTTHUMT00000042878.1	C	NM_003379		159188508	-1	no_errors	ENST00000337147	ensembl	human	known	70_37	missense	SNP	1.000	T
FAM161B	145483	genome.wustl.edu	37	14	74409178	74409178	+	Missense_Mutation	SNP	C	C	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr14:74409178C>A	ENST00000534936.1	-	4	1271	c.1166G>T	c.(1165-1167)aGa>aTa	p.R389I	FAM161B_ENST00000286544.3_Missense_Mutation_p.R452I			Q96MY7	F161B_HUMAN	family with sequence similarity 161, member B	389										breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(2)	21						GGTTTCTCTTCTTTTGGCTGC	0.577																																																	0													157.0	144.0	149.0					14																	74409178		2203	4300	6503	SO:0001583	missense	145483			AA356453	CCDS9822.1, CCDS9822.2	14q24.2	2008-06-05	2008-06-05	2008-06-05		ENSG00000156050			19854	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 44"""	C14orf44			Standard	NM_152445		Approved	FLJ31697	uc001xpd.3	Q96MY7		ENST00000534936.1:c.1166G>T	14.37:g.74409178C>A	ENSP00000445326:p.Arg389Ile		B7Z882|J3KNA2	Missense_Mutation	SNP	pfam_UPF0564	p.R452I	ENST00000534936.1	37	c.1355		14	.	.	.	.	.	.	.	.	.	.	C	18.15	3.559589	0.65538	.	.	ENSG00000156050	ENST00000286544;ENST00000534936	T;T	0.23950	1.88;1.88	5.5	3.55	0.40652	.	0.313274	0.31484	N	0.007569	T	0.43166	0.1235	M	0.76574	2.34	0.19575	N	0.999964	D	0.61080	0.989	P	0.58077	0.832	T	0.28299	-1.0048	10	0.72032	D	0.01	-4.825	11.0066	0.47637	0.0:0.7883:0.0:0.2117	.	389	Q96MY7	F161B_HUMAN	I	452;389	ENSP00000286544:R452I;ENSP00000445326:R389I	ENSP00000286544:R452I	R	-	2	0	FAM161B	73478931	0.998000	0.40836	0.994000	0.49952	0.969000	0.65631	1.164000	0.31810	1.563000	0.49615	-0.140000	0.14226	AGA	FAM161B	-	pfam_UPF0564		0.577	FAM161B-201	KNOWN	basic|appris_candidate	protein_coding	FAM161B	HGNC	protein_coding		C	NM_152445		74409178	-1	no_errors	ENST00000286544	ensembl	human	known	70_37	missense	SNP	0.012	A
ERICH6	131831	genome.wustl.edu	37	3	150416593	150416593	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr3:150416593C>G	ENST00000295910.6	-	3	590	c.538G>C	c.(538-540)Gat>Cat	p.D180H	FAM194A_ENST00000491361.1_Missense_Mutation_p.D34H	NM_152394.3	NP_689607.2														NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						TGCACTTTATCAGACAAATCT	0.388																																																	0													166.0	164.0	165.0					3																	150416593		2203	4300	6503	SO:0001583	missense	131831																														ENST00000295910.6:c.538G>C	3.37:g.150416593C>G	ENSP00000295910:p.Asp180His			Missense_Mutation	SNP	NULL	p.D180H	ENST00000295910.6	37	c.538	CCDS3151.2	3	.	.	.	.	.	.	.	.	.	.	C	8.467	0.856553	0.17106	.	.	ENSG00000163645	ENST00000295910;ENST00000491361;ENST00000313811;ENST00000474463	T;T;T	0.48522	2.73;2.53;0.81	3.83	-7.08	0.01558	.	1.799730	0.03004	N	0.148594	T	0.34048	0.0884	N	0.22421	0.69	0.09310	N	1	B	0.21753	0.06	B	0.29353	0.101	T	0.34129	-0.9841	10	0.42905	T	0.14	2.8978	9.7564	0.40506	0.1297:0.7264:0.0:0.1439	.	180	Q7L0X2	F194A_HUMAN	H	180;34;138;154	ENSP00000295910:D180H;ENSP00000419366:D34H;ENSP00000419304:D154H	ENSP00000295910:D180H	D	-	1	0	FAM194A	151899283	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.752000	0.01819	-1.818000	0.01218	-0.469000	0.05056	GAT	FAM194A	-	NULL		0.388	FAM194A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM194A	HGNC	protein_coding	OTTHUMT00000257666.1	C			150416593	-1	no_errors	ENST00000295910	ensembl	human	known	70_37	missense	SNP	0.000	G
FAM217B	63939	genome.wustl.edu	37	20	58519266	58519266	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr20:58519266G>T	ENST00000358293.3	+	5	683	c.268G>T	c.(268-270)Gat>Tat	p.D90Y	FAM217B_ENST00000360816.3_Missense_Mutation_p.D90Y|FAM217B_ENST00000469084.1_Intron	NM_001190826.1	NP_001177755.1	Q9NTX9	F217B_HUMAN	family with sequence similarity 217, member B	90																	AGAGAATGCTGATGAGGACAG	0.438																																																	0													67.0	65.0	66.0					20																	58519266		2203	4300	6503	SO:0001583	missense	63939			AL109928	CCDS13484.1	20q13.33	2012-02-07	2012-02-07	2012-02-07	ENSG00000196227	ENSG00000196227			16170	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 177"""	C20orf177			Standard	NM_022106		Approved	dJ551D2.5	uc002ybc.3	Q9NTX9	OTTHUMG00000032873	ENST00000358293.3:c.268G>T	20.37:g.58519266G>T	ENSP00000351040:p.Asp90Tyr		B3KWH1|Q9NTA3	Missense_Mutation	SNP	NULL	p.D90Y	ENST00000358293.3	37	c.268	CCDS13484.1	20	.	.	.	.	.	.	.	.	.	.	G	27.5	4.838006	0.91117	.	.	ENSG00000196227	ENST00000358293;ENST00000360816	T;T	0.46451	0.87;0.87	5.56	5.56	0.83823	.	0.155177	0.38959	N	0.001515	T	0.64249	0.2581	M	0.63843	1.955	0.58432	D	0.999999	D	0.89917	1.0	D	0.74348	0.983	T	0.66023	-0.6026	10	0.87932	D	0	-9.1393	19.5302	0.95226	0.0:0.0:1.0:0.0	.	90	Q9NTX9	CT177_HUMAN	Y	90	ENSP00000351040:D90Y;ENSP00000354056:D90Y	ENSP00000351040:D90Y	D	+	1	0	C20orf177	57952661	1.000000	0.71417	0.581000	0.28614	0.992000	0.81027	9.097000	0.94193	2.592000	0.87571	0.655000	0.94253	GAT	FAM217B	-	NULL		0.438	FAM217B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM217B	HGNC	protein_coding	OTTHUMT00000268139.1	G	NM_022106		58519266	+1	no_errors	ENST00000358293	ensembl	human	known	70_37	missense	SNP	1.000	T
FBN3	84467	genome.wustl.edu	37	19	8182454	8182454	+	Silent	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr19:8182454C>G	ENST00000600128.1	-	27	3771	c.3357G>C	c.(3355-3357)ctG>ctC	p.L1119L	FBN3_ENST00000270509.2_Silent_p.L1119L|FBN3_ENST00000601739.1_Silent_p.L1119L			Q75N90	FBN3_HUMAN	fibrillin 3	1119	EGF-like 15; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						GGCCATCACTCAGGGAGCACT	0.612																																																	0													58.0	42.0	47.0					19																	8182454		2190	4275	6465	SO:0001819	synonymous_variant	84467				CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.3357G>C	19.37:g.8182454C>G			Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Silent	SNP	pfam_EGF-like_Ca-bd,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd,pirsf_FBN,pfscan_EG-like_dom	p.L1119	ENST00000600128.1	37	c.3357	CCDS12196.1	19																																																																																			FBN3	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EG-like_dom,pirsf_FBN,pfscan_EG-like_dom		0.612	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN3	HGNC	protein_coding	OTTHUMT00000461428.2	C	NM_032447		8182454	-1	no_errors	ENST00000270509	ensembl	human	known	70_37	silent	SNP	1.000	G
FBXL20	84961	genome.wustl.edu	37	17	37499487	37499487	+	Nonsense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr17:37499487G>C	ENST00000264658.6	-	2	310	c.50C>G	c.(49-51)tCa>tGa	p.S17*	FBXL20_ENST00000583610.1_Nonsense_Mutation_p.S17*|FBXL20_ENST00000577399.1_Nonsense_Mutation_p.S19*|FBXL20_ENST00000394294.3_Nonsense_Mutation_p.S17*	NM_032875.2	NP_116264.2	Q96IG2	FXL20_HUMAN	F-box and leucine-rich repeat protein 20	17				S -> P (in Ref. 1; BAF84533). {ECO:0000305}.	behavioral fear response (GO:0001662)	cytoplasm (GO:0005737)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22			LUAD - Lung adenocarcinoma(14;0.146)			ATCACTATTTGAGAACATCTG	0.313																																																	0													87.0	86.0	87.0					17																	37499487		2203	4296	6499	SO:0001587	stop_gained	84961			BC007557	CCDS32640.1, CCDS54116.1	17q21.2	2011-06-09				ENSG00000108306		"""F-boxes / Leucine-rich repeats"""	24679	protein-coding gene	gene with protein product		609086				12477932	Standard	NM_032875		Approved	MGC15482, Fbl2, Fbl20	uc002hrt.3	Q96IG2		ENST00000264658.6:c.50C>G	17.37:g.37499487G>C	ENSP00000264658:p.Ser17*		A8K729|Q38J52	Nonsense_Mutation	SNP	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom_cyclin-like	p.S17*	ENST00000264658.6	37	c.50	CCDS32640.1	17	.	.	.	.	.	.	.	.	.	.	G	36	5.858230	0.97036	.	.	ENSG00000108306	ENST00000264658;ENST00000394294	.	.	.	5.42	5.42	0.78866	.	0.143577	0.48767	D	0.000166	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	16.1193	0.81336	0.0:0.0:1.0:0.0	.	.	.	.	X	17	.	ENSP00000264658:S17X	S	-	2	0	FBXL20	34753013	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.736000	0.74811	2.517000	0.84864	0.643000	0.83706	TCA	FBXL20	-	NULL		0.313	FBXL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL20	HGNC	protein_coding	OTTHUMT00000444315.2	G	NM_032875		37499487	-1	no_errors	ENST00000264658	ensembl	human	known	70_37	nonsense	SNP	1.000	C
FLNC	2318	genome.wustl.edu	37	7	128489420	128489420	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr7:128489420G>T	ENST00000325888.8	+	30	5248	c.4987G>T	c.(4987-4989)Gag>Tag	p.E1663*	RP11-309L24.2_ENST00000469965.1_RNA|FLNC_ENST00000346177.6_Nonsense_Mutation_p.E1663*	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1663					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						GATTGGGCAGGAGACGGTGAT	0.647																																																	0													59.0	67.0	65.0					7																	128489420		2127	4242	6369	SO:0001587	stop_gained	2318			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.4987G>T	7.37:g.128489420G>T	ENSP00000327145:p.Glu1663*		B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Nonsense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.E1663*	ENST00000325888.8	37	c.4987	CCDS43644.1	7	.	.	.	.	.	.	.	.	.	.	G	46	12.760839	0.99694	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	.	.	.	5.65	5.65	0.86999	.	0.054216	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	19.7405	0.96228	0.0:0.0:1.0:0.0	.	.	.	.	X	1663	.	ENSP00000327145:E1663X	E	+	1	0	FLNC	128276656	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.638000	0.74309	2.655000	0.90218	0.655000	0.94253	GAG	FLNC	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like		0.647	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	G			128489420	+1	no_errors	ENST00000325888	ensembl	human	known	70_37	nonsense	SNP	1.000	T
FOXK1	221937	genome.wustl.edu	37	7	4801904	4801904	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr7:4801904G>A	ENST00000328914.4	+	9	2011	c.2011G>A	c.(2011-2013)Gag>Aag	p.E671K	FOXK1_ENST00000446823.1_Missense_Mutation_p.E508K	NM_001037165.1	NP_001032242.1			forkhead box K1											breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		GGGGCCCAAGGAGCCAGCAGC	0.692																																																	0													23.0	19.0	20.0					7																	4801904		2032	3994	6026	SO:0001583	missense	221937			BK004104	CCDS34591.1	7p22	2006-12-15			ENSG00000164916	ENSG00000164916		"""Forkhead boxes"""	23480	protein-coding gene	gene with protein product						15202027	Standard	NM_001037165		Approved	IMAGE:5164497	uc003snc.1	P85037	OTTHUMG00000151739	ENST00000328914.4:c.2011G>A	7.37:g.4801904G>A	ENSP00000328720:p.Glu671Lys			Missense_Mutation	SNP	pfam_TF_fork_head,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,smart_TF_fork_head,pfscan_FHA_dom,pfscan_TF_fork_head,prints_TF_fork_head	p.E671K	ENST00000328914.4	37	c.2011	CCDS34591.1	7	.	.	.	.	.	.	.	.	.	.	g	18.98	3.737646	0.69304	.	.	ENSG00000164916	ENST00000446823;ENST00000450194;ENST00000328914;ENST00000545598	D;D	0.95853	-3.43;-3.83	4.82	4.82	0.62117	.	0.147859	0.44097	D	0.000489	D	0.90693	0.7080	N	0.22421	0.69	0.41902	D	0.990421	B;B	0.34290	0.028;0.447	B;B	0.30572	0.012;0.117	D	0.91112	0.4923	10	0.54805	T	0.06	.	15.0709	0.72037	0.0:0.0:1.0:0.0	.	671;508	P85037;P85037-2	FOXK1_HUMAN;.	K	508;427;671;554	ENSP00000394442:E508K;ENSP00000328720:E671K	ENSP00000328720:E671K	E	+	1	0	FOXK1	4768430	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	3.959000	0.56744	2.232000	0.73038	0.556000	0.70494	GAG	FOXK1	-	NULL		0.692	FOXK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXK1	HGNC	protein_coding	OTTHUMT00000323729.2	G			4801904	+1	no_errors	ENST00000328914	ensembl	human	known	70_37	missense	SNP	1.000	A
FLNC	2318	genome.wustl.edu	37	7	128492713	128492713	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr7:128492713G>A	ENST00000325888.8	+	36	6172	c.5911G>A	c.(5911-5913)Gag>Aag	p.E1971K	RP11-309L24.2_ENST00000469965.1_RNA|FLNC_ENST00000346177.6_Missense_Mutation_p.E1938K	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1971					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						GAAGATCACCGAGAGTGATCT	0.627																																																	0													40.0	45.0	44.0					7																	128492713		2056	4189	6245	SO:0001583	missense	2318			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.5911G>A	7.37:g.128492713G>A	ENSP00000327145:p.Glu1971Lys		B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.E1971K	ENST00000325888.8	37	c.5911	CCDS43644.1	7	.	.	.	.	.	.	.	.	.	.	G	36	5.688721	0.96784	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	T;T	0.43294	0.95;0.95	5.97	5.97	0.96955	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.73450	0.3588	M	0.89715	3.055	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.83275	0.996;0.989	T	0.77078	-0.2721	10	0.66056	D	0.02	.	20.428	0.99075	0.0:0.0:1.0:0.0	.	1938;1971	Q14315-2;Q14315	.;FLNC_HUMAN	K	1971;1938	ENSP00000327145:E1971K;ENSP00000344002:E1938K	ENSP00000327145:E1971K	E	+	1	0	FLNC	128279949	1.000000	0.71417	0.968000	0.41197	0.985000	0.73830	9.869000	0.99810	2.837000	0.97791	0.655000	0.94253	GAG	FLNC	-	superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like		0.627	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	G			128492713	+1	no_errors	ENST00000325888	ensembl	human	known	70_37	missense	SNP	1.000	A
FRYL	285527	genome.wustl.edu	37	4	48592790	48592790	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr4:48592790C>G	ENST00000503238.1	-	14	1392	c.1393G>C	c.(1393-1395)Gat>Cat	p.D465H	FRYL_ENST00000507711.1_Missense_Mutation_p.D465H|FRYL_ENST00000358350.4_Missense_Mutation_p.D465H|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000506685.1_Missense_Mutation_p.D171H|FRYL_ENST00000537810.1_Missense_Mutation_p.D465H			O94915	FRYL_HUMAN	FRY-like	465					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						GGTTCACCATCTTTCTGCTGC	0.373																																																	0													143.0	132.0	136.0					4																	48592790		1867	4110	5977	SO:0001583	missense	285527			AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.1393G>C	4.37:g.48592790C>G	ENSP00000426064:p.Asp465His		O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.D465H	ENST00000503238.1	37	c.1393	CCDS43227.1	4	.	.	.	.	.	.	.	.	.	.	C	18.64	3.667258	0.67814	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000507711;ENST00000506685	T;T;T;T	0.50001	1.72;1.72;1.72;0.76	5.6	5.6	0.85130	Armadillo-type fold (1);	0.000000	0.85682	U	0.000000	T	0.69869	0.3159	M	0.72894	2.215	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.77004	0.975;0.989	T	0.71517	-0.4569	10	0.66056	D	0.02	.	19.6103	0.95602	0.0:1.0:0.0:0.0	.	465;465	F2Z2S2;O94915	.;FRYL_HUMAN	H	465;465;465;465;171	ENSP00000426064:D465H;ENSP00000351113:D465H;ENSP00000441114:D465H;ENSP00000421584:D465H	ENSP00000351113:D465H	D	-	1	0	FRYL	48287547	1.000000	0.71417	0.991000	0.47740	0.270000	0.26580	7.776000	0.85560	2.629000	0.89072	0.655000	0.94253	GAT	FRYL	-	superfamily_ARM-type_fold		0.373	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRYL	HGNC	protein_coding	OTTHUMT00000369265.2	C			48592790	-1	no_errors	ENST00000358350	ensembl	human	known	70_37	missense	SNP	1.000	G
GBP4	115361	genome.wustl.edu	37	1	89658773	89658773	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:89658773C>G	ENST00000355754.6	-	5	581	c.484G>C	c.(484-486)Gag>Cag	p.E162Q		NM_052941.4	NP_443173.2	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	162	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(19)|skin(1)|stomach(2)|urinary_tract(1)	33				all cancers(265;0.00723)|Epithelial(280;0.0291)		TCTGCTAGCTCAGTCACATAG	0.458																																																	0													109.0	101.0	104.0					1																	89658773		2203	4300	6503	SO:0001583	missense	115361			AF288814	CCDS721.1	1p22.2	2008-02-05			ENSG00000162654	ENSG00000162654			20480	protein-coding gene	gene with protein product		612466				16689661	Standard	NM_052941		Approved	Mpa2	uc001dnb.3	Q96PP9	OTTHUMG00000010663	ENST00000355754.6:c.484G>C	1.37:g.89658773C>G	ENSP00000359490:p.Glu162Gln		B2R630|Q05D63|Q6NSL0|Q86T99	Missense_Mutation	SNP	pfam_Guanylate-bd_C,pfam_Guanylate-bd_N,superfamily_Guanylate-bd_C	p.E162Q	ENST00000355754.6	37	c.484	CCDS721.1	1	.	.	.	.	.	.	.	.	.	.	C	18.36	3.606357	0.66445	.	.	ENSG00000162654	ENST00000355754	D	0.83914	-1.78	4.93	4.93	0.64822	Guanylate-binding protein, N-terminal (1);	0.112791	0.56097	D	0.000025	D	0.89501	0.6733	M	0.87097	2.86	0.36015	D	0.838317	D	0.63046	0.992	P	0.60541	0.876	D	0.90759	0.4663	10	0.56958	D	0.05	.	15.9979	0.80265	0.0:1.0:0.0:0.0	.	162	Q96PP9	GBP4_HUMAN	Q	162	ENSP00000359490:E162Q	ENSP00000359490:E162Q	E	-	1	0	GBP4	89431361	1.000000	0.71417	0.999000	0.59377	0.461000	0.32589	2.934000	0.48956	2.716000	0.92895	0.655000	0.94253	GAG	GBP4	-	pfam_Guanylate-bd_N		0.458	GBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP4	HGNC	protein_coding	OTTHUMT00000029409.1	C	NM_052941		89658773	-1	no_errors	ENST00000355754	ensembl	human	known	70_37	missense	SNP	1.000	G
GCM2	9247	genome.wustl.edu	37	6	10874955	10874955	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr6:10874955C>T	ENST00000379491.4	-	5	941	c.794G>A	c.(793-795)aGa>aAa	p.R265K	RP11-637O19.3_ENST00000480294.1_Intron|SYCP2L_ENST00000543878.1_Intron	NM_004752.3	NP_004743.1	O75603	GCM2_HUMAN	glial cells missing homolog 2 (Drosophila)	265					cell differentiation (GO:0030154)|cellular calcium ion homeostasis (GO:0006874)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to organic substance (GO:0071310)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|parathyroid gland development (GO:0060017)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	30	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)				CAAATAGATTCTTGGGCTTGA	0.453																																																	0													173.0	168.0	170.0					6																	10874955		2203	4300	6503	SO:0001583	missense	9247			AF079550	CCDS4517.1	6p24.2	2008-08-29	2001-11-28	2002-09-27	ENSG00000124827	ENSG00000124827			4198	protein-coding gene	gene with protein product		603716	"""glial cells missing (Drosophila) homolog b"""	GCMB		9928992	Standard	NM_004752		Approved	hGCMb	uc003mzn.4	O75603	OTTHUMG00000014249	ENST00000379491.4:c.794G>A	6.37:g.10874955C>T	ENSP00000368805:p.Arg265Lys		D3GDV6|Q5THN5	Missense_Mutation	SNP	pfam_Tscrpt_reg_GCM_motif,superfamily_Tscrpt_reg_GCM_motif,pfscan_Tscrpt_reg_GCM_motif	p.R265K	ENST00000379491.4	37	c.794	CCDS4517.1	6	.	.	.	.	.	.	.	.	.	.	C	15.35	2.806368	0.50421	.	.	ENSG00000124827	ENST00000379491	T	0.69926	-0.44	5.5	4.64	0.57946	.	0.172925	0.64402	D	0.000015	T	0.50000	0.1590	M	0.76170	2.325	0.80722	D	1	B	0.34015	0.435	B	0.30401	0.115	T	0.55108	-0.8192	10	0.34782	T	0.22	-7.5825	11.6737	0.51417	0.0:0.8574:0.0:0.1426	.	265	O75603	GCM2_HUMAN	K	265	ENSP00000368805:R265K	ENSP00000368805:R265K	R	-	2	0	GCM2	10982941	0.952000	0.32445	0.999000	0.59377	0.667000	0.39255	2.240000	0.43088	1.465000	0.48006	-0.142000	0.14014	AGA	GCM2	-	NULL		0.453	GCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCM2	HGNC	protein_coding	OTTHUMT00000039844.1	C			10874955	-1	no_errors	ENST00000379491	ensembl	human	known	70_37	missense	SNP	0.998	T
GLIS2	84662	genome.wustl.edu	37	16	4386876	4386876	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr16:4386876C>T	ENST00000262366.3	+	8	1747	c.926C>T	c.(925-927)tCa>tTa	p.S309L	GLIS2_ENST00000433375.1_Missense_Mutation_p.S309L|PAM16_ENST00000577031.1_Intron|RP11-295D4.1_ENST00000574705.1_RNA			Q9BZE0	GLIS2_HUMAN	GLIS family zinc finger 2	309					cell differentiation (GO:0030154)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(4)|endometrium(1)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	11						GACCCCAGCTCACTGCGCAAG	0.637																																																	0													68.0	56.0	60.0					16																	4386876		2197	4299	6496	SO:0001583	missense	84662			AF325914	CCDS10511.1	16p13.3	2013-01-08			ENSG00000126603	ENSG00000126603		"""Zinc fingers, C2H2-type"""	29450	protein-coding gene	gene with protein product	"""nephrocystin-7"""	608539				11741991, 14500813, 17618285	Standard	NM_032575		Approved	NPHP7	uc002cwc.1	Q9BZE0	OTTHUMG00000129467	ENST00000262366.3:c.926C>T	16.37:g.4386876C>T	ENSP00000262366:p.Ser309Leu		B3KX84	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S309L	ENST00000262366.3	37	c.926	CCDS10511.1	16	.	.	.	.	.	.	.	.	.	.	C	34	5.350635	0.95830	.	.	ENSG00000126603	ENST00000262366;ENST00000433375	T;T	0.49432	0.78;0.78	5.82	5.82	0.92795	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.64068	0.2565	L	0.42632	1.34	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.64529	-0.6386	10	0.87932	D	0	.	18.8769	0.92341	0.0:1.0:0.0:0.0	.	309	Q9BZE0	GLIS2_HUMAN	L	309	ENSP00000262366:S309L;ENSP00000395547:S309L	ENSP00000262366:S309L	S	+	2	0	GLIS2	4326877	1.000000	0.71417	0.975000	0.42487	0.991000	0.79684	6.010000	0.70753	2.757000	0.94681	0.655000	0.94253	TCA	GLIS2	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.637	GLIS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLIS2	HGNC	protein_coding	OTTHUMT00000251630.1	C	NM_032575		4386876	+1	no_errors	ENST00000262366	ensembl	human	known	70_37	missense	SNP	1.000	T
GLIS2	84662	genome.wustl.edu	37	16	4386904	4386904	+	Silent	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr16:4386904C>T	ENST00000262366.3	+	8	1775	c.954C>T	c.(952-954)ggC>ggT	p.G318G	GLIS2_ENST00000433375.1_Silent_p.G318G|PAM16_ENST00000577031.1_Intron|RP11-295D4.1_ENST00000574705.1_RNA			Q9BZE0	GLIS2_HUMAN	GLIS family zinc finger 2	318					cell differentiation (GO:0030154)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(4)|endometrium(1)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	11						AGGCCCATGGCCACTTTGTGT	0.667																																																	0													67.0	55.0	59.0					16																	4386904		2197	4298	6495	SO:0001819	synonymous_variant	84662			AF325914	CCDS10511.1	16p13.3	2013-01-08			ENSG00000126603	ENSG00000126603		"""Zinc fingers, C2H2-type"""	29450	protein-coding gene	gene with protein product	"""nephrocystin-7"""	608539				11741991, 14500813, 17618285	Standard	NM_032575		Approved	NPHP7	uc002cwc.1	Q9BZE0	OTTHUMG00000129467	ENST00000262366.3:c.954C>T	16.37:g.4386904C>T			B3KX84	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G318	ENST00000262366.3	37	c.954	CCDS10511.1	16																																																																																			GLIS2	-	NULL		0.667	GLIS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLIS2	HGNC	protein_coding	OTTHUMT00000251630.1	C	NM_032575		4386904	+1	no_errors	ENST00000262366	ensembl	human	known	70_37	silent	SNP	1.000	T
GLIS2	84662	genome.wustl.edu	37	16	4387480	4387480	+	Silent	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr16:4387480C>T	ENST00000262366.3	+	8	2351	c.1530C>T	c.(1528-1530)gtC>gtT	p.V510V	GLIS2_ENST00000433375.1_Silent_p.V510V|PAM16_ENST00000577031.1_Intron|RP11-295D4.1_ENST00000574705.1_RNA			Q9BZE0	GLIS2_HUMAN	GLIS family zinc finger 2	510					cell differentiation (GO:0030154)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(4)|endometrium(1)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	11						GCTGGGTGGTCATCCCGCCGG	0.706																																																	0													11.0	10.0	11.0					16																	4387480		2167	4255	6422	SO:0001819	synonymous_variant	84662			AF325914	CCDS10511.1	16p13.3	2013-01-08			ENSG00000126603	ENSG00000126603		"""Zinc fingers, C2H2-type"""	29450	protein-coding gene	gene with protein product	"""nephrocystin-7"""	608539				11741991, 14500813, 17618285	Standard	NM_032575		Approved	NPHP7	uc002cwc.1	Q9BZE0	OTTHUMG00000129467	ENST00000262366.3:c.1530C>T	16.37:g.4387480C>T			B3KX84	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V510	ENST00000262366.3	37	c.1530	CCDS10511.1	16																																																																																			GLIS2	-	NULL		0.706	GLIS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLIS2	HGNC	protein_coding	OTTHUMT00000251630.1	C	NM_032575		4387480	+1	no_errors	ENST00000262366	ensembl	human	known	70_37	silent	SNP	1.000	T
GNAI3	2773	genome.wustl.edu	37	1	110125079	110125079	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:110125079G>A	ENST00000369851.4	+	5	592	c.482G>A	c.(481-483)aGa>aAa	p.R161K		NM_006496.3	NP_006487.1	P08754	GNAI3_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3	161					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|negative regulation of adenylate cyclase activity (GO:0007194)|platelet activation (GO:0030168)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle fusion (GO:0006906)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|midbody (GO:0030496)|plasma membrane (GO:0005886)|zymogen granule (GO:0042588)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|kidney(1)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	12		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.046)|Colorectal(144;0.119)|Epithelial(280;0.139)|all cancers(265;0.147)|LUSC - Lung squamous cell carcinoma(189;0.237)		GATCTGGATAGAATATCCCAG	0.373																																																	0													110.0	105.0	107.0					1																	110125079		2203	4300	6503	SO:0001583	missense	2773			M27543	CCDS802.1	1p13	2012-10-02			ENSG00000065135	ENSG00000065135			4387	protein-coding gene	gene with protein product		139370				3109953	Standard	NM_006496		Approved	87U6	uc001dxz.3	P08754	OTTHUMG00000011648	ENST00000369851.4:c.482G>A	1.37:g.110125079G>A	ENSP00000358867:p.Arg161Lys		P17539|Q5TZX1	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_I,prints_Fungi_GproteinA	p.R161K	ENST00000369851.4	37	c.482	CCDS802.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.306752	0.95629	.	.	ENSG00000065135	ENST00000369851	D	0.91295	-2.82	5.92	5.92	0.95590	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.92476	0.7611	M	0.84846	2.72	0.80722	D	1	B	0.26400	0.148	B	0.38683	0.279	D	0.90519	0.4487	10	0.72032	D	0.01	.	19.9185	0.97074	0.0:0.0:1.0:0.0	.	161	P08754	GNAI3_HUMAN	K	161	ENSP00000358867:R161K	ENSP00000358867:R161K	R	+	2	0	GNAI3	109926602	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.795000	0.96236	0.655000	0.94253	AGA	GNAI3	-	pfam_Gprotein_alpha_su,superfamily_GproteinA_insert,smart_Gprotein_alpha_su		0.373	GNAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNAI3	HGNC	protein_coding	OTTHUMT00000032222.1	G	NM_006496		110125079	+1	no_errors	ENST00000369851	ensembl	human	known	70_37	missense	SNP	1.000	A
GNB1L	54584	genome.wustl.edu	37	22	19799874	19799874	+	Silent	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr22:19799874C>G	ENST00000329517.6	-	5	587	c.351G>C	c.(349-351)cgG>cgC	p.R117R	GNB1L_ENST00000405009.1_Silent_p.R117R|GNB1L_ENST00000403325.1_Silent_p.R117R|GNB1L_ENST00000460402.1_5'UTR	NM_053004.2	NP_443730.1	Q9BYB4	GNB1L_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 1-like	117					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|social behavior (GO:0035176)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)				breast(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(3)|skin(1)	12	Colorectal(54;0.0993)					GGATGCTGCTCCGGCAGAAGC	0.697																																																	0													37.0	33.0	35.0					22																	19799874		2203	4300	6503	SO:0001819	synonymous_variant	54584			AF238328	CCDS13768.1	22q11.2	2013-05-21			ENSG00000185838	ENSG00000185838		"""WD repeat domain containing"""	4397	protein-coding gene	gene with protein product		610778				11072084	Standard	NM_053004		Approved	GY2, WDR14	uc002zqf.1	Q9BYB4	OTTHUMG00000150279	ENST00000329517.6:c.351G>C	22.37:g.19799874C>G			Q9H2S2|Q9H4M4	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R117	ENST00000329517.6	37	c.351	CCDS13768.1	22																																																																																			GNB1L	-	superfamily_WD40_repeat_dom		0.697	GNB1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNB1L	HGNC	protein_coding	OTTHUMT00000075202.1	C			19799874	-1	no_errors	ENST00000329517	ensembl	human	known	70_37	silent	SNP	0.917	G
GOLGA6L2	283685	genome.wustl.edu	37	15	23685649	23685649	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr15:23685649C>T	ENST00000567107.1	-	8	2025	c.1973G>A	c.(1972-1974)aGa>aAa	p.R658K	GOLGA6L2_ENST00000312015.5_Intron|GOLGA6L2_ENST00000345070.5_Intron			Q8N9W4	GG6L2_HUMAN	golgin A6 family-like 2	0										breast(1)|endometrium(7)	8						cgcatcttctcttcctgctcc	0.582																																																	0																																										SO:0001583	missense	283685			AK093463		15q11.2	2012-10-05	2010-02-12		ENSG00000174450	ENSG00000174450			26695	protein-coding gene	gene with protein product	"""cancer/testis antigen 105"""		"""golgi autoantigen, golgin subfamily a, 6-like 2"""				Standard	XM_002343322		Approved	CT105, FLJ36144	uc021sfy.1	Q8N9W4	OTTHUMG00000176417	ENST00000567107.1:c.1973G>A	15.37:g.23685649C>T	ENSP00000454407:p.Arg658Lys		A1L301	Missense_Mutation	SNP	NULL	p.R658K	ENST00000567107.1	37	c.1973		15																																																																																			GOLGA6L2	-	NULL		0.582	GOLGA6L2-002	PUTATIVE	basic|appris_candidate_longest	protein_coding	GOLGA6L2	HGNC	protein_coding	OTTHUMT00000431937.1	C	NM_182561		23685649	-1	no_errors	ENST00000567107	ensembl	human	putative	70_37	missense	SNP	0.003	T
GRIN3B	116444	genome.wustl.edu	37	19	1005526	1005526	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr19:1005526G>A	ENST00000234389.3	+	3	2045	c.2026G>A	c.(2026-2028)Gag>Aag	p.E676K	AC004528.4_ENST00000588380.1_RNA	NM_138690.1	NP_619635.1	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3B	676					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|protein insertion into membrane (GO:0051205)|regulation of calcium ion transport (GO:0051924)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|neurotransmitter receptor activity (GO:0030594)			breast(1)|kidney(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GACCTTCGAGGAGCTGTCGGG	0.701																																																	0													24.0	24.0	24.0					19																	1005526		2199	4299	6498	SO:0001583	missense	116444				CCDS32861.1	19p13.3	2014-05-06			ENSG00000116032	ENSG00000116032		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16768	protein-coding gene	gene with protein product		606651					Standard	XM_003403700		Approved	GluN3B	uc002lqo.1	O60391	OTTHUMG00000181904	ENST00000234389.3:c.2026G>A	19.37:g.1005526G>A	ENSP00000234389:p.Glu676Lys		Q5EAK7|Q7RTW9	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.E676K	ENST00000234389.3	37	c.2026	CCDS32861.1	19	.	.	.	.	.	.	.	.	.	.	G	13.21	2.170375	0.38315	.	.	ENSG00000116032	ENST00000234389	T	0.53206	0.63	4.36	3.31	0.37934	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.176041	0.47852	D	0.000214	T	0.47097	0.1427	L	0.47716	1.5	0.39846	D	0.973176	P	0.43578	0.811	P	0.45660	0.489	T	0.52548	-0.8561	10	0.62326	D	0.03	.	13.0608	0.59005	0.0:0.1633:0.8367:0.0	.	676	O60391	NMD3B_HUMAN	K	676	ENSP00000234389:E676K	ENSP00000234389:E676K	E	+	1	0	GRIN3B	956526	1.000000	0.71417	1.000000	0.80357	0.037000	0.13140	3.698000	0.54771	0.844000	0.35094	-0.837000	0.03062	GAG	GRIN3B	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt		0.701	GRIN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN3B	HGNC	protein_coding	OTTHUMT00000103923.2	G			1005526	+1	no_errors	ENST00000234389	ensembl	human	known	70_37	missense	SNP	1.000	A
GRIK5	2901	genome.wustl.edu	37	19	42510919	42510919	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr19:42510919G>C	ENST00000262895.3	-	15	1914	c.1915C>G	c.(1915-1917)Ctg>Gtg	p.L639V	GRIK5_ENST00000301218.4_Missense_Mutation_p.L639V|GRIK5_ENST00000593562.1_Missense_Mutation_p.L639V	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5	639					cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				AAGGCGGCCAGGTTGGCCGTG	0.642																																																	0													64.0	50.0	55.0					19																	42510919		2203	4300	6503	SO:0001583	missense	2901				CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.1915C>G	19.37:g.42510919G>C	ENSP00000262895:p.Leu639Val		Q8WWG8	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.L639V	ENST00000262895.3	37	c.1915	CCDS12595.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.4|22.4	4.289739|4.289739	0.80914|0.80914	.|.	.|.	ENSG00000105737|ENSG00000105737	ENST00000262895;ENST00000301218|ENST00000454993	T;T|.	0.74526|.	-0.85;-0.85|.	5.36|5.36	4.33|4.33	0.51752|0.51752	Ionotropic glutamate receptor (2);|.	0.000000|.	0.64402|.	D|.	0.000007|.	D|D	0.87830|0.87830	0.6276|0.6276	H|H	0.97918|0.97918	4.105|4.105	0.53005|0.53005	D|D	0.999964|0.999964	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	D|D	0.91424|0.91424	0.5161|0.5161	10|5	0.87932|.	D|.	0|.	.|.	13.0045|13.0045	0.58696|0.58696	0.0799:0.0:0.9201:0.0|0.0799:0.0:0.9201:0.0	.|.	639|.	Q16478|.	GRIK5_HUMAN|.	V|R	639|15	ENSP00000262895:L639V;ENSP00000301218:L639V|.	ENSP00000262895:L639V|.	L|P	-|-	1|2	2|0	GRIK5|GRIK5	47202759|47202759	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.820000|4.820000	0.62671|0.62671	1.268000|1.268000	0.44264|0.44264	0.563000|0.563000	0.77884|0.77884	CTG|CCT	GRIK5	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,prints_NMDA_rcpt		0.642	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK5	HGNC	protein_coding	OTTHUMT00000463453.1	G			42510919	-1	no_errors	ENST00000301218	ensembl	human	known	70_37	missense	SNP	1.000	C
GTF3C1	2975	genome.wustl.edu	37	16	27556663	27556663	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr16:27556663G>A	ENST00000356183.4	-	2	418	c.403C>T	c.(403-405)Cgc>Tgc	p.R135C	GTF3C1_ENST00000561623.1_Missense_Mutation_p.R135C	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	135					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						ATTGTACAGCGAGGCTGCAAG	0.483																																																	0													186.0	157.0	167.0					16																	27556663		2197	4300	6497	SO:0001583	missense	2975			U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.403C>T	16.37:g.27556663G>A	ENSP00000348510:p.Arg135Cys		B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	pfam_TFIIIC_Bblock-bd	p.R135C	ENST00000356183.4	37	c.403	CCDS32414.1	16	.	.	.	.	.	.	.	.	.	.	G	6.431	0.447719	0.12223	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.22743	1.94	4.33	3.28	0.37604	.	0.201128	0.34088	N	0.004275	T	0.09202	0.0227	N	0.12182	0.205	0.09310	N	1	B;B	0.12630	0.004;0.006	B;B	0.09377	0.002;0.004	T	0.13710	-1.0499	10	0.31617	T	0.26	-6.5248	3.7571	0.08589	0.1589:0.0:0.611:0.2301	.	135;135	Q12789;Q12789-3	TF3C1_HUMAN;.	C	135	ENSP00000348510:R135C	ENSP00000348510:R135C	R	-	1	0	GTF3C1	27464164	0.991000	0.36638	0.566000	0.28421	0.394000	0.30568	4.771000	0.62318	2.113000	0.64589	0.491000	0.48974	CGC	GTF3C1	-	NULL		0.483	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C1	HGNC	protein_coding	OTTHUMT00000433856.1	G	NM_001520		27556663	-1	no_errors	ENST00000356183	ensembl	human	known	70_37	missense	SNP	0.008	A
GTF3C6	112495	genome.wustl.edu	37	6	111279991	111279991	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr6:111279991G>T	ENST00000329970.7	+	1	229	c.19G>T	c.(19-21)Gag>Tag	p.E7*		NM_138408.3	NP_612417.1	Q969F1	TF3C6_HUMAN	general transcription factor IIIC, polypeptide 6, alpha 35kDa	7					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			NS(1)|kidney(1)|large_intestine(1)|lung(1)	4		all_cancers(87;0.00328)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|Colorectal(196;0.0466)|all_epithelial(87;0.0575)		OV - Ovarian serous cystadenocarcinoma(136;0.105)|all cancers(137;0.179)|Epithelial(106;0.186)		GGCGGCGGACGAGCGGAGTCC	0.677																																																	0													20.0	16.0	18.0					6																	111279991		1947	3876	5823	SO:0001587	stop_gained	112495			AK057977	CCDS5087.1	6q21	2010-03-23	2007-07-26	2007-07-26	ENSG00000155115	ENSG00000155115		"""General transcription factors"""	20872	protein-coding gene	gene with protein product		611784	"""chromosome 6 open reading frame 51"""	C6orf51		17409385	Standard	NM_138408		Approved	bA397G5.3, TFIIIC35	uc003pum.3	Q969F1	OTTHUMG00000015370	ENST00000329970.7:c.19G>T	6.37:g.111279991G>T	ENSP00000357863:p.Glu7*		Q5VXN2	Nonsense_Mutation	SNP	pfam_TFIIIC_tau55-rel	p.E7*	ENST00000329970.7	37	c.19	CCDS5087.1	6	.	.	.	.	.	.	.	.	.	.	G	26.6	4.754839	0.89843	.	.	ENSG00000155115	ENST00000329970	.	.	.	3.8	-0.174	0.13319	.	1.299070	0.05135	N	0.493295	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.0276	7.6241	0.28202	0.1045:0.5515:0.344:0.0	.	.	.	.	X	7	.	ENSP00000357863:E7X	E	+	1	0	GTF3C6	111386684	0.001000	0.12720	0.004000	0.12327	0.035000	0.12851	0.568000	0.23623	-0.057000	0.13199	-0.479000	0.04858	GAG	GTF3C6	-	NULL		0.677	GTF3C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C6	HGNC	protein_coding	OTTHUMT00000041820.1	G	NM_138408		111279991	+1	no_errors	ENST00000329970	ensembl	human	known	70_37	nonsense	SNP	0.004	T
GZMB	3002	genome.wustl.edu	37	14	25101087	25101087	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr14:25101087C>T	ENST00000216341.4	-	4	683	c.577G>A	c.(577-579)Gag>Aag	p.E193K	RP11-104E19.1_ENST00000557736.1_RNA|RP11-104E19.1_ENST00000555300.1_RNA|GZMB_ENST00000526004.1_3'UTR|GZMB_ENST00000382540.1_Missense_Mutation_p.E148K|GZMB_ENST00000415355.3_Missense_Mutation_p.E181K|GZMB_ENST00000382542.1_Missense_Mutation_p.E227K			P10144	GRAB_HUMAN	granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)	193	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				apoptotic process (GO:0006915)|cytolysis (GO:0019835)|intrinsic apoptotic signaling pathway (GO:0097193)|Notch signaling pathway (GO:0007219)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(2)|large_intestine(1)|lung(4)|stomach(4)|urinary_tract(2)	13				GBM - Glioblastoma multiforme(265;0.028)		TTTTTAATCTCTGGGTCCCCC	0.458																																																	0													128.0	121.0	124.0					14																	25101087		2203	4300	6503	SO:0001583	missense	3002			BC030195	CCDS9633.1	14q11.2	2008-08-13			ENSG00000100453	ENSG00000100453			4709	protein-coding gene	gene with protein product	"""fragmentin 2"", ""cytotoxic serine protease B"", ""cathepsin G-like 1"", ""T-cell serine protease 1-3E"""	123910		CTLA1, CSPB		2323780	Standard	NM_004131		Approved	CCPI, CGL-1, CSP-B, CGL1, CTSGL1, HLP, SECT	uc001wps.2	P10144	OTTHUMG00000029369	ENST00000216341.4:c.577G>A	14.37:g.25101087C>T	ENSP00000216341:p.Glu193Lys		Q8N1D2|Q9UCC1	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.E227K	ENST00000216341.4	37	c.679	CCDS9633.1	14	.	.	.	.	.	.	.	.	.	.	c	1.328	-0.597577	0.03771	.	.	ENSG00000100453	ENST00000415355;ENST00000216341;ENST00000382542;ENST00000382540;ENST00000382539	T;D;D;T	0.93019	0.24;-3.15;-3.15;1.52	5.3	0.32	0.15878	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.452303	0.16456	N	0.213632	T	0.77545	0.4146	N	0.05012	-0.13	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.65602	-0.6128	10	0.02654	T	1	.	3.3041	0.06993	0.1686:0.2843:0.0:0.5471	.	181;193	Q6XGZ4;P10144	.;GRAB_HUMAN	K	181;193;227;148;98	ENSP00000387385:E181K;ENSP00000216341:E193K;ENSP00000371982:E227K;ENSP00000371980:E148K	ENSP00000216341:E193K	E	-	1	0	GZMB	24170927	0.000000	0.05858	0.003000	0.11579	0.018000	0.09664	-0.015000	0.12634	-0.088000	0.12506	-0.302000	0.09304	GAG	GZMB	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6		0.458	GZMB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GZMB	HGNC	protein_coding	OTTHUMT00000276540.3	C	NM_004131		25101087	-1	no_errors	ENST00000382542	ensembl	human	known	70_37	missense	SNP	0.002	T
HCRTR1	3061	genome.wustl.edu	37	1	32084964	32084964	+	Silent	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:32084964C>T	ENST00000373706.5	+	1	324	c.171C>T	c.(169-171)ttC>ttT	p.F57F	HCRTR1_ENST00000468521.1_3'UTR|HCRTR1_ENST00000403528.2_Silent_p.F57F|HCRTR1_ENST00000373705.1_Silent_p.F57F			O43613	OX1R_HUMAN	hypocretin (orexin) receptor 1	57					feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|orexin receptor activity (GO:0016499)|peptide hormone binding (GO:0017046)			breast(2)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	7		Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.053)		TGGCTGTGTTCGTCGTGGCCC	0.587																																																	0													119.0	121.0	120.0					1																	32084964		2203	4300	6503	SO:0001819	synonymous_variant	3061			AF041243	CCDS344.1	1p33	2012-08-08			ENSG00000121764	ENSG00000121764		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4848	protein-coding gene	gene with protein product		602392				9491897	Standard	NM_001525		Approved	OX1R	uc009vtx.2	O43613	OTTHUMG00000003876	ENST00000373706.5:c.171C>T	1.37:g.32084964C>T			A8K3A6|Q9HBV6	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Orexin_rcpt,prints_GPCR_Rhodpsn,prints_Orexin_rcpt_1,prints_NPY_rcpt	p.F57	ENST00000373706.5	37	c.171	CCDS344.1	1																																																																																			HCRTR1	-	pfam_7TM_GPCR_olfarory/Srsx,prints_GPCR_Rhodpsn		0.587	HCRTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCRTR1	HGNC	protein_coding	OTTHUMT00000011042.1	C	NM_001525		32084964	+1	no_errors	ENST00000373706	ensembl	human	known	70_37	silent	SNP	0.996	T
HEATR4	399671	genome.wustl.edu	37	14	73963365	73963365	+	Missense_Mutation	SNP	C	C	T	rs141407968	byFrequency	TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr14:73963365C>T	ENST00000553558.1	-	15	2886	c.2565G>A	c.(2563-2565)atG>atA	p.M855I	HEATR4_ENST00000334988.2_Missense_Mutation_p.M855I|HEATR4_ENST00000560393.1_Missense_Mutation_p.M808I	NM_001220484.1	NP_001207413.1	Q86WZ0	HEAT4_HUMAN	HEAT repeat containing 4	855										breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		TGAGTATCTTCATTGTCTGGT	0.373																																																	0													168.0	154.0	159.0					14																	73963365		2203	4299	6502	SO:0001583	missense	399671			BC047590	CCDS9815.1, CCDS9815.2	14q24.3	2013-09-20			ENSG00000187105	ENSG00000187105			16761	protein-coding gene	gene with protein product						15489334	Standard	NM_203309		Approved	MGC48595	uc021rwf.2	Q86WZ0	OTTHUMG00000171602	ENST00000553558.1:c.2565G>A	14.37:g.73963365C>T	ENSP00000450444:p.Met855Ile		B7Z7V9|E9KL41	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold	p.M855I	ENST00000553558.1	37	c.2565	CCDS9815.2	14	.	.	.	.	.	.	.	.	.	.	C	15.52	2.856671	0.51376	.	.	ENSG00000187105	ENST00000553558;ENST00000334988	T	0.23754	1.89	5.16	5.16	0.70880	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000005	T	0.19846	0.0477	N	0.24115	0.695	0.34424	D	0.697784	P	0.49185	0.92	B	0.40825	0.341	T	0.22626	-1.0211	10	0.56958	D	0.05	-20.9051	15.6828	0.77385	0.0:1.0:0.0:0.0	.	855	Q86WZ0	HEAT4_HUMAN	I	855;808	ENSP00000450444:M855I	ENSP00000335447:M808I	M	-	3	0	HEATR4	73033118	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.901000	0.56303	2.690000	0.91761	0.655000	0.94253	ATG	HEATR4	-	superfamily_ARM-type_fold		0.373	HEATR4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HEATR4	HGNC	protein_coding	OTTHUMT00000414422.2	C	NM_203309		73963365	-1	no_errors	ENST00000334988	ensembl	human	known	70_37	missense	SNP	1.000	T
HEATR6	63897	genome.wustl.edu	37	17	58156276	58156276	+	5'UTR	SNP	C	C	G	rs558396689	byFrequency	TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr17:58156276C>G	ENST00000184956.6	-	0	16				CTD-2319I12.2_ENST00000589740.1_lincRNA|HEATR6_ENST00000585976.1_5'UTR|HEATR6_ENST00000585712.1_5'UTR	NM_022070.4	NP_071353.4	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6								poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	44	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			CAGCAGCCATCTTTTCTACGG	0.607																																																	0													9.0	8.0	8.0					17																	58156276		2159	4248	6407	SO:0001623	5_prime_UTR_variant	63897			BX640819	CCDS11623.1	17q23.2	2007-05-01				ENSG00000068097			24076	protein-coding gene	gene with protein product	"""amplified in breast cancer 1"""					12755490	Standard	NM_022070		Approved	ABC1, FLJ22087	uc002iyk.1	Q6AI08		ENST00000184956.6:c.-1G>C	17.37:g.58156276C>G			B3KXP3|Q6MZX1|Q6MZY2|Q8TDM9|Q9H6B3|Q9H6M7	RNA	SNP	-	NULL	ENST00000184956.6	37	NULL	CCDS11623.1	17																																																																																			HEATR6	-	-		0.607	HEATR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR6	HGNC	protein_coding	OTTHUMT00000449165.1	C	NM_022070		58156276	-1	no_errors	ENST00000585712	ensembl	human	known	70_37	rna	SNP	0.649	G
HELZ2	85441	genome.wustl.edu	37	20	62201861	62201861	+	Missense_Mutation	SNP	G	G	C	rs563895075		TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr20:62201861G>C	ENST00000467148.1	-	3	635	c.566C>G	c.(565-567)tCt>tGt	p.S189C	HELZ2_ENST00000479540.1_5'UTR|HELZ2_ENST00000427522.2_5'Flank	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	189					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GCTCACCTCAGAGTGGACGGC	0.617													G|||	1	0.000199681	0.0	0.0	5008	,	,		15723	0.0		0.0	False		,,,				2504	0.001																0													73.0	64.0	67.0					20																	62201861		2201	4300	6501	SO:0001583	missense	85441			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.566C>G	20.37:g.62201861G>C	ENSP00000417401:p.Ser189Cys		Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	pfam_RNase_II/R,smart_RNase_II/R	p.S189C	ENST00000467148.1	37	c.566	CCDS33508.1	20	.	.	.	.	.	.	.	.	.	.	G	16.20	3.055860	0.55325	.	.	ENSG00000130589	ENST00000467148	T	0.02606	4.23	4.28	3.33	0.38152	.	0.298781	0.33005	N	0.005398	T	0.09468	0.0233	L	0.49126	1.545	0.09310	N	0.999996	D;D	0.89917	1.0;0.999	D;D	0.79108	0.992;0.956	T	0.03394	-1.1041	10	0.59425	D	0.04	-1.1655	9.9285	0.41507	0.0974:0.0:0.9026:0.0	.	189;189	Q4VXQ0;Q9BYK8	.;PR285_HUMAN	C	189	ENSP00000417401:S189C	ENSP00000417401:S189C	S	-	2	0	RP4-697K14.7	61672305	1.000000	0.71417	0.127000	0.21898	0.056000	0.15407	4.642000	0.61383	0.818000	0.34468	0.558000	0.71614	TCT	HELZ2	-	NULL		0.617	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HELZ2	HGNC	protein_coding	OTTHUMT00000354127.1	G	NM_001037335		62201861	-1	no_errors	ENST00000467148	ensembl	human	known	70_37	missense	SNP	0.260	C
HEPH	9843	genome.wustl.edu	37	X	65486299	65486299	+	Missense_Mutation	SNP	A	A	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chrX:65486299A>T	ENST00000343002.2	+	20	3926	c.3262A>T	c.(3262-3264)Att>Ttt	p.I1088F	HEPH_ENST00000374727.3_Missense_Mutation_p.I1091F|HEPH_ENST00000336279.5_Missense_Mutation_p.I821F|HEPH_ENST00000419594.1_Missense_Mutation_p.I899F|HEPH_ENST00000441993.2_Missense_Mutation_p.I1090F|HEPH_ENST00000519389.1_Missense_Mutation_p.I1142F			Q9BQS7	HEPH_HUMAN	hephaestin	1088					cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						CCCCAGAGACATTGAAGAAGG	0.448																																																	0													181.0	131.0	148.0					X																	65486299		2203	4300	6503	SO:0001583	missense	9843			AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.3262A>T	X.37:g.65486299A>T	ENSP00000343939:p.Ile1088Phe		B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Missense_Mutation	SNP	pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Cupredoxin	p.I1142F	ENST00000343002.2	37	c.3424		X	.	.	.	.	.	.	.	.	.	.	A	1.201	-0.632520	0.03584	.	.	ENSG00000089472	ENST00000519389;ENST00000374727;ENST00000336279;ENST00000441993;ENST00000419594;ENST00000343002	D;D;D;D;D;D	0.99239	-5.59;-5.57;-5.58;-5.61;-5.58;-5.57	5.01	1.02	0.19986	.	0.467692	0.17768	N	0.162680	D	0.96049	0.8713	L	0.27053	0.805	0.09310	N	1	B;B;B	0.20164	0.0;0.042;0.0	B;B;B	0.15484	0.0;0.013;0.0	D	0.92275	0.5828	10	0.54805	T	0.06	.	2.7747	0.05344	0.485:0.0:0.1659:0.3491	.	1142;899;1088	E9PHN8;E7ES21;Q9BQS7	.;.;HEPH_HUMAN	F	1142;1091;821;1090;899;1088	ENSP00000430620:I1142F;ENSP00000363859:I1091F;ENSP00000337418:I821F;ENSP00000411687:I1090F;ENSP00000413211:I899F;ENSP00000343939:I1088F	ENSP00000337418:I821F	I	+	1	0	HEPH	65403024	0.011000	0.17503	0.025000	0.17156	0.014000	0.08584	0.222000	0.17699	0.195000	0.20347	0.486000	0.48141	ATT	HEPH	-	NULL		0.448	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	HEPH	HGNC	protein_coding	OTTHUMT00000056995.1	A	NM_138737		65486299	+1	no_errors	ENST00000519389	ensembl	human	known	70_37	missense	SNP	0.005	T
HIVEP1	3096	genome.wustl.edu	37	6	12164662	12164662	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr6:12164662G>A	ENST00000379388.2	+	9	8457	c.8125G>A	c.(8125-8127)Gat>Aat	p.D2709N	HIVEP1_ENST00000541134.1_Missense_Mutation_p.D574N	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	2709					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				GAGCAGCGATGATGACGAGGA	0.478																																																	0													41.0	45.0	44.0					6																	12164662		2178	4281	6459	SO:0001583	missense	3096			J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.8125G>A	6.37:g.12164662G>A	ENSP00000368698:p.Asp2709Asn		B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D2709N	ENST00000379388.2	37	c.8125	CCDS43426.1	6	.	.	.	.	.	.	.	.	.	.	G	22.1	4.241582	0.79912	.	.	ENSG00000095951	ENST00000379388;ENST00000541134;ENST00000542327	T;T	0.44482	2.43;0.92	5.71	5.71	0.89125	.	0.439400	0.16839	N	0.197412	T	0.51719	0.1691	M	0.66939	2.045	0.80722	D	1	D	0.61697	0.99	P	0.54401	0.751	T	0.55444	-0.8140	10	0.87932	D	0	-12.601	19.8498	0.96734	0.0:0.0:1.0:0.0	.	2709	P15822	ZEP1_HUMAN	N	2709;574;691	ENSP00000368698:D2709N;ENSP00000445617:D574N	ENSP00000368698:D2709N	D	+	1	0	HIVEP1	12272648	1.000000	0.71417	0.683000	0.30040	0.431000	0.31685	9.189000	0.94928	2.704000	0.92352	0.591000	0.81541	GAT	HIVEP1	-	NULL		0.478	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP1	HGNC	protein_coding	OTTHUMT00000039870.2	G	NM_002114		12164662	+1	no_errors	ENST00000379388	ensembl	human	known	70_37	missense	SNP	1.000	A
HMGB1P5	10354	genome.wustl.edu	37	3	22423698	22423698	+	RNA	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr3:22423698G>A	ENST00000451497.1	+	0	263									high mobility group box 1 pseudogene 5																		AAGAAACTGGGAGAGATGTGG	0.463																																																	0																																												10354			AF076677		3p24	2011-09-21	2011-04-05	2010-10-15	ENSG00000132967	ENSG00000132967		"""High mobility group / HMG-box pseudogenes"""	4997	pseudogene	pseudogene			"""high-mobility group (nonhistone chromosomal) protein 1-like 5"", ""high-mobility group (nonhistone chromosomal) protein 1-like 5 pseudogene"", ""high-mobility group box 1-like 5 pseudogene"", ""high-mobility group box 1-like 15"", ""high-mobility group box 1 pseudogene 2"", ""high-mobility group box 1-like 5"", ""high-mobility group box 1 pseudogene 5"""	HMG1L5, HMGB1L15, HMGB1P2, HMGB1L5		9925949	Standard	NG_000897		Approved				OTTHUMG00000155591		3.37:g.22423698G>A				RNA	SNP	-	NULL	ENST00000451497.1	37	NULL		3																																																																																			HMGB1P5	-	-		0.463	HMGB1P5-002	KNOWN	basic	processed_transcript	HMGB1P5	HGNC	pseudogene	OTTHUMT00000340803.1	G	NG_000897		22423698	+1	no_errors	ENST00000451497	ensembl	human	known	70_37	rna	SNP	1.000	A
