#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ABCA13	154664	genome.wustl.edu	37	7	48349706	48349706	+	Nonsense_Mutation	SNP	C	C	T	rs376273529		TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr7:48349706C>T	ENST00000435803.1	+	24	9508	c.9484C>T	c.(9484-9486)Cga>Tga	p.R3162*		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3162					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						GTTGCTGAGTCGAAACTTGGA	0.512													C|||	1	0.000199681	0.0	0.0	5008	,	,		19296	0.0		0.0	False		,,,				2504	0.001																0								C	stop/ARG	1,4007		0,1,2003	259.0	255.0	256.0		9484	5.0	0.0	7		256	0,8378		0,0,4189	no	stop-gained	ABCA13	NM_152701.3		0,1,6192	TT,TC,CC		0.0,0.025,0.0081		3162/5059	48349706	1,12385	2004	4189	6193	SO:0001587	stop_gained	154664			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.9484C>T	7.37:g.48349706C>T	ENSP00000411096:p.Arg3162*		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Nonsense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.R3162*	ENST00000435803.1	37	c.9484	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	C	50	17.068804	0.99878	2.5E-4	0.0	ENSG00000179869	ENST00000435803	.	.	.	5.84	4.96	0.65561	.	0.984861	0.08254	N	0.974213	.	.	.	.	.	.	0.37259	D	0.906896	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.9301	0.63989	0.1516:0.8484:0.0:0.0	.	.	.	.	X	3162	.	ENSP00000411096:R3162X	R	+	1	2	ABCA13	48320252	0.003000	0.15002	0.003000	0.11579	0.023000	0.10783	1.467000	0.35321	1.472000	0.48140	0.655000	0.94253	CGA	ABCA13	-	NULL		0.512	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	C	NM_152701		48349706	+1	no_errors	ENST00000435803	ensembl	human	known	70_37	nonsense	SNP	0.009	T
ABTB2	25841	genome.wustl.edu	37	11	34189500	34189500	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr11:34189500C>T	ENST00000435224.2	-	6	2027	c.1603G>A	c.(1603-1605)Gaa>Aaa	p.E535K	ABTB2_ENST00000298992.2_Missense_Mutation_p.E349K	NM_145804.2	NP_665803.2	Q8N961	ABTB2_HUMAN	ankyrin repeat and BTB (POZ) domain containing 2	535					cellular response to toxic substance (GO:0097237)	nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)				ACCATCGCTTCGTCCCCAGCA	0.552																																																	0													184.0	112.0	136.0					11																	34189500		2202	4298	6500	SO:0001583	missense	25841			AK056863	CCDS7890.1, CCDS7890.2	11p13	2013-10-02			ENSG00000166016	ENSG00000166016		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23842	protein-coding gene	gene with protein product							Standard	NM_145804		Approved	DKFZP586C1619, BTBD22, ABTB2A	uc001mvl.2	Q8N961	OTTHUMG00000044382	ENST00000435224.2:c.1603G>A	11.37:g.34189500C>T	ENSP00000410157:p.Glu535Lys		A8K6S9|E9PRW7|Q52LD6|Q6MZW4|Q8NB44	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Ankyrin_rpt,superfamily_Histone-fold,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like	p.E535K	ENST00000435224.2	37	c.1603	CCDS7890.2	11	.	.	.	.	.	.	.	.	.	.	C	34	5.320358	0.95682	.	.	ENSG00000166016	ENST00000435224;ENST00000298992	T;T	0.63255	-0.03;-0.03	5.03	5.03	0.67393	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.52191	0.1719	N	0.25332	0.735	0.80722	D	1	P	0.36535	0.557	B	0.34779	0.189	T	0.58934	-0.7548	10	0.62326	D	0.03	-24.5875	18.3507	0.90337	0.0:1.0:0.0:0.0	.	349	Q8N961	ABTB2_HUMAN	K	535;349	ENSP00000410157:E535K;ENSP00000298992:E349K	ENSP00000298992:E349K	E	-	1	0	ABTB2	34146076	1.000000	0.71417	0.994000	0.49952	0.614000	0.37383	7.818000	0.86416	2.329000	0.79093	0.491000	0.48974	GAA	ABTB2	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.552	ABTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABTB2	HGNC	protein_coding	OTTHUMT00000388703.3	C	NM_145804		34189500	-1	no_errors	ENST00000435224	ensembl	human	known	70_37	missense	SNP	1.000	T
ACACB	32	genome.wustl.edu	37	12	109625846	109625846	+	Missense_Mutation	SNP	C	C	T	rs202216589		TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr12:109625846C>T	ENST00000338432.7	+	13	2142	c.2023C>T	c.(2023-2025)Cgg>Tgg	p.R675W	ACACB_ENST00000377854.5_Missense_Mutation_p.R675W|ACACB_ENST00000377848.3_Missense_Mutation_p.R675W			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	675	Biotin carboxylation.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	ACTGAATTTCCGGAGCAGCAA	0.512																																																	0								C	TRP/ARG	0,4406		0,0,2203	99.0	98.0	99.0		2023	5.3	1.0	12		99	1,8599	1.2+/-3.3	0,1,4299	no	missense	ACACB	NM_001093.3	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	675/2459	109625846	1,13005	2203	4300	6503	SO:0001583	missense	32			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.2023C>T	12.37:g.109625846C>T	ENSP00000341044:p.Arg675Trp		A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	pfam_AcCoA_COase_cen,pfam_Carboxyl_trans,pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,superfamily_PreATP-grasp_fold,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_COA_CT_N,pfscan_COA_CT_C,pfscan_Biotin_lipoyl	p.R675W	ENST00000338432.7	37	c.2023	CCDS31898.1	12	.	.	.	.	.	.	.	.	.	.	c	32	5.147721	0.94603	0.0	1.16E-4	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854	T;T;T	0.44083	0.93;0.93;0.93	5.27	5.27	0.74061	Rudiment single hybrid motif (1);ATP-grasp fold, subdomain 2 (1);Biotin carboxylation domain (1);Biotin carboxylase, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.77329	0.4114	H	0.96777	3.88	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.85632	0.1271	10	0.87932	D	0	.	18.6174	0.91308	0.0:1.0:0.0:0.0	.	675	O00763	ACACB_HUMAN	W	675	ENSP00000341044:R675W;ENSP00000367079:R675W;ENSP00000367085:R675W	ENSP00000341044:R675W	R	+	1	2	ACACB	108110229	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	7.749000	0.85096	2.509000	0.84616	0.531000	0.56144	CGG	ACACB	-	pfam_Biotin_COase_C,superfamily_Rudment_hybrid_motif,smart_Biotin_COase_C,pfscan_Biotin_carboxylation_dom		0.512	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACB	HGNC	protein_coding	OTTHUMT00000403077.1	C	NM_001093		109625846	+1	no_errors	ENST00000338432	ensembl	human	known	70_37	missense	SNP	1.000	T
ACSM1	116285	genome.wustl.edu	37	16	20682921	20682921	+	Silent	SNP	C	C	G			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr16:20682921C>G	ENST00000307493.4	-	4	751	c.684G>C	c.(682-684)ggG>ggC	p.G228G	ACSM1_ENST00000219151.4_5'UTR|ACSM1_ENST00000520010.1_Silent_p.G228G	NM_052956.2	NP_443188.2	Q08AH1	ACSM1_HUMAN	acyl-CoA synthetase medium-chain family member 1	228					benzoate metabolic process (GO:0018874)|butyrate metabolic process (GO:0019605)|cholesterol homeostasis (GO:0042632)|energy derivation by oxidation of organic compounds (GO:0015980)|fatty acid biosynthetic process (GO:0006633)|fatty acid oxidation (GO:0019395)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	blood microparticle (GO:0072562)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	acyl-CoA ligase activity (GO:0003996)|ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty acid ligase activity (GO:0015645)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(23)|skin(3)|upper_aerodigestive_tract(2)	42						AGCCTGTGGTCCCACTGGTGA	0.517																																																	0													126.0	104.0	112.0					16																	20682921		2201	4300	6501	SO:0001819	synonymous_variant	116285			AB059429	CCDS10587.1	16p12.3	2008-02-05	2005-09-08	2005-09-08	ENSG00000166743	ENSG00000166743	6.2.1.2	"""Acyl-CoA synthetase family"""	18049	protein-coding gene	gene with protein product		614357	"""butyryl Coenzyme A synthetase 1"""	BUCS1		11470804, 12654705	Standard	NM_052956		Approved	MACS1	uc002dhm.1	Q08AH1	OTTHUMG00000131550	ENST00000307493.4:c.684G>C	16.37:g.20682921C>G			Q08AH2|Q96A20	Silent	SNP	pfam_AMP-dep_Synth/Lig	p.G228	ENST00000307493.4	37	c.684	CCDS10587.1	16																																																																																			ACSM1	-	pfam_AMP-dep_Synth/Lig		0.517	ACSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM1	HGNC	protein_coding	OTTHUMT00000254412.1	C	NM_052956		20682921	-1	no_errors	ENST00000307493	ensembl	human	known	70_37	silent	SNP	0.997	G
ACTL7A	10881	genome.wustl.edu	37	9	111625118	111625118	+	Silent	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr9:111625118G>A	ENST00000333999.3	+	1	516	c.516G>A	c.(514-516)ccG>ccA	p.P172P		NM_006687.2	NP_006678.1	Q9Y615	ACL7A_HUMAN	actin-like 7A	172						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|male germ cell nucleus (GO:0001673)|motile cilium (GO:0031514)|nucleus (GO:0005634)|protein complex (GO:0043234)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|endometrium(2)|large_intestine(4)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						TTTCAGACCCGCCACTGAGCC	0.532																																					Esophageal Squamous(177;1480 3591 17554)												0													100.0	98.0	98.0					9																	111625118		2203	4300	6503	SO:0001819	synonymous_variant	10881			BC014610	CCDS6772.1	9q31	2008-02-05			ENSG00000187003	ENSG00000187003			161	protein-coding gene	gene with protein product		604303				10373328	Standard	NM_006687		Approved		uc004bdj.1	Q9Y615	OTTHUMG00000020461	ENST00000333999.3:c.516G>A	9.37:g.111625118G>A			B2RC83|Q5JSV0	Silent	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.P172	ENST00000333999.3	37	c.516	CCDS6772.1	9																																																																																			ACTL7A	-	pfam_Actin-like,smart_Actin-like		0.532	ACTL7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL7A	HGNC	protein_coding	OTTHUMT00000053570.1	G	NM_006687		111625118	+1	no_errors	ENST00000333999	ensembl	human	known	70_37	silent	SNP	0.402	A
AGBL1	123624	genome.wustl.edu	37	15	86697674	86697674	+	Silent	SNP	A	A	G			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr15:86697674A>G	ENST00000441037.2	+	3	233	c.138A>G	c.(136-138)ggA>ggG	p.G46G	AGBL1_ENST00000421325.2_Silent_p.G46G	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	46					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						AAAAGATTGGACGGAAGGCCC	0.448																																																	0													79.0	80.0	80.0					15																	86697674		1906	4125	6031	SO:0001819	synonymous_variant	123624			AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.138A>G	15.37:g.86697674A>G			A1A4X5|A6NJH6|C9JHL5	Silent	SNP	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.G46	ENST00000441037.2	37	c.138	CCDS58398.1	15																																																																																			AGBL1	-	superfamily_ARM-type_fold		0.448	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	AGBL1	HGNC	protein_coding	OTTHUMT00000314929.5	A	NM_152336		86697674	+1	no_errors	ENST00000441037	ensembl	human	known	70_37	silent	SNP	1.000	G
AGBL3	340351	genome.wustl.edu	37	7	134730620	134730620	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr7:134730620C>T	ENST00000436302.2	+	11	2052	c.1799C>T	c.(1798-1800)tCa>tTa	p.S600L	AGBL3_ENST00000458078.1_Missense_Mutation_p.S574L|AGBL3_ENST00000435976.2_Missense_Mutation_p.S600L	NM_178563.3	NP_848658.3	Q8NEM8	CBPC3_HUMAN	ATP/GTP binding protein-like 3	600						cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|lung(2)|skin(3)	10						TTTGAGGATTCAGACACACCT	0.353																																																	0													83.0	75.0	78.0					7																	134730620		692	1591	2283	SO:0001583	missense	340351			BC030651	CCDS47718.1	7q33	2014-06-23			ENSG00000146856	ENSG00000146856			27981	protein-coding gene	gene with protein product							Standard	NM_178563		Approved	MGC32955, CCP3	uc011kpw.2	Q8NEM8	OTTHUMG00000155406	ENST00000436302.2:c.1799C>T	7.37:g.134730620C>T	ENSP00000388275:p.Ser600Leu		B7Z827|Q9H965	Missense_Mutation	SNP	pfam_Peptidase_M14	p.S574L	ENST00000436302.2	37	c.1721	CCDS47718.1	7	.	.	.	.	.	.	.	.	.	.	C	6.421	0.445726	0.12164	.	.	ENSG00000146856	ENST00000436302;ENST00000458078;ENST00000435976	T;T;T	0.10005	2.93;2.92;2.94	5.33	4.46	0.54185	.	0.700299	0.13306	N	0.397836	T	0.07773	0.0195	L	0.33485	1.01	0.23260	N	0.998025	B	0.13145	0.007	B	0.17433	0.018	T	0.41233	-0.9520	10	0.10902	T	0.67	-9.8304	6.8564	0.24042	0.1443:0.7038:0.0:0.152	.	600	Q8NEM8-4	.	L	600;574;600	ENSP00000388275:S600L;ENSP00000395969:S574L;ENSP00000401220:S600L	ENSP00000275763:S600L	S	+	2	0	AGBL3	134381160	0.998000	0.40836	0.952000	0.39060	0.091000	0.18340	1.673000	0.37534	1.476000	0.48215	-0.143000	0.13931	TCA	AGBL3	-	NULL		0.353	AGBL3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	AGBL3	HGNC	protein_coding	OTTHUMT00000376655.1	C	NM_178563		134730620	+1	no_errors	ENST00000458078	ensembl	human	known	70_37	missense	SNP	0.894	T
AJUBA	84962	genome.wustl.edu	37	14	23445919	23445919	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr14:23445919G>A	ENST00000262713.2	-	3	1486	c.1111C>T	c.(1111-1113)Cga>Tga	p.R371*	AJUBA_ENST00000397388.3_5'UTR|AJUBA_ENST00000361265.4_Nonsense_Mutation_p.R371*|RP11-298I3.5_ENST00000555074.1_Intron	NM_032876.4	NP_116265.1	Q96IF1	AJUBA_HUMAN	ajuba LIM protein	371	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				calcium-dependent cell-cell adhesion (GO:0016339)|cellular protein localization (GO:0034613)|focal adhesion assembly (GO:0048041)|G2/M transition of mitotic cell cycle (GO:0000086)|gene silencing by miRNA (GO:0035195)|glycerophospholipid biosynthetic process (GO:0046474)|lamellipodium assembly (GO:0030032)|mitotic cell cycle (GO:0000278)|negative regulation of hippo signaling (GO:0035331)|negative regulation of kinase activity (GO:0033673)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular biosynthetic process (GO:0031328)|positive regulation of gene silencing by miRNA (GO:2000637)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein complex assembly (GO:0031334)|regulation of cell migration (GO:0030334)|regulation of cellular response to hypoxia (GO:1900037)|regulation of GTPase activity (GO:0043087)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)|wound healing, spreading of epidermal cells (GO:0035313)	cell-cell junction (GO:0005911)|cytoplasmic mRNA processing body (GO:0000932)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcription factor complex (GO:0005667)	alpha-catenin binding (GO:0045294)|chromatin binding (GO:0003682)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)										CGCAAAGTTCGCCCTAGAAAC	0.493																																																	0													118.0	109.0	112.0					14																	23445919		2203	4300	6503	SO:0001587	stop_gained	84962			AK025567	CCDS9581.1, CCDS9582.1	14q11.2	2011-11-10	2011-11-10	2011-11-10	ENSG00000129474	ENSG00000129474			20250	protein-coding gene	gene with protein product		609066	"""jub, ajuba homolog (Xenopus laevis)"""	JUB		10330178	Standard	NM_032876		Approved	MGC15563	uc001whz.3	Q96IF1	OTTHUMG00000028711	ENST00000262713.2:c.1111C>T	14.37:g.23445919G>A	ENSP00000262713:p.Arg371*		A8MX18|D3DS37	Nonsense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.R371*	ENST00000262713.2	37	c.1111	CCDS9581.1	14	.	.	.	.	.	.	.	.	.	.	G	36	5.909110	0.97093	.	.	ENSG00000129474	ENST00000262713;ENST00000361265	.	.	.	5.74	-0.407	0.12385	.	0.185059	0.34802	N	0.003678	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.6627	0.45712	0.0:0.1026:0.3529:0.5444	.	.	.	.	X	371	.	ENSP00000262713:R371X	R	-	1	2	JUB	22515759	0.996000	0.38824	0.900000	0.35374	0.855000	0.48748	2.085000	0.41634	0.029000	0.15352	0.655000	0.94253	CGA	AJUBA	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM		0.493	AJUBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AJUBA	HGNC	protein_coding	OTTHUMT00000071685.2	G			23445919	-1	no_errors	ENST00000262713	ensembl	human	known	70_37	nonsense	SNP	0.379	A
AKAP6	9472	genome.wustl.edu	37	14	33292524	33292524	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr14:33292524G>C	ENST00000280979.4	+	13	5675	c.5505G>C	c.(5503-5505)gaG>gaC	p.E1835D	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1835					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		GTAGCAGTGAGATGACCAATC	0.378																																					Melanoma(49;821 1200 7288 13647 42351)												0													96.0	97.0	96.0					14																	33292524		2203	4300	6503	SO:0001583	missense	9472			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.5505G>C	14.37:g.33292524G>C	ENSP00000280979:p.Glu1835Asp		A7E242|A7E2D4|O15028	Missense_Mutation	SNP	smart_Spectrin/alpha-actinin	p.E1835D	ENST00000280979.4	37	c.5505	CCDS9644.1	14	.	.	.	.	.	.	.	.	.	.	G	4.723	0.134439	0.09032	.	.	ENSG00000151320	ENST00000280979	T	0.05513	3.43	5.48	-5.08	0.02929	.	0.352189	0.30093	N	0.010423	T	0.05181	0.0138	L	0.55103	1.725	0.18873	N	0.999988	B	0.21753	0.06	B	0.17433	0.018	T	0.22417	-1.0217	10	0.35671	T	0.21	-7.3128	7.2086	0.25921	0.4132:0.2811:0.3056:0.0	.	1835	Q13023	AKAP6_HUMAN	D	1835	ENSP00000280979:E1835D	ENSP00000280979:E1835D	E	+	3	2	AKAP6	32362275	0.217000	0.23597	0.000000	0.03702	0.711000	0.40976	0.006000	0.13152	-1.255000	0.02481	0.650000	0.86243	GAG	AKAP6	-	NULL		0.378	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP6	HGNC	protein_coding	OTTHUMT00000276617.2	G	NM_004274		33292524	+1	no_errors	ENST00000280979	ensembl	human	known	70_37	missense	SNP	0.000	C
ANK2	287	genome.wustl.edu	37	4	114281990	114281990	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr4:114281990G>A	ENST00000357077.4	+	39	10746	c.10693G>A	c.(10693-10695)Gag>Aag	p.E3565K	ANK2_ENST00000506722.1_Missense_Mutation_p.E1471K|ANK2_ENST00000394537.3_Missense_Mutation_p.E1480K|ANK2_ENST00000264366.6_Missense_Mutation_p.E3532K|ANK2_ENST00000509550.1_Missense_Mutation_p.E656K|ANK2_ENST00000510275.2_Missense_Mutation_p.E132K	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	3565					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TCCACAGGATGAGCAGGAACG	0.453																																																	0													130.0	114.0	119.0					4																	114281990		2203	4300	6503	SO:0001583	missense	287			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.10693G>A	4.37:g.114281990G>A	ENSP00000349588:p.Glu3565Lys		Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.E3565K	ENST00000357077.4	37	c.10693	CCDS3702.1	4	.	.	.	.	.	.	.	.	.	.	G	19.31	3.803117	0.70682	.	.	ENSG00000145362	ENST00000506722;ENST00000431447;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056;ENST00000509550;ENST00000510275;ENST00000505342	T;T;T;T;T;D;D	0.96200	-0.3;-0.29;-0.31;-0.32;-1.07;-2.07;-3.94	5.28	5.28	0.74379	.	0.376588	0.22155	N	0.063872	D	0.93782	0.8012	L	0.38531	1.155	0.42968	D	0.994421	P;P;P;B;P;B	0.52061	0.881;0.611;0.577;0.012;0.95;0.452	B;B;B;B;P;B	0.48334	0.184;0.343;0.184;0.006;0.574;0.228	D	0.92059	0.5655	10	0.16896	T	0.51	.	18.9144	0.92499	0.0:0.0:1.0:0.0	.	656;515;481;1480;3565;1471	E9PCH6;F8W694;Q7Z344;Q01484-2;Q01484-4;Q01484-5	.;.;.;.;.;.	K	1471;515;1480;3565;3532;1471;656;132;575	ENSP00000421067:E1471K;ENSP00000378044:E1480K;ENSP00000349588:E3565K;ENSP00000264366:E3532K;ENSP00000426944:E656K;ENSP00000421023:E132K;ENSP00000422498:E575K	ENSP00000264366:E3532K	E	+	1	0	ANK2	114501439	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.263000	0.78421	2.487000	0.83934	0.557000	0.71058	GAG	ANK2	-	superfamily_DEATH-like,smart_Death		0.453	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2	G	NM_001148		114281990	+1	no_errors	ENST00000357077	ensembl	human	known	70_37	missense	SNP	1.000	A
ANKRD62	342850	genome.wustl.edu	37	18	12125918	12125918	+	Nonsense_Mutation	SNP	C	C	T	rs557624087	byFrequency	TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr18:12125918C>T	ENST00000587848.2	+	13	2263	c.2098C>T	c.(2098-2100)Cag>Tag	p.Q700*	ANKRD62_ENST00000314074.8_Nonsense_Mutation_p.Q686*|ANKRD62_ENST00000418274.2_3'UTR			A6NC57	ANR62_HUMAN	ankyrin repeat domain 62	700										breast(2)|haematopoietic_and_lymphoid_tissue(1)	3						TTCTCACATTCAGATTCTTTC	0.413																																																	0																																										SO:0001587	stop_gained	342850			BX648696	CCDS67439.1	18p11.21	2014-01-21			ENSG00000181626	ENSG00000181626		"""Ankyrin repeat domain containing"""	35241	protein-coding gene	gene with protein product							Standard	XM_003959949		Approved	DKFZp779B1634	uc031rhk.1	A6NC57	OTTHUMG00000180673	ENST00000587848.2:c.2098C>T	18.37:g.12125918C>T	ENSP00000467740:p.Gln700*			Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.Q686*	ENST00000587848.2	37	c.2056		18	.	.	.	.	.	.	.	.	.	.	.	11.82	1.753816	0.31046	.	.	ENSG00000181626	ENST00000314074;ENST00000418274	.	.	.	1.85	-0.104	0.13605	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	5.1585	0.15048	0.1547:0.2312:0.6141:0.0	.	.	.	.	X	686;422	.	ENSP00000326572:Q686X	Q	+	1	0	ANKRD62	12115918	0.090000	0.21635	0.014000	0.15608	0.028000	0.11728	1.327000	0.33746	-0.036000	0.13669	-0.712000	0.03635	CAG	ANKRD62	-	NULL		0.413	ANKRD62-003	PUTATIVE	basic|appris_candidate_longest	protein_coding	ANKRD62	HGNC	protein_coding	OTTHUMT00000452521.2	C	XM_001715728		12125918	+1	no_errors	ENST00000314074	ensembl	human	known	70_37	nonsense	SNP	0.030	T
ARHGAP6	395	genome.wustl.edu	37	X	11157357	11157357	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chrX:11157357C>T	ENST00000337414.4	-	13	3423	c.2551G>A	c.(2551-2553)Gag>Aag	p.E851K	ARHGAP6_ENST00000380736.1_Missense_Mutation_p.E648K|ARHGAP6_ENST00000303025.6_Missense_Mutation_p.E648K|ARHGAP6_ENST00000534860.1_Intron	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	851					actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						AGCTCACTCTCGCTGAGGTCG	0.692																																																	0													11.0	10.0	11.0					X																	11157357		2174	4265	6439	SO:0001583	missense	395			AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.2551G>A	X.37:g.11157357C>T	ENSP00000338967:p.Glu851Lys		B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.E851K	ENST00000337414.4	37	c.2551	CCDS14140.1	X	.	.	.	.	.	.	.	.	.	.	C	14.89	2.669875	0.47677	.	.	ENSG00000047648	ENST00000380736;ENST00000303025;ENST00000337414	T;T;T	0.26223	1.75;1.75;1.76	5.12	3.26	0.37387	.	0.229900	0.30036	N	0.010576	T	0.19604	0.0471	M	0.65975	2.015	0.09310	N	0.999999	P;B	0.46020	0.871;0.396	B;B	0.30316	0.114;0.062	T	0.17623	-1.0363	10	0.37606	T	0.19	.	8.3499	0.32297	0.0:0.6287:0.2909:0.0804	.	851;851	O43182;A8KAL3	RHG06_HUMAN;.	K	648;648;851	ENSP00000370112:E648K;ENSP00000302312:E648K;ENSP00000338967:E851K	ENSP00000302312:E648K	E	-	1	0	ARHGAP6	11067278	0.664000	0.27457	0.043000	0.18650	0.105000	0.19272	1.224000	0.32539	0.346000	0.23899	0.594000	0.82650	GAG	ARHGAP6	-	NULL		0.692	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP6	HGNC	protein_coding	OTTHUMT00000055760.2	C	NM_013427		11157357	-1	no_errors	ENST00000337414	ensembl	human	known	70_37	missense	SNP	0.088	T
APOOL	139322	genome.wustl.edu	37	X	84329357	84329357	+	Silent	SNP	A	A	G			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chrX:84329357A>G	ENST00000373173.2	+	8	765	c.678A>G	c.(676-678)gaA>gaG	p.E226E		NM_198450.5	NP_940852.3	Q6UXV4	MIC27_HUMAN	apolipoprotein O-like	226						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	8						TGCCAACAGAACTCAGCTCTG	0.373																																																	0													101.0	91.0	95.0					X																	84329357		1854	4085	5939	SO:0001819	synonymous_variant	139322			AK130506	CCDS48138.1	Xq21.1	2007-01-17	2007-01-17	2007-01-17	ENSG00000155008	ENSG00000155008			24009	protein-coding gene	gene with protein product			"""chromosome X open reading frame 33"", ""family with sequence similarity 121A"""	CXorf33, FAM121A		12975309	Standard	NM_198450		Approved	UNQ8193, AAIR8193	uc004eem.3	Q6UXV4	OTTHUMG00000021930	ENST00000373173.2:c.678A>G	X.37:g.84329357A>G			Q3KNU7|Q5H9D1	Silent	SNP	pfam_Apolipoprotein_O	p.E226	ENST00000373173.2	37	c.678	CCDS48138.1	X																																																																																			APOOL	-	NULL		0.373	APOOL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOOL	HGNC	protein_coding	OTTHUMT00000057385.2	A	NM_198450		84329357	+1	no_errors	ENST00000373173	ensembl	human	known	70_37	silent	SNP	0.114	G
ATP7A	538	genome.wustl.edu	37	X	77289250	77289250	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chrX:77289250G>T	ENST00000341514.6	+	17	3597	c.3442G>T	c.(3442-3444)Gtt>Ttt	p.V1148F	ATP7A_ENST00000350425.4_Missense_Mutation_p.V151F|ATP7A_ENST00000343533.5_Missense_Mutation_p.V1070F	NM_000052.5	NP_000043.4	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	1148					blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cartilage development (GO:0051216)|catecholamine metabolic process (GO:0006584)|cellular copper ion homeostasis (GO:0006878)|central nervous system neuron development (GO:0021954)|cerebellar Purkinje cell differentiation (GO:0021702)|collagen fibril organization (GO:0030199)|copper ion export (GO:0060003)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|dendrite morphogenesis (GO:0048813)|detoxification of copper ion (GO:0010273)|dopamine metabolic process (GO:0042417)|elastic fiber assembly (GO:0048251)|elastin biosynthetic process (GO:0051542)|epinephrine metabolic process (GO:0042414)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|lung alveolus development (GO:0048286)|mitochondrion organization (GO:0007005)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of neuron apoptotic process (GO:0043524)|neuron projection morphogenesis (GO:0048812)|norepinephrine biosynthetic process (GO:0042421)|norepinephrine metabolic process (GO:0042415)|peptidyl-lysine modification (GO:0018205)|pigmentation (GO:0043473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of oxidoreductase activity (GO:0051353)|pyramidal neuron development (GO:0021860)|regulation of gene expression (GO:0010468)|regulation of oxidative phosphorylation (GO:0002082)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|response to iron(III) ion (GO:0010041)|response to zinc ion (GO:0010043)|serotonin metabolic process (GO:0042428)|skin development (GO:0043588)|T-helper cell differentiation (GO:0042093)|transmembrane transport (GO:0055085)|tryptophan metabolic process (GO:0006568)|tyrosine metabolic process (GO:0006570)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|copper-dependent protein binding (GO:0032767)|copper-exporting ATPase activity (GO:0004008)|superoxide dismutase copper chaperone activity (GO:0016532)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(26)|pancreas(1)|prostate(1)|urinary_tract(1)	53					Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	TGCATCCCTGGTTCAAATTGA	0.358																																																	0													128.0	118.0	121.0					X																	77289250		2203	4296	6499	SO:0001583	missense	538			L06133	CCDS35339.1, CCDS75997.1	Xq21.1	2012-10-22	2008-07-31		ENSG00000165240	ENSG00000165240	3.6.3.4	"""ATPases / P-type"""	869	protein-coding gene	gene with protein product	"""copper pump 1"", ""copper-transporting ATPase 1"""	300011	"""Menkes syndrome"""	MNK		10079817	Standard	NM_000052		Approved		uc004ecx.4	Q04656	OTTHUMG00000021885	ENST00000341514.6:c.3442G>T	X.37:g.77289250G>T	ENSP00000345728:p.Val1148Phe		B1AT72|O00227|O00745|Q9BYY8	Missense_Mutation	SNP	pfam_HeavyMe-assoc_HMA,pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,pfam_HAD-SF_hydro-like_3,superfamily_HAD-like_dom,superfamily_HeavyMe-assoc_HMA,pfscan_HeavyMe-assoc_HMA,prints_ATPase_P-typ_cat/Cu-transptr,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_H-transp,prints_HG_scavenger,tigrfam_ATPase_P-typ_heavy-metal,tigrfam_ATPase_P-typ_ion-transptr,tigrfam_HMA_Cu_ion-bd	p.V1148F	ENST00000341514.6	37	c.3442	CCDS35339.1	X	.	.	.	.	.	.	.	.	.	.	G	12.89	2.074612	0.36566	.	.	ENSG00000165240	ENST00000343533;ENST00000350425;ENST00000341514	D;D;D	0.97665	-4.09;-4.48;-4.09	5.16	2.36	0.29203	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);	0.292367	0.32736	N	0.005704	D	0.92619	0.7655	N	0.22421	0.69	0.46798	D	0.999208	B	0.26195	0.144	B	0.31191	0.125	D	0.87603	0.2498	10	0.52906	T	0.07	0.0214	8.3868	0.32505	0.1539:0.1351:0.711:0.0	.	1148	Q04656	ATP7A_HUMAN	F	1070;151;1148	ENSP00000343026:V1070F;ENSP00000343678:V151F;ENSP00000345728:V1148F	ENSP00000345728:V1148F	V	+	1	0	ATP7A	77175906	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	1.041000	0.30291	0.477000	0.27464	-0.253000	0.11424	GTT	ATP7A	-	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_heavy-metal		0.358	ATP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP7A	HGNC	protein_coding	OTTHUMT00000057306.1	G	NM_000052		77289250	+1	no_errors	ENST00000341514	ensembl	human	known	70_37	missense	SNP	0.992	T