HNF1B	6928	genome.wustl.edu	37	17	36099473	36099473	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr17:36099473G>C	ENST00000225893.4	-	2	863	c.502C>G	c.(502-504)Ctg>Gtg	p.L168V	HNF1B_ENST00000560016.1_Missense_Mutation_p.L168V|HNF1B_ENST00000561193.1_Missense_Mutation_p.L168V|HNF1B_ENST00000427275.2_Missense_Mutation_p.L168V	NM_000458.2|NM_001165923.1	NP_000449.1|NP_001159395.1	P35680	HNF1B_HUMAN	HNF1 homeobox B	168					anterior/posterior pattern specification (GO:0009952)|branching morphogenesis of an epithelial tube (GO:0048754)|embryonic digestive tract morphogenesis (GO:0048557)|endocrine pancreas development (GO:0031018)|endodermal cell fate specification (GO:0001714)|epithelial cell proliferation (GO:0050673)|genitalia development (GO:0048806)|hepatoblast differentiation (GO:0061017)|hindbrain development (GO:0030902)|inner cell mass cell differentiation (GO:0001826)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|mesonephric duct formation (GO:0072181)|negative regulation of mesenchymal cell apoptotic process involved in mesonephric nephron morphogenesis (GO:0061296)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric nephron tubule development (GO:0039020)|pronephros development (GO:0048793)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of endodermal cell fate specification (GO:0042663)|regulation of pronephros size (GO:0035565)|regulation of Wnt signaling pathway (GO:0030111)|response to glucose (GO:0009749)|ureteric bud elongation (GO:0060677)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(3)|large_intestine(2)|liver(1)|lung(3)|ovary(3)|prostate(1)|skin(2)	28		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			CAGGTGTACAGAGCGGCACGC	0.582																																					Colon(71;102 1179 9001 27917 43397)												0													170.0	148.0	155.0					17																	36099473		2203	4300	6503	SO:0001583	missense	6928			BC017714	CCDS11324.1, CCDS58538.1	17q12	2014-05-06	2007-08-24	2007-08-24	ENSG00000108753	ENSG00000275410		"""Homeoboxes / HNF class"""	11630	protein-coding gene	gene with protein product		189907	"""transcription factor 2, hepatic; LF-B3; variant hepatic nuclear factor"""	TCF2		1677179, 10484768	Standard	NM_000458		Approved	LFB3, VHNF1, HNF1beta, MODY5	uc002hok.4	P35680	OTTHUMG00000188478	ENST00000225893.4:c.502C>G	17.37:g.36099473G>C	ENSP00000225893:p.Leu168Val		B4DKM3|E0YMJ9	Missense_Mutation	SNP	pfam_HNF1b_C,pfam_HNF-1_N,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_HNF1_dimer_dom,smart_Homeodomain,pfscan_Homeodomain	p.L168V	ENST00000225893.4	37	c.502	CCDS11324.1	17	.	.	.	.	.	.	.	.	.	.	G	21.7	4.180961	0.78677	.	.	ENSG00000108753	ENST00000225893;ENST00000427275;ENST00000544593;ENST00000539087	D;D	0.99239	-5.61;-5.61	5.96	5.0	0.66597	Hepatocyte nuclear factor 1, N-terminal (1);Lambda repressor-like, DNA-binding (2);	0.000000	0.85682	D	0.000000	D	0.99269	0.9745	M	0.80982	2.52	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.91635	0.999;0.998	D	0.99509	1.0955	10	0.87932	D	0	-8.6006	10.3951	0.44196	0.1475:0.0:0.8525:0.0	.	168;168	E0YMJ6;P35680	.;HNF1B_HUMAN	V	168;168;168;56	ENSP00000225893:L168V;ENSP00000412212:L168V	ENSP00000225893:L168V	L	-	1	2	HNF1B	33173586	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.637000	0.83313	1.535000	0.49220	0.655000	0.94253	CTG	HNF1B	-	pfam_HNF-1_N,superfamily_Lambda_DNA-bd_dom		0.582	HNF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF1B	HGNC	protein_coding	OTTHUMT00000256807.3	G	NM_000458		36099473	-1	no_errors	ENST00000225893	ensembl	human	known	70_37	missense	SNP	1.000	C
HSPB7	27129	genome.wustl.edu	37	1	16344400	16344400	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:16344400G>C	ENST00000311890.9	-	1	885	c.59C>G	c.(58-60)tCt>tGt	p.S20C	HSPB7_ENST00000406363.2_Missense_Mutation_p.S20C|HSPB7_ENST00000411503.1_Missense_Mutation_p.S20C|HSPB7_ENST00000487046.1_Missense_Mutation_p.S20C|HSPB7_ENST00000375718.4_Intron|HSPB7_ENST00000545268.1_Missense_Mutation_p.S20C	NM_014424.4	NP_055239.1	Q9UBY9	HSPB7_HUMAN	heat shock 27kDa protein family, member 7 (cardiovascular)	20	Poly-Ser.|Required for localization to SC35 splicing speckles.				regulation of heart contraction (GO:0008016)|response to unfolded protein (GO:0006986)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)			breast(1)|large_intestine(1)|liver(1)|lung(6)|skin(1)	10		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.21e-08)|COAD - Colon adenocarcinoma(227;5.5e-06)|BRCA - Breast invasive adenocarcinoma(304;9.08e-05)|Kidney(64;0.000162)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		ggaggaggaagaggaagagga	0.652																																																	0													45.0	44.0	44.0					1																	16344400		2203	4300	6503	SO:0001583	missense	27129			AF155908	CCDS30611.1	1p36.23-p34.3	2011-09-02	2002-08-29		ENSG00000173641	ENSG00000173641		"""Heat shock proteins / HSPB"""	5249	protein-coding gene	gene with protein product		610692	"""heat shock 27kD protein family, member 7 (cardiovascular)"""			10593960	Standard	NM_014424		Approved	cvHSP	uc001axo.2	Q9UBY9	OTTHUMG00000009531	ENST00000311890.9:c.59C>G	1.37:g.16344400G>C	ENSP00000310111:p.Ser20Cys		B3KQ37|C9K0Y0|Q9NU17	Missense_Mutation	SNP	pfam_a-crystallin/Hsp20_dom,superfamily_HSP20-like_chaperone,pfscan_a-crystallin/Hsp20_dom,prints_Alpha-crystallin/HSP	p.S20C	ENST00000311890.9	37	c.59	CCDS30611.1	1	.	.	.	.	.	.	.	.	.	.	G	15.04	2.716695	0.48622	.	.	ENSG00000173641	ENST00000411503;ENST00000311890;ENST00000375714;ENST00000487046;ENST00000406363;ENST00000545268	D;D;D;D	0.95447	-3.03;-3.03;-3.71;-3.06	3.3	3.3	0.37823	.	0.000000	0.36482	N	0.002576	D	0.92371	0.7579	N	0.24115	0.695	0.21697	N	0.999581	D;D;D;B	0.63046	0.992;0.992;0.992;0.44	P;P;P;B	0.51355	0.667;0.667;0.667;0.308	D	0.85926	0.1449	10	0.39692	T	0.17	-5.5267	11.0613	0.47948	0.0:0.1908:0.8092:0.0	.	46;46;108;20	Q7Z3C1;Q5T5Q1;Q5T5Q2;Q9UBY9	.;.;.;HSPB7_HUMAN	C	20;20;108;20;20;20	ENSP00000391578:S20C;ENSP00000310111:S20C;ENSP00000419477:S20C;ENSP00000385472:S20C	ENSP00000310111:S20C	S	-	2	0	HSPB7	16216987	0.868000	0.29978	0.618000	0.29105	0.713000	0.41058	4.556000	0.60775	2.145000	0.66743	0.407000	0.27541	TCT	HSPB7	-	NULL		0.652	HSPB7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HSPB7	HGNC	protein_coding	OTTHUMT00000026334.2	G	NM_014424		16344400	-1	no_errors	ENST00000487046	ensembl	human	known	70_37	missense	SNP	0.317	C
HSPG2	3339	genome.wustl.edu	37	1	22202144	22202144	+	Missense_Mutation	SNP	C	C	T	rs200196481		TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:22202144C>T	ENST00000374695.3	-	25	3359	c.3280G>A	c.(3280-3282)Gcc>Acc	p.A1094T		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	1094	Laminin IV type A 2. {ECO:0000255|PROSITE-ProRule:PRU00458}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GGCTGCTGGGCGTAGGATGCT	0.667													C|||	1	0.000199681	0.0	0.0	5008	,	,		16758	0.0		0.001	False		,,,				2504	0.0																0													68.0	74.0	72.0					1																	22202144		2203	4300	6503	SO:0001583	missense	3339			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.3280G>A	1.37:g.22202144C>T	ENSP00000363827:p.Ala1094Thr		Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Laminin_G,pfam_Laminin_B_type_IV,pfam_EGF_laminin,pfam_LDrepeatLR_classA_rpt,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_SEA,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Laminin_B_subgr,smart_EGF_laminin,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_LDrepeatLR_classA_rpt,pfscan_SEA,pfscan_Ig-like	p.A1094T	ENST00000374695.3	37	c.3280	CCDS30625.1	1	.	.	.	.	.	.	.	.	.	.	C	0.031	-1.336048	0.01287	.	.	ENSG00000142798	ENST00000374695	T	0.35973	1.28	5.44	1.81	0.25067	Laminin B type IV (2);Laminin B, subgroup (1);	1.276010	0.05726	N	0.598617	T	0.17408	0.0418	N	0.11313	0.125	0.25238	N	0.989779	B	0.11235	0.004	B	0.10450	0.005	T	0.22312	-1.0220	10	0.02654	T	1	.	6.4147	0.21710	0.0:0.3312:0.0:0.6688	.	1094	P98160	PGBM_HUMAN	T	1094	ENSP00000363827:A1094T	ENSP00000363827:A1094T	A	-	1	0	HSPG2	22074731	0.524000	0.26282	0.716000	0.30569	0.009000	0.06853	-0.042000	0.12063	0.380000	0.24823	-1.337000	0.01257	GCC	HSPG2	-	pfam_Laminin_B_type_IV,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV		0.667	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPG2	HGNC	protein_coding	OTTHUMT00000007598.1	C	NM_005529		22202144	-1	no_errors	ENST00000374695	ensembl	human	known	70_37	missense	SNP	0.994	T
INSRR	3645	genome.wustl.edu	37	1	156814526	156814526	+	Silent	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:156814526G>A	ENST00000368195.3	-	13	2943	c.2547C>T	c.(2545-2547)taC>taT	p.Y849Y	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	849	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					ACTTGATTTCGTACTTGAGGA	0.607																																																	0													72.0	71.0	71.0					1																	156814526		2203	4300	6503	SO:0001819	synonymous_variant	3645			J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.2547C>T	1.37:g.156814526G>A			O60724|Q5VZS3	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_insulin-like_rcpt,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Y849	ENST00000368195.3	37	c.2547	CCDS1160.1	1																																																																																			INSRR	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pirsf_Tyr_kinase_insulin-like_rcpt,pfscan_Fibronectin_type3		0.607	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INSRR	HGNC	protein_coding	OTTHUMT00000098929.1	G	NM_014215		156814526	-1	no_errors	ENST00000368195	ensembl	human	known	70_37	silent	SNP	0.979	A
IFI16	3428	genome.wustl.edu	37	1	159021543	159021543	+	Silent	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:159021543G>A	ENST00000295809.7	+	10	1995	c.1740G>A	c.(1738-1740)gtG>gtA	p.V580V	IFI16_ENST00000448393.2_Silent_p.V468V|IFI16_ENST00000368131.4_Silent_p.V524V|IFI16_ENST00000359709.3_Silent_p.V524V|IFI16_ENST00000340979.6_Silent_p.V468V|IFI16_ENST00000368132.3_Silent_p.V524V|IFI16_ENST00000430894.2_Silent_p.V528V			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	580	HIN-200 2. {ECO:0000255|PROSITE- ProRule:PRU00106}.|Interaction with TP53 core domain.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					TCAAAGAAGTGATGGTGCTGA	0.428																																																	0													89.0	92.0	91.0					1																	159021543		2203	4300	6503	SO:0001819	synonymous_variant	3428			M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	ENST00000295809.7:c.1740G>A	1.37:g.159021543G>A			B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Silent	SNP	pfam_HIN200/IF120x,pfam_DAPIN,superfamily_DEATH-like,pfscan_DAPIN,pfscan_HIN200/IF120x	p.V580	ENST00000295809.7	37	c.1740		1																																																																																			IFI16	-	pfam_HIN200/IF120x,pfscan_HIN200/IF120x		0.428	IFI16-013	KNOWN	basic	protein_coding	IFI16	HGNC	protein_coding	OTTHUMT00000421720.1	G	NM_005531		159021543	+1	no_errors	ENST00000295809	ensembl	human	known	70_37	silent	SNP	0.149	A
IFI16	3428	genome.wustl.edu	37	1	159021552	159021552	+	Silent	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:159021552G>A	ENST00000295809.7	+	10	2004	c.1749G>A	c.(1747-1749)ctG>ctA	p.L583L	IFI16_ENST00000448393.2_Silent_p.L471L|IFI16_ENST00000368131.4_Silent_p.L527L|IFI16_ENST00000359709.3_Silent_p.L527L|IFI16_ENST00000340979.6_Silent_p.L471L|IFI16_ENST00000368132.3_Silent_p.L527L|IFI16_ENST00000430894.2_Silent_p.L531L			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	583	HIN-200 2. {ECO:0000255|PROSITE- ProRule:PRU00106}.|Interaction with TP53 core domain.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					TGATGGTGCTGAACGCAACAG	0.428																																																	0													90.0	93.0	92.0					1																	159021552		2203	4300	6503	SO:0001819	synonymous_variant	3428			M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	ENST00000295809.7:c.1749G>A	1.37:g.159021552G>A			B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Silent	SNP	pfam_HIN200/IF120x,pfam_DAPIN,superfamily_DEATH-like,pfscan_DAPIN,pfscan_HIN200/IF120x	p.L583	ENST00000295809.7	37	c.1749		1																																																																																			IFI16	-	pfam_HIN200/IF120x,pfscan_HIN200/IF120x		0.428	IFI16-013	KNOWN	basic	protein_coding	IFI16	HGNC	protein_coding	OTTHUMT00000421720.1	G	NM_005531		159021552	+1	no_errors	ENST00000295809	ensembl	human	known	70_37	silent	SNP	0.592	A
HSD17B7	51478	genome.wustl.edu	37	1	162773227	162773227	+	Missense_Mutation	SNP	T	T	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:162773227T>G	ENST00000254521.3	+	6	704	c.649T>G	c.(649-651)Tat>Gat	p.Y217D	HSD17B7_ENST00000367917.3_Intron|HSD17B7_ENST00000485405.1_3'UTR	NM_016371.2	NP_057455.1	P56937	DHB7_HUMAN	hydroxysteroid (17-beta) dehydrogenase 7	217					cholesterol biosynthetic process (GO:0006695)|estrogen biosynthetic process (GO:0006703)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	3-keto sterol reductase activity (GO:0000253)|estradiol 17-beta-dehydrogenase activity (GO:0004303)			endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9	all_hematologic(112;0.115)					CTAGGGTCTCTATTCCAATGT	0.423																																																	0													73.0	65.0	67.0					1																	162773227		2203	4292	6495	SO:0001583	missense	51478			AF098786	CCDS1242.1	1q23	2011-09-14			ENSG00000132196	ENSG00000132196	1.1.1.270	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5215	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 37C, member 1"""	606756				10544267, 10419022, 19027726	Standard	NM_016371		Approved	PRAP, SDR37C1	uc001gci.3	P56937	OTTHUMG00000034420	ENST00000254521.3:c.649T>G	1.37:g.162773227T>G	ENSP00000254521:p.Tyr217Asp		Q5T246|Q7Z4V9|Q8WWS2|Q9UF00	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH	p.Y217D	ENST00000254521.3	37	c.649	CCDS1242.1	1	.	.	.	.	.	.	.	.	.	.	T	15.69	2.907763	0.52333	.	.	ENSG00000132196	ENST00000254521	T	0.77098	-1.07	4.68	4.68	0.58851	NAD(P)-binding domain (1);	0.177641	0.50627	D	0.000101	D	0.82287	0.5004	M	0.79475	2.455	0.34533	D	0.709429	D	0.71674	0.998	D	0.63381	0.914	D	0.85029	0.0916	9	0.56958	D	0.05	-22.8921	11.8987	0.52671	0.0:0.0:0.0:1.0	.	217	P56937	DHB7_HUMAN	D	217	ENSP00000254521:Y217D	ENSP00000254521:Y217D	Y	+	1	0	HSD17B7	161039851	1.000000	0.71417	0.992000	0.48379	0.134000	0.20937	7.392000	0.79840	2.084000	0.62774	0.528000	0.53228	TAT	HSD17B7	-	prints_Glc/ribitol_DH		0.423	HSD17B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B7	HGNC	protein_coding	OTTHUMT00000083207.1	T	NM_016371		162773227	+1	no_errors	ENST00000254521	ensembl	human	known	70_37	missense	SNP	1.000	G
ITCH	83737	genome.wustl.edu	37	20	33030037	33030037	+	Silent	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr20:33030037C>T	ENST00000262650.6	+	11	1153	c.1017C>T	c.(1015-1017)caC>caT	p.H339H	ITCH_ENST00000535650.1_Silent_p.H188H|ITCH-AS1_ENST00000454205.1_RNA|ITCH_ENST00000374864.4_Silent_p.H298H			Q96J02	ITCH_HUMAN	itchy E3 ubiquitin protein ligase	339	WW 1. {ECO:0000255|PROSITE- ProRule:PRU00224}.				apoptotic process (GO:0006915)|defense response to virus (GO:0051607)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of defense response to virus (GO:0050687)|negative regulation of JNK cascade (GO:0046329)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cell growth (GO:0001558)|regulation of protein deubiquitination (GO:0090085)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	CXCR chemokine receptor binding (GO:0045236)|ligase activity (GO:0016874)|ribonucleoprotein complex binding (GO:0043021)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(9)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(13)|skin(1)|upper_aerodigestive_tract(1)	36						TGGACCAGCACGGGCGAGTTT	0.378																																																	0													101.0	102.0	102.0					20																	33030037		2203	4300	6503	SO:0001819	synonymous_variant	83737			AF095745	CCDS13234.1, CCDS58768.1, CCDS58769.1	20q11.22	2014-09-17	2012-02-23		ENSG00000078747	ENSG00000078747			13890	protein-coding gene	gene with protein product		606409	"""itchy (mouse homolog) E3 ubiquitin protein ligase"", ""itchy E3 ubiquitin protein ligase homolog (mouse)"""			11318614	Standard	NM_001257137		Approved	AIP4	uc010geu.2	Q96J02	OTTHUMG00000032300	ENST00000262650.6:c.1017C>T	20.37:g.33030037C>T			A6NEW4|B4E234|E1P5P3|F5H217|O43584|Q5QP37|Q5TEL0|Q96F66|Q9BY75|Q9H451|Q9H4U5	Silent	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_WW_Rsp5_WWP,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.H339	ENST00000262650.6	37	c.1017	CCDS58768.1	20																																																																																			ITCH	-	pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP		0.378	ITCH-002	KNOWN	basic|CCDS	protein_coding	ITCH	HGNC	protein_coding	OTTHUMT00000078783.2	C			33030037	+1	no_errors	ENST00000262650	ensembl	human	known	70_37	silent	SNP	1.000	T
JAM3	83700	genome.wustl.edu	37	11	134014899	134014899	+	Intron	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr11:134014899C>G	ENST00000299106.4	+	5	771				JAM3_ENST00000441717.3_Intron|JAM3_ENST00000529443.2_Intron			Q9BX67	JAM3_HUMAN	junctional adhesion molecule 3						adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|establishment of cell polarity (GO:0030010)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|myelination (GO:0042552)|myeloid progenitor cell differentiation (GO:0002318)|neutrophil homeostasis (GO:0001780)|regulation of actin cytoskeleton organization by cell-cell adhesion (GO:0090138)|regulation of neutrophil chemotaxis (GO:0090022)|spermatid development (GO:0007286)|transmission of nerve impulse (GO:0019226)	cell-cell contact zone (GO:0044291)|desmosome (GO:0030057)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|paranodal junction (GO:0033010)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	integrin binding (GO:0005178)			breast(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)	10	all_hematologic(175;0.127)	all_cancers(12;1.06e-21)|all_epithelial(12;3.37e-16)|all_lung(97;7.03e-06)|Lung NSC(97;1.67e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0506)|Esophageal squamous(93;0.0566)		Epithelial(10;1.55e-09)|BRCA - Breast invasive adenocarcinoma(10;1.35e-08)|all cancers(11;2.81e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00402)|Lung(977;0.245)		GGTAAGATCTCTTCTAAGAGG	0.428																																																	0													84.0	73.0	77.0					11																	134014899		2201	4297	6498	SO:0001627	intron_variant	83700			AF356518	CCDS8494.1, CCDS55799.1, CCDS8494.2	11q25	2013-01-29			ENSG00000166086	ENSG00000166086		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15532	protein-coding gene	gene with protein product		606871					Standard	NM_032801		Approved	JAM-C, JAMC	uc001qhb.3	Q9BX67	OTTHUMG00000167130	ENST00000299106.4:c.612+10C>G	11.37:g.134014899C>G			B3KWG9|Q8WWL8|Q96FL1	RNA	SNP	-	NULL	ENST00000299106.4	37	NULL	CCDS8494.2	11	.	.	.	.	.	.	.	.	.	.	C	14.76	2.632907	0.47049	.	.	ENSG00000166086	ENST00000532165	.	.	.	4.47	1.99	0.26369	.	.	.	.	.	T	0.23766	0.0575	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.14699	-1.0463	4	.	.	.	.	3.6563	0.08222	0.0:0.5737:0.2486:0.1777	.	.	.	.	V	54	.	.	L	+	1	0	JAM3	133520109	0.000000	0.05858	0.036000	0.18154	0.994000	0.84299	0.268000	0.18571	2.051000	0.60960	0.551000	0.68910	CTT	JAM3	-	-		0.428	JAM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	JAM3	HGNC	protein_coding	OTTHUMT00000393303.4	C	NM_032801		134014899	+1	no_errors	ENST00000532165	ensembl	human	known	70_37	rna	SNP	0.001	G
KLHL41	10324	genome.wustl.edu	37	2	170366664	170366664	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr2:170366664C>T	ENST00000284669.1	+	1	453	c.376C>T	c.(376-378)Ctt>Ttt	p.L126F	RP11-724O16.1_ENST00000513963.1_Intron|BBS5_ENST00000554017.1_Intron	NM_006063.2	NP_006054.2	O60662	KLH41_HUMAN	kelch-like family member 41	126					myofibril assembly (GO:0030239)|protein ubiquitination (GO:0016567)|regulation of lateral pseudopodium assembly (GO:0031275)|regulation of myoblast differentiation (GO:0045661)|regulation of myoblast proliferation (GO:2000291)|regulation of skeletal muscle cell differentiation (GO:2001014)|skeletal muscle cell differentiation (GO:0035914)|striated muscle contraction (GO:0006941)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|M band (GO:0031430)|pseudopodium (GO:0031143)											CGTTTCTTATCTTCAGAAAAG	0.458																																																	0													117.0	129.0	125.0					2																	170366664		2203	4300	6503	SO:0001583	missense	10324			AF056929	CCDS2234.1	2q31.1	2013-02-22	2013-02-22	2013-01-08	ENSG00000239474	ENSG00000239474		"""Kelch-like"", ""BTB/POZ domain containing"""	16905	protein-coding gene	gene with protein product	"""sarcomeric muscle protein"""	607701	"""kelch repeat and BTB (POZ) domain containing 10"", ""kelch-like 41 (Drosophila)"""	KBTBD10		9655184	Standard	NM_006063		Approved	SARCOSIN, Krp1	uc002ueu.1	O60662	OTTHUMG00000132205	ENST00000284669.1:c.376C>T	2.37:g.170366664C>T	ENSP00000284669:p.Leu126Phe		Q53R42	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.L126F	ENST00000284669.1	37	c.376	CCDS2234.1	2	.	.	.	.	.	.	.	.	.	.	C	21.0	4.085768	0.76642	.	.	ENSG00000239474	ENST00000284669	D	0.83075	-1.68	5.17	5.17	0.71159	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.92466	0.7608	M	0.86343	2.81	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93684	0.7001	10	0.87932	D	0	.	18.6673	0.91495	0.0:1.0:0.0:0.0	.	126	O60662	KBTBA_HUMAN	F	126	ENSP00000284669:L126F	ENSP00000284669:L126F	L	+	1	0	KBTBD10	170074910	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.411000	0.81874	0.585000	0.79938	CTT	KBTBD10	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin		0.458	KLHL41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD10	HGNC	protein_coding	OTTHUMT00000255263.1	C	NM_006063		170366664	+1	no_errors	ENST00000284669	ensembl	human	known	70_37	missense	SNP	1.000	T
KIAA0100	9703	genome.wustl.edu	37	17	26969347	26969347	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr17:26969347G>C	ENST00000528896.2	-	6	596	c.522C>G	c.(520-522)atC>atG	p.I174M	KIAA0100_ENST00000544884.1_Missense_Mutation_p.I31M|KIAA0100_ENST00000389003.3_Missense_Mutation_p.I31M	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	174						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					TCACCTCACAGATTAGCCTGG	0.512																																																	0													81.0	75.0	77.0					17																	26969347		2203	4300	6503	SO:0001583	missense	9703			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.522C>G	17.37:g.26969347G>C	ENSP00000436773:p.Ile174Met		A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	pfam_FMP27_C,pfam_FMP27_N,pfam_FMP27_GFWDK_dom	p.I174M	ENST00000528896.2	37	c.522	CCDS32595.1	17	.	.	.	.	.	.	.	.	.	.	G	11.31	1.601518	0.28534	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.22539	1.95;1.96	4.29	1.01	0.19927	FMP27, N-terminal (1);	0.624751	0.18570	N	0.137362	T	0.08492	0.0211	N	0.08118	0	0.22354	N	0.99918	P;B;P	0.41345	0.746;0.044;0.555	B;B;B	0.38562	0.276;0.04;0.2	T	0.16748	-1.0392	10	0.52906	T	0.07	.	3.1328	0.06429	0.1628:0.117:0.56:0.1603	.	31;174;174	Q14667-4;F6XS94;Q14667	.;.;K0100_HUMAN	M	174;174;174;31	ENSP00000436773:I174M;ENSP00000446443:I31M	ENSP00000005905:I174M	I	-	3	3	KIAA0100	23993474	1.000000	0.71417	0.940000	0.37924	0.950000	0.60333	0.984000	0.29565	0.050000	0.15949	-0.291000	0.09656	ATC	KIAA0100	-	pfam_FMP27_N		0.512	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0100	HGNC	protein_coding	OTTHUMT00000390571.3	G	NM_014680		26969347	-1	no_errors	ENST00000005905	ensembl	human	known	70_37	missense	SNP	0.993	C
KIAA0100	9703	genome.wustl.edu	37	17	26969920	26969920	+	Missense_Mutation	SNP	C	C	G	rs137954415		TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr17:26969920C>G	ENST00000528896.2	-	5	556	c.482G>C	c.(481-483)aGa>aCa	p.R161T	KIAA0100_ENST00000544884.1_Missense_Mutation_p.R18T|KIAA0100_ENST00000389003.3_Missense_Mutation_p.R18T	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	161						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					AAATCTGCTTCTACTGATCTG	0.453																																																	0													121.0	113.0	116.0					17																	26969920		2203	4300	6503	SO:0001583	missense	9703			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.482G>C	17.37:g.26969920C>G	ENSP00000436773:p.Arg161Thr		A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	pfam_FMP27_C,pfam_FMP27_N,pfam_FMP27_GFWDK_dom	p.R161T	ENST00000528896.2	37	c.482	CCDS32595.1	17	.	.	.	.	.	.	.	.	.	.	C	13.08	2.130990	0.37630	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.22945	1.97;1.93	5.52	4.51	0.55191	FMP27, N-terminal (1);	0.337902	0.35262	N	0.003335	T	0.15219	0.0367	N	0.24115	0.695	0.22961	N	0.998507	P;B;B	0.37276	0.589;0.145;0.009	B;B;B	0.39027	0.288;0.05;0.022	T	0.14144	-1.0483	10	0.15952	T	0.53	.	6.1036	0.20061	0.0:0.6056:0.0:0.3943	.	18;161;161	Q14667-4;F6XS94;Q14667	.;.;K0100_HUMAN	T	161;161;161;18	ENSP00000436773:R161T;ENSP00000446443:R18T	ENSP00000005905:R161T	R	-	2	0	KIAA0100	23994047	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.520000	0.35899	1.157000	0.42530	0.655000	0.94253	AGA	KIAA0100	-	pfam_FMP27_N		0.453	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0100	HGNC	protein_coding	OTTHUMT00000390571.3	C	NM_014680		26969920	-1	no_errors	ENST00000005905	ensembl	human	known	70_37	missense	SNP	0.995	G
KIAA0100	9703	genome.wustl.edu	37	17	26970223	26970223	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr17:26970223C>T	ENST00000528896.2	-	4	429	c.355G>A	c.(355-357)Gaa>Aaa	p.E119K	KIAA0100_ENST00000544884.1_5'UTR|KIAA0100_ENST00000389003.3_5'UTR	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	119						extracellular region (GO:0005576)		p.K118_E119>N*(1)|p.E119*(1)		breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					AAGGACAGTTCCTTTTGATCC	0.493																																																	2	Substitution - Nonsense(1)|Complex - compound substitution(1)	lung(2)											121.0	126.0	124.0					17																	26970223		2203	4300	6503	SO:0001583	missense	9703			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.355G>A	17.37:g.26970223C>T	ENSP00000436773:p.Glu119Lys		A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	pfam_FMP27_C,pfam_FMP27_N,pfam_FMP27_GFWDK_dom	p.E119K	ENST00000528896.2	37	c.355	CCDS32595.1	17	.	.	.	.	.	.	.	.	.	.	C	11.96	1.793262	0.31685	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896	T	0.21734	1.99	5.53	3.5	0.40072	FMP27, N-terminal (1);	0.397955	0.30959	N	0.008529	T	0.09949	0.0244	N	0.12182	0.205	0.46564	D	0.999108	B;B	0.09022	0.002;0.001	B;B	0.09377	0.004;0.002	T	0.15983	-1.0418	10	0.18276	T	0.48	.	7.6658	0.28430	0.1642:0.7534:0.0:0.0825	.	119;119	F6XS94;Q14667	.;K0100_HUMAN	K	119	ENSP00000436773:E119K	ENSP00000005905:E119K	E	-	1	0	KIAA0100	23994350	0.583000	0.26757	0.961000	0.40146	0.956000	0.61745	1.504000	0.35726	1.295000	0.44724	0.563000	0.77884	GAA	KIAA0100	-	pfam_FMP27_N		0.493	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0100	HGNC	protein_coding	OTTHUMT00000390571.3	C	NM_014680		26970223	-1	no_errors	ENST00000005905	ensembl	human	known	70_37	missense	SNP	0.627	T
KIAA0100	9703	genome.wustl.edu	37	17	26970293	26970293	+	Silent	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr17:26970293G>A	ENST00000528896.2	-	4	359	c.285C>T	c.(283-285)atC>atT	p.I95I	KIAA0100_ENST00000544884.1_5'UTR|KIAA0100_ENST00000389003.3_5'UTR	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	95						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					GGTCCGTTCTGATACGCACTT	0.517																																																	0													121.0	124.0	123.0					17																	26970293		2203	4300	6503	SO:0001819	synonymous_variant	9703			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.285C>T	17.37:g.26970293G>A			A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Nonsense_Mutation	SNP	NULL	p.Q79*	ENST00000528896.2	37	c.235	CCDS32595.1	17																																																																																			KIAA0100	-	NULL		0.517	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0100	HGNC	protein_coding	OTTHUMT00000390571.3	G	NM_014680		26970293	-1	no_errors	ENST00000583403	ensembl	human	known	70_37	nonsense	SNP	1.000	A
KIAA0754	643314	genome.wustl.edu	37	1	39878795	39878795	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:39878795C>T	ENST00000530275.1	+	1	2645	c.2450C>T	c.(2449-2451)cCa>cTa	p.P817L	MACF1_ENST00000564288.1_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000567887.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000289893.4_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000372915.3_Intron|MACF1_ENST00000361689.2_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	817	Ala-rich.									central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GGGTTCTCCCCAGAGTGGGCT	0.577																																																	0													24.0	27.0	26.0					1																	39878795		2042	4188	6230	SO:0001583	missense	643314					1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.2450C>T	1.37:g.39878795C>T	ENSP00000431179:p.Pro817Leu		E9PMC2|Q6ZSB2	Missense_Mutation	SNP	NULL	p.P817L	ENST00000530275.1	37	c.2450		1	.	.	.	.	.	.	.	.	.	.	C	11.59	1.684741	0.29872	.	.	ENSG00000255103	ENST00000530275	T	0.34472	1.36	2.88	-0.353	0.12594	.	.	.	.	.	T	0.21468	0.0517	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.20472	-1.0274	9	0.59425	D	0.04	.	6.9848	0.24723	0.0:0.6451:0.0:0.3549	.	817	O94854	K0754_HUMAN	L	817	ENSP00000431179:P817L	ENSP00000431179:P817L	P	+	2	0	RP4-562N20.1	39651382	0.000000	0.05858	0.001000	0.08648	0.104000	0.19210	0.516000	0.22817	-0.212000	0.10109	0.561000	0.74099	CCA	KIAA0754	-	NULL		0.577	KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	KIAA0754	HGNC	protein_coding	OTTHUMT00000392100.1	C	NM_015038		39878795	+1	no_errors	ENST00000530275	ensembl	human	known	70_37	missense	SNP	0.003	T
KIAA0754	643314	genome.wustl.edu	37	1	39878942	39878942	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:39878942C>T	ENST00000530275.1	+	1	2792	c.2597C>T	c.(2596-2598)tCc>tTc	p.S866F	MACF1_ENST00000564288.1_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000567887.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000289893.4_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000372915.3_Intron|MACF1_ENST00000361689.2_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	866	Ala-rich.									central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GAGCCCGCCTCCCCAGCTGCT	0.677																																																	0													16.0	19.0	18.0					1																	39878942		1918	4116	6034	SO:0001583	missense	643314					1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.2597C>T	1.37:g.39878942C>T	ENSP00000431179:p.Ser866Phe		E9PMC2|Q6ZSB2	Missense_Mutation	SNP	NULL	p.S866F	ENST00000530275.1	37	c.2597		1	.	.	.	.	.	.	.	.	.	.	C	12.36	1.913928	0.33815	.	.	ENSG00000255103	ENST00000530275	T	0.25085	1.82	4.48	-2.51	0.06365	.	.	.	.	.	T	0.12689	0.0308	N	0.14661	0.345	0.09310	N	1	P	0.39157	0.662	B	0.33196	0.159	T	0.18241	-1.0343	9	0.72032	D	0.01	.	10.0951	0.42471	0.0:0.4584:0.0:0.5416	.	866	O94854	K0754_HUMAN	F	866	ENSP00000431179:S866F	ENSP00000431179:S866F	S	+	2	0	RP4-562N20.1	39651529	0.008000	0.16893	0.000000	0.03702	0.193000	0.23685	-0.229000	0.09098	-0.335000	0.08451	-0.448000	0.05591	TCC	KIAA0754	-	NULL		0.677	KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	KIAA0754	HGNC	protein_coding	OTTHUMT00000392100.1	C	NM_015038		39878942	+1	no_errors	ENST00000530275	ensembl	human	known	70_37	missense	SNP	0.000	T
CEP162	22832	genome.wustl.edu	37	6	84836213	84836213	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr6:84836213C>T	ENST00000403245.3	-	26	4003	c.3889G>A	c.(3889-3891)Gaa>Aaa	p.E1297K	KIAA1009_ENST00000461137.1_5'UTR|KIAA1009_ENST00000257766.4_Missense_Mutation_p.E1221K	NM_014895.2	NP_055710.2														breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	43		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		TCTCTCAATTCTTCTAAGAGT	0.303																																																	0													89.0	80.0	83.0					6																	84836213		2193	4280	6473	SO:0001583	missense	22832																														ENST00000403245.3:c.3889G>A	6.37:g.84836213C>T	ENSP00000385215:p.Glu1297Lys			Missense_Mutation	SNP	NULL	p.E1297K	ENST00000403245.3	37	c.3889	CCDS34494.2	6	.	.	.	.	.	.	.	.	.	.	C	22.4	4.290288	0.80914	.	.	ENSG00000135315	ENST00000257766;ENST00000403245	T;T	0.22945	1.93;1.93	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.37785	0.1016	L	0.49699	1.58	0.49687	D	0.999814	D	0.71674	0.998	D	0.80764	0.994	T	0.05903	-1.0857	10	0.42905	T	0.14	-20.9202	18.4242	0.90604	0.0:1.0:0.0:0.0	.	1297	Q5TB80	QN1_HUMAN	K	1221;1297	ENSP00000257766:E1221K;ENSP00000385215:E1297K	ENSP00000257766:E1221K	E	-	1	0	KIAA1009	84892932	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	6.226000	0.72277	2.430000	0.82344	0.655000	0.94253	GAA	KIAA1009	-	NULL		0.303	KIAA1009-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIAA1009	HGNC	protein_coding	OTTHUMT00000317315.1	C			84836213	-1	no_errors	ENST00000403245	ensembl	human	known	70_37	missense	SNP	1.000	T
KIAA1377	57562	genome.wustl.edu	37	11	101818816	101818816	+	Missense_Mutation	SNP	C	C	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr11:101818816C>A	ENST00000263468.8	+	4	719	c.449C>A	c.(448-450)tCc>tAc	p.S150Y		NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	150										breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		ATTCAGGAATCCAACTTAAAA	0.343																																																	0													89.0	87.0	88.0					11																	101818816		2203	4299	6502	SO:0001583	missense	57562			AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.449C>A	11.37:g.101818816C>A	ENSP00000263468:p.Ser150Tyr		Q4G0U6	Missense_Mutation	SNP	NULL	p.S150Y	ENST00000263468.8	37	c.449	CCDS31658.1	11	.	.	.	.	.	.	.	.	.	.	C	15.97	2.988578	0.53934	.	.	ENSG00000110318	ENST00000263468	T	0.10573	2.86	5.4	3.51	0.40186	.	0.220870	0.38605	N	0.001632	T	0.21881	0.0527	M	0.76002	2.32	0.80722	D	1	P	0.52842	0.956	P	0.54100	0.742	T	0.00975	-1.1494	10	0.66056	D	0.02	-0.134	7.9759	0.30155	0.0:0.7528:0.0:0.2472	.	150	Q9P2H0	K1377_HUMAN	Y	150	ENSP00000263468:S150Y	ENSP00000263468:S150Y	S	+	2	0	KIAA1377	101324026	0.968000	0.33430	0.998000	0.56505	0.841000	0.47740	1.990000	0.40717	1.406000	0.46857	-0.136000	0.14681	TCC	KIAA1377	-	NULL		0.343	KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1377	HGNC	protein_coding	OTTHUMT00000394140.1	C	NM_020802		101818816	+1	no_errors	ENST00000263468	ensembl	human	known	70_37	missense	SNP	0.969	A
KIRREL	55243	genome.wustl.edu	37	1	158047909	158047909	+	Missense_Mutation	SNP	C	C	T	rs151150995		TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:158047909C>T	ENST00000359209.6	+	3	398	c.331C>T	c.(331-333)Cgg>Tgg	p.R111W	KIRREL_ENST00000392272.2_Missense_Mutation_p.R111W|KIRREL_ENST00000416935.2_Intron|KIRREL_ENST00000360089.4_Missense_Mutation_p.R50W|KIRREL_ENST00000368173.3_Missense_Mutation_p.R111W			Q96J84	KIRR1_HUMAN	kin of IRRE like (Drosophila)	111	Ig-like C2-type 1.				excretion (GO:0007588)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of actin filament polymerization (GO:0030838)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|dendritic shaft (GO:0043198)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	myosin binding (GO:0017022)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(5)|skin(3)|stomach(1)	38	all_hematologic(112;0.0378)					GCGCTCTCGGCGGGCCAAACT	0.612																																																	0								C	TRP/ARG	0,4406		0,0,2203	98.0	94.0	95.0		331	-0.7	1.0	1	dbSNP_134	95	1,8599	1.2+/-3.3	0,1,4299	yes	missense	KIRREL	NM_018240.5	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	111/758	158047909	1,13005	2203	4300	6503	SO:0001583	missense	55243			AK001707	CCDS1172.2, CCDS72952.1	1q21-q25	2013-01-29			ENSG00000183853	ENSG00000183853		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15734	protein-coding gene	gene with protein product	"""nephrin-like protein 1"""	607428				12424224	Standard	NM_001286349		Approved	NEPH1	uc001frn.4	Q96J84	OTTHUMG00000022438	ENST00000359209.6:c.331C>T	1.37:g.158047909C>T	ENSP00000352138:p.Arg111Trp		Q5W0F8|Q5XKC6|Q7Z696|Q7Z7N8|Q8TB15|Q9H9N1|Q9NVA5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R111W	ENST00000359209.6	37	c.331	CCDS1172.2	1	.	.	.	.	.	.	.	.	.	.	C	16.50	3.141851	0.57044	0.0	1.16E-4	ENSG00000183853	ENST00000360089;ENST00000368173;ENST00000392272;ENST00000359209	T;T;T;T	0.67698	1.64;-0.28;-0.28;-0.28	4.14	-0.732	0.11147	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.232481	0.20710	N	0.087120	T	0.68007	0.2954	M	0.75085	2.285	0.80722	D	1	D;D	0.71674	0.989;0.998	P;D	0.65010	0.822;0.931	T	0.69803	-0.5046	10	0.37606	T	0.19	-15.8239	11.8307	0.52293	0.7321:0.2679:0.0:0.0	.	50;111	Q5W0F9;Q96J84	.;KIRR1_HUMAN	W	50;111;111;111	ENSP00000353202:R50W;ENSP00000357155:R111W;ENSP00000376098:R111W;ENSP00000352138:R111W	ENSP00000352138:R111W	R	+	1	2	KIRREL	156314533	0.013000	0.17824	0.994000	0.49952	0.984000	0.73092	-0.229000	0.09098	0.075000	0.16796	0.467000	0.42956	CGG	KIRREL	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like		0.612	KIRREL-001	KNOWN	basic|CCDS	protein_coding	KIRREL	HGNC	protein_coding	OTTHUMT00000058342.3	C	NM_018240		158047909	+1	no_errors	ENST00000368173	ensembl	human	known	70_37	missense	SNP	0.974	T
KLHL14	57565	genome.wustl.edu	37	18	30257279	30257279	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr18:30257279C>G	ENST00000359358.4	-	8	2041	c.1603G>C	c.(1603-1605)Gat>Cat	p.D535H		NM_020805.1	NP_065856.1	Q9P2G3	KLH14_HUMAN	kelch-like family member 14	535						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(20)|ovary(2)	31						AGCATTACATCAAGGTGGGAG	0.443																																																	0													87.0	74.0	79.0					18																	30257279		2203	4300	6503	SO:0001583	missense	57565			AB037805	CCDS32813.1	18q12.1	2013-10-15	2013-01-30		ENSG00000197705	ENSG00000197705		"""Kelch-like"", ""BTB/POZ domain containing"""	29266	protein-coding gene	gene with protein product	"""printor"""	613772	"""kelch-like 14 (Drosophila)"""			10718198, 19535332	Standard	NM_020805		Approved	KIAA1384	uc002kxm.1	Q9P2G3	OTTHUMG00000179819	ENST00000359358.4:c.1603G>C	18.37:g.30257279C>G	ENSP00000352314:p.Asp535His		A6NNW1|B4DHA0|Q8WU41	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.D535H	ENST00000359358.4	37	c.1603	CCDS32813.1	18	.	.	.	.	.	.	.	.	.	.	C	26.0	4.697360	0.88830	.	.	ENSG00000197705	ENST00000359358	T	0.66638	-0.22	5.73	5.73	0.89815	Galactose oxidase, beta-propeller (1);	0.000000	0.48767	U	0.000167	T	0.81259	0.4785	M	0.64260	1.97	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.81106	-0.1083	10	0.66056	D	0.02	.	20.27	0.98469	0.0:1.0:0.0:0.0	.	535	Q9P2G3	KLH14_HUMAN	H	535	ENSP00000352314:D535H	ENSP00000352314:D535H	D	-	1	0	KLHL14	28511277	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.439000	0.80444	2.854000	0.98071	0.655000	0.94253	GAT	KLHL14	-	smart_Kelch_1,pirsf_Kelch-like_gigaxonin		0.443	KLHL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL14	HGNC	protein_coding	OTTHUMT00000448376.1	C			30257279	-1	no_errors	ENST00000359358	ensembl	human	known	70_37	missense	SNP	1.000	G
KLHL4	56062	genome.wustl.edu	37	X	86772953	86772953	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chrX:86772953G>C	ENST00000373119.4	+	1	202	c.57G>C	c.(55-57)tgG>tgC	p.W19C	KLHL4_ENST00000373114.4_Missense_Mutation_p.W19C	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	19						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						GGCTACGCTGGAGGTGGTTTA	0.483																																																	0													115.0	105.0	109.0					X																	86772953		2203	4300	6503	SO:0001583	missense	56062			AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.57G>C	X.37:g.86772953G>C	ENSP00000362211:p.Trp19Cys		B2RTW2|Q9Y3J5	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.W19C	ENST00000373119.4	37	c.57	CCDS14457.1	X	.	.	.	.	.	.	.	.	.	.	G	17.79	3.476166	0.63737	.	.	ENSG00000102271	ENST00000373119;ENST00000373114	D;D	0.93712	-3.27;-3.26	5.05	5.05	0.67936	.	0.000000	0.64402	D	0.000004	D	0.96386	0.8821	M	0.75264	2.295	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	D	0.96946	0.9691	10	0.87932	D	0	.	16.3818	0.83467	0.0:0.0:1.0:0.0	.	19;19	Q9C0H6;Q9C0H6-2	KLHL4_HUMAN;.	C	19	ENSP00000362211:W19C;ENSP00000362206:W19C	ENSP00000362206:W19C	W	+	3	0	KLHL4	86659609	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.641000	0.91032	2.327000	0.79052	0.513000	0.50165	TGG	KLHL4	-	NULL		0.483	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL4	HGNC	protein_coding	OTTHUMT00000057413.1	G			86772953	+1	no_errors	ENST00000373114	ensembl	human	known	70_37	missense	SNP	1.000	C
KRT34	3885	genome.wustl.edu	37	17	39535335	39535335	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr17:39535335G>A	ENST00000394001.1	-	6	1126	c.1096C>T	c.(1096-1098)Cag>Tag	p.Q366*		NM_021013.3	NP_066293.2	O76011	KRT34_HUMAN	keratin 34	366	Coil 2.|Rod.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Breast(137;0.000496)				TCTGCCAGCTGAGACTCCACG	0.617																																																	0													128.0	109.0	115.0					17																	39535335		2203	4300	6503	SO:0001587	stop_gained	3885			Y16790	CCDS11390.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000131737	ENSG00000131737		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6452	protein-coding gene	gene with protein product	"""hard keratin type I 4"""	602763	"""keratin, hair, acidic, 4"""	KRTHA4		2431943, 9756910, 16831889	Standard	NM_021013		Approved	Ha-4	uc002hwm.3	O76011	OTTHUMG00000133436	ENST00000394001.1:c.1096C>T	17.37:g.39535335G>A	ENSP00000377570:p.Gln366*		Q8IUT8|Q8N4W2	Nonsense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_I	p.Q366*	ENST00000394001.1	37	c.1096	CCDS11390.1	17	.	.	.	.	.	.	.	.	.	.	N	14.16	2.453421	0.43531	.	.	ENSG00000131737	ENST00000394001;ENST00000251648	.	.	.	5.05	5.05	0.67936	.	0.000000	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	14.2057	0.65732	0.0:0.1614:0.8386:0.0	.	.	.	.	X	324;366	.	ENSP00000251648:Q366X	Q	-	1	0	KRT34	36788861	0.992000	0.36948	0.951000	0.38953	0.024000	0.10985	2.084000	0.41625	2.512000	0.84698	0.650000	0.86243	CAG	KRT34	-	pfam_F,prints_Keratin_I		0.617	KRT34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT34	HGNC	protein_coding	OTTHUMT00000257304.3	G	NM_021013		39535335	-1	no_errors	ENST00000394001	ensembl	human	known	70_37	nonsense	SNP	0.970	A
KRT5	3852	genome.wustl.edu	37	12	52913666	52913666	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr12:52913666C>T	ENST00000252242.4	-	1	805	c.415G>A	c.(415-417)Ggt>Agt	p.G139S		NM_000424.3	NP_000415.2	P13647	K2C5_HUMAN	keratin 5	139	Gly-rich.|Head.				cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|hemidesmosome assembly (GO:0031581)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)			endometrium(5)|kidney(1)|large_intestine(8)|lung(15)|prostate(4)|skin(2)	35				BRCA - Breast invasive adenocarcinoma(357;0.189)		TCTTGGATACCTCCAGGAGGG	0.622																																																	0													154.0	148.0	150.0					12																	52913666		2203	4300	6503	SO:0001583	missense	3852				CCDS8830.1	12q13.13	2013-01-16	2008-08-01		ENSG00000186081	ENSG00000186081		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6442	protein-coding gene	gene with protein product		148040	"""epidermolysis bullosa simplex 2 Dowling-Meara/Kobner/Weber-Cockayne types"", ""keratin 5 (epidermolysis bullosa simplex, Dowling-Meara/Kobner/Weber-Cockayne types)"""	EBS2		1713141, 16831889	Standard	NM_000424		Approved	KRT5A	uc001san.3	P13647	OTTHUMG00000169657	ENST00000252242.4:c.415G>A	12.37:g.52913666C>T	ENSP00000252242:p.Gly139Ser		Q6PI71|Q6UBJ0|Q8TA91	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.G139S	ENST00000252242.4	37	c.415	CCDS8830.1	12	.	.	.	.	.	.	.	.	.	.	C	15.99	2.996396	0.54147	.	.	ENSG00000186081	ENST00000252242;ENST00000456000;ENST00000549420;ENST00000551275	D;T;D	0.95035	-3.29;-1.1;-3.59	5.66	5.66	0.87406	.	0.000000	0.64402	D	0.000016	D	0.93510	0.7929	M	0.85777	2.775	0.29660	N	0.843314	B	0.23442	0.085	B	0.16289	0.015	D	0.89616	0.3845	10	0.62326	D	0.03	.	8.4964	0.33130	0.0:0.7428:0.1464:0.1108	.	139	P13647	K2C5_HUMAN	S	139;104;29;104	ENSP00000252242:G139S;ENSP00000447209:G29S;ENSP00000448041:G104S	ENSP00000252242:G139S	G	-	1	0	KRT5	51199933	.	.	1.000000	0.80357	0.842000	0.47809	.	.	2.669000	0.90835	0.655000	0.94253	GGT	KRT5	-	NULL		0.622	KRT5-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	KRT5	HGNC	protein_coding	OTTHUMT00000405312.1	C			52913666	-1	no_errors	ENST00000252242	ensembl	human	known	70_37	missense	SNP	0.866	T
LAS1L	81887	genome.wustl.edu	37	X	64741096	64741096	+	Intron	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chrX:64741096G>C	ENST00000374811.3	-	11	1489				LAS1L_ENST00000374807.5_Intron|LAS1L_ENST00000374804.5_Intron|LAS1L_ENST00000312391.8_Intron	NM_031206.4	NP_112483.1	Q9Y4W2	LAS1L_HUMAN	LAS1-like (S. cerevisiae)						rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	33						CAGGGACTAAGAGGGTCTTGG	0.498																																																	0																																										SO:0001627	intron_variant	81887			BC014545	CCDS14381.1, CCDS55433.1, CCDS55434.1	Xq12	2008-02-05			ENSG00000001497	ENSG00000001497			25726	protein-coding gene	gene with protein product						12477932	Standard	NM_031206		Approved	FLJ12525	uc004dwa.2	Q9Y4W2	OTTHUMG00000021720	ENST00000374811.3:c.1448+2343C>G	X.37:g.64741096G>C			A9X410|Q5JXQ0|Q8TEN5|Q9H9V5	RNA	SNP	-	NULL	ENST00000374811.3	37	NULL	CCDS14381.1	X																																																																																			LAS1L	-	-		0.498	LAS1L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAS1L	HGNC	protein_coding	OTTHUMT00000056974.1	G	NM_031206		64741096	-1	no_errors	ENST00000484069	ensembl	human	known	70_37	rna	SNP	0.000	C
LAS1L	81887	genome.wustl.edu	37	X	64741915	64741915	+	Intron	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chrX:64741915G>A	ENST00000374811.3	-	11	1489				LAS1L_ENST00000374807.5_Intron|LAS1L_ENST00000374804.5_Intron|LAS1L_ENST00000312391.8_Intron	NM_031206.4	NP_112483.1	Q9Y4W2	LAS1L_HUMAN	LAS1-like (S. cerevisiae)						rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	33						tgtttaagatgagaaaagctc	0.512																																																	0																																										SO:0001627	intron_variant	81887			BC014545	CCDS14381.1, CCDS55433.1, CCDS55434.1	Xq12	2008-02-05			ENSG00000001497	ENSG00000001497			25726	protein-coding gene	gene with protein product						12477932	Standard	NM_031206		Approved	FLJ12525	uc004dwa.2	Q9Y4W2	OTTHUMG00000021720	ENST00000374811.3:c.1448+1524C>T	X.37:g.64741915G>A			A9X410|Q5JXQ0|Q8TEN5|Q9H9V5	RNA	SNP	-	NULL	ENST00000374811.3	37	NULL	CCDS14381.1	X																																																																																			LAS1L	-	-		0.512	LAS1L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAS1L	HGNC	protein_coding	OTTHUMT00000056974.1	G	NM_031206		64741915	-1	no_errors	ENST00000484069	ensembl	human	known	70_37	rna	SNP	0.492	A
LCE2D	353141	genome.wustl.edu	37	1	152636743	152636743	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:152636743C>G	ENST00000368784.1	+	2	217	c.162C>G	c.(160-162)agC>agG	p.S54R		NM_178430.2	NP_848517.1	Q5TA82	LCE2D_HUMAN	late cornified envelope 2D	54	Cys-rich.				keratinization (GO:0031424)					large_intestine(1)|lung(7)|prostate(2)	10	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTCTGGGAGCTGCTGTGGTC	0.657																																																	0													93.0	104.0	100.0					1																	152636743		2203	4300	6503	SO:0001583	missense	353141			BI670513	CCDS1018.1	1q21.3	2008-02-05	2004-10-11	2004-10-15	ENSG00000187223	ENSG00000187223		"""Late cornified envelopes"""	16518	protein-coding gene	gene with protein product		612612	"""small proline rich-like (epidermal differentiation complex) 1A"""	SPRL1A		11698679	Standard	NM_178430		Approved	LEP12	uc001fag.4	Q5TA82	OTTHUMG00000014400	ENST00000368784.1:c.162C>G	1.37:g.152636743C>G	ENSP00000357773:p.Ser54Arg		A1L4M8	Missense_Mutation	SNP	NULL	p.S54R	ENST00000368784.1	37	c.162	CCDS1018.1	1	.	.	.	.	.	.	.	.	.	.	C	0.204	-1.042269	0.01997	.	.	ENSG00000187223	ENST00000368784	T	0.03663	3.85	2.29	-2.77	0.05877	.	.	.	.	.	T	0.01489	0.0048	M	0.73962	2.25	0.09310	N	1	B	0.20368	0.044	B	0.15484	0.013	T	0.44283	-0.9338	9	0.62326	D	0.03	.	2.2587	0.04061	0.2608:0.3798:0.0:0.3594	.	54	Q5TA82	LCE2D_HUMAN	R	54	ENSP00000357773:S54R	ENSP00000357773:S54R	S	+	3	2	LCE2D	150903367	0.000000	0.05858	0.145000	0.22337	0.071000	0.16799	-1.104000	0.03326	-0.266000	0.09339	0.305000	0.20034	AGC	LCE2D	-	NULL		0.657	LCE2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE2D	HGNC	protein_coding	OTTHUMT00000040058.1	C	NM_178430		152636743	+1	no_errors	ENST00000368784	ensembl	human	known	70_37	missense	SNP	0.592	G
LCT	3938	genome.wustl.edu	37	2	136564854	136564854	+	Silent	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr2:136564854G>A	ENST00000264162.2	-	9	4027	c.4017C>T	c.(4015-4017)ttC>ttT	p.F1339F	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1339	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	TCGTGTTGTTGAAATCAACAT	0.512																																																	0													210.0	167.0	182.0					2																	136564854		2203	4300	6503	SO:0001819	synonymous_variant	3938			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.4017C>T	2.37:g.136564854G>A			Q4ZG58	Silent	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.F1339	ENST00000264162.2	37	c.4017	CCDS2178.1	2																																																																																			LCT	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1		0.512	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCT	HGNC	protein_coding	OTTHUMT00000254657.1	G	NM_002299		136564854	-1	no_errors	ENST00000264162	ensembl	human	known	70_37	silent	SNP	0.002	A
LHX6	26468	genome.wustl.edu	37	9	124979434	124979434	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr9:124979434C>A	ENST00000373755.2	-	4	616	c.508G>T	c.(508-510)Gag>Tag	p.E170*	LHX6_ENST00000541397.2_Nonsense_Mutation_p.E188*|LHX6_ENST00000340587.3_Nonsense_Mutation_p.E199*|LHX6_ENST00000394319.4_Nonsense_Mutation_p.E199*|LHX6_ENST00000559895.1_5'UTR|LHX6_ENST00000373754.2_Nonsense_Mutation_p.E170*	NM_001242334.1	NP_001229263.1	Q9UPM6	LHX6_HUMAN	LIM homeobox 6	170	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.|Required for interaction with LDB1. {ECO:0000250}.				cell maturation (GO:0048469)|cerebral cortex GABAergic interneuron migration (GO:0021853)|cerebral cortex radially oriented cell migration (GO:0021799)|cerebral cortex tangential migration (GO:0021800)|forebrain neuron fate commitment (GO:0021877)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(5)	8						CCGAACTCCTCACCAGTGGAC	0.627																																																	0													90.0	80.0	84.0					9																	124979434		2203	4300	6503	SO:0001587	stop_gained	26468			AB031041	CCDS6837.2, CCDS6838.2, CCDS56583.1, CCDS56584.1, CCDS59144.1	9q33.2	2011-06-20			ENSG00000106852	ENSG00000106852		"""Homeoboxes / LIM class"""	21735	protein-coding gene	gene with protein product		608215				10393337	Standard	NM_014368		Approved	LHX6.1	uc004blx.4	Q9UPM6	OTTHUMG00000020601	ENST00000373755.2:c.508G>T	9.37:g.124979434C>A	ENSP00000362860:p.Glu170*		A6PVQ1|A6PVQ2|A8K1B2|B7Z4D0|H0YN76|Q5T7S7|Q5T7S8|Q9NTK3|Q9UPM5	Nonsense_Mutation	SNP	pfam_Znf_LIM,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeodomain,pfscan_Znf_LIM,pfscan_Homeodomain	p.E199*	ENST00000373755.2	37	c.595	CCDS56583.1	9	.	.	.	.	.	.	.	.	.	.	C	37	6.258169	0.97417	.	.	ENSG00000106852	ENST00000373755;ENST00000373754;ENST00000394319;ENST00000340587;ENST00000541397	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.1961	0.93690	0.0:1.0:0.0:0.0	.	.	.	.	X	170;170;199;199;188	.	ENSP00000340137:E199X	E	-	1	0	LHX6	124019255	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.818000	0.86416	2.781000	0.95711	0.655000	0.94253	GAG	LHX6	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM		0.627	LHX6-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	LHX6	HGNC	protein_coding	OTTHUMT00000053924.2	C	NM_014368		124979434	-1	no_errors	ENST00000394319	ensembl	human	known	70_37	nonsense	SNP	1.000	A
LIG3	3980	genome.wustl.edu	37	17	33318059	33318059	+	Missense_Mutation	SNP	G	G	A	rs148073351		TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr17:33318059G>A	ENST00000378526.4	+	5	1100	c.967G>A	c.(967-969)Gat>Aat	p.D323N	LIG3_ENST00000262327.5_Missense_Mutation_p.D323N	NM_013975.3	NP_039269.2	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent	323					base-excision repair (GO:0006284)|base-excision repair, DNA ligation (GO:0006288)|DNA biosynthetic process (GO:0071897)|DNA repair (GO:0006281)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitochondrial DNA repair (GO:0043504)|negative regulation of DNA recombination (GO:0045910)|nucleotide-excision repair (GO:0006289)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(8)|lung(9)|ovary(3)|pancreas(2)|prostate(1)|skin(3)|stomach(1)	31		Ovarian(249;0.17)			Bleomycin(DB00290)	CAACTTGAACGATAAGCAGAT	0.488								Other BER factors																																									0								G	ASN/ASP,ASN/ASP	0,4406		0,0,2203	127.0	115.0	119.0		967,967	5.7	1.0	17	dbSNP_134	119	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	LIG3	NM_002311.4,NM_013975.3	23,23	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	323/950,323/1010	33318059	1,13005	2203	4300	6503	SO:0001583	missense	3980				CCDS11284.2, CCDS11285.2	17q11.2-q12	2008-10-29			ENSG00000005156	ENSG00000005156			6600	protein-coding gene	gene with protein product		600940	"""ligase II, DNA, ATP-dependent"""	LIG2		7760816	Standard	NM_002311		Approved		uc002hik.2	P49916	OTTHUMG00000128519	ENST00000378526.4:c.967G>A	17.37:g.33318059G>A	ENSP00000367787:p.Asp323Asn		Q16714|Q6NVK3	Missense_Mutation	SNP	pfam_DNA_ligase_ATP-dep_cent,pfam_DNA_ligase_ATP-dep_N,pfam_Znf_PARP,pfam_DNA_ligase_ATP-dep_C,superfamily_NA-bd_OB-fold-like,superfamily_BRCT_dom,superfamily_DNA_ligase_ATP-dep_N,smart_BRCT_dom,pfscan_BRCT_dom,pfscan_Znf_PARP,pfscan_DNA_ligase_ATP-dep_cent,tigrfam_DNA_ligase_ATP-dep	p.D323N	ENST00000378526.4	37	c.967	CCDS11284.2	17	.	.	.	.	.	.	.	.	.	.	G	31	5.099699	0.94197	0.0	1.16E-4	ENSG00000005156	ENST00000378526;ENST00000262327	T;T	0.18502	2.21;2.21	5.65	5.65	0.86999	DNA ligase, ATP-dependent, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.16171	0.0389	L	0.28556	0.865	0.80722	D	1	P;P;P	0.41102	0.738;0.738;0.738	B;B;B	0.38683	0.279;0.279;0.218	T	0.01276	-1.1398	10	0.39692	T	0.17	-18.6325	18.891	0.92403	0.0:0.0:1.0:0.0	.	323;323;323	E5KLB5;P49916;E5KLB6	.;DNLI3_HUMAN;.	N	323	ENSP00000367787:D323N;ENSP00000262327:D323N	ENSP00000262327:D323N	D	+	1	0	LIG3	30342172	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.419000	0.97397	2.941000	0.99782	0.655000	0.94253	GAT	LIG3	-	pfam_DNA_ligase_ATP-dep_N,superfamily_DNA_ligase_ATP-dep_N,tigrfam_DNA_ligase_ATP-dep		0.488	LIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIG3	HGNC	protein_coding	OTTHUMT00000250330.3	G	NM_013975		33318059	+1	no_errors	ENST00000378526	ensembl	human	known	70_37	missense	SNP	1.000	A
LINC00094	266655	genome.wustl.edu	37	9	136891828	136891828	+	RNA	SNP	G	G	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr9:136891828G>T	ENST00000603928.1	+	0	300				LINC00094_ENST00000430633.1_RNA|LINC00094_ENST00000552018.1_RNA|LINC00094_ENST00000605164.1_RNA|LINC00094_ENST00000550853.1_RNA|LINC00094_ENST00000432807.1_RNA|LINC00094_ENST00000599836.1_RNA	NR_015427.2				long intergenic non-protein coding RNA 94																		GGCCGTCTCAGAACAGCAGGG	0.592																																																	0																																												266655			AK092667		9q34	2012-10-12	2011-08-11	2011-08-11	ENSG00000235106	ENSG00000235106		"""Long non-coding RNAs"""	24742	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 94"""	NCRNA00094		12477932	Standard	NR_015427		Approved	FLJ35348, bA374P20.3	uc004ceu.3		OTTHUMG00000020880		9.37:g.136891828G>T				RNA	SNP	-	NULL	ENST00000603928.1	37	NULL		9																																																																																			LINC00094	-	-		0.592	LINC00094-005	KNOWN	basic	antisense	LINC00094	HGNC	antisense	OTTHUMT00000470013.1	G			136891828	+1	no_errors	ENST00000430633	ensembl	human	known	70_37	rna	SNP	0.000	T
LINC00488	677779	genome.wustl.edu	37	3	108897102	108897102	+	lincRNA	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr3:108897102C>G	ENST00000494582.1	+	0	91				RP11-59E19.4_ENST00000562158.1_lincRNA	NR_026767.1				long intergenic non-protein coding RNA 488																		CTAGATGTCTCCAGTCAGTCG	0.478																																																	0																																												677779			AK123226		3q13.13	2012-10-12	2011-09-14	2011-09-14	ENSG00000214381	ENSG00000214381		"""Long non-coding RNAs"""	32675	non-coding RNA	RNA, long non-coding			"""chromosome 3 open reading frame 66"""	C3orf66			Standard	NR_026767		Approved	FLJ41232	uc003dxn.4		OTTHUMG00000159206		3.37:g.108897102C>G				RNA	SNP	-	NULL	ENST00000494582.1	37	NULL		3																																																																																			LINC00488	-	-		0.478	LINC00488-001	KNOWN	basic	lincRNA	LINC00488	HGNC	lincRNA	OTTHUMT00000353835.1	C	NR_026767		108897102	+1	no_errors	ENST00000494582	ensembl	human	known	70_37	rna	SNP	0.003	G
LINGO1	84894	genome.wustl.edu	37	15	77906551	77906551	+	Silent	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr15:77906551G>A	ENST00000355300.6	-	2	1872	c.1698C>T	c.(1696-1698)atC>atT	p.I566I	LINGO1_ENST00000561030.1_Silent_p.I560I	NM_032808.5	NP_116197.4	Q96FE5	LIGO1_HUMAN	leucine rich repeat and Ig domain containing 1	566					central nervous system neuron development (GO:0021954)|negative regulation of axonogenesis (GO:0050771)|negative regulation of oligodendrocyte differentiation (GO:0048715)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein kinase B signaling (GO:0043491)|regulation of axonogenesis (GO:0050770)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31						CCAGGAAAGAGATGAAGCCCA	0.607																																																	0													114.0	122.0	119.0					15																	77906551		2156	4262	6418	SO:0001819	synonymous_variant	84894			AK027500	CCDS45313.1, CCDS73766.1	15q24	2013-01-11	2007-02-01	2007-02-01		ENSG00000169783		"""Immunoglobulin superfamily / I-set domain containing"""	21205	protein-coding gene	gene with protein product		609791	"""leucine rich repeat neuronal 6A"""	LRRN6A		14686891	Standard	XM_006720723		Approved	FLJ14594, LERN1	uc002bct.1	Q96FE5		ENST00000355300.6:c.1698C>T	15.37:g.77906551G>A			D3DW80|Q6NUK3|Q6UXM3|Q6VVG0|Q6VVG1|Q6VVG2|Q8N3K5|Q96K52	Silent	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.I566	ENST00000355300.6	37	c.1698	CCDS45313.1	15																																																																																			LINGO1	-	NULL		0.607	LINGO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO1	HGNC	protein_coding	OTTHUMT00000419546.1	G	NM_032808		77906551	-1	no_errors	ENST00000355300	ensembl	human	known	70_37	silent	SNP	1.000	A
LINC00969	440993	genome.wustl.edu	37	3	195395487	195395487	+	lincRNA	SNP	C	C	G	rs536034494	byFrequency	TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr3:195395487C>G	ENST00000445430.1	+	0	894									long intergenic non-protein coding RNA 969																		GCCAGGACCTCGAGTTTGTTC	0.617																																																	0																																												440993			AK128346		3q29	2013-06-07			ENSG00000242086	ENSG00000242086		"""Long non-coding RNAs"""	48729	non-coding RNA	RNA, long non-coding							Standard	XR_427455		Approved				OTTHUMG00000155834		3.37:g.195395487C>G				RNA	SNP	-	NULL	ENST00000445430.1	37	NULL		3																																																																																			AC069513.3	-	-		0.617	LINC00969-038	KNOWN	basic	lincRNA	LOC440993	Clone_based_vega_gene	lincRNA	OTTHUMT00000341951.1	C			195395487	+1	no_errors	ENST00000414625	ensembl	human	known	70_37	rna	SNP	0.988	G
LRRC4	64101	genome.wustl.edu	37	7	127670470	127670470	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr7:127670470G>C	ENST00000249363.3	-	2	481	c.224C>G	c.(223-225)tCg>tGg	p.S75W	SND1_ENST00000354725.3_Intron	NM_022143.4	NP_071426.1	Q9HBW1	LRRC4_HUMAN	leucine rich repeat containing 4	75	LRRNT.				postsynaptic density protein 95 clustering (GO:0097119)|regulation of synapse organization (GO:0050807)|synapse organization (GO:0050808)	cell junction (GO:0030054)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(6)|lung(4)|pancreas(1)|skin(2)	26				Lung(243;0.124)		CCGGGTGTTCGAGGGAATACC	0.637																																																	0													171.0	173.0	172.0					7																	127670470		2203	4300	6503	SO:0001583	missense	64101			AF196976	CCDS5799.1	7q31	2013-01-14	2003-11-19		ENSG00000128594	ENSG00000128594		"""Immunoglobulin superfamily / I-set domain containing"""	15586	protein-coding gene	gene with protein product		610486	"""leucine-rich repeat-containing 4"""			12969517	Standard	NM_022143		Approved	NAG14	uc003vmk.3	Q9HBW1	OTTHUMG00000157563	ENST00000249363.3:c.224C>G	7.37:g.127670470G>C	ENSP00000249363:p.Ser75Trp		A4D0Y9|Q14DU9|Q6ZMI8|Q96A85	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.S75W	ENST00000249363.3	37	c.224	CCDS5799.1	7	.	.	.	.	.	.	.	.	.	.	G	16.00	2.998277	0.54147	.	.	ENSG00000128594	ENST00000249363;ENST00000476782	T;T	0.45668	0.89;0.89	4.66	4.66	0.58398	Leucine-rich repeat-containing N-terminal (1);	0.080065	0.51477	D	0.000098	T	0.63510	0.2517	M	0.85542	2.76	0.58432	D	0.999999	D	0.71674	0.998	P	0.58454	0.839	T	0.70687	-0.4803	10	0.62326	D	0.03	.	15.09	0.72185	0.0:0.0:1.0:0.0	.	75	Q9HBW1	LRRC4_HUMAN	W	75	ENSP00000249363:S75W;ENSP00000418093:S75W	ENSP00000249363:S75W	S	-	2	0	LRRC4	127457706	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.475000	0.60210	2.373000	0.80994	0.655000	0.94253	TCG	LRRC4	-	smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp		0.637	LRRC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC4	HGNC	protein_coding	OTTHUMT00000349170.1	G	NM_022143		127670470	-1	no_errors	ENST00000249363	ensembl	human	known	70_37	missense	SNP	1.000	C
LY9	4063	genome.wustl.edu	37	1	160769448	160769448	+	Intron	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:160769448G>A	ENST00000263285.6	+	2	154				LY9_ENST00000368041.2_Intron|LY9_ENST00000471816.1_Intron|LY9_ENST00000368039.2_Intron|LY9_ENST00000341032.4_Intron|LY9_ENST00000368037.5_Intron|LY9_ENST00000368040.1_Intron|LY9_ENST00000392203.4_Intron			Q9HBG7	LY9_HUMAN	lymphocyte antigen 9						cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			CTCAGCATCTGACATTTATGC	0.433																																																	0																																										SO:0001627	intron_variant	4063			L42621	CCDS30916.1, CCDS30917.1, CCDS65695.1, CCDS65696.1	1q23.3	2013-01-11			ENSG00000122224	ENSG00000122224		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6730	protein-coding gene	gene with protein product		600684				8537117, 7797269	Standard	NM_001261457		Approved	CD229, mLY9, SLAMF3, hly9	uc001fwu.4	Q9HBG7	OTTHUMG00000024007	ENST00000263285.6:c.125-95G>A	1.37:g.160769448G>A			A8K7N3|Q14775|Q5VYI3|Q6P2J4|Q9H4N5|Q9NQ24	RNA	SNP	-	NULL	ENST00000263285.6	37	NULL	CCDS30916.1	1																																																																																			LY9	-	-		0.433	LY9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LY9	HGNC	protein_coding	OTTHUMT00000060457.3	G	NM_002348		160769448	+1	no_errors	ENST00000485624	ensembl	human	known	70_37	rna	SNP	0.016	A
MAGEC3	139081	genome.wustl.edu	37	X	140984784	140984784	+	Missense_Mutation	SNP	A	A	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chrX:140984784A>T	ENST00000298296.1	+	7	1240	c.1240A>T	c.(1240-1242)Agt>Tgt	p.S414C	MAGEC3_ENST00000536088.1_Missense_Mutation_p.S116C|MAGEC3_ENST00000483584.1_3'UTR|MAGEC3_ENST00000409007.1_Missense_Mutation_p.S116C|MAGEC3_ENST00000443323.2_Missense_Mutation_p.S36C|MAGEC3_ENST00000544766.1_Missense_Mutation_p.S116C	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	414	Pro-rich.									NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					tcctccccagagtcctcTAGA	0.587																																																	0													26.0	24.0	25.0					X																	140984784		2203	4300	6503	SO:0001583	missense	139081			AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.1240A>T	X.37:g.140984784A>T	ENSP00000298296:p.Ser414Cys		Q3SYA7|Q5JZ43|Q9BZ80	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.S414C	ENST00000298296.1	37	c.1240	CCDS14676.1	X	.	.	.	.	.	.	.	.	.	.	a	12.99	2.104712	0.37145	.	.	ENSG00000165509	ENST00000298296;ENST00000536088;ENST00000443323;ENST00000544766;ENST00000409007	T;T;T;T;T	0.04119	3.87;3.7;3.73;3.7;3.7	1.18	1.18	0.20946	.	.	.	.	.	T	0.07279	0.0184	N	0.19112	0.55	0.09310	N	1	D;D	0.67145	0.976;0.996	D;P	0.63381	0.914;0.738	T	0.34925	-0.9809	9	0.66056	D	0.02	.	4.1545	0.10254	1.0:0.0:0.0:0.0	.	414;116	Q8TD91;Q3SYA7	MAGC3_HUMAN;.	C	414;116;36;116;116	ENSP00000298296:S414C;ENSP00000441107:S116C;ENSP00000438254:S36C;ENSP00000440444:S116C;ENSP00000386566:S116C	ENSP00000298296:S414C	S	+	1	0	MAGEC3	140812450	0.151000	0.22747	0.022000	0.16811	0.291000	0.27294	1.519000	0.35888	0.706000	0.31912	0.150000	0.16122	AGT	MAGEC3	-	NULL		0.587	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC3	HGNC	protein_coding	OTTHUMT00000058606.1	A	NM_138702		140984784	+1	no_errors	ENST00000298296	ensembl	human	known	70_37	missense	SNP	0.021	T
MAML1	9794	genome.wustl.edu	37	5	179193509	179193509	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr5:179193509C>G	ENST00000292599.3	+	2	1761	c.1498C>G	c.(1498-1500)Cag>Gag	p.Q500E	MAML1_ENST00000503050.1_3'UTR	NM_014757.4	NP_055572.1			mastermind-like 1 (Drosophila)											central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	36	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TAACTTGAATCAGAACTCCGC	0.572																																																	0													71.0	62.0	65.0					5																	179193509		2203	4300	6503	SO:0001583	missense	9794			D83785	CCDS34315.1	5q35	2008-07-18	2001-11-28			ENSG00000161021			13632	protein-coding gene	gene with protein product	"""mastermind homolog"""	605424	"""mastermind (drosophila)-like 1"""			11101851, 11390662	Standard	NM_014757		Approved	KIAA0200, Mam-1	uc003mkm.3	Q92585		ENST00000292599.3:c.1498C>G	5.37:g.179193509C>G	ENSP00000292599:p.Gln500Glu			Missense_Mutation	SNP	pfam_Neuroggenic_mastermind-like_N	p.Q500E	ENST00000292599.3	37	c.1498	CCDS34315.1	5	.	.	.	.	.	.	.	.	.	.	C	8.904	0.957154	0.18507	.	.	ENSG00000161021	ENST00000292599;ENST00000376951	T	0.23147	1.92	5.15	5.15	0.70609	.	0.262046	0.33591	N	0.004746	T	0.36166	0.0957	M	0.76838	2.35	0.35316	D	0.784321	P;P	0.44776	0.843;0.659	P;B	0.45406	0.479;0.142	T	0.51293	-0.8724	10	0.31617	T	0.26	-6.87	13.5685	0.61832	0.1557:0.8443:0.0:0.0	.	537;500	Q59GH4;Q92585	.;MAML1_HUMAN	E	500;537	ENSP00000292599:Q500E	ENSP00000292599:Q500E	Q	+	1	0	MAML1	179126115	1.000000	0.71417	0.984000	0.44739	0.027000	0.11550	4.005000	0.57075	2.386000	0.81285	0.563000	0.77884	CAG	MAML1	-	NULL		0.572	MAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML1	HGNC	protein_coding	OTTHUMT00000372316.2	C	NM_014757		179193509	+1	no_errors	ENST00000292599	ensembl	human	known	70_37	missense	SNP	0.997	G
MAP4	4134	genome.wustl.edu	37	3	47896844	47896844	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr3:47896844C>T	ENST00000360240.6	-	17	3673	c.3155G>A	c.(3154-3156)gGa>gAa	p.G1052E	MAP4_ENST00000420772.2_Missense_Mutation_p.G745E|MAP4_ENST00000441748.2_Missense_Mutation_p.G166E|MAP4_ENST00000395734.3_Missense_Mutation_p.G1052E|MAP4_ENST00000426837.2_Missense_Mutation_p.G2197E|MAP4_ENST00000383737.4_Missense_Mutation_p.G711E|MAP4_ENST00000264724.11_Missense_Mutation_p.G787E	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4	1052					cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	CTTGACATCTCCTCCACCTGG	0.517																																																	0													180.0	158.0	165.0					3																	47896844		2203	4300	6503	SO:0001583	missense	4134				CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.3155G>A	3.37:g.47896844C>T	ENSP00000353375:p.Gly1052Glu		Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Missense_Mutation	SNP	pfam_Tau/MAP_tubulin-bd_rpt	p.G1052E	ENST00000360240.6	37	c.3155	CCDS33750.1	3	.	.	.	.	.	.	.	.	.	.	C	24.7	4.557513	0.86231	.	.	ENSG00000047849	ENST00000383737;ENST00000264724;ENST00000395734;ENST00000426837;ENST00000360240;ENST00000420772;ENST00000335271;ENST00000441748	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	4.9	4.9	0.64082	.	.	.	.	.	D	0.99889	0.9947	M	0.88979	2.995	0.47778	D	0.999511	D;D;D;D;D;D	0.89917	1.0;0.996;0.997;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.954;0.973;0.997;1.0;0.998	D	0.96093	0.9063	9	0.87932	D	0	-13.9246	15.3796	0.74645	0.0:1.0:0.0:0.0	.	745;1052;1052;787;711;2197	F8W9U4;P27816-6;P27816;E9PGM5;B9ZVR1;E7EVA0	.;.;MAP4_HUMAN;.;.;.	E	711;787;1052;2197;1052;745;380;166	ENSP00000373243:G711E;ENSP00000264724:G787E;ENSP00000379083:G1052E;ENSP00000407602:G2197E;ENSP00000353375:G1052E;ENSP00000409731:G745E;ENSP00000334770:G380E;ENSP00000415130:G166E	ENSP00000264724:G787E	G	-	2	0	MAP4	47871848	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	6.893000	0.75649	2.552000	0.86080	0.561000	0.74099	GGA	MAP4	-	pfam_Tau/MAP_tubulin-bd_rpt		0.517	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP4	HGNC	protein_coding	OTTHUMT00000346085.1	C	NM_002375		47896844	-1	no_errors	ENST00000360240	ensembl	human	known	70_37	missense	SNP	1.000	T
MCOLN2	255231	genome.wustl.edu	37	1	85424280	85424280	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:85424280C>G	ENST00000370608.3	-	3	410	c.343G>C	c.(343-345)Gat>Cat	p.D115H	MCOLN2_ENST00000531325.1_5'UTR|MCOLN2_ENST00000284027.5_Missense_Mutation_p.D87H	NM_153259.2	NP_694991.2	Q8IZK6	MCLN2_HUMAN	mucolipin 2	115					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	18				all cancers(265;0.0111)|Epithelial(280;0.0263)|OV - Ovarian serous cystadenocarcinoma(397;0.217)		CTGTAGTCATCTTCATCTGTA	0.368																																																	0													106.0	102.0	103.0					1																	85424280		2203	4300	6503	SO:0001583	missense	255231			AK094010	CCDS30762.1	1p22	2011-12-16			ENSG00000153898	ENSG00000153898		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13357	protein-coding gene	gene with protein product		607399				16382100	Standard	XM_005270719		Approved	TRPML2, FLJ36691, TRP-ML2	uc001dkm.3	Q8IZK6	OTTHUMG00000009954	ENST00000370608.3:c.343G>C	1.37:g.85424280C>G	ENSP00000359640:p.Asp115His		A6NI99|Q2M3I6|Q5TAG5|Q8N9R3	Missense_Mutation	SNP	pfam_PKD1_2_channel	p.D115H	ENST00000370608.3	37	c.343	CCDS30762.1	1	.	.	.	.	.	.	.	.	.	.	C	18.58	3.654361	0.67472	.	.	ENSG00000153898	ENST00000370608;ENST00000284027	T;T	0.61040	0.14;0.14	6.07	6.07	0.98685	.	0.045428	0.85682	D	0.000000	T	0.65302	0.2678	M	0.69358	2.11	0.80722	D	1	D	0.58620	0.983	P	0.54499	0.754	T	0.64149	-0.6475	10	0.51188	T	0.08	-23.8848	20.6593	0.99626	0.0:1.0:0.0:0.0	.	115	Q8IZK6	MCLN2_HUMAN	H	115;87	ENSP00000359640:D115H;ENSP00000284027:D87H	ENSP00000284027:D87H	D	-	1	0	MCOLN2	85196868	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.440000	0.80464	2.885000	0.99019	0.655000	0.94253	GAT	MCOLN2	-	NULL		0.368	MCOLN2-001	KNOWN	basic|CCDS	protein_coding	MCOLN2	HGNC	protein_coding	OTTHUMT00000027567.2	C	NM_153259		85424280	-1	no_errors	ENST00000370608	ensembl	human	known	70_37	missense	SNP	1.000	G
MDC1	9656	genome.wustl.edu	37	6	30680935	30680935	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr6:30680935G>A	ENST00000376406.3	-	5	1431	c.784C>T	c.(784-786)Cag>Tag	p.Q262*	MDC1-AS1_ENST00000442150.1_RNA|MDC1_ENST00000376405.2_Nonsense_Mutation_p.Q262*|MDC1_ENST00000494654.1_5'Flank	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	262	Required for nuclear localization (NLS1).				DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						ACTAAAGGCTGATCCTTTTCA	0.527								Other conserved DNA damage response genes																																									0													127.0	121.0	123.0					6																	30680935		1511	2708	4219	SO:0001587	stop_gained	9656			D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.784C>T	6.37:g.30680935G>A	ENSP00000365588:p.Gln262*		A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Nonsense_Mutation	SNP	pfam_FHA_dom,superfamily_BRCT_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_BRCT_dom,pfscan_FHA_dom	p.Q262*	ENST00000376406.3	37	c.784	CCDS34384.1	6	.	.	.	.	.	.	.	.	.	.	G	35	5.446892	0.96205	.	.	ENSG00000137337	ENST00000376406;ENST00000376405;ENST00000429610;ENST00000422104	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-0.0026	14.599	0.68427	0.0:0.0:1.0:0.0	.	.	.	.	X	262;262;262;134	.	ENSP00000365587:Q262X	Q	-	1	0	MDC1	30788914	0.091000	0.21658	0.020000	0.16555	0.287000	0.27160	3.342000	0.52159	2.825000	0.97269	0.655000	0.94253	CAG	MDC1	-	NULL		0.527	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MDC1	HGNC	protein_coding	OTTHUMT00000076103.1	G	NM_014641		30680935	-1	no_errors	ENST00000376406	ensembl	human	known	70_37	nonsense	SNP	0.017	A
MELK	9833	genome.wustl.edu	37	9	36583688	36583688	+	Silent	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr9:36583688C>T	ENST00000298048.2	+	3	307	c.123C>T	c.(121-123)atC>atT	p.I41I	MELK_ENST00000536860.1_Silent_p.I41I|MELK_ENST00000536987.1_Intron|MELK_ENST00000545008.1_Silent_p.I41I|MELK_ENST00000543751.1_Intron|MELK_ENST00000541717.1_Silent_p.I41I|MELK_ENST00000538311.1_Intron|MELK_ENST00000536329.1_Intron|MELK_ENST00000487398.1_Intron	NM_014791.3	NP_055606.1	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase	41	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|neural precursor cell proliferation (GO:0061351)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)	cell cortex (GO:0005938)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			CTATAAAAATCATGGATAAAA	0.333																																					Ovarian(82;980 1317 7225 14391 18624)												0													68.0	67.0	68.0					9																	36583688		2203	4300	6503	SO:0001819	synonymous_variant	9833			D79997	CCDS6606.1, CCDS59123.1, CCDS59124.1, CCDS59125.1, CCDS59126.1, CCDS59127.1, CCDS59128.1	9p13.1	2008-02-05			ENSG00000165304	ENSG00000165304			16870	protein-coding gene	gene with protein product		607025				8724849, 9136115	Standard	NM_001256689		Approved	KIAA0175	uc003zzn.4	Q14680	OTTHUMG00000019906	ENST00000298048.2:c.123C>T	9.37:g.36583688C>T			A6P3A7|A6P3A8|B1AMQ6|B7Z1E6|B7Z5M5|B7Z6Q7|B7Z6R8|B7Z6Y0|B7Z7Q1|D3DRP8|F5H0Y0|F5H2R4|F5H689|Q7L3C3	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase-assoc_KA1,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,superfamily_Kinase-assoc_KA1,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.I41	ENST00000298048.2	37	c.123	CCDS6606.1	9																																																																																			MELK	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.333	MELK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MELK	HGNC	protein_coding	OTTHUMT00000052428.3	C	NM_014791		36583688	+1	no_errors	ENST00000298048	ensembl	human	known	70_37	silent	SNP	1.000	T
MGA	23269	genome.wustl.edu	37	15	41991294	41991294	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr15:41991294G>A	ENST00000570161.1	+	4	2125	c.2125G>A	c.(2125-2127)Gaa>Aaa	p.E709K	MGA_ENST00000389936.4_Missense_Mutation_p.E709K|MGA_ENST00000219905.7_Missense_Mutation_p.E709K|MGA_ENST00000566586.1_Missense_Mutation_p.E709K|MGA_ENST00000545763.1_Missense_Mutation_p.E709K			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GTTGGAAAAGGAATTGATAGA	0.348																																																	0													81.0	76.0	78.0					15																	41991294		1834	4083	5917	SO:0001583	missense	23269			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.2125G>A	15.37:g.41991294G>A	ENSP00000457035:p.Glu709Lys		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_TF_T-box,pfam_HLH_dom,superfamily_p53-like_TF_DNA-bd,superfamily_HLH_dom,smart_TF_T-box,smart_HLH_dom,pfscan_HLH_dom,pfscan_TF_T-box,prints_TF_T-box	p.E709K	ENST00000570161.1	37	c.2125	CCDS55959.1	15	.	.	.	.	.	.	.	.	.	.	G	18.22	3.574953	0.65878	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	T;T;T	0.47869	0.83;0.83;0.83	5.14	5.14	0.70334	.	2.639510	0.01224	N	0.008182	T	0.51075	0.1653	N	0.24115	0.695	0.35686	D	0.814472	D;B	0.53151	0.958;0.124	P;B	0.47645	0.553;0.033	T	0.51293	-0.8724	10	0.87932	D	0	.	16.7781	0.85557	0.0:0.0:1.0:0.0	.	709;709	F5H7K2;E7ENI0	.;.	K	709	ENSP00000219905:E709K;ENSP00000374586:E709K;ENSP00000442467:E709K	ENSP00000219905:E709K	E	+	1	0	MGA	39778586	1.000000	0.71417	1.000000	0.80357	0.779000	0.44077	6.706000	0.74649	2.406000	0.81754	0.561000	0.74099	GAA	MGA	-	NULL		0.348	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGA	HGNC	protein_coding	OTTHUMT00000420229.1	G	NM_001164273.1		41991294	+1	no_errors	ENST00000219905	ensembl	human	known	70_37	missense	SNP	1.000	A
MGAM	8972	genome.wustl.edu	37	7	141752684	141752684	+	Missense_Mutation	SNP	C	C	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr7:141752684C>A	ENST00000549489.2	+	26	3154	c.3059C>A	c.(3058-3060)tCc>tAc	p.S1020Y	MGAM_ENST00000475668.2_Missense_Mutation_p.S1020Y	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1020					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.S1020F(3)		cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GCTGACATCTCCTTAAAGTCT	0.468																																																	3	Substitution - Missense(3)	lung(3)											145.0	135.0	138.0					7																	141752684		1945	4147	6092	SO:0001583	missense	8972			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.3059C>A	7.37:g.141752684C>A	ENSP00000447378:p.Ser1020Tyr		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.S1020Y	ENST00000549489.2	37	c.3059	CCDS47727.1	7	.	.	.	.	.	.	.	.	.	.	C	12.78	2.041040	0.35989	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	T	0.10668	2.85	4.2	2.3	0.28687	Glycoside hydrolase-type carbohydrate-binding (1);	0.433124	0.17208	N	0.182879	T	0.13884	0.0336	M	0.75615	2.305	0.09310	N	1	P	0.40211	0.707	B	0.37943	0.261	T	0.09684	-1.0663	10	0.66056	D	0.02	.	8.9312	0.35672	0.0:0.8004:0.0:0.1996	.	1020	O43451	MGA_HUMAN	Y	1020;1020;897	ENSP00000447378:S1020Y	ENSP00000316431:S897Y	S	+	2	0	MGAM	141399153	0.055000	0.20627	0.526000	0.27913	0.475000	0.33008	0.182000	0.16900	0.711000	0.32018	0.454000	0.30748	TCC	MGAM	-	superfamily_Glyco_hydro-type_carb-bd		0.468	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	C			141752684	+1	no_errors	ENST00000549489	ensembl	human	known	70_37	missense	SNP	0.082	A
MGAT3	4248	genome.wustl.edu	37	22	39884875	39884875	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr22:39884875C>T	ENST00000341184.6	+	2	1738	c.1523C>T	c.(1522-1524)aCg>aTg	p.T508M		NM_001098270.1|NM_002409.4	NP_001091740.1|NP_002400.3	Q09327	MGAT3_HUMAN	mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase	508					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,4-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0003830)			endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|prostate(1)|skin(1)	24	Melanoma(58;0.04)					CCCAGGAGCACGGCGGCGGGC	0.657																																																	0													21.0	24.0	23.0					22																	39884875		2194	4290	6484	SO:0001583	missense	4248			D13789	CCDS13994.2	22q13.1	2013-02-25			ENSG00000128268	ENSG00000128268	2.4.1.144	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7046	protein-coding gene	gene with protein product		604621				8370666	Standard	NM_002409		Approved	GNT-III	uc010gxy.3	Q09327	OTTHUMG00000030185	ENST00000341184.6:c.1523C>T	22.37:g.39884875C>T	ENSP00000345270:p.Thr508Met		A6NGD0|Q14CK5|Q6IC49|Q9UH32	Missense_Mutation	SNP	pfam_Glyco_trans_17	p.T508M	ENST00000341184.6	37	c.1523	CCDS13994.2	22	.	.	.	.	.	.	.	.	.	.	C	10.72	1.428615	0.25726	.	.	ENSG00000128268	ENST00000341184	.	.	.	5.83	5.83	0.93111	.	0.316889	0.26149	N	0.026041	T	0.24314	0.0589	N	0.19112	0.55	0.09310	N	0.999999	P	0.49862	0.929	B	0.36885	0.235	T	0.29305	-1.0016	9	0.87932	D	0	.	15.6185	0.76787	0.0:1.0:0.0:0.0	.	508	Q09327	MGAT3_HUMAN	M	508	.	ENSP00000345270:T508M	T	+	2	0	MGAT3	38214821	0.899000	0.30636	0.028000	0.17463	0.361000	0.29550	2.361000	0.44160	2.775000	0.95449	0.650000	0.86243	ACG	MGAT3	-	NULL		0.657	MGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGAT3	HGNC	protein_coding	OTTHUMT00000075039.2	C	NM_002409		39884875	+1	no_errors	ENST00000341184	ensembl	human	known	70_37	missense	SNP	0.062	T
KMT2D	8085	genome.wustl.edu	37	12	49426469	49426469	+	Nonsense_Mutation	SNP	G	G	A	rs188017299		TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr12:49426469G>A	ENST00000301067.7	-	39	12018	c.12019C>T	c.(12019-12021)Caa>Taa	p.Q4007*	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	4007	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GAAAAGTGTTGAAGAGGCTTT	0.557																																																	0													56.0	60.0	59.0					12																	49426469		2124	4261	6385	SO:0001587	stop_gained	8085			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.12019C>T	12.37:g.49426469G>A	ENSP00000301067:p.Gln4007*		O14687	Nonsense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.Q4007*	ENST00000301067.7	37	c.12019	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	G	52	18.657301	0.99908	.	.	ENSG00000167548	ENST00000301067	.	.	.	5.31	5.31	0.75309	.	0.000000	0.36167	N	0.002755	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.1333	0.89609	0.0:0.0:1.0:0.0	.	.	.	.	X	4007	.	ENSP00000301067:Q4007X	Q	-	1	0	MLL2	47712736	1.000000	0.71417	0.999000	0.59377	0.683000	0.39861	4.173000	0.58249	2.675000	0.91044	0.591000	0.81541	CAA	MLL2	-	NULL		0.557	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL2	HGNC	protein_coding	OTTHUMT00000390183.2	G			49426469	-1	no_errors	ENST00000301067	ensembl	human	known	70_37	nonsense	SNP	0.954	A
KMT2C	58508	genome.wustl.edu	37	7	151848594	151848595	+	Frame_Shift_Ins	INS	-	-	GA			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr7:151848594_151848595insGA	ENST00000262189.6	-	50	12816_12817	c.12598_12599insTC	c.(12598-12600)catfs	p.H4200fs	KMT2C_ENST00000355193.2_Frame_Shift_Ins_p.H4257fs|KMT2C_ENST00000485241.1_5'Flank	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	4200					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										CACTTTACAATGACAACACCAC	0.411																																																	0																																										SO:0001589	frameshift_variant	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.12597_12598dupTC	7.37:g.151848595_151848596dupGA	ENSP00000262189:p.His4200fs		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Ins	INS	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.H4257fs	ENST00000262189.6	37	c.12770_12769	CCDS5931.1	7																																																																																			MLL3	-	NULL		0.411	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	HGNC	protein_coding	OTTHUMT00000318887.3	-			151848595	-1	no_errors	ENST00000355193	ensembl	human	known	70_37	frame_shift_ins	INS	1.000:1.000	GA
MMEL1	79258	genome.wustl.edu	37	1	2542727	2542727	+	Silent	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:2542727C>T	ENST00000378412.3	-	4	446	c.285G>A	c.(283-285)gtG>gtA	p.V95V	MMEL1_ENST00000288709.6_Silent_p.V86V|MMEL1_ENST00000502556.1_Silent_p.V95V			Q495T6	MMEL1_HUMAN	membrane metallo-endopeptidase-like 1	95						endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|urinary_tract(1)	27	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)		TACCTGCTATCACGCAGCCAG	0.706																																																	0													18.0	16.0	17.0					1																	2542727		2193	4294	6487	SO:0001819	synonymous_variant	79258			AF336981	CCDS30569.1, CCDS30569.2	1p36	2008-02-05			ENSG00000142606	ENSG00000142606			14668	protein-coding gene	gene with protein product			"""membrane metallo-endopeptidase-like 2"""	MMEL2			Standard	NM_033467		Approved	SEP, NL1, NL2, NEPII	uc001ajy.2	Q495T6	OTTHUMG00000000846	ENST00000378412.3:c.285G>A	1.37:g.2542727C>T			B9DI79|Q495T7|Q495T8|Q5SZS6|Q96PH9	Silent	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.V95	ENST00000378412.3	37	c.285	CCDS30569.2	1																																																																																			MMEL1	-	NULL		0.706	MMEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMEL1	HGNC	protein_coding	OTTHUMT00000002395.2	C	NM_033467		2542727	-1	no_errors	ENST00000378412	ensembl	human	known	70_37	silent	SNP	0.995	T
MPDZ	8777	genome.wustl.edu	37	9	13176300	13176300	+	Missense_Mutation	SNP	A	A	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr9:13176300A>T	ENST00000319217.7	-	20	3013	c.2766T>A	c.(2764-2766)agT>agA	p.S922R	MPDZ_ENST00000381022.2_Missense_Mutation_p.S922R|MPDZ_ENST00000546205.1_Missense_Mutation_p.S922R|MPDZ_ENST00000541718.1_Missense_Mutation_p.S922R|MPDZ_ENST00000536827.1_Missense_Mutation_p.S922R|MPDZ_ENST00000447879.1_Missense_Mutation_p.S922R|MPDZ_ENST00000381015.4_Missense_Mutation_p.S922R	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	922					cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		CAGGCCCCATACTTATGTCCA	0.413																																																	0													105.0	90.0	95.0					9																	13176300		1861	4104	5965	SO:0001583	missense	8777			AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.2766T>A	9.37:g.13176300A>T	ENSP00000320006:p.Ser922Arg		A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Missense_Mutation	SNP	pfam_PDZ,pfam_L27_2,superfamily_PDZ,smart_PDZ,pfscan_L27,pfscan_PDZ	p.S922R	ENST00000319217.7	37	c.2766		9	.	.	.	.	.	.	.	.	.	.	A	3.686	-0.064567	0.07273	.	.	ENSG00000107186	ENST00000319217;ENST00000541718;ENST00000381022;ENST00000536827;ENST00000447879;ENST00000381015;ENST00000399902;ENST00000546205	T;T;T;T;T;T;T	0.11063	2.86;2.81;2.81;2.82;2.87;2.86;2.86	5.78	-0.0755	0.13726	.	0.516771	0.17870	N	0.159204	T	0.03827	0.0108	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.001;0.003;0.003	T	0.40515	-0.9559	10	0.20519	T	0.43	.	3.0332	0.06113	0.2854:0.1048:0.4908:0.119	.	922;922;922	B7ZMI4;O75970-3;O75970-2	.;.;.	R	922;922;922;922;922;922;872;922	ENSP00000320006:S922R;ENSP00000439807:S922R;ENSP00000370410:S922R;ENSP00000444151:S922R;ENSP00000415208:S922R;ENSP00000370403:S922R;ENSP00000446358:S922R	ENSP00000320006:S922R	S	-	3	2	MPDZ	13166300	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.244000	0.18124	0.063000	0.16370	-0.468000	0.05107	AGT	MPDZ	-	NULL		0.413	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	MPDZ	HGNC	protein_coding	OTTHUMT00000055485.2	A	NM_003829		13176300	-1	no_errors	ENST00000319217	ensembl	human	known	70_37	missense	SNP	0.000	T
MPHOSPH9	10198	genome.wustl.edu	37	12	123682868	123682868	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr12:123682868C>G	ENST00000606320.1	-	12	2157	c.1951G>C	c.(1951-1953)Gat>Cat	p.D651H	MPHOSPH9_ENST00000541076.2_Missense_Mutation_p.D621H|MPHOSPH9_ENST00000392425.3_Missense_Mutation_p.D499H|MPHOSPH9_ENST00000302349.5_Missense_Mutation_p.D499H			Q99550	MPP9_HUMAN	M-phase phosphoprotein 9	651						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(18)|prostate(2)|skin(1)	33	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)		AAAGCACTATCTAATTGGCCA	0.303																																																	0													46.0	44.0	45.0					12																	123682868		2203	4299	6502	SO:0001583	missense	10198			X98258	CCDS9243.1, CCDS9243.2	12q24	2008-03-03			ENSG00000051825	ENSG00000051825			7215	protein-coding gene	gene with protein product		605501				8885239	Standard	NM_022782		Approved	MPP9	uc001uel.3	Q99550	OTTHUMG00000168849	ENST00000606320.1:c.1951G>C	12.37:g.123682868C>G	ENSP00000475489:p.Asp651His		A1L486|A6NEE2|B3KR87|Q9H976|U3KQ28	Missense_Mutation	SNP	superfamily_Prefoldin	p.D499H	ENST00000606320.1	37	c.1495		12	.	.	.	.	.	.	.	.	.	.	C	21.1	4.095789	0.76870	.	.	ENSG00000051825	ENST00000302349;ENST00000541076	T;T	0.78126	-1.15;-1.15	5.0	5.0	0.66597	.	0.445449	0.23596	N	0.046495	D	0.83459	0.5259	L	0.60455	1.87	0.41619	D	0.988956	D	0.56287	0.975	P	0.54759	0.76	D	0.85504	0.1193	10	0.66056	D	0.02	-15.0588	18.6715	0.91513	0.0:1.0:0.0:0.0	.	499	Q99550	MPP9_HUMAN	H	499	ENSP00000303597:D499H;ENSP00000445859:D499H	ENSP00000303597:D499H	D	-	1	0	MPHOSPH9	122248821	1.000000	0.71417	0.982000	0.44146	0.954000	0.61252	5.154000	0.64894	2.483000	0.83821	0.462000	0.41574	GAT	MPHOSPH9	-	superfamily_Prefoldin		0.303	MPHOSPH9-030	NOVEL	basic	protein_coding	MPHOSPH9	HGNC	protein_coding	OTTHUMT00000471390.2	C			123682868	-1	no_errors	ENST00000541076	ensembl	human	known	70_37	missense	SNP	0.996	G
MSL3	10943	genome.wustl.edu	37	X	11776885	11776885	+	Intron	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chrX:11776885C>G	ENST00000312196.4	+	1	207				MSL3_ENST00000361672.2_Intron|MSL3_ENST00000380693.3_5'Flank|MSL3_ENST00000398527.2_Missense_Mutation_p.P20R|MSL3_ENST00000337339.2_Intron	NM_078629.3	NP_523353.2	Q8N5Y2	MS3L1_HUMAN	male-specific lethal 3 homolog (Drosophila)						chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|multicellular organismal development (GO:0007275)|transcription from RNA polymerase II promoter (GO:0006366)	MSL complex (GO:0072487)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(3)|cervix(1)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|urinary_tract(1)	19						CCTGGCCGTCCGATCCAGGTT	0.602																																																	0																																										SO:0001627	intron_variant	10943			AF117065	CCDS14147.1, CCDS14148.1, CCDS14149.1, CCDS55369.1, CCDS65213.1	Xp22.3	2008-10-29	2008-10-29	2008-10-29	ENSG00000005302	ENSG00000005302			7370	protein-coding gene	gene with protein product		300609	"""male-specific lethal-3 (Drosophila)-like 1"", ""male-specific lethal 3-like 1 (Drosophila)"""	MSL3L1		10395802, 10908644	Standard	NM_078628		Approved		uc004cuw.3	Q8N5Y2	OTTHUMG00000021132	ENST00000312196.4:c.102+401C>G	X.37:g.11776885C>G			A6NCU2|A6NHW8|A8K165|B4DUV8|B7Z227|Q9UG70|Q9Y5Z8	Missense_Mutation	SNP	pfam_MRG_dom,pfam_Tudor-knot,superfamily_Chromodomain-like,smart_Chromo_domain/shadow	p.P20R	ENST00000312196.4	37	c.59	CCDS14147.1	X	.	.	.	.	.	.	.	.	.	.	C	10.40	1.340295	0.24339	.	.	ENSG00000005302	ENST00000421368;ENST00000398527	T;T	0.14022	2.54;3.16	2.89	-3.8	0.04307	.	.	.	.	.	T	0.07279	0.0184	N	0.19112	0.55	0.09310	N	0.999995	B	0.21821	0.061	B	0.28784	0.094	T	0.38757	-0.9646	9	0.56958	D	0.05	.	1.447	0.02366	0.1488:0.3989:0.1462:0.306	.	20	B4DUV8	.	R	20	ENSP00000401809:P20R;ENSP00000381538:P20R	ENSP00000381538:P20R	P	+	2	0	MSL3	11686806	0.000000	0.05858	0.000000	0.03702	0.059000	0.15707	-1.269000	0.02834	-1.220000	0.02594	0.525000	0.51046	CCG	MSL3	-	NULL		0.602	MSL3-009	KNOWN	basic|appris_principal|CCDS	protein_coding	MSL3	HGNC	protein_coding	OTTHUMT00000055757.1	C	NM_006800		11776885	+1	no_errors	ENST00000398527	ensembl	human	known	70_37	missense	SNP	0.000	G
MTHFD2L	441024	genome.wustl.edu	37	4	75147263	75147263	+	Silent	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr4:75147263C>T	ENST00000395759.2	+	7	954	c.927C>T	c.(925-927)ttC>ttT	p.F309F	MTHFD2L_ENST00000325278.6_Silent_p.F251F	NM_001144978.1	NP_001138450.1	Q9H903	MTD2L_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like	309					folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|tetrahydrofolate interconversion (GO:0035999)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NAD+) activity (GO:0004487)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)			central_nervous_system(1)|endometrium(1)|lung(4)|ovary(2)	8			all cancers(17;0.0101)|Lung(101;0.196)			ATGTGGACTTCGAAGGTAATA	0.338																																																	0													101.0	101.0	101.0					4																	75147263		2203	4300	6503	SO:0001819	synonymous_variant	441024			BC065771	CCDS47075.1	4q13.3	2011-08-03			ENSG00000163738	ENSG00000163738			31865	protein-coding gene	gene with protein product		614047				21163947	Standard	NM_001144978		Approved	MGC72244	uc011cbk.2	Q9H903	OTTHUMG00000157135	ENST00000395759.2:c.927C>T	4.37:g.75147263C>T			Q6P079|Q8N560	Silent	SNP	pfam_THF_DH/CycHdrlase_NAD-bd_dom,pfam_THF_DH/CycHdrlase_cat_dom,prints_THF_DH/CycHdrlase	p.F309	ENST00000395759.2	37	c.927	CCDS47075.1	4																																																																																			MTHFD2L	-	pfam_THF_DH/CycHdrlase_NAD-bd_dom,prints_THF_DH/CycHdrlase		0.338	MTHFD2L-202	KNOWN	basic|appris_principal|CCDS	protein_coding	MTHFD2L	HGNC	protein_coding		C	NM_001004346		75147263	+1	no_errors	ENST00000395759	ensembl	human	known	70_37	silent	SNP	1.000	T
MTOR	2475	genome.wustl.edu	37	1	11181396	11181396	+	Silent	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:11181396C>T	ENST00000361445.4	-	49	6916	c.6840G>A	c.(6838-6840)ctG>ctA	p.L2280L	MTOR_ENST00000376838.1_Silent_p.L485L	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	2280	Interaction with MLST8.|PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	CCTTCTGCATCAGAGTCAAGT	0.532																																																	0													134.0	108.0	117.0					1																	11181396		2203	4300	6503	SO:0001819	synonymous_variant	2475			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.6840G>A	1.37:g.11181396C>T			Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Silent	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_DUF3385_TOR,pfam_Rapamycin-bd_dom,pfam_FATC,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,superfamily_Rapamycin-bd_dom,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.L2280	ENST00000361445.4	37	c.6840	CCDS127.1	1																																																																																			MTOR	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom		0.532	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTOR	HGNC	protein_coding	OTTHUMT00000005558.1	C	NM_004958		11181396	-1	no_errors	ENST00000361445	ensembl	human	known	70_37	silent	SNP	1.000	T
MUC2	4583	genome.wustl.edu	37	11	1095260	1095260	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr11:1095260C>G	ENST00000441003.2	+	32	6107	c.6080C>G	c.(6079-6081)tCg>tGg	p.S2027W	MUC2_ENST00000361558.6_Missense_Mutation_p.S165W|MUC2_ENST00000333592.6_3'UTR	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4389					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CCCTCCAAGTCGACGCCCACG	0.612																																																	0													76.0	97.0	90.0					11																	1095260		2130	4220	6350	SO:0001583	missense	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.6080C>G	11.37:g.1095260C>G	ENSP00000415183:p.Ser2027Trp		Q14878	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.S2027W	ENST00000441003.2	37	c.6080		11	.	.	.	.	.	.	.	.	.	.	C	11.58	1.679874	0.29783	.	.	ENSG00000198788	ENST00000441003;ENST00000361558	T;T	0.44881	2.52;0.91	2.72	1.72	0.24424	.	.	.	.	.	T	0.47875	0.1469	M	0.62723	1.935	0.09310	N	1	P	0.50819	0.939	P	0.51701	0.677	T	0.33979	-0.9847	9	0.72032	D	0.01	.	7.1439	0.25573	0.0:0.7176:0.2824:0.0	.	2027	E7EUV1	.	W	2027;165	ENSP00000415183:S2027W;ENSP00000354885:S165W	ENSP00000354885:S165W	S	+	2	0	MUC2	1085260	0.387000	0.25188	0.000000	0.03702	0.005000	0.04900	3.682000	0.54656	0.404000	0.25506	0.491000	0.48974	TCG	MUC2	-	NULL		0.612	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	HGNC	protein_coding	OTTHUMT00000345894.2	C	NM_002457		1095260	+1	no_errors	ENST00000441003	ensembl	human	known	70_37	missense	SNP	0.001	G
MUC4	4585	genome.wustl.edu	37	3	195513362	195513362	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr3:195513362G>A	ENST00000463781.3	-	2	5548	c.5089C>T	c.(5089-5091)Ctt>Ttt	p.L1697F	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.L1697F	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTGACAGGAAGACGGGTGGTG	0.602																																																	0													40.0	43.0	42.0					3																	195513362		689	1582	2271	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5089C>T	3.37:g.195513362G>A	ENSP00000417498:p.Leu1697Phe		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.L1697F	ENST00000463781.3	37	c.5089	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	-	6.568	0.473061	0.12461	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.47528	1.05;0.84	.	.	.	.	.	.	.	.	T	0.30324	0.0761	N	0.19112	0.55	0.09310	N	1	P	0.50156	0.932	B	0.43990	0.438	T	0.13575	-1.0504	7	.	.	.	.	5.8679	0.18786	8.0E-4:0.0:0.9992:0.0	.	1697	E7ESK3	.	F	1697	ENSP00000417498:L1697F;ENSP00000420243:L1697F	.	L	-	1	0	MUC4	196997757	0.080000	0.21391	0.016000	0.15963	0.016000	0.09150	1.408000	0.34668	0.088000	0.17205	0.089000	0.15464	CTT	MUC4	-	NULL		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	G	NM_018406		195513362	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	missense	SNP	0.029	A
MUC5B	727897	genome.wustl.edu	37	11	1261581	1261581	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr11:1261581G>A	ENST00000529681.1	+	30	4004	c.3946G>A	c.(3946-3948)Gcc>Acc	p.A1316T	MUC5B_ENST00000447027.1_Missense_Mutation_p.A1319T|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1316					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CTTCACCACCGCCTGGGTCCC	0.622																																																	0													87.0	97.0	93.0					11																	1261581		2090	4213	6303	SO:0001583	missense	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.3946G>A	11.37:g.1261581G>A	ENSP00000436812:p.Ala1316Thr		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.A1319T	ENST00000529681.1	37	c.3955	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	G	10.34	1.322901	0.23994	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.15487	2.42;2.61	4.5	-1.86	0.07760	.	.	.	.	.	T	0.03871	0.0109	N	0.00368	-1.59	0.09310	N	1	B;B	0.14438	0.01;0.01	B;B	0.06405	0.002;0.002	T	0.38972	-0.9636	9	0.87932	D	0	.	5.9718	0.19357	0.4827:0.0:0.3922:0.1251	.	2009;1319	A7Y9J9;E9PBJ0	.;.	T	1316;1319;1317;1386	ENSP00000436812:A1316T;ENSP00000415793:A1319T	ENSP00000343037:A1317T	A	+	1	0	MUC5B	1218157	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	0.271000	0.18626	-0.430000	0.07318	-1.598000	0.00824	GCC	MUC5B	-	NULL		0.622	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	G	XM_001126093		1261581	+1	no_errors	ENST00000447027	ensembl	human	known	70_37	missense	SNP	0.000	A
MYH16	84176	genome.wustl.edu	37	7	98845316	98845316	+	RNA	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr7:98845316G>A	ENST00000453194.1	+	0	372									myosin, heavy chain 16 pseudogene																		GAAGCGCACAGAGATGCCGCC	0.617																																																	0																																												84176			BK001410		7q22.1	2013-09-26	2007-12-17		ENSG00000002079	ENSG00000002079		"""Myosins / Myosin superfamily : Class II"""	31038	pseudogene	pseudogene	"""sarcomeric myosin"""	608580	"""myosin, heavy polypeptide 5"", ""myosin, heavy polypeptide 16"", ""myosin, heavy chain 16"""	MYH5		11919279, 15014174	Standard	NR_002147		Approved	MHC20, MYH16P	uc003upw.3		OTTHUMG00000154426		7.37:g.98845316G>A				RNA	SNP	-	NULL	ENST00000453194.1	37	NULL		7																																																																																			MYH16	-	-		0.617	MYH16-002	KNOWN	basic	processed_transcript	MYH16	HGNC	pseudogene	OTTHUMT00000335264.1	G	NR_002147		98845316	+1	no_errors	ENST00000453194	ensembl	human	known	70_37	rna	SNP	0.998	A
MYH16	84176	genome.wustl.edu	37	7	98845346	98845346	+	RNA	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr7:98845346G>A	ENST00000453194.1	+	0	402									myosin, heavy chain 16 pseudogene																		CTCCATCTCTGACAACGCCTA	0.612																																																	0																																												84176			BK001410		7q22.1	2013-09-26	2007-12-17		ENSG00000002079	ENSG00000002079		"""Myosins / Myosin superfamily : Class II"""	31038	pseudogene	pseudogene	"""sarcomeric myosin"""	608580	"""myosin, heavy polypeptide 5"", ""myosin, heavy polypeptide 16"", ""myosin, heavy chain 16"""	MYH5		11919279, 15014174	Standard	NR_002147		Approved	MHC20, MYH16P	uc003upw.3		OTTHUMG00000154426		7.37:g.98845346G>A				RNA	SNP	-	NULL	ENST00000453194.1	37	NULL		7																																																																																			MYH16	-	-		0.612	MYH16-002	KNOWN	basic	processed_transcript	MYH16	HGNC	pseudogene	OTTHUMT00000335264.1	G	NR_002147		98845346	+1	no_errors	ENST00000453194	ensembl	human	known	70_37	rna	SNP	1.000	A
MYOCD	93649	genome.wustl.edu	37	17	12666834	12666834	+	Missense_Mutation	SNP	C	C	T	rs139170912		TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr17:12666834C>T	ENST00000343344.4	+	13	2690	c.2690C>T	c.(2689-2691)cCg>cTg	p.P897L	RP11-1090M7.1_ENST00000584772.1_RNA|MYOCD_ENST00000425538.1_Missense_Mutation_p.P945L			Q8IZQ8	MYCD_HUMAN	myocardin	897					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		GACCTCACTCCGCCAAATTCC	0.512													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17530	0.0		0.0	False		,,,				2504	0.0																0								C	LEU/PRO,LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	68.0	61.0	63.0		2834,2690	6.1	0.9	17	dbSNP_134	63	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	MYOCD	NM_001146312.1,NM_153604.2	98,98	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging,probably-damaging	945/987,897/939	12666834	2,13004	2203	4300	6503	SO:0001583	missense	93649			AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.2690C>T	17.37:g.12666834C>T	ENSP00000341835:p.Pro897Leu		Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	pfam_RPEL_repeat,pfam_SAP_DNA-bd,smart_RPEL_repeat,smart_SAP_DNA-bd,pfscan_RPEL_repeat,pfscan_SAP_DNA-bd	p.P945L	ENST00000343344.4	37	c.2834	CCDS11163.1	17	.	.	.	.	.	.	.	.	.	.	C	18.70	3.679565	0.68042	2.27E-4	1.16E-4	ENSG00000141052	ENST00000395982;ENST00000425538;ENST00000343344;ENST00000443061	T;T	0.46451	0.89;0.87	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.58323	0.2114	L	0.60455	1.87	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.992;1.0;0.999	T	0.49542	-0.8929	10	0.02654	T	1	-20.3272	19.4349	0.94788	0.0:1.0:0.0:0.0	.	621;945;897	E9PEP9;Q8IZQ8-3;Q8IZQ8	.;.;MYCD_HUMAN	L	621;945;897;607	ENSP00000341835:P897L;ENSP00000400148:P607L	ENSP00000341835:P897L	P	+	2	0	MYOCD	12607559	1.000000	0.71417	0.946000	0.38457	0.430000	0.31655	7.440000	0.80464	2.894000	0.99253	0.655000	0.94253	CCG	MYOCD	-	NULL		0.512	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOCD	HGNC	protein_coding	OTTHUMT00000129950.1	C	NM_153604		12666834	+1	no_errors	ENST00000425538	ensembl	human	known	70_37	missense	SNP	1.000	T
NACC2	138151	genome.wustl.edu	37	9	138903634	138903634	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr9:138903634C>T	ENST00000371753.1	-	5	1550	c.1492G>A	c.(1492-1494)Gag>Aag	p.E498K	NACC2_ENST00000277554.2_Missense_Mutation_p.E498K			Q96BF6	NACC2_HUMAN	NACC family member 2, BEN and BTB (POZ) domain containing	498					cellular protein complex localization (GO:0034629)|histone deacetylation (GO:0016575)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle by negative regulation of transcription from RNA polymerase II promoter (GO:1900477)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|posttranscriptional regulation of gene expression (GO:0010608)|protein homooligomerization (GO:0051260)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)			endometrium(2)|kidney(1)|lung(1)|urinary_tract(1)	5						CCCCGCCGCTCGGCGTAGATG	0.706																																																	0													7.0	8.0	7.0					9																	138903634		2145	4200	6345	SO:0001583	missense	138151			BC015649	CCDS6993.1	9q34.3	2013-01-09	2008-10-03	2008-10-03	ENSG00000148411	ENSG00000148411		"""BEN domain containing"", ""BTB/POZ domain containing"""	23846	protein-coding gene	gene with protein product	"""BEN domain containing 9"""	615786	"""BTB (POZ) domain containing 14A"""	BTBD14A		12477932	Standard	NM_144653		Approved	MGC23427, BEND9, BTBD31	uc004cgv.4	Q96BF6	OTTHUMG00000020921	ENST00000371753.1:c.1492G>A	9.37:g.138903634C>T	ENSP00000360818:p.Glu498Lys			Missense_Mutation	SNP	pfam_BTB_POZ,pfam_BEN_domain,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.E498K	ENST00000371753.1	37	c.1492	CCDS6993.1	9	.	.	.	.	.	.	.	.	.	.	C	16.05	3.012228	0.54468	.	.	ENSG00000148411	ENST00000371753;ENST00000277554	T;T	0.68903	-0.36;-0.36	5.13	5.13	0.70059	.	0.139194	0.46145	D	0.000314	T	0.50531	0.1621	N	0.24115	0.695	0.40210	D	0.977616	P	0.49635	0.926	B	0.33960	0.173	T	0.63409	-0.6644	10	0.87932	D	0	.	17.5547	0.87887	0.0:1.0:0.0:0.0	.	498	Q96BF6	NACC2_HUMAN	K	498	ENSP00000360818:E498K;ENSP00000277554:E498K	ENSP00000277554:E498K	E	-	1	0	NACC2	138043455	0.990000	0.36364	0.900000	0.35374	0.148000	0.21650	5.193000	0.65120	2.384000	0.81235	0.313000	0.20887	GAG	NACC2	-	NULL		0.706	NACC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NACC2	HGNC	protein_coding	OTTHUMT00000055040.1	C	NM_144653		138903634	-1	no_errors	ENST00000277554	ensembl	human	known	70_37	missense	SNP	0.992	T
NBEAL2	23218	genome.wustl.edu	37	3	47030778	47030778	+	Missense_Mutation	SNP	G	G	A	rs376604123		TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr3:47030778G>A	ENST00000450053.3	+	5	559	c.380G>A	c.(379-381)cGa>cAa	p.R127Q	NBEAL2_ENST00000292309.5_Missense_Mutation_p.R127Q|NBEAL2_ENST00000383740.2_5'UTR	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	127					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		CCCCAGGGCCGAGGCACGCAG	0.642													A|||	1	0.000199681	0.0008	0.0	5008	,	,		17528	0.0		0.0	False		,,,				2504	0.0																0													35.0	44.0	41.0					3																	47030778		2124	4208	6332	SO:0001583	missense	23218			AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.380G>A	3.37:g.47030778G>A	ENSP00000415034:p.Arg127Gln		O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R127Q	ENST00000450053.3	37	c.380	CCDS46817.1	3	.	.	.	.	.	.	.	.	.	.	A	7.426	0.637661	0.14386	.	.	ENSG00000160796	ENST00000292309;ENST00000450053;ENST00000296147	T;T	0.55760	0.52;0.5	4.07	-3.23	0.05109	.	.	.	.	.	T	0.31827	0.0809	N	0.19112	0.55	0.09310	N	0.999998	B;B	0.15719	0.014;0.013	B;B	0.08055	0.001;0.003	T	0.28364	-1.0046	9	0.12430	T	0.62	.	11.9471	0.52934	0.5818:0.0:0.4182:0.0	.	120;127	Q6ZNJ1-4;Q6ZNJ1	.;NBEL2_HUMAN	Q	127;127;120	ENSP00000292309:R127Q;ENSP00000415034:R127Q	ENSP00000292309:R127Q	R	+	2	0	NBEAL2	47005782	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.049000	0.01405	-1.469000	0.01890	-1.799000	0.00621	CGA	NBEAL2	-	NULL		0.642	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL2	HGNC	protein_coding	OTTHUMT00000344363.3	G	XM_291064		47030778	+1	no_errors	ENST00000450053	ensembl	human	known	70_37	missense	SNP	0.000	A