ARMCX2	9823	genome.wustl.edu	37	X	100910679	100910679	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chrX:100910679G>C	ENST00000328766.5	-	5	2349	c.1896C>G	c.(1894-1896)ttC>ttG	p.F632L	ARMCX2_ENST00000330154.2_Missense_Mutation_p.F632L|ARMCX2_ENST00000467416.1_5'Flank|ARMCX2_ENST00000356824.4_Missense_Mutation_p.F632L	NM_014782.5	NP_055597.1	Q7L311	ARMX2_HUMAN	armadillo repeat containing, X-linked 2	632						integral component of membrane (GO:0016021)				NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(6)|prostate(1)|skin(1)	29						TAACCAATCAGAATTTGTTCA	0.348																																																	0													68.0	63.0	65.0					X																	100910679		2203	4300	6503	SO:0001583	missense	9823			AB011084	CCDS14490.1	Xq21.33-q22.2	2014-03-21			ENSG00000184867	ENSG00000184867		"""Armadillo repeat containing"""	16869	protein-coding gene	gene with protein product		300363				9628581, 11162520, 16221301, 22569362	Standard	XM_005278109		Approved	ALEX2, KIAA0512, GASP9	uc004eif.3	Q7L311	OTTHUMG00000022038	ENST00000328766.5:c.1896C>G	X.37:g.100910679G>C	ENSP00000331662:p.Phe632Leu		O60267|Q5H9D9	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold,smart_Armadillo	p.F632L	ENST00000328766.5	37	c.1896	CCDS14490.1	X	.	.	.	.	.	.	.	.	.	.	G	9.823	1.186389	0.21870	.	.	ENSG00000184867	ENST00000328766;ENST00000330154;ENST00000356824	T;T;T	0.40476	1.03;1.03;1.03	3.99	3.99	0.46301	.	0.517042	0.19585	N	0.110754	T	0.31167	0.0788	N	0.04203	-0.255	0.31845	N	0.623025	P	0.52842	0.956	P	0.62184	0.899	T	0.09618	-1.0666	10	0.02654	T	1	.	10.4788	0.44680	0.0:0.0:1.0:0.0	.	632	Q7L311	ARMX2_HUMAN	L	632	ENSP00000331662:F632L;ENSP00000328631:F632L;ENSP00000349281:F632L	ENSP00000331662:F632L	F	-	3	2	ARMCX2	100797335	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	1.883000	0.39658	2.233000	0.73108	0.422000	0.28245	TTC	ARMCX2	-	NULL		0.348	ARMCX2-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ARMCX2	HGNC	protein_coding	OTTHUMT00000057586.1	G	NM_014782		100910679	-1	no_errors	ENST00000328766	ensembl	human	known	70_37	missense	SNP	1.000	C
ATRNL1	26033	genome.wustl.edu	37	10	116919962	116919962	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr10:116919962C>T	ENST00000355044.3	+	6	1117	c.991C>T	c.(991-993)Caa>Taa	p.Q331*	ATRNL1_ENST00000529665.1_3'UTR|ATRNL1_ENST00000527407.1_Nonsense_Mutation_p.Q331*	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	331					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		CAGTTCTTTTCAAATGGTCCT	0.338																																																	0													166.0	174.0	171.0					10																	116919962		2203	4300	6503	SO:0001587	stop_gained	26033			AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.991C>T	10.37:g.116919962C>T	ENSP00000347152:p.Gln331*		O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Nonsense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_Plexin_repeat,pfam_CUB,pfam_EGF_extracell,superfamily_C-type_lectin_fold,superfamily_CUB,superfamily_Plexin-like_fold,smart_EG-like_dom,smart_CUB,smart_Plexin-like,smart_C-type_lectin,smart_EGF_laminin,pfscan_CUB,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_C-type_lectin	p.Q331*	ENST00000355044.3	37	c.991	CCDS7592.1	10	.	.	.	.	.	.	.	.	.	.	C	36	5.808323	0.96967	.	.	ENSG00000107518	ENST00000355044	.	.	.	5.65	5.65	0.86999	.	0.168264	0.56097	D	0.000022	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.8912	17.8978	0.88895	0.0:1.0:0.0:0.0	.	.	.	.	X	331	.	ENSP00000347152:Q331X	Q	+	1	0	ATRNL1	116909952	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.792000	0.85828	2.661000	0.90470	0.555000	0.69702	CAA	ATRNL1	-	NULL		0.338	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATRNL1	HGNC	protein_coding	OTTHUMT00000050507.3	C	XM_049349		116919962	+1	no_errors	ENST00000355044	ensembl	human	known	70_37	nonsense	SNP	1.000	T
BAI2	576	genome.wustl.edu	37	1	32196648	32196648	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr1:32196648G>A	ENST00000373658.3	-	29	4474	c.4133C>T	c.(4132-4134)cCg>cTg	p.P1378L	BAI2_ENST00000440175.2_Missense_Mutation_p.P987L|BAI2_ENST00000373655.2_Missense_Mutation_p.P1378L|BAI2_ENST00000398542.1_Missense_Mutation_p.P1278L|BAI2_ENST00000398556.3_Missense_Mutation_p.P1293L|BAI2_ENST00000257070.4_Missense_Mutation_p.P1345L|BAI2_ENST00000398538.1_Missense_Mutation_p.P1366L|BAI2_ENST00000527361.1_Missense_Mutation_p.P1345L|BAI2_ENST00000398547.1_Missense_Mutation_p.P1311L|BAI2_ENST00000465256.1_5'UTR	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	1378					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		GGTCCCCTCCGGCCGGGCCCT	0.716																																																	0													7.0	10.0	9.0					1																	32196648		2168	4237	6405	SO:0001583	missense	576			AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.4133C>T	1.37:g.32196648G>A	ENSP00000362762:p.Pro1378Leu		B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.P1378L	ENST00000373658.3	37	c.4133	CCDS346.2	1	.	.	.	.	.	.	.	.	.	.	G	11.54	1.670385	0.29693	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000440175;ENST00000398538	T;T;T;T;T;T;T;T;T	0.42513	1.64;1.86;1.03;1.03;2.02;0.97;0.97;1.67;1.06	5.47	5.47	0.80525	.	0.173245	0.28252	N	0.016037	T	0.30293	0.0760	L	0.36672	1.1	0.53005	D	0.999962	B;P;B;D;P;P;B	0.56746	0.1;0.786;0.269;0.977;0.906;0.68;0.087	B;B;B;B;P;B;B	0.44422	0.008;0.306;0.056;0.32;0.449;0.161;0.031	T	0.06570	-1.0819	10	0.08381	T	0.77	.	8.7877	0.34832	0.1609:0.0:0.8391:0.0	.	1345;1366;987;1293;1378;1378;1366	O60241-4;O60241-3;B4DKC3;A2A3C6;O60241-2;O60241;A2A3C2	.;.;.;.;.;BAI2_HUMAN;.	L	1293;1311;1378;1378;1278;1345;1345;987;1366	ENSP00000381564:P1293L;ENSP00000381555:P1311L;ENSP00000362762:P1378L;ENSP00000362759:P1378L;ENSP00000381550:P1278L;ENSP00000257070:P1345L;ENSP00000435397:P1345L;ENSP00000391071:P987L;ENSP00000381548:P1366L	ENSP00000257070:P1345L	P	-	2	0	BAI2	31969235	0.143000	0.22626	0.997000	0.53966	0.637000	0.38172	2.742000	0.47434	2.735000	0.93741	0.655000	0.94253	CCG	BAI2	-	NULL		0.716	BAI2-015	KNOWN	basic|CCDS	protein_coding	BAI2	HGNC	protein_coding	OTTHUMT00000381838.1	G	NM_001703		32196648	-1	no_errors	ENST00000373658	ensembl	human	known	70_37	missense	SNP	0.988	A
ATXN7L2	127002	genome.wustl.edu	37	1	110032595	110032595	+	Missense_Mutation	SNP	T	T	C			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr1:110032595T>C	ENST00000369870.3	+	8	1096	c.1081T>C	c.(1081-1083)Tgt>Cgt	p.C361R		NM_153340.4	NP_699171.3	Q5T6C5	AT7L2_HUMAN	ataxin 7-like 2	361										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)	17		all_epithelial(167;0.00197)|all_lung(203;0.00291)|Lung NSC(277;0.00453)		Colorectal(144;0.0129)|Lung(183;0.0426)|Epithelial(280;0.0675)|READ - Rectum adenocarcinoma(129;0.0693)|all cancers(265;0.071)|LUSC - Lung squamous cell carcinoma(189;0.228)		TGAAGGCCCCTGTGGTGGTGA	0.632																																																	0													86.0	95.0	92.0					1																	110032595		2203	4300	6503	SO:0001583	missense	127002			BC037582	CCDS30794.1	1p13.2	2008-02-05			ENSG00000162650	ENSG00000162650			28713	protein-coding gene	gene with protein product						12477932	Standard	NM_153340		Approved	MGC46534, FLJ00381	uc001dxr.3	Q5T6C5	OTTHUMG00000011027	ENST00000369870.3:c.1081T>C	1.37:g.110032595T>C	ENSP00000358886:p.Cys361Arg			Missense_Mutation	SNP	pfam_SCA7_dom	p.C361R	ENST00000369870.3	37	c.1081	CCDS30794.1	1	.	.	.	.	.	.	.	.	.	.	T	5.821	0.335665	0.11013	.	.	ENSG00000162650	ENST00000369870;ENST00000541125	T	0.28454	1.61	5.68	4.54	0.55810	.	0.253689	0.35838	N	0.002956	T	0.10035	0.0246	L	0.40543	1.245	0.49483	D	0.999798	B	0.21381	0.055	B	0.19148	0.024	T	0.08027	-1.0742	10	0.16420	T	0.52	1.5105	10.1481	0.42776	0.0:0.0:0.3234:0.6766	.	361	Q5T6C5	AT7L2_HUMAN	R	361	ENSP00000358886:C361R	ENSP00000358886:C361R	C	+	1	0	ATXN7L2	109834118	0.035000	0.19736	0.984000	0.44739	0.993000	0.82548	0.187000	0.16998	0.966000	0.38159	0.459000	0.35465	TGT	ATXN7L2	-	NULL		0.632	ATXN7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN7L2	HGNC	protein_coding	OTTHUMT00000030331.1	T	NM_153340		110032595	+1	no_errors	ENST00000369870	ensembl	human	known	70_37	missense	SNP	0.701	C
BCL2L11	10018	genome.wustl.edu	37	2	111907693	111907693	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr2:111907693G>A	ENST00000393256.3	+	3	740	c.467G>A	c.(466-468)gGa>gAa	p.G156E	BCL2L11_ENST00000393253.2_Missense_Mutation_p.G66E|BCL2L11_ENST00000308659.8_Missense_Mutation_p.G96E|BCL2L11_ENST00000357757.2_Missense_Mutation_p.G156E	NM_001204106.1|NM_006538.4|NM_138621.4|NM_138627.3	NP_001191035.1|NP_006529.1|NP_619527.1|NP_619533.1	O43521	B2L11_HUMAN	BCL2-like 11 (apoptosis facilitator)	156					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|apoptotic signaling pathway (GO:0097190)|B cell apoptotic process (GO:0001783)|B cell homeostasis (GO:0001782)|brain development (GO:0007420)|cell-matrix adhesion (GO:0007160)|cellular process regulating host cell cycle in response to virus (GO:0060154)|developmental pigmentation (GO:0048066)|ear development (GO:0043583)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|kidney development (GO:0001822)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|myeloid cell homeostasis (GO:0002262)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic process by virus (GO:0060139)|positive regulation of cell cycle (GO:0045787)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902110)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|post-embryonic organ morphogenesis (GO:0048563)|regulation of developmental pigmentation (GO:0048070)|regulation of organ growth (GO:0046620)|response to endoplasmic reticulum stress (GO:0034976)|spermatogenesis (GO:0007283)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|thymocyte apoptotic process (GO:0070242)|thymus development (GO:0048538)|tube formation (GO:0035148)	BIM-BCL-2 complex (GO:0097141)|BIM-BCL-xl complex (GO:0097140)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|mitochondrial outer membrane (GO:0005741)				endometrium(4)|large_intestine(3)|lung(2)|prostate(2)	11						CGGCGTATTGGAGACGAGTTT	0.443																																																	0													159.0	119.0	133.0					2																	111907693		2203	4300	6503	SO:0001583	missense	10018			AF032458	CCDS2089.1, CCDS2092.1, CCDS42731.1, CCDS56131.1, CCDS56132.1, CCDS56133.1, CCDS56134.1, CCDS56135.1, CCDS56136.1, CCDS74560.1, CCDS74561.1, CCDS74559.1	2q13	2014-09-17			ENSG00000153094	ENSG00000153094			994	protein-coding gene	gene with protein product		603827				9731710, 9430630	Standard	NM_006538		Approved	BOD, BimL, BimEL, BimS, BIM	uc002tgv.1	O43521	OTTHUMG00000131256	ENST00000393256.3:c.467G>A	2.37:g.111907693G>A	ENSP00000376943:p.Gly156Glu		A8K2W2|O43522|Q0MSE7|Q0MSE8|Q0MSE9|Q53R28|Q6JTU6|Q6T851|Q6TE14|Q6TE15|Q6TE16|Q6V402|Q8WYL6|Q8WYL7|Q8WYL8|Q8WYL9|Q8WYM0|Q8WYM1	Missense_Mutation	SNP	pfam_Bcl-x_interacting,pfam_Apoptosis_Bim_N,pirsf_Bcl-2-like_11	p.G156E	ENST00000393256.3	37	c.467	CCDS2089.1	2	.	.	.	.	.	.	.	.	.	.	G	27.3	4.822663	0.90873	.	.	ENSG00000153094	ENST00000308659;ENST00000357757;ENST00000393253;ENST00000393256;ENST00000452033	.	.	.	5.89	5.89	0.94794	Bcl-x interacting (1);	0.000000	0.56097	D	0.000022	T	0.67515	0.2901	L	0.32530	0.975	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.69243	-0.5196	9	0.87932	D	0	-14.1923	15.7362	0.77846	0.0:0.0:1.0:0.0	.	66;156;96	O43521-3;O43521;O43521-2	.;B2L11_HUMAN;.	E	96;156;66;156;23	.	ENSP00000309226:G96E	G	+	2	0	BCL2L11	111624164	1.000000	0.71417	0.999000	0.59377	0.953000	0.61014	5.870000	0.69620	2.791000	0.96007	0.591000	0.81541	GGA	BCL2L11	-	pfam_Bcl-x_interacting,pirsf_Bcl-2-like_11		0.443	BCL2L11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCL2L11	HGNC	protein_coding	OTTHUMT00000254022.3	G			111907693	+1	no_errors	ENST00000393256	ensembl	human	known	70_37	missense	SNP	1.000	A
BCLAF1	9774	genome.wustl.edu	37	6	136582162	136582162	+	3'UTR	SNP	G	G	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr6:136582162G>T	ENST00000531224.1	-	0	3101				BCLAF1_ENST00000353331.4_3'UTR|BCLAF1_ENST00000527536.1_3'UTR|BCLAF1_ENST00000530767.1_3'UTR|BCLAF1_ENST00000527759.1_3'UTR|BCLAF1_ENST00000529917.1_5'UTR|BCLAF1_ENST00000031135.9_3'UTR	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1						apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		TAAGTAAAATGCTTACATTCT	0.269																																					Colon(142;1534 1789 5427 7063 28491)												0													64.0	60.0	62.0					6																	136582162		692	1585	2277	SO:0001624	3_prime_UTR_variant	9774			AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.*86C>A	6.37:g.136582162G>T			A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	RNA	SNP	-	NULL	ENST00000531224.1	37	NULL	CCDS5177.1	6																																																																																			BCLAF1	-	-		0.269	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCLAF1	HGNC	protein_coding	OTTHUMT00000042375.2	G	NM_014739		136582162	-1	no_errors	ENST00000529917	ensembl	human	known	70_37	rna	SNP	1.000	T
C12orf54	121273	genome.wustl.edu	37	12	48882264	48882265	+	Intron	INS	-	-	A	rs71439447|rs551426749	byFrequency	TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr12:48882264_48882265insA	ENST00000548364.1	+	4	192				C12orf54_ENST00000548913.1_3'UTR|C12orf54_ENST00000314014.2_Intron|RP11-722P11.4_ENST00000551847.1_RNA			Q6X4T0	CL054_HUMAN	chromosome 12 open reading frame 54											endometrium(1)|large_intestine(4)	5						AACTTACAGCCAAAAAAAAAAA	0.347													|||unknown(HR)	1246	0.248802	0.1634	0.2709	5008	,	,		16723	0.505		0.0895	False		,,,				2504	0.2485																0																																										SO:0001627	intron_variant	121273			BC031670	CCDS8764.1	12q13.11	2011-01-31			ENSG00000177627	ENSG00000177627			28553	protein-coding gene	gene with protein product						12477932	Standard	NM_152319		Approved	MGC35033	uc001rrr.3	Q6X4T0	OTTHUMG00000170019	ENST00000548364.1:c.136-442->A	12.37:g.48882275_48882275dupA			Q6X4S9|Q8N5S2	RNA	INS	-	NULL	ENST00000548364.1	37	NULL	CCDS8764.1	12																																																																																			C12orf54	-	-		0.347	C12orf54-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	C12orf54	HGNC	protein_coding	OTTHUMT00000406875.1	-	NM_152319		48882265	+1	no_errors	ENST00000548913	ensembl	human	known	70_37	rna	INS	0.096:0.084	A
BEST3	144453	genome.wustl.edu	37	12	70048836	70048836	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr12:70048836C>G	ENST00000330891.5	-	10	2084	c.1858G>C	c.(1858-1860)Gac>Cac	p.D620H	BEST3_ENST00000331471.4_Intron|BEST3_ENST00000553096.1_Missense_Mutation_p.D514H|BEST3_ENST00000488961.1_Missense_Mutation_p.D407H	NM_001282613.1|NM_032735.2	NP_001269542.1|NP_116124.2	Q8N1M1	BEST3_HUMAN	bestrophin 3	620					negative regulation of ion transport (GO:0043271)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(2)	12	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)			GTTTCTGTGTCAATTAAAAGA	0.488																																																	0													86.0	83.0	84.0					12																	70048836		1891	4121	6012	SO:0001583	missense	144453			AF440758	CCDS8992.2, CCDS41810.1, CCDS61192.1, CCDS61193.1, CCDS73496.1	12q14.2-q15	2012-09-26	2006-10-18	2006-10-18	ENSG00000127325	ENSG00000127325		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17105	protein-coding gene	gene with protein product		607337	"""vitelliform macular dystrophy 2-like 3"""	VMD2L3		12032738	Standard	NM_032735		Approved	MGC40411, MGC13168	uc001svg.3	Q8N1M1	OTTHUMG00000149919	ENST00000330891.5:c.1858G>C	12.37:g.70048836C>G	ENSP00000332413:p.Asp620His		B5MDI8|F8VVZ2|Q53YQ7|Q8N356|Q8NFT9|Q9BR80	Missense_Mutation	SNP	pfam_Bestrophin/UPF0187	p.D620H	ENST00000330891.5	37	c.1858	CCDS8992.2	12	.	.	.	.	.	.	.	.	.	.	C	19.47	3.833846	0.71258	.	.	ENSG00000127325	ENST00000488961;ENST00000330891;ENST00000553096	D;D;D	0.98135	-4.4;-4.74;-4.71	5.53	4.62	0.57501	.	0.539093	0.19203	N	0.120140	D	0.96262	0.8781	L	0.34521	1.04	0.49798	D	0.999829	D;D	0.57571	0.97;0.98	P;P	0.50231	0.62;0.635	D	0.95323	0.8422	10	0.45353	T	0.12	-4.4881	14.2229	0.65839	0.0:0.8505:0.1495:0.0	.	620;407	Q8N1M1;B5MDI8	BEST3_HUMAN;.	H	407;620;514	ENSP00000433213:D407H;ENSP00000332413:D620H;ENSP00000449548:D514H	ENSP00000332413:D620H	D	-	1	0	BEST3	68335103	0.029000	0.19370	0.019000	0.16419	0.403000	0.30841	1.142000	0.31540	1.289000	0.44618	0.563000	0.77884	GAC	BEST3	-	NULL		0.488	BEST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEST3	HGNC	protein_coding	OTTHUMT00000313908.2	C	NM_152439		70048836	-1	no_errors	ENST00000330891	ensembl	human	known	70_37	missense	SNP	0.302	G
CFAP54	144535	genome.wustl.edu	37	12	97073515	97073515	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr12:97073515C>T	ENST00000524981.4	+	40	5724	c.5701C>T	c.(5701-5703)Ctt>Ttt	p.L1901F				Q96N23	CL055_HUMAN		0																	TTCATTATTTCTTGCACAGAC	0.428																																																	0													168.0	160.0	162.0					12																	97073515		2203	4300	6503	SO:0001583	missense	144535																														ENST00000524981.4:c.5701C>T	12.37:g.97073515C>T	ENSP00000431759:p.Leu1901Phe			Missense_Mutation	SNP	NULL	p.L326F	ENST00000524981.4	37	c.976		12	.	.	.	.	.	.	.	.	.	.	C	18.16	3.561953	0.65538	.	.	ENSG00000188596	ENST00000524981;ENST00000342887	.	.	.	5.27	5.27	0.74061	.	0.663319	0.14940	N	0.289594	T	0.79981	0.4540	M	0.70275	2.135	0.42019	D	0.990975	D	0.89917	1.0	D	0.87578	0.998	T	0.81044	-0.1111	9	0.72032	D	0.01	-15.4589	18.4799	0.90808	0.0:1.0:0.0:0.0	.	326	Q6ZTY8	CL063_HUMAN	F	1901;326	.	ENSP00000345466:L326F	L	+	1	0	C12orf63	95597646	1.000000	0.71417	0.969000	0.41365	0.761000	0.43186	5.448000	0.66612	2.437000	0.82529	0.655000	0.94253	CTT	C12orf55	-	NULL		0.428	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf55	HGNC	protein_coding	OTTHUMT00000395046.4	C			97073515	+1	no_errors	ENST00000342887	ensembl	human	known	70_37	missense	SNP	0.998	T
C19orf38	255809	genome.wustl.edu	37	19	10959203	10959203	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr19:10959203C>T	ENST00000397820.4	+	1	126	c.19C>T	c.(19-21)Ctc>Ttc	p.L7F	C19orf38_ENST00000592854.1_Missense_Mutation_p.L7F	NM_001136482.1	NP_001129954.1	A8MVS5	HIDE1_HUMAN	chromosome 19 open reading frame 38	7						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)	2						GACCATCTTGCTCTTTGCAGC	0.627																																																	0													72.0	72.0	72.0					19																	10959203		692	1591	2283	SO:0001583	missense	255809				CCDS45970.1	19p13.2	2011-08-02	2008-04-14		ENSG00000214212	ENSG00000214212			34073	protein-coding gene	gene with protein product	"""Highly expressed in immature dendritic cell transcript 1"""						Standard	NM_001136482		Approved	HIDE1	uc010dxm.1	A8MVS5		ENST00000397820.4:c.19C>T	19.37:g.10959203C>T	ENSP00000380920:p.Leu7Phe		B2RXI3	Missense_Mutation	SNP	NULL	p.L7F	ENST00000397820.4	37	c.19	CCDS45970.1	19	.	.	.	.	.	.	.	.	.	.	C	6.707	0.499200	0.12762	.	.	ENSG00000214212	ENST00000397820	.	.	.	5.03	1.57	0.23409	.	0.857191	0.09437	U	0.802345	T	0.30386	0.0763	L	0.41710	1.295	0.09310	N	1	B	0.19073	0.033	B	0.19946	0.027	T	0.22487	-1.0215	9	0.33940	T	0.23	-22.5885	4.2248	0.10575	0.0:0.6022:0.1931:0.2047	.	7	A8MVS5	HIDE1_HUMAN	F	7	.	ENSP00000380920:L7F	L	+	1	0	C19orf38	10820203	0.934000	0.31675	0.094000	0.20943	0.113000	0.19764	1.329000	0.33770	1.268000	0.44264	0.650000	0.86243	CTC	C19orf38	-	NULL		0.627	C19orf38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf38	HGNC	protein_coding	OTTHUMT00000452622.1	C	NM_001136482		10959203	+1	no_errors	ENST00000397820	ensembl	human	known	70_37	missense	SNP	0.153	T
SSBP3-AS1	619518	genome.wustl.edu	37	1	54703787	54703787	+	Silent	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr1:54703787G>A	ENST00000361350.4	+	1	78	c.48G>A	c.(46-48)gtG>gtA	p.V16V	SSBP3_ENST00000357475.4_Intron|SSBP3_ENST00000371320.3_Intron|SSBP3_ENST00000417664.2_Intron|SSBP3_ENST00000371319.3_Intron|SSBP3_ENST00000326956.7_Intron			Q7Z2R9	SSAS1_HUMAN	SSBP3 antisense RNA 1	16						extracellular region (GO:0005576)											TCACACCAGTGAGGACCCTGG	0.552																																																	0																																										SO:0001819	synonymous_variant	619518			AF176918		1p32.3	2013-08-29	2013-08-29	2013-08-29	ENSG00000198711	ENSG00000198711		"""Long non-coding RNAs"""	32328	non-coding RNA	RNA, long non-coding			"""chromosome 1 open reading frame 191"""	C1orf191			Standard	NR_103541		Approved	MSTP128		Q7Z2R9	OTTHUMG00000008365	ENST00000361350.4:c.48G>A	1.37:g.54703787G>A				Silent	SNP	NULL	p.V16	ENST00000361350.4	37	c.48		1																																																																																			C1orf191	-	NULL		0.552	SSBP3-AS1-001	KNOWN	basic|appris_principal	protein_coding	C1orf191	HGNC	protein_coding	OTTHUMT00000023027.1	G			54703787	+1	no_errors	ENST00000361350	ensembl	human	known	70_37	silent	SNP	0.000	A
C4orf46	201725	genome.wustl.edu	37	4	159592830	159592830	+	Missense_Mutation	SNP	G	G	A	rs140932563		TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr4:159592830G>A	ENST00000379205.4	-	1	368	c.124C>T	c.(124-126)Ccg>Tcg	p.P42S	C4orf46_ENST00000508836.1_Intron|ETFDH_ENST00000511912.1_5'Flank|C4orf46_ENST00000508457.1_Missense_Mutation_p.P42S|ETFDH_ENST00000307738.5_5'Flank	NM_001008393.2	NP_001008394.1	Q504U0	CD046_HUMAN	chromosome 4 open reading frame 46	42								p.P42S(1)		kidney(1)|lung(3)|skin(1)	5						CTCCTGCTCGGAACTGGCCAG	0.687																																																	1	Substitution - Missense(1)	skin(1)											30.0	26.0	27.0					4																	159592830		2203	4300	6503	SO:0001583	missense	201725				CCDS34088.1	4q32.1	2014-07-30			ENSG00000205208	ENSG00000205208			27320	protein-coding gene	gene with protein product	"""renal cancer differentiation gene 1"""						Standard	NM_001008393		Approved	LOC201725, RCDG1	uc003iqa.3	Q504U0	OTTHUMG00000161919	ENST00000379205.4:c.124C>T	4.37:g.159592830G>A	ENSP00000368503:p.Pro42Ser		B3KNH7	Missense_Mutation	SNP	NULL	p.P42S	ENST00000379205.4	37	c.124	CCDS34088.1	4	.	.	.	.	.	.	.	.	.	.	G	13.71	2.318053	0.40996	.	.	ENSG00000205208	ENST00000379205;ENST00000508457	.	.	.	4.07	2.34	0.29019	.	0.834799	0.10096	N	0.716630	T	0.28566	0.0707	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.23940	-1.0174	9	0.54805	T	0.06	.	9.0356	0.36284	0.185:0.0:0.815:0.0	.	42	Q504U0	CD046_HUMAN	S	42	.	ENSP00000368503:P42S	P	-	1	0	C4orf46	159812280	0.089000	0.21612	0.050000	0.19076	0.090000	0.18270	0.794000	0.26958	0.486000	0.27676	-0.251000	0.11542	CCG	C4orf46	-	NULL		0.687	C4orf46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf46	HGNC	protein_coding	OTTHUMT00000366378.1	G	NM_001008393		159592830	-1	no_errors	ENST00000379205	ensembl	human	known	70_37	missense	SNP	0.088	A
CACNA1I	8911	genome.wustl.edu	37	22	40061971	40061971	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr22:40061971G>A	ENST00000402142.3	+	23	4064	c.4064G>A	c.(4063-4065)cGc>cAc	p.R1355H	CACNA1I_ENST00000400164.3_Missense_Mutation_p.R1320H|CACNA1I_ENST00000404898.1_Missense_Mutation_p.R1320H|CACNA1I_ENST00000336649.4_Missense_Mutation_p.R1361H|CACNA1I_ENST00000407673.1_Missense_Mutation_p.R1320H|CACNA1I_ENST00000401624.1_Missense_Mutation_p.R1355H	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	1355					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	GCCAACTACCGCTGGGTCCAT	0.597																																																	0													95.0	103.0	100.0					22																	40061971		2153	4234	6387	SO:0001583	missense	8911			AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.4064G>A	22.37:g.40061971G>A	ENSP00000385019:p.Arg1355His		B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.R1361H	ENST00000402142.3	37	c.4082	CCDS46710.1	22	.	.	.	.	.	.	.	.	.	.	G	20.4	3.977340	0.74360	.	.	ENSG00000100346	ENST00000402142;ENST00000404898;ENST00000401624;ENST00000407673;ENST00000336649;ENST00000400164	D;D;D;D;D;D	0.98531	-4.98;-4.98;-4.98;-4.98;-4.98;-4.98	4.3	4.3	0.51218	Ion transport (1);	0.214888	0.41396	D	0.000900	D	0.98273	0.9428	M	0.76433	2.335	0.28752	N	0.901387	D;D;D;D	0.89917	0.983;0.996;0.997;1.0	P;P;P;D	0.71656	0.729;0.799;0.759;0.974	D	0.94969	0.8115	10	0.87932	D	0	.	5.6831	0.17786	0.2689:0.0:0.731:0.0	.	1320;1355;1320;1355	Q9P0X4-3;Q9P0X4-2;Q9P0X4-4;Q9P0X4	.;.;.;CAC1I_HUMAN	H	1355;1320;1355;1320;1361;1320	ENSP00000385019:R1355H;ENSP00000384093:R1320H;ENSP00000383887:R1355H;ENSP00000385680:R1320H;ENSP00000337829:R1361H;ENSP00000383028:R1320H	ENSP00000337829:R1361H	R	+	2	0	CACNA1I	38391917	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.386000	0.59620	1.915000	0.55452	0.462000	0.41574	CGC	CACNA1I	-	pfam_Ion_trans_dom		0.597	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	CACNA1I	HGNC	protein_coding	OTTHUMT00000321290.1	G	NM_001003406		40061971	+1	no_errors	ENST00000336649	ensembl	human	known	70_37	missense	SNP	1.000	A