NBPF20	100288142	genome.wustl.edu	37	1	148252786	148252786	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:148252786C>G	ENST00000369202.1	-	110	13763	c.13566G>C	c.(13564-13566)aaG>aaC	p.K4522N				Q3BBV1	NBPFK_HUMAN	neuroblastoma breakpoint family, member 20	843						cytoplasm (GO:0005737)				breast(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|urinary_tract(1)	27						ttcttcttttcttctttgatc	0.418																																																	0																																										SO:0001583	missense	100288142				CCDS72856.1	1q21.2	2014-01-16			ENSG00000203832			"""neuroblastoma breakpoint family"""	32000	protein-coding gene	gene with protein product		614007				16079250	Standard	NM_001278267		Approved			Q3BBV1	OTTHUMG00000042439	ENST00000369202.1:c.13566G>C	1.37:g.148252786C>G	ENSP00000358203:p.Lys4522Asn			Missense_Mutation	SNP	pfam_NBPF_dom	p.K4522N	ENST00000369202.1	37	c.13566		1	.	.	.	.	.	.	.	.	.	.	.	8.739	0.918439	0.17982	.	.	ENSG00000203832	ENST00000414231;ENST00000369202;ENST00000446099;ENST00000430395	T	0.04603	3.59	.	.	.	.	.	.	.	.	T	0.00906	0.0030	.	.	.	0.22571	N	0.998979	B;B;.	0.33212	0.008;0.402;.	B;B;.	0.33690	0.001;0.168;.	T	0.38950	-0.9637	5	0.62326	D	0.03	.	.	.	.	.	170;833;4522	B4DS78;Q8IX62;A2BH96	.;.;.	N	572;4522;75;170	ENSP00000358203:K4522N	ENSP00000358203:K4522N	K	-	3	2	NBPF20	146619410	0.014000	0.17966	0.027000	0.17364	0.032000	0.12392	-0.472000	0.06623	-2.375000	0.00598	-2.399000	0.00225	AAG	NBPF20	-	NULL		0.418	NBPF20-001	KNOWN	basic|appris_principal	protein_coding	NBPF20	HGNC	protein_coding	OTTHUMT00000100689.2	C			148252786	-1	no_errors	ENST00000369202	ensembl	human	known	70_37	missense	SNP	0.028	G
NDC80	10403	genome.wustl.edu	37	18	2616517	2616517	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr18:2616517G>C	ENST00000261597.4	+	17	2055	c.1873G>C	c.(1873-1875)Gag>Cag	p.E625Q		NM_006101.2	NP_006092.1	O14777	NDC80_HUMAN	NDC80 kinetochore complex component	625	Interaction with the C-terminus of CDCA1 and the SPBC24-SPBC25 subcomplex.				attachment of spindle microtubules to kinetochore (GO:0008608)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				NS(1)|biliary_tract(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)|urinary_tract(2)	22						AAATATTAAAGAGATTAGAGA	0.299																																																	0													40.0	43.0	42.0					18																	2616517		2199	4282	6481	SO:0001583	missense	10403			AF017790	CCDS11827.1	18p11.31	2013-01-17	2013-01-17	2007-03-02	ENSG00000080986	ENSG00000080986			16909	protein-coding gene	gene with protein product		607272	"""highly expressed in cancer, rich in leucine heptad repeats (yeast)"", ""kinetochore associated 2"", ""NDC80 kinetochore complex component homolog (S. cerevisiae)"""	KNTC2		9315664, 12351790	Standard	NM_006101		Approved	HEC, HEC1, hsNDC80, TID3	uc002kli.3	O14777	OTTHUMG00000131483	ENST00000261597.4:c.1873G>C	18.37:g.2616517G>C	ENSP00000261597:p.Glu625Gln		Q6PJX2	Missense_Mutation	SNP	pfam_Kinetochore_Ndc80,superfamily_t-SNARE	p.E625Q	ENST00000261597.4	37	c.1873	CCDS11827.1	18	.	.	.	.	.	.	.	.	.	.	G	7.891	0.732376	0.15507	.	.	ENSG00000080986	ENST00000261597	T	0.49432	0.78	5.47	4.59	0.56863	.	0.333418	0.34245	N	0.004123	T	0.34948	0.0915	L	0.47716	1.5	0.28039	N	0.933831	P	0.39216	0.664	B	0.34242	0.178	T	0.18871	-1.0323	10	0.15066	T	0.55	-4.8199	10.1561	0.42823	0.0768:0.137:0.7862:0.0	.	625	O14777	NDC80_HUMAN	Q	625	ENSP00000261597:E625Q	ENSP00000261597:E625Q	E	+	1	0	NDC80	2606517	1.000000	0.71417	0.991000	0.47740	0.167000	0.22549	2.210000	0.42816	1.407000	0.46875	0.555000	0.69702	GAG	NDC80	-	NULL		0.299	NDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDC80	HGNC	protein_coding	OTTHUMT00000254327.1	G	NM_006101		2616517	+1	no_errors	ENST00000261597	ensembl	human	known	70_37	missense	SNP	0.974	C
NDST4	64579	genome.wustl.edu	37	4	115898403	115898403	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr4:115898403G>A	ENST00000264363.2	-	3	1684	c.1006C>T	c.(1006-1008)Cgc>Tgc	p.R336C		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	336	Heparan sulfate N-deacetylase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		ACCTGAGTGCGCAGTAAATTT	0.343																																																	0													74.0	77.0	76.0					4																	115898403		2203	4300	6503	SO:0001583	missense	64579			AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.1006C>T	4.37:g.115898403G>A	ENSP00000264363:p.Arg336Cys		Q2KHM8	Missense_Mutation	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom	p.R336C	ENST00000264363.2	37	c.1006	CCDS3706.1	4	.	.	.	.	.	.	.	.	.	.	G	29.2	4.986208	0.93044	.	.	ENSG00000138653	ENST00000264363	T	0.44881	0.91	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.72740	0.3498	M	0.90198	3.095	0.80722	D	1	D	0.89917	1.0	D	0.70016	0.967	T	0.77517	-0.2558	10	0.87932	D	0	.	20.2576	0.98430	0.0:0.0:1.0:0.0	.	336	Q9H3R1	NDST4_HUMAN	C	336	ENSP00000264363:R336C	ENSP00000264363:R336C	R	-	1	0	NDST4	116117852	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.985000	0.88162	2.783000	0.95769	0.655000	0.94253	CGC	NDST4	-	pfam_Heparan_SO4_deacetylase		0.343	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST4	HGNC	protein_coding	OTTHUMT00000256427.1	G	NM_022569		115898403	-1	no_errors	ENST00000264363	ensembl	human	known	70_37	missense	SNP	1.000	A
NFATC3	4775	genome.wustl.edu	37	16	68248234	68248234	+	Intron	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr16:68248234C>G	ENST00000346183.3	+	10	3130				NFATC3_ENST00000349223.5_Intron|RP11-96D1.5_ENST00000569088.1_RNA|NFATC3_ENST00000535127.2_3'UTR|NFATC3_ENST00000575270.1_Intron|NFATC3_ENST00000329524.4_Missense_Mutation_p.Q1037E	NM_173165.2	NP_775188.1	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3						cellular respiration (GO:0045333)|cellular response to calcium ion (GO:0071277)|cellular response to lithium ion (GO:0071285)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	44		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		TGACACAGACCAATTTATATC	0.423																																																	0													153.0	128.0	136.0					16																	68248234		2198	4300	6498	SO:0001627	intron_variant	4775			L41067	CCDS10860.1, CCDS10861.1, CCDS10862.1	16q22	2009-11-24			ENSG00000072736	ENSG00000072736		"""Nuclear factor of activated T-cells"""	7777	protein-coding gene	gene with protein product		602698				7749981	Standard	NM_004555		Approved	NFAT4, NFATX	uc002evo.2	Q12968	OTTHUMG00000137555	ENST00000346183.3:c.3107-12019C>G	16.37:g.68248234C>G			O75211|Q14516|Q99840|Q99841|Q99842	Missense_Mutation	SNP	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT_TIG_rcpt,pfscan_RHD,prints_NFAT	p.Q1037E	ENST00000346183.3	37	c.3109	CCDS10860.1	16	.	.	.	.	.	.	.	.	.	.	C	14.84	2.654042	0.47362	.	.	ENSG00000072736	ENST00000329524;ENST00000535127	T	0.07327	3.2	5.96	5.96	0.96718	.	.	.	.	.	T	0.07143	0.0181	N	0.22421	0.69	0.28354	N	0.920776	B	0.25609	0.13	B	0.19148	0.024	T	0.17319	-1.0373	9	0.36615	T	0.2	.	12.9566	0.58432	0.1718:0.8282:0.0:0.0	.	1037	B5B2S0	.	E	1037;558	ENSP00000331324:Q1037E	ENSP00000331324:Q1037E	Q	+	1	0	NFATC3	66805735	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.095000	0.50235	2.826000	0.97356	0.655000	0.94253	CAA	NFATC3	-	NULL		0.423	NFATC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NFATC3	HGNC	protein_coding	OTTHUMT00000268890.2	C	NM_004555		68248234	+1	no_errors	ENST00000329524	ensembl	human	known	70_37	missense	SNP	1.000	G
NFE2L3	9603	genome.wustl.edu	37	7	26225031	26225031	+	Silent	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr7:26225031G>C	ENST00000056233.3	+	4	1972	c.1713G>C	c.(1711-1713)ctG>ctC	p.L571L		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	571					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						GATATTATCTGACAGACCTAC	0.388																																																	0													84.0	80.0	81.0					7																	26225031		2202	4300	6502	SO:0001819	synonymous_variant	9603			AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.1713G>C	7.37:g.26225031G>C			Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Silent	SNP	pfam_bZIP,pfam_bZIP_Maf,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.L571	ENST00000056233.3	37	c.1713	CCDS5396.1	7																																																																																			NFE2L3	-	pfam_bZIP_Maf,superfamily_Euk_TF_DNA-bd		0.388	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFE2L3	HGNC	protein_coding	OTTHUMT00000214088.1	G			26225031	+1	no_errors	ENST00000056233	ensembl	human	known	70_37	silent	SNP	1.000	C
NFYA	4800	genome.wustl.edu	37	6	41060767	41060767	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr6:41060767G>C	ENST00000341376.6	+	8	1032	c.831G>C	c.(829-831)aaG>aaC	p.K277N	NFYA_ENST00000353205.5_Missense_Mutation_p.K248N|OARD1_ENST00000480585.1_Intron	NM_002505.4	NP_002496.1	P23511	NFYA_HUMAN	nuclear transcription factor Y, alpha	277					cellular lipid metabolic process (GO:0044255)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription from RNA polymerase II promoter (GO:0006366)	CCAAT-binding factor complex (GO:0016602)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|large_intestine(4)|lung(2)|urinary_tract(1)	9	Ovarian(28;0.0418)|Colorectal(47;0.196)					GTATTCTTAAGAGGAGGCAAG	0.463																																																	0													97.0	92.0	94.0					6																	41060767		2203	4300	6503	SO:0001583	missense	4800				CCDS4849.1, CCDS4850.1	6p21.3	2008-11-11			ENSG00000001167	ENSG00000001167			7804	protein-coding gene	gene with protein product		189903				1774067, 9612081	Standard	NM_002505		Approved	HAP2, CBF-B, NF-YA	uc003opo.3	P23511	OTTHUMG00000014669	ENST00000341376.6:c.831G>C	6.37:g.41060767G>C	ENSP00000345702:p.Lys277Asn		Q8IXU0	Missense_Mutation	SNP	pfam_TF_CBFB,smart_TF_CBFB,pfscan_TF_CBFB,prints_TF_CBFB	p.K277N	ENST00000341376.6	37	c.831	CCDS4849.1	6	.	.	.	.	.	.	.	.	.	.	G	23.3	4.405608	0.83230	.	.	ENSG00000001167	ENST00000341376;ENST00000353205	.	.	.	5.88	3.13	0.36017	CCAAT-binding factor, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.75384	0.3842	M	0.89785	3.06	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.87578	0.982;0.998	T	0.79841	-0.1633	9	0.87932	D	0	-19.2774	10.561	0.45146	0.2102:0.0:0.7898:0.0	.	248;277	P23511-2;P23511	.;NFYA_HUMAN	N	277;248	.	ENSP00000345702:K277N	K	+	3	2	NFYA	41168745	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.856000	0.62932	0.836000	0.34901	0.655000	0.94253	AAG	NFYA	-	pfam_TF_CBFB,smart_TF_CBFB,pfscan_TF_CBFB,prints_TF_CBFB		0.463	NFYA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFYA	HGNC	protein_coding	OTTHUMT00000040496.1	G			41060767	+1	no_errors	ENST00000341376	ensembl	human	known	70_37	missense	SNP	1.000	C
NIPSNAP1	8508	genome.wustl.edu	37	22	29956727	29956727	+	Silent	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr22:29956727G>C	ENST00000216121.7	-	8	956	c.702C>G	c.(700-702)ctC>ctG	p.L234L		NM_001202502.1|NM_003634.3	NP_001189431.1|NP_003625.2	Q9BPW8	NIPS1_HUMAN	nipsnap homolog 1 (C. elegans)	234					sensory perception of pain (GO:0019233)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|synaptic membrane (GO:0097060)	neurotransmitter binding (GO:0042165)	p.?(1)		large_intestine(2)|lung(2)|skin(1)	5						ACCTACCCCAGAGATGGTGCA	0.532																																																	1	Unknown(1)	lung(1)											137.0	136.0	136.0					22																	29956727		2203	4300	6503	SO:0001819	synonymous_variant	8508			AJ001258	CCDS13860.1	22q12	2013-09-12	2001-11-28		ENSG00000184117	ENSG00000184117			7827	protein-coding gene	gene with protein product	"""4-nitrophenylphosphatase domain and non-neuronal SNAP25-like 1"""	603249	"""NIPSNAP, C. elegans, homolog 1"""			9661659	Standard	NM_003634		Approved		uc003afx.4	Q9BPW8	OTTHUMG00000151294	ENST00000216121.7:c.702C>G	22.37:g.29956727G>C			B2RAY3|O43800	Silent	SNP	pfam_NIPSNAP,superfamily_Dimeric_a/b-barrel	p.L234	ENST00000216121.7	37	c.702	CCDS13860.1	22																																																																																			NIPSNAP1	-	pfam_NIPSNAP,superfamily_Dimeric_a/b-barrel		0.532	NIPSNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPSNAP1	HGNC	protein_coding	OTTHUMT00000322117.1	G			29956727	-1	no_errors	ENST00000216121	ensembl	human	known	70_37	silent	SNP	0.994	C
NIPSNAP1	8508	genome.wustl.edu	37	22	29956745	29956745	+	Silent	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr22:29956745G>C	ENST00000216121.7	-	8	938	c.684C>G	c.(682-684)ctC>ctG	p.L228L		NM_001202502.1|NM_003634.3	NP_001189431.1|NP_003625.2	Q9BPW8	NIPS1_HUMAN	nipsnap homolog 1 (C. elegans)	228					sensory perception of pain (GO:0019233)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|synaptic membrane (GO:0097060)	neurotransmitter binding (GO:0042165)	p.?(1)		large_intestine(2)|lung(2)|skin(1)	5						GCACCACGTAGAGCTCTCCTA	0.537																																																	1	Unknown(1)	lung(1)											148.0	144.0	145.0					22																	29956745		2203	4300	6503	SO:0001819	synonymous_variant	8508			AJ001258	CCDS13860.1	22q12	2013-09-12	2001-11-28		ENSG00000184117	ENSG00000184117			7827	protein-coding gene	gene with protein product	"""4-nitrophenylphosphatase domain and non-neuronal SNAP25-like 1"""	603249	"""NIPSNAP, C. elegans, homolog 1"""			9661659	Standard	NM_003634		Approved		uc003afx.4	Q9BPW8	OTTHUMG00000151294	ENST00000216121.7:c.684C>G	22.37:g.29956745G>C			B2RAY3|O43800	Silent	SNP	pfam_NIPSNAP,superfamily_Dimeric_a/b-barrel	p.L228	ENST00000216121.7	37	c.684	CCDS13860.1	22																																																																																			NIPSNAP1	-	pfam_NIPSNAP,superfamily_Dimeric_a/b-barrel		0.537	NIPSNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPSNAP1	HGNC	protein_coding	OTTHUMT00000322117.1	G			29956745	-1	no_errors	ENST00000216121	ensembl	human	known	70_37	silent	SNP	0.996	C
NLRP9	338321	genome.wustl.edu	37	19	56220299	56220299	+	Silent	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr19:56220299C>T	ENST00000332836.2	-	9	2982	c.2955G>A	c.(2953-2955)aaG>aaA	p.K985K	CTD-2611O12.7_ENST00000597680.1_RNA|CTD-2611O12.8_ENST00000596293.1_RNA|CTD-2611O12.6_ENST00000600582.1_RNA	NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	985						cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		CACCCCTGATCTTGTATTCCT	0.493																																																	0													111.0	108.0	109.0					19																	56220299		2203	4300	6503	SO:0001819	synonymous_variant	338321			AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.2955G>A	19.37:g.56220299C>T			B2RN12|Q86W27	Silent	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.K985	ENST00000332836.2	37	c.2955	CCDS12934.1	19																																																																																			NLRP9	-	NULL		0.493	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP9	HGNC	protein_coding	OTTHUMT00000453653.1	C	NM_176820		56220299	-1	no_errors	ENST00000332836	ensembl	human	known	70_37	silent	SNP	0.002	T
NME7	29922	genome.wustl.edu	37	1	169292499	169292499	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:169292499G>C	ENST00000367811.3	-	3	390	c.134C>G	c.(133-135)aCc>aGc	p.T45S	NME7_ENST00000472647.1_Missense_Mutation_p.T9S|NME7_ENST00000469474.1_5'UTR|RP4-800F24.1_ENST00000432081.1_RNA	NM_013330.3	NP_037462.1	Q9Y5B8	NDK7_HUMAN	NME/NM23 family member 7	45	DM10. {ECO:0000255|PROSITE- ProRule:PRU00665}.				brain development (GO:0007420)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|CTP biosynthetic process (GO:0006241)|determination of left/right symmetry (GO:0007368)|epithelial cilium movement (GO:0003351)|GTP biosynthetic process (GO:0006183)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|UTP biosynthetic process (GO:0006228)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(8)|skin(1)	16	all_hematologic(923;0.208)					CTTTAAAAAGGTGCGATGATT	0.318																																																	0													149.0	158.0	155.0					1																	169292499		2203	4300	6503	SO:0001583	missense	29922			AF153191	CCDS1277.1, CCDS44274.1	1q24.2	2014-07-31	2012-05-18		ENSG00000143156	ENSG00000143156			20461	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 67"""	613465	"""non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase)"""			19852809	Standard	NM_197972		Approved	FLJ37194, NM23-H7, CFAP67	uc001gfu.3	Q9Y5B8	OTTHUMG00000034586	ENST00000367811.3:c.134C>G	1.37:g.169292499G>C	ENSP00000356785:p.Thr45Ser		A8K3T6|A8MY09|B3KSW9|Q5TGZ4	Missense_Mutation	SNP	pfam_Nucleoside_diP_kinase,superfamily_Nucleoside_diP_kinase,smart_Uncharacterised_DM10,smart_Nucleoside_diP_kinase,pirsf_NDK7,prints_Nucleoside_diP_kinase	p.T45S	ENST00000367811.3	37	c.134	CCDS1277.1	1	.	.	.	.	.	.	.	.	.	.	G	12.18	1.861614	0.32884	.	.	ENSG00000143156	ENST00000472647;ENST00000367811	T;T	0.55930	0.49;0.49	5.48	3.59	0.41128	Uncharacterised domain DM10 (2);	0.356818	0.31472	N	0.007586	T	0.25865	0.0630	M	0.71871	2.18	0.36107	D	0.844516	B;B	0.33512	0.415;0.276	B;B	0.34301	0.179;0.098	T	0.12578	-1.0542	9	0.10111	T	0.7	-8.6685	6.1073	0.20081	0.2223:0.1358:0.6419:0.0	.	49;45	Q59GR0;Q9Y5B8	.;NDK7_HUMAN	S	9;45	ENSP00000433341:T9S;ENSP00000356785:T45S	ENSP00000356785:T45S	T	-	2	0	NME7	167559123	0.247000	0.23920	0.980000	0.43619	0.971000	0.66376	1.389000	0.34453	1.317000	0.45149	0.655000	0.94253	ACC	NME7	-	smart_Uncharacterised_DM10,pirsf_NDK7		0.318	NME7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NME7	HGNC	protein_coding	OTTHUMT00000083688.1	G	NM_013330		169292499	-1	no_errors	ENST00000367811	ensembl	human	known	70_37	missense	SNP	0.003	C
NOTCH3	4854	genome.wustl.edu	37	19	15291846	15291846	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr19:15291846C>T	ENST00000263388.2	-	18	2995	c.2920G>A	c.(2920-2922)Ggg>Agg	p.G974R		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	974	EGF-like 25. {ECO:0000255|PROSITE- ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			CAGACGCCCCCGTGTAGGCAG	0.697																																																	0													12.0	15.0	14.0					19																	15291846		2190	4287	6477	SO:0001583	missense	4854			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.2920G>A	19.37:g.15291846C>T	ENSP00000263388:p.Gly974Arg		Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_Notch_dom,pfam_Notch_NODP_dom,pfam_Notch_NOD_dom,pfam_EGF_extracell,pfam_DUF3454_notch,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_3,prints_Notch_dom	p.G974R	ENST00000263388.2	37	c.2920	CCDS12326.1	19	.	.	.	.	.	.	.	.	.	.	C	19.53	3.844421	0.71488	.	.	ENSG00000074181	ENST00000263388;ENST00000539383	D	0.99766	-6.69	5.36	3.19	0.36642	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.32901	N	0.005516	D	0.99486	0.9817	M	0.89904	3.07	0.80722	D	1	D;P	0.60575	0.988;0.768	P;B	0.47573	0.55;0.286	D	0.98113	1.0421	10	0.87932	D	0	.	9.8902	0.41285	0.0:0.7823:0.14:0.0778	.	925;974	Q59FL3;Q9UM47	.;NOTC3_HUMAN	R	974;924	ENSP00000263388:G974R	ENSP00000263388:G974R	G	-	1	0	NOTCH3	15152846	1.000000	0.71417	0.982000	0.44146	0.216000	0.24613	5.682000	0.68182	0.621000	0.30232	0.491000	0.48974	GGG	NOTCH3	-	smart_EGF-like_Ca-bd,smart_EG-like_dom,pirsf_Notch,pfscan_EG-like_dom		0.697	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	HGNC	protein_coding	OTTHUMT00000465714.1	C	NM_000435		15291846	-1	no_errors	ENST00000263388	ensembl	human	known	70_37	missense	SNP	1.000	T
NPDC1	56654	genome.wustl.edu	37	9	139937556	139937556	+	Intron	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr9:139937556C>T	ENST00000371601.4	-	2	326				NPDC1_ENST00000371600.3_Missense_Mutation_p.E106K|NPDC1_ENST00000488145.1_Intron	NM_015392.3	NP_056207.3	Q9NQX5	NPDC1_HUMAN	neural proliferation, differentiation and control, 1							integral component of membrane (GO:0016021)				NS(1)|large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	5	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.96e-05)|Epithelial(140;0.000486)		AGGGCCGGCTCACGGCCCCGC	0.716																																																	0													14.0	17.0	16.0					9																	139937556		2190	4287	6477	SO:0001627	intron_variant	56654			AF285836	CCDS7024.1	9q34.3	2008-07-21			ENSG00000107281	ENSG00000107281			7899	protein-coding gene	gene with protein product		605798				11245976	Standard	NM_015392		Approved	DKFZp586J0523, CAB-, CAB1	uc004ckt.2	Q9NQX5	OTTHUMG00000020956	ENST00000371601.4:c.113-31G>A	9.37:g.139937556C>T			Q5SPY8|Q9BTD6|Q9BXT3|Q9NQS2|Q9Y434	Missense_Mutation	SNP	pfam_NPDC1	p.E106K	ENST00000371601.4	37	c.316	CCDS7024.1	9	.	.	.	.	.	.	.	.	.	.	C	17.10	3.301863	0.60195	.	.	ENSG00000107281	ENST00000371600	.	.	.	4.11	3.2	0.36748	.	.	.	.	.	T	0.32734	0.0839	.	.	.	0.20764	N	0.99985	B	0.14805	0.011	B	0.12837	0.008	T	0.28933	-1.0028	7	0.87932	D	0	.	8.1867	0.31343	0.0:0.8827:0.0:0.1173	.	106	Q5SPY9	.	K	106	.	ENSP00000360659:E106K	E	-	1	0	NPDC1	139057377	0.228000	0.23718	0.005000	0.12908	0.295000	0.27426	2.146000	0.42216	1.024000	0.39682	0.561000	0.74099	GAG	NPDC1	-	NULL		0.716	NPDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPDC1	HGNC	protein_coding	OTTHUMT00000055182.1	C	NM_015392		139937556	-1	no_errors	ENST00000371600	ensembl	human	known	70_37	missense	SNP	0.012	T
NPHP4	261734	genome.wustl.edu	37	1	5937269	5937269	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:5937269G>A	ENST00000378156.4	-	20	2966	c.2701C>T	c.(2701-2703)Ccc>Tcc	p.P901S	NPHP4_ENST00000478423.2_5'UTR	NM_015102.3	NP_055917.1	O75161	NPHP4_HUMAN	nephronophthisis 4	901					actin cytoskeleton organization (GO:0030036)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(4)	47	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		ACGTCCTGGGGCCCCTTGCCC	0.677																																																	0													17.0	19.0	18.0					1																	5937269		2057	4166	6223	SO:0001583	missense	261734			AB014573	CCDS44052.1	1p36	2010-03-26			ENSG00000131697	ENSG00000131697			19104	protein-coding gene	gene with protein product	"""nephroretinin"", ""nephrocystin-4"", ""POC10 centriolar protein homolog (Chlamydomonas)"""	607215				11920287, 12205563	Standard	XR_244787		Approved	SLSN4, KIAA0673, POC10	uc001alq.2	O75161	OTTHUMG00000000701	ENST00000378156.4:c.2701C>T	1.37:g.5937269G>A	ENSP00000367398:p.Pro901Ser		Q8IWC0	Missense_Mutation	SNP	NULL	p.P901S	ENST00000378156.4	37	c.2701	CCDS44052.1	1	.	.	.	.	.	.	.	.	.	.	G	10.43	1.346751	0.24426	.	.	ENSG00000131697	ENST00000378156	D	0.87179	-2.22	5.11	1.11	0.20524	.	0.275955	0.29444	N	0.012137	T	0.76601	0.4010	L	0.39397	1.21	0.09310	N	1	B	0.21225	0.053	B	0.20955	0.032	T	0.56992	-0.7887	10	0.12430	T	0.62	.	7.0337	0.24980	0.446:0.0:0.554:0.0	.	901	O75161	NPHP4_HUMAN	S	901	ENSP00000367398:P901S	ENSP00000367398:P901S	P	-	1	0	NPHP4	5859856	0.139000	0.22563	0.067000	0.19924	0.021000	0.10359	1.357000	0.34090	0.565000	0.29255	0.462000	0.41574	CCC	NPHP4	-	NULL		0.677	NPHP4-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	NPHP4	HGNC	protein_coding	OTTHUMT00000001715.2	G			5937269	-1	no_errors	ENST00000378156	ensembl	human	known	70_37	missense	SNP	0.009	A
NRP2	8828	genome.wustl.edu	37	2	206565458	206565458	+	Intron	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr2:206565458C>T	ENST00000357785.5	+	2	282				NRP2_ENST00000357118.4_Intron|NRP2_ENST00000540178.1_Intron|NRP2_ENST00000272849.3_Intron|NRP2_ENST00000360409.3_Intron|NRP2_ENST00000417189.1_Intron|NRP2_ENST00000355117.4_Intron|NRP2_ENST00000540841.1_Intron|NRP2_ENST00000412873.2_Intron			Q99435	NELL2_HUMAN	neuropilin 2							extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(14)|lung(19)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	52						AAATTTCACTCACAAGCCGCA	0.488																																																	0													52.0	49.0	50.0					2																	206565458		876	1991	2867	SO:0001627	intron_variant	8828			AF016098	CCDS2364.1, CCDS2365.1, CCDS46496.1, CCDS46497.1, CCDS46498.1, CCDS46499.1	2q33.3	2008-05-23			ENSG00000118257	ENSG00000118257			8005	protein-coding gene	gene with protein product		602070				9529250, 9331348	Standard	NM_003872		Approved	VEGF165R2	uc002vaw.3	O60462	OTTHUMG00000132893	ENST00000357785.5:c.251+3013C>T	2.37:g.206565458C>T			B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	RNA	SNP	-	NULL	ENST00000357785.5	37	NULL	CCDS46496.1	2																																																																																			NRP2	-	-		0.488	NRP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRP2	HGNC	protein_coding	OTTHUMT00000336467.1	C			206565458	+1	no_errors	ENST00000464003	ensembl	human	known	70_37	rna	SNP	0.618	T
NUDT16L1	84309	genome.wustl.edu	37	16	4745112	4745112	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr16:4745112G>A	ENST00000304301.6	+	3	601	c.568G>A	c.(568-570)Gag>Aag	p.E190K	NUDT16L1_ENST00000586536.1_3'UTR|NUDT16L1_ENST00000405142.1_3'UTR|NUDT16L1_ENST00000586252.1_Missense_Mutation_p.E150K	NM_032349.3	NP_115725.1	Q9BRJ7	SDOS_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1	190	Interaction with PXN. {ECO:0000250}.					cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			endometrium(1)|large_intestine(1)|lung(1)|skin(1)	4						GAAGCTGGTTGAGGCCCTGGC	0.622																																																	0													77.0	74.0	75.0					16																	4745112		2197	4300	6497	SO:0001583	missense	84309			BC006223	CCDS10519.1, CCDS59257.1	16p13.3	2008-02-05			ENSG00000168101	ENSG00000168101		"""Nudix motif containing"""	28154	protein-coding gene	gene with protein product						11805099	Standard	NM_032349		Approved	SDOS	uc002cxe.3	Q9BRJ7	OTTHUMG00000129471	ENST00000304301.6:c.568G>A	16.37:g.4745112G>A	ENSP00000306670:p.Glu190Lys		Q8NAI2	Missense_Mutation	SNP	superfamily_NUDIX_hydrolase_dom-like	p.E190K	ENST00000304301.6	37	c.568	CCDS10519.1	16	.	.	.	.	.	.	.	.	.	.	G	14.38	2.519048	0.44866	.	.	ENSG00000168101	ENST00000304301	T	0.50813	0.73	4.38	4.38	0.52667	NUDIX hydrolase domain-like (1);	0.877610	0.09436	N	0.802465	T	0.48352	0.1495	N	0.13235	0.315	0.80722	D	1	D	0.63880	0.993	P	0.59171	0.853	T	0.30707	-0.9969	10	0.19147	T	0.46	.	15.5336	0.75983	0.0:0.0:1.0:0.0	.	190	Q9BRJ7	SDOS_HUMAN	K	190	ENSP00000306670:E190K	ENSP00000306670:E190K	E	+	1	0	NUDT16L1	4685113	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	5.318000	0.65829	1.971000	0.57363	0.655000	0.94253	GAG	NUDT16L1	-	superfamily_NUDIX_hydrolase_dom-like		0.622	NUDT16L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDT16L1	HGNC	protein_coding	OTTHUMT00000251634.1	G	NM_032349		4745112	+1	no_errors	ENST00000304301	ensembl	human	known	70_37	missense	SNP	1.000	A
OGFR	11054	genome.wustl.edu	37	20	61444515	61444515	+	Silent	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr20:61444515G>A	ENST00000290291.6	+	7	1573	c.1548G>A	c.(1546-1548)ggG>ggA	p.G516G	OGFR_ENST00000370461.1_Silent_p.G464G	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	516					opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)			endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					GTACCCCTGGGAGCCCATCGG	0.697																																																	0													15.0	20.0	18.0					20																	61444515		2170	4258	6428	SO:0001819	synonymous_variant	11054			AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1548G>A	20.37:g.61444515G>A			O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Silent	SNP	pfam_OGF_rcpt,pfam_OGF_rcpt_rpt	p.G516	ENST00000290291.6	37	c.1548	CCDS13504.1	20																																																																																			OGFR	-	NULL		0.697	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OGFR	HGNC	protein_coding	OTTHUMT00000080067.1	G			61444515	+1	no_errors	ENST00000290291	ensembl	human	known	70_37	silent	SNP	0.506	A
OR13C9	286362	genome.wustl.edu	37	9	107380216	107380216	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr9:107380216C>G	ENST00000259362.1	-	1	269	c.270G>C	c.(268-270)aaG>aaC	p.K90N		NM_001001956.1	NP_001001956.1	Q8NGT0	O13C9_HUMAN	olfactory receptor, family 13, subfamily C, member 9	90						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(9)|prostate(1)|skin(4)	22						AGGAAATGGTCTTTCTTTCTG	0.507																																																	0													134.0	138.0	137.0					9																	107380216		2203	4300	6503	SO:0001583	missense	286362				CCDS35093.1	9q31.1	2013-09-24			ENSG00000136839	ENSG00000136839		"""GPCR / Class A : Olfactory receptors"""	15104	protein-coding gene	gene with protein product							Standard	NM_001001956		Approved		uc011lvr.2	Q8NGT0	OTTHUMG00000020416	ENST00000259362.1:c.270G>C	9.37:g.107380216C>G	ENSP00000259362:p.Lys90Asn		Q6IFL2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K90N	ENST00000259362.1	37	c.270	CCDS35093.1	9	.	.	.	.	.	.	.	.	.	.	C	11.27	1.590321	0.28357	.	.	ENSG00000136839	ENST00000259362	T	0.38240	1.15	4.78	2.75	0.32379	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000085	T	0.29914	0.0748	L	0.55103	1.725	0.21386	N	0.999708	P	0.35745	0.518	B	0.34093	0.175	T	0.28364	-1.0046	10	0.87932	D	0	.	7.6626	0.28413	0.0:0.7673:0.0:0.2327	.	90	Q8NGT0	O13C9_HUMAN	N	90	ENSP00000259362:K90N	ENSP00000259362:K90N	K	-	3	2	OR13C9	106420037	0.000000	0.05858	1.000000	0.80357	0.969000	0.65631	-0.539000	0.06113	1.210000	0.43336	0.637000	0.83480	AAG	OR13C9	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.507	OR13C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C9	HGNC	protein_coding	OTTHUMT00000053490.1	C			107380216	-1	no_errors	ENST00000259362	ensembl	human	known	70_37	missense	SNP	0.946	G
OR2AE1	81392	genome.wustl.edu	37	7	99474453	99474453	+	Silent	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr7:99474453G>C	ENST00000316368.2	-	1	227	c.204C>G	c.(202-204)ctC>ctG	p.L68L		NM_001005276.1	NP_001005276.1	Q8NHA4	O2AE1_HUMAN	olfactory receptor, family 2, subfamily AE, member 1	68						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)	11	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					TCAGATCCATGAGGGAGAGCT	0.493																																																	0													104.0	90.0	94.0					7																	99474453		2203	4300	6503	SO:0001819	synonymous_variant	81392			AC011904	CCDS34696.1	7q22.1	2014-02-19	2002-02-28		ENSG00000244623	ENSG00000244623		"""GPCR / Class A : Olfactory receptors"""	15087	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily AE, member 2"""	OR2AE2			Standard	NM_001005276		Approved		uc003usc.1	Q8NHA4	OTTHUMG00000156650	ENST00000316368.2:c.204C>G	7.37:g.99474453G>C			B2RPD2	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L68	ENST00000316368.2	37	c.204	CCDS34696.1	7																																																																																			OR2AE1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.493	OR2AE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2AE1	HGNC	protein_coding	OTTHUMT00000345053.1	G			99474453	-1	no_errors	ENST00000316368	ensembl	human	known	70_37	silent	SNP	1.000	C
OR2AE1	81392	genome.wustl.edu	37	7	99474518	99474518	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr7:99474518G>C	ENST00000316368.2	-	1	162	c.139C>G	c.(139-141)Ctc>Gtc	p.L47V		NM_001005276.1	NP_001005276.1	Q8NHA4	O2AE1_HUMAN	olfactory receptor, family 2, subfamily AE, member 1	47						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)	11	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					CAGATGAGGAGAATGGTGAGG	0.502																																																	0													99.0	93.0	95.0					7																	99474518		2203	4300	6503	SO:0001583	missense	81392			AC011904	CCDS34696.1	7q22.1	2014-02-19	2002-02-28		ENSG00000244623	ENSG00000244623		"""GPCR / Class A : Olfactory receptors"""	15087	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily AE, member 2"""	OR2AE2			Standard	NM_001005276		Approved		uc003usc.1	Q8NHA4	OTTHUMG00000156650	ENST00000316368.2:c.139C>G	7.37:g.99474518G>C	ENSP00000313936:p.Leu47Val		B2RPD2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L47V	ENST00000316368.2	37	c.139	CCDS34696.1	7	.	.	.	.	.	.	.	.	.	.	G	5.526	0.281981	0.10458	.	.	ENSG00000244623	ENST00000316368	T	0.04083	3.71	3.63	1.79	0.24919	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36200	N	0.002728	T	0.03871	0.0109	L	0.45744	1.44	0.09310	N	0.999999	P	0.42871	0.792	B	0.36959	0.237	T	0.39231	-0.9624	10	0.56958	D	0.05	.	2.3772	0.04345	0.109:0.192:0.5014:0.1975	.	47	Q8NHA4	O2AE1_HUMAN	V	47	ENSP00000313936:L47V	ENSP00000313936:L47V	L	-	1	0	OR2AE1	99312454	0.000000	0.05858	0.566000	0.28421	0.166000	0.22503	-2.151000	0.01289	0.512000	0.28257	0.501000	0.49751	CTC	OR2AE1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.502	OR2AE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2AE1	HGNC	protein_coding	OTTHUMT00000345053.1	G			99474518	-1	no_errors	ENST00000316368	ensembl	human	known	70_37	missense	SNP	0.090	C
OR2T10	127069	genome.wustl.edu	37	1	248756633	248756633	+	Missense_Mutation	SNP	G	G	A	rs200418834		TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:248756633G>A	ENST00000330500.2	-	1	467	c.437C>T	c.(436-438)tCa>tTa	p.S146L	Y_RNA_ENST00000364732.1_RNA	NM_001004693.1	NP_001004693.1	Q8NGZ9	O2T10_HUMAN	olfactory receptor, family 2, subfamily T, member 10	146						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(17)|skin(3)|upper_aerodigestive_tract(1)	26	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CCAGCAGCCTGATGCCAGGAG	0.547													g|||	1	0.000199681	0.0	0.0014	5008	,	,		18547	0.0		0.0	False		,,,				2504	0.0																0													109.0	115.0	113.0					1																	248756633		2052	4233	6285	SO:0001583	missense	127069				CCDS31121.1	1q44	2012-08-09			ENSG00000184022	ENSG00000184022		"""GPCR / Class A : Olfactory receptors"""	19573	protein-coding gene	gene with protein product							Standard	NM_001004693		Approved		uc010pzn.2	Q8NGZ9	OTTHUMG00000040388	ENST00000330500.2:c.437C>T	1.37:g.248756633G>A	ENSP00000329210:p.Ser146Leu		B2RNK7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S146L	ENST00000330500.2	37	c.437	CCDS31121.1	1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	.	1.945	-0.442758	0.04604	.	.	ENSG00000184022	ENST00000330500	T	0.33216	1.42	2.35	1.35	0.21983	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.17534	0.0421	N	0.12611	0.24	0.09310	N	1	P	0.41848	0.763	B	0.42163	0.378	T	0.10086	-1.0645	9	0.41790	T	0.15	.	6.5247	0.22295	0.2714:0.0:0.7286:0.0	.	146	Q8NGZ9	O2T10_HUMAN	L	146	ENSP00000329210:S146L	ENSP00000329210:S146L	S	-	2	0	OR2T10	246823256	0.000000	0.05858	0.605000	0.28930	0.011000	0.07611	-0.270000	0.08584	1.123000	0.41961	0.447000	0.29281	TCA	OR2T10	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.547	OR2T10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T10	HGNC	protein_coding	OTTHUMT00000097139.1	G	NM_001004693		248756633	-1	no_errors	ENST00000330500	ensembl	human	known	70_37	missense	SNP	0.000	A
OR5T3	390154	genome.wustl.edu	37	11	56020507	56020507	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr11:56020507G>A	ENST00000303059.3	+	1	832	c.832G>A	c.(832-834)Gtg>Atg	p.V278M		NM_001004747.1	NP_001004747.1	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T, member 3	278						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(23)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	39	Esophageal squamous(21;0.00448)					CCTAACTGGAGTGACAATTTA	0.403																																																	0													192.0	172.0	179.0					11																	56020507		2201	4295	6496	SO:0001583	missense	390154			AB065837	CCDS31524.1	11q11	2012-08-09			ENSG00000172489	ENSG00000172489		"""GPCR / Class A : Olfactory receptors"""	15297	protein-coding gene	gene with protein product							Standard	NM_001004747		Approved	OR5T3Q	uc010rjd.2	Q8NGG3	OTTHUMG00000166852	ENST00000303059.3:c.832G>A	11.37:g.56020507G>A	ENSP00000305403:p.Val278Met		Q6IFC7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V278M	ENST00000303059.3	37	c.832	CCDS31524.1	11	.	.	.	.	.	.	.	.	.	.	G	9.702	1.154835	0.21371	.	.	ENSG00000172489	ENST00000303059	T	0.00364	7.81	4.46	2.53	0.30540	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42682	D	0.000668	T	0.01661	0.0053	H	0.98238	4.18	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.17653	-1.0362	10	0.87932	D	0	.	10.4437	0.44481	0.0:0.129:0.6039:0.2671	.	278	Q8NGG3	OR5T3_HUMAN	M	278	ENSP00000305403:V278M	ENSP00000305403:V278M	V	+	1	0	OR5T3	55777083	0.008000	0.16893	0.020000	0.16555	0.193000	0.23685	0.095000	0.15127	0.582000	0.29556	0.643000	0.83706	GTG	OR5T3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.403	OR5T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5T3	HGNC	protein_coding	OTTHUMT00000391599.1	G	NM_001004747		56020507	+1	no_errors	ENST00000303059	ensembl	human	known	70_37	missense	SNP	0.001	A
OR7G1	125962	genome.wustl.edu	37	19	9225957	9225957	+	Silent	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr19:9225957C>G	ENST00000541538.1	-	1	482	c.483G>C	c.(481-483)ctG>ctC	p.L161L	OR7G1_ENST00000293614.1_Silent_p.L161L	NM_001005192.2	NP_001005192.2	Q8NGA0	OR7G1_HUMAN	olfactory receptor, family 7, subfamily G, member 1	161						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|skin(2)	20						GCAATACCATCAGACTCTGAA	0.478																																																	0													114.0	105.0	108.0					19																	9225957		2203	4300	6503	SO:0001819	synonymous_variant	125962				CCDS32898.1, CCDS32898.2	19p13.2	2013-09-24			ENSG00000161807	ENSG00000161807		"""GPCR / Class A : Olfactory receptors"""	8465	protein-coding gene	gene with protein product				OR7G1P			Standard	NM_001005192		Approved	OR19-15	uc021uoi.1	Q8NGA0	OTTHUMG00000168067	ENST00000541538.1:c.483G>C	19.37:g.9225957C>G			Q6IFJ5|Q96RA1	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L161	ENST00000541538.1	37	c.483	CCDS32898.2	19																																																																																			OR7G1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.478	OR7G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7G1	HGNC	protein_coding	OTTHUMT00000397912.1	C			9225957	-1	no_errors	ENST00000293614	ensembl	human	known	70_37	silent	SNP	0.000	G
PALM3	342979	genome.wustl.edu	37	19	14165745	14165745	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr19:14165745C>T	ENST00000340790.4	-	6	693	c.694G>A	c.(694-696)Gcc>Acc	p.A232T		NM_001145028.1	NP_001138500.1	A6NDB9	PALM3_HUMAN	paralemmin 3	232					negative regulation of cytokine-mediated signaling pathway (GO:0001960)|response to lipopolysaccharide (GO:0032496)|Toll signaling pathway (GO:0008063)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)			endometrium(1)|kidney(2)|pancreas(1)|skin(1)	5						GCCCCTGTGGCACAGTCCTCT	0.667																																																	0													37.0	38.0	38.0					19																	14165745		692	1591	2283	SO:0001583	missense	342979				CCDS46001.1	19p13.12	2010-04-15			ENSG00000187867	ENSG00000187867			33274	protein-coding gene	gene with protein product							Standard	NM_001145028		Approved		uc010xnk.1	A6NDB9		ENST00000340790.4:c.694G>A	19.37:g.14165745C>T	ENSP00000344996:p.Ala232Thr			Missense_Mutation	SNP	NULL	p.A232T	ENST00000340790.4	37	c.694	CCDS46001.1	19	.	.	.	.	.	.	.	.	.	.	c	14.54	2.566879	0.45694	.	.	ENSG00000187867	ENST00000340790	T	0.42900	0.96	4.03	0.132	0.14762	.	0.756413	0.12262	N	0.484594	T	0.46268	0.1384	L	0.50333	1.59	0.22034	N	0.999405	D	0.58268	0.982	P	0.60789	0.879	T	0.28839	-1.0031	10	0.52906	T	0.07	-4.2205	2.5775	0.04810	0.1873:0.5203:0.1826:0.1097	.	232	A6NDB9	PALM3_HUMAN	T	232	ENSP00000344996:A232T	ENSP00000344996:A232T	A	-	1	0	PALM3	14026745	0.826000	0.29277	0.628000	0.29241	0.078000	0.17371	-0.046000	0.11983	0.311000	0.23014	0.484000	0.47621	GCC	PALM3	-	NULL		0.667	PALM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PALM3	HGNC	protein_coding	OTTHUMT00000458540.1	C	NM_001145028		14165745	-1	no_errors	ENST00000340790	ensembl	human	known	70_37	missense	SNP	0.571	T
PBX2P1	5088	genome.wustl.edu	37	3	142897134	142897136	+	RNA	DEL	TTT	TTT	-	rs553879413|rs36138113|rs541447224	byFrequency	TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	TTT	TTT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr3:142897134_142897136delTTT	ENST00000560287.1	+	0	2008_2010									pre-B-cell leukemia homeobox 2 pseudogene 1																		GGGGTTGAACttttttttttttt	0.384																																																	0																																												5088					3q24	2014-03-25	2007-01-30	2007-01-30	ENSG00000244171	ENSG00000244171		"""Homeoboxes / TALE class"""	8635	pseudogene	pseudogene			"""pre-B-cell leukemia transcription factor pseudogene 1"""	PBX2, PBXP1		1682799	Standard	NG_002434		Approved				OTTHUMG00000159350		3.37:g.142897143_142897145delTTT				RNA	DEL	-	NULL	ENST00000560287.1	37	NULL		3																																																																																			PBX2P1	-	-		0.384	PBX2P1-002	KNOWN	basic	processed_transcript	PBX2P1	HGNC	pseudogene	OTTHUMT00000417717.1	TTT	NG_002434		142897136	+1	no_errors	ENST00000560287	ensembl	human	known	70_37	rna	DEL	0.986:0.988:0.989	-
PCCA	5095	genome.wustl.edu	37	13	100953745	100953745	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr13:100953745G>T	ENST00000376285.1	+	13	1135	c.1097G>T	c.(1096-1098)gGc>gTc	p.G366V	PCCA_ENST00000376279.3_Missense_Mutation_p.G366V|PCCA_ENST00000376286.4_Missense_Mutation_p.G340V	NM_000282.3	NP_000273.2	P05165	PCCA_HUMAN	propionyl CoA carboxylase, alpha polypeptide	366	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|propionyl-CoA carboxylase activity (GO:0004658)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|prostate(1)|skin(2)	26	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	TGCATTACTGGCCTGGACCTA	0.473																																																	0			GRCh37	CI034188	PCCA	I							162.0	141.0	148.0					13																	100953745		2203	4300	6503	SO:0001583	missense	5095			X14608	CCDS9496.2, CCDS45065.1, CCDS53878.1	13q32	2011-01-14	2010-04-30		ENSG00000175198	ENSG00000175198	6.4.1.3		8653	protein-coding gene	gene with protein product		232000	"""propionyl Coenzyme A carboxylase, alpha polypeptide"""			1427880	Standard	NM_000282		Approved		uc001voo.3	P05165	OTTHUMG00000017284	ENST00000376285.1:c.1097G>T	13.37:g.100953745G>T	ENSP00000365462:p.Gly366Val		B4DKY8|B4DPF9|C9JPQ8|Q15979|Q8WXQ7	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,pfam_ATP-grasp_RimK-type,pfam_ATP-grasp_carboxylate-amine,superfamily_PreATP-grasp_fold,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_Biotin_lipoyl	p.G366V	ENST00000376285.1	37	c.1097	CCDS9496.2	13	.	.	.	.	.	.	.	.	.	.	G	22.8	4.333152	0.81801	.	.	ENSG00000175198	ENST00000376286;ENST00000376279;ENST00000376285	D;D;D	0.99567	-6.18;-6.18;-6.18	5.61	5.61	0.85477	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);Biotin carboxylation domain (1);	0.000000	0.85682	D	0.000000	D	0.99873	0.9940	H	0.99800	4.79	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.79784	0.971;0.981;0.993	D	0.96293	0.9215	10	0.87932	D	0	.	20.0862	0.97801	0.0:0.0:1.0:0.0	.	366;340;366	C9JPQ8;P05165-2;P05165	.;.;PCCA_HUMAN	V	340;366;366	ENSP00000365463:G340V;ENSP00000365456:G366V;ENSP00000365462:G366V	ENSP00000365456:G366V	G	+	2	0	PCCA	99751746	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.549000	0.98106	2.823000	0.97156	0.644000	0.83932	GGC	PCCA	-	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_ATP-grasp_RimK-type,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom		0.473	PCCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCCA	HGNC	protein_coding	OTTHUMT00000045627.2	G			100953745	+1	no_errors	ENST00000376285	ensembl	human	known	70_37	missense	SNP	1.000	T
PCDHAC1	56135	genome.wustl.edu	37	5	140308552	140308552	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr5:140308552C>G	ENST00000253807.2	+	1	2075	c.2075C>G	c.(2074-2076)tCc>tGc	p.S692C	PCDHA10_ENST00000506939.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHAC1_ENST00000409700.3_Missense_Mutation_p.S692C|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	692					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTTGTATTTCCTTTTTATTT	0.483																																																	0													120.0	116.0	117.0					5																	140308552		2203	4300	6503	SO:0001583	missense	56135			AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.2075C>G	5.37:g.140308552C>G	ENSP00000253807:p.Ser692Cys		Q9Y5F5|Q9Y5I5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.S692C	ENST00000253807.2	37	c.2075	CCDS4241.1	5	.	.	.	.	.	.	.	.	.	.	C	17.62	3.435451	0.62955	.	.	ENSG00000248383	ENST00000409700;ENST00000253807	T;T	0.38887	1.11;1.11	5.95	5.07	0.68467	.	.	.	.	.	T	0.61702	0.2368	L	0.56199	1.76	0.35272	D	0.780523	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.73477	-0.3970	9	0.87932	D	0	.	17.3487	0.87316	0.0:0.8752:0.1248:0.0	.	692;692	Q9H158;Q9H158-2	PCDC1_HUMAN;.	C	692	ENSP00000386356:S692C;ENSP00000253807:S692C	ENSP00000253807:S692C	S	+	2	0	PCDHAC1	140288736	0.996000	0.38824	1.000000	0.80357	0.977000	0.68977	3.442000	0.52900	1.489000	0.48450	0.563000	0.77884	TCC	PCDHAC1	-	NULL		0.483	PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHAC1	HGNC	protein_coding	OTTHUMT00000251798.1	C	NM_018898		140308552	+1	no_errors	ENST00000253807	ensembl	human	known	70_37	missense	SNP	1.000	G
PCDHGA4	56111	genome.wustl.edu	37	5	140736303	140736303	+	Silent	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr5:140736303G>A	ENST00000571252.1	+	1	1536	c.1536G>A	c.(1534-1536)ggG>ggA	p.G512G	PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	512	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCAATACAGGGATCCTATATG	0.527																																																	0													132.0	139.0	137.0					5																	140736303		2107	4262	6369	SO:0001819	synonymous_variant	56111			AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.1536G>A	5.37:g.140736303G>A			Q9Y5D3	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G512	ENST00000571252.1	37	c.1536	CCDS58979.1	5																																																																																			PCDHGA4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin		0.527	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA4	HGNC	protein_coding	OTTHUMT00000437959.1	G	NM_018917		140736303	+1	no_errors	ENST00000571252	ensembl	human	known	70_37	silent	SNP	0.073	A
PCNT	5116	genome.wustl.edu	37	21	47851644	47851644	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr21:47851644G>T	ENST00000359568.5	+	38	8373	c.8266G>T	c.(8266-8268)Gag>Tag	p.E2756*	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	2756					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					CCGCACCCTGGAGCTGTCAGA	0.657																																																	0													22.0	22.0	22.0					21																	47851644		2203	4300	6503	SO:0001587	stop_gained	5116			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.8266G>T	21.37:g.47851644G>T	ENSP00000352572:p.Glu2756*		O43152|Q7Z7C9	Nonsense_Mutation	SNP	pfam_PACT_domain	p.E2756*	ENST00000359568.5	37	c.8266	CCDS33592.1	21	.	.	.	.	.	.	.	.	.	.	G	49	15.230978	0.99827	.	.	ENSG00000160299	ENST00000359568	.	.	.	5.32	5.32	0.75619	.	0.000000	0.34411	N	0.003981	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	11.7977	0.52110	0.0801:0.0:0.9199:0.0	.	.	.	.	X	2756	.	ENSP00000352572:E2756X	E	+	1	0	PCNT	46676072	0.980000	0.34600	0.942000	0.38095	0.418000	0.31294	1.893000	0.39758	2.664000	0.90586	0.655000	0.94253	GAG	PCNT	-	NULL		0.657	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNT	HGNC	protein_coding	OTTHUMT00000207336.1	G	NM_006031		47851644	+1	no_errors	ENST00000359568	ensembl	human	known	70_37	nonsense	SNP	0.994	T
PDX1	3651	genome.wustl.edu	37	13	28498509	28498509	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr13:28498509C>T	ENST00000381033.4	+	2	642	c.523C>T	c.(523-525)Cgc>Tgc	p.R175C	PDX1-AS1_ENST00000499662.2_RNA	NM_000209.3	NP_000200.1	O00330	ODPX_HUMAN	pancreatic and duodenal homeobox 1	0					cellular metabolic process (GO:0044237)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	transferase activity, transferring acyl groups (GO:0016746)					all_cancers(110;0.175)|all_hematologic(3;0.0447)|Acute lymphoblastic leukemia(6;0.155)	Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0402)|all cancers(112;0.0404)|OV - Ovarian serous cystadenocarcinoma(117;0.197)		CTCACGGCCGCGCCGGGTGGA	0.567																																																	0													53.0	56.0	55.0					13																	28498509		2203	4300	6503	SO:0001583	missense	3651			AF035260	CCDS9327.1	13q12.1	2012-03-09	2006-12-01	2006-12-01	ENSG00000139515	ENSG00000139515		"""Homeoboxes / ANTP class : HOXL subclass"""	6107	protein-coding gene	gene with protein product	"""somatostatin transcription factor 1"""	600733	"""insulin promoter factor 1, homeodomain transcription factor"""	IPF1		7590740	Standard	NM_000209		Approved	IDX-1, STF-1, PDX-1, MODY4	uc001urt.2	P52945	OTTHUMG00000016638	ENST00000381033.4:c.523C>T	13.37:g.28498509C>T	ENSP00000370421:p.Arg175Cys		B4DW62|D3DR11|E9PB14|E9PBP7|O60221|Q96FV8|Q99783	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa,prints_Homeobox_antennapedia	p.R175C	ENST00000381033.4	37	c.523	CCDS9327.1	13	.	.	.	.	.	.	.	.	.	.	C	25.1	4.606099	0.87157	.	.	ENSG00000139515	ENST00000381033	D	0.96200	-3.94	4.86	4.86	0.63082	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98416	0.9473	H	0.95917	3.74	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99461	1.0943	10	0.87932	D	0	.	14.821	0.70074	0.1445:0.8555:0.0:0.0	.	175	P52945	PDX1_HUMAN	C	175	ENSP00000370421:R175C	ENSP00000370421:R175C	R	+	1	0	PDX1	27396509	0.999000	0.42202	0.996000	0.52242	0.983000	0.72400	3.880000	0.56145	2.382000	0.81193	0.555000	0.69702	CGC	PDX1	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa		0.567	PDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDX1	HGNC	protein_coding	OTTHUMT00000044310.2	C	NM_000209		28498509	+1	no_errors	ENST00000381033	ensembl	human	known	70_37	missense	SNP	1.000	T
PEX11A	8800	genome.wustl.edu	37	15	90233993	90233993	+	5'UTR	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr15:90233993G>C	ENST00000300056.3	-	0	20				PEX11A_ENST00000557982.1_5'UTR|PEX11A_ENST00000559170.1_5'UTR|PEX11A_ENST00000561224.1_5'Flank|WDR93_ENST00000268130.7_5'Flank|WDR93_ENST00000558000.1_5'Flank|PEX11A_ENST00000561257.1_5'Flank|WDR93_ENST00000560294.1_5'Flank	NM_001271573.1	NP_001258502.1	O75192	PX11A_HUMAN	peroxisomal biogenesis factor 11 alpha						brown fat cell differentiation (GO:0050873)|cellular lipid metabolic process (GO:0044255)|peroxisome fission (GO:0016559)|peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|regulation of peroxisome size (GO:0044375)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	integral component of peroxisomal membrane (GO:0005779)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(2)|lung(3)	7	Lung NSC(78;0.0237)|all_lung(78;0.0478)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|BRCA - Breast invasive adenocarcinoma(143;0.128)			CTCCGCCCCAGAGGGGGCGGG	0.672																																																	0																																										SO:0001623	5_prime_UTR_variant	8800			AF093668	CCDS10354.1, CCDS61751.1	15q	2008-08-26	2008-08-26		ENSG00000166821	ENSG00000166821			8852	protein-coding gene	gene with protein product		603866	"""peroxisomal biogenesis factor 11A"""			9792670	Standard	NM_003847		Approved	PEX11-ALPHA, MGC119947, MGC138534	uc002boi.4	O75192	OTTHUMG00000149809	ENST00000300056.3:c.-130C>G	15.37:g.90233993G>C			B4DV88	RNA	SNP	-	NULL	ENST00000300056.3	37	NULL	CCDS10354.1	15																																																																																			PEX11A	-	-		0.672	PEX11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX11A	HGNC	protein_coding	OTTHUMT00000313420.1	G	NM_003847		90233993	-1	no_errors	ENST00000557982	ensembl	human	known	70_37	rna	SNP	0.000	C
PEX6	5190	genome.wustl.edu	37	6	42935173	42935173	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr6:42935173C>T	ENST00000304611.8	-	8	1886	c.1817G>A	c.(1816-1818)cGg>cAg	p.R606Q	PEX6_ENST00000244546.4_Missense_Mutation_p.R606Q	NM_000287.3	NP_000278.3	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	606					ATP catabolic process (GO:0006200)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix, translocation (GO:0016561)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(3)	15			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			AGTGAGGGCCCGCAGGATGCT	0.632																																																	0													32.0	29.0	30.0					6																	42935173		2203	4300	6503	SO:0001583	missense	5190			U56602	CCDS4877.1	6p22-p11	2010-04-21			ENSG00000124587	ENSG00000124587		"""ATPases / AAA-type"""	8859	protein-coding gene	gene with protein product		601498				8670792	Standard	NM_000287		Approved	PXAAA1, PAF-2	uc003otf.3	Q13608	OTTHUMG00000014713	ENST00000304611.8:c.1817G>A	6.37:g.42935173C>T	ENSP00000303511:p.Arg606Gln		Q5T8W1|Q8WYQ0|Q8WYQ1|Q8WYQ2|Q99476	Missense_Mutation	SNP	pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.R606Q	ENST00000304611.8	37	c.1817	CCDS4877.1	6	.	.	.	.	.	.	.	.	.	.	C	9.992	1.231043	0.22626	.	.	ENSG00000124587	ENST00000304611;ENST00000244546	T;T	0.78816	-1.21;-1.21	5.48	-8.58	0.00897	.	1.373150	0.03800	N	0.264227	T	0.24431	0.0592	N	0.02345	-0.59	0.20975	N	0.999816	B	0.02656	0.0	B	0.01281	0.0	T	0.42137	-0.9469	10	0.02654	T	1	-1.4502	17.532	0.87817	0.0:0.2375:0.0:0.7625	.	606	Q13608	PEX6_HUMAN	Q	606	ENSP00000303511:R606Q;ENSP00000244546:R606Q	ENSP00000244546:R606Q	R	-	2	0	PEX6	43043151	0.000000	0.05858	0.659000	0.29680	0.963000	0.63663	-1.684000	0.01932	-1.797000	0.01252	-0.254000	0.11334	CGG	PEX6	-	NULL		0.632	PEX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX6	HGNC	protein_coding	OTTHUMT00000040569.1	C	NM_000287		42935173	-1	no_errors	ENST00000304611	ensembl	human	known	70_37	missense	SNP	0.216	T
PFAS	5198	genome.wustl.edu	37	17	8159596	8159596	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr17:8159596G>T	ENST00000314666.6	+	7	825	c.692G>T	c.(691-693)cGa>cTa	p.R231L	PFAS_ENST00000545834.1_5'UTR	NM_012393.2	NP_036525.1	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	231					'de novo' IMP biosynthetic process (GO:0006189)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|phosphoribosylformylglycinamidine synthase activity (GO:0004642)			central_nervous_system(3)|endometrium(8)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35					L-Glutamine(DB00130)	GAGCACAGCCGACACTGGTTC	0.567																																																	0													38.0	38.0	38.0					17																	8159596		2203	4300	6503	SO:0001583	missense	5198			AB002359	CCDS11136.1	17p13.1	2008-07-31	2008-07-31		ENSG00000178921	ENSG00000178921	6.3.5.3		8863	protein-coding gene	gene with protein product	"""FGAR amidotransferase"""	602133				8110788	Standard	NM_012393		Approved	PURL, FGARAT, KIAA0361	uc002gkr.3	O15067	OTTHUMG00000108188	ENST00000314666.6:c.692G>T	17.37:g.8159596G>T	ENSP00000313490:p.Arg231Leu		A6H8V8	Missense_Mutation	SNP	pfam_AIR_synth_C_dom,pfam_AIR_synth_N_dom,superfamily_PurM_N-like,superfamily_AIR_synth_C_dom,tigrfam_PRibForGlyAmidine_synth	p.R231L	ENST00000314666.6	37	c.692	CCDS11136.1	17	.	.	.	.	.	.	.	.	.	.	G	27.9	4.876146	0.91664	.	.	ENSG00000178921	ENST00000314666	T	0.33654	1.4	4.64	4.64	0.57946	.	0.000000	0.85682	D	0.000000	T	0.73783	0.3631	H	0.98218	4.175	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.84294	0.0501	10	0.87932	D	0	-6.0695	15.0476	0.71838	0.0:0.0:1.0:0.0	.	231	O15067	PUR4_HUMAN	L	231	ENSP00000313490:R231L	ENSP00000313490:R231L	R	+	2	0	PFAS	8100321	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	5.540000	0.67205	2.403000	0.81681	0.563000	0.77884	CGA	PFAS	-	tigrfam_PRibForGlyAmidine_synth		0.567	PFAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFAS	HGNC	protein_coding	OTTHUMT00000226994.2	G			8159596	+1	no_errors	ENST00000314666	ensembl	human	known	70_37	missense	SNP	1.000	T
PGRMC1	10857	genome.wustl.edu	37	X	118370404	118370404	+	Silent	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chrX:118370404C>T	ENST00000217971.7	+	1	189	c.78C>T	c.(76-78)ttC>ttT	p.F26F	PGRMC1_ENST00000535419.1_Silent_p.F26F	NM_006667.3	NP_006658.1	O00264	PGRC1_HUMAN	progesterone receptor membrane component 1	26					axon guidance (GO:0007411)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)	heme binding (GO:0020037)|steroid binding (GO:0005496)			lung(6)	6					Dextromethorphan(DB00514)|Nortriptyline(DB00540)	ATGAGATTTTCACGTCGCCGC	0.647																																																	0													35.0	27.0	30.0					X																	118370404		2199	4294	6493	SO:0001819	synonymous_variant	10857				CCDS14576.1, CCDS65313.1	Xq22-q24	2005-11-29			ENSG00000101856	ENSG00000101856			16090	protein-coding gene	gene with protein product		300435				9705155	Standard	NM_006667		Approved	HPR6.6	uc004erb.3	O00264	OTTHUMG00000022268	ENST00000217971.7:c.78C>T	X.37:g.118370404C>T			B7Z1L3|Q9UGJ9	Silent	SNP	pfam_Cyt_B5,superfamily_Cyt_B5	p.F26	ENST00000217971.7	37	c.78	CCDS14576.1	X																																																																																			PGRMC1	-	NULL		0.647	PGRMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGRMC1	HGNC	protein_coding	OTTHUMT00000058024.1	C	NM_006667		118370404	+1	no_errors	ENST00000217971	ensembl	human	known	70_37	silent	SNP	1.000	T
PGRMC1	10857	genome.wustl.edu	37	X	118370416	118370416	+	Silent	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chrX:118370416C>T	ENST00000217971.7	+	1	201	c.90C>T	c.(88-90)ctC>ctT	p.L30L	PGRMC1_ENST00000535419.1_Silent_p.L30L	NM_006667.3	NP_006658.1	O00264	PGRC1_HUMAN	progesterone receptor membrane component 1	30					axon guidance (GO:0007411)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)	heme binding (GO:0020037)|steroid binding (GO:0005496)			lung(6)	6					Dextromethorphan(DB00514)|Nortriptyline(DB00540)	CGTCGCCGCTCAACCTGCTGC	0.667																																																	0													35.0	25.0	29.0					X																	118370416		2200	4294	6494	SO:0001819	synonymous_variant	10857				CCDS14576.1, CCDS65313.1	Xq22-q24	2005-11-29			ENSG00000101856	ENSG00000101856			16090	protein-coding gene	gene with protein product		300435				9705155	Standard	NM_006667		Approved	HPR6.6	uc004erb.3	O00264	OTTHUMG00000022268	ENST00000217971.7:c.90C>T	X.37:g.118370416C>T			B7Z1L3|Q9UGJ9	Silent	SNP	pfam_Cyt_B5,superfamily_Cyt_B5	p.L30	ENST00000217971.7	37	c.90	CCDS14576.1	X																																																																																			PGRMC1	-	NULL		0.667	PGRMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGRMC1	HGNC	protein_coding	OTTHUMT00000058024.1	C	NM_006667		118370416	+1	no_errors	ENST00000217971	ensembl	human	known	70_37	silent	SNP	1.000	T
PHF1	5252	genome.wustl.edu	37	6	33383743	33383743	+	Silent	SNP	G	G	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr6:33383743G>T	ENST00000374516.3	+	15	1843	c.1572G>T	c.(1570-1572)ggG>ggT	p.G524G	PHF1_ENST00000374512.3_3'UTR|CUTA_ENST00000492510.1_5'Flank	NM_024165.2	NP_077084.1	O43189	PHF1_HUMAN	PHD finger protein 1	524					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of histone H3-K27 methylation (GO:0061087)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	methylated histone binding (GO:0035064)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19		Ovarian(999;0.0443)				TGTCTCCTGGGACTGGGGGAG	0.612																																																	0													85.0	84.0	85.0					6																	33383743		2203	4300	6503	SO:0001819	synonymous_variant	5252			AF029678	CCDS4777.1, CCDS4778.1	6p21.3	2013-01-28			ENSG00000112511	ENSG00000112511		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	8919	protein-coding gene	gene with protein product	"""tudor domain containing 19C"""	602881				9545646, 18385154	Standard	NM_024165		Approved	MTF2L2, TDRD19C	uc003oeh.3	O43189	OTTHUMG00000031105	ENST00000374516.3:c.1572G>T	6.37:g.33383743G>T			B1AZX2|B1AZX3|O60929|Q5SU07|Q5SU08|Q96KM7	Silent	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Tudor,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.G524	ENST00000374516.3	37	c.1572	CCDS4777.1	6																																																																																			PHF1	-	NULL		0.612	PHF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF1	HGNC	protein_coding	OTTHUMT00000076175.3	G			33383743	+1	no_errors	ENST00000374516	ensembl	human	known	70_37	silent	SNP	0.999	T
PIK3R3	8503	genome.wustl.edu	37	1	46509193	46509193	+	3'UTR	SNP	C	C	T	rs541010119	byFrequency	TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:46509193C>T	ENST00000262741.5	-	0	2227				PIK3R3_ENST00000354242.4_3'UTR|PIK3R3_ENST00000420542.1_3'UTR|PIK3R3_ENST00000372006.1_3'UTR|PIK3R3_ENST00000340332.6_3'UTR|PIK3R3_ENST00000488808.1_5'UTR	NM_003629.3	NP_003620.3	Q92569	P55G_HUMAN	phosphoinositide-3-kinase, regulatory subunit 3 (gamma)						insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)			endometrium(1)|large_intestine(5)|lung(6)|prostate(2)	14	Acute lymphoblastic leukemia(166;0.155)				Isoprenaline(DB01064)	GCCCCCATCCCGGCCGGCTGC	0.483													C|||	9	0.00179712	0.0	0.0	5008	,	,		18362	0.0		0.0	False		,,,				2504	0.0092																0																																										SO:0001624	3_prime_UTR_variant	8503			BC021622	CCDS529.1	1p34.1	2013-02-14	2008-02-04		ENSG00000117461	ENSG00000117461		"""SH2 domain containing"""	8981	protein-coding gene	gene with protein product		606076				9524259	Standard	NM_003629		Approved	p55	uc001cpb.4	Q92569	OTTHUMG00000008096	ENST00000262741.5:c.*152G>A	1.37:g.46509193C>T			B2R9C1|D3DQ12|O60482|Q5T4P1|Q5T4P2	RNA	SNP	-	NULL	ENST00000262741.5	37	NULL	CCDS529.1	1																																																																																			PIK3R3	-	-		0.483	PIK3R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3R3	HGNC	protein_coding	OTTHUMT00000022171.1	C	NM_003629		46509193	-1	no_errors	ENST00000488808	ensembl	human	known	70_37	rna	SNP	0.023	T
PITRM1	10531	genome.wustl.edu	37	10	3180157	3180157	+	3'UTR	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr10:3180157G>A	ENST00000224949.4	-	0	3214				PITRM1_ENST00000380994.1_3'UTR|PITRM1_ENST00000464395.1_5'UTR|PITRM1_ENST00000380989.2_3'UTR|PITRM1_ENST00000451104.2_3'UTR			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1						positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						TAGCATTTCTGACTTTTCATA	0.473																																																	0																																										SO:0001624	3_prime_UTR_variant	10531			AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.*66C>T	10.37:g.3180157G>A			B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	RNA	SNP	-	NULL	ENST00000224949.4	37	NULL	CCDS59208.1	10																																																																																			PITRM1	-	-		0.473	PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	PITRM1	HGNC	protein_coding	OTTHUMT00000046469.2	G			3180157	-1	no_errors	ENST00000464395	ensembl	human	known	70_37	rna	SNP	0.000	A
PITRM1	10531	genome.wustl.edu	37	10	3180552	3180552	+	Intron	SNP	G	G	A	rs375476261		TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr10:3180552G>A	ENST00000224949.4	-	26	2952				PITRM1_ENST00000380994.1_Intron|PITRM1_ENST00000464395.1_Intron|PITRM1_ENST00000380989.2_Intron|PITRM1_ENST00000451104.2_Intron			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1						positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						CCACAGGCACGATGGAGCCGC	0.577													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19557	0.0		0.0	False		,,,				2504	0.0																0								G	,,	7,4345		0,7,2169	33.0	37.0	36.0		,,	-8.2	0.0	10		36	0,8540		0,0,4270	no	intron,intron,intron	PITRM1	NM_001242307.1,NM_001242309.1,NM_014889.3	,,	0,7,6439	AA,AG,GG		0.0,0.1608,0.0543	,,	,,	3180552	7,12885	2176	4270	6446	SO:0001627	intron_variant	10531			AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.2918-23C>T	10.37:g.3180552G>A			B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	RNA	SNP	-	NULL	ENST00000224949.4	37	NULL	CCDS59208.1	10																																																																																			PITRM1	-	-		0.577	PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	PITRM1	HGNC	protein_coding	OTTHUMT00000046469.2	G			3180552	-1	no_errors	ENST00000490510	ensembl	human	known	70_37	rna	SNP	0.000	A
PKP1	5317	genome.wustl.edu	37	1	201282404	201282404	+	Silent	SNP	C	C	T	rs374045033	byFrequency	TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:201282404C>T	ENST00000352845.3	+	3	417	c.417C>T	c.(415-417)ggC>ggT	p.G139G	PKP1_ENST00000263946.3_Silent_p.G139G|PKP1_ENST00000367324.3_Silent_p.G139G			Q13835	PKP1_HUMAN	plakophilin 1	139					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intermediate filament bundle assembly (GO:0045110)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|lamin binding (GO:0005521)|signal transducer activity (GO:0004871)|structural constituent of epidermis (GO:0030280)			NS(2)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(5)|prostate(1)	22						ACACCACCGGCGCAGGCAGCG	0.642													C|||	3	0.000599042	0.0	0.0	5008	,	,		15163	0.003		0.0	False		,,,				2504	0.0																0													18.0	20.0	19.0					1																	201282404		2203	4299	6502	SO:0001819	synonymous_variant	5317			X79293	CCDS30966.1, CCDS30967.1	1q32	2014-06-18	2014-06-18		ENSG00000081277	ENSG00000081277		"""Armadillo repeat containing"""	9023	protein-coding gene	gene with protein product	"""ectodermal dysplasia/skin fragility syndrome"""	601975	"""plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)"""			9272178	Standard	NM_001005337		Approved	B6P	uc001gwd.3	Q13835	OTTHUMG00000035729	ENST00000352845.3:c.417C>T	1.37:g.201282404C>T			O00645|Q14CA0|Q15152	Silent	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.G139	ENST00000352845.3	37	c.417	CCDS30966.1	1																																																																																			PKP1	-	NULL		0.642	PKP1-004	KNOWN	basic|CCDS	protein_coding	PKP1	HGNC	protein_coding	OTTHUMT00000086897.1	C	NM_000299		201282404	+1	no_errors	ENST00000263946	ensembl	human	known	70_37	silent	SNP	0.000	T
PLCB1	23236	genome.wustl.edu	37	20	8755253	8755253	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr20:8755253G>A	ENST00000338037.6	+	27	3025	c.2998G>A	c.(2998-3000)Gaa>Aaa	p.E1000K	PLCB1_ENST00000378637.2_Missense_Mutation_p.E1000K|PLCB1_ENST00000378641.3_Missense_Mutation_p.E1000K|PLCB1_ENST00000494924.1_3'UTR	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	1000					activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						TCTGGATGCTGAAATGACCCA	0.443																																																	0													114.0	115.0	114.0					20																	8755253		2203	4300	6503	SO:0001583	missense	23236			AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.2998G>A	20.37:g.8755253G>A	ENSP00000338185:p.Glu1000Lys		D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	pirsf_PLC-beta,pfam_PLC-beta_C,pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,prints_Pinositol_PLipase_C,pfscan_C2_membr_targeting,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.E1000K	ENST00000338037.6	37	c.2998	CCDS13102.1	20	.	.	.	.	.	.	.	.	.	.	G	22.5	4.298194	0.81025	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719	T;T;T	0.49139	0.79;0.79;0.79	5.63	5.63	0.86233	PLC-beta, C-terminal (1);	0.055984	0.64402	D	0.000001	T	0.57710	0.2072	M	0.61703	1.905	0.54753	D	0.999981	P;P	0.48764	0.837;0.915	P;P	0.49999	0.6;0.628	T	0.52373	-0.8584	10	0.30078	T	0.28	.	19.6788	0.95950	0.0:0.0:1.0:0.0	.	1000;1000	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	K	1000;1000;1000;920;920	ENSP00000367908:E1000K;ENSP00000338185:E1000K;ENSP00000367904:E1000K	ENSP00000338185:E1000K	E	+	1	0	PLCB1	8703253	1.000000	0.71417	0.967000	0.41034	0.981000	0.71138	9.476000	0.97823	2.653000	0.90120	0.650000	0.86243	GAA	PLCB1	-	pirsf_PLC-beta,pfam_PLC-beta_C		0.443	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCB1	HGNC	protein_coding	OTTHUMT00000077938.3	G			8755253	+1	no_errors	ENST00000338037	ensembl	human	known	70_37	missense	SNP	0.998	A
PLEKHA3	65977	genome.wustl.edu	37	2	179346649	179346649	+	Intron	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr2:179346649C>T	ENST00000234453.5	+	1	442				PLEKHA3_ENST00000461474.1_3'UTR	NM_019091.3	NP_061964.3	Q9HB20	PKHA3_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3							Golgi apparatus (GO:0005794)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.0266)|all cancers(119;0.0865)			TCACATCCCTCAGTAATTGTG	0.448																																																	0													93.0	80.0	84.0					2																	179346649		692	1591	2283	SO:0001627	intron_variant	65977			AF286162	CCDS33336.1	2q31.2	2013-01-10	2002-01-14		ENSG00000116095	ENSG00000116095		"""Pleckstrin homology (PH) domain containing"""	14338	protein-coding gene	gene with protein product	"""four-phosphate-adaptor protein 1"""	607774	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 3"""			11001876, 15107860	Standard	NM_019091		Approved	FAPP1	uc002umn.3	Q9HB20	OTTHUMG00000154446	ENST00000234453.5:c.40+1013C>T	2.37:g.179346649C>T			Q4ZG69|Q86TQ1|Q9NXT3	RNA	SNP	-	NULL	ENST00000234453.5	37	NULL	CCDS33336.1	2																																																																																			PLEKHA3	-	-		0.448	PLEKHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA3	HGNC	protein_coding	OTTHUMT00000335241.2	C	NM_019091		179346649	+1	no_errors	ENST00000461474	ensembl	human	known	70_37	rna	SNP	0.009	T
PLEKHA6	22874	genome.wustl.edu	37	1	204197977	204197977	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:204197977C>G	ENST00000272203.3	-	20	3080	c.2764G>C	c.(2764-2766)Gac>Cac	p.D922H	PLEKHA6_ENST00000414478.1_Missense_Mutation_p.D942H	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	922										breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			AGGACTTTGTCTGGAGTGGAG	0.562																																																	0													160.0	146.0	151.0					1																	204197977		2203	4300	6503	SO:0001583	missense	22874			AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.2764G>C	1.37:g.204197977C>G	ENSP00000272203:p.Asp922His		A7MD51|Q5VTI6	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.D922H	ENST00000272203.3	37	c.2764	CCDS1444.1	1	.	.	.	.	.	.	.	.	.	.	C	18.80	3.701312	0.68501	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	T;T	0.40756	1.02;1.02	5.3	5.3	0.74995	.	0.118400	0.56097	D	0.000024	T	0.65811	0.2727	M	0.71581	2.175	0.54753	D	0.999986	D	0.89917	1.0	D	0.83275	0.996	T	0.68887	-0.5290	10	0.72032	D	0.01	-39.6059	18.5393	0.91022	0.0:1.0:0.0:0.0	.	922	Q9Y2H5	PKHA6_HUMAN	H	922;942	ENSP00000272203:D922H;ENSP00000402046:D942H	ENSP00000272203:D922H	D	-	1	0	PLEKHA6	202464600	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.484000	0.60271	2.466000	0.83321	0.563000	0.77884	GAC	PLEKHA6	-	NULL		0.562	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA6	HGNC	protein_coding	OTTHUMT00000087889.3	C	NM_014935		204197977	-1	no_errors	ENST00000272203	ensembl	human	known	70_37	missense	SNP	0.998	G
PMPCA	23203	genome.wustl.edu	37	9	139311359	139311359	+	Intron	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr9:139311359C>T	ENST00000371717.3	+	7	642				PMPCA_ENST00000462616.1_3'UTR|PMPCA_ENST00000399219.3_Intron	NM_001282946.1|NM_015160.1	NP_001269875.1|NP_055975.1	Q10713	MPPA_HUMAN	peptidase (mitochondrial processing) alpha						cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			endometrium(3)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|urinary_tract(1)	14		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;9.3e-06)|Epithelial(140;1.15e-05)		GAAGCCTGGTCATGCTGTCTT	0.547																																																	0													34.0	25.0	28.0					9																	139311359		2203	4300	6503	SO:0001627	intron_variant	23203			D21064	CCDS35180.1, CCDS65192.1	9q34.3	2008-02-05	2003-06-13	2003-06-20	ENSG00000165688	ENSG00000165688			18667	protein-coding gene	gene with protein product		613036	"""inositol polyphosphate-5-phosphatase, 72 kD"""	INPP5E		8590280, 7788527	Standard	NM_015160		Approved	KIAA0123, Alpha-MPP	uc004chl.3	Q10713	OTTHUMG00000020926	ENST00000371717.3:c.634-44C>T	9.37:g.139311359C>T			B4DKL3|E7ET61|Q16639|Q5SXM9|Q8N513	RNA	SNP	-	NULL	ENST00000371717.3	37	NULL	CCDS35180.1	9																																																																																			PMPCA	-	-		0.547	PMPCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMPCA	HGNC	protein_coding	OTTHUMT00000055054.1	C	NM_015160		139311359	+1	no_errors	ENST00000462616	ensembl	human	known	70_37	rna	SNP	0.000	T
PNISR	25957	genome.wustl.edu	37	6	99849308	99849308	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr6:99849308C>G	ENST00000369239.5	-	12	1730	c.1526G>C	c.(1525-1527)aGg>aCg	p.R509T	PNISR_ENST00000438806.1_Missense_Mutation_p.R509T	NM_032870.2	NP_116259.2	Q8TF01	PNISR_HUMAN	PNN-interacting serine/arginine-rich protein	509	Ser-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						ACTTCCCGACCTACTCCTTCC	0.383																																																	0													126.0	115.0	119.0					6																	99849308		2203	4300	6503	SO:0001583	missense	25957			AK027759	CCDS5043.1	6q16.3	2011-06-06	2011-06-06	2011-06-06	ENSG00000132424	ENSG00000132424			21222	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 111"", ""splicing factor, arginine/serine-rich 18"""	C6orf111, SFRS18		14578391	Standard	NM_032870		Approved	FLJ14752, bA98I9.2, DKFZp564B0769, SRrp130	uc021zdd.1	Q8TF01	OTTHUMG00000015262	ENST00000369239.5:c.1526G>C	6.37:g.99849308C>G	ENSP00000358242:p.Arg509Thr		A8K540|E1P5D2|Q5T064|Q5T065|Q6P2B4|Q6P2N4|Q6PJ93|Q6PK36|Q7Z640|Q8N2L1|Q8TF00|Q96K10|Q96SI3|Q96SM5|Q9P076|Q9P0C0|Q9Y4N3	Missense_Mutation	SNP	NULL	p.R509T	ENST00000369239.5	37	c.1526	CCDS5043.1	6	.	.	.	.	.	.	.	.	.	.	C	13.74	2.328705	0.41197	.	.	ENSG00000132424	ENST00000369239;ENST00000438806	.	.	.	5.35	4.46	0.54185	.	0.243428	0.46758	D	0.000264	T	0.25044	0.0608	L	0.27053	0.805	0.41132	D	0.985891	B	0.25609	0.13	B	0.25987	0.065	T	0.05989	-1.0852	9	0.13853	T	0.58	.	11.257	0.49060	0.0:0.8549:0.0:0.1451	.	509	Q8TF01	PNISR_HUMAN	T	509	.	ENSP00000358242:R509T	R	-	2	0	PNISR	99956029	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.143000	0.50608	2.669000	0.90835	0.579000	0.79373	AGG	PNISR	-	NULL		0.383	PNISR-007	KNOWN	basic|appris_principal|CCDS	protein_coding	PNISR	HGNC	protein_coding	OTTHUMT00000041598.1	C	NM_032870		99849308	-1	no_errors	ENST00000369239	ensembl	human	known	70_37	missense	SNP	1.000	G
POGLUT1	56983	genome.wustl.edu	37	3	119196263	119196263	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr3:119196263G>C	ENST00000295588.4	+	4	508	c.424G>C	c.(424-426)Gag>Cag	p.E142Q		NM_152305.2	NP_689518.1	Q8NBL1	PGLT1_HUMAN	protein O-glucosyltransferase 1	142					cardiovascular system development (GO:0072358)|Notch signaling pathway (GO:0007219)|protein O-linked glycosylation (GO:0006493)|regulation of Notch signaling pathway (GO:0008593)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	glucosyltransferase activity (GO:0046527)|protein xylosyltransferase activity (GO:0030158)|UDP-glucosyltransferase activity (GO:0035251)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|prostate(1)	16						TAAATGGATGGAGCCTGCCAT	0.483																																																	0													154.0	139.0	144.0					3																	119196263		2203	4300	6503	SO:0001583	missense	56983			BC030614	CCDS2988.1	3q13.33	2010-09-29	2010-09-29	2010-09-29	ENSG00000163389	ENSG00000163389			22954	protein-coding gene	gene with protein product	"""KDELC family like 1"""	615618	"""chromosome 3 open reading frame 9"", ""KTEL (Lys-Tyr-Glu-Leu) containing 1"""	C3orf9, KTELC1		16524674	Standard	NM_152305		Approved	MDS010, MGC32995, 9630046K23Rik, MDSRP, hCLP46, KDELCL1, Rumi	uc003ecm.3	Q8NBL1	OTTHUMG00000159379	ENST00000295588.4:c.424G>C	3.37:g.119196263G>C	ENSP00000295588:p.Glu142Gln		B2RD13|Q53GJ4|Q8N2T1	Missense_Mutation	SNP	pfam_LipoPS_modifying,smart_LipoPS_modifying	p.E142Q	ENST00000295588.4	37	c.424	CCDS2988.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.65|16.65	3.183480|3.183480	0.57800|0.57800	.|.	.|.	ENSG00000163389|ENSG00000163389	ENST00000295588|ENST00000476573	T|.	0.22539|.	1.95|.	5.26|5.26	5.26|5.26	0.73747|0.73747	.|.	0.368675|.	0.26297|.	N|.	0.025187|.	T|T	0.36635|0.36635	0.0974|0.0974	N|N	0.04880|0.04880	-0.145|-0.145	0.43448|0.43448	D|D	0.995636|0.995636	B|.	0.09022|.	0.002|.	B|.	0.15484|.	0.013|.	T|T	0.23511|0.23511	-1.0186|-1.0186	10|5	0.16896|.	T|.	0.51|.	-17.0503|-17.0503	14.2547|14.2547	0.66043|0.66043	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	142|.	Q8NBL1|.	PGLT1_HUMAN|.	Q|A	142|128	ENSP00000295588:E142Q|.	ENSP00000295588:E142Q|.	E|G	+|+	1|2	0|0	POGLUT1|POGLUT1	120678953|120678953	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	2.395000|2.395000	0.44459|0.44459	2.739000|2.739000	0.93911|0.93911	0.655000|0.655000	0.94253|0.94253	GAG|GGA	POGLUT1	-	pfam_LipoPS_modifying,smart_LipoPS_modifying		0.483	POGLUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POGLUT1	HGNC	protein_coding	OTTHUMT00000355034.2	G	NM_152305		119196263	+1	no_errors	ENST00000295588	ensembl	human	known	70_37	missense	SNP	1.000	C
POLD3	10714	genome.wustl.edu	37	11	74329661	74329661	+	Missense_Mutation	SNP	T	T	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr11:74329661T>C	ENST00000263681.2	+	6	601	c.472T>C	c.(472-474)Tca>Cca	p.S158P	POLD3_ENST00000527458.1_Missense_Mutation_p.S119P|POLD3_ENST00000532497.1_Missense_Mutation_p.S52P	NM_006591.2	NP_006582.1	Q15054	DPOD3_HUMAN	polymerase (DNA-directed), delta 3, accessory subunit	158					base-excision repair (GO:0006284)|DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	delta DNA polymerase complex (GO:0043625)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|stomach(1)	18	Breast(11;3.21e-06)					GTTTGAGCAGTCACATCTTCA	0.493																																																	0													115.0	111.0	112.0					11																	74329661		2200	4293	6493	SO:0001583	missense	10714			D26018	CCDS8233.1	11q14	2014-06-13			ENSG00000077514	ENSG00000077514		"""DNA polymerases"""	20932	protein-coding gene	gene with protein product	"""DNA polymerase delta subunit p66"", ""Pol delta C subunit (p66)"", ""protein phosphatase 1, regulatory subunit 128"""	611415				10219083	Standard	NM_006591		Approved	P66, KIAA0039, P68, PPP1R128	uc001ovf.2	Q15054	OTTHUMG00000165621	ENST00000263681.2:c.472T>C	11.37:g.74329661T>C	ENSP00000263681:p.Ser158Pro		B7ZAI6|Q32MZ9|Q32N00	Missense_Mutation	SNP	pfam_DNA_polymerase_subunit_Cdc27	p.S158P	ENST00000263681.2	37	c.472	CCDS8233.1	11	.	.	.	.	.	.	.	.	.	.	T	11.44	1.638522	0.29157	.	.	ENSG00000077514	ENST00000263681;ENST00000527458;ENST00000532497;ENST00000538052;ENST00000530511;ENST00000531615	.	.	.	5.44	0.078	0.14410	.	1.092320	0.06895	N	0.804866	T	0.33585	0.0868	L	0.57536	1.79	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.29579	-1.0007	8	.	.	.	-2.8088	1.4807	0.02436	0.2615:0.0826:0.2966:0.3593	.	158	Q15054	DPOD3_HUMAN	P	158;119;52;158;119;119	.	.	S	+	1	0	POLD3	74007309	0.912000	0.30974	0.145000	0.22337	0.812000	0.45895	1.098000	0.31000	0.118000	0.18165	0.482000	0.46254	TCA	POLD3	-	pfam_DNA_polymerase_subunit_Cdc27		0.493	POLD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLD3	HGNC	protein_coding	OTTHUMT00000385376.1	T	NM_006591		74329661	+1	no_errors	ENST00000263681	ensembl	human	known	70_37	missense	SNP	0.000	C
POU4F3	5459	genome.wustl.edu	37	5	145719265	145719265	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr5:145719265C>T	ENST00000230732.4	+	2	364	c.275C>T	c.(274-276)tCg>tTg	p.S92L	CTC-359M8.1_ENST00000515598.1_RNA	NM_002700.2	NP_002691.1	Q15319	PO4F3_HUMAN	POU class 4 homeobox 3	92					auditory receptor cell differentiation (GO:0042491)|axon extension (GO:0048675)|inner ear morphogenesis (GO:0042472)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACGTCCACTTCGTCCACCGTG	0.657																																																	0													145.0	126.0	132.0					5																	145719265		2203	4300	6503	SO:0001583	missense	5459			U10060	CCDS4281.1	5q32	2011-06-20	2007-07-13		ENSG00000091010	ENSG00000091010		"""Homeoboxes / POU class"""	9220	protein-coding gene	gene with protein product		602460	"""POU domain class 4, transcription factor 3"""	DFNA15		9506947	Standard	NM_002700		Approved	BRN3C	uc003loa.2	Q15319	OTTHUMG00000129684	ENST00000230732.4:c.275C>T	5.37:g.145719265C>T	ENSP00000230732:p.Ser92Leu		O60557|Q2M3F8	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,pfscan_Homeodomain,pfscan_POU_specific,prints_POU	p.S92L	ENST00000230732.4	37	c.275	CCDS4281.1	5	.	.	.	.	.	.	.	.	.	.	C	14.79	2.639859	0.47153	.	.	ENSG00000091010	ENST00000230732	T	0.23147	1.92	4.63	4.63	0.57726	.	0.415120	0.21756	N	0.069590	T	0.23289	0.0563	M	0.75447	2.3	0.58432	D	0.999998	P	0.49862	0.929	B	0.30943	0.122	T	0.16070	-1.0415	10	0.31617	T	0.26	.	12.8312	0.57746	0.0:0.8342:0.1658:0.0	.	92	Q15319	PO4F3_HUMAN	L	92	ENSP00000230732:S92L	ENSP00000230732:S92L	S	+	2	0	POU4F3	145699458	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.338000	0.79269	2.391000	0.81399	0.462000	0.41574	TCG	POU4F3	-	NULL		0.657	POU4F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU4F3	HGNC	protein_coding	OTTHUMT00000251887.2	C	NM_002700		145719265	+1	no_errors	ENST00000230732	ensembl	human	known	70_37	missense	SNP	1.000	T
PPAP2B	8613	genome.wustl.edu	37	1	57044973	57044973	+	5'UTR	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:57044973G>C	ENST00000371250.3	-	0	268					NM_003713.4	NP_003704.3	O14495	LPP3_HUMAN	phosphatidic acid phosphatase type 2B						Bergmann glial cell differentiation (GO:0060020)|blood vessel development (GO:0001568)|canonical Wnt signaling pathway involved in positive regulation of cell-cell adhesion (GO:0044329)|canonical Wnt signaling pathway involved in positive regulation of endothelial cell migration (GO:0044328)|canonical Wnt signaling pathway involved in positive regulation of wound healing (GO:0044330)|dephosphorylation (GO:0016311)|gastrulation with mouth forming second (GO:0001702)|germ cell migration (GO:0008354)|homotypic cell-cell adhesion (GO:0034109)|lipid metabolic process (GO:0006629)|negative regulation of protein phosphorylation (GO:0001933)|phospholipid metabolic process (GO:0006644)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein stabilization (GO:0050821)|regulation of sphingolipid mediated signaling pathway (GO:1902068)|regulation of Wnt signaling pathway (GO:0030111)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	adherens junction (GO:0005912)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)|phosphoprotein phosphatase activity (GO:0004721)|sphingosine-1-phosphate phosphatase activity (GO:0042392)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	17						AACTTTTGCAGAGCTGCGCAG	0.622																																																	0																																										SO:0001623	5_prime_UTR_variant	8613			AB000889	CCDS604.1	1p32.2	2009-05-27			ENSG00000162407	ENSG00000162407	3.1.3.4		9229	protein-coding gene	gene with protein product		607125				9305923	Standard	NM_003713		Approved	PAP-2b, LPP3	uc001cyj.2	O14495	OTTHUMG00000008160	ENST00000371250.3:c.-284C>G	1.37:g.57044973G>C			B2R651|D3DQ52|Q5U0F7|Q96GW0|Q99782	RNA	SNP	-	NULL	ENST00000371250.3	37	NULL	CCDS604.1	1																																																																																			PPAP2B	-	-		0.622	PPAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAP2B	HGNC	protein_coding	OTTHUMT00000022334.2	G	NM_003713		57044973	-1	no_errors	ENST00000476206	ensembl	human	known	70_37	rna	SNP	0.016	C
PPP1R13B	23368	genome.wustl.edu	37	14	104224057	104224057	+	Nonsense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr14:104224057G>C	ENST00000202556.9	-	5	668	c.386C>G	c.(385-387)tCa>tGa	p.S129*		NM_015316.2	NP_056131.2	Q96KQ4	ASPP1_HUMAN	protein phosphatase 1, regulatory subunit 13B	129					intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(6)|kidney(2)|large_intestine(7)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				TTGGAGCTCTGAGAGGGTAAG	0.388																																																	0													129.0	119.0	122.0					14																	104224057		1874	4105	5979	SO:0001587	stop_gained	23368			AB018314	CCDS41997.1	14q32.33	2013-01-10	2011-10-04		ENSG00000088808	ENSG00000088808		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14950	protein-coding gene	gene with protein product		606455	"""protein phosphatase 1, regulatory (inhibitor) subunit 13B"""			9872452	Standard	NM_015316		Approved	p53BP2-like, KIAA0771, p85, ASPP1	uc001yof.1	Q96KQ4	OTTHUMG00000171647	ENST00000202556.9:c.386C>G	14.37:g.104224057G>C	ENSP00000202556:p.Ser129*		B2RMX5|O94870	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SH3_domain,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SH3_domain,prints_SH3_domain	p.S129*	ENST00000202556.9	37	c.386	CCDS41997.1	14	.	.	.	.	.	.	.	.	.	.	G	37	6.377263	0.97520	.	.	ENSG00000088808	ENST00000202556;ENST00000555734	.	.	.	5.92	5.92	0.95590	.	0.057161	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.3214	0.98679	0.0:0.0:1.0:0.0	.	.	.	.	X	129;126	.	ENSP00000202556:S129X	S	-	2	0	PPP1R13B	103293810	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.476000	0.97823	2.804000	0.96469	0.655000	0.94253	TCA	PPP1R13B	-	NULL		0.388	PPP1R13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R13B	HGNC	protein_coding	OTTHUMT00000414591.1	G	NM_015316		104224057	-1	no_errors	ENST00000202556	ensembl	human	known	70_37	nonsense	SNP	1.000	C
PPP1R9B	84687	genome.wustl.edu	37	17	48211892	48211892	+	3'UTR	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr17:48211892G>C	ENST00000316878.6	-	0	3254				AC002401.1_ENST00000451776.1_RNA|PPP1R9B_ENST00000501501.2_5'UTR	NM_032595.3	NP_115984.3	Q96SB3	NEB2_HUMAN	protein phosphatase 1, regulatory subunit 9B						actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to morphine (GO:0071315)|dendrite development (GO:0016358)|filopodium assembly (GO:0046847)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of cell proliferation (GO:0042127)|regulation of exit from mitosis (GO:0007096)|regulation of opioid receptor signaling pathway (GO:2000474)|regulation of protein phosphorylation (GO:0001932)|RNA splicing (GO:0008380)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|protein phosphatase type 1 complex (GO:0000164)|ruffle membrane (GO:0032587)|synapse (GO:0045202)	protein phosphatase 1 binding (GO:0008157)|protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	8						CTGGACCCCAGAGAGGCCACA	0.577																																																	0																																										SO:0001624	3_prime_UTR_variant	84687			AJ401189	CCDS74102.1	17q21.33	2013-01-31	2011-10-04	2001-07-02	ENSG00000108819	ENSG00000108819		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9298	protein-coding gene	gene with protein product	"""spinophilin"", ""Neurabin-2"""	603325	"""protein phosphatase 1, regulatory subunit 9B, spinophilin"", ""protein phosphatase 1, regulatory (inhibitor) subunit 9B"""	PPP1R6, PPP1R9		9275233	Standard	NM_032595		Approved	Spn, SPINO	uc002iqh.4	Q96SB3	OTTHUMG00000162008	ENST00000316878.6:c.*804C>G	17.37:g.48211892G>C			Q8TCR9	RNA	SNP	-	NULL	ENST00000316878.6	37	NULL		17																																																																																			PPP1R9B	-	-		0.577	PPP1R9B-201	KNOWN	basic|appris_principal	protein_coding	PPP1R9B	HGNC	protein_coding		G	NM_032595		48211892	-1	no_errors	ENST00000316878	ensembl	human	known	70_37	rna	SNP	0.692	C
PPP1R9B	84687	genome.wustl.edu	37	17	48211941	48211941	+	3'UTR	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr17:48211941G>C	ENST00000316878.6	-	0	3205				AC002401.1_ENST00000451776.1_RNA|PPP1R9B_ENST00000501501.2_5'UTR	NM_032595.3	NP_115984.3	Q96SB3	NEB2_HUMAN	protein phosphatase 1, regulatory subunit 9B						actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to morphine (GO:0071315)|dendrite development (GO:0016358)|filopodium assembly (GO:0046847)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of cell proliferation (GO:0042127)|regulation of exit from mitosis (GO:0007096)|regulation of opioid receptor signaling pathway (GO:2000474)|regulation of protein phosphorylation (GO:0001932)|RNA splicing (GO:0008380)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|protein phosphatase type 1 complex (GO:0000164)|ruffle membrane (GO:0032587)|synapse (GO:0045202)	protein phosphatase 1 binding (GO:0008157)|protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	8						TTTGGCACCTGGAAGAGGGGA	0.577																																																	0																																										SO:0001624	3_prime_UTR_variant	84687			AJ401189	CCDS74102.1	17q21.33	2013-01-31	2011-10-04	2001-07-02	ENSG00000108819	ENSG00000108819		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9298	protein-coding gene	gene with protein product	"""spinophilin"", ""Neurabin-2"""	603325	"""protein phosphatase 1, regulatory subunit 9B, spinophilin"", ""protein phosphatase 1, regulatory (inhibitor) subunit 9B"""	PPP1R6, PPP1R9		9275233	Standard	NM_032595		Approved	Spn, SPINO	uc002iqh.4	Q96SB3	OTTHUMG00000162008	ENST00000316878.6:c.*755C>G	17.37:g.48211941G>C			Q8TCR9	RNA	SNP	-	NULL	ENST00000316878.6	37	NULL		17																																																																																			PPP1R9B	-	-		0.577	PPP1R9B-201	KNOWN	basic|appris_principal	protein_coding	PPP1R9B	HGNC	protein_coding		G	NM_032595		48211941	-1	no_errors	ENST00000316878	ensembl	human	known	70_37	rna	SNP	0.892	C
PRMT2	3275	genome.wustl.edu	37	21	48063477	48063477	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr21:48063477G>A	ENST00000397637.1	+	3	1024	c.70G>A	c.(70-72)Ggt>Agt	p.G24S	PRMT2_ENST00000397628.1_Missense_Mutation_p.G24S|PRMT2_ENST00000355680.3_Missense_Mutation_p.G24S|PRMT2_ENST00000458387.2_Missense_Mutation_p.G24S|PRMT2_ENST00000440086.1_Missense_Mutation_p.G24S|PRMT2_ENST00000334494.4_Missense_Mutation_p.G24S|PRMT2_ENST00000451211.2_Missense_Mutation_p.G24S|PRMT2_ENST00000397638.2_Missense_Mutation_p.G24S|PRMT2_ENST00000291705.6_Missense_Mutation_p.G24S			P55345	ANM2_HUMAN	protein arginine methyltransferase 2	24	Interaction with ESR1.				developmental cell growth (GO:0048588)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|protein methylation (GO:0006479)|regulation of androgen receptor signaling pathway (GO:0060765)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (GO:0042054)|histone-arginine N-methyltransferase activity (GO:0008469)|peroxisome proliferator activated receptor binding (GO:0042975)|progesterone receptor binding (GO:0033142)|protein homodimerization activity (GO:0042803)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|retinoic acid receptor binding (GO:0042974)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	Breast(49;0.247)	Lung NSC(3;0.245)		Epithelial(3;1.03e-07)|OV - Ovarian serous cystadenocarcinoma(3;4.68e-07)|all cancers(3;7.48e-07)|Colorectal(79;0.167)|Lung(125;0.203)|LUSC - Lung squamous cell carcinoma(216;0.23)|READ - Rectum adenocarcinoma(84;0.248)		CAGTGAGGCCGGTCTCCTGCA	0.532																																																	0													80.0	79.0	79.0					21																	48063477		2203	4300	6503	SO:0001583	missense	3275			U80213	CCDS13737.1, CCDS56219.1, CCDS56220.1, CCDS68230.1, CCDS68231.1, CCDS74806.1	21q22.3	2014-06-12	2006-02-16	2006-02-16	ENSG00000160310	ENSG00000160310	2.1.1.125	"""Protein arginine methyltransferases"""	5186	protein-coding gene	gene with protein product		601961	"""HMT1 (hnRNP methyltransferase, S. cerevisiae)-like 1"", ""HMT1 hnRNP methyltransferase-like 1 (S. cerevisiae)"""	HRMT1L1		9545638	Standard	XM_005261111		Approved	MGC111373	uc002zjy.3	P55345	OTTHUMG00000048806	ENST00000397637.1:c.70G>A	21.37:g.48063477G>A	ENSP00000380759:p.Gly24Ser		B7U630|B7U631|B7U632|P78350|Q498Y5|Q5U7D4|Q6FHF0|Q99781|Q9BW15|Q9UMC2	Missense_Mutation	SNP	pfam_SH3_domain,pfam_Arg_MeTrfase,pfam_SH3_2,pfam_Small_mtfrase_dom,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_tRNA_Trfase_Trm5/Tyw2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain	p.G24S	ENST00000397637.1	37	c.70	CCDS13737.1	21	.	.	.	.	.	.	.	.	.	.	G	5.351	0.250011	0.10130	.	.	ENSG00000160310	ENST00000355680;ENST00000397638;ENST00000458387;ENST00000451211;ENST00000291705;ENST00000397637;ENST00000334494;ENST00000397628;ENST00000440086	T;T;T;T;T;T;T;T;T	0.27557	1.66;1.66;1.66;1.66;1.66;1.66;1.66;1.66;1.66	3.84	-0.216	0.13153	Src homology-3 domain (1);	5.165910	0.00424	N	0.000066	T	0.12178	0.0296	N	0.08118	0	0.09310	N	1	B;B;P;B;B	0.40970	0.002;0.113;0.734;0.226;0.028	B;B;B;B;B	0.19666	0.0;0.007;0.025;0.026;0.004	T	0.16512	-1.0400	10	0.32370	T	0.25	-9.2604	5.4348	0.16476	0.1864:0.4174:0.3963:0.0	.	24;24;24;24;24	B7U632;B7U630;B7U631;Q498Y5;P55345	.;.;.;.;ANM2_HUMAN	S	24	ENSP00000347906:G24S;ENSP00000380760:G24S;ENSP00000407463:G24S;ENSP00000411984:G24S;ENSP00000291705:G24S;ENSP00000380759:G24S;ENSP00000335490:G24S;ENSP00000380752:G24S;ENSP00000397266:G24S	ENSP00000291705:G24S	G	+	1	0	PRMT2	46887905	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.454000	0.21827	-0.061000	0.13110	0.591000	0.81541	GGT	PRMT2	-	superfamily_SH3_domain		0.532	PRMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRMT2	HGNC	protein_coding	OTTHUMT00000207401.1	G	NM_001535		48063477	+1	no_errors	ENST00000355680	ensembl	human	known	70_37	missense	SNP	0.000	A
PROKR2	128674	genome.wustl.edu	37	20	5294986	5294986	+	Silent	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr20:5294986G>A	ENST00000217270.3	-	1	29	c.30C>T	c.(28-30)ttC>ttT	p.F10F	PROKR2_ENST00000546004.1_Silent_p.F10F	NM_144773.2	NP_658986.1	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	10					circadian rhythm (GO:0007623)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(3)|lung(22)|ovary(5)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	53						AGTTGGGTGTGAAACTGGTGT	0.507										HNSCC(71;0.22)																																							0													78.0	71.0	73.0					20																	5294986		2203	4300	6503	SO:0001819	synonymous_variant	128674			AL121755	CCDS13089.1	20p12.3	2012-08-08	2006-02-15	2006-02-15	ENSG00000101292	ENSG00000101292		"""GPCR / Class A : Prokineticin receptors"""	15836	protein-coding gene	gene with protein product		607123	"""G protein-coupled receptor 73-like 1"", ""Kallmann syndrome 3 (autosomal dominant)"""	GPR73L1, KAL3		11886876, 17054399	Standard	NM_144773		Approved	GPR73b, PKR2, GPRg2, dJ680N4.3	uc010zqw.2	Q8NFJ6	OTTHUMG00000031800	ENST00000217270.3:c.30C>T	20.37:g.5294986G>A			A5JUU1|Q2M3C0|Q5TDY1|Q9NTT0	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.F10	ENST00000217270.3	37	c.30	CCDS13089.1	20																																																																																			PROKR2	-	NULL		0.507	PROKR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROKR2	HGNC	protein_coding	OTTHUMT00000077854.1	G	NM_144773		5294986	-1	no_errors	ENST00000217270	ensembl	human	known	70_37	silent	SNP	0.000	A
PRR14L	253143	genome.wustl.edu	37	22	32108390	32108390	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr22:32108390C>G	ENST00000327423.6	-	4	5624	c.5435G>C	c.(5434-5436)aGa>aCa	p.R1812T	PRR14L_ENST00000434485.1_Missense_Mutation_p.R1812T|PRR14L_ENST00000397493.2_Missense_Mutation_p.R1812T	NM_173566.2	NP_775837.2	Q5THK1	PR14L_HUMAN	proline rich 14-like	1812										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|skin(1)|urinary_tract(2)	14						GCAGTCTGCTCTGGTCTGGAC	0.547																																																	0													106.0	113.0	111.0					22																	32108390		692	1591	2283	SO:0001583	missense	253143			BC040859	CCDS13900.2	22q12.2	2011-01-25	2011-01-25	2011-01-25	ENSG00000183530	ENSG00000183530			28738	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 30"""	C22orf30		12477932	Standard	NM_173566		Approved	MGC50372	uc003alp.4	Q5THK1	OTTHUMG00000030139	ENST00000327423.6:c.5435G>C	22.37:g.32108390C>G	ENSP00000331845:p.Arg1812Thr		Q5THK4|Q6ZNN1|Q6ZWH0|Q8IW74|Q9H5T4	Missense_Mutation	SNP	NULL	p.R1812T	ENST00000327423.6	37	c.5435	CCDS13900.2	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.68|18.68	3.675854|3.675854	0.67928|0.67928	.|.	.|.	ENSG00000183530|ENSG00000183530	ENST00000330495|ENST00000397493;ENST00000327423;ENST00000434485	.|T;T;T	.|0.50548	.|0.74;0.74;0.74	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	.|0.214229	.|0.42682	.|D	.|0.000662	T|T	0.55178|0.55178	0.1904|0.1904	L|L	0.45581|0.45581	1.43|1.43	0.33643|0.33643	D|D	0.607519|0.607519	.|D;D;D	.|0.56521	.|0.976;0.976;0.976	.|P;P;P	.|0.54060	.|0.741;0.741;0.741	T|T	0.64605|0.64605	-0.6368|-0.6368	5|10	.|0.45353	.|T	.|0.12	-10.7532|-10.7532	16.1806|16.1806	0.81895|0.81895	0.0:0.867:0.133:0.0|0.0:0.867:0.133:0.0	.|.	.|1812;1812;1812	.|Q5THK1-2;Q5THK1;Q5THK1-4	.|.;PR14L_HUMAN;.	H|T	114|1812	.|ENSP00000380630:R1812T;ENSP00000331845:R1812T;ENSP00000388314:R1812T	.|ENSP00000331845:R1812T	Q|R	-|-	3|2	2|0	PRR14L|PRR14L	30438390|30438390	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	1.857000|1.857000	0.39399|0.39399	2.738000|2.738000	0.93877|0.93877	0.655000|0.655000	0.94253|0.94253	CAG|AGA	PRR14L	-	NULL		0.547	PRR14L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PRR14L	HGNC	protein_coding	OTTHUMT00000074993.2	C	NM_173566		32108390	-1	no_errors	ENST00000397493	ensembl	human	known	70_37	missense	SNP	1.000	G
PRRC2A	7916	genome.wustl.edu	37	6	31595578	31595578	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr6:31595578G>A	ENST00000376033.2	+	12	1561	c.1327G>A	c.(1327-1329)Gaa>Aaa	p.E443K	PRRC2A_ENST00000376007.4_Missense_Mutation_p.E443K	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	443	2 X type B repeats.|4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						CCCAGCACCTGAAGATGAGGA	0.587																																																	0													47.0	54.0	51.0					6																	31595578		1509	2709	4218	SO:0001583	missense	7916			M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.1327G>A	6.37:g.31595578G>A	ENSP00000365201:p.Glu443Lys		B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	pfam_BAT2_N	p.E443K	ENST00000376033.2	37	c.1327	CCDS4708.1	6	.	.	.	.	.	.	.	.	.	.	G	14.10	2.435242	0.43224	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033	T;T	0.11930	2.73;2.73	4.38	4.38	0.52667	.	0.000000	0.49916	D	0.000127	T	0.19005	0.0456	L	0.60455	1.87	0.50467	D	0.999878	D	0.55172	0.97	P	0.54815	0.761	T	0.00893	-1.1524	10	0.87932	D	0	-11.3809	16.2187	0.82244	0.0:0.0:1.0:0.0	.	443	P48634	PRC2A_HUMAN	K	443;432;443;443	ENSP00000365175:E443K;ENSP00000365201:E443K	ENSP00000365175:E443K	E	+	1	0	PRRC2A	31703557	1.000000	0.71417	0.983000	0.44433	0.993000	0.82548	7.093000	0.76937	2.453000	0.82957	0.561000	0.74099	GAA	PRRC2A	-	NULL		0.587	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2A	HGNC	protein_coding	OTTHUMT00000259319.1	G	NM_080686		31595578	+1	no_errors	ENST00000376007	ensembl	human	known	70_37	missense	SNP	0.999	A
PRRC2A	7916	genome.wustl.edu	37	6	31595770	31595770	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr6:31595770G>C	ENST00000376033.2	+	12	1753	c.1519G>C	c.(1519-1521)Gag>Cag	p.E507Q	PRRC2A_ENST00000376007.4_Missense_Mutation_p.E507Q	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	507	2 X type B repeats.|4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						GCTCAAAGCAGAGCCTGCTGC	0.622																																																	0													118.0	115.0	116.0					6																	31595770		1511	2709	4220	SO:0001583	missense	7916			M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.1519G>C	6.37:g.31595770G>C	ENSP00000365201:p.Glu507Gln		B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	pfam_BAT2_N	p.E507Q	ENST00000376033.2	37	c.1519	CCDS4708.1	6	.	.	.	.	.	.	.	.	.	.	G	12.12	1.843298	0.32606	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033	T;T	0.06608	3.28;3.28	4.62	4.62	0.57501	.	0.000000	0.52532	D	0.000072	T	0.05686	0.0149	L	0.40543	1.245	0.34903	D	0.746678	D	0.53885	0.963	P	0.47573	0.55	T	0.13335	-1.0513	10	0.87932	D	0	-16.5102	16.7445	0.85468	0.0:0.0:1.0:0.0	.	507	P48634	PRC2A_HUMAN	Q	507;496;507;507	ENSP00000365175:E507Q;ENSP00000365201:E507Q	ENSP00000365175:E507Q	E	+	1	0	PRRC2A	31703749	0.997000	0.39634	1.000000	0.80357	0.988000	0.76386	2.668000	0.46816	2.569000	0.86673	0.561000	0.74099	GAG	PRRC2A	-	NULL		0.622	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2A	HGNC	protein_coding	OTTHUMT00000259319.1	G	NM_080686		31595770	+1	no_errors	ENST00000376007	ensembl	human	known	70_37	missense	SNP	1.000	C
PSEN2	5664	genome.wustl.edu	37	1	227079026	227079026	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:227079026C>T	ENST00000366783.3	+	10	1370	c.934C>T	c.(934-936)Cag>Tag	p.Q312*	PSEN2_ENST00000366782.1_Nonsense_Mutation_p.Q345*|PSEN2_ENST00000391872.2_Nonsense_Mutation_p.Q345*|PSEN2_ENST00000471728.1_3'UTR|PSEN2_ENST00000340188.4_Nonsense_Mutation_p.Q279*|PSEN2_ENST00000472139.2_Nonsense_Mutation_p.Q168*|PSEN2_ENST00000422240.2_Nonsense_Mutation_p.Q312*	NM_000447.2|NM_012486.2	NP_000438.2|NP_036618.2	P49810	PSN2_HUMAN	presenilin 2	312					amyloid precursor protein catabolic process (GO:0042987)|anagen (GO:0042640)|apoptotic signaling pathway (GO:0097190)|beta-amyloid metabolic process (GO:0050435)|brain morphogenesis (GO:0048854)|calcium ion transport (GO:0006816)|cardiac muscle contraction (GO:0060048)|cell fate specification (GO:0001708)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic limb morphogenesis (GO:0030326)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|forebrain development (GO:0030900)|hematopoietic progenitor cell differentiation (GO:0002244)|intracellular signal transduction (GO:0035556)|locomotion (GO:0040011)|lung alveolus development (GO:0048286)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|memory (GO:0007613)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein binding (GO:0032091)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of protein phosphorylation (GO:0001933)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of coagulation (GO:0050820)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein processing (GO:0016485)|protein transport (GO:0015031)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of synaptic plasticity (GO:0048167)|response to hypoxia (GO:0001666)|somitogenesis (GO:0001756)|T cell activation involved in immune response (GO:0002286)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cell cortex (GO:0005938)|cell surface (GO:0009986)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary rootlet (GO:0035253)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|kinetochore (GO:0000776)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nuclear inner membrane (GO:0005637)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Z disc (GO:0030018)	aspartic-type endopeptidase activity (GO:0004190)|endopeptidase activity (GO:0004175)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|urinary_tract(1)	20		Prostate(94;0.0771)				CCCCTCCTCTCAGGGTGCCCT	0.627																																																	0													55.0	47.0	50.0					1																	227079026		2203	4300	6503	SO:0001587	stop_gained	5664			BC006365	CCDS1556.1, CCDS44324.1	1q42.13	2014-09-17	2014-02-24		ENSG00000143801	ENSG00000143801			9509	protein-coding gene	gene with protein product		600759	"""Alzheimer disease 4"""	AD4		7638621	Standard	NM_000447		Approved	AD3L, STM2, PS2	uc009xeo.1	P49810	OTTHUMG00000037563	ENST00000366783.3:c.934C>T	1.37:g.227079026C>T	ENSP00000355747:p.Gln312*		A8K8D4|B1AP21|Q96P32	Nonsense_Mutation	SNP	pfam_Peptidase_A22A,smart_Peptidase_A22,prints_Pept_A22A_PS2,prints_Peptidase_A22A	p.Q345*	ENST00000366783.3	37	c.1033	CCDS1556.1	1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.278399	0.80692	.	.	ENSG00000143801	ENST00000366783;ENST00000340188;ENST00000422240;ENST00000460775;ENST00000366782;ENST00000391872;ENST00000472139	.	.	.	5.25	3.23	0.37069	.	0.545908	0.20643	N	0.088379	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	.	6.9873	0.24735	0.264:0.5821:0.154:0.0	.	.	.	.	X	312;279;312;139;345;345;168	.	ENSP00000339860:Q279X	Q	+	1	0	PSEN2	225145649	0.808000	0.29022	0.997000	0.53966	0.988000	0.76386	1.253000	0.32886	2.438000	0.82558	0.655000	0.94253	CAG	PSEN2	-	smart_Peptidase_A22,prints_Pept_A22A_PS2		0.627	PSEN2-001	KNOWN	basic|CCDS	protein_coding	PSEN2	HGNC	protein_coding	OTTHUMT00000091539.1	C	NM_000447		227079026	+1	no_errors	ENST00000391872	ensembl	human	known	70_37	nonsense	SNP	0.711	T