CLCN4	1183	genome.wustl.edu	37	X	10174519	10174520	+	Missense_Mutation	DNP	CG	CG	AC			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C|G	C|G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chrX:10174519_10174520CG>AC	ENST00000380833.4	+	7	1068_1069	c.677_678CG>AC	c.(676-678)cCG>cAC	p.P226H	CLCN4_ENST00000380829.1_Missense_Mutation_p.P226H|CLCN4_ENST00000421085.2_Missense_Mutation_p.P132H	NM_001256944.1|NM_001830.3	NP_001243873.1|NP_001821.2	P51793	CLCN4_HUMAN	chloride channel, voltage-sensitive 4	226					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						AAGGAAGGGCCGCTAGTGCACG	0.559																																					Melanoma(74;1050 1296 1576 30544 38374)												0																																										SO:0001583	missense	1183			X77197	CCDS14137.1, CCDS59159.1	Xp22.3	2012-09-26	2012-02-23		ENSG00000073464	ENSG00000073464		"""Ion channels / Chloride channels : Voltage-sensitive"""	2022	protein-coding gene	gene with protein product		302910	"""chloride channel 4"""			8069296	Standard	NM_001830		Approved	CLC4, ClC-4	uc004csy.4	P51793	OTTHUMG00000021125	Exception_encountered	X.37:g.10174519_10174520delinsAC	ENSP00000370213:p.Pro226His		A1L3U1|B7Z5Z4|Q9UBU1	Missense_Mutation|Silent	SNP	pfam_Cl-channel_volt-gated,pfam_Cysta_beta_synth_core,superfamily_Cl-channel_core,smart_Cysta_beta_synth_core,prints_Cl-channel_volt-gated,prints_Cl_channel-4	p.P226Q|p.P226	ENST00000380833.4	37	c.677|c.678	CCDS14137.1	X																																																																																			CLCN4	-	pfam_Cl-channel_volt-gated,superfamily_Cl-channel_core,prints_Cl-channel_volt-gated		0.559	CLCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN4	HGNC	protein_coding	OTTHUMT00000055730.1	C|G			10174519|10174520	+1	no_errors	ENST00000380833	ensembl	human	known	70_37	missense|silent	SNP	1.000|0.061	A|C
CASK	8573	genome.wustl.edu	37	X	41416352	41416352	+	Splice_Site	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chrX:41416352C>T	ENST00000378163.1	-	19	2213	c.1739G>A	c.(1738-1740)aGa>aAa	p.R580K	CASK_ENST00000378158.1_Splice_Site_p.R580K|CASK_ENST00000378166.4_Splice_Site_p.R580K|CASK_ENST00000472704.1_Intron|CASK_ENST00000421587.2_Intron|CASK_ENST00000318588.9_Splice_Site_p.R580K|CASK_ENST00000442742.2_Intron|CASK_ENST00000361962.4_Splice_Site_p.R580K			O14936	CSKP_HUMAN	calcium/calmodulin-dependent serine protein kinase (MAGUK family)	580					calcium ion import (GO:0070509)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of wound healing (GO:0061045)|nucleotide phosphorylation (GO:0046939)|positive regulation of calcium ion import (GO:0090280)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	actin cytoskeleton (GO:0015629)|basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(5)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|ovary(3)|prostate(1)|stomach(1)	32						AGGGGAATCTCTCTGAAATAA	0.423																																					NSCLC(42;104 1086 3090 27189 35040)												0													146.0	107.0	120.0					X																	41416352		2203	4300	6503	SO:0001630	splice_region_variant	8573			AF035582	CCDS14257.1, CCDS48094.1, CCDS48095.1	Xp11.4	2010-02-09			ENSG00000147044	ENSG00000147044			1497	protein-coding gene	gene with protein product		300172	"""trinucleotide repeat containing 8"""	TNRC8		9722958	Standard	NM_003688		Approved	LIN2, CAGH39, FGS4	uc004dfl.4	O14936	OTTHUMG00000021378	ENST00000378163.1:c.1738-1G>A	X.37:g.41416352C>T			A6NES1|B7ZKY0|O43215|Q17RI4|Q59HA0|Q5VT16|Q5VT17|Q5VT18|Q5VT19|Q66T42|Q9BYH6|Q9NYB2|Q9NYB3	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Guanylate_kin,pfam_L27_C,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_L27,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,pfscan_Guanylate_kin	p.R580K	ENST00000378163.1	37	c.1739		X	.	.	.	.	.	.	.	.	.	.	C	5.980	0.364835	0.11296	.	.	ENSG00000147044	ENST00000318588;ENST00000361962;ENST00000378163;ENST00000378168;ENST00000378158;ENST00000378166	T;T;T;T;T;T	0.66638	-0.2;-0.21;-0.2;0.95;-0.22;-0.2	5.24	5.24	0.73138	Src homology-3 domain (1);PDZ/DHR/GLGF (1);	0.000000	0.49916	D	0.000133	T	0.49236	0.1545	N	0.08118	0	0.50039	D	0.999841	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.40813	-0.9543	10	0.33940	T	0.23	.	18.1202	0.89568	0.0:1.0:0.0:0.0	.	580;580	O14936-2;O14936	.;CSKP_HUMAN	K	580;580;580;47;580;580	ENSP00000322727:R580K;ENSP00000354641:R580K;ENSP00000367405:R580K;ENSP00000367410:R47K;ENSP00000367400:R580K;ENSP00000367408:R580K	ENSP00000322727:R580K	R	-	2	0	CASK	41301296	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.551000	0.67274	2.302000	0.77476	0.600000	0.82982	AGA	CASK	-	superfamily_SH3_domain,superfamily_PDZ		0.423	CASK-007	KNOWN	basic|appris_candidate_longest	protein_coding	CASK	HGNC	protein_coding	OTTHUMT00000056285.1	C	NM_003688	Missense_Mutation	41416352	-1	no_errors	ENST00000378163	ensembl	human	known	70_37	missense	SNP	1.000	T
COL18A1	80781	genome.wustl.edu	37	21	46925806	46925806	+	Missense_Mutation	SNP	G	G	A	rs201265799		TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr21:46925806G>A	ENST00000359759.4	+	36	4408	c.4387G>A	c.(4387-4389)Gag>Aag	p.E1463K	COL18A1_ENST00000400337.2_Missense_Mutation_p.E1048K|COL18A1_ENST00000355480.5_Missense_Mutation_p.E1228K|SLC19A1_ENST00000567670.1_Intron			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	1463	Nonhelical region 11 (NC11).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CGAGGTTCCCGAGGGCTGGCT	0.667																																																	0								G	LYS/GLU,LYS/GLU	3,4139		0,3,2068	72.0	84.0	80.0		3682,3142	3.9	0.9	21		80	0,8366		0,0,4183	yes	missense,missense	COL18A1	NM_030582.3,NM_130445.2	56,56	0,3,6251	AA,AG,GG		0.0,0.0724,0.024	probably-damaging,probably-damaging	1228/1520,1048/1340	46925806	3,12505	2071	4183	6254	SO:0001583	missense	80781				CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.4387G>A	21.37:g.46925806G>A	ENSP00000352798:p.Glu1463Lys		A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Missense_Mutation	SNP	pfam_Collagenase_NC10/endostatin,pfam_DUF959_COL18_N,pfam_Collagen,pfam_Frizzled_dom,superfamily_C-type_lectin_fold,superfamily_ConA-like_lec_gl_sf,superfamily_Frizzled_dom,smart_Frizzled_dom,smart_Laminin_G,pfscan_Frizzled_dom	p.E1463K	ENST00000359759.4	37	c.4387		21	.	.	.	.	.	.	.	.	.	.	G	23.8	4.459842	0.84317	7.24E-4	0.0	ENSG00000182871	ENST00000400337;ENST00000400347;ENST00000355480;ENST00000359759;ENST00000539645;ENST00000342220	T;T;T;T	0.50001	0.76;0.76;0.76;0.76	3.93	3.93	0.45458	Collagenase NC10/endostatin (1);	0.000000	0.85682	U	0.000000	T	0.66761	0.2822	M	0.77406	2.37	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.79108	0.992;0.977;0.974;0.974	T	0.68838	-0.5303	10	0.42905	T	0.14	.	13.0632	0.59018	0.0:0.0:1.0:0.0	.	1463;1045;1228;1048	P39060;D3DSM4;P39060-1;P39060-2	COIA1_HUMAN;.;.;.	K	1048;1048;1228;1463;1463;396	ENSP00000383191:E1048K;ENSP00000347665:E1228K;ENSP00000352798:E1463K;ENSP00000339118:E396K	ENSP00000339118:E396K	E	+	1	0	COL18A1	45750234	1.000000	0.71417	0.909000	0.35828	0.937000	0.57800	5.448000	0.66612	1.911000	0.55334	0.491000	0.48974	GAG	COL18A1	-	pfam_Collagenase_NC10/endostatin		0.667	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	COL18A1	HGNC	protein_coding	OTTHUMT00000206827.1	G			46925806	+1	no_errors	ENST00000359759	ensembl	human	known	70_37	missense	SNP	0.982	A
COL8A1	1295	genome.wustl.edu	37	3	99509748	99509748	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr3:99509748G>A	ENST00000261037.3	+	4	602	c.222G>A	c.(220-222)atG>atA	p.M74I	COL8A1_ENST00000273342.4_Missense_Mutation_p.M74I	NM_001850.4	NP_001841.2	P27658	CO8A1_HUMAN	collagen, type VIII, alpha 1	74	Nonhelical region (NC2).				angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen type VIII trimer (GO:0005591)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)				breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(15)|skin(5)|upper_aerodigestive_tract(1)	27						GCAAGGAGATGCCCCACTTGC	0.522																																																	0													80.0	77.0	78.0					3																	99509748		2203	4300	6503	SO:0001583	missense	1295			AF170702	CCDS2934.1	3q11.1-q13.2	2013-01-16			ENSG00000144810	ENSG00000144810		"""Collagens"""	2215	protein-coding gene	gene with protein product		120251	"""chromosome 3 open reading frame 7"""	C3orf7		2029894	Standard	NM_001850		Approved	MGC9568	uc003dth.2	P27658	OTTHUMG00000148669	ENST00000261037.3:c.222G>A	3.37:g.99509748G>A	ENSP00000261037:p.Met74Ile		D3DN42|Q53XI6|Q96D07	Missense_Mutation	SNP	pfam_Collagen,pfam_C1q,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q,prints_C1q	p.M74I	ENST00000261037.3	37	c.222	CCDS2934.1	3	.	.	.	.	.	.	.	.	.	.	G	11.24	1.581091	0.28180	.	.	ENSG00000144810	ENST00000261037;ENST00000452013;ENST00000273342	D;D	0.90504	-2.68;-2.68	5.54	4.65	0.58169	.	0.382752	0.29286	N	0.012582	T	0.77955	0.4208	N	0.08118	0	0.36032	D	0.839498	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.73017	-0.4115	10	0.22109	T	0.4	.	7.8213	0.29290	0.0859:0.1651:0.7491:0.0	.	74;74	E7EPK9;P27658	.;CO8A1_HUMAN	I	74	ENSP00000261037:M74I;ENSP00000273342:M74I	ENSP00000261037:M74I	M	+	3	0	COL8A1	100992438	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.381000	0.34362	1.314000	0.45095	0.563000	0.77884	ATG	COL8A1	-	NULL		0.522	COL8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL8A1	HGNC	protein_coding	OTTHUMT00000309001.1	G	NM_001850		99509748	+1	no_errors	ENST00000261037	ensembl	human	known	70_37	missense	SNP	1.000	A
CTNNA3	29119	genome.wustl.edu	37	10	67680320	67680320	+	Missense_Mutation	SNP	A	A	G			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr10:67680320A>G	ENST00000433211.2	-	18	2630	c.2456T>C	c.(2455-2457)gTg>gCg	p.V819A	CTNNA3_ENST00000373744.4_Missense_Mutation_p.V819A|CTNNA3_ENST00000373735.1_5'UTR	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						CACTGTTTGCACTACAGCATT	0.448																																																	0													89.0	81.0	84.0					10																	67680320		2203	4300	6503	SO:0001583	missense	29119			AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.2456T>C	10.37:g.67680320A>G	ENSP00000389714:p.Val819Ala			Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.V819A	ENST00000433211.2	37	c.2456	CCDS7269.1	10	.	.	.	.	.	.	.	.	.	.	A	29.0	4.968787	0.92855	.	.	ENSG00000183230	ENST00000433211;ENST00000373744;ENST00000373735	T;T;T	0.39592	1.07;1.07;1.07	5.88	5.88	0.94601	.	0.000000	0.53938	D	0.000053	T	0.65491	0.2696	M	0.80616	2.505	0.80722	D	1	D	0.63046	0.992	D	0.77004	0.989	T	0.65998	-0.6032	10	0.37606	T	0.19	-19.5201	14.299	0.66334	1.0:0.0:0.0:0.0	.	819	Q9UI47	CTNA3_HUMAN	A	819;819;158	ENSP00000389714:V819A;ENSP00000362849:V819A;ENSP00000362840:V158A	ENSP00000362840:V158A	V	-	2	0	CTNNA3	67350326	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.336000	0.96533	2.263000	0.75096	0.529000	0.55759	GTG	CTNNA3	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Vinculin		0.448	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA3	HGNC	protein_coding	OTTHUMT00000048282.2	A	NM_013266		67680320	-1	no_errors	ENST00000373744	ensembl	human	known	70_37	missense	SNP	1.000	G
CXCR4	7852	genome.wustl.edu	37	2	136872498	136872498	+	Nonsense_Mutation	SNP	G	G	A	rs104893624		TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr2:136872498G>A	ENST00000241393.3	-	2	1104	c.1000C>T	c.(1000-1002)Cga>Tga	p.R334*	CXCR4_ENST00000409817.1_Nonsense_Mutation_p.R338*|CXCR4_ENST00000466288.1_5'UTR	NM_003467.2	NP_003458.1	P61073	CXCR4_HUMAN	chemokine (C-X-C motif) receptor 4	334					activation of MAPK activity (GO:0000187)|ameboidal cell migration (GO:0001667)|apoptotic process (GO:0006915)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular response to cytokine stimulus (GO:0071345)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|entry into host cell (GO:0030260)|G-protein coupled receptor signaling pathway (GO:0007186)|germ cell development (GO:0007281)|germ cell migration (GO:0008354)|inflammatory response (GO:0006954)|motor neuron axon guidance (GO:0008045)|myelin maintenance (GO:0043217)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|neutrophil activation (GO:0042119)|patterning of blood vessels (GO:0001569)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of cell migration (GO:0030334)|regulation of chemotaxis (GO:0050920)|response to hypoxia (GO:0001666)|response to virus (GO:0009615)|T cell proliferation (GO:0042098)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|G-protein coupled receptor activity (GO:0004930)|myosin light chain binding (GO:0032027)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|virus receptor activity (GO:0001618)	p.R338*(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.155)	Framycetin(DB00452)|Plerixafor(DB06809)	TGTCCACCTCGCTTTCCTTTG	0.438																																																	1	Substitution - Nonsense(1)	large_intestine(1)	GRCh37	CM030831	CXCR4	M	rs104893624						223.0	212.0	216.0					2																	136872498		2203	4300	6503	SO:0001587	stop_gained	7852			AF005058	CCDS33295.1, CCDS46420.1	2q21	2014-09-17	2002-08-22		ENSG00000121966	ENSG00000121966		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	2561	protein-coding gene	gene with protein product		162643	"""chemokine (C-X-C motif), receptor 4 (fusin)"""			9599023, 9379028	Standard	NM_001008540		Approved	LESTR, NPY3R, HM89, NPYY3R, D2S201E, fusin, HSY3RR, NPYR, CD184	uc002tuz.3	P61073	OTTHUMG00000153583	ENST00000241393.3:c.1000C>T	2.37:g.136872498G>A	ENSP00000241393:p.Arg334*		B2R5N0|O60835|P30991|P56438|Q53S69|Q9BXA0|Q9UKN2	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_Chemokine_CXCR4_N,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CXCR4,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt	p.R338*	ENST00000241393.3	37	c.1012	CCDS46420.1	2	.	.	.	.	.	.	.	.	.	.	G	31	5.093279	0.94149	.	.	ENSG00000121966	ENST00000409817;ENST00000241393;ENST00000537957	.	.	.	5.95	5.0	0.66597	.	0.000000	0.53938	D	0.000048	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.9075	0.88923	0.0:0.0:0.8704:0.1296	.	.	.	.	X	338;334;204	.	ENSP00000241393:R334X	R	-	1	2	CXCR4	136588968	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	2.846000	0.48262	2.827000	0.97445	0.650000	0.86243	CGA	CXCR4	-	prints_Chemokine_CXCR4		0.438	CXCR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CXCR4	HGNC	protein_coding	OTTHUMT00000331732.1	G			136872498	-1	no_errors	ENST00000409817	ensembl	human	known	70_37	nonsense	SNP	1.000	A
CYP17A1	1586	genome.wustl.edu	37	10	104592361	104592361	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr10:104592361C>T	ENST00000369887.3	-	6	1217	c.1046G>A	c.(1045-1047)cGt>cAt	p.R349H	CYP17A1_ENST00000489268.1_5'Flank|CYP17A1-AS1_ENST00000369884.4_RNA	NM_000102.3	NP_000093.1	P05093	CP17A_HUMAN	cytochrome P450, family 17, subfamily A, polypeptide 1	349					adrenal gland development (GO:0030325)|androgen biosynthetic process (GO:0006702)|biphenyl metabolic process (GO:0018879)|cellular response to antibiotic (GO:0071236)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to lipopolysaccharide (GO:0071222)|dibenzo-p-dioxin metabolic process (GO:0018894)|glucocorticoid biosynthetic process (GO:0006704)|hippocampus development (GO:0021766)|hormone biosynthetic process (GO:0042446)|Leydig cell differentiation (GO:0033327)|ovulation (GO:0030728)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|progesterone metabolic process (GO:0042448)|response to acetate (GO:0010034)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to fungicide (GO:0060992)|response to herbicide (GO:0009635)|response to insecticide (GO:0017085)|response to ionizing radiation (GO:0010212)|response to methylmercury (GO:0051597)|response to nutrient levels (GO:0031667)|response to retinoic acid (GO:0032526)|response to steroid hormone (GO:0048545)|sex differentiation (GO:0007548)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	axon (GO:0030424)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)	17-alpha-hydroxyprogesterone aldolase activity (GO:0047442)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|steroid 17-alpha-monooxygenase activity (GO:0004508)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)	Abiraterone(DB05812)|Aminophenazone(DB01424)|Dexamethasone(DB01234)|Metoclopramide(DB01233)|Progesterone(DB00396)	CAGGAGGAGACGGTTACGGTC	0.582																																																	0													149.0	123.0	132.0					10																	104592361		2203	4300	6503	SO:0001583	missense	1586			M19489	CCDS7541.1	10q24.3	2010-05-04	2003-02-14	2003-02-28	ENSG00000148795	ENSG00000148795	1.14.99.9	"""Cytochrome P450s"""	2593	protein-coding gene	gene with protein product	"""Steroid 17-alpha-monooxygenase"""	609300	"""cytochrome P450, subfamily XVII (steroid 17-alpha-hydroxylase), adrenal hyperplasia"""	CYP17		1347802	Standard	NM_000102		Approved	P450C17, CPT7, S17AH	uc001kwg.3	P05093	OTTHUMG00000018969	ENST00000369887.3:c.1046G>A	10.37:g.104592361C>T	ENSP00000358903:p.Arg349His		Q5TZV7	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.R349H	ENST00000369887.3	37	c.1046	CCDS7541.1	10	.	.	.	.	.	.	.	.	.	.	C	2.340	-0.351318	0.05173	.	.	ENSG00000148795	ENST00000369887	T	0.79749	-1.3	5.37	-4.54	0.03452	.	1.501560	0.03139	N	0.166304	T	0.62490	0.2432	N	0.13043	0.29	0.09310	N	1	B	0.12630	0.006	B	0.09377	0.004	T	0.51553	-0.8691	10	0.14656	T	0.56	.	8.2479	0.31700	0.1902:0.496:0.0:0.3138	.	349	P05093	CP17A_HUMAN	H	349	ENSP00000358903:R349H	ENSP00000358903:R349H	R	-	2	0	CYP17A1	104582351	0.001000	0.12720	0.000000	0.03702	0.043000	0.13939	-0.134000	0.10436	-1.100000	0.03030	-0.367000	0.07326	CGT	CYP17A1	-	pfam_Cyt_P450,superfamily_Cyt_P450		0.582	CYP17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP17A1	HGNC	protein_coding	OTTHUMT00000050101.1	C	NM_000102		104592361	-1	no_errors	ENST00000369887	ensembl	human	known	70_37	missense	SNP	0.000	T
DCAF8L2	347442	genome.wustl.edu	37	X	27766066	27766066	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chrX:27766066C>T	ENST00000451261.2	+	5	1453	c.1054C>T	c.(1054-1056)Cgg>Tgg	p.R352W		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	352										central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						CAGACAAGACCGGCCAGCTTC	0.468																																																	0													91.0	64.0	72.0					X																	27766066		692	1591	2283	SO:0001583	missense	347442				CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.1054C>T	X.37:g.27766066C>T	ENSP00000462745:p.Arg352Trp		B2RXH9|J3KT06	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R352W	ENST00000451261.2	37	c.1054	CCDS59162.1	X																																																																																			DCAF8L2	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom		0.468	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF8L2	HGNC	protein_coding	OTTHUMT00000056143.4	C	XM_293354		27766066	+1	no_errors	ENST00000451261	ensembl	human	known	70_37	missense	SNP	0.002	T
DCDC1	341019	genome.wustl.edu	37	11	30915926	30915926	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr11:30915926G>A	ENST00000597505.1	-	33	4761	c.4762C>T	c.(4762-4764)Cga>Tga	p.R1588*	DCDC1_ENST00000406071.2_Nonsense_Mutation_p.R326*			P59894	DCDC1_HUMAN	doublecortin domain containing 1	0					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					GCCGCTACTCGCCGCCCTGAG	0.478																																																	0													54.0	54.0	54.0					11																	30915926		1896	4117	6013	SO:0001587	stop_gained	100506627			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.4762C>T	11.37:g.30915926G>A	ENSP00000472625:p.Arg1588*		A6PVL6|B7WNX6|Q6ZU04	Nonsense_Mutation	SNP	superfamily_Doublecortin_dom	p.R326*	ENST00000597505.1	37	c.976		11	.	.	.	.	.	.	.	.	.	.	G	15.20	2.762997	0.49574	.	.	ENSG00000170959	ENST00000406071	.	.	.	6.17	3.2	0.36748	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.6088	0.28118	0.1439:0.1353:0.7208:0.0	.	.	.	.	X	326	.	ENSP00000385936:R326X	R	-	1	2	DCDC5	30872502	0.988000	0.35896	0.999000	0.59377	0.289000	0.27227	1.989000	0.40707	0.955000	0.37878	-0.136000	0.14681	CGA	DCDC5	-	NULL		0.478	DCDC1-010	PUTATIVE	basic	protein_coding	DCDC5	HGNC	protein_coding	OTTHUMT00000463167.1	G	NM_181807		30915926	-1	no_errors	ENST00000406071	ensembl	human	known	70_37	nonsense	SNP	0.998	A
DDR2	4921	genome.wustl.edu	37	1	162748502	162748502	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr1:162748502C>T	ENST00000367922.3	+	18	2854	c.2416C>T	c.(2416-2418)Cga>Tga	p.R806*	DDR2_ENST00000367921.3_Nonsense_Mutation_p.R806*|RN7SL861P_ENST00000473793.2_RNA	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	806	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	AGAGTTCTTCCGAGACCAAGG	0.488																																					NSCLC(161;314 2006 8283 19651 23192)												0													109.0	105.0	107.0					1																	162748502		2203	4300	6503	SO:0001587	stop_gained	4921			AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.2416C>T	1.37:g.162748502C>T	ENSP00000356899:p.Arg806*		Q7Z730	Nonsense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Kinase-like_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R806*	ENST00000367922.3	37	c.2416	CCDS1241.1	1	.	.	.	.	.	.	.	.	.	.	C	43	10.297386	0.99378	.	.	ENSG00000162733	ENST00000367922;ENST00000367921	.	.	.	5.49	4.56	0.56223	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1.000000	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.029	0.64604	0.1611:0.8389:0.0:0.0	.	.	.	.	X	806	.	ENSP00000356898:R806X	R	+	1	2	DDR2	161015126	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.902000	0.28459	1.268000	0.44264	0.655000	0.94253	CGA	DDR2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.488	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDR2	HGNC	protein_coding	OTTHUMT00000083213.2	C	NM_006182		162748502	+1	no_errors	ENST00000367921	ensembl	human	known	70_37	nonsense	SNP	1.000	T
DNAH17	8632	genome.wustl.edu	37	17	76488833	76488833	+	Silent	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr17:76488833G>A	ENST00000585328.1	-	42	6532	c.6408C>T	c.(6406-6408)ctC>ctT	p.L2136L	RP11-559N14.5_ENST00000585969.1_RNA|DNAH17_ENST00000389840.5_Silent_p.L2127L|RP11-559N14.5_ENST00000588565.1_RNA|DNAH17_ENST00000586052.1_5'Flank|RP11-559N14.5_ENST00000591373.1_RNA	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	2127	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			AGGTCTTGTTGAGGGATTTGA	0.602																																																	0													48.0	51.0	50.0					17																	76488833		1953	4145	6098	SO:0001819	synonymous_variant	8632			AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.6408C>T	17.37:g.76488833G>A			O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_HR1_rho-bd	p.L2127	ENST00000585328.1	37	c.6381		17																																																																																			DNAH17	-	pfam_ATPase_dyneun-rel_AAA		0.602	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	DNAH17	HGNC	protein_coding	OTTHUMT00000318962.2	G	NM_173628		76488833	-1	no_errors	ENST00000389840	ensembl	human	known	70_37	silent	SNP	0.997	A
DNAJC16	23341	genome.wustl.edu	37	1	15863003	15863003	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr1:15863003G>A	ENST00000375847.3	+	4	432	c.268G>A	c.(268-270)Gat>Aat	p.D90N	DNAJC16_ENST00000375838.1_Missense_Mutation_p.D90N|DNAJC16_ENST00000375849.1_Missense_Mutation_p.D90N	NM_015291.2	NP_056106.1	Q9Y2G8	DJC16_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 16	90	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(7)|urinary_tract(1)	18		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		ATCAAATTATGATCAATATGG	0.363																																																	0													44.0	46.0	45.0					1																	15863003		2202	4300	6502	SO:0001583	missense	23341			AB023179	CCDS30606.1, CCDS72710.1	1p36.1	2011-09-02			ENSG00000116138	ENSG00000116138		"""Heat shock proteins / DNAJ (HSP40)"""	29157	protein-coding gene	gene with protein product							Standard	NM_015291		Approved	KIAA0962	uc001aws.3	Q9Y2G8	OTTHUMG00000002358	ENST00000375847.3:c.268G>A	1.37:g.15863003G>A	ENSP00000365007:p.Asp90Asn		Q68D57|Q86X32|Q8N5P4	Missense_Mutation	SNP	pfam_DnaJ_N,pfam_Thioredoxin_domain,superfamily_DnaJ_N,superfamily_Thioredoxin-like_fold,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.D90N	ENST00000375847.3	37	c.268	CCDS30606.1	1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.466537	0.84425	.	.	ENSG00000116138	ENST00000375847;ENST00000375838;ENST00000375849;ENST00000546230	D;D;D	0.82433	-1.61;-1.61;-1.61	5.92	5.92	0.95590	Heat shock protein DnaJ, N-terminal (4);	0.000000	0.85682	D	0.000000	D	0.90985	0.7165	M	0.71036	2.16	0.36912	D	0.890975	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.92643	0.6126	10	0.87932	D	0	-25.5639	18.8844	0.92370	0.0:0.0:1.0:0.0	.	90;90	Q9Y2G8;Q5TDG9	DJC16_HUMAN;.	N	90	ENSP00000365007:D90N;ENSP00000364998:D90N;ENSP00000365009:D90N	ENSP00000364998:D90N	D	+	1	0	DNAJC16	15735590	1.000000	0.71417	0.131000	0.22000	0.415000	0.31203	8.596000	0.90844	2.809000	0.96659	0.655000	0.94253	GAT	DNAJC16	-	pfam_DnaJ_N,superfamily_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ		0.363	DNAJC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC16	HGNC	protein_coding	OTTHUMT00000006764.1	G	NM_015291		15863003	+1	no_errors	ENST00000375847	ensembl	human	known	70_37	missense	SNP	1.000	A
DNAJC30	84277	genome.wustl.edu	37	7	73097088	73097088	+	Silent	SNP	G	G	A	rs374274920		TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr7:73097088G>A	ENST00000395176.2	-	1	695	c.666C>T	c.(664-666)atC>atT	p.I222I	WBSCR22_ENST00000423166.2_5'Flank|WBSCR22_ENST00000423497.1_5'Flank|WBSCR22_ENST00000265758.2_5'Flank	NM_032317.2	NP_115693.2	Q96LL9	DJC30_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 30	222						mitochondrion (GO:0005739)				kidney(1)|large_intestine(2)|lung(1)	4						TATAAAAGCCGATGATGATGA	0.517																																																	0								G		0,4406		0,0,2203	44.0	52.0	49.0		666	-3.6	0.0	7		49	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	DNAJC30	NM_032317.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		222/227	73097088	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	84277			AF412025	CCDS5556.1	7q11.23	2011-09-02	2008-06-17	2008-06-17	ENSG00000176410	ENSG00000176410		"""Heat shock proteins / DNAJ (HSP40)"""	16410	protein-coding gene	gene with protein product			"""Williams Beuren syndrome chromosome region 18"""	WBSCR18		12073013	Standard	NM_032317		Approved		uc003tys.1	Q96LL9	OTTHUMG00000023290	ENST00000395176.2:c.666C>T	7.37:g.73097088G>A			Q9BSG8	Silent	SNP	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.I222	ENST00000395176.2	37	c.666	CCDS5556.1	7																																																																																			DNAJC30	-	NULL		0.517	DNAJC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC30	HGNC	protein_coding	OTTHUMT00000252304.2	G			73097088	-1	no_errors	ENST00000395176	ensembl	human	known	70_37	silent	SNP	0.004	A
DSEL	92126	genome.wustl.edu	37	18	65180658	65180658	+	Silent	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr18:65180658G>A	ENST00000310045.7	-	2	2691	c.1218C>T	c.(1216-1218)ctC>ctT	p.L406L	CTD-2541J13.2_ENST00000583493.1_RNA|CTD-2541J13.2_ENST00000581951.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	396					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				GCTGTGGTGTGAGCTGGGGAT	0.478																																																	0													107.0	86.0	93.0					18																	65180658		2203	4300	6503	SO:0001819	synonymous_variant	92126			AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.1218C>T	18.37:g.65180658G>A			Q17RH1|Q6P5Z3	Silent	SNP	pfam_Sulfotransferase_dom,superfamily_Chondroitin_lyas	p.L406	ENST00000310045.7	37	c.1218	CCDS11995.1	18																																																																																			DSEL	-	NULL		0.478	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSEL	HGNC	protein_coding	OTTHUMT00000256221.1	G	NM_032160		65180658	-1	no_errors	ENST00000310045	ensembl	human	known	70_37	silent	SNP	0.610	A