PTCHD1	139411	genome.wustl.edu	37	X	23411550	23411550	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chrX:23411550G>A	ENST00000379361.4	+	3	2775	c.1915G>A	c.(1915-1917)Gag>Aag	p.E639K		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	639					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						ATACAATGATGAGGTCGATGT	0.393																																																	0													61.0	61.0	61.0					X																	23411550		2202	4300	6502	SO:0001583	missense	139411			AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.1915G>A	X.37:g.23411550G>A	ENSP00000368666:p.Glu639Lys		B4DQH0|Q0IJ60|Q6P6B8	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.E639K	ENST00000379361.4	37	c.1915	CCDS35215.2	X	.	.	.	.	.	.	.	.	.	.	G	16.41	3.116226	0.56505	.	.	ENSG00000165186	ENST00000379361	D	0.85411	-1.98	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	D	0.87462	0.6183	L	0.29908	0.895	0.58432	D	0.999998	D	0.69078	0.997	D	0.77004	0.989	D	0.84012	0.0349	10	0.15499	T	0.54	.	18.3322	0.90274	0.0:0.0:1.0:0.0	.	639	Q96NR3	PTHD1_HUMAN	K	639	ENSP00000368666:E639K	ENSP00000368666:E639K	E	+	1	0	PTCHD1	23321471	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.471000	0.97696	2.269000	0.75478	0.600000	0.82982	GAG	PTCHD1	-	pfam_Patched		0.393	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD1	HGNC	protein_coding	OTTHUMT00000056047.2	G	NM_173495		23411550	+1	no_errors	ENST00000379361	ensembl	human	known	70_37	missense	SNP	1.000	A
PTEN	5728	genome.wustl.edu	37	10	89693162	89693162	+	Intron	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr10:89693162G>C	ENST00000371953.3	+	5	1849					NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog						activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.?(2)|p.Y27fs*1(2)|p.K163_V166>NKGE(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		atgatgttttgatgtatgtgt	0.284		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																													yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	47	Whole gene deletion(37)|Deletion - Frameshift(7)|Unknown(2)|Complex - compound substitution(1)	prostate(16)|central_nervous_system(10)|skin(5)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|ovary(3)|thyroid(1)|soft_tissue(1)|urinary_tract(1)																																								SO:0001627	intron_variant	5728	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.492+154G>C	10.37:g.89693162G>C			B2R904|F2YHV0|O00633|O02679|Q6ICT7	RNA	SNP	-	NULL	ENST00000371953.3	37	NULL	CCDS31238.1	10																																																																																			PTEN	-	-		0.284	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTEN	HGNC	protein_coding	OTTHUMT00000049241.1	G	NM_000314		89693162	+1	no_errors	ENST00000498703	ensembl	human	known	70_37	rna	SNP	0.000	C
PTEN	5728	genome.wustl.edu	37	10	89717729	89717729	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr10:89717729G>A	ENST00000371953.3	+	7	2111	c.754G>A	c.(754-756)Gat>Aat	p.D252N	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	252	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.		D -> G (in MCEPHAS). {ECO:0000269|PubMed:15805158}.		activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.D252Y(4)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.?(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TGTGTGTGGTGATATCAAAGT	0.393		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																													yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	52	Whole gene deletion(37)|Deletion - Frameshift(9)|Substitution - Missense(4)|Deletion - In frame(1)|Unknown(1)	prostate(16)|central_nervous_system(12)|skin(6)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|ovary(3)|urinary_tract(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|endometrium(1)											120.0	106.0	111.0					10																	89717729		2203	4300	6503	SO:0001583	missense	5728	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.754G>A	10.37:g.89717729G>A	ENSP00000361021:p.Asp252Asn		B2R904|F2YHV0|O00633|O02679|Q6ICT7	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.D252N	ENST00000371953.3	37	c.754	CCDS31238.1	10	.	.	.	.	.	.	.	.	.	.	G	35	5.467929	0.96257	.	.	ENSG00000171862	ENST00000371953	D	0.99207	-5.56	5.15	5.15	0.70609	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.092939	0.64402	D	0.000001	D	0.99399	0.9788	M	0.85542	2.76	0.80722	D	1	D	0.69078	0.997	D	0.65323	0.934	D	0.98974	1.0802	9	.	.	.	-9.9468	18.6161	0.91303	0.0:0.0:1.0:0.0	.	252	P60484	PTEN_HUMAN	N	252	ENSP00000361021:D252N	.	D	+	1	0	PTEN	89707709	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.429000	0.97481	2.380000	0.81148	0.585000	0.79938	GAT	PTEN	-	pfam_Tensin_phosphatase_C2-dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tensin_phosphatase_C2-dom		0.393	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTEN	HGNC	protein_coding	OTTHUMT00000049241.1	G	NM_000314		89717729	+1	no_errors	ENST00000371953	ensembl	human	known	70_37	missense	SNP	1.000	A
PTEN	5728	genome.wustl.edu	37	10	89720783	89720783	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr10:89720783G>A	ENST00000371953.3	+	8	2291	c.934G>A	c.(934-936)Gac>Aac	p.D312N	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	312	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.W274_F341del(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TGCAGATAATGACAAGGAATA	0.348		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																													yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	50	Whole gene deletion(37)|Deletion - Frameshift(9)|Deletion - In frame(2)|Unknown(2)	prostate(16)|central_nervous_system(12)|skin(6)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|ovary(3)|urinary_tract(2)|soft_tissue(1)											104.0	102.0	103.0					10																	89720783		2203	4299	6502	SO:0001583	missense	5728	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.934G>A	10.37:g.89720783G>A	ENSP00000361021:p.Asp312Asn		B2R904|F2YHV0|O00633|O02679|Q6ICT7	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.D312N	ENST00000371953.3	37	c.934	CCDS31238.1	10	.	.	.	.	.	.	.	.	.	.	G	17.16	3.318835	0.60524	.	.	ENSG00000171862	ENST00000371953	D	0.94537	-3.45	5.13	5.13	0.70059	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.92202	0.7527	L	0.31065	0.9	0.80722	D	1	P	0.35493	0.505	B	0.42319	0.383	D	0.90522	0.4489	9	.	.	.	-9.1918	18.5632	0.91108	0.0:0.0:1.0:0.0	.	312	P60484	PTEN_HUMAN	N	312	ENSP00000361021:D312N	.	D	+	1	0	PTEN	89710763	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.369000	0.97156	2.399000	0.81585	0.591000	0.81541	GAC	PTEN	-	pfam_Tensin_phosphatase_C2-dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tensin_phosphatase_C2-dom		0.348	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTEN	HGNC	protein_coding	OTTHUMT00000049241.1	G	NM_000314		89720783	+1	no_errors	ENST00000371953	ensembl	human	known	70_37	missense	SNP	1.000	A
PTPRH	5794	genome.wustl.edu	37	19	55713638	55713638	+	Silent	SNP	G	G	A	rs377115239		TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr19:55713638G>A	ENST00000376350.3	-	6	961	c.939C>T	c.(937-939)atC>atT	p.I313I	PTPRH_ENST00000588559.1_5'UTR|PTPRH_ENST00000263434.5_Silent_p.I135I	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	313	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		AGGTCAGGGCGATGGAGCTGT	0.577																																																	0								G	,	1,4405	2.1+/-5.4	0,1,2202	105.0	86.0	92.0		405,939	3.9	0.9	19		92	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	PTPRH	NM_001161440.1,NM_002842.3	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	135/938,313/1116	55713638	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5794				CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.939C>T	19.37:g.55713638G>A			C9JCH2|Q15426|Q2NKN9|Q2NKP0	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.I313	ENST00000376350.3	37	c.939	CCDS33110.1	19																																																																																			PTPRH	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.577	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRH	HGNC	protein_coding	OTTHUMT00000452649.1	G			55713638	-1	no_errors	ENST00000376350	ensembl	human	known	70_37	silent	SNP	0.905	A
RFNG	5986	genome.wustl.edu	37	17	80008563	80008563	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr17:80008563C>T	ENST00000310496.4	-	3	401	c.394G>A	c.(394-396)Gac>Aac	p.D132N	GPS1_ENST00000578552.1_5'Flank|GPS1_ENST00000392358.2_5'Flank|GPS1_ENST00000320548.4_5'Flank|RFNG_ENST00000584838.1_5'UTR|GPS1_ENST00000306823.6_5'Flank|GPS1_ENST00000355130.2_5'Flank|RFNG_ENST00000429557.3_Missense_Mutation_p.D6N	NM_002917.1	NP_002908.1	Q9Y644	RFNG_HUMAN	RFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase	132					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|pattern specification process (GO:0007389)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of protein binding (GO:0032092)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of Golgi membrane (GO:0030173)	metal ion binding (GO:0046872)|O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity (GO:0033829)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			ATGAACTTGTCATACTCCACG	0.632																																																	0													123.0	109.0	114.0					17																	80008563		2203	4300	6503	SO:0001583	missense	5986			BC069034	CCDS32773.1	17q25.3	2013-02-19	2006-11-13		ENSG00000169733	ENSG00000169733	2.4.1.222	"""Beta 3-glycosyltransferases"""	9974	protein-coding gene	gene with protein product		602578	"""radical fringe (Drosophila) homolog"", ""radical fringe homolog (Drosophila)"""			9187150	Standard	NM_002917		Approved		uc002kdj.3	Q9Y644	OTTHUMG00000178512	ENST00000310496.4:c.394G>A	17.37:g.80008563C>T	ENSP00000307971:p.Asp132Asn		O00588	Missense_Mutation	SNP	pfam_Fringe-like,pirsf_Fringe	p.D132N	ENST00000310496.4	37	c.394	CCDS32773.1	17	.	.	.	.	.	.	.	.	.	.	C	19.56	3.849965	0.71603	.	.	ENSG00000169733	ENST00000310496;ENST00000429557	T	0.71103	-0.54	3.61	3.61	0.41365	.	0.000000	0.85682	D	0.000000	D	0.85159	0.5633	M	0.87900	2.915	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	D	0.87479	0.2419	10	0.49607	T	0.09	-21.4937	15.2582	0.73601	0.0:1.0:0.0:0.0	.	132	Q9Y644	RFNG_HUMAN	N	132;91	ENSP00000307971:D132N	ENSP00000307971:D132N	D	-	1	0	RFNG	77601852	1.000000	0.71417	0.773000	0.31616	0.086000	0.17979	5.454000	0.66651	1.563000	0.49615	0.561000	0.74099	GAC	RFNG	-	pfam_Fringe-like,pirsf_Fringe		0.632	RFNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFNG	HGNC	protein_coding	OTTHUMT00000442263.1	C	NM_002917		80008563	-1	no_errors	ENST00000310496	ensembl	human	known	70_37	missense	SNP	1.000	T
RFTN1	23180	genome.wustl.edu	37	3	16419401	16419401	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr3:16419401C>T	ENST00000334133.4	-	5	922	c.650G>A	c.(649-651)aGa>aAa	p.R217K	RFTN1_ENST00000432519.1_Missense_Mutation_p.R181K	NM_015150.1	NP_055965.1	Q14699	RFTN1_HUMAN	raftlin, lipid raft linker 1	217					B cell receptor signaling pathway (GO:0050853)|dsRNA transport (GO:0033227)|growth (GO:0040007)|interleukin-17 production (GO:0032620)|membrane raft assembly (GO:0001765)|protein localization to membrane raft (GO:1903044)|protein transport into membrane raft (GO:0032596)|response to exogenous dsRNA (GO:0043330)|T cell antigen processing and presentation (GO:0002457)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 3 signaling pathway (GO:0034138)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	double-stranded RNA binding (GO:0003725)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	38						GCTTTGGTTTCTCCCAGCCGG	0.617																																																	0													60.0	63.0	62.0					3																	16419401		2203	4300	6503	SO:0001583	missense	23180			D42043	CCDS33712.1	3p24.3	2010-04-09			ENSG00000131378	ENSG00000131378			30278	protein-coding gene	gene with protein product	"""raft-linking protein"""					7788527, 12805216	Standard	NM_015150		Approved	MIG2, KIAA0084, FLJ23866, Raftlin	uc003cay.3	Q14699	OTTHUMG00000156973	ENST00000334133.4:c.650G>A	3.37:g.16419401C>T	ENSP00000334153:p.Arg217Lys		Q0D2G0|Q496Y2|Q4QQI7|Q5JB48|Q7Z7P2	Missense_Mutation	SNP	NULL	p.R217K	ENST00000334133.4	37	c.650	CCDS33712.1	3	.	.	.	.	.	.	.	.	.	.	C	7.324	0.617646	0.14129	.	.	ENSG00000131378	ENST00000432519;ENST00000334133;ENST00000451036	T;T;T	0.41758	1.52;1.54;0.99	4.95	-8.23	0.01033	.	3.212750	0.02737	N	0.115776	T	0.17789	0.0427	N	0.14661	0.345	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.33214	-0.9877	10	0.02654	T	1	3.0368	5.985	0.19430	0.1492:0.317:0.447:0.0868	.	181;217	G3XAJ6;Q14699	.;RFTN1_HUMAN	K	181;217;217	ENSP00000403926:R181K;ENSP00000334153:R217K;ENSP00000403997:R217K	ENSP00000334153:R217K	R	-	2	0	RFTN1	16394405	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.604000	0.05667	-1.094000	0.03054	0.561000	0.74099	AGA	RFTN1	-	NULL		0.617	RFTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RFTN1	HGNC	protein_coding	OTTHUMT00000346908.1	C	NM_015150		16419401	-1	no_errors	ENST00000334133	ensembl	human	known	70_37	missense	SNP	0.000	T
RHBDF1	64285	genome.wustl.edu	37	16	109765	109765	+	Silent	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr16:109765G>A	ENST00000262316.6	-	14	1924	c.1782C>T	c.(1780-1782)atC>atT	p.I594I		NM_022450.3	NP_071895.3	Q96CC6	RHDF1_HUMAN	rhomboid 5 homolog 1 (Drosophila)	594					cell migration (GO:0016477)|cell proliferation (GO:0008283)|negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)|proteolysis (GO:0006508)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	18		all_cancers(16;2.56e-05)|all_epithelial(16;0.000116)|Hepatocellular(780;0.0068)|Lung NSC(18;0.0795)|all_lung(18;0.159)				GCCGTCCTGTGATGACACAGT	0.612																																																	0													173.0	122.0	139.0					16																	109765		2203	4300	6503	SO:0001819	synonymous_variant	64285			BC014425	CCDS32344.1	16p13.3	2008-02-05	2006-02-22		ENSG00000007384	ENSG00000007384			20561	protein-coding gene	gene with protein product		614403	"""chromosome 16 open reading frame 8"", ""rhomboid family 1 (Drosophila)"""	C16orf8		8318735, 15965977	Standard	NM_022450		Approved	EGFR-RS, FLJ2235, Dist1	uc002cfl.4	Q96CC6	OTTHUMG00000060719	ENST00000262316.6:c.1782C>T	16.37:g.109765G>A			Q04842|Q1W6H2|Q4TT59|Q96S34|Q9H6E1	Silent	SNP	pfam_Rhomboid_SP,pfam_Peptidase_S54_rhomboid_dom	p.I594	ENST00000262316.6	37	c.1782	CCDS32344.1	16																																																																																			RHBDF1	-	NULL		0.612	RHBDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHBDF1	HGNC	protein_coding	OTTHUMT00000134178.2	G	NM_022450		109765	-1	no_errors	ENST00000262316	ensembl	human	known	70_37	silent	SNP	1.000	A
RHPN2	85415	genome.wustl.edu	37	19	33490562	33490562	+	Silent	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr19:33490562G>C	ENST00000254260.3	-	10	1190	c.1155C>G	c.(1153-1155)ctC>ctG	p.L385L	RHPN2_ENST00000400226.4_Silent_p.L234L	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	385	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					TGTGGTCGTAGAGCTGGGACA	0.602																																																	0													78.0	63.0	68.0					19																	33490562		2203	4300	6503	SO:0001819	synonymous_variant	85415			AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.1155C>G	19.37:g.33490562G>C			B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Silent	SNP	pfam_BRO1_dom,pfam_HR1_rho-bd,superfamily_HR1_rho-bd,superfamily_PDZ,smart_HR1_rho-bd,smart_PDZ,pfscan_BRO1_dom	p.L385	ENST00000254260.3	37	c.1155	CCDS12427.1	19																																																																																			RHPN2	-	pfam_BRO1_dom,pfscan_BRO1_dom		0.602	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHPN2	HGNC	protein_coding	OTTHUMT00000450828.2	G	NM_033103		33490562	-1	no_errors	ENST00000254260	ensembl	human	known	70_37	silent	SNP	1.000	C
RLTPR	146206	genome.wustl.edu	37	16	67683738	67683738	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr16:67683738C>T	ENST00000334583.6	+	21	2277	c.1949C>T	c.(1948-1950)tCt>tTt	p.S650F	RLTPR_ENST00000545661.1_Missense_Mutation_p.S614F	NM_001013838.1	NP_001013860.1	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing	650	Tropomodulin-like.				cell migration (GO:0016477)|establishment of protein localization (GO:0045184)|homeostasis of number of cells (GO:0048872)|maintenance of cell polarity (GO:0030011)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|F-actin capping protein complex (GO:0008290)|immunological synapse (GO:0001772)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(4)|kidney(1)|lung(9)|urinary_tract(2)	18		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		AACCACACATCTGCTTTGGGT	0.667																																																	0													43.0	51.0	48.0					16																	67683738		2105	4217	6322	SO:0001583	missense	146206			AB113647	CCDS45513.1	16q22.1	2010-09-10				ENSG00000159753			27089	protein-coding gene	gene with protein product	"""RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein"", ""leucine rich repeat containing 16C"""	610859				15588584, 19846667	Standard	XM_005255807		Approved	LRRC16C, CARMIL2	uc002etn.3	Q6F5E8		ENST00000334583.6:c.1949C>T	16.37:g.67683738C>T	ENSP00000334958:p.Ser650Phe		B8X2Z3	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.S650F	ENST00000334583.6	37	c.1949	CCDS45513.1	16	.	.	.	.	.	.	.	.	.	.	C	31	5.096248	0.94197	.	.	ENSG00000159753	ENST00000334583;ENST00000545661	T;T	0.56776	0.44;0.44	5.11	5.11	0.69529	.	0.059857	0.64402	D	0.000004	T	0.61553	0.2356	L	0.42245	1.32	0.45930	D	0.998769	D;D	0.67145	0.996;0.996	P;P	0.59703	0.862;0.804	T	0.63791	-0.6557	10	0.59425	D	0.04	-10.6818	15.2694	0.73689	0.0:1.0:0.0:0.0	.	614;650	B8X2Z3;Q6F5E8	.;LR16C_HUMAN	F	650;614	ENSP00000334958:S650F;ENSP00000441481:S614F	ENSP00000334958:S650F	S	+	2	0	RLTPR	66241239	0.283000	0.24277	0.999000	0.59377	0.991000	0.79684	3.035000	0.49759	2.392000	0.81423	0.561000	0.74099	TCT	RLTPR	-	NULL		0.667	RLTPR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RLTPR	HGNC	protein_coding	OTTHUMT00000467858.1	C	NM_001013838		67683738	+1	no_errors	ENST00000334583	ensembl	human	known	70_37	missense	SNP	0.998	T
RNF111	54778	genome.wustl.edu	37	15	59373346	59373346	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr15:59373346C>G	ENST00000557998.1	+	8	2447	c.2160C>G	c.(2158-2160)atC>atG	p.I720M	RNF111_ENST00000348370.4_Missense_Mutation_p.I720M|RNF111_ENST00000561186.1_Missense_Mutation_p.I720M|RNF111_ENST00000434298.1_Missense_Mutation_p.I720M|RNF111_ENST00000559209.1_Missense_Mutation_p.I720M	NM_001270530.1	NP_001257459.1	Q6ZNA4	RN111_HUMAN	ring finger protein 111	720	Pro-rich.				gene expression (GO:0010467)|pattern specification process (GO:0007389)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein polyubiquitination (GO:0000209)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|SUMO polymer binding (GO:0032184)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35				all cancers(107;0.194)		CTGCACCAATCCCTCAGCATC	0.502																																					NSCLC(72;983 1365 10746 34387 47081)												0													327.0	269.0	289.0					15																	59373346		2192	4291	6483	SO:0001583	missense	54778			AL157474	CCDS10169.1, CCDS58365.1, CCDS58366.1	15q21	2013-01-09			ENSG00000157450	ENSG00000157450		"""RING-type (C3HC4) zinc fingers"""	17384	protein-coding gene	gene with protein product		605840				11298452	Standard	NM_017610		Approved	ARK, Arkadia, FLJ38008, DKFZP761D081	uc002aft.4	Q6ZNA4	OTTHUMG00000132716	ENST00000557998.1:c.2160C>G	15.37:g.59373346C>G	ENSP00000452732:p.Ile720Met		C9JUS4|H0YN55|Q6P9A4|Q6ZMU2|Q7L428|Q7Z346|Q8N1P9|Q8WUA3|Q9NSR1	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.I720M	ENST00000557998.1	37	c.2160	CCDS58366.1	15	.	.	.	.	.	.	.	.	.	.	C	16.08	3.020956	0.54576	.	.	ENSG00000157450	ENST00000348370;ENST00000434298	T;T	0.15487	2.42;2.44	5.55	4.63	0.57726	.	0.131736	0.53938	D	0.000055	T	0.08891	0.0220	N	0.08118	0	0.32705	N	0.512327	P;P;P	0.50443	0.935;0.868;0.919	P;B;B	0.45610	0.487;0.23;0.406	T	0.05305	-1.0893	10	0.56958	D	0.05	-1.2376	2.8252	0.05483	0.2371:0.5035:0.1213:0.138	.	720;720;720	Q6ZNA4-3;Q6ZNA4;Q6ZNA4-2	.;RN111_HUMAN;.	M	720	ENSP00000288199:I720M;ENSP00000393641:I720M	ENSP00000288199:I720M	I	+	3	3	RNF111	57160638	0.997000	0.39634	1.000000	0.80357	0.993000	0.82548	0.362000	0.20284	2.613000	0.88420	0.467000	0.42956	ATC	RNF111	-	NULL		0.502	RNF111-003	KNOWN	basic|CCDS	protein_coding	RNF111	HGNC	protein_coding	OTTHUMT00000416012.1	C	NM_017610		59373346	+1	no_errors	ENST00000434298	ensembl	human	known	70_37	missense	SNP	0.995	G
RPA2	6118	genome.wustl.edu	37	1	28240755	28240755	+	Intron	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:28240755C>T	ENST00000373912.3	-	2	310				RPA2_ENST00000313433.7_Missense_Mutation_p.R67Q|RPA2_ENST00000373909.3_Intron	NM_002946.3	NP_002937.1	P15927	RFA2_HUMAN	replication protein A2, 32kDa						base-excision repair (GO:0006284)|DNA recombinase assembly (GO:0000730)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|mitotic G1 DNA damage checkpoint (GO:0031571)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of DNA damage checkpoint (GO:2000001)|regulation of double-strand break repair via homologous recombination (GO:0010569)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor A complex (GO:0005662)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	damaged DNA binding (GO:0003684)|enzyme binding (GO:0019899)|protein phosphatase binding (GO:0019903)|single-stranded DNA binding (GO:0003697)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(3)|skin(1)	11		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.62e-24)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00294)|STAD - Stomach adenocarcinoma(196;0.00308)|BRCA - Breast invasive adenocarcinoma(304;0.00613)|READ - Rectum adenocarcinoma(331;0.0649)		CCGGAGGCTTCGCCCCTTCAA	0.637								Direct reversal of damage;Nucleotide excision repair (NER)																																									0																																										SO:0001627	intron_variant	6118			BC021257	CCDS314.1, CCDS72740.1	1p35	2008-02-05	2002-08-29		ENSG00000117748	ENSG00000117748			10290	protein-coding gene	gene with protein product		179836	"""replication protein A2 (32kD)"""			8454588	Standard	XM_005245965		Approved		uc001bpe.1	P15927	OTTHUMG00000003915	ENST00000373912.3:c.11-75G>A	1.37:g.28240755C>T			Q52II0|Q5TEI9|Q5TEJ5	Missense_Mutation	SNP	pfam_RPA_C,pfam_NA-bd_OB_tRNA-helicase,superfamily_NA-bd_OB-fold-like	p.R67Q	ENST00000373912.3	37	c.200	CCDS314.1	1	.	.	.	.	.	.	.	.	.	.	C	11.46	1.644574	0.29246	.	.	ENSG00000117748	ENST00000313433	T	0.22945	1.93	3.38	2.45	0.29901	.	3.617650	0.01776	N	0.031491	T	0.21550	0.0519	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26052	-1.0114	6	.	.	.	.	8.0443	0.30540	0.2423:0.7576:0.0:0.0	.	.	.	.	Q	67	ENSP00000363015:R67Q	.	R	-	2	0	RPA2	28113342	0.000000	0.05858	0.001000	0.08648	0.120000	0.20174	-0.271000	0.08572	0.749000	0.32854	-0.448000	0.05591	CGA	RPA2	-	NULL		0.637	RPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPA2	HGNC	protein_coding	OTTHUMT00000011179.1	C	NM_002946		28240755	-1	no_errors	ENST00000313433	ensembl	human	known	70_37	missense	SNP	0.001	T
RRP9	9136	genome.wustl.edu	37	3	51970552	51970552	+	Silent	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr3:51970552C>T	ENST00000232888.6	-	7	610	c.537G>A	c.(535-537)cgG>cgA	p.R179R		NM_004704.3	NP_004695.1	O43818	U3IP2_HUMAN	ribosomal RNA processing 9, small subunit (SSU) processome component, homolog (yeast)	179					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|ovary(1)|skin(1)	21				BRCA - Breast invasive adenocarcinoma(193;8.04e-05)|Kidney(197;0.000553)|KIRC - Kidney renal clear cell carcinoma(197;0.000724)		CATGCAGCTTCCGTCCACTCT	0.642																																																	0													48.0	47.0	48.0					3																	51970552		2203	4300	6503	SO:0001819	synonymous_variant	9136			AJ001340	CCDS2837.1	3p21.31	2013-01-10	2008-02-26	2006-10-24	ENSG00000114767	ENSG00000114767		"""WD repeat domain containing"""	16829	protein-coding gene	gene with protein product			"""RNA, U3 small nucleolar interacting protein 2"""	RNU3IP2		9418896, 12032086	Standard	NM_004704		Approved	U3-55K	uc003dbw.2	O43818	OTTHUMG00000156930	ENST00000232888.6:c.537G>A	3.37:g.51970552C>T			B2R996|Q8IZ30	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R179	ENST00000232888.6	37	c.537	CCDS2837.1	3																																																																																			RRP9	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.642	RRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRP9	HGNC	protein_coding	OTTHUMT00000346637.1	C	NM_004704		51970552	-1	no_errors	ENST00000232888	ensembl	human	known	70_37	silent	SNP	1.000	T
RSPH4A	345895	genome.wustl.edu	37	6	116943980	116943980	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr6:116943980G>A	ENST00000229554.5	+	2	873	c.736G>A	c.(736-738)Gaa>Aaa	p.E246K	RSPH4A_ENST00000368580.4_Missense_Mutation_p.E246K|RSPH4A_ENST00000368581.4_Missense_Mutation_p.E246K	NM_001010892.2	NP_001010892.1	Q5TD94	RSH4A_HUMAN	radial spoke head 4 homolog A (Chlamydomonas)	246					axoneme assembly (GO:0035082)|cilium movement (GO:0003341)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|radial spoke (GO:0001534)				breast(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						TGAGCGTCCTGAAAATGCTGT	0.318									Kartagener syndrome																																								0													90.0	98.0	95.0					6																	116943980		2203	4300	6503	SO:0001583	missense	345895	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome		CCDS34521.1, CCDS55051.1	6q22.1	2012-05-03	2009-02-17	2009-02-17	ENSG00000111834	ENSG00000111834			21558	protein-coding gene	gene with protein product		612647	"""radial spokehead-like 3"""	RSHL3		19200523	Standard	NM_001010892		Approved	dJ412I7.1, FLJ37974, RSPH6B, CILD11	uc003pxe.2	Q5TD94	OTTHUMG00000015444	ENST00000229554.5:c.736G>A	6.37:g.116943980G>A	ENSP00000229554:p.Glu246Lys		B4DSI1|Q3KP24|Q5TD95	Missense_Mutation	SNP	pfam_Radial_spoke	p.E246K	ENST00000229554.5	37	c.736	CCDS34521.1	6	.	.	.	.	.	.	.	.	.	.	G	15.17	2.754485	0.49362	.	.	ENSG00000111834	ENST00000368581;ENST00000229554;ENST00000447842;ENST00000368580	T;T;T	0.17528	2.27;2.27;2.27	4.8	4.8	0.61643	.	0.588554	0.19306	N	0.117514	T	0.09335	0.0230	L	0.54323	1.7	0.26932	N	0.966439	P;B	0.37061	0.58;0.149	B;B	0.37888	0.26;0.06	T	0.09465	-1.0673	10	0.31617	T	0.26	-5.1608	13.533	0.61633	0.0:0.0:1.0:0.0	.	246;246	Q5TD94-3;Q5TD94	.;RSH4A_HUMAN	K	246;246;41;246	ENSP00000357570:E246K;ENSP00000229554:E246K;ENSP00000357569:E246K	ENSP00000229554:E246K	E	+	1	0	RSPH4A	117050673	0.899000	0.30636	1.000000	0.80357	0.996000	0.88848	0.684000	0.25364	2.661000	0.90470	0.609000	0.83330	GAA	RSPH4A	-	pfam_Radial_spoke		0.318	RSPH4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH4A	HGNC	protein_coding	OTTHUMT00000041960.1	G	NM_001010892		116943980	+1	no_errors	ENST00000229554	ensembl	human	known	70_37	missense	SNP	1.000	A
RTN1	6252	genome.wustl.edu	37	14	60212537	60212537	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr14:60212537C>T	ENST00000267484.5	-	2	1239	c.904G>A	c.(904-906)Gag>Aag	p.E302K		NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	302					neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)				central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		TCTTGCTTCTCAGGGGTCTTC	0.512																																																	0													96.0	93.0	94.0					14																	60212537		2203	4300	6503	SO:0001583	missense	6252			L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.904G>A	14.37:g.60212537C>T	ENSP00000267484:p.Glu302Lys		Q16800|Q16801|Q5BKZ4|Q9BQ59	Missense_Mutation	SNP	pfam_Reticulon,pfscan_Reticulon	p.E302K	ENST00000267484.5	37	c.904	CCDS9740.1	14	.	.	.	.	.	.	.	.	.	.	C	17.36	3.370033	0.61624	.	.	ENSG00000139970	ENST00000267484;ENST00000433623	T	0.24538	1.85	5.53	5.53	0.82687	.	0.217350	0.38326	N	0.001731	T	0.25457	0.0619	M	0.67953	2.075	0.33975	D	0.647224	P	0.44734	0.842	B	0.40165	0.321	T	0.31024	-0.9958	10	0.15499	T	0.54	.	10.5702	0.45196	0.0:0.8823:0.0:0.1177	.	302	Q16799	RTN1_HUMAN	K	302;228	ENSP00000267484:E302K	ENSP00000267484:E302K	E	-	1	0	RTN1	59282290	0.237000	0.23815	0.948000	0.38648	0.834000	0.47266	1.621000	0.36986	2.588000	0.87417	0.557000	0.71058	GAG	RTN1	-	NULL		0.512	RTN1-001	KNOWN	basic|CCDS	protein_coding	RTN1	HGNC	protein_coding	OTTHUMT00000072278.2	C			60212537	-1	no_errors	ENST00000267484	ensembl	human	known	70_37	missense	SNP	0.899	T
S100PBP	64766	genome.wustl.edu	37	1	33291767	33291767	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:33291767C>G	ENST00000373475.5	+	3	321	c.67C>G	c.(67-69)Cca>Gca	p.P23A	S100PBP_ENST00000398243.3_Missense_Mutation_p.P23A|S100PBP_ENST00000356689.3_3'UTR|S100PBP_ENST00000373476.1_Missense_Mutation_p.P23A	NM_022753.3	NP_073590.2			S100P binding protein											endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|stomach(1)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				AGACGGTGCCCCATTTTCTTG	0.468																																																	0													166.0	153.0	157.0					1																	33291767		2203	4300	6503	SO:0001583	missense	64766			BX647916	CCDS30666.1	1p35.1	2008-02-05			ENSG00000116497	ENSG00000116497			25768	protein-coding gene	gene with protein product	"""S100P binding protein 1"""	611889				12477932	Standard	NM_022753		Approved	FLJ12903, S100PBPR	uc001bwc.4	Q96BU1	OTTHUMG00000003955	ENST00000373475.5:c.67C>G	1.37:g.33291767C>G	ENSP00000362574:p.Pro23Ala			Missense_Mutation	SNP	NULL	p.P23A	ENST00000373475.5	37	c.67	CCDS30666.1	1	.	.	.	.	.	.	.	.	.	.	C	7.647	0.682158	0.14907	.	.	ENSG00000116497	ENST00000530710;ENST00000373476;ENST00000373475;ENST00000529027;ENST00000531123;ENST00000398243;ENST00000356689;ENST00000526230;ENST00000531256;ENST00000482212	.	.	.	5.71	0.421	0.16451	.	0.603497	0.15692	N	0.249378	T	0.21347	0.0514	N	0.24115	0.695	0.22354	N	0.999179	P;P	0.42296	0.775;0.587	B;B	0.38156	0.266;0.225	T	0.10177	-1.0641	9	0.62326	D	0.03	-0.2711	7.8509	0.29453	0.0:0.5301:0.0:0.4699	.	23;23	A8MTZ6;Q96BU1	.;S1PBP_HUMAN	A	23	.	ENSP00000349117:P23A	P	+	1	0	S100PBP	33064354	0.158000	0.22850	0.860000	0.33809	0.102000	0.19082	-0.009000	0.12765	0.096000	0.17463	0.655000	0.94253	CCA	S100PBP	-	NULL		0.468	S100PBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S100PBP	HGNC	protein_coding	OTTHUMT00000011266.1	C	NM_022753		33291767	+1	no_errors	ENST00000373475	ensembl	human	known	70_37	missense	SNP	0.480	G
SAMM50	25813	genome.wustl.edu	37	22	44372002	44372002	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr22:44372002C>T	ENST00000350028.4	+	8	873	c.716C>T	c.(715-717)tCa>tTa	p.S239L	SAMM50_ENST00000396202.3_Missense_Mutation_p.S29L	NM_015380.4	NP_056195.3	Q9Y512	SAM50_HUMAN	SAMM50 sorting and assembly machinery component	239					cellular protein metabolic process (GO:0044267)|protein import into mitochondrial outer membrane (GO:0045040)|protein targeting to mitochondrion (GO:0006626)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrial sorting and assembly machinery complex (GO:0001401)|mitochondrion (GO:0005739)				endometrium(3)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)				GGCTGCCTCTCAAGGACGGCG	0.468																																																	0													107.0	96.0	100.0					22																	44372002		2203	4300	6503	SO:0001583	missense	25813			AK001087	CCDS14055.1	22q13.31	2013-08-21	2013-08-21	2005-11-20	ENSG00000100347	ENSG00000100347			24276	protein-coding gene	gene with protein product		612058	"""sorting and assembly machinery component 50 homolog (S. cerevisiae)"""			15644312	Standard	NM_015380		Approved	CGI-51, TRG-3, YNL026W, OMP85, TOB55	uc003bej.3	Q9Y512	OTTHUMG00000150557	ENST00000350028.4:c.716C>T	22.37:g.44372002C>T	ENSP00000345445:p.Ser239Leu		Q53HC4|Q56VW7|Q969Y9|Q96I46|Q9NW85|Q9UQM9	Missense_Mutation	SNP	pfam_Bac_surfAg_D15	p.S239L	ENST00000350028.4	37	c.716	CCDS14055.1	22	.	.	.	.	.	.	.	.	.	.	C	18.76	3.692809	0.68271	.	.	ENSG00000100347	ENST00000350028;ENST00000396202	T;T	0.40225	1.04;1.04	5.29	4.25	0.50352	Bacterial surface antigen (D15) (1);	0.229124	0.44688	D	0.000437	T	0.38904	0.1058	L	0.37561	1.115	0.39044	D	0.960187	B;B	0.20368	0.016;0.044	B;B	0.35813	0.062;0.211	T	0.29971	-0.9994	10	0.30854	T	0.27	-11.6848	12.8758	0.57989	0.1629:0.8371:0.0:0.0	.	44;239	B3KUE6;Q9Y512	.;SAM50_HUMAN	L	239;29	ENSP00000345445:S239L;ENSP00000379505:S29L	ENSP00000345445:S239L	S	+	2	0	SAMM50	42703335	0.999000	0.42202	0.010000	0.14722	0.909000	0.53808	5.434000	0.66526	1.329000	0.45376	0.555000	0.69702	TCA	SAMM50	-	pfam_Bac_surfAg_D15		0.468	SAMM50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMM50	HGNC	protein_coding	OTTHUMT00000318898.2	C	NM_015380		44372002	+1	no_errors	ENST00000350028	ensembl	human	known	70_37	missense	SNP	0.771	T
SCAI	286205	genome.wustl.edu	37	9	127765467	127765467	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr9:127765467C>G	ENST00000336505.6	-	11	1049	c.991G>C	c.(991-993)Gaa>Caa	p.E331Q	SCAI_ENST00000487795.1_5'UTR|SCAI_ENST00000373549.4_Missense_Mutation_p.E354Q	NM_001144877.2	NP_001138349.1	Q8N9R8	SCAI_HUMAN	suppressor of cancer cell invasion	331					negative regulation of cell migration (GO:0030336)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|prostate(5)|stomach(1)|urinary_tract(1)	35						TGGGGGTTTTCTCGTCTAGTA	0.363																																																	0													270.0	254.0	259.0					9																	127765467		1858	4102	5960	SO:0001583	missense	286205			AK093983	CCDS43877.1, CCDS48017.1	9q34.11	2009-11-06	2009-07-09	2009-07-09	ENSG00000173611	ENSG00000173611			26709	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 126"""	C9orf126			Standard	NM_173690		Approved	FLJ36664, NET40	uc004bpd.3	Q8N9R8	OTTHUMG00000020667	ENST00000336505.6:c.991G>C	9.37:g.127765467C>G	ENSP00000336756:p.Glu331Gln		Q3SXZ1|Q3SXZ2|Q5T163|Q8N1I4	Missense_Mutation	SNP	pfam_DUF3550,pirsf_UCP013022	p.E354Q	ENST00000336505.6	37	c.1060	CCDS48017.1	9	.	.	.	.	.	.	.	.	.	.	C	22.3	4.276725	0.80580	.	.	ENSG00000173611	ENST00000336505;ENST00000373549	T;T	0.45668	0.9;0.89	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.64875	0.2638	M	0.72894	2.215	0.58432	D	0.999995	D;D	0.67145	0.991;0.996	D;D	0.76575	0.988;0.986	T	0.58999	-0.7536	10	0.32370	T	0.25	-16.3426	19.1267	0.93388	0.0:1.0:0.0:0.0	.	331;354	Q8N9R8;Q8N9R8-2	SCAI_HUMAN;.	Q	331;354	ENSP00000336756:E331Q;ENSP00000362650:E354Q	ENSP00000336756:E331Q	E	-	1	0	SCAI	126805288	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.487000	0.81328	2.767000	0.95098	0.561000	0.74099	GAA	SCAI	-	pfam_DUF3550,pirsf_UCP013022		0.363	SCAI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAI	HGNC	protein_coding	OTTHUMT00000054055.3	C	NM_173690		127765467	-1	no_errors	ENST00000373549	ensembl	human	known	70_37	missense	SNP	1.000	G
SEC24D	9871	genome.wustl.edu	37	4	119653979	119653979	+	Nonsense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr4:119653979G>C	ENST00000280551.6	-	20	2823	c.2585C>G	c.(2584-2586)tCa>tGa	p.S862*	SEC24D_ENST00000429811.2_3'UTR|SEC24D_ENST00000511481.1_Nonsense_Mutation_p.S493*|SEC24D_ENST00000505134.1_5'UTR|SEC24D_ENST00000379735.5_Nonsense_Mutation_p.S863*			O94855	SC24D_HUMAN	SEC24 family member D	862					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37						TTCATCAGTTGAGATCTCTGG	0.438																																																	0													195.0	161.0	173.0					4																	119653979		2203	4300	6503	SO:0001587	stop_gained	9871			AB018298	CCDS3710.1	4q26	2013-10-21	2013-10-21		ENSG00000150961	ENSG00000150961			10706	protein-coding gene	gene with protein product		607186	"""SEC24 (S. cerevisiae) related gene family, member D"", ""SEC24 family, member D (S. cerevisiae)"""			9872452, 10075675	Standard	NM_014822		Approved	KIAA0755	uc003ici.4	O94855	OTTHUMG00000132957	ENST00000280551.6:c.2585C>G	4.37:g.119653979G>C	ENSP00000280551:p.Ser862*		Q8IYI7	Nonsense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom	p.S863*	ENST00000280551.6	37	c.2588	CCDS3710.1	4	.	.	.	.	.	.	.	.	.	.	G	43	10.513971	0.99419	.	.	ENSG00000150961	ENST00000280551;ENST00000379735;ENST00000511481	.	.	.	5.62	5.62	0.85841	.	0.188343	0.48767	D	0.000166	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-5.4101	19.6571	0.95847	0.0:0.0:1.0:0.0	.	.	.	.	X	862;863;493	.	ENSP00000280551:S862X	S	-	2	0	SEC24D	119873427	1.000000	0.71417	0.651000	0.29564	0.921000	0.55340	9.467000	0.97671	2.643000	0.89663	0.591000	0.81541	TCA	SEC24D	-	pfam_Sec23/24_helical_dom,superfamily_Sec23/24_helical_dom		0.438	SEC24D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SEC24D	HGNC	protein_coding	OTTHUMT00000256514.4	G			119653979	-1	no_errors	ENST00000379735	ensembl	human	known	70_37	nonsense	SNP	0.997	C
SERPINA4	5267	genome.wustl.edu	37	14	95030000	95030000	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr14:95030000C>T	ENST00000557004.1	+	2	602	c.181C>T	c.(181-183)Cgc>Tgc	p.R61C	SERPINA4_ENST00000555095.1_Missense_Mutation_p.R61C|SERPINA5_ENST00000553780.1_Intron|SERPINA4_ENST00000298841.5_Missense_Mutation_p.R61C			P29622	KAIN_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4	61					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(28)|ovary(3)|skin(1)|urinary_tract(1)	46				COAD - Colon adenocarcinoma(157;0.211)		CTTTGCCTTCCGCTTCTACTA	0.592																																																	0													84.0	77.0	80.0					14																	95030000		2203	4300	6503	SO:0001583	missense	5267			L19684	CCDS9927.1	14q32.13	2014-02-18	2005-08-18		ENSG00000100665	ENSG00000100665		"""Serine (or cysteine) peptidase inhibitors"""	8948	protein-coding gene	gene with protein product		147935	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4"""	PI4		8227002, 24172014	Standard	NM_001289032		Approved	KST, KAL, KLST, kallistatin	uc001ydk.3	P29622	OTTHUMG00000170859	ENST00000557004.1:c.181C>T	14.37:g.95030000C>T	ENSP00000450838:p.Arg61Cys		Q53XB5|Q86TR9|Q96BZ5	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.R61C	ENST00000557004.1	37	c.181	CCDS9927.1	14	.	.	.	.	.	.	.	.	.	.	C	15.47	2.843602	0.51164	.	.	ENSG00000100665	ENST00000557004;ENST00000555095;ENST00000298841	D;D;D	0.85411	-1.98;-1.98;-1.98	4.38	-2.21	0.06973	Serpin domain (3);	0.695493	0.11957	N	0.513120	D	0.88455	0.6441	M	0.69523	2.12	0.09310	N	1	D;D	0.76494	0.999;0.964	D;B	0.67725	0.953;0.397	T	0.78902	-0.2021	10	0.66056	D	0.02	.	6.7059	0.23250	0.5848:0.2538:0.0:0.1613	.	61;61	B2R815;P29622	.;KAIN_HUMAN	C	61	ENSP00000450838:R61C;ENSP00000451172:R61C;ENSP00000298841:R61C	ENSP00000298841:R61C	R	+	1	0	SERPINA4	94099753	0.000000	0.05858	0.001000	0.08648	0.137000	0.21094	-2.170000	0.01268	-0.283000	0.09115	0.563000	0.77884	CGC	SERPINA4	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.592	SERPINA4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SERPINA4	HGNC	protein_coding	OTTHUMT00000410718.1	C	NM_006215		95030000	+1	no_errors	ENST00000298841	ensembl	human	known	70_37	missense	SNP	0.002	T
SIPA1L2	57568	genome.wustl.edu	37	1	232534989	232534989	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:232534989C>T	ENST00000366630.1	-	22	5411	c.5053G>A	c.(5053-5055)Gaa>Aaa	p.E1685K	SIPA1L2_ENST00000262861.4_Missense_Mutation_p.E1685K|SIPA1L2_ENST00000308942.4_Missense_Mutation_p.E741K			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	1685					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				TGCTGCACTTCTGCTTGGAGA	0.498																																																	0													109.0	105.0	106.0					1																	232534989		2082	4235	6317	SO:0001583	missense	57568			AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.5053G>A	1.37:g.232534989C>T	ENSP00000355589:p.Glu1685Lys		Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	pfam_DUF3401,pfam_Rap_GAP,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP	p.E1685K	ENST00000366630.1	37	c.5053	CCDS41474.1	1	.	.	.	.	.	.	.	.	.	.	C	16.08	3.022396	0.54683	.	.	ENSG00000116991	ENST00000366630;ENST00000262861;ENST00000308942	D;D;T	0.84298	-1.83;-1.83;2.04	4.99	2.97	0.34412	.	0.061282	0.64402	D	0.000006	D	0.88731	0.6516	M	0.80982	2.52	0.43868	D	0.996471	P;D	0.55800	0.91;0.973	B;P	0.50405	0.294;0.64	D	0.90986	0.4831	10	0.87932	D	0	-29.7354	15.1121	0.72365	0.0:0.7328:0.2672:0.0	.	1685;741	Q9P2F8;Q9P2F8-2	SI1L2_HUMAN;.	K	1685;1685;741	ENSP00000355589:E1685K;ENSP00000262861:E1685K;ENSP00000309102:E741K	ENSP00000262861:E1685K	E	-	1	0	SIPA1L2	230601612	0.993000	0.37304	0.529000	0.27951	0.491000	0.33493	3.007000	0.49536	1.289000	0.44618	0.460000	0.39030	GAA	SIPA1L2	-	NULL		0.498	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIPA1L2	HGNC	protein_coding	OTTHUMT00000092318.1	C	XM_045839		232534989	-1	no_errors	ENST00000262861	ensembl	human	known	70_37	missense	SNP	0.913	T
SIRPD	128646	genome.wustl.edu	37	20	1532404	1532404	+	Silent	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr20:1532404C>T	ENST00000381623.3	-	2	1543	c.354G>A	c.(352-354)gtG>gtA	p.V118V	SIRPD_ENST00000381621.1_Silent_p.V118V			Q9H106	SIRPD_HUMAN	signal-regulatory protein delta	118	Ig-like V-type.					extracellular region (GO:0005576)				breast(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)	15						TTATGAACTTCACGCAGTAAT	0.493																																																	0													148.0	142.0	144.0					20																	1532404		2203	4300	6503	SO:0001819	synonymous_variant	128646			AL049634	CCDS13018.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000125900	ENSG00000125900		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16248	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type substrate 1-like 2"""	PTPNS1L2		16339511	Standard	NM_178460		Approved	dJ576H24.4	uc002wfi.3	Q9H106	OTTHUMG00000031674	ENST00000381623.3:c.354G>A	20.37:g.1532404C>T			B3KS88|Q5TFQ6	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.V118	ENST00000381623.3	37	c.354	CCDS13018.1	20																																																																																			SIRPD	-	pfam_Ig_V-set,smart_Ig_sub		0.493	SIRPD-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIRPD	HGNC	protein_coding	OTTHUMT00000077552.1	C	NM_178460		1532404	-1	no_errors	ENST00000381621	ensembl	human	known	70_37	silent	SNP	0.996	T
SLC26A6	65010	genome.wustl.edu	37	3	48663652	48663652	+	Splice_Site	SNP	G	G	A	rs374322645		TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr3:48663652G>A	ENST00000395550.2	-	20	2311	c.2264C>T	c.(2263-2265)tCg>tTg	p.S755L	SLC26A6_ENST00000383733.3_Splice_Site_p.S736L|SLC26A6_ENST00000337000.8_Splice_Site_p.S647L|SLC26A6_ENST00000420764.2_Splice_Site_p.S754L|SLC26A6_ENST00000455886.2_Splice_Site_p.S719L|SLC26A6_ENST00000358747.6_Splice_Site_p.S734L			Q9BXS9	S26A6_HUMAN	solute carrier family 26 (anion exchanger), member 6	755					angiotensin-activated signaling pathway (GO:0038166)|anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular response to cAMP (GO:0071320)|cellular response to fructose stimulus (GO:0071332)|cellular response to interferon-gamma (GO:0071346)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|epithelial fluid transport (GO:0042045)|formate transport (GO:0015724)|intestinal absorption (GO:0050892)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|mannitol transport (GO:0015797)|oxalate transport (GO:0019532)|oxalic acid secretion (GO:0046724)|positive regulation of dipeptide transmembrane transport (GO:2001150)|protein kinase C signaling (GO:0070528)|regulation of intracellular pH (GO:0051453)|sperm capacitation (GO:0048240)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transepithelial chloride transport (GO:0030321)|transepithelial transport (GO:0070633)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|chloride channel complex (GO:0034707)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)|vesicle membrane (GO:0012506)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|chloride transmembrane transporter activity (GO:0015108)|efflux transmembrane transporter activity (GO:0015562)|formate efflux transmembrane transporter activity (GO:0015660)|formate transmembrane transporter activity (GO:0015499)|formate uptake transmembrane transporter activity (GO:0015659)|oxalate transmembrane transporter activity (GO:0019531)|PDZ domain binding (GO:0030165)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)		SLC26A6/PRKAR2A(2)	NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00609)		TAGGCTCACCGAAACAGGGCT	0.562																																					NSCLC(13;369 479 28271 30152 44026)												0								G	LEU/SER,LEU/SER,LEU/SER,LEU/SER	1,3993		0,1,1996	70.0	78.0	76.0		2207,2261,2264,2201	-0.4	0.3	3		76	0,8334		0,0,4167	no	missense-near-splice,missense-near-splice,missense-near-splice,missense-near-splice	SLC26A6	NM_134426.2,NM_134263.2,NM_022911.2,NM_001040454.1	145,145,145,145	0,1,6163	AA,AG,GG		0.0,0.025,0.0081	benign,benign,benign,benign	736/741,754/759,755/760,734/739	48663652	1,12327	1997	4167	6164	SO:0001630	splice_region_variant	65010			AF279265	CCDS43087.1, CCDS46824.1, CCDS46825.1, CCDS46826.1, CCDS63627.1, CCDS63628.1	3p21.31	2013-08-05	2013-07-18		ENSG00000225697	ENSG00000225697		"""Solute carriers"""	14472	protein-coding gene	gene with protein product	"""pendrin-like protein 1"", ""pendrin L1"", ""sulfate anion transporter"", ""anion transporter 1"""	610068	"""solute carrier family 26, member 6"""			11087667, 11247665	Standard	NM_022911		Approved	DKFZp586E1422		Q9BXS9	OTTHUMG00000186381	ENST00000395550.2:c.2265+1C>T	3.37:g.48663652G>A			B4DMZ1|Q548A7|Q96Q90|Q9NQU1	Missense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.S755L	ENST00000395550.2	37	c.2264	CCDS43087.1	3	.	.	.	.	.	.	.	.	.	.	G	11.01	1.514583	0.27123	2.5E-4	0.0	ENSG00000225697	ENST00000420764;ENST00000395550;ENST00000383733;ENST00000337000;ENST00000447978;ENST00000358747;ENST00000455886	D;D;D;D;D;D	0.91894	-2.8;-2.8;-2.93;-2.8;-2.8;-2.92	5.74	-0.438	0.12268	.	.	.	.	.	T	0.78194	0.4245	N	0.01668	-0.77	0.09310	N	1	B;B;B;B;B;B;B	0.15473	0.007;0.0;0.013;0.001;0.001;0.001;0.0	B;B;B;B;B;B;B	0.10450	0.002;0.0;0.005;0.0;0.0;0.001;0.0	T	0.65421	-0.6172	9	0.39692	T	0.17	.	11.8204	0.52235	0.5234:0.0:0.4766:0.0	.	719;749;647;736;754;755;4141	B4DMZ1;Q86YZ4;G3XAC1;Q9BXS9-2;Q548A7;Q9BXS9;Q5Y190	.;.;.;.;.;S26A6_HUMAN;.	L	754;755;736;647;749;734;719	ENSP00000404684:S754L;ENSP00000378920:S755L;ENSP00000373239:S736L;ENSP00000337648:S647L;ENSP00000351597:S734L;ENSP00000401066:S719L	ENSP00000337648:S647L	S	-	2	0	SLC26A6	48638656	0.000000	0.05858	0.276000	0.24689	0.687000	0.40016	0.068000	0.14531	-0.075000	0.12798	-0.469000	0.05056	TCG	SLC26A6	-	NULL		0.562	SLC26A6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC26A6	HGNC	protein_coding	OTTHUMT00000345040.1	G	NM_022911	Missense_Mutation	48663652	-1	no_errors	ENST00000395550	ensembl	human	known	70_37	missense	SNP	0.001	A
SLC38A5	92745	genome.wustl.edu	37	X	48324406	48324406	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chrX:48324406C>T	ENST00000376876.3	-	7	1330	c.487G>A	c.(487-489)Gag>Aag	p.E163K	SLC38A5_ENST00000317669.5_Missense_Mutation_p.E163K|SLC38A5_ENST00000376875.1_Missense_Mutation_p.E112K			Q8WUX1	S38A5_HUMAN	solute carrier family 38, member 5	163					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)			breast(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(3)|skin(1)	19						ACTCACCCCTCGGGGTCCATG	0.592											OREG0019763	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													76.0	53.0	61.0					X																	48324406		2202	4299	6501	SO:0001583	missense	92745			AF276889	CCDS14293.1	Xp11.23	2013-05-22			ENSG00000017483	ENSG00000017483		"""Solute carriers"""	18070	protein-coding gene	gene with protein product		300649				11243884	Standard	NM_033518		Approved	SN2, JM24	uc010nid.3	Q8WUX1	OTTHUMG00000024117	ENST00000376876.3:c.487G>A	X.37:g.48324406C>T	ENSP00000366073:p.Glu163Lys	953	B3KT20|B5MDE6|B7WPJ9|Q6PIW9|Q8WYU2|Q96PQ4	Missense_Mutation	SNP	pfam_AA_transpt_TM	p.E163K	ENST00000376876.3	37	c.487	CCDS14293.1	X	.	.	.	.	.	.	.	.	.	.	c	9.658	1.143454	0.21205	.	.	ENSG00000017483	ENST00000376876;ENST00000376875;ENST00000317669;ENST00000440085;ENST00000441948;ENST00000413668;ENST00000416711;ENST00000429543	T;T;T;T;T;T;T;T	0.49432	3.09;3.09;3.09;1.5;1.51;1.48;1.48;0.78	4.55	-0.883	0.10600	.	1.236970	0.05672	N	0.588793	T	0.22742	0.0549	N	0.11427	0.14	0.09310	N	1	B	0.18013	0.025	B	0.14023	0.01	T	0.14727	-1.0462	10	0.13108	T	0.6	.	2.6844	0.05103	0.3538:0.3262:0.0:0.3199	.	163	Q8WUX1	S38A5_HUMAN	K	163;112;163;163;163;163;163;163	ENSP00000366073:E163K;ENSP00000366071:E112K;ENSP00000313740:E163K;ENSP00000402988:E163K;ENSP00000407258:E163K;ENSP00000403976:E163K;ENSP00000389644:E163K;ENSP00000416948:E163K	ENSP00000313740:E163K	E	-	1	0	SLC38A5	48209350	0.000000	0.05858	0.005000	0.12908	0.276000	0.26787	-0.067000	0.11579	0.007000	0.14760	0.436000	0.28706	GAG	SLC38A5	-	pfam_AA_transpt_TM		0.592	SLC38A5-011	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC38A5	HGNC	protein_coding	OTTHUMT00000060724.1	C	NM_033518		48324406	-1	no_errors	ENST00000317669	ensembl	human	known	70_37	missense	SNP	0.000	T
SLC4A11	83959	genome.wustl.edu	37	20	3211114	3211114	+	Intron	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr20:3211114G>A	ENST00000380056.3	-	11	1511				SLC4A11_ENST00000380059.3_Intron|SLC4A11_ENST00000539553.2_Intron|SLC4A11_ENST00000488544.1_5'Flank	NM_032034.3	NP_114423.1	Q8NBS3	S4A11_HUMAN	solute carrier family 4, sodium borate transporter, member 11						bicarbonate transport (GO:0015701)|borate transmembrane transport (GO:0035445)|borate transport (GO:0046713)|cellular cation homeostasis (GO:0030003)|fluid transport (GO:0042044)|proton transport (GO:0015992)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	bicarbonate transmembrane transporter activity (GO:0015106)|borate transmembrane transporter activity (GO:0046715)|hydrogen ion channel activity (GO:0015252)|inorganic anion exchanger activity (GO:0005452)|protein dimerization activity (GO:0046983)|sodium channel activity (GO:0005272)|symporter activity (GO:0015293)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(4)|soft_tissue(1)|urinary_tract(1)	40						GGCTGAACCAGATCCCAAGCC	0.632																																					NSCLC(190;922 2139 10266 10292 38692)												0													51.0	54.0	53.0					20																	3211114		2203	4300	6503	SO:0001627	intron_variant	83959			AF336127	CCDS13052.1, CCDS54445.1, CCDS54446.1	20p13	2014-02-14	2007-08-03		ENSG00000088836	ENSG00000088836		"""Solute carriers"""	16438	protein-coding gene	gene with protein product		610206	"""corneal endothelial dystrophy 2 (autosomal recessive)"", ""solute carrier family 4, sodium bicarbonate transporter-like, member 11"", ""corneal dystrophy and perceptive deafness 1"""	CHED2, CDPD1		10843999, 11302728, 16767101	Standard	NM_001174089		Approved	dJ794I6.2, BTR1, NaBC1, FECD4	uc010zqe.2	Q8NBS3	OTTHUMG00000031740	ENST00000380056.3:c.1463+46C>T	20.37:g.3211114G>A			B4DKC8|B4DKX9|G3V1M3|Q2TB62|Q2TB63|Q9BXF4|Q9NTW9	RNA	SNP	-	NULL	ENST00000380056.3	37	NULL	CCDS13052.1	20																																																																																			SLC4A11	-	-		0.632	SLC4A11-002	KNOWN	basic|CCDS	protein_coding	SLC4A11	HGNC	protein_coding	OTTHUMT00000077728.1	G			3211114	-1	no_errors	ENST00000470631	ensembl	human	known	70_37	rna	SNP	0.000	A
SLC6A9	6536	genome.wustl.edu	37	1	44466890	44466890	+	Silent	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:44466890C>G	ENST00000360584.2	-	10	1691	c.1500G>C	c.(1498-1500)gtG>gtC	p.V500V	SLC6A9_ENST00000475075.2_Silent_p.V316V|SLC6A9_ENST00000372306.3_Silent_p.V427V|SLC6A9_ENST00000357730.2_Silent_p.V446V|SLC6A9_ENST00000372310.3_Silent_p.V427V|SLC6A9_ENST00000537678.1_Silent_p.V362V|SLC6A9_ENST00000372307.3_Silent_p.V362V	NM_201649.3	NP_964012.2	P48067	SC6A9_HUMAN	solute carrier family 6 (neurotransmitter transporter, glycine), member 9	500					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)			endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(2)	22	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)			Glycine(DB00145)	CGCCCAAGGTCACATAGGTCT	0.597																																																	0													143.0	136.0	138.0					1																	44466890		2203	4300	6503	SO:0001819	synonymous_variant	6536			S70609	CCDS30695.1, CCDS41316.1, CCDS41317.1	1p33	2013-05-22			ENSG00000196517	ENSG00000196517		"""Solute carriers"""	11056	protein-coding gene	gene with protein product		601019				8183239, 7587377	Standard	NM_006934		Approved	GLYT1	uc001cll.4	P48067	OTTHUMG00000008294	ENST00000360584.2:c.1500G>C	1.37:g.44466890C>G			A6NDH1|A6NII2|A6NNZ8|Q5TAB8|Q5TAB9|Q5TAC0	Silent	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_glycine_GLY1	p.V500	ENST00000360584.2	37	c.1500	CCDS41317.1	1																																																																																			SLC6A9	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport		0.597	SLC6A9-001	KNOWN	basic|CCDS	protein_coding	SLC6A9	HGNC	protein_coding	OTTHUMT00000022825.2	C	NM_201649		44466890	-1	no_errors	ENST00000360584	ensembl	human	known	70_37	silent	SNP	1.000	G