DUSP27	92235	genome.wustl.edu	37	1	167097688	167097688	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr1:167097688G>A	ENST00000361200.2	+	6	3486	c.3320G>A	c.(3319-3321)aGa>aAa	p.R1107K	DUSP27_ENST00000485151.1_Intron|DUSP27_ENST00000271385.5_Missense_Mutation_p.R1107K|DUSP27_ENST00000443333.1_Missense_Mutation_p.R1107K			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	1107					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						ACAGAAAACAGAGAAGAAGGG	0.493																																																	0													44.0	40.0	41.0					1																	167097688		2203	4300	6503	SO:0001583	missense	92235			AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.3320G>A	1.37:g.167097688G>A	ENSP00000354483:p.Arg1107Lys		A0AUM4|Q9C074	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP,prints_Atypical_DUSP_famA	p.R1107K	ENST00000361200.2	37	c.3320	CCDS30932.1	1	.	.	.	.	.	.	.	.	.	.	G	7.750	0.703075	0.15172	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.03035	4.07;4.07;4.07	5.4	3.4	0.38934	.	0.280558	0.26268	N	0.025357	T	0.01124	0.0037	L	0.57536	1.79	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.47947	-0.9077	10	0.19590	T	0.45	-16.0603	2.332	0.04238	0.2082:0.1581:0.4917:0.1419	.	1107	Q5VZP5	DUS27_HUMAN	K	1107	ENSP00000354483:R1107K;ENSP00000271385:R1107K;ENSP00000404874:R1107K	ENSP00000271385:R1107K	R	+	2	0	DUSP27	165364312	0.091000	0.21658	0.996000	0.52242	0.944000	0.59088	0.890000	0.28295	1.286000	0.44565	0.549000	0.68633	AGA	DUSP27	-	NULL		0.493	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP27	HGNC	protein_coding	OTTHUMT00000083244.1	G	NM_001080426		167097688	+1	no_errors	ENST00000271385	ensembl	human	known	70_37	missense	SNP	0.015	A
CRACR2A	84766	genome.wustl.edu	37	12	3782683	3782683	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr12:3782683G>T	ENST00000252322.1	-	7	1068	c.600C>A	c.(598-600)ttC>ttA	p.F200L	EFCAB4B_ENST00000440314.2_Missense_Mutation_p.F200L|EFCAB4B_ENST00000444507.1_Missense_Mutation_p.F200L	NM_032680.3	NP_116069.1	Q9BSW2	EFC4B_HUMAN		200					activation of store-operated calcium channel activity (GO:0032237)|immune system process (GO:0002376)|positive regulation of calcium ion transport (GO:0051928)|store-operated calcium entry (GO:0002115)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00287)|COAD - Colon adenocarcinoma(12;0.0264)			TTCTGGTCAGGAAGTCTTCAA	0.502																																																	0													158.0	145.0	149.0					12																	3782683		2203	4300	6503	SO:0001583	missense	84766																														ENST00000252322.1:c.600C>A	12.37:g.3782683G>T	ENSP00000252322:p.Phe200Leu		B4E1X0|B9EK63	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_EF_hand_Ca-bd,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,pfscan_EF_HAND_2,tigrfam_Small_GTP-bd_dom	p.F200L	ENST00000252322.1	37	c.600	CCDS8522.1	12	.	.	.	.	.	.	.	.	.	.	G	9.667	1.145685	0.21288	.	.	ENSG00000130038	ENST00000440314;ENST00000444507;ENST00000252322	T;T;T	0.64085	-0.08;2.37;2.33	4.55	2.31	0.28768	.	0.053459	0.85682	N	0.000000	T	0.48484	0.1502	L	0.46157	1.445	0.33865	D	0.634255	B;B;B	0.30542	0.284;0.02;0.058	B;B;B	0.27380	0.079;0.016;0.028	T	0.53947	-0.8366	10	0.20046	T	0.44	-13.1801	9.2615	0.37614	0.2199:0.0:0.7801:0.0	.	200;200;200	D7UEQ6;Q9BSW2-2;Q9BSW2	.;.;EFC4B_HUMAN	L	200	ENSP00000409382:F200L;ENSP00000412496:F200L;ENSP00000252322:F200L	ENSP00000252322:F200L	F	-	3	2	EFCAB4B	3652944	1.000000	0.71417	0.831000	0.32960	0.359000	0.29487	0.540000	0.23191	0.899000	0.36444	0.650000	0.86243	TTC	EFCAB4B	-	NULL		0.502	EFCAB4B-005	KNOWN	basic|CCDS	protein_coding	EFCAB4B	HGNC	protein_coding	OTTHUMT00000398673.1	G			3782683	-1	no_errors	ENST00000440314	ensembl	human	known	70_37	missense	SNP	1.000	T
EIF4A1	1973	genome.wustl.edu	37	17	7479841	7479841	+	Splice_Site	SNP	G	G	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr17:7479841G>T	ENST00000293831.8	+	5	361		c.e5-1		EIF4A1_ENST00000577269.1_Splice_Site|SNORA48_ENST00000386847.1_RNA|EIF4A1_ENST00000582746.1_Splice_Site|SENP3-EIF4A1_ENST00000579777.1_RNA|CD68_ENST00000250092.6_5'Flank|SNORD10_ENST00000459579.1_RNA|SNORA67_ENST00000384423.1_RNA|CD68_ENST00000380498.6_5'Flank	NM_001416.3	NP_001407.1	P60842	IF4A1_HUMAN	eukaryotic translation initiation factor 4A1						cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)	p.?(1)		NS(1)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	22						TCTCTGCTCAGATACAGAAGG	0.517																																					Melanoma(120;278 1668 15796 27423 46368)												1	Unknown(1)	upper_aerodigestive_tract(1)											68.0	58.0	61.0					17																	7479841		2203	4300	6503	SO:0001630	splice_region_variant	1973			D13748	CCDS11113.1, CCDS58511.1	17p13	2012-02-23	2010-02-10		ENSG00000161960	ENSG00000161960		"""DEAD-boxes"""	3282	protein-coding gene	gene with protein product		602641	"""eukaryotic translation initiation factor 4A, isoform 1"""	EIF4A		8493113, 9790779	Standard	NM_001416		Approved	DDX2A, EIF-4A		P60842	OTTHUMG00000108149	ENST00000293831.8:c.346-1G>T	17.37:g.7479841G>T			B2R6L8|D3DTP9|J3QLC4|P04765|Q5U018|Q61516	Splice_Site	SNP	-	e5-1	ENST00000293831.8	37	c.346-1	CCDS11113.1	17	.	.	.	.	.	.	.	.	.	.	G	16.60	3.167509	0.57476	.	.	ENSG00000161960	ENST00000293831	.	.	.	5.1	5.1	0.69264	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0637	0.80856	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	EIF4A1	7420565	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	7.324000	0.79115	2.670000	0.90874	0.655000	0.94253	.	EIF4A1	-	-		0.517	EIF4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4A1	HGNC	protein_coding	OTTHUMT00000226952.6	G	NM_001416	Intron	7479841	+1	no_errors	ENST00000293831	ensembl	human	known	70_37	splice_site	SNP	1.000	T
AC023490.2	0	genome.wustl.edu	37	22	20378434	20378434	+	lincRNA	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr22:20378434G>A	ENST00000426653.1	+	0	484				AC023490.1_ENST00000438669.1_lincRNA																							AGCCTGCTGCGGAGGCGAAGC	0.706																																																	0																																												0																															22.37:g.20378434G>A				RNA	SNP	-	NULL	ENST00000426653.1	37	NULL		22																																																																																			AC023490.2	-	-		0.706	AC023490.2-001	KNOWN	basic|exp_conf	lincRNA	ENSG00000235704	Clone_based_vega_gene	lincRNA	OTTHUMT00000322210.1	G			20378434	+1	no_errors	ENST00000426653	ensembl	human	known	70_37	rna	SNP	0.589	A
ERCC4	2072	genome.wustl.edu	37	16	14026059	14026059	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr16:14026059G>A	ENST00000311895.7	+	6	1028	c.1019G>A	c.(1018-1020)cGa>cAa	p.R340Q	CTD-2135D7.2_ENST00000575137.1_RNA|CTD-2135D7.2_ENST00000570663.1_RNA|ERCC4_ENST00000575156.1_Missense_Mutation_p.R340Q	NM_005236.2	NP_005227.1	Q92889	XPF_HUMAN	excision repair cross-complementation group 4	340	Helicase-like.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of telomere maintenance (GO:0032205)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair involved in interstrand cross-link repair (GO:1901255)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|nucleotide-excision repair, DNA incision, 5'-to lesion (GO:0006296)|resolution of meiotic recombination intermediates (GO:0000712)|response to UV (GO:0009411)|telomere maintenance (GO:0000723)|telomere maintenance via telomere shortening (GO:0010834)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	chromosome, telomeric region (GO:0000781)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleotide-excision repair factor 1 complex (GO:0000110)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	damaged DNA binding (GO:0003684)|endodeoxyribonuclease activity (GO:0004520)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(5)|lung(12)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	38						ATAAATGCTCGAGCAAGGGTT	0.333			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														yes	Rec		Xeroderma pigmentosum (F)	16	16p13.3-p13.13	2072	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""		E	0													115.0	113.0	114.0					16																	14026059		2196	4300	6496	SO:0001583	missense	2072	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	L76568	CCDS32390.1	16p13.3	2014-09-17	2014-03-07		ENSG00000175595	ENSG00000175595			3436	protein-coding gene	gene with protein product	"""xeroderma pigmentosum, complementation group F"""	133520	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""	XPF		9579555, 8887684	Standard	NM_005236		Approved	RAD1, FANCQ	uc002dce.2	Q92889	OTTHUMG00000048194	ENST00000311895.7:c.1019G>A	16.37:g.14026059G>A	ENSP00000310520:p.Arg340Gln		A5PKV6|A8K111|O00140|Q8TD83	Missense_Mutation	SNP	pfam_ERCC4_domain,superfamily_Restrct_endonuc-II-like,superfamily_RuvA_2-like,smart_ERCC4_domain,tigrfam_Rad1	p.R340Q	ENST00000311895.7	37	c.1019	CCDS32390.1	16	.	.	.	.	.	.	.	.	.	.	G	34	5.321687	0.95682	.	.	ENSG00000175595	ENST00000311895;ENST00000439007;ENST00000389138	T	0.67523	-0.27	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.81786	0.4896	M	0.80746	2.51	0.80722	D	1	D;D	0.76494	0.999;0.999	P;P	0.61940	0.896;0.895	D	0.83975	0.0329	10	0.72032	D	0.01	-10.2736	18.5322	0.90996	0.0:0.0:1.0:0.0	.	340;340	A5PKV6;Q92889	.;XPF_HUMAN	Q	340;329;329	ENSP00000310520:R340Q	ENSP00000310520:R340Q	R	+	2	0	ERCC4	13933560	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.281000	0.95811	2.683000	0.91414	0.655000	0.94253	CGA	ERCC4	-	tigrfam_Rad1		0.333	ERCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC4	HGNC	protein_coding	OTTHUMT00000109634.2	G	NM_005236		14026059	+1	no_errors	ENST00000311895	ensembl	human	known	70_37	missense	SNP	1.000	A
EVX1	2128	genome.wustl.edu	37	7	27282448	27282448	+	5'UTR	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr7:27282448C>T	ENST00000496902.4	+	0	285				EVX1_ENST00000535619.1_5'Flank|EVX1-AS_ENST00000517726.1_RNA|EVX1_ENST00000222761.3_5'UTR|EVX1-AS_ENST00000519218.1_RNA|RP1-170O19.17_ENST00000523608.2_lincRNA|EVX1-AS_ENST00000519050.1_RNA			P49640	EVX1_HUMAN	even-skipped homeobox 1						embryo development ending in birth or egg hatching (GO:0009792)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|liver(1)|lung(10)|prostate(1)|skin(1)	14						GAGGAGCGCTCGCTTCACAAG	0.647											OREG0003749	type=REGULATORY REGION|Gene=EVX1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0																																										SO:0001623	5_prime_UTR_variant	101410536				CCDS5413.1	7p15.2	2012-03-09	2007-02-15		ENSG00000106038	ENSG00000106038		"""Homeoboxes / ANTP class : HOXL subclass"""	3506	protein-coding gene	gene with protein product		142996	"""eve, even-skipped homeobox homolog 1 (Drosophila)"""			1684419	Standard	XM_005249640		Approved		uc003szd.1	P49640	OTTHUMG00000023093	ENST00000496902.4:c.-202C>T	7.37:g.27282448C>T		793	A4D199|B4DQJ0	RNA	SNP	-	NULL	ENST00000496902.4	37	NULL	CCDS5413.1	7																																																																																			EVX1-AS	-	-		0.647	EVX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVX1-AS	HGNC	protein_coding	OTTHUMT00000358750.3	C			27282448	-1	no_errors	ENST00000519050	ensembl	human	known	70_37	rna	SNP	1.000	T
FAM120B	84498	genome.wustl.edu	37	6	170627030	170627030	+	Silent	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr6:170627030C>T	ENST00000476287.1	+	2	660	c.552C>T	c.(550-552)atC>atT	p.I184I	FAM120B_ENST00000252510.9_Intron|FAM120B_ENST00000540480.1_Silent_p.I196I|FAM120B_ENST00000537664.1_Silent_p.I207I	NM_032448.1	NP_115824.1	Q96EK7	F120B_HUMAN	family with sequence similarity 120B	184					cell differentiation (GO:0030154)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(2)	44		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)		ATTACCTAATCTATGACACTT	0.483																																																	0													89.0	94.0	92.0					6																	170627030		2203	4300	6503	SO:0001819	synonymous_variant	84498			AB058741	CCDS5314.1, CCDS75555.1	6q27	2011-04-13	2006-07-04	2006-07-04	ENSG00000112584	ENSG00000112584			21109	protein-coding gene	gene with protein product	"""PPARgamma constitutive coactivator 1"", ""constitutive coactivator of PPAR-gamma"""	612266	"""KIAA1838"""	KIAA1838		14585507	Standard	NM_032448		Approved	PGCC1, CCPG	uc003qxp.3	Q96EK7	OTTHUMG00000016080	ENST00000476287.1:c.552C>T	6.37:g.170627030C>T			B4DL34|Q86V68|Q96JI9	Silent	SNP	NULL	p.I207	ENST00000476287.1	37	c.621	CCDS5314.1	6																																																																																			FAM120B	-	NULL		0.483	FAM120B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM120B	HGNC	protein_coding	OTTHUMT00000043259.2	C	NM_032448		170627030	+1	no_errors	ENST00000537664	ensembl	human	known	70_37	silent	SNP	0.978	T
FAM208B	54906	genome.wustl.edu	37	10	5788751	5788751	+	Missense_Mutation	SNP	T	T	G			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr10:5788751T>G	ENST00000328090.5	+	15	3992	c.3367T>G	c.(3367-3369)Tac>Gac	p.Y1123D	RP11-336A10.2_ENST00000411512.2_RNA	NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	1123																	GGGCACTAAGTACCTTTGTGC	0.488																																																	0													122.0	118.0	119.0					10																	5788751		1990	4176	6166	SO:0001583	missense	54906			BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.3367T>G	10.37:g.5788751T>G	ENSP00000328426:p.Tyr1123Asp		Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	pfam_DUF3715,pfam_DUF3699	p.Y1123D	ENST00000328090.5	37	c.3367	CCDS41485.1	10	.	.	.	.	.	.	.	.	.	.	T	10.99	1.508391	0.27036	.	.	ENSG00000108021	ENST00000328090	T	0.05649	3.41	5.68	0.783	0.18572	.	0.778678	0.11626	N	0.545305	T	0.11410	0.0278	L	0.50333	1.59	0.09310	N	1	D	0.54964	0.969	P	0.53490	0.727	T	0.20672	-1.0268	10	0.48119	T	0.1	.	7.5245	0.27647	0.0:0.3478:0.0:0.6522	.	1123	Q5VWN6	F208B_HUMAN	D	1123	ENSP00000328426:Y1123D	ENSP00000328426:Y1123D	Y	+	1	0	C10orf18	5828757	0.011000	0.17503	0.004000	0.12327	0.004000	0.04260	0.238000	0.18004	0.094000	0.17404	0.482000	0.46254	TAC	FAM208B	-	NULL		0.488	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM208B	HGNC	protein_coding	OTTHUMT00000046571.2	T	NM_017782		5788751	+1	no_errors	ENST00000328090	ensembl	human	known	70_37	missense	SNP	0.009	G
FAM71A	149647	genome.wustl.edu	37	1	212799050	212799050	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr1:212799050G>T	ENST00000294829.3	+	1	1262	c.831G>T	c.(829-831)gaG>gaT	p.E277D	RP11-338C15.5_ENST00000427949.1_RNA	NM_153606.3	NP_705834.2	Q8IYT1	FA71A_HUMAN	family with sequence similarity 71, member A	277						nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(12)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)		GGATTAAAGAGgcagcagcag	0.552																																																	0													41.0	47.0	45.0					1																	212799050		2202	4300	6502	SO:0001583	missense	149647				CCDS1507.1	1q32.3	2008-02-05			ENSG00000162771	ENSG00000162771			26541	protein-coding gene	gene with protein product						12477932	Standard	NM_153606		Approved	FLJ32796	uc010pth.1	Q8IYT1	OTTHUMG00000041084	ENST00000294829.3:c.831G>T	1.37:g.212799050G>T	ENSP00000294829:p.Glu277Asp		Q5VTZ1	Missense_Mutation	SNP	pfam_DUF3699	p.E277D	ENST00000294829.3	37	c.831	CCDS1507.1	1	.	.	.	.	.	.	.	.	.	.	G	5.195	0.221562	0.09863	.	.	ENSG00000162771	ENST00000294829;ENST00000545975	T	0.03951	3.75	2.77	1.83	0.25207	.	.	.	.	.	T	0.02193	0.0068	N	0.08118	0	0.09310	N	1	B	0.30326	0.276	B	0.27887	0.084	T	0.48514	-0.9029	9	0.13470	T	0.59	.	5.6119	0.17410	0.1616:0.0:0.8384:0.0	.	277	Q8IYT1	FA71A_HUMAN	D	277;52	ENSP00000294829:E277D	ENSP00000294829:E277D	E	+	3	2	FAM71A	210865673	0.004000	0.15560	0.000000	0.03702	0.011000	0.07611	0.537000	0.23144	0.498000	0.27948	0.655000	0.94253	GAG	FAM71A	-	NULL		0.552	FAM71A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM71A	HGNC	protein_coding	OTTHUMT00000098529.1	G	NM_153606		212799050	+1	no_errors	ENST00000294829	ensembl	human	known	70_37	missense	SNP	0.001	T
FBXO18	84893	genome.wustl.edu	37	10	5945069	5945069	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr10:5945069C>T	ENST00000362091.4	+	2	203	c.88C>T	c.(88-90)Caa>Taa	p.Q30*	FBXO18_ENST00000397269.3_5'UTR|FBXO18_ENST00000470089.1_Intron|FBXO18_ENST00000379999.5_Nonsense_Mutation_p.Q81*	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	30					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)			NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						GCCCTTCGGTCAAAGATGGAC	0.478																																																	0													96.0	88.0	91.0					10																	5945069		2203	4300	6503	SO:0001587	stop_gained	84893			AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.88C>T	10.37:g.5945069C>T	ENSP00000355415:p.Gln30*		Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Nonsense_Mutation	SNP	pfam_UvrD-like_ATP-bd,pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	p.Q81*	ENST00000362091.4	37	c.241	CCDS7072.1	10	.	.	.	.	.	.	.	.	.	.	C	24.5	4.538982	0.85917	.	.	ENSG00000134452	ENST00000362091;ENST00000379999	.	.	.	5.42	5.42	0.78866	.	0.482216	0.23211	N	0.050664	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-9.721	18.0024	0.89201	0.0:1.0:0.0:0.0	.	.	.	.	X	30;81	.	ENSP00000355415:Q30X	Q	+	1	0	FBXO18	5985075	1.000000	0.71417	0.890000	0.34922	0.046000	0.14306	3.300000	0.51834	2.536000	0.85505	0.655000	0.94253	CAA	FBXO18	-	NULL		0.478	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO18	HGNC	protein_coding	OTTHUMT00000046596.1	C	NM_032807		5945069	+1	no_errors	ENST00000379999	ensembl	human	known	70_37	nonsense	SNP	0.989	T
FCGBP	8857	genome.wustl.edu	37	19	40366170	40366170	+	Silent	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr19:40366170C>T	ENST00000221347.6	-	30	14071	c.14064G>A	c.(14062-14064)gcG>gcA	p.A4688A		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4688						extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GGAAGTACTGCGCGGGCGGCA	0.706																																																	0													16.0	24.0	21.0					19																	40366170		2194	4295	6489	SO:0001819	synonymous_variant	8857			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.14064G>A	19.37:g.40366170C>T			O95784	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_VWF_C,smart_VWC_out	p.A4688	ENST00000221347.6	37	c.14064	CCDS12546.1	19																																																																																			FCGBP	-	pfam_Unchr_dom_Cys-rich,smart_Unchr_dom_Cys-rich		0.706	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	C	NM_003890		40366170	-1	no_errors	ENST00000221347	ensembl	human	known	70_37	silent	SNP	0.000	T
FHL1	2273	genome.wustl.edu	37	X	135291510	135291510	+	Missense_Mutation	SNP	G	G	A	rs199818971		TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chrX:135291510G>A	ENST00000345434.3	+	6	878	c.797G>A	c.(796-798)cGg>cAg	p.R266Q	FHL1_ENST00000539015.1_Intron|FHL1_ENST00000370676.3_Intron|FHL1_ENST00000370690.3_Intron|FHL1_ENST00000370683.1_Intron|FHL1_ENST00000543669.1_Intron|FHL1_ENST00000535737.1_Intron|FHL1_ENST00000394153.2_Intron|FHL1_ENST00000394155.2_Missense_Mutation_p.R266Q			Q13642	FHL1_HUMAN	four and a half LIM domains 1	266					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|organ morphogenesis (GO:0009887)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane depolarization (GO:0003254)|regulation of potassium ion transmembrane transporter activity (GO:1901016)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ion channel binding (GO:0044325)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(192;0.000127)					GCCAACCTCCGGGGCAGGCAT	0.577											OREG0019943	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													57.0	52.0	53.0					X																	135291510		1568	3582	5150	SO:0001583	missense	2273			U60115	CCDS14655.1, CCDS55505.1, CCDS55506.1, CCDS55507.1, CCDS76036.1	Xq26.3	2014-09-17			ENSG00000022267	ENSG00000022267			3702	protein-coding gene	gene with protein product	"""Four-and-a-half LIM domains 1"", ""LIM protein SLIMMER"""	300163				8753811, 9714789	Standard	NM_001449		Approved	SLIM1, KYO-T, bA535K18.1, FHL1B, XMPMA, FLH1A, MGC111107	uc004ezo.3	Q13642	OTTHUMG00000022504	ENST00000345434.3:c.797G>A	X.37:g.135291510G>A	ENSP00000071281:p.Arg266Gln	1617	B7Z5T4|B7Z793|O95212|Q13230|Q13645|Q5JXI7|Q5M7Y6|Q6IB30|Q9NZ40|Q9UKZ8|Q9Y630	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.R266Q	ENST00000345434.3	37	c.797	CCDS55507.1	X	.	.	.	.	.	.	.	.	.	.	g	14.14	2.447406	0.43429	.	.	ENSG00000022267	ENST00000394155;ENST00000345434	T;T	0.65178	-0.14;-0.14	4.41	3.46	0.39613	.	0.124211	0.56097	D	0.000034	T	0.40886	0.1135	N	0.08118	0	0.23886	N	0.99656	D	0.55385	0.971	P	0.45681	0.49	T	0.22347	-1.0219	10	0.34782	T	0.22	.	7.9992	0.30286	0.0:0.0:0.7575:0.2425	.	266	Q13642	FHL1_HUMAN	Q	266	ENSP00000377710:R266Q;ENSP00000071281:R266Q	ENSP00000071281:R266Q	R	+	2	0	FHL1	135119176	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.521000	0.45563	2.187000	0.69744	0.421000	0.28195	CGG	FHL1	-	NULL		0.577	FHL1-002	KNOWN	basic|CCDS	protein_coding	FHL1	HGNC	protein_coding	OTTHUMT00000058461.1	G	NM_001449		135291510	+1	no_errors	ENST00000345434	ensembl	human	known	70_37	missense	SNP	1.000	A
FOXP1	27086	genome.wustl.edu	37	3	71355068	71355068	+	Intron	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr3:71355068G>A	ENST00000318789.4	-	5	454				FOXP1-AS1_ENST00000465742.2_RNA|FOXP1_ENST00000318779.3_Intron|FOXP1_ENST00000484350.1_5'Flank|FOXP1_ENST00000493089.1_Intron|FOXP1_ENST00000475937.1_Intron	NM_001244810.1|NM_001244813.1|NM_032682.5	NP_001231739.1|NP_001231742.1|NP_116071.2	Q9H334	FOXP1_HUMAN	forkhead box P1						negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		GGCGGGAGAGGCAATTTTCAC	0.517			T	PAX5	ALL																																			Dom	yes		3	3p14.1	27086	forkhead box P1		L	0																																										SO:0001627	intron_variant	27086			AF146696	CCDS2914.1, CCDS33785.1, CCDS58837.1, CCDS58838.1, CCDS58839.1, CCDS74963.1, CCDS74964.1	3p14.1	2008-07-18			ENSG00000114861	ENSG00000114861		"""Forkhead boxes"""	3823	protein-coding gene	gene with protein product	"""fork head-related protein like B"", ""glutamine-rich factor 1"", ""PAX5/FOXP1 fusion protein"""	605515				8265594, 11751404	Standard	NM_032682		Approved	QRF1, 12CC4, HSPC215, hFKH1B	uc003doj.3	Q9H334	OTTHUMG00000158803	ENST00000318789.4:c.72-6037C>T	3.37:g.71355068G>A			A3QVP8|B3KV70|G5E9V8|Q8NAN6|Q9BSG9|Q9H332|Q9H333|Q9P0R1	RNA	SNP	-	NULL	ENST00000318789.4	37	NULL	CCDS2914.1	3																																																																																			FOXP1	-	-		0.517	FOXP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FOXP1	HGNC	protein_coding	OTTHUMT00000352250.1	G	NM_032682		71355068	-1	no_errors	ENST00000470112	ensembl	human	known	70_37	rna	SNP	0.996	A
FSIP2	401024	genome.wustl.edu	37	2	186671174	186671174	+	Missense_Mutation	SNP	T	T	C			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr2:186671174T>C	ENST00000424728.1	+	17	17141	c.17141T>C	c.(17140-17142)gTa>gCa	p.V5714A	FSIP2_ENST00000343098.5_Missense_Mutation_p.V5803A			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	5714										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						GGTGATAATGTATTAAATGTA	0.338																																																	0													86.0	81.0	82.0					2																	186671174		1810	4069	5879	SO:0001583	missense	401024			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.17141T>C	2.37:g.186671174T>C	ENSP00000401306:p.Val5714Ala		Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NULL	p.V5803A	ENST00000424728.1	37	c.17408		2	.	.	.	.	.	.	.	.	.	.	T	1.785	-0.480985	0.04383	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.39997	1.05;1.05	4.14	-2.76	0.05896	.	.	.	.	.	T	0.10252	0.0251	N	0.01352	-0.895	0.09310	N	1	.	.	.	.	.	.	T	0.28396	-1.0045	7	0.02654	T	1	.	3.1283	0.06414	0.3053:0.3143:0.0:0.3804	.	.	.	.	A	5803;5714	ENSP00000344403:V5803A;ENSP00000401306:V5714A	ENSP00000344403:V5803A	V	+	2	0	FSIP2	186379419	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.883000	0.04170	-0.530000	0.06349	-0.285000	0.09966	GTA	FSIP2	-	NULL		0.338	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	T	NM_173651		186671174	+1	no_errors	ENST00000343098	ensembl	human	known	70_37	missense	SNP	0.000	C
FTCD	10841	genome.wustl.edu	37	21	47558551	47558551	+	Silent	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr21:47558551C>T	ENST00000291670.5	-	12	1357	c.1314G>A	c.(1312-1314)gcG>gcA	p.A438A	FTCD_ENST00000397746.3_Silent_p.A438A|FTCD_ENST00000397743.1_Missense_Mutation_p.G424S|FTCD_ENST00000359679.2_Silent_p.A438A|FTCD_ENST00000498355.2_5'UTR|FTCD_ENST00000397748.1_Silent_p.A438A|FTCD_ENST00000355384.2_Missense_Mutation_p.G424S	NM_006657.2	NP_006648.1	O95954	FTCD_HUMAN	formimidoyltransferase cyclodeaminase	438	Cyclodeaminase/cyclohydrolase. {ECO:0000250}.		A -> E. {ECO:0000269|PubMed:12815595}.		cellular nitrogen compound metabolic process (GO:0034641)|cytoskeleton organization (GO:0007010)|folic acid-containing compound metabolic process (GO:0006760)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	folic acid binding (GO:0005542)|formimidoyltetrahydrofolate cyclodeaminase activity (GO:0030412)|glutamate formimidoyltransferase activity (GO:0030409)			endometrium(1)|large_intestine(2)|lung(9)|pancreas(1)|prostate(3)|skin(3)	19	Breast(49;0.214)			Colorectal(79;0.235)	Tetrahydrofolic acid(DB00116)	CCTGTAGGGCCGCCGTGCGCC	0.687																																																	0													8.0	11.0	10.0					21																	47558551		2166	4241	6407	SO:0001819	synonymous_variant	10841			U91541	CCDS13731.1	21q22.3	2013-06-10	2013-06-10		ENSG00000160282	ENSG00000160282	2.1.2.5, 4.3.1.4		3974	protein-coding gene	gene with protein product		606806	"""formiminotransferase cyclodeaminase"""			10029623, 10773664	Standard	NM_006657		Approved		uc002zif.3	O95954	OTTHUMG00000090488	ENST00000291670.5:c.1314G>A	21.37:g.47558551C>T			B9EGD0|Q86V03|Q9HCT4|Q9HCT5|Q9HCT6|Q9UHJ2	Missense_Mutation	SNP	pfam_Formiminotransferase_N,pfam_Formiminotransferase_C,pfam_Cyclodeamin/CycHdrlase,superfamily_FormiminoTrfase_N/C_subdom,superfamily_Cyclodeamin/CycHdrlase,tigrfam_Formiminotransferase_cat	p.G424S	ENST00000291670.5	37	c.1270	CCDS13731.1	21	.	.	.	.	.	.	.	.	.	.	C	4.336	0.061856	0.08339	.	.	ENSG00000160282	ENST00000355384;ENST00000397743	D;D	0.82255	-1.59;-1.59	4.39	-8.77	0.00827	.	.	.	.	.	T	0.68072	0.2961	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.51919	-0.8644	8	0.51188	T	0.08	0.9566	4.2873	0.10862	0.2132:0.2167:0.4239:0.1462	.	424	B7WPK3	.	S	424	ENSP00000347545:G424S;ENSP00000380851:G424S	ENSP00000347545:G424S	G	-	1	0	FTCD	46382979	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-3.257000	0.00537	-4.455000	0.00048	-2.418000	0.00219	GGC	FTCD	-	NULL		0.687	FTCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FTCD	HGNC	protein_coding	OTTHUMT00000206962.1	C	NM_006657		47558551	-1	no_errors	ENST00000355384	ensembl	human	known	70_37	missense	SNP	0.001	T