SLC7A8	23428	genome.wustl.edu	37	14	23624564	23624564	+	Intron	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr14:23624564C>T	ENST00000316902.7	-	3	1234				RNU6-1138P_ENST00000365359.1_RNA|SLC7A8_ENST00000469263.1_Intron|SLC7A8_ENST00000529705.2_Missense_Mutation_p.G2R|SLC7A8_ENST00000453702.1_5'Flank|SLC7A8_ENST00000422941.2_5'Flank	NM_012244.3	NP_036376.2	Q9UHI5	LAT2_HUMAN	solute carrier family 7 (amino acid transporter light chain, L system), member 8						amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|metal ion homeostasis (GO:0055065)|neutral amino acid transport (GO:0015804)|organic cation transport (GO:0015695)|response to toxic substance (GO:0009636)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-amino acid transmembrane transporter activity (GO:0015179)|neutral amino acid transmembrane transporter activity (GO:0015175)|organic cation transmembrane transporter activity (GO:0015101)|peptide antigen binding (GO:0042605)|toxin transporter activity (GO:0019534)			autonomic_ganglia(1)|endometrium(6)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|skin(1)	24	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00809)	L-Alanine(DB00160)|L-DOPA(DB01235)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	CCATACTGCCCCATCccctcc	0.582																																																	0																																										SO:0001627	intron_variant	23428			Y18483	CCDS9590.1, CCDS41924.1, CCDS58304.1, CCDS58305.1	14q11.2	2013-05-22	2011-07-12		ENSG00000092068	ENSG00000092068		"""Solute carriers"""	11066	protein-coding gene	gene with protein product		604235				10080183, 10391915	Standard	NM_001267036		Approved	LPI-PC1, LAT2	uc001wiz.4	Q9UHI5	OTTHUMG00000028720	ENST00000316902.7:c.508+9929G>A	14.37:g.23624564C>T			B2R8Q4|B4DKT4|B4DTV6|D3DS46|F2Z2J4|Q86U05|Q9UKQ6|Q9UKQ7|Q9UKQ8|Q9Y445	Missense_Mutation	SNP	pfam_AA-permease_dom,pirsf_AA/rel_permease1	p.G2R	ENST00000316902.7	37	c.4	CCDS9590.1	14	.	.	.	.	.	.	.	.	.	.	C	12.90	2.076561	0.36662	.	.	ENSG00000092068	ENST00000529705	D	0.90732	-2.72	5.4	2.58	0.30949	.	.	.	.	.	T	0.81346	0.4803	.	.	.	0.09310	N	0.999997	B	0.09022	0.002	B	0.04013	0.001	T	0.65882	-0.6060	7	.	.	.	.	6.8793	0.24164	0.0:0.7189:0.0:0.2811	.	2	B4DKT4	.	R	2	ENSP00000434345:G2R	.	G	-	1	0	SLC7A8	22694404	0.003000	0.15002	0.004000	0.12327	0.002000	0.02628	0.746000	0.26275	0.771000	0.33359	-0.218000	0.12543	GGG	SLC7A8	-	NULL		0.582	SLC7A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A8	HGNC	protein_coding	OTTHUMT00000071718.3	C			23624564	-1	no_errors	ENST00000529705	ensembl	human	putative	70_37	missense	SNP	0.002	T
SMC4	10051	genome.wustl.edu	37	3	160117444	160117444	+	5'UTR	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr3:160117444G>C	ENST00000357388.3	+	0	353				SMC4_ENST00000469762.1_5'UTR|SMC4_ENST00000344722.5_5'Flank|SMC4_ENST00000360111.2_5'UTR|RP11-432B6.3_ENST00000483754.1_Intron|IFT80_ENST00000326448.7_5'Flank|IFT80_ENST00000496589.1_5'Flank|IFT80_ENST00000477495.1_5'Flank|SMC4_ENST00000462787.1_5'Flank	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4						kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			CGCCATTTTCGAGTGAAGGAC	0.498																																																	0																																										SO:0001623	5_prime_UTR_variant	10051			AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.-99G>C	3.37:g.160117444G>C			A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	RNA	SNP	-	NULL	ENST00000357388.3	37	NULL	CCDS3189.1	3																																																																																			SMC4	-	-		0.498	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC4	HGNC	protein_coding	OTTHUMT00000352862.1	G			160117444	+1	no_errors	ENST00000472282	ensembl	human	known	70_37	rna	SNP	1.000	C
SOCS2	8835	genome.wustl.edu	37	12	93968591	93968591	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr12:93968591C>T	ENST00000340600.2	+	3	831	c.233C>T	c.(232-234)tCa>tTa	p.S78L	SOCS2_ENST00000551556.1_Missense_Mutation_p.S78L|SOCS2_ENST00000536696.2_Missense_Mutation_p.S78L|SOCS2_ENST00000549206.1_Missense_Mutation_p.S78L|SOCS2_ENST00000548537.1_3'UTR|SOCS2_ENST00000549122.1_Missense_Mutation_p.S78L	NM_001270468.1|NM_001270469.1|NM_001270471.1|NM_003877.4	NP_001257397.1|NP_001257398.1|NP_001257400.1|NP_003868.1	O14508	SOCS2_HUMAN	suppressor of cytokine signaling 2	78	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cellular response to hormone stimulus (GO:0032870)|growth hormone receptor signaling pathway (GO:0060396)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of signal transduction (GO:0009967)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of signal transduction (GO:0009966)|response to estradiol (GO:0032355)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	growth hormone receptor binding (GO:0005131)|insulin-like growth factor receptor binding (GO:0005159)|JAK pathway signal transduction adaptor activity (GO:0008269)|SH3/SH2 adaptor activity (GO:0005070)			cervix(1)|endometrium(3)|large_intestine(3)|lung(6)|ovary(1)	14						AGCTCGCATTCAGACTACCTA	0.393																																																	0													77.0	75.0	75.0					12																	93968591		2203	4300	6503	SO:0001583	missense	8835			AF037989	CCDS9047.1	12q	2013-02-14			ENSG00000120833	ENSG00000120833		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19382	protein-coding gene	gene with protein product	"""STAT-induced STAT inhibitor-2"""	605117				9344848, 9266833	Standard	NM_003877		Approved	STATI2, SSI2, SOCS-2, SSI-2, CIS2, Cish2	uc031qjc.1	O14508		ENST00000340600.2:c.233C>T	12.37:g.93968591C>T	ENSP00000339428:p.Ser78Leu		A8K3D1|O14542|O95102|Q9UKS5	Missense_Mutation	SNP	pfam_SOCS_C,pfam_SH2,smart_SH2,smart_SOCS_C,pfscan_SOCS_C,pfscan_SH2,prints_SH2	p.S78L	ENST00000340600.2	37	c.233	CCDS9047.1	12	.	.	.	.	.	.	.	.	.	.	C	21.7	4.181208	0.78677	.	.	ENSG00000120833	ENST00000340600;ENST00000549206;ENST00000536696;ENST00000539385;ENST00000548091;ENST00000549122;ENST00000549887;ENST00000551556	D;D;D;D;D;D;D	0.89050	-2.46;-2.46;-2.46;-2.46;-2.46;-2.46;-2.46	5.84	5.84	0.93424	SH2 motif (4);	0.117107	0.56097	D	0.000027	D	0.89663	0.6780	M	0.70108	2.13	0.41044	D	0.985259	P	0.38992	0.653	B	0.38327	0.271	D	0.89744	0.3935	10	0.54805	T	0.06	-0.5511	20.1346	0.98019	0.0:1.0:0.0:0.0	.	78	O14508	SOCS2_HUMAN	L	78;78;78;26;78;78;78;78	ENSP00000339428:S78L;ENSP00000448815:S78L;ENSP00000442898:S78L;ENSP00000447902:S78L;ENSP00000447161:S78L;ENSP00000448611:S78L;ENSP00000449227:S78L	ENSP00000339428:S78L	S	+	2	0	SOCS2	92492722	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.784000	0.62411	2.765000	0.95021	0.655000	0.94253	TCA	SOCS2	-	pfam_SH2,smart_SH2,pfscan_SH2		0.393	SOCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOCS2	HGNC	protein_coding	OTTHUMT00000407731.2	C			93968591	+1	no_errors	ENST00000340600	ensembl	human	known	70_37	missense	SNP	1.000	T
SPATA6	54558	genome.wustl.edu	37	1	48918758	48918758	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:48918758G>A	ENST00000371847.3	-	2	261	c.97C>T	c.(97-99)Ctt>Ttt	p.L33F	SPATA6_ENST00000371843.3_Missense_Mutation_p.L33F|SPATA6_ENST00000396199.3_5'UTR|SPATA6_ENST00000463938.1_5'UTR	NM_019073.2	NP_061946.1	Q9NWH7	SPAT6_HUMAN	spermatogenesis associated 6	33					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|large_intestine(6)|lung(7)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	21						CAGATGCTAAGATAGATGTCC	0.403																																																	0													152.0	142.0	145.0					1																	48918758		2203	4300	6503	SO:0001583	missense	54558			AK000869	CCDS551.1, CCDS65535.1, CCDS72787.1	1p32.3	2012-03-15			ENSG00000132122	ENSG00000132122			18309	protein-coding gene	gene with protein product	"""spermatogenesis-related factor-1"""	613947					Standard	XM_005270948		Approved	SRF1, FLJ10007, SRF-1	uc001crr.2	Q9NWH7	OTTHUMG00000007794	ENST00000371847.3:c.97C>T	1.37:g.48918758G>A	ENSP00000360913:p.Leu33Phe		Q5T3N7|Q8WUE6	Missense_Mutation	SNP	NULL	p.L33F	ENST00000371847.3	37	c.97	CCDS551.1	1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.362334	0.82353	.	.	ENSG00000132122	ENST00000371847;ENST00000371843	T;T	0.31769	1.48;1.48	5.12	5.12	0.69794	.	0.000000	0.64402	D	0.000005	T	0.54631	0.1870	M	0.68952	2.095	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	T	0.57648	-0.7775	10	0.72032	D	0.01	.	16.0466	0.80724	0.0:0.0:1.0:0.0	.	33;33	Q9NWH7-2;Q9NWH7	.;SPAT6_HUMAN	F	33	ENSP00000360913:L33F;ENSP00000360909:L33F	ENSP00000360909:L33F	L	-	1	0	SPATA6	48691345	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.624000	0.54231	2.407000	0.81776	0.555000	0.69702	CTT	SPATA6	-	NULL		0.403	SPATA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA6	HGNC	protein_coding	OTTHUMT00000021347.1	G	NM_019073		48918758	-1	no_errors	ENST00000371847	ensembl	human	known	70_37	missense	SNP	1.000	A
SORT1	6272	genome.wustl.edu	37	1	109870156	109870156	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:109870156G>A	ENST00000256637.6	-	12	1497	c.1439C>T	c.(1438-1440)tCa>tTa	p.S480L	SORT1_ENST00000538502.1_Missense_Mutation_p.S343L	NM_002959.5	NP_002950.3	Q99523	SORT_HUMAN	sortilin 1	480					endocytosis (GO:0006897)|endosome to lysosome transport (GO:0008333)|endosome transport via multivesicular body sorting pathway (GO:0032509)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose import (GO:0046323)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|myotube differentiation (GO:0014902)|negative regulation of lipoprotein lipase activity (GO:0051005)|nerve growth factor signaling pathway (GO:0038180)|neuropeptide signaling pathway (GO:0007218)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|plasma membrane to endosome transport (GO:0048227)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|vesicle organization (GO:0016050)	cell surface (GO:0009986)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	enzyme binding (GO:0019899)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotensin receptor activity, non-G-protein coupled (GO:0030379)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		ATTCGGCTCTGAGAGTGGGGC	0.488																																																	0													95.0	86.0	89.0					1																	109870156		2203	4300	6503	SO:0001583	missense	6272			BC023542	CCDS798.1, CCDS55618.1	1p13.3	2008-05-14			ENSG00000134243	ENSG00000134243			11186	protein-coding gene	gene with protein product		602458					Standard	NM_002959		Approved	Gp95, NT3	uc001dxm.2	Q99523	OTTHUMG00000011999	ENST00000256637.6:c.1439C>T	1.37:g.109870156G>A	ENSP00000256637:p.Ser480Leu		B4DWI3|C0JYZ0|Q8IZ49	Missense_Mutation	SNP	pfam_BNR_rpt,smart_VPS10	p.S480L	ENST00000256637.6	37	c.1439	CCDS798.1	1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.361525	0.82353	.	.	ENSG00000134243	ENST00000256637;ENST00000538502	T;T	0.39056	1.1;1.1	5.62	5.62	0.85841	VPS10 (1);	0.208574	0.40908	D	0.000989	T	0.63977	0.2557	M	0.83774	2.66	0.45914	D	0.998757	D;D	0.89917	1.0;1.0	D;D	0.79108	0.989;0.992	T	0.68723	-0.5333	10	0.87932	D	0	-4.314	18.4615	0.90739	0.0:0.0:1.0:0.0	.	343;480	B4DWI3;Q99523	.;SORT_HUMAN	L	480;343	ENSP00000256637:S480L;ENSP00000438597:S343L	ENSP00000256637:S480L	S	-	2	0	SORT1	109671679	1.000000	0.71417	0.963000	0.40424	0.795000	0.44927	5.796000	0.69080	2.648000	0.89879	0.650000	0.86243	TCA	SORT1	-	smart_VPS10		0.488	SORT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORT1	HGNC	protein_coding	OTTHUMT00000033179.1	G	NM_002959		109870156	-1	no_errors	ENST00000256637	ensembl	human	known	70_37	missense	SNP	0.943	A
SPTB	6710	genome.wustl.edu	37	14	65242109	65242109	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr14:65242109C>G	ENST00000389721.5	-	22	4608	c.4576G>C	c.(4576-4578)Gag>Cag	p.E1526Q	SPTB_ENST00000389722.3_Missense_Mutation_p.E1526Q|SPTB_ENST00000556626.1_Missense_Mutation_p.E1526Q|SPTB_ENST00000389720.3_Missense_Mutation_p.E1526Q|SPTB_ENST00000542895.1_Missense_Mutation_p.E1526Q	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1526					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		CCCAGAATCTCATTCTGCAGT	0.652																																																	0													31.0	30.0	30.0					14																	65242109		2203	4300	6503	SO:0001583	missense	6710				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.4576G>C	14.37:g.65242109C>G	ENSP00000374371:p.Glu1526Gln		Q15510|Q15519	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Pleckstrin_homology,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.E1526Q	ENST00000389721.5	37	c.4576	CCDS32100.1	14	.	.	.	.	.	.	.	.	.	.	C	21.0	4.075972	0.76415	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000335612;ENST00000553938;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T;T	0.57595	0.39;0.39;0.39;0.39;0.39;0.39	5.05	5.05	0.67936	.	0.113709	0.64402	D	0.000015	T	0.78929	0.4361	M	0.91872	3.25	0.80722	D	1	D;D;D	0.89917	1.0;0.997;1.0	D;D;D	0.83275	0.996;0.991;0.996	D	0.84213	0.0457	10	0.87932	D	0	.	17.5392	0.87842	0.0:1.0:0.0:0.0	.	310;1526;1530	E7EV95;P11277;Q59FP5	.;SPTB1_HUMAN;.	Q	1530;1526;310;191;1526;1526;1526;1526	ENSP00000374372:E1526Q;ENSP00000451324:E191Q;ENSP00000451752:E1526Q;ENSP00000374371:E1526Q;ENSP00000443882:E1526Q;ENSP00000374370:E1526Q	ENSP00000334218:E310Q	E	-	1	0	SPTB	64311862	1.000000	0.71417	0.964000	0.40570	0.425000	0.31504	7.799000	0.85936	2.491000	0.84063	0.555000	0.69702	GAG	SPTB	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.652	SPTB-004	KNOWN	basic|CCDS	protein_coding	SPTB	HGNC	protein_coding	OTTHUMT00000414080.1	C			65242109	-1	no_errors	ENST00000389722	ensembl	human	known	70_37	missense	SNP	1.000	G
ACTA2	59	genome.wustl.edu	37	10	90733069	90733069	+	Intron	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr10:90733069G>C	ENST00000458208.1	-	1	452				STAMBPL1_ENST00000371927.3_Nonstop_Mutation_p.*462S	NM_001141945.1	NP_001135417.1	P62736	ACTA_HUMAN	actin, alpha 2, smooth muscle, aorta						glomerular mesangial cell development (GO:0072144)|muscle contraction (GO:0006936)|regulation of blood pressure (GO:0008217)|response to virus (GO:0009615)|vascular smooth muscle contraction (GO:0014829)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|smooth muscle contractile fiber (GO:0030485)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(1)|urinary_tract(2)	17		Colorectal(252;0.0161)		Colorectal(12;0.000123)|COAD - Colon adenocarcinoma(12;0.00018)		GAACAGCTCTGAGAGAGACAA	0.453																																																	0													69.0	65.0	66.0					10																	90733069		876	1991	2867	SO:0001627	intron_variant	57559			X13839	CCDS7392.1	10q23.31	2014-09-17			ENSG00000107796	ENSG00000107796			130	protein-coding gene	gene with protein product		102620				2398629	Standard	NM_001141945		Approved	ACTSA	uc001kfp.3	P62736	OTTHUMG00000018700	ENST00000458208.1:c.22+17626C>G	10.37:g.90733069G>C			B2R8A4|P03996|P04108|Q6FI19	Nonstop_Mutation	SNP	pfam_JAB1_Mov34_MPN_PAD1,smart_JAB1_Mov34_MPN_PAD1	p.*462S	ENST00000458208.1	37	c.1385	CCDS7392.1	10	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.633864	0.00806	.	.	ENSG00000138134	ENST00000371927	.	.	.	3.23	-4.66	0.03329	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.411	0.16349	0.2658:0.5004:0.2338:0.0	.	.	.	.	S	462	.	.	X	+	2	2	STAMBPL1	90723049	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	0.184000	0.16939	-0.970000	0.03569	-1.437000	0.01076	TGA	STAMBPL1	-	NULL		0.453	ACTA2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	STAMBPL1	HGNC	protein_coding	OTTHUMT00000049264.1	G	NM_001613		90733069	+1	no_errors	ENST00000371927	ensembl	human	known	70_37	nonstop	SNP	0.001	C
STK38	11329	genome.wustl.edu	37	6	36483145	36483145	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr6:36483145G>C	ENST00000229812.7	-	7	924	c.639C>G	c.(637-639)atC>atG	p.I213M		NM_007271.2	NP_009202.1			serine/threonine kinase 38											NS(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TGTCTGGTTTGATGTCTCTGT	0.433																																					Colon(180;997 3561 16158)												0													242.0	205.0	218.0					6																	36483145		2203	4300	6503	SO:0001583	missense	11329				CCDS4822.1	6p21	2006-10-06			ENSG00000112079	ENSG00000112079			17847	protein-coding gene	gene with protein product		606964				7761441	Standard	NM_007271		Approved	NDR	uc003omh.3	Q15208	OTTHUMG00000014598	ENST00000229812.7:c.639C>G	6.37:g.36483145G>C	ENSP00000229812:p.Ile213Met			Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_cat_dom	p.I213M	ENST00000229812.7	37	c.639	CCDS4822.1	6	.	.	.	.	.	.	.	.	.	.	G	19.46	3.832040	0.71258	.	.	ENSG00000112079	ENST00000229812	T	0.53640	0.61	5.78	4.9	0.64082	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.56949	0.2020	M	0.78637	2.42	0.80722	D	1	D	0.67145	0.996	D	0.74023	0.982	T	0.64689	-0.6348	10	0.87932	D	0	.	8.8842	0.35394	0.0681:0.0:0.6641:0.2678	.	213	Q15208	STK38_HUMAN	M	213	ENSP00000229812:I213M	ENSP00000229812:I213M	I	-	3	3	STK38	36591123	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.438000	0.52871	1.415000	0.47037	0.655000	0.94253	ATC	STK38	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.433	STK38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK38	HGNC	protein_coding	OTTHUMT00000040346.1	G	NM_007271		36483145	-1	no_errors	ENST00000229812	ensembl	human	known	70_37	missense	SNP	1.000	C
STXBP2	6813	genome.wustl.edu	37	19	7709550	7709550	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr19:7709550G>A	ENST00000221283.5	+	14	1189	c.1158G>A	c.(1156-1158)atG>atA	p.M386I	STXBP2_ENST00000602355.1_5'Flank|STXBP2_ENST00000414284.2_Missense_Mutation_p.M383I|STXBP2_ENST00000441779.2_Missense_Mutation_p.M397I	NM_006949.2	NP_008880.2	Q15833	STXB2_HUMAN	syntaxin binding protein 2	386					leukocyte mediated cytotoxicity (GO:0001909)|neutrophil degranulation (GO:0043312)|protein transport (GO:0015031)|regulation of mast cell degranulation (GO:0043304)|vesicle docking involved in exocytosis (GO:0006904)	azurophil granule (GO:0042582)|cytolytic granule (GO:0044194)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin-3 binding (GO:0030348)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	23						AGGACTCCATGAAGCTGATCG	0.657																																																	0													73.0	52.0	59.0					19																	7709550		2203	4300	6503	SO:0001583	missense	6813			U63533	CCDS12181.1, CCDS45948.1, CCDS62522.1	19p13.3-p13.2	2014-09-17				ENSG00000076944			11445	protein-coding gene	gene with protein product		601717				8921365	Standard	NM_001127396		Approved	UNC18B, Hunc18b	uc010xjr.3	Q15833		ENST00000221283.5:c.1158G>A	19.37:g.7709550G>A	ENSP00000221283:p.Met386Ile		B4E175|E7EQD5|Q9BU65	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.M386I	ENST00000221283.5	37	c.1158	CCDS12181.1	19	.	.	.	.	.	.	.	.	.	.	G	20.2	3.949457	0.73787	.	.	ENSG00000076944	ENST00000221283;ENST00000414284;ENST00000441779;ENST00000543902	T;T;T	0.78924	-1.22;-1.22;-1.22	4.02	4.02	0.46733	.	0.098718	0.64402	D	0.000003	T	0.77572	0.4150	L	0.38838	1.175	0.80722	D	1	P;P;B;P;P	0.50443	0.935;0.935;0.012;0.92;0.935	P;P;B;P;P	0.53760	0.734;0.734;0.03;0.615;0.734	T	0.79780	-0.1659	10	0.56958	D	0.05	-11.222	13.6988	0.62595	0.0:0.0:1.0:0.0	.	397;397;352;383;386	E7EQD5;B4E175;B4DY46;Q15833-2;Q15833	.;.;.;.;STXB2_HUMAN	I	386;383;397;386	ENSP00000221283:M386I;ENSP00000409471:M383I;ENSP00000413606:M397I	ENSP00000221283:M386I	M	+	3	0	STXBP2	7615550	1.000000	0.71417	1.000000	0.80357	0.637000	0.38172	9.569000	0.98170	2.088000	0.63022	0.591000	0.81541	ATG	STXBP2	-	pfam_Sec1-like,superfamily_Sec1-like		0.657	STXBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STXBP2	HGNC	protein_coding	OTTHUMT00000460963.1	G	NM_006949		7709550	+1	no_errors	ENST00000221283	ensembl	human	known	70_37	missense	SNP	1.000	A
SYNE2	23224	genome.wustl.edu	37	14	64468776	64468776	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr14:64468776G>C	ENST00000344113.4	+	29	3975	c.3763G>C	c.(3763-3765)Gat>Cat	p.D1255H	SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000358025.3_Missense_Mutation_p.D1255H|SYNE2_ENST00000554584.1_Missense_Mutation_p.D1255H	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	1255					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CATTGATGCTGATCGCATCTA	0.403																																																	0													133.0	128.0	129.0					14																	64468776		1904	4113	6017	SO:0001583	missense	23224			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.3763G>C	14.37:g.64468776G>C	ENSP00000341781:p.Asp1255His		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.D1255H	ENST00000344113.4	37	c.3763	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	G	12.02	1.812223	0.32053	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.60672	0.55;0.55;0.17	5.41	5.41	0.78517	.	0.000000	0.56097	D	0.000023	T	0.65344	0.2682	L	0.55481	1.735	0.80722	D	1	D;D	0.76494	0.998;0.999	P;D	0.63192	0.819;0.912	T	0.62445	-0.6853	10	0.33940	T	0.23	.	9.098	0.36651	0.1292:0.0:0.8708:0.0	.	1255;1255	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	H	1255	ENSP00000350719:D1255H;ENSP00000341781:D1255H;ENSP00000452570:D1255H	ENSP00000261678:D1255H	D	+	1	0	SYNE2	63538529	0.870000	0.30015	0.627000	0.29227	0.481000	0.33189	1.892000	0.39748	2.709000	0.92574	0.655000	0.94253	GAT	SYNE2	-	NULL		0.403	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	G	NM_182914		64468776	+1	no_errors	ENST00000358025	ensembl	human	known	70_37	missense	SNP	0.636	C
TARBP1	6894	genome.wustl.edu	37	1	234527332	234527332	+	Silent	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:234527332G>C	ENST00000040877.1	-	30	4856	c.4857C>G	c.(4855-4857)acC>acG	p.T1619T	TARBP1_ENST00000483404.1_5'UTR	NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	1619					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			ATCATGGCTTGGTATCTCCGT	0.458																																																	0													54.0	47.0	49.0					1																	234527332		2203	4300	6503	SO:0001819	synonymous_variant	6894				CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.4857C>G	1.37:g.234527332G>C			Q9H581	Silent	SNP	pfam_SpoU_MeTrfase,superfamily_ARM-type_fold	p.T1619	ENST00000040877.1	37	c.4857	CCDS1601.1	1																																																																																			TARBP1	-	NULL		0.458	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	TARBP1	HGNC	protein_coding	OTTHUMT00000092616.1	G	NM_005646		234527332	-1	no_errors	ENST00000040877	ensembl	human	known	70_37	silent	SNP	0.000	C
TCEAL1	9338	genome.wustl.edu	37	X	102884879	102884879	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chrX:102884879C>T	ENST00000372625.3	+	3	199	c.35C>T	c.(34-36)cCg>cTg	p.P12L	TCEAL1_ENST00000372624.3_Missense_Mutation_p.P12L|TCEAL1_ENST00000469820.1_3'UTR|TCEAL1_ENST00000372626.3_Missense_Mutation_p.P12L	NM_001006639.1|NM_004780.2	NP_001006640.1|NP_004771.2	Q15170	TCAL1_HUMAN	transcription elongation factor A (SII)-like 1	12					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			ovary(1)	1						GAAGAAGAGCCGCAGAGCGCG	0.527																																																	0													12.0	11.0	11.0					X																	102884879		2164	4233	6397	SO:0001583	missense	9338			M99701	CCDS35358.1	Xq22.1	2014-03-21			ENSG00000172465	ENSG00000172465			11616	protein-coding gene	gene with protein product		300237				8206389, 7971997, 16221301	Standard	NM_004780		Approved	p21, pp21, SIIR, P21, WEX9	uc004eku.3	Q15170	OTTHUMG00000022699	ENST00000372625.3:c.35C>T	X.37:g.102884879C>T	ENSP00000361708:p.Pro12Leu		Q9UJQ9	Missense_Mutation	SNP	pfam_TF_A-like/BEX-like	p.P12L	ENST00000372625.3	37	c.35	CCDS35358.1	X	.	.	.	.	.	.	.	.	.	.	C	14.92	2.680470	0.47886	.	.	ENSG00000172465	ENST00000372626;ENST00000537029;ENST00000372625;ENST00000372624	T;T;T	0.10668	2.85;2.85;2.85	4.3	4.3	0.51218	.	0.157646	0.30446	N	0.009606	T	0.10981	0.0268	.	.	.	0.09310	N	0.999995	D	0.53745	0.962	B	0.42282	0.382	T	0.16482	-1.0401	9	0.87932	D	0	-2.1625	11.1588	0.48503	0.0:1.0:0.0:0.0	.	12	Q15170-2	.	L	12	ENSP00000361709:P12L;ENSP00000361708:P12L;ENSP00000361707:P12L	ENSP00000361707:P12L	P	+	2	0	TCEAL1	102771535	0.412000	0.25392	0.022000	0.16811	0.688000	0.40055	3.372000	0.52387	2.401000	0.81631	0.600000	0.82982	CCG	TCEAL1	-	pfam_TF_A-like/BEX-like		0.527	TCEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEAL1	HGNC	protein_coding	OTTHUMT00000058903.1	C	NM_004780		102884879	+1	no_errors	ENST00000372624	ensembl	human	known	70_37	missense	SNP	0.018	T
TEK	7010	genome.wustl.edu	37	9	27109601	27109601	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr9:27109601G>A	ENST00000380036.4	+	1	455	c.13G>A	c.(13-15)Gcc>Acc	p.A5T	TEK_ENST00000519097.1_Missense_Mutation_p.A5T|TEK_ENST00000406359.4_Missense_Mutation_p.A5T	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	5					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	GGACTCTTTAGCCAGCTTAGT	0.403																																																	0													252.0	234.0	240.0					9																	27109601		2203	4300	6503	SO:0001583	missense	7010			L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.13G>A	9.37:g.27109601G>A	ENSP00000369375:p.Ala5Thr		A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Tyr_kin_Tie2_Ig-like_dom-1_N,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A5T	ENST00000380036.4	37	c.13	CCDS6519.1	9	.	.	.	.	.	.	.	.	.	.	G	15.88	2.963618	0.53507	.	.	ENSG00000120156	ENST00000519097;ENST00000380036;ENST00000346448;ENST00000406359;ENST00000519080	T;T;T;T	0.73258	-0.73;-0.7;-0.72;2.87	5.5	5.5	0.81552	.	0.315220	0.22646	N	0.057384	T	0.73040	0.3536	N	0.12182	0.205	0.41717	D	0.989484	D;D;D;D;D	0.89917	0.993;0.993;1.0;0.993;0.993	D;D;D;D;D	0.80764	0.984;0.984;0.994;0.977;0.984	T	0.73110	-0.4086	10	0.30854	T	0.27	.	19.7727	0.96373	0.0:0.0:1.0:0.0	.	5;38;5;5;5	E7EWI2;Q59HG2;B5A953;E5RIV9;Q02763	.;.;.;.;TIE2_HUMAN	T	5	ENSP00000430686:A5T;ENSP00000369375:A5T;ENSP00000383977:A5T;ENSP00000428337:A5T	ENSP00000343716:A5T	A	+	1	0	TEK	27099601	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.417000	0.73337	2.758000	0.94735	0.563000	0.77884	GCC	TEK	-	NULL		0.403	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TEK	HGNC	protein_coding	OTTHUMT00000051965.3	G			27109601	+1	no_errors	ENST00000380036	ensembl	human	known	70_37	missense	SNP	1.000	A
TEX11	56159	genome.wustl.edu	37	X	70073170	70073170	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chrX:70073170C>T	ENST00000395889.2	-	7	533	c.378G>A	c.(376-378)atG>atA	p.M126I	TEX11_ENST00000344304.3_Missense_Mutation_p.M126I|TEX11_ENST00000374333.2_Missense_Mutation_p.M111I	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	126					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					TTCCTATTCTCATATTCATCT	0.358																																																	0													49.0	44.0	46.0					X																	70073170		2202	4300	6502	SO:0001583	missense	56159			AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.378G>A	X.37:g.70073170C>T	ENSP00000379226:p.Met126Ile		A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Missense_Mutation	SNP	pfam_Meiosis_specific_SPO22,smart_TPR_repeat	p.M126I	ENST00000395889.2	37	c.378	CCDS35323.1	X	.	.	.	.	.	.	.	.	.	.	c	0.055	-1.239470	0.01493	.	.	ENSG00000120498	ENST00000374333;ENST00000395889;ENST00000344304	T;T;T	0.29917	1.55;1.56;1.56	4.67	0.686	0.18015	Tetratricopeptide-like helical (1);	0.443699	0.25789	N	0.028291	T	0.15522	0.0374	N	0.19112	0.55	0.28148	N	0.92951	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.23261	-1.0193	9	.	.	.	-1.0865	7.2224	0.25994	0.1254:0.6469:0.0:0.2277	.	111;126	Q8IYF3-3;Q8IYF3	.;TEX11_HUMAN	I	111;126;126	ENSP00000363453:M111I;ENSP00000379226:M126I;ENSP00000340995:M126I	.	M	-	3	0	TEX11	69989895	1.000000	0.71417	0.462000	0.27118	0.007000	0.05969	0.992000	0.29667	-0.349000	0.08274	-0.905000	0.02835	ATG	TEX11	-	NULL		0.358	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TEX11	HGNC	protein_coding	OTTHUMT00000359072.1	C			70073170	-1	no_errors	ENST00000344304	ensembl	human	known	70_37	missense	SNP	0.989	T
TG	7038	genome.wustl.edu	37	8	133899234	133899234	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr8:133899234G>C	ENST00000220616.4	+	9	1657	c.1617G>C	c.(1615-1617)aaG>aaC	p.K539N	TG_ENST00000377869.1_Missense_Mutation_p.K539N	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	539					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		AAGCTGCTAAGAAGGATGGTA	0.448																																																	0													57.0	58.0	58.0					8																	133899234		2203	4300	6503	SO:0001583	missense	7038			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.1617G>C	8.37:g.133899234G>C	ENSP00000220616:p.Lys539Asn		O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_CarbesteraseB,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	p.K539N	ENST00000220616.4	37	c.1617	CCDS34944.1	8	.	.	.	.	.	.	.	.	.	.	G	7.670	0.686861	0.14973	.	.	ENSG00000042832	ENST00000377869;ENST00000220616;ENST00000535932	T;T	0.66280	-0.2;-0.2	5.06	2.31	0.28768	.	0.964926	0.08531	N	0.931982	T	0.59998	0.2235	M	0.69823	2.125	0.09310	N	1	B	0.33583	0.418	B	0.29176	0.099	T	0.51903	-0.8646	10	0.87932	D	0	.	9.4825	0.38908	0.2296:0.0:0.7704:0.0	.	539	P01266	THYG_HUMAN	N	539	ENSP00000367100:K539N;ENSP00000220616:K539N	ENSP00000220616:K539N	K	+	3	2	TG	133968416	0.001000	0.12720	0.000000	0.03702	0.227000	0.25037	1.122000	0.31295	0.319000	0.23209	0.557000	0.71058	AAG	TG	-	pirsf_Thyroglobulin		0.448	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	HGNC	protein_coding	OTTHUMT00000379606.1	G	NM_003235		133899234	+1	no_errors	ENST00000220616	ensembl	human	known	70_37	missense	SNP	0.001	C
TIMMDC1	51300	genome.wustl.edu	37	3	119242575	119242575	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr3:119242575C>T	ENST00000494664.1	+	7	1032	c.830C>T	c.(829-831)tCa>tTa	p.S277L	TIMMDC1_ENST00000493694.1_Missense_Mutation_p.S143L	NM_016589.3	NP_057673.2	Q9NPL8	TIDC1_HUMAN	translocase of inner mitochondrial membrane domain containing 1	277						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				autonomic_ganglia(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|stomach(1)|urinary_tract(1)	15						AGAAACCCTTCAGTAATAGAT	0.433																																																	0													123.0	128.0	126.0					3																	119242575		2203	4300	6503	SO:0001583	missense	51300			AF210057	CCDS33831.1	3q13.33	2013-12-05	2011-07-05	2011-07-05	ENSG00000113845	ENSG00000113845			1321	protein-coding gene	gene with protein product		615534	"""chromosome 3 open reading frame 1"""	C3orf1		11092749	Standard	NM_016589		Approved	FLJ22597	uc003ecn.3	Q9NPL8	OTTHUMG00000159388	ENST00000494664.1:c.830C>T	3.37:g.119242575C>T	ENSP00000418803:p.Ser277Leu		D3DN81|Q6IAJ7|Q6UWU6|Q9NPR3|Q9NPS5|Q9P0Y6	Missense_Mutation	SNP	pfam_Tim17/Tim22/Tim23/PMP24	p.S277L	ENST00000494664.1	37	c.830	CCDS33831.1	3	.	.	.	.	.	.	.	.	.	.	C	19.73	3.881157	0.72294	.	.	ENSG00000113845	ENST00000494664;ENST00000493694	T;T	0.49432	1.31;0.78	5.32	5.32	0.75619	.	0.616349	0.16127	N	0.228368	T	0.45756	0.1358	L	0.57536	1.79	0.34303	D	0.684573	P	0.34522	0.455	B	0.31686	0.134	T	0.61931	-0.6961	10	0.66056	D	0.02	-0.3022	14.3747	0.66865	0.0:1.0:0.0:0.0	.	277	Q9NPL8	TIDC1_HUMAN	L	277;143	ENSP00000418803:S277L;ENSP00000419510:S143L	ENSP00000419510:S143L	S	+	2	0	TIMMDC1	120725265	0.951000	0.32395	0.728000	0.30774	0.527000	0.34593	2.036000	0.41165	2.777000	0.95525	0.650000	0.86243	TCA	TIMMDC1	-	NULL		0.433	TIMMDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIMMDC1	HGNC	protein_coding	OTTHUMT00000355077.3	C	NM_016589		119242575	+1	no_errors	ENST00000494664	ensembl	human	known	70_37	missense	SNP	0.881	T
TJP2	9414	genome.wustl.edu	37	9	71789346	71789346	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr9:71789346C>T	ENST00000377245.4	+	1	266	c.58C>T	c.(58-60)Cgc>Tgc	p.R20C	TJP2_ENST00000348208.4_Missense_Mutation_p.R20C|TJP2_ENST00000265384.7_Missense_Mutation_p.R20C|TJP2_ENST00000453658.2_Intron|TJP2_ENST00000377259.1_Intron	NM_004817.3	NP_004808.2	Q9UDY2	ZO2_HUMAN	tight junction protein 2	20					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|hippo signaling (GO:0035329)|nucleotide phosphorylation (GO:0046939)|response to organic substance (GO:0010033)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	guanylate kinase activity (GO:0004385)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(5)|lung(9)|prostate(3)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	35						AGGTTGGCTCCGCGTAAGTGC	0.697																																																	0													27.0	27.0	27.0					9																	71789346		2059	4041	6100	SO:0001583	missense	9414			L27476	CCDS6627.1, CCDS6628.1, CCDS55314.1, CCDS55315.1, CCDS55316.1, CCDS55317.1	9q13-q21	2012-07-12	2012-07-12		ENSG00000119139	ENSG00000119139			11828	protein-coding gene	gene with protein product	"""Friedreich ataxia region gene X104 (tight junction protein ZO-2)"", ""zona occludens 2"""	607709	"""deafness, autosomal dominant 51"""	DFNA51		7951235, 20602916	Standard	NM_001170630		Approved	ZO-2, X104, ZO2	uc011lrv.2	Q9UDY2	OTTHUMG00000019978	ENST00000377245.4:c.58C>T	9.37:g.71789346C>T	ENSP00000366453:p.Arg20Cys		A2A3H9|B7Z2R8|B7Z7T6|F5H301|F5H886|Q15883|Q5VXL0|Q5VXL1|Q8N756|Q8NI14|Q99839|Q9UDY0|Q9UDY1	Missense_Mutation	SNP	pfam_PDZ,pfam_Guanylate_kin,pfam_SH3_2,superfamily_PDZ,superfamily_SH3_domain,smart_PDZ,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin,prints_ZonOcculS2,prints_ZonOcculdens	p.R20C	ENST00000377245.4	37	c.58	CCDS6627.1	9	.	.	.	.	.	.	.	.	.	.	C	19.50	3.839220	0.71373	.	.	ENSG00000119139	ENST00000377245;ENST00000348208;ENST00000265384	T;T;T	0.09723	2.95;2.95;2.96	5.27	5.27	0.74061	PDZ/DHR/GLGF (1);	1.160740	0.06510	N	0.737911	T	0.09555	0.0235	N	0.08118	0	0.80722	D	1	D;P;D	0.60575	0.968;0.946;0.988	B;B;B	0.43783	0.431;0.249;0.429	T	0.36261	-0.9755	10	0.72032	D	0.01	.	14.3944	0.67001	0.0:1.0:0.0:0.0	.	20;20;20	Q9UDY2-2;Q9UDY2;Q9UDY2-5	.;ZO2_HUMAN;.	C	20	ENSP00000366453:R20C;ENSP00000345893:R20C;ENSP00000265384:R20C	ENSP00000265384:R20C	R	+	1	0	TJP2	70979166	0.016000	0.18221	0.491000	0.27477	0.895000	0.52256	3.271000	0.51608	2.446000	0.82766	0.467000	0.42956	CGC	TJP2	-	superfamily_PDZ		0.697	TJP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	TJP2	HGNC	protein_coding	OTTHUMT00000052572.2	C	NM_201629		71789346	+1	no_errors	ENST00000377245	ensembl	human	known	70_37	missense	SNP	0.842	T
TMEM115	11070	genome.wustl.edu	37	3	50395801	50395801	+	Frame_Shift_Del	DEL	G	G	-			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr3:50395801delG	ENST00000266025.3	-	1	1240	c.694delC	c.(694-696)ctgfs	p.L232fs	XXcos-LUCA11.5_ENST00000606589.1_Intron	NM_007024.4	NP_008955.1	Q12893	TM115_HUMAN	transmembrane protein 115	232					negative regulation of cell proliferation (GO:0008285)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(2)|endometrium(1)|lung(1)|prostate(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		ACAGGCTGCAGGATCTCAGGG	0.577																																																	0													101.0	98.0	99.0					3																	50395801		2203	4300	6503	SO:0001589	frameshift_variant	11070			BC011948	CCDS2828.1	3p21.31	2008-11-04			ENSG00000126062	ENSG00000126062			30055	protein-coding gene	gene with protein product	"""placental protein 6"""	607069				11085536	Standard	NM_007024		Approved	PL6	uc003dan.1	Q12893	OTTHUMG00000044212	ENST00000266025.3:c.694delC	3.37:g.50395801delG	ENSP00000266025:p.Leu232fs		A2IDB7|O14568|Q6IAY4|Q9UIX3	Frame_Shift_Del	DEL	pfam_DUF1751_Mem_euk	p.L232fs	ENST00000266025.3	37	c.694	CCDS2828.1	3																																																																																			TMEM115	-	NULL		0.577	TMEM115-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM115	HGNC	protein_coding	OTTHUMT00000102784.3	G	NM_007024		50395801	-1	no_errors	ENST00000266025	ensembl	human	known	70_37	frame_shift_del	DEL	1.000	-
TMEM191A	84222	genome.wustl.edu	37	22	21058272	21058272	+	RNA	SNP	C	C	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr22:21058272C>A	ENST00000450925.2	+	0	1568					NR_026815.1		Q9H0A3	T191A_HUMAN	transmembrane protein 191A (pseudogene)							integral component of membrane (GO:0016021)											CGGGCAGCTTCGCAGAGTGCA	0.731																																																	0																																												84222			AL136879		22q11.21	2012-04-20	2012-04-20		ENSG00000226287	ENSG00000226287			25317	pseudogene	pseudogene			"""transmembrane protein 191A"""			11230166	Standard	NR_026815		Approved	DKFZp434N035, TMEM191AP	uc002zsx.1	Q9H0A3	OTTHUMG00000150164		22.37:g.21058272C>A			B2R8E2	RNA	SNP	-	NULL	ENST00000450925.2	37	NULL		22																																																																																			TMEM191A	-	-		0.731	TMEM191A-001	KNOWN	basic	processed_transcript	TMEM191A	HGNC	processed_transcript	OTTHUMT00000316649.1	C			21058272	+1	no_errors	ENST00000419950	ensembl	human	known	70_37	rna	SNP	0.000	A
TMEM211	255349	genome.wustl.edu	37	22	25331426	25331426	+	Silent	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr22:25331426G>C	ENST00000423535.1	-	3	476	c.477C>G	c.(475-477)ctC>ctG	p.L159L	TMEM211_ENST00000407886.1_Silent_p.L88L|TMEM211_ENST00000382744.1_Silent_p.L88L			Q6ICI0	TM211_HUMAN	transmembrane protein 211	159						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	8						GGACTGCATTGAGGATAGCAG	0.567																																																	0													98.0	84.0	89.0					22																	25331426		2203	4300	6503	SO:0001819	synonymous_variant	255349				CCDS33624.1	22q11.23	2009-01-12			ENSG00000206069	ENSG00000206069			33725	protein-coding gene	gene with protein product							Standard	NM_001001663		Approved	bA9F11.1	uc003abk.1	Q6ICI0	OTTHUMG00000150790	ENST00000423535.1:c.477C>G	22.37:g.25331426G>C				Silent	SNP	pfam_Lipome_HGMIC_fus_partner-like	p.L159	ENST00000423535.1	37	c.477		22																																																																																			TMEM211	-	pfam_Lipome_HGMIC_fus_partner-like		0.567	TMEM211-202	KNOWN	basic|appris_principal	protein_coding	TMEM211	HGNC	protein_coding		G	NM_001001663		25331426	-1	no_errors	ENST00000423535	ensembl	human	known	70_37	silent	SNP	0.528	C
TMEM213	155006	genome.wustl.edu	37	7	138482803	138482803	+	5'UTR	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr7:138482803C>T	ENST00000442682.2	+	0	107				TMEM213_ENST00000413208.1_5'UTR|ATP6V0A4_ENST00000310018.2_5'UTR|TMEM213_ENST00000397602.3_5'UTR|TMEM213_ENST00000458494.1_5'UTR|TMEM213_ENST00000422794.2_Missense_Mutation_p.S36F|ATP6V0A4_ENST00000353492.4_5'UTR	NM_001085429.1	NP_001078898.1	A2RRL7	TM213_HUMAN	transmembrane protein 213							integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|kidney(1)|lung(1)	6						CGGCACAACTCCGCAGGACCG	0.642																																																	0													10.0	13.0	12.0					7																	138482803		2166	4235	6401	SO:0001623	5_prime_UTR_variant	155006				CCDS47722.1	7q34	2008-08-08			ENSG00000214128	ENSG00000214128			27220	protein-coding gene	gene with protein product							Standard	NM_001085429		Approved		uc010lna.3	A2RRL7	OTTHUMG00000157182	ENST00000442682.2:c.-47C>T	7.37:g.138482803C>T			A4D1R3|C9JH49|C9JX41|C9K0P0	Missense_Mutation	SNP	NULL	p.S36F	ENST00000442682.2	37	c.107	CCDS47722.1	7	.	.	.	.	.	.	.	.	.	.	C	10.53	1.377072	0.24857	.	.	ENSG00000214128	ENST00000422794	.	.	.	3.17	0.155	0.14906	.	0.490031	0.14891	U	0.292437	T	0.36276	0.0961	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.33624	-0.9861	6	0.87932	D	0	.	3.7435	0.08539	0.2097:0.5634:0.0:0.2269	.	.	.	.	F	36	.	ENSP00000402388:S36F	S	+	2	0	TMEM213	138133343	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.253000	0.08794	0.007000	0.14760	0.436000	0.28706	TCC	TMEM213	-	NULL		0.642	TMEM213-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM213	HGNC	protein_coding	OTTHUMT00000347800.2	C	NM_001085429		138482803	+1	no_errors	ENST00000422794	ensembl	human	known	70_37	missense	SNP	0.000	T
LEO1	123169	genome.wustl.edu	37	15	52239400	52239400	+	Intron	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr15:52239400G>C	ENST00000299601.5	-	11	1957				LEO1_ENST00000315141.5_Intron	NM_138792.2	NP_620147.1	Q8WVC0	LEO1_HUMAN	Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)						endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of myeloid cell differentiation (GO:0045638)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|skin(1)	14				all cancers(107;0.00264)		CAACTAATTTGTGCCTGCCTG	0.433																																					Esophageal Squamous(40;229 896 18505 32465 43844)|Ovarian(53;886 1123 14462 18432 23189)												0																																										SO:0001627	intron_variant	29766			AY302186	CCDS10146.1, CCDS66767.1	15q21.2	2008-02-05			ENSG00000166477	ENSG00000166477			30401	protein-coding gene	gene with protein product		610507				15632063	Standard	NM_001286430		Approved		uc002abo.3	Q8WVC0	OTTHUMG00000131843	ENST00000299601.5:c.1896+88C>G	15.37:g.52239400G>C			Q96N99	RNA	SNP	-	NULL	ENST00000299601.5	37	NULL	CCDS10146.1	15																																																																																			TMOD3	-	-		0.433	LEO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMOD3	HGNC	protein_coding	OTTHUMT00000254791.2	G	NM_138792		52239400	+1	no_errors	ENST00000558300	ensembl	human	putative	70_37	rna	SNP	0.000	C
TNFAIP8	25816	genome.wustl.edu	37	5	118728573	118728573	+	Frame_Shift_Del	DEL	A	A	-			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr5:118728573delA	ENST00000503646.1	+	3	782	c.94delA	c.(94-96)aaafs	p.K32fs	TNFAIP8_ENST00000513374.1_Frame_Shift_Del_p.K44fs|TNFAIP8_ENST00000504771.2_Frame_Shift_Del_p.K32fs|TNFAIP8_ENST00000415806.2_3'UTR|TNFAIP8_ENST00000504642.1_Frame_Shift_Del_p.K34fs|TNFAIP8_ENST00000274456.6_Frame_Shift_Del_p.K22fs			O95379	TFIP8_HUMAN	tumor necrosis factor, alpha-induced protein 8	32					defense response to Gram-positive bacterium (GO:0050830)|interleukin-1 beta production (GO:0032611)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)	cytoplasm (GO:0005737)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)			ovary(1)	1		all_cancers(142;0.0317)|Prostate(80;0.111)|Breast(839;0.231)		Epithelial(69;4.63e-83)|OV - Ovarian serous cystadenocarcinoma(64;1.39e-82)|all cancers(49;4.88e-75)|GBM - Glioblastoma multiforme(465;0.00338)|BRCA - Breast invasive adenocarcinoma(61;0.0148)|COAD - Colon adenocarcinoma(49;0.0829)		GATCTTGGGTAAAATGGTGTC	0.413																																																	0													37.0	32.0	33.0					5																	118728573		1910	4128	6038	SO:0001589	frameshift_variant	25816			AF070671	CCDS47257.1, CCDS47258.1, CCDS68933.1	5q23.1	2008-02-05			ENSG00000145779	ENSG00000145779			17260	protein-coding gene	gene with protein product		612111				10233894, 10644768	Standard	NM_001286813		Approved	GG2-1, MDC-3.13, SCC-S2	uc003ksi.3	O95379	OTTHUMG00000162949	ENST00000503646.1:c.94delA	5.37:g.118728573delA	ENSP00000421848:p.Lys32fs		B3KMH1|B3KMI2|B7Z713|Q9P1Q1|Q9UER5|Q9UP47	Frame_Shift_Del	DEL	pfam_DUF758	p.M33fs	ENST00000503646.1	37	c.94	CCDS47258.1	5																																																																																			TNFAIP8	-	pfam_DUF758		0.413	TNFAIP8-002	PUTATIVE	alternative_5_UTR|basic|exp_conf|CCDS	protein_coding	TNFAIP8	HGNC	protein_coding	OTTHUMT00000371134.2	A	NM_014350		118728573	+1	no_errors	ENST00000504771	ensembl	human	known	70_37	frame_shift_del	DEL	1.000	-
TOMM40L	84134	genome.wustl.edu	37	1	161197766	161197766	+	Silent	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:161197766G>A	ENST00000367988.3	+	6	740	c.471G>A	c.(469-471)ctG>ctA	p.L157L	MIR5187_ENST00000583479.1_RNA|TOMM40L_ENST00000474486.1_3'UTR|NR1I3_ENST00000479324.1_5'Flank|TOMM40L_ENST00000545897.1_Silent_p.L123L|TOMM40L_ENST00000367987.1_Silent_p.L157L	NM_032174.4	NP_115550.2	Q969M1	TM40L_HUMAN	translocase of outer mitochondrial membrane 40 homolog (yeast)-like	157					ion transport (GO:0006811)|protein transport (GO:0015031)	mitochondrial outer membrane (GO:0005741)|pore complex (GO:0046930)|protein complex (GO:0043234)	porin activity (GO:0015288)			large_intestine(2)|liver(4)|lung(4)	10	all_cancers(52;1.86e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			ATCCTGACCTGATTGGGGAGT	0.517											OREG0013943	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													57.0	56.0	56.0					1																	161197766		2203	4300	6503	SO:0001819	synonymous_variant	84134				CCDS1227.1, CCDS65700.1	1q23.3	2008-02-05	2007-01-12		ENSG00000158882	ENSG00000158882			25756	protein-coding gene	gene with protein product			"""translocase of outer mitochondrial membrane 40 homolog-like (yeast)"""				Standard	NM_032174		Approved	FLJ12770, TOMM40B	uc001fzd.3	Q969M1	OTTHUMG00000034345	ENST00000367988.3:c.471G>A	1.37:g.161197766G>A		1814	B7Z4U0|D3DVG9	Silent	SNP	pfam_Porin_Euk	p.L157	ENST00000367988.3	37	c.471	CCDS1227.1	1																																																																																			TOMM40L	-	pfam_Porin_Euk		0.517	TOMM40L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOMM40L	HGNC	protein_coding	OTTHUMT00000083029.1	G	NM_032174		161197766	+1	no_errors	ENST00000367987	ensembl	human	known	70_37	silent	SNP	1.000	A
TOPBP1	11073	genome.wustl.edu	37	3	133347256	133347256	+	Silent	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr3:133347256C>T	ENST00000260810.5	-	16	2885	c.2754G>A	c.(2752-2754)aaG>aaA	p.K918K		NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	918	BRCT 6. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						CACTCTGCTTCTTACTGAGTT	0.388								Other conserved DNA damage response genes																													Ovarian(21;193 658 4424 15423 17362)												0													120.0	114.0	116.0					3																	133347256		1886	4107	5993	SO:0001819	synonymous_variant	11073			AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.2754G>A	3.37:g.133347256C>T			B7Z7W8|Q7LGC1|Q9UEB9	Silent	SNP	pfam_BRCT_dom,superfamily_BRCT_dom,superfamily_Secretoglobin,smart_BRCT_dom,pfscan_BRCT_dom	p.K918	ENST00000260810.5	37	c.2754	CCDS46919.1	3																																																																																			TOPBP1	-	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom		0.388	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOPBP1	HGNC	protein_coding	OTTHUMT00000357254.1	C	NM_007027		133347256	-1	no_errors	ENST00000260810	ensembl	human	known	70_37	silent	SNP	1.000	T
TOPORS	10210	genome.wustl.edu	37	9	32542823	32542823	+	Nonsense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr9:32542823G>C	ENST00000360538.2	-	3	1816	c.1700C>G	c.(1699-1701)tCa>tGa	p.S567*	TOPORS_ENST00000379858.1_Nonsense_Mutation_p.S502*	NM_005802.4	NP_005793.2	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase	567	Interaction with SUMO1.|Interaction with TOP1.|Interaction with p53/TP53.|Required for sumoylation and localization to discrete nuclear foci.				cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of apoptotic process (GO:0043066)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein localization to nucleus (GO:0034504)|protein monoubiquitination (GO:0006513)|protein sumoylation (GO:0016925)|regulation of cell proliferation (GO:0042127)|retina layer formation (GO:0010842)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|gamma-tubulin complex (GO:0000930)|midbody (GO:0030496)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|PML body (GO:0016605)|spindle pole (GO:0000922)|ubiquitin ligase complex (GO:0000151)	antigen binding (GO:0003823)|DNA binding (GO:0003677)|DNA topoisomerase binding (GO:0044547)|SUMO ligase activity (GO:0019789)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		AGATGACAATGATGTAGATCG	0.378																																																	0													166.0	162.0	164.0					9																	32542823		2203	4300	6503	SO:0001587	stop_gained	10210			AF098300	CCDS6527.1, CCDS56566.1	9p21	2013-01-09	2010-09-17		ENSG00000197579	ENSG00000197579		"""RING-type (C3HC4) zinc fingers"""	21653	protein-coding gene	gene with protein product		609507	"""retinitis pigmentosa 31 (autosomal dominant)"", ""topoisomerase I binding, arginine/serine-rich"""	RP31		10352183, 12083797, 17924349	Standard	NM_005802		Approved	TP53BPL, LUN	uc003zrb.3	Q9NS56	OTTHUMG00000019743	ENST00000360538.2:c.1700C>G	9.37:g.32542823G>C	ENSP00000353735:p.Ser567*		O43273|Q6P987|Q9NS55|Q9UNR9	Nonsense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.S567*	ENST00000360538.2	37	c.1700	CCDS6527.1	9	.	.	.	.	.	.	.	.	.	.	G	23.1	4.376223	0.82682	.	.	ENSG00000197579	ENST00000360538;ENST00000379858	.	.	.	5.67	5.67	0.87782	.	0.000000	0.35235	N	0.003345	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-7.07	12.1066	0.53816	0.0:0.0:0.7254:0.2746	.	.	.	.	X	567;502	.	ENSP00000353735:S567X	S	-	2	0	TOPORS	32532823	0.998000	0.40836	0.672000	0.29872	0.629000	0.37895	3.178000	0.50879	2.675000	0.91044	0.650000	0.86243	TCA	TOPORS	-	NULL		0.378	TOPORS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TOPORS	HGNC	protein_coding	OTTHUMT00000052007.1	G	NM_005802		32542823	-1	no_errors	ENST00000360538	ensembl	human	known	70_37	nonsense	SNP	0.958	C
TRABD2A	129293	genome.wustl.edu	37	2	85051106	85051106	+	Silent	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr2:85051106G>A	ENST00000409520.2	-	6	1347	c.1305C>T	c.(1303-1305)ttC>ttT	p.F435F	TRABD2A_ENST00000479944.1_5'UTR|TRABD2A_ENST00000335459.5_Silent_p.F386F	NM_001277053.1	NP_001263982.1	Q86V40	TIKI1_HUMAN	TraB domain containing 2A	435					head development (GO:0060322)|metabolic process (GO:0008152)|negative regulation of Wnt signaling pathway (GO:0030178)|protein oxidation (GO:0018158)|Wnt signaling pathway (GO:0016055)	integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|Wnt-protein binding (GO:0017147)										ACAGATCGCTGAATTGCCGGA	0.647																																																	0													36.0	42.0	40.0					2																	85051106		2201	4300	6501	SO:0001819	synonymous_variant	129293			BC049209	CCDS46349.1, CCDS62946.1	2p11.2	2012-07-04	2012-07-04	2012-07-04	ENSG00000186854	ENSG00000186854			27013	protein-coding gene	gene with protein product		614912	"""chromosome 2 open reading frame 89"""	C2orf89		12477932	Standard	NM_001080824		Approved		uc010ysl.3	Q86V40	OTTHUMG00000152922	ENST00000409520.2:c.1305C>T	2.37:g.85051106G>A			B4DKK8|I6UMB9	Silent	SNP	NULL	p.F435	ENST00000409520.2	37	c.1305		2																																																																																			TRABD2A	-	NULL		0.647	TRABD2A-201	KNOWN	basic|appris_principal	protein_coding	TRABD2A	HGNC	protein_coding		G	NM_001080824		85051106	-1	no_errors	ENST00000409520	ensembl	human	known	70_37	silent	SNP	0.000	A
TRABD2B	388630	genome.wustl.edu	37	1	48240993	48240993	+	Missense_Mutation	SNP	C	C	T	rs569339407	byFrequency	TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:48240993C>T	ENST00000606738.2	-	6	1303	c.1198G>A	c.(1198-1200)Gat>Aat	p.D400N	TRABD2B_ENST00000435576.2_5'UTR	NM_001194986.1	NP_001181915.1	A6NFA1	TIKI2_HUMAN	TraB domain containing 2B	400					metabolic process (GO:0008152)|negative regulation of Wnt signaling pathway (GO:0030178)|protein oxidation (GO:0018158)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|Wnt-protein binding (GO:0017147)										GGATCCTCATCCTCTGGTGGG	0.687													c|||	2	0.000399361	0.0008	0.0	5008	,	,		13498	0.0		0.001	False		,,,				2504	0.0																0																																										SO:0001583	missense	388630				CCDS58000.1	1p33	2012-07-04			ENSG00000204018				44200	protein-coding gene	gene with protein product		614913					Standard	NM_001194986		Approved		uc021ong.1	A6NFA1	OTTHUMG00000007960	ENST00000606738.2:c.1198G>A	1.37:g.48240993C>T	ENSP00000476820:p.Asp400Asn		I6U4Y0	Missense_Mutation	SNP	superfamily_SuperAg_toxin_C_Staph/Strep	p.D400N	ENST00000606738.2	37	c.1198	CCDS58000.1	1																																																																																			TRABD2B	-	NULL		0.687	TRABD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRABD2B	HGNC	protein_coding	OTTHUMT00000021842.3	C	NM_001194986		48240993	-1	no_errors	ENST00000371865	ensembl	human	known	70_37	missense	SNP	1.000	T