GABRG2	2566	genome.wustl.edu	37	5	161495040	161495040	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr5:161495040C>T	ENST00000361925.4	+	1	255	c.35C>T	c.(34-36)tCa>tTa	p.S12L	GABRG2_ENST00000393933.4_5'Flank|GABRG2_ENST00000356592.3_Missense_Mutation_p.S12L|GABRG2_ENST00000414552.2_Missense_Mutation_p.S12L			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	12					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ACAGGAAGCTCAGTCTACTCG	0.473																																																	0													87.0	83.0	84.0					5																	161495040		2203	4300	6503	SO:0001583	missense	2566				CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.35C>T	5.37:g.161495040C>T	ENSP00000354651:p.Ser12Leu		F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABBAg_rcpt,prints_GABAA_rcpt,prints_GABBAg2_rcpt,prints_GABAAa_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.S12L	ENST00000361925.4	37	c.35	CCDS4358.1	5	.	.	.	.	.	.	.	.	.	.	C	13.29	2.193342	0.38707	.	.	ENSG00000113327	ENST00000356592;ENST00000414552;ENST00000361925	T;T;T	0.80653	-1.4;-0.86;-1.4	5.08	3.17	0.36434	.	1.997860	0.02000	N	0.046185	T	0.62073	0.2398	N	0.03608	-0.345	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.58008	-0.7712	10	0.33940	T	0.23	.	4.7169	0.12899	0.1419:0.6098:0.1554:0.0929	.	12;12;12	F5HB82;P18507;P18507-2	.;GBRG2_HUMAN;.	L	12	ENSP00000349000:S12L;ENSP00000410732:S12L;ENSP00000354651:S12L	ENSP00000349000:S12L	S	+	2	0	GABRG2	161427618	0.328000	0.24687	0.999000	0.59377	0.996000	0.88848	0.296000	0.19083	1.148000	0.42385	0.491000	0.48974	TCA	GABRG2	-	prints_GABBAg2_rcpt		0.473	GABRG2-002	KNOWN	basic|CCDS	protein_coding	GABRG2	HGNC	protein_coding	OTTHUMT00000252706.1	C			161495040	+1	no_errors	ENST00000356592	ensembl	human	known	70_37	missense	SNP	0.886	T
GIGYF1	64599	genome.wustl.edu	37	7	100284015	100284015	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr7:100284015G>A	ENST00000275732.5	-	8	1945	c.736C>T	c.(736-738)Cgg>Tgg	p.R246W	GIGYF1_ENST00000471340.2_Intron	NM_022574.4	NP_072096.2	O75420	PERQ1_HUMAN	GRB10 interacting GYF protein 1	246					insulin-like growth factor receptor signaling pathway (GO:0048009)					central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					TTGCGCCGCCGTTCCCCATGT	0.647																																																	0													39.0	37.0	37.0					7																	100284015		2172	4230	6402	SO:0001583	missense	64599			AF053356	CCDS34708.1	7q22	2008-02-11	2008-02-11	2008-02-11	ENSG00000146830	ENSG00000146830			9126	protein-coding gene	gene with protein product	"""GYF domain containing 1"""	612064	"""PERQ amino acid rich, with GYF domain 1"""	PERQ1		9799793, 12771153	Standard	NM_022574		Approved	GYF1	uc003uwg.1	O75420	OTTHUMG00000157036	ENST00000275732.5:c.736C>T	7.37:g.100284015G>A	ENSP00000275732:p.Arg246Trp		Q6Y7W7|Q8WZ38	Missense_Mutation	SNP	pfam_GYF,superfamily_GYF,smart_GYF,pfscan_GYF	p.R246W	ENST00000275732.5	37	c.736	CCDS34708.1	7	.	.	.	.	.	.	.	.	.	.	.	21.5	4.163991	0.78339	.	.	ENSG00000146830	ENST00000275732	D	0.85258	-1.96	4.94	3.99	0.46301	.	0.000000	0.85682	D	0.000000	D	0.88370	0.6418	L	0.45137	1.4	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.88509	0.3088	10	0.66056	D	0.02	-28.431	12.2796	0.54757	0.0:0.0:0.8204:0.1796	.	246	O75420	PERQ1_HUMAN	W	246	ENSP00000275732:R246W	ENSP00000275732:R246W	R	-	1	2	GIGYF1	100121951	1.000000	0.71417	0.938000	0.37757	0.752000	0.42762	7.637000	0.83313	2.567000	0.86603	0.563000	0.77884	CGG	GIGYF1	-	NULL		0.647	GIGYF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIGYF1	HGNC	protein_coding	OTTHUMT00000347205.2	G	NM_022574		100284015	-1	no_errors	ENST00000275732	ensembl	human	known	70_37	missense	SNP	0.997	A
GLIPR1	11010	genome.wustl.edu	37	12	75892666	75892666	+	Missense_Mutation	SNP	T	T	C			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr12:75892666T>C	ENST00000266659.3	+	6	910	c.709T>C	c.(709-711)Ttt>Ctt	p.F237L	KRR1_ENST00000229214.4_3'UTR	NM_006851.2	NP_006842.2	P48060	GLIP1_HUMAN	GLI pathogenesis-related 1	237					cellular lipid metabolic process (GO:0044255)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	14						CACTTCTCTCTTTCTCATTGT	0.338																																																	0													162.0	149.0	153.0					12																	75892666		2203	4300	6503	SO:0001583	missense	11010			U16307	CCDS9011.1	12q14.1	2008-08-15	2008-08-15			ENSG00000139278			17001	protein-coding gene	gene with protein product		602692	"""GLI pathogenesis-related 1 (glioma)"""			7607567, 8973356	Standard	NM_006851		Approved	RTVP1, GliPR	uc001sxs.3	P48060	OTTHUMG00000169757	ENST00000266659.3:c.709T>C	12.37:g.75892666T>C	ENSP00000266659:p.Phe237Leu		A7YET6|F8VUC2|Q15409|Q969K2	Missense_Mutation	SNP	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1,prints_V5_allergen	p.F237L	ENST00000266659.3	37	c.709	CCDS9011.1	12	.	.	.	.	.	.	.	.	.	.	T	11.73	1.725958	0.30593	.	.	ENSG00000139278	ENST00000266659	T	0.06142	3.34	5.16	1.36	0.22044	.	0.446865	0.23600	N	0.046442	T	0.06188	0.0160	M	0.67953	2.075	0.58432	D	0.999994	B	0.29378	0.243	B	0.27380	0.079	T	0.20438	-1.0275	10	0.11794	T	0.64	.	5.5515	0.17093	0.1672:0.0:0.3469:0.4859	.	237	P48060	GLIP1_HUMAN	L	237	ENSP00000266659:F237L	ENSP00000266659:F237L	F	+	1	0	GLIPR1	74178933	0.976000	0.34144	0.996000	0.52242	0.410000	0.31052	0.479000	0.22228	0.944000	0.37579	0.459000	0.35465	TTT	GLIPR1	-	NULL		0.338	GLIPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLIPR1	HGNC	protein_coding	OTTHUMT00000405722.1	T	NM_006851		75892666	+1	no_errors	ENST00000266659	ensembl	human	known	70_37	missense	SNP	0.909	C
GPR149	344758	genome.wustl.edu	37	3	154145322	154145322	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr3:154145322G>A	ENST00000389740.2	-	2	1256	c.1157C>T	c.(1156-1158)gCg>gTg	p.A386V		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	386					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			CCCATCGGACGCCACTGCATA	0.488																																																	0													68.0	70.0	69.0					3																	154145322		1998	4178	6176	SO:0001583	missense	344758			AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.1157C>T	3.37:g.154145322G>A	ENSP00000374390:p.Ala386Val			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.A386V	ENST00000389740.2	37	c.1157	CCDS43162.1	3	.	.	.	.	.	.	.	.	.	.	G	16.94	3.260903	0.59431	.	.	ENSG00000174948	ENST00000389740	.	.	.	5.91	5.91	0.95273	.	0.641076	0.17169	N	0.184345	T	0.38026	0.1025	L	0.50333	1.59	0.09310	N	0.999993	P	0.42161	0.772	B	0.27262	0.078	T	0.47548	-0.9109	9	0.72032	D	0.01	-2.6203	20.2985	0.98592	0.0:0.0:1.0:0.0	.	386	Q86SP6	GP149_HUMAN	V	386	.	ENSP00000374390:A386V	A	-	2	0	GPR149	155628016	0.852000	0.29690	0.010000	0.14722	0.040000	0.13550	4.991000	0.63883	2.793000	0.96121	0.655000	0.94253	GCG	GPR149	-	NULL		0.488	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR149	HGNC	protein_coding	OTTHUMT00000353430.1	G	XM_293580		154145322	-1	no_errors	ENST00000389740	ensembl	human	known	70_37	missense	SNP	0.153	A
GPR17	2840	genome.wustl.edu	37	2	128409567	128409567	+	3'UTR	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr2:128409567C>T	ENST00000272644.3	+	0	1416				LIMS2_ENST00000324938.5_Intron|LIMS2_ENST00000409455.1_Intron|LIMS2_ENST00000409254.1_5'Flank|GPR17_ENST00000544369.1_3'UTR|GPR17_ENST00000486700.1_3'UTR|LIMS2_ENST00000409808.2_Intron|LIMS2_ENST00000410011.1_Intron|LIMS2_ENST00000355119.4_Intron|LIMS2_ENST00000545738.2_Intron	NM_001161416.1|NM_001161417.1|NM_005291.2	NP_001154888.1|NP_001154889.1|NP_005282.1	Q13304	GPR17_HUMAN	G protein-coupled receptor 17						chemokine-mediated signaling pathway (GO:0070098)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)|urinary_tract(1)	19	Colorectal(110;0.1)	Ovarian(717;0.15)		BRCA - Breast invasive adenocarcinoma(221;0.0677)		AGACACTCAACGACTTCATCT	0.557																																																	0																																										SO:0001624	3_prime_UTR_variant	2840				CCDS2148.1	2q21	2014-01-30			ENSG00000144230	ENSG00000144230		"""GPCR / Class A : Orphans"""	4471	protein-coding gene	gene with protein product		603071				8558062	Standard	NM_001161415		Approved		uc002tpc.3	Q13304	OTTHUMG00000131533	ENST00000272644.3:c.*238C>T	2.37:g.128409567C>T			A8K9L0|B2R9X0|Q8N5S7|Q9UDZ6|Q9UE21	RNA	SNP	-	NULL	ENST00000272644.3	37	NULL	CCDS2148.1	2																																																																																			GPR17	-	-		0.557	GPR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR17	HGNC	protein_coding	OTTHUMT00000254390.1	C			128409567	+1	no_errors	ENST00000486700	ensembl	human	known	70_37	rna	SNP	0.000	T
GRID2	2895	genome.wustl.edu	37	4	94006335	94006335	+	Nonsense_Mutation	SNP	C	C	G			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr4:94006335C>G	ENST00000282020.4	+	3	692	c.434C>G	c.(433-435)tCa>tGa	p.S145*	GRID2_ENST00000510992.1_Intron|GRID2_ENST00000505687.1_3'UTR	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	145					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		TACACTCTCTCAGTTCGCCCA	0.483																																																	0													100.0	94.0	96.0					4																	94006335		2203	4300	6503	SO:0001587	stop_gained	2895			AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.434C>G	4.37:g.94006335C>G	ENSP00000282020:p.Ser145*		E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Nonsense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.S145*	ENST00000282020.4	37	c.434	CCDS3637.1	4	.	.	.	.	.	.	.	.	.	.	C	38	6.706627	0.97776	.	.	ENSG00000152208	ENST00000282020	.	.	.	5.23	5.23	0.72850	.	0.259259	0.40064	N	0.001190	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	13.4886	0.61382	0.0:0.9246:0.0:0.0754	.	.	.	.	X	145	.	ENSP00000282020:S145X	S	+	2	0	GRID2	94225358	0.823000	0.29233	0.582000	0.28627	0.961000	0.63080	2.426000	0.44731	2.613000	0.88420	0.655000	0.94253	TCA	GRID2	-	pfam_ANF_lig-bd_rcpt		0.483	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID2	HGNC	protein_coding	OTTHUMT00000253588.2	C			94006335	+1	no_errors	ENST00000282020	ensembl	human	known	70_37	nonsense	SNP	0.907	G
GVINP1	387751	genome.wustl.edu	37	11	6740009	6740009	+	RNA	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr11:6740009C>T	ENST00000526769.3	-	0	3195					NR_003945.1		Q7Z2Y8	GVIN1_HUMAN	GTPase, very large interferon inducible pseudogene 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										TATAATAGTTCTTCCCTTTTG	0.418																																																	0																																												387751			BX538318		11p15.4	2014-03-18	2010-09-28	2010-09-28	ENSG00000254838	ENSG00000254838			25813	pseudogene	pseudogene	"""very large inducible GTPase 1"""		"""GTPase, very large interferon inducible 1"", ""GTPase, very large interferon inducible 1, pseudogene"""	GVIN1, GVIN1P		12874213, 19369598	Standard	NR_003945		Approved	VLIG-1, FLJ13373, VLIG1	uc001meo.4	Q7Z2Y8	OTTHUMG00000165506		11.37:g.6740009C>T			A6NFL2|Q9H8N5	RNA	SNP	-	NULL	ENST00000526769.3	37	NULL		11																																																																																			GVINP1	-	-		0.418	GVINP1-002	KNOWN	basic|exp_conf	processed_transcript	GVINP1	HGNC	pseudogene	OTTHUMT00000386960.3	C	NR_003945		6740009	-1	no_errors	ENST00000526769	ensembl	human	known	70_37	rna	SNP	0.000	T
HABP4	22927	genome.wustl.edu	37	9	99227724	99227724	+	Silent	SNP	C	C	T	rs142219564		TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr9:99227724C>T	ENST00000375249.4	+	3	693	c.618C>T	c.(616-618)gaC>gaT	p.D206D	HABP4_ENST00000375251.3_Intron	NM_014282.2	NP_055097.2			hyaluronan binding protein 4											NS(1)|cervix(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	13		Acute lymphoblastic leukemia(62;0.0169)|all_hematologic(171;0.214)				GAGTTTTTGACGCTTTTGACC	0.473													C|||	1	0.000199681	0.0	0.0	5008	,	,		17023	0.0		0.001	False		,,,				2504	0.0																0								C		0,4406		0,0,2203	117.0	127.0	123.0		618	-7.0	0.0	9	dbSNP_134	123	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	HABP4	NM_014282.2		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		206/414	99227724	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	22927			AF241831	CCDS6719.1	9q22.3-q31	2008-02-05			ENSG00000130956	ENSG00000130956			17062	protein-coding gene	gene with protein product						9523163, 10887182	Standard	XM_005251812		Approved	IHABP4, SERBP1L	uc010msg.3	Q5JVS0	OTTHUMG00000020298	ENST00000375249.4:c.618C>T	9.37:g.99227724C>T				Silent	SNP	pfam_HABP4_PAIRBP1-bd	p.D206	ENST00000375249.4	37	c.618	CCDS6719.1	9																																																																																			HABP4	-	NULL		0.473	HABP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HABP4	HGNC	protein_coding	OTTHUMT00000053269.1	C	NM_014282		99227724	+1	no_errors	ENST00000375249	ensembl	human	known	70_37	silent	SNP	0.028	T
HK2	3099	genome.wustl.edu	37	2	75107455	75107455	+	Silent	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr2:75107455C>T	ENST00000290573.2	+	10	1929	c.1329C>T	c.(1327-1329)ctC>ctT	p.L443L	HK2_ENST00000409174.1_Silent_p.L415L	NM_000189.4	NP_000180.2	P52789	HXK2_HUMAN	hexokinase 2	443	Hexokinase type-2 1.|Regulatory.				apoptotic mitochondrial changes (GO:0008637)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|lactation (GO:0007595)|regulation of glucose import (GO:0046324)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)	p.L443L(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	43						TCCGCTTCCTCCGCTCCGAGG	0.617																																																	1	Substitution - coding silent(1)	breast(1)											117.0	131.0	126.0					2																	75107455		2203	4300	6503	SO:0001819	synonymous_variant	3099				CCDS1956.1	2p13	2010-03-19			ENSG00000159399	ENSG00000159399	2.7.1.1		4923	protein-coding gene	gene with protein product		601125					Standard	NM_000189		Approved		uc002snd.3	P52789	OTTHUMG00000129972	ENST00000290573.2:c.1329C>T	2.37:g.75107455C>T			D6W5J2|Q8WU87|Q9UN82	Silent	SNP	pfam_Hexokinase_C,pfam_Hexokinase_N,prints_Hexokinase	p.L443	ENST00000290573.2	37	c.1329	CCDS1956.1	2																																																																																			HK2	-	pfam_Hexokinase_C		0.617	HK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HK2	HGNC	protein_coding	OTTHUMT00000252238.2	C	NM_000189		75107455	+1	no_errors	ENST00000290573	ensembl	human	known	70_37	silent	SNP	1.000	T
HNF1B	6928	genome.wustl.edu	37	17	36093702	36093702	+	Silent	SNP	G	G	A	rs148713761		TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr17:36093702G>A	ENST00000225893.4	-	3	1018	c.657C>T	c.(655-657)tcC>tcT	p.S219S	HNF1B_ENST00000561193.1_Silent_p.S193S|HNF1B_ENST00000427275.2_Silent_p.S193S|HNF1B_ENST00000560016.1_Silent_p.S219S	NM_000458.2|NM_001165923.1	NP_000449.1|NP_001159395.1	P35680	HNF1B_HUMAN	HNF1 homeobox B	219					anterior/posterior pattern specification (GO:0009952)|branching morphogenesis of an epithelial tube (GO:0048754)|embryonic digestive tract morphogenesis (GO:0048557)|endocrine pancreas development (GO:0031018)|endodermal cell fate specification (GO:0001714)|epithelial cell proliferation (GO:0050673)|genitalia development (GO:0048806)|hepatoblast differentiation (GO:0061017)|hindbrain development (GO:0030902)|inner cell mass cell differentiation (GO:0001826)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|mesonephric duct formation (GO:0072181)|negative regulation of mesenchymal cell apoptotic process involved in mesonephric nephron morphogenesis (GO:0061296)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric nephron tubule development (GO:0039020)|pronephros development (GO:0048793)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of endodermal cell fate specification (GO:0042663)|regulation of pronephros size (GO:0035565)|regulation of Wnt signaling pathway (GO:0030111)|response to glucose (GO:0009749)|ureteric bud elongation (GO:0060677)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(3)|large_intestine(2)|liver(1)|lung(3)|ovary(3)|prostate(1)|skin(2)	28		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			AGGCATCATCGGACTGCCCAG	0.552																																					Colon(71;102 1179 9001 27917 43397)												0								G	,	0,4406		0,0,2203	81.0	73.0	76.0		657,579	2.9	1.0	17	dbSNP_134	76	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	HNF1B	NM_000458.2,NM_001165923.1	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	219/558,193/532	36093702	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	6928			BC017714	CCDS11324.1, CCDS58538.1	17q12	2014-05-06	2007-08-24	2007-08-24	ENSG00000108753	ENSG00000275410		"""Homeoboxes / HNF class"""	11630	protein-coding gene	gene with protein product		189907	"""transcription factor 2, hepatic; LF-B3; variant hepatic nuclear factor"""	TCF2		1677179, 10484768	Standard	NM_000458		Approved	LFB3, VHNF1, HNF1beta, MODY5	uc002hok.4	P35680	OTTHUMG00000188478	ENST00000225893.4:c.657C>T	17.37:g.36093702G>A			B4DKM3|E0YMJ9	Silent	SNP	pfam_HNF1b_C,pfam_HNF-1_N,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_HNF1_dimer_dom,smart_Homeodomain,pfscan_Homeodomain	p.S219	ENST00000225893.4	37	c.657	CCDS11324.1	17																																																																																			HNF1B	-	NULL		0.552	HNF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF1B	HGNC	protein_coding	OTTHUMT00000256807.3	G	NM_000458		36093702	-1	no_errors	ENST00000225893	ensembl	human	known	70_37	silent	SNP	1.000	A
HS6ST2	90161	genome.wustl.edu	37	X	131762918	131762918	+	Missense_Mutation	SNP	T	T	C			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chrX:131762918T>C	ENST00000370836.2	-	4	1566	c.1151A>G	c.(1150-1152)aAt>aGt	p.N384S	HS6ST2_ENST00000406696.3_Missense_Mutation_p.N110S|HS6ST2_ENST00000521489.1_Missense_Mutation_p.N424S|HS6ST2_ENST00000370833.2_Missense_Mutation_p.N278S	NM_147175.3	NP_671704.3	Q96MM7	H6ST2_HUMAN	heparan sulfate 6-O-sulfotransferase 2	384					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(2)	9	Acute lymphoblastic leukemia(192;0.000127)					GTTGGCTAGATTGTAGGGACA	0.557																																																	0													72.0	69.0	70.0					X																	131762918		2067	4198	6265	SO:0001583	missense	90161			AB067776	CCDS48169.1, CCDS48170.1	Xq26.2	2008-02-05			ENSG00000171004	ENSG00000171004		"""Sulfotransferases, membrane-bound"""	19133	protein-coding gene	gene with protein product		300545				10644753	Standard	NM_147175		Approved		uc011mvd.1	Q96MM7	OTTHUMG00000022430	ENST00000370836.2:c.1151A>G	X.37:g.131762918T>C	ENSP00000359873:p.Asn384Ser		B9WRT4|B9WRT5|E9PDY5|Q2TB13|Q4VC07|Q6PIC4|Q86SM9|Q8N3T4|Q8NBN4|Q96SJ4	Missense_Mutation	SNP	pfam_Sulfotransferase	p.N424S	ENST00000370836.2	37	c.1271	CCDS48169.1	X	.	.	.	.	.	.	.	.	.	.	T	18.49	3.635152	0.67130	.	.	ENSG00000171004	ENST00000370837;ENST00000370836;ENST00000521489;ENST00000406696;ENST00000370833;ENST00000319809	T;T;T;T;T	0.75704	-0.96;-0.96;-0.96;-0.96;-0.96	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	D	0.88533	0.6462	M	0.89904	3.07	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.87578	0.996;0.998;0.998	D	0.90737	0.4647	10	0.87932	D	0	-9.1769	14.5446	0.68020	0.0:0.0:0.0:1.0	.	384;424;110	Q96MM7;E9PDY5;B7Z5H6	H6ST2_HUMAN;.;.	S	238;384;424;110;278;265	ENSP00000359874:N238S;ENSP00000359873:N384S;ENSP00000429473:N424S;ENSP00000384013:N110S;ENSP00000359870:N278S	ENSP00000324617:N265S	N	-	2	0	HS6ST2	131590599	1.000000	0.71417	0.995000	0.50966	0.960000	0.62799	8.040000	0.89188	2.034000	0.60081	0.486000	0.48141	AAT	HS6ST2	-	pfam_Sulfotransferase		0.557	HS6ST2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	HS6ST2	HGNC	protein_coding	OTTHUMT00000058332.3	T	NM_147174		131762918	-1	no_errors	ENST00000521489	ensembl	human	known	70_37	missense	SNP	1.000	C
HS6ST2	90161	genome.wustl.edu	37	X	132090974	132090974	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chrX:132090974G>A	ENST00000370836.2	-	3	1224	c.809C>T	c.(808-810)cCg>cTg	p.P270L	HS6ST2_ENST00000521489.1_Missense_Mutation_p.P270L|HS6ST2_ENST00000370833.2_Missense_Mutation_p.P124L	NM_147175.3	NP_671704.3	Q96MM7	H6ST2_HUMAN	heparan sulfate 6-O-sulfotransferase 2	270					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(2)	9	Acute lymphoblastic leukemia(192;0.000127)					CCGCTTACCCGGCCGGTGGCA	0.657																																																	0													24.0	28.0	26.0					X																	132090974		2175	4250	6425	SO:0001583	missense	90161			AB067776	CCDS48169.1, CCDS48170.1	Xq26.2	2008-02-05			ENSG00000171004	ENSG00000171004		"""Sulfotransferases, membrane-bound"""	19133	protein-coding gene	gene with protein product		300545				10644753	Standard	NM_147175		Approved		uc011mvd.1	Q96MM7	OTTHUMG00000022430	ENST00000370836.2:c.809C>T	X.37:g.132090974G>A	ENSP00000359873:p.Pro270Leu		B9WRT4|B9WRT5|E9PDY5|Q2TB13|Q4VC07|Q6PIC4|Q86SM9|Q8N3T4|Q8NBN4|Q96SJ4	Missense_Mutation	SNP	pfam_Sulfotransferase	p.P270L	ENST00000370836.2	37	c.809	CCDS48169.1	X	.	.	.	.	.	.	.	.	.	.	g	21.6	4.179224	0.78564	.	.	ENSG00000171004	ENST00000370837;ENST00000370836;ENST00000521489;ENST00000370833;ENST00000319809	T;T;T;T	0.49432	0.78;0.78;0.78;0.78	4.56	4.56	0.56223	.	0.000000	0.85682	D	0.000000	T	0.73009	0.3532	M	0.89414	3.03	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.79797	-0.1652	10	0.87932	D	0	-14.1497	15.0269	0.71677	0.0:0.0:1.0:0.0	.	270;270	Q96MM7;E9PDY5	H6ST2_HUMAN;.	L	124;270;270;124;111	ENSP00000359874:P124L;ENSP00000359873:P270L;ENSP00000429473:P270L;ENSP00000359870:P124L	ENSP00000324617:P111L	P	-	2	0	HS6ST2	131918656	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.153000	0.94687	2.096000	0.63516	0.525000	0.51046	CCG	HS6ST2	-	pfam_Sulfotransferase		0.657	HS6ST2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	HS6ST2	HGNC	protein_coding	OTTHUMT00000058332.3	G	NM_147174		132090974	-1	no_errors	ENST00000521489	ensembl	human	known	70_37	missense	SNP	1.000	A
IFIT2	3433	genome.wustl.edu	37	10	91066443	91066443	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr10:91066443C>T	ENST00000371826.3	+	2	899	c.730C>T	c.(730-732)Cca>Tca	p.P244S	LIPA_ENST00000371837.1_Intron|LIPA_ENST00000487618.1_Intron	NM_001547.4	NP_001538.4	P09913	IFIT2_HUMAN	interferon-induced protein with tetratricopeptide repeats 2	244					apoptotic mitochondrial changes (GO:0008637)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|negative regulation of protein binding (GO:0032091)|positive regulation of apoptotic process (GO:0043065)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	12		Colorectal(252;0.0161)				GGAGAAAGCCCCAGGTGTAAC	0.438																																																	0													78.0	78.0	78.0					10																	91066443		1982	4180	6162	SO:0001583	missense	3433			M14660	CCDS41548.1	10q23.31	2013-01-11			ENSG00000119922	ENSG00000119922		"""Tetratricopeptide (TTC) repeat domain containing"""	5409	protein-coding gene	gene with protein product		147040		IFI54, G10P2		3175763, 3360121	Standard	NM_001547		Approved	IFI-54, ISG-54K, cig42, GARG-39	uc009xts.3	P09913	OTTHUMG00000018707	ENST00000371826.3:c.730C>T	10.37:g.91066443C>T	ENSP00000360891:p.Pro244Ser		Q5T767	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.P244S	ENST00000371826.3	37	c.730	CCDS41548.1	10	.	.	.	.	.	.	.	.	.	.	C	0.022	-1.410572	0.01145	.	.	ENSG00000119922	ENST00000371826	T	0.55234	0.53	4.58	3.68	0.42216	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.217055	0.38959	N	0.001505	T	0.43986	0.1272	L	0.37897	1.145	0.48087	D	0.999581	P	0.51351	0.944	P	0.46362	0.514	T	0.25502	-1.0130	10	0.11794	T	0.64	-2.3938	12.9167	0.58211	0.0:0.9202:0.0:0.0798	.	244	P09913	IFIT2_HUMAN	S	244	ENSP00000360891:P244S	ENSP00000360891:P244S	P	+	1	0	IFIT2	91056423	0.096000	0.21769	0.124000	0.21820	0.066000	0.16364	0.952000	0.29149	1.533000	0.49186	0.655000	0.94253	CCA	IFIT2	-	pfscan_TPR-contain_dom		0.438	IFIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFIT2	HGNC	protein_coding	OTTHUMT00000049293.1	C	NM_001547		91066443	+1	no_errors	ENST00000371826	ensembl	human	known	70_37	missense	SNP	0.921	T
IL12RB2	3595	genome.wustl.edu	37	1	67861644	67861644	+	Missense_Mutation	SNP	G	G	A	rs371557250		TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr1:67861644G>A	ENST00000262345.1	+	16	3101	c.2461G>A	c.(2461-2463)Gaa>Aaa	p.E821K	IL12RB2_ENST00000371000.1_3'UTR|IL12RB2_ENST00000544434.1_Missense_Mutation_p.E735K	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2	821					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						CTCTCTGGAAGAACTGGAGCC	0.527																																																	0								G	LYS/GLU	0,4406		0,0,2203	271.0	258.0	262.0		2461	4.4	0.7	1		262	1,8599	1.2+/-3.3	0,1,4299	no	missense	IL12RB2	NM_001559.2	56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	821/863	67861644	1,13005	2203	4300	6503	SO:0001583	missense	3595			U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.2461G>A	1.37:g.67861644G>A	ENSP00000262345:p.Glu821Lys		B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_IgC2-like_lig-bd,pfam_IL6_recept-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.E821K	ENST00000262345.1	37	c.2461	CCDS638.1	1	.	.	.	.	.	.	.	.	.	.	G	15.30	2.791360	0.50102	0.0	1.16E-4	ENSG00000081985	ENST00000262345;ENST00000544434	T;T	0.49720	0.77;1.73	5.29	4.36	0.52297	.	0.423880	0.26971	N	0.021574	T	0.32912	0.0845	N	0.19112	0.55	0.80722	D	1	D;P	0.62365	0.991;0.651	P;B	0.56563	0.801;0.165	T	0.13791	-1.0496	10	0.49607	T	0.09	-8.9469	9.1779	0.37123	0.0981:0.0:0.9019:0.0	.	735;821	F5H7L6;Q99665	.;I12R2_HUMAN	K	821;735	ENSP00000262345:E821K;ENSP00000442443:E735K	ENSP00000262345:E821K	E	+	1	0	IL12RB2	67634232	0.995000	0.38212	0.684000	0.30055	0.070000	0.16714	2.500000	0.45381	2.643000	0.89663	0.591000	0.81541	GAA	IL12RB2	-	NULL		0.527	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL12RB2	HGNC	protein_coding	OTTHUMT00000025202.2	G	NM_001559		67861644	+1	no_errors	ENST00000262345	ensembl	human	known	70_37	missense	SNP	0.820	A
IL20	50604	genome.wustl.edu	37	1	207039699	207039699	+	Missense_Mutation	SNP	A	A	G			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr1:207039699A>G	ENST00000367098.1	+	3	578	c.215A>G	c.(214-216)cAa>cGa	p.Q72R	IL20_ENST00000391930.2_Missense_Mutation_p.Q72R|IL20_ENST00000367096.3_Missense_Mutation_p.Q72R			Q9UHF5	IL17B_HUMAN	interleukin 20	0					cell-cell signaling (GO:0007267)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)			endometrium(2)|large_intestine(3)|lung(2)|pancreas(1)|urinary_tract(1)	9	Breast(84;0.201)			OV - Ovarian serous cystadenocarcinoma(81;0.00459)		GAGTCTTTGCAAGACACAAAG	0.493																																																	0													134.0	136.0	135.0					1																	207039699		2203	4300	6503	SO:0001583	missense	50604			AF224266	CCDS1470.1	1q32	2008-02-05			ENSG00000162891	ENSG00000162891		"""Interleukins and interleukin receptors"""	6002	protein-coding gene	gene with protein product		605619				11163236	Standard	NM_018724		Approved	ZCYTO10, IL10D, IL-20	uc001her.3	Q9NYY1	OTTHUMG00000036456	ENST00000367098.1:c.215A>G	1.37:g.207039699A>G	ENSP00000356065:p.Gln72Arg		Q14CE5	Missense_Mutation	SNP	pfam_Interleukin-10/19/20/24,superfamily_4_helix_cytokine-like_core,smart_Interleukin-10/19/20/24,prints_Interleukin-20,prints_Interleukin-24	p.Q72R	ENST00000367098.1	37	c.215	CCDS1470.1	1	.	.	.	.	.	.	.	.	.	.	A	8.750	0.921155	0.17982	.	.	ENSG00000162891	ENST00000367098;ENST00000367096;ENST00000391930	T;T;T	0.18338	2.22;2.22;2.22	4.74	3.59	0.41128	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.551134	0.19113	N	0.122381	T	0.13927	0.0337	L	0.47190	1.495	0.28460	N	0.915924	B;B	0.16396	0.017;0.005	B;B	0.17722	0.011;0.019	T	0.24154	-1.0168	10	0.18710	T	0.47	-1.5823	8.0319	0.30470	0.8197:0.0:0.0:0.1803	.	72;72	Q2THG6;Q9NYY1	.;IL20_HUMAN	R	72	ENSP00000356065:Q72R;ENSP00000356063:Q72R;ENSP00000375796:Q72R	ENSP00000356063:Q72R	Q	+	2	0	IL20	205106322	1.000000	0.71417	1.000000	0.80357	0.407000	0.30961	2.051000	0.41307	0.742000	0.32697	0.528000	0.53228	CAA	IL20	-	pfam_Interleukin-10/19/20/24,superfamily_4_helix_cytokine-like_core,smart_Interleukin-10/19/20/24		0.493	IL20-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IL20	HGNC	protein_coding	OTTHUMT00000088676.1	A	NM_018724		207039699	+1	no_errors	ENST00000367096	ensembl	human	known	70_37	missense	SNP	1.000	G
IL26	55801	genome.wustl.edu	37	12	68619010	68619010	+	Silent	SNP	A	A	G			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr12:68619010A>G	ENST00000229134.4	-	3	346	c.282T>C	c.(280-282)ttT>ttC	p.F94F	IFNG-AS1_ENST00000536914.1_RNA	NM_018402.1	NP_060872.1	Q9NPH9	IL26_HUMAN	interleukin 26	94					cell-cell signaling (GO:0007267)|negative regulation of epithelial cell proliferation (GO:0050680)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(1)	12			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000515)		GCAGTTGACCAAAAACGTCTT	0.358																																																	0													83.0	77.0	79.0					12																	68619010		2203	4300	6503	SO:0001819	synonymous_variant	55801			AJ251549	CCDS8981.1	12q15	2008-08-04			ENSG00000111536	ENSG00000111536		"""Interleukins and interleukin receptors"""	17119	protein-coding gene	gene with protein product		605679				10729163, 11528524	Standard	NM_018402		Approved	AK155, IL-26	uc001stx.1	Q9NPH9	OTTHUMG00000169114	ENST00000229134.4:c.282T>C	12.37:g.68619010A>G				Silent	SNP	pfam_Interleukin-10/19/20/24,superfamily_4_helix_cytokine-like_core	p.F94	ENST00000229134.4	37	c.282	CCDS8981.1	12																																																																																			IL26	-	pfam_Interleukin-10/19/20/24,superfamily_4_helix_cytokine-like_core		0.358	IL26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL26	HGNC	protein_coding	OTTHUMT00000402302.1	A	NM_018402		68619010	-1	no_errors	ENST00000229134	ensembl	human	known	70_37	silent	SNP	1.000	G
INTS6	26512	genome.wustl.edu	37	13	52025274	52025274	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr13:52025274C>T	ENST00000311234.4	-	3	698	c.226G>A	c.(226-228)Gaa>Aaa	p.E76K	INTS6_ENST00000463928.1_Missense_Mutation_p.E76K|INTS6_ENST00000425000.1_5'UTR|INTS6-AS1_ENST00000595424.1_RNA|INTS6_ENST00000491723.1_5'UTR|INTS6-AS1_ENST00000594959.1_RNA|INTS6-AS1_ENST00000593709.1_RNA|INTS6_ENST00000442263.3_Missense_Mutation_p.E76K|INTS6_ENST00000398119.2_Missense_Mutation_p.E63K|INTS6-AS1_ENST00000595435.1_RNA|INTS6-AS1_ENST00000596050.1_RNA|INTS6-AS1_ENST00000598905.1_RNA|INTS6-AS1_ENST00000593672.1_RNA|INTS6_ENST00000420668.2_Missense_Mutation_p.E76K	NM_012141.2	NP_036273.1	Q9UL03	INT6_HUMAN	integrator complex subunit 6	76	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				signal transduction (GO:0007165)|snRNA processing (GO:0016180)	actin cytoskeleton (GO:0015629)|integrator complex (GO:0032039)|nucleus (GO:0005634)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Breast(56;0.000286)|Lung NSC(96;0.00145)|Prostate(109;0.00403)|Hepatocellular(98;0.065)|Myeloproliferative disorder(33;0.163)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;7.7e-08)		TTTTTCAATTCATTCATAAAC	0.333																																																	0													84.0	88.0	86.0					13																	52025274		2203	4299	6502	SO:0001583	missense	26512			AF097645	CCDS9428.1, CCDS41890.1, CCDS45048.1	13q14.3	2010-08-20	2006-03-15	2006-03-15	ENSG00000102786	ENSG00000102786		"""DEAD-boxes"""	14879	protein-coding gene	gene with protein product		604331	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26"""	DDX26		10467397, 16239144	Standard	XM_005266340		Approved	DICE1, HDB, Notchl2, DBI-1, DDX26A, INT6	uc001vfk.3	Q9UL03	OTTHUMG00000016945	ENST00000311234.4:c.226G>A	13.37:g.52025274C>T	ENSP00000310260:p.Glu76Lys		Q0P664|Q6PJP4|Q9UFK0|Q9Y5M9	Missense_Mutation	SNP	pfam_VWF_A,pfscan_VWF_A	p.E76K	ENST00000311234.4	37	c.226	CCDS9428.1	13	.	.	.	.	.	.	.	.	.	.	C	35	5.470705	0.96274	.	.	ENSG00000102786	ENST00000311234;ENST00000398119;ENST00000420668;ENST00000491189;ENST00000488009;ENST00000485178;ENST00000483288;ENST00000442263	T;T;T;T;T;T	0.65732	2.63;-0.17;2.63;-0.17;-0.17;2.63	5.65	5.65	0.86999	von Willebrand factor, type A (3);	0.099758	0.64402	D	0.000002	D	0.83013	0.5162	M	0.89414	3.03	0.80722	D	1	D;D	0.89917	0.974;1.0	D;D	0.83275	0.969;0.996	D	0.84714	0.0736	10	0.52906	T	0.07	-9.0788	18.7157	0.91675	0.0:1.0:0.0:0.0	.	76;76	Q9UL03-2;Q9UL03	.;INT6_HUMAN	K	76;63;76;3;3;63;63;76	ENSP00000310260:E76K;ENSP00000381187:E63K;ENSP00000388585:E76K;ENSP00000419569:E63K;ENSP00000417707:E63K;ENSP00000411245:E76K	ENSP00000310260:E76K	E	-	1	0	INTS6	50923275	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.798000	0.85924	2.663000	0.90544	0.561000	0.74099	GAA	INTS6	-	pfam_VWF_A,pfscan_VWF_A		0.333	INTS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS6	HGNC	protein_coding	OTTHUMT00000045023.1	C	NM_012141		52025274	-1	no_errors	ENST00000311234	ensembl	human	known	70_37	missense	SNP	1.000	T
IPO4	79711	genome.wustl.edu	37	14	24653559	24653559	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr14:24653559G>A	ENST00000354464.6	-	17	1878	c.1702C>T	c.(1702-1704)Cag>Tag	p.Q568*	RP11-468E2.2_ENST00000561419.1_3'UTR	NM_024658.3	NP_078934.3	Q8TEX9	IPO4_HUMAN	importin 4	568					DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|stomach(2)|urinary_tract(1)	33				GBM - Glioblastoma multiforme(265;0.0087)		AGACCCAGCTGGCAGCATTCC	0.672																																																	0													16.0	22.0	20.0					14																	24653559		2165	4261	6426	SO:0001587	stop_gained	79711			AF411122	CCDS9616.1	14q11.2	2003-03-10			ENSG00000196497	ENSG00000196497		"""Importins"""	19426	protein-coding gene	gene with protein product						11823430	Standard	NR_051979		Approved	Imp4, FLJ23338	uc001wmv.1	Q8TEX9	OTTHUMG00000028801	ENST00000354464.6:c.1702C>T	14.37:g.24653559G>A	ENSP00000346453:p.Gln568*		B2RN95|Q2NL96|Q86TZ9|Q8NCG8|Q96SJ3|Q9BTI4|Q9H5L0	Nonsense_Mutation	SNP	pfam_HEAT,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_HEAT_type_2,pfscan_Importin-beta_N	p.Q568*	ENST00000354464.6	37	c.1702	CCDS9616.1	14	.	.	.	.	.	.	.	.	.	.	G	40	8.207482	0.98706	.	.	ENSG00000196497	ENST00000354464;ENST00000399536	.	.	.	5.4	5.4	0.78164	.	0.226336	0.39544	N	0.001326	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	-10.7081	18.116	0.89555	0.0:0.0:1.0:0.0	.	.	.	.	X	568;244	.	ENSP00000346453:Q568X	Q	-	1	0	IPO4	23723399	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.025000	0.70864	2.814000	0.96858	0.655000	0.94253	CAG	IPO4	-	superfamily_ARM-type_fold		0.672	IPO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO4	HGNC	protein_coding	OTTHUMT00000071931.4	G	NM_024658		24653559	-1	no_errors	ENST00000354464	ensembl	human	known	70_37	nonsense	SNP	1.000	A
IRAK3	11213	genome.wustl.edu	37	12	66605255	66605255	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr12:66605255C>G	ENST00000261233.4	+	5	887	c.466C>G	c.(466-468)Caa>Gaa	p.Q156E	IRAK3_ENST00000457197.2_Missense_Mutation_p.Q95E	NM_007199.2	NP_009130.2			interleukin-1 receptor-associated kinase 3											breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(28;0.0203)		CATCAGCTTTCAAAATATCAT	0.343																																																	0													58.0	57.0	57.0					12																	66605255		2202	4299	6501	SO:0001583	missense	11213			AF113136	CCDS8975.1, CCDS44937.1	12q13.13	2008-05-02			ENSG00000090376	ENSG00000090376			17020	protein-coding gene	gene with protein product		604459				10383454	Standard	NM_001142523		Approved	IRAK-M	uc001sth.3	Q9Y616	OTTHUMG00000169002	ENST00000261233.4:c.466C>G	12.37:g.66605255C>G	ENSP00000261233:p.Gln156Glu			Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death,superfamily_Kinase-like_dom,superfamily_DEATH-like,smart_Death,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Death,pfscan_Prot_kinase_cat_dom	p.Q156E	ENST00000261233.4	37	c.466	CCDS8975.1	12	.	.	.	.	.	.	.	.	.	.	C	8.492	0.862334	0.17178	.	.	ENSG00000090376	ENST00000261233;ENST00000457197	T;T	0.32988	1.43;1.43	6.03	5.08	0.68730	Protein kinase-like domain (1);	0.417296	0.25183	N	0.032502	T	0.17789	0.0427	N	0.24115	0.695	0.28819	N	0.8978	P;B	0.36837	0.571;0.435	B;B	0.30855	0.121;0.057	T	0.09164	-1.0687	9	.	.	.	-4.1524	10.8203	0.46601	0.2307:0.7693:0.0:0.0	.	95;156	Q9Y616-2;Q9Y616	.;IRAK3_HUMAN	E	156;95	ENSP00000261233:Q156E;ENSP00000409852:Q95E	.	Q	+	1	0	IRAK3	64891522	0.996000	0.38824	0.993000	0.49108	0.637000	0.38172	1.410000	0.34691	2.868000	0.98415	0.557000	0.71058	CAA	IRAK3	-	superfamily_Kinase-like_dom		0.343	IRAK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRAK3	HGNC	protein_coding	OTTHUMT00000401908.1	C			66605255	+1	no_errors	ENST00000261233	ensembl	human	known	70_37	missense	SNP	0.995	G
EFCAB13	124989	genome.wustl.edu	37	17	45405719	45405719	+	5'UTR	SNP	G	G	C			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr17:45405719G>C	ENST00000331493.2	+	0	411				ITGB3_ENST00000560629.1_Missense_Mutation_p.R784T|EFCAB13_ENST00000520802.1_3'UTR|ITGB3_ENST00000435993.2_Missense_Mutation_p.D749H|EFCAB13_ENST00000517484.1_5'UTR	NM_152347.4	NP_689560.3	Q8IY85	EFC13_HUMAN	EF-hand calcium binding domain 13							cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)										TAAACAGAAAGATGGAAACTA	0.303																																																	0													96.0	100.0	99.0					17																	45405719		2203	4298	6501	SO:0001623	5_prime_UTR_variant	3690			BC036407	CCDS11512.1, CCDS56034.1	17q21.32	2013-01-11	2012-07-20	2012-07-20	ENSG00000178852	ENSG00000178852		"""EF-hand domain containing"""	26864	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 57"""	C17orf57			Standard	NM_152347		Approved	FLJ40342	uc002iln.3	Q8IY85	OTTHUMG00000164767	ENST00000331493.2:c.-1G>C	17.37:g.45405719G>C			G3V128|Q49AG9	Missense_Mutation	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_tail,pfam_EGF_extracell,pfam_Integrin_bsu_cyt,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Integrin_bsu_N,prints_Integrin_bsu	p.D749H	ENST00000331493.2	37	c.2245	CCDS11512.1	17	.	.	.	.	.	.	.	.	.	.	G	8.333	0.827028	0.16749	.	.	ENSG00000178852	ENST00000435993	D	0.90504	-2.68	3.84	-0.565	0.11771	.	.	.	.	.	D	0.90317	0.6971	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.86236	0.1640	6	0.62326	D	0.03	.	6.383	0.21546	0.5046:0.0:0.4954:0.0	.	.	.	.	H	749	ENSP00000407801:D749H	ENSP00000407801:D749H	D	+	1	0	C17orf57	42760718	0.994000	0.37717	0.990000	0.47175	0.959000	0.62525	-0.073000	0.11468	-0.061000	0.13110	-0.137000	0.14449	GAT	ITGB3	-	NULL		0.303	EFCAB13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ITGB3	HGNC	protein_coding	OTTHUMT00000380147.4	G	NM_152347		45405719	+1	no_errors	ENST00000435993	ensembl	human	known	70_37	missense	SNP	0.992	C
ITGB4	3691	genome.wustl.edu	37	17	73726984	73726984	+	Nonsense_Mutation	SNP	C	C	G			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr17:73726984C>G	ENST00000200181.3	+	9	1218	c.1031C>G	c.(1030-1032)tCa>tGa	p.S344*	ITGB4_ENST00000339591.3_Nonsense_Mutation_p.S344*|ITGB4_ENST00000579662.1_Nonsense_Mutation_p.S344*|ITGB4_ENST00000584558.1_3'UTR|ITGB4_ENST00000450894.3_Nonsense_Mutation_p.S344*|ITGB4_ENST00000449880.2_Nonsense_Mutation_p.S344*	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	344					amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			CCTGTCTCCTCACTGGGGGTG	0.567																																																	0													128.0	131.0	130.0					17																	73726984		2203	4300	6503	SO:0001587	stop_gained	3691				CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.1031C>G	17.37:g.73726984C>G	ENSP00000200181:p.Ser344*		A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Nonsense_Mutation	SNP	pfam_Integrin_bsu_N,pfam_Fibronectin_type3,pfam_Calx_beta,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Fibronectin_type3,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like,smart_Integrin_bsu_N,smart_Calx_beta,smart_Fibronectin_type3,pirsf_Integrin_bsu-4,pfscan_Fibronectin_type3,prints_Integrin_bsu	p.S344*	ENST00000200181.3	37	c.1031	CCDS11727.1	17	.	.	.	.	.	.	.	.	.	.	C	40	8.148482	0.98678	.	.	ENSG00000132470	ENST00000450894;ENST00000200181;ENST00000339591;ENST00000449880	.	.	.	5.42	5.42	0.78866	.	0.147328	0.43579	D	0.000545	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	12.3672	0.55234	0.2845:0.7155:0.0:0.0	.	.	.	.	X	260;344;344;344	.	ENSP00000200181:S344X	S	+	2	0	ITGB4	71238579	1.000000	0.71417	0.952000	0.39060	0.859000	0.49053	6.064000	0.71169	2.545000	0.85829	0.557000	0.71058	TCA	ITGB4	-	pfam_Integrin_bsu_N,smart_Integrin_bsu_N,pirsf_Integrin_bsu-4,prints_Integrin_bsu		0.567	ITGB4-001	KNOWN	basic|CCDS	protein_coding	ITGB4	HGNC	protein_coding	OTTHUMT00000448334.1	C			73726984	+1	no_errors	ENST00000200181	ensembl	human	known	70_37	nonsense	SNP	0.994	G
ITPKB	3707	genome.wustl.edu	37	1	226822561	226822561	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr1:226822561G>C	ENST00000272117.3	-	7	2651	c.2652C>G	c.(2650-2652)atC>atG	p.I884M	ITPKB_ENST00000429204.1_Missense_Mutation_p.I884M			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	884					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				TCTTGTCGTGGATGAAGAGGA	0.642																																					Colon(84;110 1851 5306 33547)												0													77.0	62.0	67.0					1																	226822561		2203	4300	6503	SO:0001583	missense	3707			AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.2652C>G	1.37:g.226822561G>C	ENSP00000272117:p.Ile884Met		Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Missense_Mutation	SNP	pfam_IPK	p.I884M	ENST00000272117.3	37	c.2652	CCDS1555.1	1	.	.	.	.	.	.	.	.	.	.	G	16.31	3.088161	0.55968	.	.	ENSG00000143772	ENST00000272117;ENST00000429204	T;T	0.17054	2.3;2.3	5.06	4.15	0.48705	.	0.051027	0.85682	D	0.000000	T	0.31544	0.0800	L	0.52126	1.63	0.40857	D	0.983801	D	0.76494	0.999	D	0.79784	0.993	T	0.03453	-1.1035	10	0.51188	T	0.08	-23.1575	8.5311	0.33335	0.2261:0.0:0.7739:0.0	.	884	P27987	IP3KB_HUMAN	M	884	ENSP00000272117:I884M;ENSP00000411152:I884M	ENSP00000272117:I884M	I	-	3	3	ITPKB	224889184	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	1.464000	0.35288	1.138000	0.42230	0.561000	0.74099	ATC	ITPKB	-	pfam_IPK		0.642	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPKB	HGNC	protein_coding	OTTHUMT00000091632.1	G	NM_002221		226822561	-1	no_errors	ENST00000272117	ensembl	human	known	70_37	missense	SNP	1.000	C
KCNN2	3781	genome.wustl.edu	37	5	113698719	113698719	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr5:113698719G>A	ENST00000512097.3	+	2	1265	c.247G>A	c.(247-249)Gga>Aga	p.G83R	KCNN2_ENST00000264773.3_Missense_Mutation_p.G83R			Q9H2S1	KCNN2_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2	83	Poly-Gly.				potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transport (GO:1901379)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|protein homodimerization activity (GO:0042803)|small conductance calcium-activated potassium channel activity (GO:0016286)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)	Miconazole(DB01110)|Procaine(DB00721)	GGCGCTCTATGGAACcggcgg	0.657																																																	0													22.0	22.0	22.0					5																	113698719		2193	4291	6484	SO:0001583	missense	3781			AF239613	CCDS4114.1, CCDS43352.1	5q22.3	2012-07-05			ENSG00000080709	ENSG00000080709		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6291	protein-coding gene	gene with protein product		605879				16382103	Standard	NM_001278204		Approved	KCa2.2, hSK2	uc003kqo.3	Q9H2S1	OTTHUMG00000128836	ENST00000512097.3:c.247G>A	5.37:g.113698719G>A	ENSP00000427120:p.Gly83Arg		A6NF94|Q0VFZ4|Q6PJI0|Q6X2Y2	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_Ion_trans_2,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.G83R	ENST00000512097.3	37	c.247	CCDS4114.1	5	.	.	.	.	.	.	.	.	.	.	G	15.78	2.935844	0.52972	.	.	ENSG00000080709	ENST00000512097;ENST00000264773	D;D	0.89123	-2.47;-2.47	5.05	5.05	0.67936	.	407.602000	0.00166	N	0.000000	D	0.90631	0.7062	L	0.40543	1.245	0.80722	D	1	D	0.56287	0.975	P	0.51487	0.671	T	0.79907	-0.1605	10	0.54805	T	0.06	.	12.9437	0.58362	0.0797:0.0:0.9203:0.0	.	83	Q9H2S1	KCNN2_HUMAN	R	83	ENSP00000427120:G83R;ENSP00000264773:G83R	ENSP00000264773:G83R	G	+	1	0	KCNN2	113726618	1.000000	0.71417	0.938000	0.37757	0.955000	0.61496	5.004000	0.63966	2.624000	0.88883	0.655000	0.94253	GGA	KCNN2	-	NULL		0.657	KCNN2-001	KNOWN	not_organism_supported|upstream_ATG|basic|appris_principal|CCDS	protein_coding	KCNN2	HGNC	protein_coding	OTTHUMT00000250775.2	G	NM_021614		113698719	+1	no_errors	ENST00000264773	ensembl	human	known	70_37	missense	SNP	1.000	A
KDM5C	8242	genome.wustl.edu	37	X	53253976	53253976	+	Silent	SNP	C	C	G			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chrX:53253976C>G	ENST00000375401.3	-	1	628	c.96G>C	c.(94-96)gcG>gcC	p.A32A	KDM5C_ENST00000404049.3_Silent_p.A32A|KDM5C_ENST00000452825.3_Silent_p.A32A|KDM5C_ENST00000375383.3_Silent_p.A32A|KDM5C_ENST00000375379.3_Silent_p.A32A	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	32	JmjN. {ECO:0000255|PROSITE- ProRule:PRU00537}.				histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						GCCTGATTTTCGCGATGTAGC	0.647			"""N, F, S"""		clear cell renal carcinoma																																			Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	0													48.0	41.0	43.0					X																	53253976		2203	4300	6503	SO:0001819	synonymous_variant	8242			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.96G>C	X.37:g.53253976C>G			B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Silent	SNP	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_Znf_PHD-finger,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.A32	ENST00000375401.3	37	c.96	CCDS14351.1	X																																																																																			KDM5C	-	pfam_TF_JmjN,smart_TF_JmjN,pfscan_TF_JmjN		0.647	KDM5C-005	KNOWN	basic|CCDS	protein_coding	KDM5C	HGNC	protein_coding	OTTHUMT00000056737.2	C	NM_004187		53253976	-1	no_errors	ENST00000375401	ensembl	human	known	70_37	silent	SNP	0.997	G
KIAA1217	56243	genome.wustl.edu	37	10	24820871	24820871	+	Silent	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr10:24820871G>A	ENST00000376454.3	+	15	3225	c.3195G>A	c.(3193-3195)acG>acA	p.T1065T	KIAA1217_ENST00000376462.1_Silent_p.T985T|KIAA1217_ENST00000376451.2_Silent_p.T748T|KIAA1217_ENST00000396445.1_Silent_p.T748T|KIAA1217_ENST00000458595.1_Silent_p.T1030T|KIAA1217_ENST00000396446.1_Silent_p.T748T|KIAA1217_ENST00000376452.3_Silent_p.T1029T|KIAA1217_ENST00000307544.6_Silent_p.T748T	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	1065					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						TCACCACCACGAGGTCAGGCG	0.577																																																	0													66.0	53.0	57.0					10																	24820871		2203	4300	6503	SO:0001819	synonymous_variant	56243			BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.3195G>A	10.37:g.24820871G>A			A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Silent	SNP	pfam_AIP3_C	p.T1065	ENST00000376454.3	37	c.3195	CCDS31165.1	10																																																																																			KIAA1217	-	NULL		0.577	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1217	HGNC	protein_coding	OTTHUMT00000047223.2	G	NM_019590		24820871	+1	no_errors	ENST00000376454	ensembl	human	known	70_37	silent	SNP	0.434	A
KIAA1279	26128	genome.wustl.edu	37	10	70775881	70775881	+	Silent	SNP	A	A	G			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr10:70775881A>G	ENST00000361983.4	+	7	1677	c.1575A>G	c.(1573-1575)agA>agG	p.R525R		NM_015634.3	NP_056449.1	Q96EK5	KBP_HUMAN	KIAA1279	525					cell differentiation (GO:0030154)|mitochondrial transport (GO:0006839)|nervous system development (GO:0007399)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)	kinesin binding (GO:0019894)			breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	14						ACTCCCTGAGAGACCCAAATA	0.408																																																	0													82.0	80.0	81.0					10																	70775881		2203	4300	6503	SO:0001819	synonymous_variant	26128			BC012180	CCDS7284.1	10q22.1	2008-02-05			ENSG00000198954	ENSG00000198954			23419	protein-coding gene	gene with protein product		609367					Standard	NM_015634		Approved	DKFZP586B0923, TTC20	uc001joy.3	Q96EK5	OTTHUMG00000018363	ENST00000361983.4:c.1575A>G	10.37:g.70775881A>G			A8K5M8|Q9BR89|Q9ULE1|Q9Y428	Silent	SNP	pfam_KBP	p.R525	ENST00000361983.4	37	c.1575	CCDS7284.1	10																																																																																			KIAA1279	-	pfam_KBP		0.408	KIAA1279-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1279	HGNC	protein_coding	OTTHUMT00000048370.1	A	NM_015634		70775881	+1	no_errors	ENST00000361983	ensembl	human	known	70_37	silent	SNP	1.000	G
KRT85	3891	genome.wustl.edu	37	12	52760950	52760950	+	Silent	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr12:52760950G>A	ENST00000257901.3	-	1	315	c.240C>T	c.(238-240)ttC>ttT	p.F80F	KRT85_ENST00000544265.1_5'Flank	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	80	Head.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.F80F(1)		NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		AGCGGTAGCCGAAGCTGCGTC	0.697																																																	1	Substitution - coding silent(1)	endometrium(1)											30.0	39.0	36.0					12																	52760950		2199	4286	6485	SO:0001819	synonymous_variant	3891			X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.240C>T	12.37:g.52760950G>A			Q9NSB1	Silent	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.F80	ENST00000257901.3	37	c.240	CCDS8824.1	12																																																																																			KRT85	-	NULL		0.697	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT85	HGNC	protein_coding	OTTHUMT00000405184.1	G	NM_002283		52760950	-1	no_errors	ENST00000257901	ensembl	human	known	70_37	silent	SNP	0.855	A
KRTAP4-8	728224	genome.wustl.edu	37	17	39253891	39253891	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr17:39253891C>T	ENST00000333822.4	-	1	502	c.446G>A	c.(445-447)tGc>tAc	p.C149Y		NM_031960.2	NP_114166.1	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4-8	149	25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)	11						ACGCAGgcagcagcaggggcg	0.677																																																	0													17.0	20.0	19.0					17																	39253891		692	1587	2279	SO:0001583	missense	728224			AJ406940	CCDS45674.1	17q21.2	2013-06-25			ENSG00000204880	ENSG00000204880		"""Keratin associated proteins"""	17230	protein-coding gene	gene with protein product						11279113	Standard	NM_031960		Approved	KAP4.8	uc010wfo.2	Q9BYQ9	OTTHUMG00000133580	ENST00000333822.4:c.446G>A	17.37:g.39253891C>T	ENSP00000328444:p.Cys149Tyr		A8MSH3	Missense_Mutation	SNP	pfam_Keratin-assoc	p.C149Y	ENST00000333822.4	37	c.446	CCDS45674.1	17	.	.	.	.	.	.	.	.	.	.	.	13.51	2.257342	0.39896	.	.	ENSG00000204880	ENST00000333822;ENST00000332991	T	0.02197	4.4	3.3	3.3	0.37823	.	0.000000	0.52532	U	0.000062	T	0.09774	0.0240	M	0.89030	3	0.34780	D	0.734668	P	0.46395	0.877	P	0.51516	0.672	T	0.14783	-1.0460	10	0.87932	D	0	.	12.4883	0.55885	0.0:1.0:0.0:0.0	.	149	Q9BYQ9	KRA48_HUMAN	Y	149;119	ENSP00000328444:C149Y	ENSP00000414561:C119Y	C	-	2	0	KRTAP4-8	36507417	1.000000	0.71417	0.135000	0.22099	0.922000	0.55478	2.256000	0.43231	1.558000	0.49541	0.449000	0.29647	TGC	KRTAP4-8	-	NULL		0.677	KRTAP4-8-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	KRTAP4-8	HGNC	protein_coding	OTTHUMT00000257684.1	C	NM_031960		39253891	-1	no_errors	ENST00000333822	ensembl	human	known	70_37	missense	SNP	0.977	T
LEPR	3953	genome.wustl.edu	37	1	66036280	66036280	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr1:66036280G>C	ENST00000349533.6	+	4	350	c.165G>C	c.(163-165)aaG>aaC	p.K55N	snoU13_ENST00000459362.1_RNA|LEPR_ENST00000406510.3_5'UTR|LEPR_ENST00000371059.3_Missense_Mutation_p.K55N|LEPR_ENST00000344610.8_Missense_Mutation_p.K55N|LEPR_ENST00000371058.1_Missense_Mutation_p.K55N|LEPR_ENST00000371060.3_Missense_Mutation_p.K55N|LEPR_ENST00000462765.1_3'UTR	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		GACTCTCAAAGAATACTTCAA	0.363																																																	0													123.0	121.0	121.0					1																	66036280		2203	4300	6503	SO:0001583	missense	3953			U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.165G>C	1.37:g.66036280G>C	ENSP00000330393:p.Lys55Asn		Q6FHL5	Missense_Mutation	SNP	pfam_IgC2-like_lig-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.K55N	ENST00000349533.6	37	c.165	CCDS631.1	1	.	.	.	.	.	.	.	.	.	.	G	10.02	1.237408	0.22711	.	.	ENSG00000116678	ENST00000344610;ENST00000349533;ENST00000371060;ENST00000371059;ENST00000371058	T;T;T;T;T	0.57752	0.41;0.43;0.42;0.38;0.41	5.56	1.34	0.21922	.	0.843371	0.11339	N	0.574252	T	0.15609	0.0376	L	0.38838	1.175	0.19575	N	0.999969	B;B;B;B	0.15141	0.003;0.003;0.001;0.012	B;B;B;B	0.13407	0.004;0.004;0.009;0.009	T	0.27839	-1.0062	10	0.20519	T	0.43	-0.5508	4.2036	0.10478	0.0856:0.2764:0.493:0.145	.	55;55;55;55	P48357-4;P48357;P48357-2;P48357-3	.;LEPR_HUMAN;.;.	N	55	ENSP00000340884:K55N;ENSP00000330393:K55N;ENSP00000360099:K55N;ENSP00000360098:K55N;ENSP00000360097:K55N	ENSP00000340884:K55N	K	+	3	2	LEPR	65808868	0.160000	0.22878	0.770000	0.31555	0.892000	0.51952	0.838000	0.27572	-0.004000	0.14419	0.460000	0.39030	AAG	LEPR	-	NULL		0.363	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEPR	HGNC	protein_coding	OTTHUMT00000025275.1	G	NM_002303		66036280	+1	no_errors	ENST00000349533	ensembl	human	known	70_37	missense	SNP	0.076	C