TRAF2	7186	genome.wustl.edu	37	9	139804386	139804386	+	Silent	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr9:139804386C>T	ENST00000247668.2	+	6	595	c.543C>T	c.(541-543)gtC>gtT	p.V181V	TRAF2_ENST00000482854.1_3'UTR|TRAF2_ENST00000536468.1_Silent_p.V181V|TRAF2_ENST00000359662.3_Silent_p.V233V	NM_021138.3	NP_066961.2	Q12933	TRAF2_HUMAN	TNF receptor-associated factor 2	181					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular protein complex assembly (GO:0043623)|cellular response to nitric oxide (GO:0071732)|innate immune response (GO:0045087)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of neuron death (GO:1901215)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|programmed necrotic cell death (GO:0097300)|protein autoubiquitination (GO:0051865)|protein catabolic process (GO:0030163)|protein complex assembly (GO:0006461)|protein heterooligomerization (GO:0051291)|protein homotrimerization (GO:0070207)|protein K63-linked ubiquitination (GO:0070534)|regulation of apoptotic process (GO:0042981)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of immunoglobulin secretion (GO:0051023)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|membrane raft (GO:0045121)|ubiquitin ligase complex (GO:0000151)	CD40 receptor binding (GO:0005174)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein phosphatase binding (GO:0019903)|signal transducer activity (GO:0004871)|sphingolipid binding (GO:0046625)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.229)	OV - Ovarian serous cystadenocarcinoma(145;4.48e-06)|Epithelial(140;9.55e-06)		ACCACGAGGTCTGCCCCAAGT	0.637																																																	0													106.0	82.0	90.0					9																	139804386		2203	4300	6503	SO:0001819	synonymous_variant	7186			U12597	CCDS7013.1	9q34	2013-01-09			ENSG00000127191	ENSG00000127191		"""RING-type (C3HC4) zinc fingers"""	12032	protein-coding gene	gene with protein product		601895				7639698	Standard	NM_021138		Approved	TRAP3	uc004cjv.3	Q12933	OTTHUMG00000020952	ENST00000247668.2:c.543C>T	9.37:g.139804386C>T			A8K107|B4DPJ7|Q7Z337|Q96NT2	Silent	SNP	pfam_MATH,pfam_Znf_C3HC4_RING-type,superfamily_TRAF-like,smart_Znf_RING,smart_MATH,pirsf_TNF_rcpt--assoc_TRAF,pfscan_MATH,pfscan_Znf_RING,pfscan_Znf_TRAF	p.V233	ENST00000247668.2	37	c.699	CCDS7013.1	9																																																																																			TRAF2	-	pirsf_TNF_rcpt--assoc_TRAF,pfscan_Znf_TRAF		0.637	TRAF2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF2	HGNC	protein_coding	OTTHUMT00000055166.1	C	NM_021138		139804386	+1	no_errors	ENST00000359662	ensembl	human	known	70_37	silent	SNP	1.000	T
TRAF2	7186	genome.wustl.edu	37	9	139804464	139804464	+	Intron	SNP	C	C	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr9:139804464C>A	ENST00000247668.2	+	6	655				TRAF2_ENST00000482854.1_Intron|TRAF2_ENST00000536468.1_Intron|TRAF2_ENST00000359662.3_Intron	NM_021138.3	NP_066961.2	Q12933	TRAF2_HUMAN	TNF receptor-associated factor 2						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular protein complex assembly (GO:0043623)|cellular response to nitric oxide (GO:0071732)|innate immune response (GO:0045087)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of neuron death (GO:1901215)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|programmed necrotic cell death (GO:0097300)|protein autoubiquitination (GO:0051865)|protein catabolic process (GO:0030163)|protein complex assembly (GO:0006461)|protein heterooligomerization (GO:0051291)|protein homotrimerization (GO:0070207)|protein K63-linked ubiquitination (GO:0070534)|regulation of apoptotic process (GO:0042981)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of immunoglobulin secretion (GO:0051023)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|membrane raft (GO:0045121)|ubiquitin ligase complex (GO:0000151)	CD40 receptor binding (GO:0005174)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein phosphatase binding (GO:0019903)|signal transducer activity (GO:0004871)|sphingolipid binding (GO:0046625)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.229)	OV - Ovarian serous cystadenocarcinoma(145;4.48e-06)|Epithelial(140;9.55e-06)		TCCTTCACCTCCTTGGAGGAC	0.617																																																	0													56.0	45.0	49.0					9																	139804464		2203	4300	6503	SO:0001627	intron_variant	7186			U12597	CCDS7013.1	9q34	2013-01-09			ENSG00000127191	ENSG00000127191		"""RING-type (C3HC4) zinc fingers"""	12032	protein-coding gene	gene with protein product		601895				7639698	Standard	NM_021138		Approved	TRAP3	uc004cjv.3	Q12933	OTTHUMG00000020952	ENST00000247668.2:c.603+18C>A	9.37:g.139804464C>A			A8K107|B4DPJ7|Q7Z337|Q96NT2	RNA	SNP	-	NULL	ENST00000247668.2	37	NULL	CCDS7013.1	9																																																																																			TRAF2	-	-		0.617	TRAF2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF2	HGNC	protein_coding	OTTHUMT00000055166.1	C	NM_021138		139804464	+1	no_errors	ENST00000474950	ensembl	human	known	70_37	rna	SNP	0.000	A
TRAFD1	10906	genome.wustl.edu	37	12	112585930	112585930	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr12:112585930C>G	ENST00000257604.5	+	8	1597	c.980C>G	c.(979-981)tCc>tGc	p.S327C	TRAFD1_ENST00000412615.2_Missense_Mutation_p.S327C|Y_RNA_ENST00000363265.1_RNA	NM_001143906.1	NP_001137378.1	O14545	TRAD1_HUMAN	TRAF-type zinc finger domain containing 1	327					negative regulation of innate immune response (GO:0045824)|response to cytokine (GO:0034097)		metal ion binding (GO:0046872)			kidney(5)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	17						GGCAGCTCTTCCCCCAGAGGG	0.448																																																	0													75.0	71.0	72.0					12																	112585930		2203	4300	6503	SO:0001583	missense	10906			AB007447	CCDS9160.1	12q24.13	2013-01-25			ENSG00000135148	ENSG00000135148			24808	protein-coding gene	gene with protein product		613197				12477932	Standard	NM_006700		Approved	FLN29	uc001ttp.3	O14545	OTTHUMG00000169640	ENST00000257604.5:c.980C>G	12.37:g.112585930C>G	ENSP00000257604:p.Ser327Cys		A8K5L6|B4DI89	Missense_Mutation	SNP	superfamily_TRAF-like	p.S327C	ENST00000257604.5	37	c.980	CCDS9160.1	12	.	.	.	.	.	.	.	.	.	.	C	16.29	3.080505	0.55753	.	.	ENSG00000135148	ENST00000412615;ENST00000257604;ENST00000548277	T;T	0.35973	1.28;1.28	5.94	5.06	0.68205	.	0.397095	0.27442	N	0.019342	T	0.53045	0.1772	M	0.77103	2.36	0.23298	N	0.997956	D	0.63880	0.993	P	0.56514	0.8	T	0.53344	-0.8452	10	0.87932	D	0	-2.4594	10.5688	0.45188	0.0:0.8488:0.0:0.1512	.	327	O14545	TRAD1_HUMAN	C	327;327;121	ENSP00000396526:S327C;ENSP00000257604:S327C	ENSP00000257604:S327C	S	+	2	0	TRAFD1	111070313	0.998000	0.40836	0.520000	0.27837	0.473000	0.32948	5.294000	0.65687	1.531000	0.49152	-0.142000	0.14014	TCC	TRAFD1	-	NULL		0.448	TRAFD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAFD1	HGNC	protein_coding	OTTHUMT00000405214.1	C	NM_006700		112585930	+1	no_errors	ENST00000257604	ensembl	human	known	70_37	missense	SNP	0.371	G
TRERF1	55809	genome.wustl.edu	37	6	42232541	42232541	+	Silent	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr6:42232541C>G	ENST00000372922.4	-	7	2098	c.1536G>C	c.(1534-1536)ctG>ctC	p.L512L	TRERF1_ENST00000340840.2_Silent_p.L512L|TRERF1_ENST00000354325.2_Silent_p.L512L|TRERF1_ENST00000372917.4_Silent_p.L512L|TRERF1_ENST00000541110.1_Silent_p.L512L	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	512	Interacts with CREBBP.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TGGAGCATGTCAGCTTGTTCT	0.562																																																	0													141.0	120.0	127.0					6																	42232541		2203	4300	6503	SO:0001819	synonymous_variant	55809			AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.1536G>C	6.37:g.42232541C>G			Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Silent	SNP	pfam_ELM2_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_SANT/Myb,pfscan_ELM2_dom,pfscan_Znf_C2H2	p.L512	ENST00000372922.4	37	c.1536	CCDS4867.1	6																																																																																			TRERF1	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.562	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRERF1	HGNC	protein_coding	OTTHUMT00000040551.2	C	NM_033502		42232541	-1	no_errors	ENST00000541110	ensembl	human	known	70_37	silent	SNP	1.000	G
TRPM6	140803	genome.wustl.edu	37	9	77339658	77339658	+	Missense_Mutation	SNP	T	T	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr9:77339658T>G	ENST00000360774.1	-	39	6177	c.5940A>C	c.(5938-5940)ttA>ttC	p.L1980F	TRPM6_ENST00000376872.3_Missense_Mutation_p.L935F|TRPM6_ENST00000361255.3_Missense_Mutation_p.L1975F|TRPM6_ENST00000449912.2_Missense_Mutation_p.L1975F|TRPM6_ENST00000451710.3_Missense_Mutation_p.L1984F|TRPM6_ENST00000376871.3_Missense_Mutation_p.L817F	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1980	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.				calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						CATTTCTTTTTAAATCTGCAA	0.418																																																	0													86.0	91.0	89.0					9																	77339658		2203	4300	6503	SO:0001583	missense	140803			AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.5940A>C	9.37:g.77339658T>G	ENSP00000354006:p.Leu1980Phe		Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.L1984F	ENST00000360774.1	37	c.5952	CCDS6647.1	9	.	.	.	.	.	.	.	.	.	.	T	19.77	3.890052	0.72524	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000376872;ENST00000376871;ENST00000449912;ENST00000361255;ENST00000376870	T;T;T;T;T;T	0.08370	3.1;3.1;3.1;3.1;3.1;3.1	5.69	0.402	0.16344	MHCK/EF2 kinase (1);Protein kinase-like domain (1);	0.327889	0.27577	N	0.018758	T	0.19208	0.0461	M	0.68952	2.095	0.80722	D	1	D;D;D;D;D;D	0.89917	0.997;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.87578	0.923;0.99;0.994;0.994;0.996;0.998	T	0.01894	-1.1252	10	0.56958	D	0.05	.	4.4933	0.11824	0.0:0.2828:0.3121:0.4051	.	527;813;931;1980;1975;1975	Q9BX84-7;Q9BX84-6;Q9BX84-5;Q9BX84;Q9BX84-3;Q9BX84-2	.;.;.;TRPM6_HUMAN;.;.	F	1980;1984;935;817;1975;1975;526	ENSP00000354006:L1980F;ENSP00000407341:L1984F;ENSP00000366068:L935F;ENSP00000366067:L817F;ENSP00000396672:L1975F;ENSP00000354962:L1975F	ENSP00000354006:L1980F	L	-	3	2	TRPM6	76529478	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	0.495000	0.22483	0.417000	0.25871	0.533000	0.62120	TTA	TRPM6	-	superfamily_Kinase-like_dom,pfscan_MHCK_EF2_kinase		0.418	TRPM6-001	KNOWN	basic|CCDS	protein_coding	TRPM6	HGNC	protein_coding	OTTHUMT00000052693.1	T	NM_017662		77339658	-1	no_errors	ENST00000451710	ensembl	human	known	70_37	missense	SNP	0.999	G
TTC30B	150737	genome.wustl.edu	37	2	178415583	178415583	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr2:178415583C>G	ENST00000408939.3	-	1	2159	c.1909G>C	c.(1909-1911)Gaa>Caa	p.E637Q		NM_152517.2	NP_689730.2	Q8N4P2	TT30B_HUMAN	tetratricopeptide repeat domain 30B	637					cilium assembly (GO:0042384)|intraciliary transport (GO:0042073)	cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)				cervix(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.00151)|Epithelial(96;0.00931)|all cancers(119;0.0362)			TGCATTCTTTCTTCTTCCAGG	0.363																																																	0													148.0	152.0	150.0					2																	178415583		2201	4300	6501	SO:0001583	missense	150737			AK055552	CCDS42784.1	2q31.2	2014-02-21			ENSG00000196659	ENSG00000196659		"""Tetratricopeptide (TTC) repeat domain containing"", ""Intraflagellar transport homologs"""	26425	protein-coding gene	gene with protein product						12477932	Standard	NM_152517		Approved	FLJ30990, fleer, IFT70	uc002uln.3	Q8N4P2	OTTHUMG00000154166	ENST00000408939.3:c.1909G>C	2.37:g.178415583C>G	ENSP00000386181:p.Glu637Gln		Q63HQ1|Q96NE6	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR-contain_dom	p.E637Q	ENST00000408939.3	37	c.1909	CCDS42784.1	2	.	.	.	.	.	.	.	.	.	.	C	4.475	0.088005	0.08583	.	.	ENSG00000196659	ENST00000500357;ENST00000408939	T	0.17854	2.25	4.94	4.94	0.65067	.	0.321128	0.38548	N	0.001645	T	0.11537	0.0281	N	0.25144	0.715	0.40827	D	0.983559	B	0.02656	0.0	B	0.06405	0.002	T	0.13899	-1.0492	10	0.20519	T	0.43	.	12.5595	0.56273	0.0:0.9126:0.0:0.0874	.	637	Q8N4P2	TT30B_HUMAN	Q	590;637	ENSP00000386181:E637Q	ENSP00000386181:E637Q	E	-	1	0	TTC30B	178123829	1.000000	0.71417	1.000000	0.80357	0.478000	0.33099	3.174000	0.50847	2.715000	0.92844	0.655000	0.94253	GAA	TTC30B	-	NULL		0.363	TTC30B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC30B	HGNC	protein_coding	OTTHUMT00000334193.2	C	NM_152517		178415583	-1	no_errors	ENST00000408939	ensembl	human	known	70_37	missense	SNP	0.998	G
TTLL10	254173	genome.wustl.edu	37	1	1111181	1111181	+	Intron	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr1:1111181G>C	ENST00000379290.1	+	3	146				TTLL10_ENST00000379289.1_Intron|TTLL10-AS1_ENST00000379317.1_RNA			Q6ZVT0	TTL10_HUMAN	tubulin tyrosine ligase-like family, member 10						cellular protein modification process (GO:0006464)					haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(2)|skin(1)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;4.75e-36)|OV - Ovarian serous cystadenocarcinoma(86;5.82e-22)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		CCGCTGTGCAGGTGGAGAGAG	0.677																																																	0																																										SO:0001627	intron_variant	100506376			AK093438	CCDS8.1, CCDS44036.1	1p36.33	2014-01-28	2005-07-29	2005-07-29	ENSG00000162571	ENSG00000162571		"""Tubulin tyrosine ligase-like family"""	26693	protein-coding gene	gene with protein product			"""tubulin tyrosine ligase-like family, member 5"""	TTLL5		15890843	Standard	NM_153254		Approved	FLJ36119	uc001acy.2	Q6ZVT0	OTTHUMG00000000851	ENST00000379290.1:c.-28+1312G>C	1.37:g.1111181G>C			B1AMF6|Q5T2W4|Q5T2W5|Q8N9X2	RNA	SNP	-	NULL	ENST00000379290.1	37	NULL	CCDS44036.1	1																																																																																			TTLL10-AS1	-	-		0.677	TTLL10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL10-AS1	HGNC	protein_coding	OTTHUMT00000002421.3	G	NM_153254		1111181	-1	no_errors	ENST00000379317	ensembl	human	known	70_37	rna	SNP	0.110	C
TTLL13	440307	genome.wustl.edu	37	15	90802006	90802006	+	Nonsense_Mutation	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr15:90802006C>G	ENST00000339615.5	+	10	1489	c.1199C>G	c.(1198-1200)tCa>tGa	p.S400*	RP11-697E2.6_ENST00000561573.1_3'UTR|TTLL13_ENST00000438251.1_Nonsense_Mutation_p.S400*	NM_001029964.2	NP_001025135.2			tubulin tyrosine ligase-like family, member 13											NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)	16	Melanoma(11;0.00551)|Lung NSC(78;0.0178)|all_lung(78;0.0378)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|BRCA - Breast invasive adenocarcinoma(143;0.0323)|Kidney(142;0.0514)			ACCACGGACTCATGCCTTGAT	0.517																																																	0													137.0	106.0	117.0					15																	90802006		2199	4298	6497	SO:0001587	stop_gained	440307			BC036668		15q26.1	2013-02-14				ENSG00000213471		"""Tubulin tyrosine ligase-like family"""	32484	protein-coding gene	gene with protein product						15890843	Standard	NR_104604		Approved	FLJ46079, MGC33417	uc002bpd.1	A6NNM8		ENST00000339615.5:c.1199C>G	15.37:g.90802006C>G	ENSP00000345294:p.Ser400*			Nonsense_Mutation	SNP	pfam_Tub_tyr_ligase	p.S400*	ENST00000339615.5	37	c.1199	CCDS32328.1	15	.	.	.	.	.	.	.	.	.	.	C	39	7.675563	0.98425	.	.	ENSG00000213471	ENST00000438251;ENST00000339615	.	.	.	5.7	5.7	0.88788	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	18.8339	0.92153	0.0:1.0:0.0:0.0	.	.	.	.	X	400	.	ENSP00000345294:S400X	S	+	2	0	TTLL13	88603010	1.000000	0.71417	0.997000	0.53966	0.959000	0.62525	7.347000	0.79356	2.707000	0.92482	0.655000	0.94253	TCA	TTLL13	-	pfam_Tub_tyr_ligase		0.517	TTLL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL13	HGNC	protein_coding	OTTHUMT00000435854.1	C	NM_001029964		90802006	+1	no_errors	ENST00000438251	ensembl	human	known	70_37	nonsense	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179395192	179395192	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr2:179395192C>T	ENST00000591111.1	-	308	101451	c.101227G>A	c.(101227-101229)Gag>Aag	p.E33743K	TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E26511K|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E26444K|TTN_ENST00000460472.2_Missense_Mutation_p.E26319K|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E35384K|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E32816K|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000592182.1_RNA			Q8WZ42	TITIN_HUMAN	titin	33743					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATACCTTCTCATGGATACTC	0.368																																																	0													149.0	134.0	139.0					2																	179395192		1817	4074	5891	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.101227G>A	2.37:g.179395192C>T	ENSP00000465570:p.Glu33743Lys		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E32816K	ENST00000591111.1	37	c.98446		2	.	.	.	.	.	.	.	.	.	.	C	9.087	1.000853	0.19121	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.61040	0.14;0.29;0.27;0.26	5.23	3.41	0.39046	Ribonuclease H-like (1);	.	.	.	.	T	0.33673	0.0871	N	0.08118	0	0.26115	N	0.980621	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.23940	-1.0174	9	0.87932	D	0	.	4.0937	0.09982	0.278:0.5227:0.1173:0.082	.	26319;26444;26511;33743	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	32816;26319;26511;26444;26316	ENSP00000343764:E32816K;ENSP00000434586:E26319K;ENSP00000340554:E26511K;ENSP00000352154:E26444K	ENSP00000340554:E26511K	E	-	1	0	TTN	179103438	1.000000	0.71417	0.983000	0.44433	0.154000	0.21943	1.297000	0.33400	0.587000	0.29643	-0.305000	0.09177	GAG	TTN	-	superfamily_RNaseH-like_dom,smart_Ig_sub		0.368	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	C	NM_133378		179395192	-1	no_errors	ENST00000342992	ensembl	human	known	70_37	missense	SNP	0.979	T
TTN	7273	genome.wustl.edu	37	2	179395466	179395466	+	Silent	SNP	C	C	G	rs372521529	byFrequency	TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr2:179395466C>G	ENST00000591111.1	-	308	101177	c.100953G>C	c.(100951-100953)ctG>ctC	p.L33651L	TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN_ENST00000342175.6_Silent_p.L26419L|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000359218.5_Silent_p.L26352L|TTN_ENST00000460472.2_Silent_p.L26227L|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN_ENST00000589042.1_Silent_p.L35292L|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN_ENST00000342992.6_Silent_p.L32724L|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000592182.1_RNA			Q8WZ42	TITIN_HUMAN	titin	33651	Ig-like 148.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTCTGCTTTCAGGAACTGAG	0.463																																																	0													103.0	99.0	100.0					2																	179395466		1891	4108	5999	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.100953G>C	2.37:g.179395466C>G			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.L32724	ENST00000591111.1	37	c.98172		2																																																																																			TTN	-	superfamily_RNaseH-like_dom,smart_Ig_sub,pfscan_Ig-like		0.463	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	C	NM_133378		179395466	-1	no_errors	ENST00000342992	ensembl	human	known	70_37	silent	SNP	0.272	G
TTN	7273	genome.wustl.edu	37	2	179585135	179585135	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr2:179585135C>T	ENST00000591111.1	-	78	22627	c.22403G>A	c.(22402-22404)tGt>tAt	p.C7468Y	TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.C7785Y|TTN_ENST00000342992.6_Missense_Mutation_p.C6541Y|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13023	Ig-like 56.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGAGCAAGAACACGTGTCACT	0.403																																																	0													146.0	138.0	141.0					2																	179585135		1902	4124	6026	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.22403G>A	2.37:g.179585135C>T	ENSP00000465570:p.Cys7468Tyr		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.C6541Y	ENST00000591111.1	37	c.19622		2	.	.	.	.	.	.	.	.	.	.	C	11.96	1.793875	0.31777	.	.	ENSG00000155657	ENST00000342992	T	0.67523	-0.27	5.91	5.91	0.95273	Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.84656	0.5520	M	0.86178	2.8	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	D	0.85926	0.1449	9	0.87932	D	0	.	20.2885	0.98538	0.0:1.0:0.0:0.0	.	7468	Q8WZ42	TITIN_HUMAN	Y	6541	ENSP00000343764:C6541Y	ENSP00000343764:C6541Y	C	-	2	0	TTN	179293380	1.000000	0.71417	0.822000	0.32727	0.956000	0.61745	3.851000	0.55926	2.791000	0.96007	0.650000	0.86243	TGT	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,pfscan_Ig-like		0.403	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	C	NM_133378		179585135	-1	no_errors	ENST00000342992	ensembl	human	known	70_37	missense	SNP	0.999	T
UACA	55075	genome.wustl.edu	37	15	70952492	70952492	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr15:70952492G>T	ENST00000322954.6	-	18	4362	c.4177C>A	c.(4177-4179)Cag>Aag	p.Q1393K	UACA_ENST00000539319.1_Missense_Mutation_p.Q1284K|UACA_ENST00000560441.1_Missense_Mutation_p.Q1378K|UACA_ENST00000379983.2_Missense_Mutation_p.Q1380K	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	1393					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						TTCTTTACCTGTGCAGCACTA	0.328																																																	0													129.0	122.0	125.0					15																	70952492		2199	4298	6497	SO:0001583	missense	55075			AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.4177C>A	15.37:g.70952492G>T	ENSP00000314556:p.Gln1393Lys		G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Prefoldin,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_T_SNARE_dom,prints_Ankyrin_rpt	p.Q1393K	ENST00000322954.6	37	c.4177	CCDS10235.1	15	.	.	.	.	.	.	.	.	.	.	G	26.8	4.775371	0.90108	.	.	ENSG00000137831	ENST00000322954;ENST00000379983;ENST00000539319	T;T;T	0.50277	0.75;0.75;0.75	5.45	5.45	0.79879	.	0.106321	0.42420	D	0.000708	T	0.70692	0.3253	M	0.75615	2.305	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.83275	0.996;0.991;0.99	T	0.73212	-0.4054	10	0.66056	D	0.02	-3.7466	19.2859	0.94069	0.0:0.0:1.0:0.0	.	1284;1393;1380	F5H2B9;Q9BZF9;G3XAG2	.;UACA_HUMAN;.	K	1393;1380;1284	ENSP00000314556:Q1393K;ENSP00000369319:Q1380K;ENSP00000438667:Q1284K	ENSP00000314556:Q1393K	Q	-	1	0	UACA	68739546	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.148000	0.77389	2.552000	0.86080	0.555000	0.69702	CAG	UACA	-	NULL		0.328	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UACA	HGNC	protein_coding	OTTHUMT00000257199.2	G			70952492	-1	no_errors	ENST00000322954	ensembl	human	known	70_37	missense	SNP	1.000	T
USP34	9736	genome.wustl.edu	37	2	61493167	61493167	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr2:61493167C>T	ENST00000398571.2	-	42	5645	c.5569G>A	c.(5569-5571)Gag>Aag	p.E1857K		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	1857					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			CTGTAGTTCTCAACAGACCCC	0.393																																																	0													148.0	137.0	140.0					2																	61493167		1866	4101	5967	SO:0001583	missense	9736			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.5569G>A	2.37:g.61493167C>T	ENSP00000381577:p.Glu1857Lys		A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.E1857K	ENST00000398571.2	37	c.5569	CCDS42686.1	2	.	.	.	.	.	.	.	.	.	.	C	19.34	3.808931	0.70797	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571;ENST00000453734	T;T	0.03889	3.92;3.77	5.48	5.48	0.80851	Armadillo-type fold (1);	0.053154	0.64402	D	0.000001	T	0.08358	0.0208	N	0.08118	0	0.58432	D	0.999998	P	0.52842	0.956	D	0.65010	0.931	T	0.57802	-0.7748	10	0.22706	T	0.39	.	17.5436	0.87855	0.0:1.0:0.0:0.0	.	1857	Q70CQ2	UBP34_HUMAN	K	1705;1705;1857;135	ENSP00000381577:E1857K;ENSP00000410559:E135K	ENSP00000263989:E1705K	E	-	1	0	USP34	61346671	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.584000	0.87258	0.563000	0.77884	GAG	USP34	-	superfamily_ARM-type_fold		0.393	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP34	HGNC	protein_coding	OTTHUMT00000325650.4	C			61493167	-1	no_errors	ENST00000398571	ensembl	human	known	70_37	missense	SNP	1.000	T
UNC80	285175	genome.wustl.edu	37	2	210682667	210682667	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr2:210682667G>A	ENST00000439458.1	+	11	1764	c.1684G>A	c.(1684-1686)Gtc>Atc	p.V562I	UNC80_ENST00000272845.6_Missense_Mutation_p.V562I	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	562					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						AGAAAACACCGTCAAGGAAGG	0.542																																																	0													39.0	43.0	42.0					2																	210682667		692	1591	2283	SO:0001583	missense	285175			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.1684G>A	2.37:g.210682667G>A	ENSP00000391088:p.Val562Ile		B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	NULL	p.V562I	ENST00000439458.1	37	c.1684	CCDS46504.1	2	.	.	.	.	.	.	.	.	.	.	G	10.04	1.241131	0.22711	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.32988	1.43;1.43	6.07	1.21	0.21127	.	.	.	.	.	T	0.12944	0.0314	N	0.12182	0.205	0.80722	D	1	B	0.10296	0.003	B	0.08055	0.003	T	0.14587	-1.0467	9	0.23891	T	0.37	-7.3655	2.5577	0.04764	0.1815:0.1083:0.4866:0.2237	.	562	Q8N2C7	UNC80_HUMAN	I	562	ENSP00000391088:V562I;ENSP00000272845:V562I	ENSP00000272845:V562I	V	+	1	0	UNC80	210390912	0.993000	0.37304	0.094000	0.20943	0.989000	0.77384	2.151000	0.42263	-0.055000	0.13244	-0.140000	0.14226	GTC	UNC80	-	NULL		0.542	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	HGNC	protein_coding		G	NM_182587		210682667	+1	no_errors	ENST00000439458	ensembl	human	known	70_37	missense	SNP	0.154	A
VAV2	7410	genome.wustl.edu	37	9	136857230	136857230	+	Silent	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr9:136857230G>C	ENST00000371850.3	-	1	202	c.171C>G	c.(169-171)ctC>ctG	p.L57L	VAV2_ENST00000371851.1_Silent_p.L57L|VAV2_ENST00000486113.1_5'UTR|VAV2_ENST00000406606.3_Silent_p.L57L	NM_001134398.1	NP_001127870.1	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor	57	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	35				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		TGATGTCCTTGAGGTCGATGG	0.721																																																	0													18.0	18.0	18.0					9																	136857230		2197	4295	6492	SO:0001819	synonymous_variant	7410				CCDS6979.1, CCDS48053.1	9q34.1	2013-02-14	2007-07-25		ENSG00000160293	ENSG00000160293		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12658	protein-coding gene	gene with protein product		600428	"""vav 2 oncogene"""			7762982	Standard	NM_003371		Approved		uc004ces.3	P52735	OTTHUMG00000020882	ENST00000371850.3:c.171C>G	9.37:g.136857230G>C			A2RUM4|A8MQ12|B6ZDF5|Q5SYV3|Q5SYV4|Q5SYV5|Q6N012|Q6PIJ9|Q6Q317	Silent	SNP	pfam_DH-domain,pfam_SH3_2,pfam_CAMSAP_CH,pfam_SH3_domain,pfam_SH2,pfam_CH-domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,smart_SH2,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain,prints_SH2,prints_SH3_domain	p.L57	ENST00000371850.3	37	c.171	CCDS48053.1	9																																																																																			VAV2	-	pfam_CAMSAP_CH,pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain		0.721	VAV2-001	KNOWN	basic|CCDS	protein_coding	VAV2	HGNC	protein_coding	OTTHUMT00000054939.1	G			136857230	-1	no_errors	ENST00000371850	ensembl	human	known	70_37	silent	SNP	1.000	C
VAV2	7410	genome.wustl.edu	37	9	136857321	136857321	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr9:136857321G>C	ENST00000371850.3	-	1	111	c.80C>G	c.(79-81)tCg>tGg	p.S27W	VAV2_ENST00000371851.1_Missense_Mutation_p.S27W|VAV2_ENST00000486113.1_5'UTR|VAV2_ENST00000406606.3_Missense_Mutation_p.S27W	NM_001134398.1	NP_001127870.1	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor	27	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	35				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		GACCACGGCCGAGGGCCACAC	0.711																																																	0													17.0	17.0	17.0					9																	136857321		2189	4290	6479	SO:0001583	missense	7410				CCDS6979.1, CCDS48053.1	9q34.1	2013-02-14	2007-07-25		ENSG00000160293	ENSG00000160293		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12658	protein-coding gene	gene with protein product		600428	"""vav 2 oncogene"""			7762982	Standard	NM_003371		Approved		uc004ces.3	P52735	OTTHUMG00000020882	ENST00000371850.3:c.80C>G	9.37:g.136857321G>C	ENSP00000360916:p.Ser27Trp		A2RUM4|A8MQ12|B6ZDF5|Q5SYV3|Q5SYV4|Q5SYV5|Q6N012|Q6PIJ9|Q6Q317	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_2,pfam_CAMSAP_CH,pfam_SH3_domain,pfam_SH2,pfam_CH-domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,smart_SH2,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain,prints_SH2,prints_SH3_domain	p.S27W	ENST00000371850.3	37	c.80	CCDS48053.1	9	.	.	.	.	.	.	.	.	.	.	G	20.4	3.991715	0.74703	.	.	ENSG00000160293	ENST00000371850;ENST00000371851;ENST00000406606;ENST00000325440	T;T;T	0.60424	0.19;0.19;0.19	3.55	3.55	0.40652	Calponin homology domain (5);	0.000000	0.42548	U	0.000693	T	0.72550	0.3474	M	0.66939	2.045	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.99	T	0.76724	-0.2854	10	0.72032	D	0.01	.	14.0543	0.64756	0.0:0.0:1.0:0.0	.	27;27	P52735;P52735-3	VAV2_HUMAN;.	W	27	ENSP00000360916:S27W;ENSP00000360917:S27W;ENSP00000385362:S27W	ENSP00000317258:S27W	S	-	2	0	VAV2	135847142	1.000000	0.71417	0.979000	0.43373	0.758000	0.43043	5.633000	0.67825	1.521000	0.48983	0.185000	0.17295	TCG	VAV2	-	pfam_CAMSAP_CH,pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain		0.711	VAV2-001	KNOWN	basic|CCDS	protein_coding	VAV2	HGNC	protein_coding	OTTHUMT00000054939.1	G			136857321	-1	no_errors	ENST00000371850	ensembl	human	known	70_37	missense	SNP	1.000	C
CFAP43	80217	genome.wustl.edu	37	10	105893321	105893321	+	5'UTR	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr10:105893321G>A	ENST00000479392.1	-	0	416				WDR96_ENST00000357060.3_Intron|WDR96_ENST00000428666.1_Intron																NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						ctggttaaatgaatgaatACA	0.313																																																	0																																										SO:0001623	5_prime_UTR_variant	80217																														ENST00000479392.1:c.-110C>T	10.37:g.105893321G>A				RNA	SNP	-	NULL	ENST00000479392.1	37	NULL		10																																																																																			WDR96	-	-		0.313	WDR96-004	KNOWN	basic	processed_transcript	WDR96	HGNC	protein_coding	OTTHUMT00000050201.1	G			105893321	-1	no_errors	ENST00000479392	ensembl	human	known	70_37	rna	SNP	0.000	A
WFDC1	58189	genome.wustl.edu	37	16	84353120	84353120	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr16:84353120G>A	ENST00000219454.5	+	4	831	c.505G>A	c.(505-507)Gac>Aac	p.D169N	WFDC1_ENST00000568638.1_Missense_Mutation_p.D169N	NM_001282466.1|NM_001282467.1	NP_001269395.1|NP_001269396.1	Q9HC57	WFDC1_HUMAN	WAP four-disulfide core domain 1	169					negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|response to drug (GO:0042493)|response to estradiol (GO:0032355)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)	9						GAGCCCAGGTGACGTGGCCGA	0.667																																																	0													86.0	67.0	73.0					16																	84353120		2200	4300	6500	SO:0001583	missense	58189			AF302109	CCDS10946.1	16q24.1	2013-01-21			ENSG00000103175	ENSG00000103175		"""WAP four-disulfide core domain containing"""	15466	protein-coding gene	gene with protein product		605322				10967136	Standard	NM_021197		Approved	PS20	uc002fhw.3	Q9HC57	OTTHUMG00000137641	ENST00000219454.5:c.505G>A	16.37:g.84353120G>A	ENSP00000219454:p.Asp169Asn		D3DUL7|Q8NC27|Q9HAU1	Missense_Mutation	SNP	pfam_Whey_acidic_protein_4-diS_core,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core	p.D169N	ENST00000219454.5	37	c.505	CCDS10946.1	16	.	.	.	.	.	.	.	.	.	.	G	5.127	0.209095	0.09757	.	.	ENSG00000103175	ENST00000219454	T	0.30182	1.54	4.43	3.4	0.38934	.	0.053246	0.64402	D	0.000001	T	0.11281	0.0275	N	0.11201	0.11	0.39290	D	0.964726	B	0.32467	0.372	B	0.25614	0.062	T	0.12734	-1.0536	10	0.17832	T	0.49	-42.2978	4.3686	0.11237	0.2887:0.0:0.7113:0.0	.	169	Q9HC57	WFDC1_HUMAN	N	169	ENSP00000219454:D169N	ENSP00000219454:D169N	D	+	1	0	WFDC1	82910621	0.998000	0.40836	0.030000	0.17652	0.212000	0.24457	3.578000	0.53892	2.295000	0.77249	0.555000	0.69702	GAC	WFDC1	-	NULL		0.667	WFDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WFDC1	HGNC	protein_coding	OTTHUMT00000269083.2	G			84353120	+1	no_errors	ENST00000219454	ensembl	human	known	70_37	missense	SNP	0.827	A
WNT5B	81029	genome.wustl.edu	37	12	1741900	1741900	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr12:1741900G>A	ENST00000397196.2	+	3	389	c.157G>A	c.(157-159)Ggg>Agg	p.G53R	WNT5B_ENST00000310594.3_Missense_Mutation_p.G53R|WNT5B_ENST00000542408.1_Missense_Mutation_p.G53R|WNT5B_ENST00000537031.1_Missense_Mutation_p.G53R	NM_032642.2	NP_116031.1	Q9H1J7	WNT5B_HUMAN	wingless-type MMTV integration site family, member 5B	53					cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|fat cell differentiation (GO:0045444)|lens fiber cell development (GO:0070307)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuron differentiation (GO:0030182)|positive regulation of cell migration (GO:0030335)|positive regulation of fat cell differentiation (GO:0045600)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor binding (GO:0005102)			skin(1)	1	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00109)			TCAGCTTCCCGGGCTCTCCCC	0.577																																																	0													90.0	93.0	92.0					12																	1741900		2203	4300	6503	SO:0001583	missense	81029			AB060966	CCDS8510.1	12p13.3	2008-07-07			ENSG00000111186	ENSG00000111186		"""Wingless-type MMTV integration sites"""	16265	protein-coding gene	gene with protein product		606361				11445850	Standard	NM_030775		Approved		uc001qjk.3	Q9H1J7	OTTHUMG00000090375	ENST00000397196.2:c.157G>A	12.37:g.1741900G>A	ENSP00000380379:p.Gly53Arg		A8K315|D3DUP9|Q96S49|Q9BV04	Missense_Mutation	SNP	pfam_Wnt,smart_Wnt,prints_Wnt	p.G53R	ENST00000397196.2	37	c.157	CCDS8510.1	12	.	.	.	.	.	.	.	.	.	.	G	29.8	5.039525	0.93630	.	.	ENSG00000111186	ENST00000539198;ENST00000545811;ENST00000537031;ENST00000310594;ENST00000397196;ENST00000543071;ENST00000542408	T;T;T;T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02;-1.02;-1.02;-1.02	5.0	5.0	0.66597	.	0.090873	0.85682	D	0.000000	D	0.88448	0.6439	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.89878	0.4028	10	0.87932	D	0	.	18.6661	0.91491	0.0:0.0:1.0:0.0	.	53	Q9H1J7	WNT5B_HUMAN	R	53	ENSP00000438414:G53R;ENSP00000445395:G53R;ENSP00000439312:G53R;ENSP00000308887:G53R;ENSP00000380379:G53R;ENSP00000442348:G53R;ENSP00000440600:G53R	ENSP00000308887:G53R	G	+	1	0	WNT5B	1612161	1.000000	0.71417	0.949000	0.38748	0.982000	0.71751	4.746000	0.62133	2.475000	0.83589	0.557000	0.71058	GGG	WNT5B	-	pfam_Wnt,smart_Wnt		0.577	WNT5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT5B	HGNC	protein_coding	OTTHUMT00000206747.2	G			1741900	+1	no_errors	ENST00000310594	ensembl	human	known	70_37	missense	SNP	1.000	A
XPC	7508	genome.wustl.edu	37	3	14199944	14199944	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr3:14199944G>A	ENST00000285021.7	-	9	1653	c.1439C>T	c.(1438-1440)tCc>tTc	p.S480F	XPC_ENST00000449060.2_Missense_Mutation_p.S443F	NM_001145769.1|NM_004628.4	NP_001139241.1|NP_004619.3	Q01831	XPC_HUMAN	xeroderma pigmentosum, complementation group C	480	Arg/Lys-rich (basic).				DNA repair (GO:0006281)|intra-S DNA damage checkpoint (GO:0031573)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage recognition (GO:0000715)|nucleotide-excision repair, DNA damage removal (GO:0000718)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to drug (GO:0042493)|response to UV-B (GO:0010224)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|XPC complex (GO:0071942)	bubble DNA binding (GO:0000405)|damaged DNA binding (GO:0003684)|heteroduplex DNA loop binding (GO:0000404)|single-stranded DNA binding (GO:0003697)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GGCACTCTTGGACCCAGCCTT	0.567			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														yes	Rec		Xeroderma pigmentosum (C)	3	3p25	7508	"""xeroderma pigmentosum, complementation group C"""		E	0													36.0	36.0	36.0					3																	14199944		1568	3582	5150	SO:0001583	missense	7508	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV		CCDS46763.1	3p25.1	2014-09-17			ENSG00000154767	ENSG00000154767			12816	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group C protein"""	613208				1522891	Standard	NM_004628		Approved	XPCC, RAD4	uc011ave.2	Q01831	OTTHUMG00000155526	ENST00000285021.7:c.1439C>T	3.37:g.14199944G>A	ENSP00000285021:p.Ser480Phe		B4DIP3|E9PB96|E9PH69|Q53GT7|Q96AX0	Missense_Mutation	SNP	pfam_Rad4/PNGase_transGLS-fold,pfam_Rad4_beta-hairpin_dom3,pfam_Rad4_beta-hairpin_dom2,pfam_Rad4_beta-hairpin_dom1,tigrfam_DNA_repair_Rad4_subgr	p.S480F	ENST00000285021.7	37	c.1439	CCDS46763.1	3	.	.	.	.	.	.	.	.	.	.	G	10.91	1.482874	0.26598	.	.	ENSG00000154767	ENST00000285021;ENST00000449060;ENST00000545431	T;T	0.37411	1.2;1.22	5.52	5.52	0.82312	.	0.653207	0.16153	N	0.227143	T	0.38188	0.1031	L	0.60455	1.87	0.20307	N	0.999912	B;B	0.13594	0.008;0.008	B;B	0.16722	0.009;0.016	T	0.30446	-0.9978	10	0.72032	D	0.01	-6.4793	13.4886	0.61382	0.0:0.0:0.8443:0.1557	.	443;480	E9PH69;Q01831	.;XPC_HUMAN	F	480;443;70	ENSP00000285021:S480F;ENSP00000404002:S443F	ENSP00000285021:S480F	S	-	2	0	XPC	14174946	0.861000	0.29849	0.177000	0.23020	0.137000	0.21094	3.943000	0.56621	2.595000	0.87683	0.655000	0.94253	TCC	XPC	-	tigrfam_DNA_repair_Rad4_subgr		0.567	XPC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XPC	HGNC	protein_coding	OTTHUMT00000340517.3	G	NM_004628		14199944	-1	no_errors	ENST00000285021	ensembl	human	known	70_37	missense	SNP	0.414	A
ZFHX4	79776	genome.wustl.edu	37	8	77764826	77764826	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr8:77764826C>G	ENST00000521891.2	+	10	6117	c.5669C>G	c.(5668-5670)tCc>tGc	p.S1890C	ZFHX4_ENST00000050961.6_Missense_Mutation_p.S1845C|ZFHX4_ENST00000518282.1_Missense_Mutation_p.S1864C|ZFHX4_ENST00000455469.2_Missense_Mutation_p.S1845C	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1845					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.S1890Y(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AAGCAAAAATCCTTGGAACCA	0.433										HNSCC(33;0.089)																																							1	Substitution - Missense(1)	lung(1)											33.0	29.0	30.0					8																	77764826		1879	4115	5994	SO:0001583	missense	79776				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.5669C>G	8.37:g.77764826C>G	ENSP00000430497:p.Ser1890Cys		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.S1890C	ENST00000521891.2	37	c.5669	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	C	11.62	1.693460	0.30052	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.52526	0.66;0.71;0.68;0.68	4.71	4.71	0.59529	.	0.177434	0.27031	U	0.021265	T	0.41766	0.1173	L	0.45581	1.43	0.26338	N	0.977408	P;P;P	0.44816	0.758;0.844;0.844	B;B;B	0.39379	0.156;0.298;0.298	T	0.47433	-0.9118	10	0.54805	T	0.06	.	13.958	0.64162	0.0:0.8481:0.1519:0.0	.	1845;1845;1890	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	C	1890;1890;1845;1845;1864	ENSP00000430497:S1890C;ENSP00000399605:S1845C;ENSP00000050961:S1845C;ENSP00000430848:S1864C	ENSP00000050961:S1845C	S	+	2	0	ZFHX4	77927381	0.886000	0.30341	0.819000	0.32651	0.998000	0.95712	3.808000	0.55598	2.631000	0.89168	0.632000	0.83419	TCC	ZFHX4	-	NULL		0.433	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	C	NM_024721		77764826	+1	no_errors	ENST00000521891	ensembl	human	known	70_37	missense	SNP	0.837	G
ZNF169	169841	genome.wustl.edu	37	9	97055557	97055557	+	Intron	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr9:97055557C>G	ENST00000395395.2	+	4	346				ZNF169_ENST00000375354.4_Intron|ZNF169_ENST00000480716.1_Intron|ZNF169_ENST00000481550.2_3'UTR|ZNF169_ENST00000340911.4_Intron	NM_194320.2	NP_919301.2	Q14929	ZN169_HUMAN	zinc finger protein 169						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	24		Acute lymphoblastic leukemia(62;0.136)				TCTCCTTCCTCCATCAGGGAG	0.557																																																	0																																										SO:0001627	intron_variant	169841			U28322	CCDS6709.2	9q22.32	2014-07-30			ENSG00000175787	ENSG00000175787		"""Zinc fingers, C2H2-type"", ""-"""	12957	protein-coding gene	gene with protein product		603404				9186526, 9071574	Standard	NM_001301275		Approved	MGC51961	uc004aum.1	Q14929	OTTHUMG00000020264	ENST00000395395.2:c.256+206C>G	9.37:g.97055557C>G			A2AGP5|A8K127|Q6PI28	RNA	SNP	-	NULL	ENST00000395395.2	37	NULL	CCDS6709.2	9																																																																																			ZNF169	-	-		0.557	ZNF169-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF169	HGNC	protein_coding	OTTHUMT00000253714.1	C	NM_194320		97055557	+1	no_errors	ENST00000481550	ensembl	human	known	70_37	rna	SNP	0.002	G
ZNF280A	129025	genome.wustl.edu	37	22	22868784	22868784	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr22:22868784C>T	ENST00000302097.3	-	2	1423	c.1171G>A	c.(1171-1173)Gaa>Aaa	p.E391K		NM_080740.3	NP_542778.1	P59817	Z280A_HUMAN	zinc finger protein 280A	391					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E391K(1)		endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	18	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		TAGGGCATTTCGCCAGGCTTA	0.453																																																	1	Substitution - Missense(1)	endometrium(1)											114.0	94.0	101.0					22																	22868784		2203	4297	6500	SO:0001583	missense	129025			D87009	CCDS13800.1	22q11.21	2007-09-20	2007-09-20	2007-09-20	ENSG00000169548	ENSG00000169548			18597	protein-coding gene	gene with protein product			"""zinc finger protein 280"", ""suppressor of hairy wing homolog 1 (Drosophila)"""	ZNF280, SUHW1		9074928	Standard	NM_080740		Approved	3'OY11.1, ZNF636	uc002zwe.3	P59817	OTTHUMG00000030545	ENST00000302097.3:c.1171G>A	22.37:g.22868784C>T	ENSP00000302855:p.Glu391Lys			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E391K	ENST00000302097.3	37	c.1171	CCDS13800.1	22	.	.	.	.	.	.	.	.	.	.	C	21.2	4.113354	0.77210	.	.	ENSG00000169548	ENST00000302097	T	0.34859	1.34	3.9	0.441	0.16577	.	.	.	.	.	T	0.50154	0.1599	M	0.92317	3.295	0.33224	D	0.555079	D	0.60160	0.987	P	0.50136	0.632	T	0.61192	-0.7112	9	0.62326	D	0.03	-5.291	4.5073	0.11894	0.2116:0.5871:0.0:0.2013	.	391	P59817	Z280A_HUMAN	K	391	ENSP00000302855:E391K	ENSP00000302855:E391K	E	-	1	0	ZNF280A	21198784	0.994000	0.37717	0.256000	0.24389	0.895000	0.52256	3.146000	0.50631	0.150000	0.19136	0.655000	0.94253	GAA	ZNF280A	-	NULL		0.453	ZNF280A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF280A	HGNC	protein_coding	OTTHUMT00000075433.3	C	NM_080740		22868784	-1	no_errors	ENST00000302097	ensembl	human	known	70_37	missense	SNP	0.936	T
ZNF423	23090	genome.wustl.edu	37	16	49672168	49672168	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr16:49672168G>C	ENST00000561648.1	-	4	948	c.895C>G	c.(895-897)Cac>Gac	p.H299D	ZNF423_ENST00000567169.1_Missense_Mutation_p.H182D|ZNF423_ENST00000535559.1_Missense_Mutation_p.H182D|ZNF423_ENST00000562520.1_Missense_Mutation_p.H239D|ZNF423_ENST00000562871.1_Missense_Mutation_p.H239D|ZNF423_ENST00000563137.2_Missense_Mutation_p.H239D|ZNF423_ENST00000262383.2_Missense_Mutation_p.H299D	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	299					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				TCAGGGCAGTGAATGCACTGC	0.612																																																	0													101.0	70.0	81.0					16																	49672168		2198	4300	6498	SO:0001583	missense	23090			AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.895C>G	16.37:g.49672168G>C	ENSP00000455426:p.His299Asp		O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H299D	ENST00000561648.1	37	c.895	CCDS32445.1	16	.	.	.	.	.	.	.	.	.	.	G	16.11	3.030745	0.54790	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.07216	3.21;3.21	5.0	5.0	0.66597	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.16854	0.0405	L	0.54323	1.7	0.43025	D	0.99458	D	0.57899	0.981	P	0.50537	0.643	T	0.01301	-1.1391	9	.	.	.	.	18.3069	0.90185	0.0:0.0:1.0:0.0	.	299	Q2M1K9	ZN423_HUMAN	D	299;182	ENSP00000262383:H299D;ENSP00000442321:H182D	.	H	-	1	0	ZNF423	48229669	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	5.657000	0.67996	2.331000	0.79229	0.561000	0.74099	CAC	ZNF423	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.612	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF423	HGNC	protein_coding	OTTHUMT00000423258.1	G	NM_015069		49672168	-1	no_errors	ENST00000262383	ensembl	human	known	70_37	missense	SNP	1.000	C
ZNF556	80032	genome.wustl.edu	37	19	2877608	2877608	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr19:2877608C>G	ENST00000307635.2	+	4	739	c.652C>G	c.(652-654)Ctc>Gtc	p.L218V	ZNF556_ENST00000586426.1_Missense_Mutation_p.L217V	NM_024967.1	NP_079243.1	Q9HAH1	ZN556_HUMAN	zinc finger protein 556	218					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(3)|skin(7)	31				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTCCCACTCTCTCACTGAACA	0.498																																																	0													75.0	77.0	76.0					19																	2877608		2203	4300	6503	SO:0001583	missense	80032			BC009374	CCDS12097.1, CCDS74254.1	19p13.3	2013-09-20			ENSG00000172000	ENSG00000172000		"""Zinc fingers, C2H2-type"", ""-"""	25669	protein-coding gene	gene with protein product						12477932	Standard	XM_005259647		Approved	FLJ11637	uc002lwp.1	Q9HAH1	OTTHUMG00000180501	ENST00000307635.2:c.652C>G	19.37:g.2877608C>G	ENSP00000302603:p.Leu218Val		Q96GM3	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L218V	ENST00000307635.2	37	c.652	CCDS12097.1	19	.	.	.	.	.	.	.	.	.	.	C	10.24	1.294420	0.23564	.	.	ENSG00000172000	ENST00000307635	T	0.52983	0.64	2.44	0.0477	0.14281	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.58293	0.2112	M	0.89534	3.04	0.09310	N	1	P	0.41624	0.757	P	0.47744	0.556	T	0.53330	-0.8454	9	0.62326	D	0.03	.	4.8031	0.13307	0.0:0.6342:0.2223:0.1435	.	218	Q9HAH1	ZN556_HUMAN	V	218	ENSP00000302603:L218V	ENSP00000302603:L218V	L	+	1	0	ZNF556	2828608	0.000000	0.05858	0.003000	0.11579	0.022000	0.10575	-0.019000	0.12546	-0.150000	0.11195	0.407000	0.27541	CTC	ZNF556	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.498	ZNF556-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF556	HGNC	protein_coding	OTTHUMT00000451638.2	C	NM_024967		2877608	+1	no_errors	ENST00000307635	ensembl	human	known	70_37	missense	SNP	0.000	G
ZNF613	79898	genome.wustl.edu	37	19	52448073	52448073	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr19:52448073G>A	ENST00000293471.6	+	6	1616	c.937G>A	c.(937-939)Gag>Aag	p.E313K	ZNF613_ENST00000391794.4_Missense_Mutation_p.E277K	NM_001031721.3	NP_001026891.2	Q6PF04	ZN613_HUMAN	zinc finger protein 613	313					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	19		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.0183)		TCATACAGGAGAGAAACCACA	0.443																																																	0													69.0	73.0	72.0					19																	52448073		2203	4300	6503	SO:0001583	missense	79898			AK027565	CCDS12844.1, CCDS33089.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	25827	protein-coding gene	gene with protein product						12477932	Standard	NM_001031721		Approved	FLJ13590	uc002pxz.2	Q6PF04		ENST00000293471.6:c.937G>A	19.37:g.52448073G>A	ENSP00000293471:p.Glu313Lys		Q96SS9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E313K	ENST00000293471.6	37	c.937	CCDS33089.1	19	.	.	.	.	.	.	.	.	.	.	G	19.06	3.753941	0.69648	.	.	ENSG00000176024	ENST00000293471;ENST00000391794	T;T	0.24350	1.86;1.86	3.36	3.36	0.38483	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.33895	N	0.004445	T	0.36936	0.0985	L	0.48877	1.53	0.27914	N	0.938499	P	0.51351	0.944	P	0.56563	0.801	T	0.14144	-1.0483	10	0.54805	T	0.06	.	14.0307	0.64613	0.0:0.0:1.0:0.0	.	313	Q6PF04	ZN613_HUMAN	K	313;277	ENSP00000293471:E313K;ENSP00000375671:E277K	ENSP00000293471:E313K	E	+	1	0	ZNF613	57139885	1.000000	0.71417	0.998000	0.56505	0.953000	0.61014	6.526000	0.73799	1.890000	0.54733	0.655000	0.94253	GAG	ZNF613	-	pfscan_Znf_C2H2		0.443	ZNF613-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF613	HGNC	protein_coding	OTTHUMT00000461104.2	G	NM_024840		52448073	+1	no_errors	ENST00000293471	ensembl	human	known	70_37	missense	SNP	1.000	A
ZNF839	55778	genome.wustl.edu	37	14	102802038	102802038	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr14:102802038C>T	ENST00000558850.1	+	5	1524	c.1174C>T	c.(1174-1176)Cat>Tat	p.H392Y	ZNF839_ENST00000559185.1_Missense_Mutation_p.H392Y|ZNF839_ENST00000262236.5_Missense_Mutation_p.H392Y|ZNF839_ENST00000442396.2_Missense_Mutation_p.H508Y	NM_001267827.1	NP_001254756.1	A8K0R7	ZN839_HUMAN	zinc finger protein 839	392							metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19						TGAAAAAGATCATCTAGCAAA	0.328																																																	0													53.0	46.0	48.0					14																	102802038		1817	4070	5887	SO:0001583	missense	55778			AK093342	CCDS45164.1, CCDS58336.1	14q32.32	2010-05-06	2008-06-23	2008-06-23	ENSG00000022976	ENSG00000022976			20345	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 131"""	C14orf131			Standard	NM_018335		Approved		uc010awk.2	A8K0R7		ENST00000558850.1:c.1174C>T	14.37:g.102802038C>T	ENSP00000453363:p.His392Tyr		B3KSD2|Q53FH5|Q6GPI5|Q86TU1|Q9BQ86|Q9NUU3	Missense_Mutation	SNP	pfscan_Znf_C2H2	p.H508Y	ENST00000558850.1	37	c.1522	CCDS58336.1	14	.	.	.	.	.	.	.	.	.	.	C	11.02	1.516127	0.27123	.	.	ENSG00000022976	ENST00000442396;ENST00000262236;ENST00000398436	T;T	0.18502	2.21;2.22	4.97	3.1	0.35709	.	0.720633	0.13084	N	0.415084	T	0.17280	0.0415	L	0.49126	1.545	0.09310	N	1	B;B;B;P	0.37573	0.395;0.244;0.395;0.6	B;B;B;B	0.40009	0.157;0.091;0.157;0.316	T	0.14643	-1.0465	10	0.42905	T	0.14	.	6.2211	0.20681	0.1389:0.6542:0.0:0.207	.	508;392;271;392	A8K0R7-5;A8K0R7-2;Q9NT83;A8K0R7	.;.;.;ZN839_HUMAN	Y	508;392;60	ENSP00000399863:H508Y;ENSP00000262236:H392Y	ENSP00000262236:H392Y	H	+	1	0	ZNF839	101871791	0.000000	0.05858	0.001000	0.08648	0.687000	0.40016	0.390000	0.20768	0.508000	0.28173	0.447000	0.29281	CAT	ZNF839	-	NULL		0.328	ZNF839-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF839	HGNC	protein_coding	OTTHUMT00000415492.2	C	NM_018335		102802038	+1	no_errors	ENST00000442396	ensembl	human	known	70_37	missense	SNP	0.000	T
ZSCAN22	342945	genome.wustl.edu	37	19	58850077	58850077	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RK-01A-11D-A18J-09	TCGA-EK-A2RK-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	db76d80c-fc42-4c87-a81a-b24328659356	4899ab66-79f9-45d7-8334-ac9137cecb72	g.chr19:58850077G>C	ENST00000329665.4	+	3	1008	c.861G>C	c.(859-861)caG>caC	p.Q287H		NM_181846.2	NP_862829.1	P10073	ZSC22_HUMAN	zinc finger and SCAN domain containing 22	287					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|pancreas(1)|prostate(2)	16		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0289)		AGGCACACCAGAAGACCCATT	0.592																																																	0													152.0	158.0	156.0					19																	58850077		2203	4300	6503	SO:0001583	missense	342945			M20675	CCDS12975.1	19q13.43	2013-01-08	2006-09-20	2006-09-20				"""-"", ""Zinc fingers, C2H2-type"""	4929	protein-coding gene	gene with protein product	"""oncogene HKR2"""	165260	"""zinc finger protein 50"", ""GLI-Kruppel family member HKR2"""	ZNF50, HKR2		2850480, 1505991	Standard	NM_181846		Approved		uc002qsc.2	P10073		ENST00000329665.4:c.861G>C	19.37:g.58850077G>C	ENSP00000332433:p.Gln287His		Q15922|Q7Z3L8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.Q287H	ENST00000329665.4	37	c.861	CCDS12975.1	19	.	.	.	.	.	.	.	.	.	.	G	9.392	1.075749	0.20227	.	.	ENSG00000182318	ENST00000329665	T	0.07567	3.18	3.85	2.7	0.31948	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09468	0.0233	M	0.64080	1.96	0.26316	N	0.97776	P	0.35139	0.486	B	0.34346	0.18	T	0.19257	-1.0311	9	0.62326	D	0.03	.	4.9342	0.13932	0.1202:0.2188:0.661:0.0	.	287	P10073	ZSC22_HUMAN	H	287	ENSP00000332433:Q287H	ENSP00000332433:Q287H	Q	+	3	2	ZSCAN22	63541889	0.002000	0.14202	0.993000	0.49108	0.345000	0.29048	1.034000	0.30204	2.128000	0.65567	0.313000	0.20887	CAG	ZSCAN22	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.592	ZSCAN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN22	HGNC	protein_coding	OTTHUMT00000466765.1	G	NM_181846		58850077	+1	no_errors	ENST00000329665	ensembl	human	known	70_37	missense	SNP	0.643	C