LHFP	10186	genome.wustl.edu	37	13	40175136	40175136	+	Missense_Mutation	SNP	G	G	A	rs200931835		TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr13:40175136G>A	ENST00000379589.3	-	2	680	c.218C>T	c.(217-219)tCc>tTc	p.S73F	LHFP_ENST00000495922.1_5'Flank	NM_005780.2	NP_005771.1	Q9Y693	LHFP_HUMAN	lipoma HMGIC fusion partner	73						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)		HMGA2/LHFP(2)	breast(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(6)|prostate(2)	13		Lung NSC(96;3.55e-06)|Breast(139;0.00408)|Ovarian(182;0.0107)|Prostate(109;0.0118)|Lung SC(185;0.0719)|Hepatocellular(188;0.114)		OV - Ovarian serous cystadenocarcinoma(117;6.48e-46)|Epithelial(112;8.43e-42)|all cancers(112;1.42e-36)|GBM - Glioblastoma multiforme(144;0.00187)|BRCA - Breast invasive adenocarcinoma(63;0.00886)|KIRC - Kidney renal clear cell carcinoma(186;0.048)|Kidney(163;0.0601)|LUSC - Lung squamous cell carcinoma(192;0.105)		GCCCTGGAAGGAGGCATAGCG	0.597			T	HMGA2	lipoma								G|||	1	0.000199681	0.0	0.0	5008	,	,		19630	0.0		0.0	False		,,,				2504	0.001							Dom	yes		13	13q12	10186	lipoma HMGIC fusion partner		M	0													199.0	172.0	181.0					13																	40175136		2203	4300	6503	SO:0001583	missense	10186			AF098807	CCDS9369.1	13q12	2008-07-18			ENSG00000183722	ENSG00000183722			6586	protein-coding gene	gene with protein product		606710				10329012	Standard	NM_005780		Approved	MGC22429	uc001uxf.3	Q9Y693	OTTHUMG00000016767	ENST00000379589.3:c.218C>T	13.37:g.40175136G>A	ENSP00000368908:p.Ser73Phe		B2R7M2|Q53FC0|Q96SH5	Missense_Mutation	SNP	pfam_Lipome_HGMIC_fus_partner-like	p.S73F	ENST00000379589.3	37	c.218	CCDS9369.1	13	.	.	.	.	.	.	.	.	.	.	G	23.0	4.361392	0.82353	.	.	ENSG00000183722	ENST00000379589	T	0.73575	-0.76	5.38	5.38	0.77491	.	0.000000	0.64402	D	0.000001	D	0.87297	0.6142	M	0.83012	2.62	0.51482	D	0.999927	D	0.89917	1.0	D	0.79108	0.992	D	0.87902	0.2691	9	.	.	.	.	18.101	0.89505	0.0:0.0:1.0:0.0	.	73	Q9Y693	LHFP_HUMAN	F	73	ENSP00000368908:S73F	.	S	-	2	0	LHFP	39073136	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.414000	0.80117	2.522000	0.85027	0.655000	0.94253	TCC	LHFP	-	pfam_Lipome_HGMIC_fus_partner-like		0.597	LHFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHFP	HGNC	protein_coding	OTTHUMT00000044619.1	G	NM_005780		40175136	-1	no_errors	ENST00000379589	ensembl	human	known	70_37	missense	SNP	1.000	A
LIMA1	51474	genome.wustl.edu	37	12	50571413	50571413	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr12:50571413C>T	ENST00000341247.4	-	11	1863	c.1714G>A	c.(1714-1716)Gat>Aat	p.D572N	LIMA1_ENST00000394943.3_Missense_Mutation_p.D573N|LIMA1_ENST00000552909.1_Missense_Mutation_p.D411N|LIMA1_ENST00000552823.1_Missense_Mutation_p.D412N|LIMA1_ENST00000547825.1_Missense_Mutation_p.D270N|LIMA1_ENST00000552783.1_Missense_Mutation_p.D413N|LIMA1_ENST00000552491.1_Missense_Mutation_p.D269N	NM_001113546.1|NM_016357.4	NP_001107018.1|NP_057441.1	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1	572					actin filament bundle assembly (GO:0051017)|negative regulation of actin filament depolymerization (GO:0030835)|ruffle organization (GO:0031529)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(2)	44						AGATCTAGATCGACATCCTCA	0.483																																																	0													121.0	121.0	121.0					12																	50571413		2203	4300	6503	SO:0001583	missense	51474			AF198454	CCDS8802.1, CCDS44877.1, CCDS55826.1, CCDS58230.1	12q13.12	2006-04-12				ENSG00000050405			24636	protein-coding gene	gene with protein product	"""epithelial protein lost in neoplasm beta"""	608364				10806352, 10618726, 12566430	Standard	NM_016357		Approved	EPLIN	uc001rwk.4	Q9UHB6		ENST00000341247.4:c.1714G>A	12.37:g.50571413C>T	ENSP00000340184:p.Asp572Asn		B2RB09|Q2TAN7|Q59FE8|Q9BVF2|Q9H8J1|Q9HBN5|Q9NX96|Q9NXC3|Q9NXU6|Q9P0H8|Q9UHB5	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.D573N	ENST00000341247.4	37	c.1717	CCDS8802.1	12	.	.	.	.	.	.	.	.	.	.	C	21.1	4.096422	0.76870	.	.	ENSG00000050405	ENST00000552491;ENST00000547825;ENST00000552823;ENST00000394943;ENST00000341247;ENST00000552783;ENST00000552909;ENST00000420992	T;T;D;D;T;D;D	0.85861	-1.26;-1.26;-1.62;-2.04;-1.3;-1.63;-1.63	5.38	4.48	0.54585	.	0.205376	0.49916	N	0.000127	D	0.90304	0.6967	M	0.62723	1.935	0.45415	D	0.998393	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.75020	0.985;0.974;0.978	D	0.90238	0.4284	10	0.48119	T	0.1	.	14.1156	0.65151	0.0:0.9275:0.0:0.0725	.	582;572;411	Q59FE8;Q9UHB6;F8VQE1	.;LIMA1_HUMAN;.	N	269;270;412;573;572;413;411;491	ENSP00000448463:D269N;ENSP00000448706:D270N;ENSP00000450266:D412N;ENSP00000378400:D573N;ENSP00000340184:D572N;ENSP00000448779:D413N;ENSP00000450087:D411N	ENSP00000340184:D572N	D	-	1	0	LIMA1	48857680	1.000000	0.71417	0.990000	0.47175	0.948000	0.59901	3.827000	0.55745	1.396000	0.46663	0.655000	0.94253	GAT	LIMA1	-	NULL		0.483	LIMA1-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	LIMA1	HGNC	protein_coding	OTTHUMT00000406235.2	C	NM_016357		50571413	-1	no_errors	ENST00000394943	ensembl	human	known	70_37	missense	SNP	0.997	T
LIPK	643414	genome.wustl.edu	37	10	90490853	90490853	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr10:90490853G>A	ENST00000404190.1	+	3	337	c.337G>A	c.(337-339)Gtg>Atg	p.V113M		NM_001080518.1	NP_001073987.1	Q5VXJ0	LIPK_HUMAN	lipase, family member K	113					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	hydrolase activity, acting on ester bonds (GO:0016788)			endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)	12		Colorectal(252;0.0381)		Colorectal(12;7.03e-05)|COAD - Colon adenocarcinoma(12;8.33e-05)		TGGTTATGACGTGTGGTTGGG	0.463																																																	0													77.0	79.0	78.0					10																	90490853		2034	4242	6276	SO:0001583	missense	643414				CCDS44455.1	10q23.31	2008-02-04	2007-02-27	2007-02-27	ENSG00000204021	ENSG00000204021			23444	protein-coding gene	gene with protein product		613922	"""lipase-like, ab-hydrolase domain containing 2"""	LIPL2			Standard	NM_001080518		Approved	bA186O14.2	uc010qmv.2	Q5VXJ0	OTTHUMG00000018693	ENST00000404190.1:c.337G>A	10.37:g.90490853G>A	ENSP00000383900:p.Val113Met		A7KIH8	Missense_Mutation	SNP	pfam_AB_hydrolase_lipase,pfam_AB_hydrolase_1	p.V113M	ENST00000404190.1	37	c.337	CCDS44455.1	10	.	.	.	.	.	.	.	.	.	.	G	23.2	4.387486	0.82902	.	.	ENSG00000204021	ENST00000404190	T	0.81163	-1.46	5.45	5.45	0.79879	Alpha/beta hydrolase fold-1 (1);	0.000000	0.49305	D	0.000154	D	0.94561	0.8248	H	0.99286	4.5	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96477	0.9353	10	0.87932	D	0	-18.0756	18.2139	0.89879	0.0:0.0:1.0:0.0	.	113	Q5VXJ0	LIPK_HUMAN	M	113	ENSP00000383900:V113M	ENSP00000383900:V113M	V	+	1	0	LIPK	90480833	1.000000	0.71417	1.000000	0.80357	0.655000	0.38815	7.660000	0.83776	2.836000	0.97738	0.655000	0.94253	GTG	LIPK	-	pfam_AB_hydrolase_1		0.463	LIPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPK	HGNC	protein_coding	OTTHUMT00000049253.2	G	XM_061222		90490853	+1	no_errors	ENST00000404190	ensembl	human	known	70_37	missense	SNP	1.000	A
LMAN1	3998	genome.wustl.edu	37	18	57020489	57020489	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr18:57020489C>G	ENST00000251047.5	-	5	1301	c.584G>C	c.(583-585)cGc>cCc	p.R195P	LMAN1_ENST00000587940.1_5'Flank	NM_005570.3	NP_005561.1	P49257	LMAN1_HUMAN	lectin, mannose-binding, 1	195	L-type lectin-like. {ECO:0000255|PROSITE- ProRule:PRU00658}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum organization (GO:0007029)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|positive regulation of organelle organization (GO:0010638)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|sarcomere (GO:0030017)	mannose binding (GO:0005537)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16		Colorectal(73;0.0946)			Antihemophilic Factor(DB00025)	GGGTTTGTTGCGGAAGTCCCT	0.408																																																	0													170.0	157.0	162.0					18																	57020489		2203	4300	6503	SO:0001583	missense	3998			X71661	CCDS11974.1	18q21.3-q22	2014-09-17	2002-08-30		ENSG00000074695	ENSG00000074695			6631	protein-coding gene	gene with protein product	"""endoplasmic reticulum-golgi intermediate compartment protein 53"""	601567	"""coagulation factor V-factor VIII combined deficiency"""	F5F8D		9546392, 8854877	Standard	NM_005570		Approved	MR60, ERGIC-53, ERGIC53, gp58, MCFD1, FMFD1	uc002lhz.3	P49257	OTTHUMG00000132758	ENST00000251047.5:c.584G>C	18.37:g.57020489C>G	ENSP00000251047:p.Arg195Pro		Q12895|Q8N5I7|Q9UQG1|Q9UQG2|Q9UQG3|Q9UQG4|Q9UQG5|Q9UQG6|Q9UQG7|Q9UQG8|Q9UQG9|Q9UQH0|Q9UQH1|Q9UQH2	Missense_Mutation	SNP	pfam_Lectin_leg,superfamily_ConA-like_lec_gl_sf,superfamily_HMG_superfamily	p.R195P	ENST00000251047.5	37	c.584	CCDS11974.1	18	.	.	.	.	.	.	.	.	.	.	C	23.2	4.392250	0.83011	.	.	ENSG00000074695	ENST00000251047	T	0.69806	-0.43	6.01	5.12	0.69794	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.049999	0.85682	D	0.000000	D	0.86802	0.6020	H	0.94771	3.58	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90731	0.4642	10	0.87932	D	0	-11.848	16.0534	0.80777	0.1353:0.8647:0.0:0.0	.	195;195	B4DVV0;P49257	.;LMAN1_HUMAN	P	195	ENSP00000251047:R195P	ENSP00000251047:R195P	R	-	2	0	LMAN1	55171469	1.000000	0.71417	0.859000	0.33776	0.809000	0.45718	7.313000	0.78978	1.483000	0.48342	0.655000	0.94253	CGC	LMAN1	-	pfam_Lectin_leg,superfamily_ConA-like_lec_gl_sf		0.408	LMAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMAN1	HGNC	protein_coding	OTTHUMT00000256129.2	C	NM_005570		57020489	-1	no_errors	ENST00000251047	ensembl	human	known	70_37	missense	SNP	1.000	G
LINC01270	284751	genome.wustl.edu	37	20	48909282	48909282	+	lincRNA	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr20:48909282G>A	ENST00000371639.3	+	0	26					NR_034124.1																						CCACATGACGGAGCATGACAC	0.637																																																	0																																												284751																															20.37:g.48909282G>A				RNA	SNP	-	NULL	ENST00000371639.3	37	NULL		20																																																																																			RP11-290F20.1	-	-		0.637	RP11-290F20.1-001	KNOWN	basic	lincRNA	LOC284751	Clone_based_vega_gene	lincRNA	OTTHUMT00000079678.1	G			48909282	+1	no_errors	ENST00000371639	ensembl	human	known	70_37	rna	SNP	1.000	A
LOXL4	84171	genome.wustl.edu	37	10	100013465	100013465	+	Silent	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr10:100013465G>A	ENST00000260702.3	-	11	1830	c.1680C>T	c.(1678-1680)caC>caT	p.H560H	RP11-34A14.3_ENST00000433374.1_RNA	NM_032211.6	NP_115587.6	Q96JB6	LOXL4_HUMAN	lysyl oxidase-like 4	560	Lysyl-oxidase like.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|receptor complex (GO:0043235)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(8)|ovary(4)|prostate(1)|skin(2)	26		Colorectal(252;0.234)		Epithelial(162;2.14e-11)|all cancers(201;2.49e-09)		AGTTCTCCTCGTGGGCACAAT	0.622																																																	0													95.0	88.0	90.0					10																	100013465		2203	4300	6503	SO:0001819	synonymous_variant	84171			AF338441	CCDS7473.1	10q24	2008-08-01			ENSG00000138131	ENSG00000138131			17171	protein-coding gene	gene with protein product		607318				11292829	Standard	XM_005270216		Approved	FLJ21889, LOXC	uc001kpa.1	Q96JB6	OTTHUMG00000018874	ENST00000260702.3:c.1680C>T	10.37:g.100013465G>A			Q5W0B3|Q96DY1|Q96PC0|Q9H6T5	Silent	SNP	pfam_Lysyl_oxidase,pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt,prints_Lysyl_oxidase,prints_Srcr_rcpt	p.H560	ENST00000260702.3	37	c.1680	CCDS7473.1	10																																																																																			LOXL4	-	pfam_Lysyl_oxidase,prints_Lysyl_oxidase		0.622	LOXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOXL4	HGNC	protein_coding	OTTHUMT00000049766.1	G	NM_032211		100013465	-1	no_errors	ENST00000260702	ensembl	human	known	70_37	silent	SNP	0.474	A
LRRK1	79705	genome.wustl.edu	37	15	101565148	101565148	+	Silent	SNP	C	C	G			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr15:101565148C>G	ENST00000388948.3	+	16	2567	c.2208C>G	c.(2206-2208)ctC>ctG	p.L736L	LRRK1_ENST00000284395.5_Silent_p.L733L	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TGGCCAACCTCCAGTTCTGGC	0.627																																																	0													99.0	111.0	107.0					15																	101565148		2054	4180	6234	SO:0001819	synonymous_variant	79705			AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.2208C>G	15.37:g.101565148C>G				Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Leu-rich_rpt,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_WD40_repeat_dom,smart_Ankyrin_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_cat_dom	p.L736	ENST00000388948.3	37	c.2208	CCDS42086.1	15																																																																																			LRRK1	-	pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase		0.627	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRK1	HGNC	protein_coding	OTTHUMT00000384567.2	C	NM_024652		101565148	+1	no_errors	ENST00000388948	ensembl	human	known	70_37	silent	SNP	0.966	G
LRRTM4	80059	genome.wustl.edu	37	2	77745633	77745633	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr2:77745633C>T	ENST00000409093.1	-	3	1698	c.1362G>A	c.(1360-1362)atG>atA	p.M454I	LRRTM4_ENST00000409884.1_Missense_Mutation_p.M454I|LRRTM4_ENST00000409911.1_Missense_Mutation_p.M455I|LRRTM4_ENST00000409088.3_Missense_Mutation_p.M454I|LRRTM4_ENST00000409282.1_Missense_Mutation_p.M455I			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	454					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		GGAGTTGTTTCATGCTGGCTG	0.463																																																	0													63.0	63.0	63.0					2																	77745633		1950	4172	6122	SO:0001583	missense	80059			AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.1362G>A	2.37:g.77745633C>T	ENSP00000386357:p.Met454Ile		Q4FZ98|Q6UXJ7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.M455I	ENST00000409093.1	37	c.1365	CCDS46346.1	2	.	.	.	.	.	.	.	.	.	.	C	11.17	1.558579	0.27827	.	.	ENSG00000176204	ENST00000409911;ENST00000409884;ENST00000409093;ENST00000409088;ENST00000409282	T;T;T;T;T	0.74842	-0.88;-0.88;-0.88;-0.88;-0.88	5.68	5.68	0.88126	.	0.127376	0.64402	D	0.000001	T	0.68650	0.3024	L	0.40543	1.245	0.54753	D	0.999983	B;B;B	0.20459	0.011;0.045;0.026	B;B;B	0.19666	0.012;0.026;0.012	T	0.62144	-0.6916	10	0.30854	T	0.27	.	18.3564	0.90358	0.0:1.0:0.0:0.0	.	455;454;454	Q4KMX1;Q86VH4-2;Q86VH4	.;.;LRRT4_HUMAN	I	455;454;454;454;455	ENSP00000387228:M455I;ENSP00000387297:M454I;ENSP00000386357:M454I;ENSP00000386236:M454I;ENSP00000386286:M455I	ENSP00000386236:M454I	M	-	3	0	LRRTM4	77599141	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.029000	0.64121	2.670000	0.90874	0.655000	0.94253	ATG	LRRTM4	-	NULL		0.463	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LRRTM4	HGNC	protein_coding	OTTHUMT00000328225.1	C	NM_024993		77745633	-1	no_errors	ENST00000409911	ensembl	human	known	70_37	missense	SNP	1.000	T
MACF1	23499	genome.wustl.edu	37	1	39802262	39802262	+	Silent	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr1:39802262C>T	ENST00000372915.3	+	36	10104	c.10017C>T	c.(10015-10017)ttC>ttT	p.F3339F	MACF1_ENST00000539005.1_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000567887.1_Silent_p.F3371F|MACF1_ENST00000289893.4_Silent_p.F1774F|MACF1_ENST00000564288.1_Silent_p.F3334F|MACF1_ENST00000476350.1_Intron			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	3339					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AAACTCCCTTCATGACTGCAC	0.458																																																	0													62.0	59.0	60.0					1																	39802262		2201	4300	6501	SO:0001819	synonymous_variant	23499			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.10017C>T	1.37:g.39802262C>T			B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Silent	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_RNaseH-like_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.F3371	ENST00000372915.3	37	c.10113		1																																																																																			MACF1	-	superfamily_RNaseH-like_dom		0.458	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	C	NM_033044		39802262	+1	no_errors	ENST00000567887	ensembl	human	putative	70_37	silent	SNP	0.000	T
MAPKBP1	23005	genome.wustl.edu	37	15	42116052	42116052	+	Nonsense_Mutation	SNP	G	G	T	rs140684640		TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr15:42116052G>T	ENST00000456763.2	+	30	4220	c.4024G>T	c.(4024-4026)Gag>Tag	p.E1342*	MAPKBP1_ENST00000457542.2_Nonsense_Mutation_p.E1336*|RP11-23P13.4_ENST00000512295.1_RNA|RP11-23P13.4_ENST00000510176.1_RNA|MAPKBP1_ENST00000514566.1_Intron|MAPKBP1_ENST00000260357.7_Nonsense_Mutation_p.E1175*|MAPKBP1_ENST00000221214.6_Nonsense_Mutation_p.E1219*	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	1342										breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		CAGTACAACTGAGAGATGGGC	0.627																																																	0													67.0	76.0	73.0					15																	42116052		2203	4300	6503	SO:0001587	stop_gained	23005			AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.4024G>T	15.37:g.42116052G>T	ENSP00000393099:p.Glu1342*		A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E1342*	ENST00000456763.2	37	c.4024	CCDS45239.1	15	.	.	.	.	.	.	.	.	.	.	.	40	8.118062	0.98662	.	.	ENSG00000137802	ENST00000457542;ENST00000221214;ENST00000260357;ENST00000456763	.	.	.	5.69	4.77	0.60923	.	0.592478	0.17780	N	0.162296	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	-12.8264	11.1788	0.48616	0.0:0.1165:0.7055:0.1779	.	.	.	.	X	1336;1219;1175;1342	.	ENSP00000221214:E1219X	E	+	1	0	MAPKBP1	39903344	1.000000	0.71417	0.815000	0.32552	0.152000	0.21847	6.720000	0.74723	1.381000	0.46364	0.655000	0.94253	GAG	MAPKBP1	-	NULL		0.627	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	MAPKBP1	HGNC	protein_coding	OTTHUMT00000359745.1	G	NM_014994		42116052	+1	no_errors	ENST00000456763	ensembl	human	known	70_37	nonsense	SNP	0.984	T
MMP12	4321	genome.wustl.edu	37	11	102738746	102738746	+	RNA	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr11:102738746C>T	ENST00000532855.1	-	0	775							P39900	MMP12_HUMAN	matrix metallopeptidase 12 (macrophage elastase)						collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|proteolysis (GO:0006508)|wound healing, spreading of epidermal cells (GO:0035313)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	26		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.014)	Acetohydroxamic Acid(DB00551)|Marimastat(DB00786)	ACTAGAATGGCCAAGACCTAA	0.453																																																	0													76.0	73.0	74.0					11																	102738746		1920	4129	6049			4321			L23808	CCDS73375.1	11q22.3	2009-02-26	2005-08-08			ENSG00000262406			7158	protein-coding gene	gene with protein product		601046	"""matrix metalloproteinase 12 (macrophage elastase)"""				Standard	NM_002426		Approved	HME	uc001phk.3	P39900			11.37:g.102738746C>T			B2R9X8|B7ZLF6|Q2M1L9	RNA	SNP	-	NULL	ENST00000532855.1	37	NULL		11																																																																																			MMP12	-	-		0.453	MMP12-001	KNOWN	basic	processed_transcript	MMP12	HGNC	processed_transcript	OTTHUMT00000386646.1	C	NM_002426		102738746	-1	no_errors	ENST00000326227	ensembl	human	known	70_37	rna	SNP	0.000	T
MPP1	4354	genome.wustl.edu	37	X	154033047	154033047	+	Intron	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chrX:154033047C>T	ENST00000369534.3	-	1	250				MPP1_ENST00000413259.3_Intron|MPP1_ENST00000393531.1_Intron	NM_001166460.1|NM_001166461.1|NM_002436.3	NP_001159932.1|NP_001159933.1|NP_002427.1	Q00013	EM55_HUMAN	membrane protein, palmitoylated 1, 55kDa						nucleotide phosphorylation (GO:0046939)|regulation of neutrophil chemotaxis (GO:0090022)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(9)|ovary(2)|prostate(1)	21	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					ATTCCTTGTTCCACCCGCAAA	0.483																																																	0																																										SO:0001627	intron_variant	4354				CCDS14762.1, CCDS55544.1, CCDS55545.1	Xq28	2008-03-04	2002-08-29		ENSG00000130830	ENSG00000130830			7219	protein-coding gene	gene with protein product		305360	"""membrane protein, palmitoylated 1 (55kD)"""	DXS552E		1713685	Standard	NM_002436		Approved	PEMP	uc004fmp.2	Q00013	OTTHUMG00000024244	ENST00000369534.3:c.102+499G>A	X.37:g.154033047C>T			B4DZV5|G3XAI1|Q2TSB6|Q5J7V5	Missense_Mutation	SNP	NULL	p.G53E	ENST00000369534.3	37	c.158	CCDS14762.1	X																																																																																			MPP1	-	NULL		0.483	MPP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MPP1	HGNC	protein_coding	OTTHUMT00000061191.3	C	NM_002436		154033047	-1	no_errors	ENST00000439370	ensembl	human	known	70_37	missense	SNP	0.000	T
MRPS22	56945	genome.wustl.edu	37	3	139063000	139063000	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr3:139063000C>G	ENST00000495075.1	+	3	564	c.132C>G	c.(130-132)ttC>ttG	p.F44L	MRPS22_ENST00000478464.1_5'Flank|MRPS22_ENST00000465056.1_Missense_Mutation_p.F44L|MRPS22_ENST00000310776.4_Missense_Mutation_p.F44L			P82650	RT22_HUMAN	mitochondrial ribosomal protein S22	44						mitochondrial ribosome (GO:0005761)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	12						CTTGCTCTTTCGAGATGGGGC	0.627																																																	0													19.0	21.0	20.0					3																	139063000		2203	4300	6503	SO:0001583	missense	56945			AF226045	CCDS3107.1	3q23	2012-09-13			ENSG00000175110	ENSG00000175110		"""Mitochondrial ribosomal proteins / small subunits"""	14508	protein-coding gene	gene with protein product		605810				11175783	Standard	NM_020191		Approved	MRP-S22, GK002, C3orf5, GIBT	uc003etb.3	P82650	OTTHUMG00000159910	ENST00000495075.1:c.132C>G	3.37:g.139063000C>G	ENSP00000418008:p.Phe44Leu		Q9H3I1	Missense_Mutation	SNP	pfam_Ribosomal_S22_mit	p.F44L	ENST00000495075.1	37	c.132	CCDS3107.1	3	.	.	.	.	.	.	.	.	.	.	C	2.849	-0.238836	0.05944	.	.	ENSG00000175110	ENST00000495075;ENST00000310776;ENST00000465056;ENST00000465373	D;D;D;T	0.81821	-1.54;-1.54;-1.54;-0.98	4.01	2.2	0.27929	.	0.690284	0.13403	N	0.390478	T	0.59742	0.2216	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.44817	-0.9303	10	0.02654	T	1	-0.0076	6.0203	0.19625	0.0:0.7611:0.0:0.2389	.	44;44	G5E9V5;P82650	.;RT22_HUMAN	L	44;44;44;40	ENSP00000418008:F44L;ENSP00000310785:F44L;ENSP00000418233:F44L;ENSP00000419920:F40L	ENSP00000310785:F44L	F	+	3	2	MRPS22	140545690	0.001000	0.12720	0.007000	0.13788	0.009000	0.06853	-0.236000	0.09003	0.471000	0.27319	0.591000	0.81541	TTC	MRPS22	-	NULL		0.627	MRPS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MRPS22	HGNC	protein_coding	OTTHUMT00000358120.1	C	NM_020191		139063000	+1	no_errors	ENST00000310776	ensembl	human	known	70_37	missense	SNP	0.009	G
MTRR	4552	genome.wustl.edu	37	5	7870902	7870902	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr5:7870902G>A	ENST00000264668.2	+	2	106	c.76G>A	c.(76-78)Gaa>Aaa	p.E26K	MTRR_ENST00000440940.2_5'UTR|FASTKD3_ENST00000513658.1_5'Flank|MTRR_ENST00000502509.1_Intron|MTRR_ENST00000341013.6_5'UTR|FASTKD3_ENST00000264669.5_5'Flank	NM_002454.2|NM_024010.2	NP_002445.2|NP_076915.2	Q9UBK8	MTRR_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase reductase	26					cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|DNA methylation (GO:0006306)|folic acid metabolic process (GO:0046655)|methionine biosynthetic process (GO:0009086)|methionine metabolic process (GO:0006555)|methylation (GO:0032259)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	[methionine synthase] reductase activity (GO:0030586)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor (GO:0016723)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(14)|ovary(1)|prostate(3)|stomach(1)	31					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	TACATGCCTTGAAGTGATGAG	0.393																																																	0													122.0	111.0	115.0					5																	7870902		2203	4300	6503	SO:0001583	missense	4552			AF025794	CCDS3874.1, CCDS47190.1	5p15.31	2011-05-12			ENSG00000124275	ENSG00000124275	1.16.1.8		7473	protein-coding gene	gene with protein product		602568				9501215	Standard	NM_024010		Approved	cblE	uc003jed.3	Q9UBK8	OTTHUMG00000090477	ENST00000264668.2:c.76G>A	5.37:g.7870902G>A	ENSP00000264668:p.Glu26Lys		O60471|Q32MA9|Q7Z4M8	Missense_Mutation	SNP	pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,superfamily_Riboflavin_synthase-like_b-brl,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.E26K	ENST00000264668.2	37	c.76	CCDS3874.1	5	.	.	.	.	.	.	.	.	.	.	G	14.95	2.689421	0.48097	.	.	ENSG00000124275	ENST00000264668	T	0.02236	4.38	5.8	4.04	0.47022	.	1.153770	0.06513	N	0.738310	T	0.01730	0.0055	N	0.08118	0	0.23089	N	0.998313	B	0.13145	0.007	B	0.10450	0.005	T	0.49312	-0.8953	10	0.18276	T	0.48	-8.0951	9.0541	0.36394	0.132:0.123:0.745:0.0	.	26	Q9UBK8	MTRR_HUMAN	K	26	ENSP00000264668:E26K	ENSP00000264668:E26K	E	+	1	0	MTRR	7923902	0.058000	0.20735	0.001000	0.08648	0.019000	0.09904	2.086000	0.41643	0.811000	0.34303	-0.121000	0.15023	GAA	MTRR	-	NULL		0.393	MTRR-001	KNOWN	basic|CCDS	protein_coding	MTRR	HGNC	protein_coding	OTTHUMT00000206931.1	G			7870902	+1	no_errors	ENST00000264668	ensembl	human	known	70_37	missense	SNP	0.003	A
MUC4	4585	genome.wustl.edu	37	3	195510230	195510230	+	Frame_Shift_Del	DEL	C	C	-			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr3:195510230delC	ENST00000463781.3	-	2	8680	c.8221delG	c.(8221-8223)gagfs	p.E2741fs	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Frame_Shift_Del_p.E2741fs	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGAAGTCTCGGTGACAAGA	0.562																																																	0									,,	118,1232		44,30,601	4.0	4.0	4.0		,,	-0.1	0.0	3		4	151,3465		23,105,1680	no	intron,frameshift,intron	MUC4	NM_138297.4,NM_018406.6,NM_004532.5	,,	67,135,2281	A1A1,A1R,RR		4.1759,8.7407,5.4168	,,	,,	195510230	269,4697	331	1081	1412	SO:0001589	frameshift_variant	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8221delG	3.37:g.195510230delC	ENSP00000417498:p.Glu2741fs		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Frame_Shift_Del	DEL	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.E2741fs	ENST00000463781.3	37	c.8221	CCDS54700.1	3																																																																																			MUC4	-	NULL		0.562	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	C	NM_018406		195510230	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	frame_shift_del	DEL	0.000	-
MYBPH	4608	genome.wustl.edu	37	1	203143635	203143635	+	Missense_Mutation	SNP	C	C	T	rs146696842		TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr1:203143635C>T	ENST00000255416.4	-	3	488	c.431G>A	c.(430-432)cGc>cAc	p.R144H		NM_004997.2	NP_004988.2	Q13203	MYBPH_HUMAN	myosin binding protein H	144	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|regulation of striated muscle contraction (GO:0006942)	myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)	p.R144H(1)		endometrium(5)|large_intestine(6)|lung(7)|skin(1)|urinary_tract(1)	20			BRCA - Breast invasive adenocarcinoma(75;0.153)	Colorectal(1306;0.0306)		TGCAGACACGCGCAGGAGGAA	0.632													C|||	1	0.000199681	0.0	0.0	5008	,	,		16196	0.0		0.0	False		,,,				2504	0.001				NSCLC(32;174 1025 14462 23899 42933)												1	Substitution - Missense(1)	large_intestine(1)						C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	49.0	50.0	50.0		431	5.7	1.0	1	dbSNP_134	50	0,8600		0,0,4300	no	missense	MYBPH	NM_004997.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	144/478	203143635	1,13005	2203	4300	6503	SO:0001583	missense	4608			BC044226	CCDS30975.1	1q32.1	2013-02-11	2001-11-28		ENSG00000133055	ENSG00000133055		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7552	protein-coding gene	gene with protein product		160795	"""myosin-binding protein H"""			8486381	Standard	NM_004997		Approved		uc001gzh.1	Q13203	OTTHUMG00000042121	ENST00000255416.4:c.431G>A	1.37:g.203143635C>T	ENSP00000255416:p.Arg144His		Q16886|Q86YC5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like	p.R144H	ENST00000255416.4	37	c.431	CCDS30975.1	1	.	.	.	.	.	.	.	.	.	.	C	19.81	3.895692	0.72639	2.27E-4	0.0	ENSG00000133055	ENST00000255416	T	0.60920	0.15	5.67	5.67	0.87782	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.51477	D	0.000087	T	0.82075	0.4958	M	0.92507	3.315	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86063	0.1533	10	0.87932	D	0	.	17.2606	0.87068	0.0:1.0:0.0:0.0	.	144	Q13203	MYBPH_HUMAN	H	144	ENSP00000255416:R144H	ENSP00000255416:R144H	R	-	2	0	MYBPH	201410258	1.000000	0.71417	0.952000	0.39060	0.030000	0.12068	6.598000	0.74122	2.681000	0.91329	0.655000	0.94253	CGC	MYBPH	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.632	MYBPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPH	HGNC	protein_coding	OTTHUMT00000100264.1	C	NM_004997		203143635	-1	no_errors	ENST00000255416	ensembl	human	known	70_37	missense	SNP	0.998	T
NIF3L1	60491	genome.wustl.edu	37	2	201756712	201756712	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr2:201756712G>A	ENST00000409020.1	+	2	340	c.46G>A	c.(46-48)Gta>Ata	p.V16I	PPIL3_ENST00000465823.1_5'Flank|PPIL3_ENST00000409449.1_5'Flank|NIF3L1_ENST00000416651.1_Missense_Mutation_p.V16I|PPIL3_ENST00000409361.1_5'Flank|PPIL3_ENST00000392283.4_5'Flank|NIF3L1_ENST00000409588.1_Missense_Mutation_p.V16I|NIF3L1_ENST00000409357.1_Missense_Mutation_p.V16I|NIF3L1_ENST00000359683.4_5'UTR|PPIL3_ENST00000286175.8_5'Flank			Q9GZT8	GTPC1_HUMAN	NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae)	16					7,8-dihydroneopterin 3'-triphosphate biosynthetic process (GO:0035998)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTP cyclohydrolase I activity (GO:0003934)|metal ion binding (GO:0046872)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|skin(1)|urinary_tract(2)	13						AGTCCGGTTTGTAGATTCCCT	0.443																																																	0													81.0	75.0	77.0					2																	201756712		1950	4143	6093	SO:0001583	missense	60491			AB038949	CCDS42797.1, CCDS46485.1, CCDS46486.1	2q33	2011-11-10	2011-11-10		ENSG00000196290	ENSG00000196290			13390	protein-coding gene	gene with protein product		605778	"""NIF3 (Ngg1 interacting factor 3, S.pombe homolog)-like 1"", ""NIF3 NGG1 interacting factor 3-like 1 (S. pombe)"""	ALS2CR1		11124544, 11161814, 12522100	Standard	NM_001136039		Approved	CALS-7, MDS015	uc002uwm.2	Q9GZT8	OTTHUMG00000154588	ENST00000409020.1:c.46G>A	2.37:g.201756712G>A	ENSP00000386394:p.Val16Ile		Q53TX4|Q6X735|Q9H2D2|Q9HC18	Missense_Mutation	SNP	pfam_Interacting_NIF3,superfamily_Interacting_NIF3,pirsf_UCP037490_NIF3_euk,tigrfam_Interacting_NIF3	p.V16I	ENST00000409020.1	37	c.46	CCDS46485.1	2	.	.	.	.	.	.	.	.	.	.	G	11.33	1.605695	0.28623	.	.	ENSG00000196290	ENST00000416651;ENST00000454952;ENST00000409020;ENST00000409357;ENST00000374679;ENST00000409588	T;T;T	0.43688	0.94;0.94;0.94	4.89	-1.14	0.09741	.	.	.	.	.	T	0.23210	0.0561	L	0.27053	0.805	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.19647	-1.0299	9	0.26408	T	0.33	-0.2249	3.3797	0.07249	0.245:0.1212:0.522:0.1117	.	16;16	Q6X735;Q9GZT8	.;NIF3L_HUMAN	I	16	ENSP00000400787:V16I;ENSP00000386394:V16I;ENSP00000387315:V16I	ENSP00000363811:V16I	V	+	1	0	NIF3L1	201464957	0.000000	0.05858	0.000000	0.03702	0.263000	0.26337	0.218000	0.17622	-0.071000	0.12886	-0.463000	0.05309	GTA	NIF3L1	-	pirsf_UCP037490_NIF3_euk		0.443	NIF3L1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	NIF3L1	HGNC	protein_coding	OTTHUMT00000336201.1	G	NM_021824		201756712	+1	no_errors	ENST00000409020	ensembl	human	known	70_37	missense	SNP	0.000	A
NOTCH1	4851	genome.wustl.edu	37	9	139412684	139412684	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr9:139412684C>T	ENST00000277541.6	-	7	1235	c.1160G>A	c.(1159-1161)tGc>tAc	p.C387Y	MIR4673_ENST00000584777.1_RNA	NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	387	EGF-like 10. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GTTGGTGTCGCAGTTGGAGCC	0.672			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																														Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	0													77.0	84.0	82.0					9																	139412684		2169	4276	6445	SO:0001583	missense	4851			AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.1160G>A	9.37:g.139412684C>T	ENSP00000277541:p.Cys387Tyr		Q59ED8|Q5SXM3	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_EGF_extracell,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_1,prints_Notch_dom	p.C387Y	ENST00000277541.6	37	c.1160	CCDS43905.1	9	.	.	.	.	.	.	.	.	.	.	C	25.6	4.651015	0.88056	.	.	ENSG00000148400	ENST00000277541	D	0.88509	-2.39	4.82	4.82	0.62117	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.97179	0.9078	H	0.99404	4.55	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.99297	1.0900	10	0.87932	D	0	.	16.4581	0.84029	0.0:1.0:0.0:0.0	.	387	P46531	NOTC1_HUMAN	Y	387	ENSP00000277541:C387Y	ENSP00000277541:C387Y	C	-	2	0	NOTCH1	138532505	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	7.304000	0.78882	2.223000	0.72356	0.514000	0.50259	TGC	NOTCH1	-	smart_EG-like_dom,pirsf_Notch,pfscan_EG-like_dom		0.672	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH1	HGNC	protein_coding	OTTHUMT00000055087.1	C	NM_017617		139412684	-1	no_errors	ENST00000277541	ensembl	human	known	70_37	missense	SNP	1.000	T
NRAP	4892	genome.wustl.edu	37	10	115374013	115374013	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr10:115374013G>A	ENST00000359988.3	-	29	3473	c.3229C>T	c.(3229-3231)Ctt>Ttt	p.L1077F	NRAP_ENST00000369360.3_Missense_Mutation_p.L1050F|NRAP_ENST00000369358.4_Missense_Mutation_p.L1085F|NRAP_ENST00000360478.3_Missense_Mutation_p.L1042F	NM_001261463.1|NM_198060.3	NP_001248392.1|NP_932326.2			nebulin-related anchoring protein											autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(18)|lung(39)|ovary(6)|prostate(3)|skin(1)|stomach(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		CGGGAACCAAGCATCTGTCCT	0.493																																																	0													237.0	204.0	215.0					10																	115374013		2203	4300	6503	SO:0001583	missense	4892				CCDS7578.1, CCDS7579.1, CCDS73199.1	10q24-q26	2008-08-01			ENSG00000197893	ENSG00000197893			7988	protein-coding gene	gene with protein product		602873				12789664, 10320340	Standard	NM_006175		Approved		uc001lal.4	Q86VF7	OTTHUMG00000019072	ENST00000359988.3:c.3229C>T	10.37:g.115374013G>A	ENSP00000353078:p.Leu1077Phe			Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_Znf_LIM,smart_Znf_LIM,smart_Nebulin_35r-motif,pfscan_Znf_LIM,pfscan_Nebulin_35r-motif,prints_Nebulin	p.L1085F	ENST00000359988.3	37	c.3253	CCDS7579.1	10	.	.	.	.	.	.	.	.	.	.	G	18.93	3.728574	0.69074	.	.	ENSG00000197893	ENST00000369358;ENST00000369360;ENST00000359988;ENST00000360478	T;T;T;T	0.18502	2.45;2.45;2.3;2.21	5.65	5.65	0.86999	.	0.055118	0.64402	D	0.000001	T	0.26448	0.0646	L	0.46157	1.445	0.34791	D	0.735764	D;D;P	0.56287	0.957;0.975;0.913	P;P;P	0.56700	0.641;0.804;0.564	T	0.22173	-1.0224	10	0.45353	T	0.12	.	9.5374	0.39231	0.0:0.1206:0.5816:0.2978	.	1077;1042;1077	A0AVL2;Q86VF7-4;Q86VF7	.;.;NRAP_HUMAN	F	1085;1050;1077;1042	ENSP00000358365:L1085F;ENSP00000358367:L1050F;ENSP00000353078:L1077F;ENSP00000353666:L1042F	ENSP00000353078:L1077F	L	-	1	0	NRAP	115364003	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.093000	0.30939	2.665000	0.90641	0.650000	0.86243	CTT	NRAP	-	NULL		0.493	NRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRAP	HGNC	protein_coding	OTTHUMT00000050425.2	G	NM_006175		115374013	-1	no_errors	ENST00000369358	ensembl	human	known	70_37	missense	SNP	1.000	A
NYAP1	222950	genome.wustl.edu	37	7	100086224	100086224	+	Missense_Mutation	SNP	G	G	A	rs368554898		TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr7:100086224G>A	ENST00000300179.2	+	4	1039	c.880G>A	c.(880-882)Gcc>Acc	p.A294T	NYAP1_ENST00000454988.1_Missense_Mutation_p.A237T|NYAP1_ENST00000423930.1_Missense_Mutation_p.A294T	NM_173564.2	NP_775835.2	Q6ZVC0	NYAP1_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1	294	Pro-rich.				neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												ACAGCCTCACGCCCTTCCGCC	0.667																																																	0													44.0	47.0	46.0					7																	100086224		2202	4294	6496	SO:0001583	missense	222950			AK094857	CCDS5696.1	7q22.1	2011-11-30	2011-11-30	2011-11-30	ENSG00000166924	ENSG00000166924			22009	protein-coding gene	gene with protein product		615477	"""chromosome 7 open reading frame 51"", ""KIAA1486-like"""	C7orf51, KIAA1486L		21946561	Standard	NM_173564		Approved	FLJ37538	uc003uvd.2	Q6ZVC0	OTTHUMG00000155290	ENST00000300179.2:c.880G>A	7.37:g.100086224G>A	ENSP00000300179:p.Ala294Thr		Q6U9Y3|Q8N1V0	Missense_Mutation	SNP	NULL	p.A294T	ENST00000300179.2	37	c.880	CCDS5696.1	7	.	.	.	.	.	.	.	.	.	.	G	0.194	-1.050337	0.01981	.	.	ENSG00000166924	ENST00000300179;ENST00000423930;ENST00000454988	T;T;T	0.30981	1.51;1.51;1.51	4.73	1.47	0.22746	.	1.069840	0.07323	N	0.877888	T	0.13543	0.0328	N	0.08118	0	0.09310	N	1	B;B	0.25563	0.004;0.129	B;B	0.18561	0.002;0.022	T	0.28996	-1.0026	10	0.15952	T	0.53	-1.1305	5.5541	0.17107	0.197:0.0:0.633:0.1699	.	237;294	C9JS30;Q6ZVC0	.;CG051_HUMAN	T	294;294;237	ENSP00000300179:A294T;ENSP00000411861:A294T;ENSP00000394424:A237T	ENSP00000300179:A294T	A	+	1	0	C7orf51	99924160	0.001000	0.12720	0.022000	0.16811	0.051000	0.14879	0.410000	0.21098	0.950000	0.37743	0.407000	0.27541	GCC	NYAP1	-	NULL		0.667	NYAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NYAP1	HGNC	protein_coding	OTTHUMT00000339335.2	G	NM_173564		100086224	+1	no_errors	ENST00000423930	ensembl	human	known	70_37	missense	SNP	0.018	A
OBFC1	79991	genome.wustl.edu	37	10	105659861	105659861	+	Missense_Mutation	SNP	C	C	T	rs183917764		TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr10:105659861C>T	ENST00000224950.3	-	5	583	c.416G>A	c.(415-417)cGc>cAc	p.R139H	OBFC1_ENST00000466828.1_5'UTR|OBFC1_ENST00000369764.1_Missense_Mutation_p.R139H	NM_024928.4	NP_079204.2	Q9H668	STN1_HUMAN	oligonucleotide/oligosaccharide-binding fold containing 1	139					positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromosome, telomeric region (GO:0000784)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)|single-stranded telomeric DNA binding (GO:0043047)			large_intestine(3)|lung(7)|ovary(1)|pancreas(2)	13		Colorectal(252;0.178)		Epithelial(162;3.39e-10)|all cancers(201;1.32e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0151)		TCTGTATGTGCGGATACTGCC	0.453																																																	0								C	HIS/ARG	0,4406		0,0,2203	256.0	203.0	221.0		416	0.7	0.0	10		221	1,8599	1.2+/-3.3	0,1,4299	no	missense	OBFC1	NM_024928.4	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	139/369	105659861	1,13005	2203	4300	6503	SO:0001583	missense	79991			BC017400	CCDS7552.1	10q25.1	2011-06-14				ENSG00000107960			26200	protein-coding gene	gene with protein product		613128				12477932	Standard	NM_024928		Approved	FLJ22559, bA541N10.2	uc001kxm.3	Q9H668		ENST00000224950.3:c.416G>A	10.37:g.105659861C>T	ENSP00000224950:p.Arg139His		D3DR99|Q5TCZ0	Missense_Mutation	SNP	pfam_DUF1879_CST_STN1,pfam_NA-bd_OB_tRNA-helicase,superfamily_NA-bd_OB-fold-like,pirsf_CST_STN1	p.R139H	ENST00000224950.3	37	c.416	CCDS7552.1	10	.	.	.	.	.	.	.	.	.	.	C	9.318	1.057231	0.19907	0.0	1.16E-4	ENSG00000107960	ENST00000224950;ENST00000369764	T;T	0.23552	1.9;1.9	5.82	0.706	0.18133	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);Nucleic acid binding, OB-fold, tRNA/helicase-type (1);	0.167601	0.56097	N	0.000038	T	0.17789	0.0427	L	0.46157	1.445	0.27785	N	0.943031	P	0.39624	0.681	B	0.33690	0.168	T	0.08743	-1.0707	10	0.45353	T	0.12	-4.4363	8.4049	0.32608	0.0:0.6176:0.0:0.3824	.	139	Q9H668	STN1_HUMAN	H	139	ENSP00000224950:R139H;ENSP00000358779:R139H	ENSP00000224950:R139H	R	-	2	0	OBFC1	105649851	0.307000	0.24500	0.017000	0.16124	0.273000	0.26683	0.488000	0.22371	-0.120000	0.11809	0.561000	0.74099	CGC	OBFC1	-	pfam_NA-bd_OB_tRNA-helicase,superfamily_NA-bd_OB-fold-like,pirsf_CST_STN1		0.453	OBFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OBFC1	HGNC	protein_coding	OTTHUMT00000050174.1	C	NM_024928		105659861	-1	no_errors	ENST00000224950	ensembl	human	known	70_37	missense	SNP	0.101	T
OR2T8	343172	genome.wustl.edu	37	1	248084323	248084323	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr1:248084323G>C	ENST00000319968.4	+	1	4	c.4G>C	c.(4-6)Gaa>Caa	p.E2Q		NM_001005522.1	NP_001005522.1	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T, member 8	2						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(20)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TGAAATCATGGAAAATGGGAG	0.378																																																	0													92.0	89.0	90.0					1																	248084323		2203	4300	6503	SO:0001583	missense	343172				CCDS31100.1	1q44	2012-08-09		2004-03-10	ENSG00000177462	ENSG00000177462		"""GPCR / Class A : Olfactory receptors"""	15020	protein-coding gene	gene with protein product				OR2T8P			Standard	XM_005273117		Approved		uc010pzc.2	A6NH00	OTTHUMG00000040205	ENST00000319968.4:c.4G>C	1.37:g.248084323G>C	ENSP00000326225:p.Glu2Gln			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.E2Q	ENST00000319968.4	37	c.4	CCDS31100.1	1	.	.	.	.	.	.	.	.	.	.	G	7.962	0.747116	0.15710	.	.	ENSG00000177462	ENST00000319968	T	0.38401	1.14	3.65	1.76	0.24704	.	0.714071	0.11421	N	0.565806	T	0.24967	0.0606	L	0.41415	1.275	0.09310	N	1	B	0.23316	0.083	B	0.21917	0.037	T	0.34153	-0.9840	10	0.62326	D	0.03	.	1.1078	0.01698	0.2125:0.1734:0.4365:0.1775	.	2	A6NH00	OR2T8_HUMAN	Q	2	ENSP00000326225:E2Q	ENSP00000326225:E2Q	E	+	1	0	OR2T8	246150946	0.000000	0.05858	0.090000	0.20809	0.030000	0.12068	0.494000	0.22467	0.247000	0.21414	-0.216000	0.12614	GAA	OR2T8	-	NULL		0.378	OR2T8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T8	HGNC	protein_coding	OTTHUMT00000096862.1	G	NM_001005522		248084323	+1	no_errors	ENST00000319968	ensembl	human	known	70_37	missense	SNP	0.046	C
OR2T6	254879	genome.wustl.edu	37	1	248551096	248551096	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr1:248551096C>T	ENST00000355728.2	+	1	187	c.187C>T	c.(187-189)Ctc>Ttc	p.L63F		NM_001005471.1	NP_001005471.1	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T, member 6	63						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(5)|lung(38)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GTACTTCCTCCTCAGCCACCT	0.488																																																	0													224.0	173.0	191.0					1																	248551096		2203	4300	6503	SO:0001583	missense	254879			AF399481	CCDS31114.1	1q44	2012-08-09		2004-03-10	ENSG00000198104	ENSG00000198104		"""GPCR / Class A : Olfactory receptors"""	15018	protein-coding gene	gene with protein product				OR2T6P, OR2T9			Standard	NM_001005471		Approved	OST703	uc001iei.1	Q8NHC8	OTTHUMG00000040448	ENST00000355728.2:c.187C>T	1.37:g.248551096C>T	ENSP00000347965:p.Leu63Phe		A6NE36	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L63F	ENST00000355728.2	37	c.187	CCDS31114.1	1	.	.	.	.	.	.	.	.	.	.	C	18.31	3.596585	0.66332	.	.	ENSG00000198104	ENST00000355728	T	0.14391	2.51	4.38	4.38	0.52667	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40728	N	0.001021	T	0.57725	0.2073	H	0.99555	4.625	0.40778	D	0.983148	D	0.69078	0.997	D	0.69479	0.964	T	0.79848	-0.1630	10	0.87932	D	0	.	17.0694	0.86569	0.0:1.0:0.0:0.0	.	63	Q8NHC8	OR2T6_HUMAN	F	63	ENSP00000347965:L63F	ENSP00000347965:L63F	L	+	1	0	OR2T6	246617719	0.676000	0.27567	0.997000	0.53966	0.885000	0.51271	0.867000	0.27968	2.423000	0.82170	0.643000	0.83706	CTC	OR2T6	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.488	OR2T6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T6	HGNC	protein_coding	OTTHUMT00000097344.1	C	NM_001005471		248551096	+1	no_errors	ENST00000355728	ensembl	human	known	70_37	missense	SNP	1.000	T
OR4F6	390648	genome.wustl.edu	37	15	102346600	102346600	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr15:102346600G>C	ENST00000328882.4	+	1	699	c.678G>C	c.(676-678)caG>caC	p.Q226H		NM_001005326.1	NP_001005326.1	Q8NGB9	OR4F6_HUMAN	olfactory receptor, family 4, subfamily F, member 6	226						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(1)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			TGACTGTTCAGAAAAAATCTT	0.348																																																	0													135.0	136.0	136.0					15																	102346600		2202	4300	6502	SO:0001583	missense	390648			AC025234	CCDS32341.1	15q26.3	2014-02-19	2002-02-28		ENSG00000184140	ENSG00000184140		"""GPCR / Class A : Olfactory receptors"""	15372	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily F, member 12"""	OR4F12			Standard	NM_001005326		Approved		uc010utr.2	Q8NGB9	OTTHUMG00000172267	ENST00000328882.4:c.678G>C	15.37:g.102346600G>C	ENSP00000327525:p.Gln226His		B9EH28|Q6IF95	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Q226H	ENST00000328882.4	37	c.678	CCDS32341.1	15	.	.	.	.	.	.	.	.	.	.	.	1.010	-0.688042	0.03328	.	.	ENSG00000184140	ENST00000328882	T	0.00091	8.74	4.78	-0.452	0.12205	GPCR, rhodopsin-like superfamily (1);	0.553754	0.16499	N	0.211730	T	0.00073	0.0002	N	0.10972	0.075	0.09310	N	1	B	0.15719	0.014	B	0.23852	0.049	T	0.10268	-1.0637	10	0.44086	T	0.13	.	5.4946	0.16795	0.3419:0.1427:0.5154:0.0	.	226	Q8NGB9	OR4F6_HUMAN	H	226	ENSP00000327525:Q226H	ENSP00000327525:Q226H	Q	+	3	2	OR4F6	100164123	0.000000	0.05858	0.004000	0.12327	0.058000	0.15608	-0.071000	0.11505	0.042000	0.15717	0.591000	0.81541	CAG	OR4F6	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.348	OR4F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4F6	HGNC	protein_coding	OTTHUMT00000417593.1	G			102346600	+1	no_errors	ENST00000328882	ensembl	human	known	70_37	missense	SNP	0.001	C
OR52J3	119679	genome.wustl.edu	37	11	5068144	5068144	+	Missense_Mutation	SNP	C	C	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr11:5068144C>A	ENST00000380370.1	+	1	389	c.389C>A	c.(388-390)gCt>gAt	p.A130D		NM_001001916.2	NP_001001916.2	Q8NH60	O52J3_HUMAN	olfactory receptor, family 52, subfamily J, member 3	130						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|kidney(6)|large_intestine(6)|lung(19)|ovary(1)|skin(2)	36		Medulloblastoma(188;0.00131)|all_neural(188;0.0189)|Breast(177;0.0204)		Epithelial(150;9.29e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.19)		GCCGTCTGTGCTCCACTACAT	0.493																																																	0													180.0	118.0	139.0					11																	5068144		2201	4298	6499	SO:0001583	missense	119679			AB065530	CCDS31370.1	11p15.4	2012-08-09			ENSG00000205495	ENSG00000205495		"""GPCR / Class A : Olfactory receptors"""	14799	protein-coding gene	gene with protein product							Standard	NM_001001916		Approved		uc010qyv.2	Q8NH60	OTTHUMG00000066600	ENST00000380370.1:c.389C>A	11.37:g.5068144C>A	ENSP00000369728:p.Ala130Asp		Q6IFE4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A130D	ENST00000380370.1	37	c.389	CCDS31370.1	11	.	.	.	.	.	.	.	.	.	.	C	1.820	-0.472403	0.04445	.	.	ENSG00000205495	ENST00000380370	T	0.00596	6.32	3.89	-0.35	0.12606	GPCR, rhodopsin-like superfamily (1);	1.140740	0.06705	N	0.772092	T	0.00356	0.0011	N	0.02916	-0.46	0.09310	N	1	B	0.18166	0.026	B	0.30716	0.119	T	0.41770	-0.9490	10	0.28530	T	0.3	.	3.5721	0.07921	0.4253:0.3169:0.0:0.2578	.	130	Q8NH60	O52J3_HUMAN	D	130	ENSP00000369728:A130D	ENSP00000369728:A130D	A	+	2	0	OR52J3	5024720	0.000000	0.05858	0.537000	0.28052	0.021000	0.10359	-1.462000	0.02364	-0.167000	0.10871	-0.127000	0.14921	GCT	OR52J3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.493	OR52J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52J3	HGNC	protein_coding	OTTHUMT00000142807.1	C	NM_001001916		5068144	+1	no_errors	ENST00000380370	ensembl	human	known	70_37	missense	SNP	0.050	A
OR51J1	79470	genome.wustl.edu	37	11	5424757	5424757	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr11:5424757G>C	ENST00000332043.1	+	1	931	c.931G>C	c.(931-933)Gag>Cag	p.E311Q	HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron|AC104389.28_ENST00000415970.1_RNA			Q9H342	O51J1_HUMAN	olfactory receptor, family 51, subfamily J, member 1 (gene/pseudogene)	311					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										AATGCTATTAGAGAAAAGACG	0.423																																																	0																																										SO:0001583	missense	79470					11p15.4	2012-08-09	2008-06-12	2004-03-10	ENSG00000184321	ENSG00000184321		"""GPCR / Class A : Olfactory receptors"""	14856	protein-coding gene	gene with protein product			"""olfactory receptor, family 51, subfamily J, member 1"""	OR51J2, OR51J1P			Standard	NG_002252		Approved			Q9H342	OTTHUMG00000066666	ENST00000332043.1:c.931G>C	11.37:g.5424757G>C	ENSP00000332473:p.Glu311Gln			Missense_Mutation	SNP	pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.E311Q	ENST00000332043.1	37	c.931		11	.	.	.	.	.	.	.	.	.	.	G	2.464	-0.323518	0.05350	.	.	ENSG00000184321	ENST00000332043	T	0.36157	1.27	5.01	0.252	0.15545	.	.	.	.	.	T	0.19127	0.0459	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26189	-1.0110	6	0.20046	T	0.44	.	3.5633	0.07890	0.3924:0.1937:0.4139:0.0	.	.	.	.	Q	311	ENSP00000332473:E311Q	ENSP00000332473:E311Q	E	+	1	0	OR51J1	5381333	0.000000	0.05858	0.160000	0.22671	0.130000	0.20726	0.047000	0.14056	0.173000	0.19788	0.563000	0.77884	GAG	OR51J1	-	NULL		0.423	OR51J1-001	KNOWN	basic|appris_principal	protein_coding	OR51J1	HGNC	protein_coding	OTTHUMT00000142957.1	G	NG_002252		5424757	+1	no_errors	ENST00000332043	ensembl	human	known	70_37	missense	SNP	0.023	C
PANX3	116337	genome.wustl.edu	37	11	124481634	124481634	+	Splice_Site	SNP	G	G	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr11:124481634G>T	ENST00000284288.2	+	1	248		c.e1+1			NM_052959.2	NP_443191.1	Q96QZ0	PANX3_HUMAN	pannexin 3						cell-cell signaling (GO:0007267)|ion transport (GO:0006811)|protein hexamerization (GO:0034214)|transmembrane transport (GO:0055085)	gap junction (GO:0005921)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction hemi-channel activity (GO:0055077)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(10)|prostate(2)|skin(2)|urinary_tract(1)	26	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0219)		TTCTCCTCTGGTAAGTTGCTT	0.577																																																	0													72.0	75.0	74.0					11																	124481634		2201	4299	6500	SO:0001630	splice_region_variant	116337			AF406650	CCDS8447.1	11q24.2	2011-12-02			ENSG00000154143	ENSG00000154143		"""Ion channels / Pannexins"""	20573	protein-coding gene	gene with protein product		608422					Standard	NM_052959		Approved	Px3	uc001qah.3	Q96QZ0	OTTHUMG00000165925	ENST00000284288.2:c.181+1G>T	11.37:g.124481634G>T				Splice_Site	SNP	-	e1+1	ENST00000284288.2	37	c.181+1	CCDS8447.1	11	.	.	.	.	.	.	.	.	.	.	G	12.58	1.979638	0.34942	.	.	ENSG00000154143	ENST00000284288	.	.	.	4.78	4.78	0.61160	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0228	0.89260	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PANX3	123986844	1.000000	0.71417	0.998000	0.56505	0.172000	0.22775	9.461000	0.97646	2.476000	0.83614	0.655000	0.94253	.	PANX3	-	-		0.577	PANX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PANX3	HGNC	protein_coding	OTTHUMT00000387064.1	G		Intron	124481634	+1	no_errors	ENST00000284288	ensembl	human	known	70_37	splice_site	SNP	1.000	T
PATE4	399968	genome.wustl.edu	37	11	125708251	125708251	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr11:125708251G>C	ENST00000457514.2	+	3	270	c.226G>C	c.(226-228)Gag>Cag	p.E76Q	PATE4_ENST00000534411.1_Missense_Mutation_p.E37Q	NM_001144874.1	NP_001138346.1	P0C8F1	PATE4_HUMAN	prostate and testis expressed 4	76					regulation of synaptic transmission (GO:0050804)|response to wounding (GO:0009611)	acrosomal vesicle (GO:0001669)|extracellular space (GO:0005615)				breast(1)	1						GTGCCGGGAAGAGGAGTCCTC	0.428																																																	0													118.0	103.0	108.0					11																	125708251		692	1591	2283	SO:0001583	missense	399968			AK123042	CCDS44765.1	11q24.2	2010-07-14			ENSG00000237353	ENSG00000237353		"""PATE family"""	35427	protein-coding gene	gene with protein product						18390568	Standard	NM_001144874		Approved	FLJ41047, PATE-B	uc001qcv.3	P0C8F1	OTTHUMG00000165235	ENST00000457514.2:c.226G>C	11.37:g.125708251G>C	ENSP00000411439:p.Glu76Gln			Missense_Mutation	SNP	NULL	p.E76Q	ENST00000457514.2	37	c.226	CCDS44765.1	11	.	.	.	.	.	.	.	.	.	.	G	5.734	0.319882	0.10845	.	.	ENSG00000237353	ENST00000534411;ENST00000457514	T	0.23348	1.91	1.11	0.0267	0.14151	.	.	.	.	.	T	0.09774	0.0240	.	.	.	0.09310	N	1	P	0.44344	0.833	B	0.32022	0.139	T	0.20207	-1.0282	8	0.20519	T	0.43	.	3.129	0.06417	0.3626:0.0:0.6374:0.0	.	76	P0C8F1	PATE4_HUMAN	Q	37;76	ENSP00000411439:E76Q	ENSP00000411439:E76Q	E	+	1	0	PATE4	125213461	0.002000	0.14202	0.007000	0.13788	0.005000	0.04900	0.208000	0.17415	0.002000	0.14630	0.467000	0.42956	GAG	PATE4	-	NULL		0.428	PATE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PATE4	HGNC	protein_coding	OTTHUMT00000382865.1	G	NM_001144874		125708251	+1	no_errors	ENST00000457514	ensembl	human	known	70_37	missense	SNP	0.008	C
PCDHGA1	56114	genome.wustl.edu	37	5	140712541	140712541	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr5:140712541C>T	ENST00000517417.1	+	1	2290	c.2290C>T	c.(2290-2292)Cgg>Tgg	p.R764W	PCDHGA1_ENST00000378105.3_Missense_Mutation_p.R764W	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	764					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R764W(2)		breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCGGACTCGCGGAAGAGCCA	0.582																																																	2	Substitution - Missense(2)	urinary_tract(2)											103.0	113.0	110.0					5																	140712541		2203	4298	6501	SO:0001583	missense	56114			AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.2290C>T	5.37:g.140712541C>T	ENSP00000431083:p.Arg764Trp		Q2M273|Q9Y5D6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R764W	ENST00000517417.1	37	c.2290	CCDS54922.1	5	.	.	.	.	.	.	.	.	.	.	.	9.334	1.061310	0.19987	.	.	ENSG00000204956	ENST00000517417;ENST00000378105	T;T	0.52057	0.75;0.68	3.89	0.856	0.19019	.	0.149098	0.30036	N	0.010580	T	0.55242	0.1908	M	0.90595	3.13	0.09310	N	1	P;B	0.50617	0.937;0.118	P;B	0.46718	0.525;0.066	T	0.54262	-0.8320	10	0.87932	D	0	.	6.5454	0.22402	0.4632:0.4522:0.0:0.0845	.	764;764	Q9Y5H4-2;Q9Y5H4	.;PCDG1_HUMAN	W	764	ENSP00000431083:R764W;ENSP00000367345:R764W	ENSP00000367345:R764W	R	+	1	2	PCDHGA1	140692725	0.000000	0.05858	0.000000	0.03702	0.433000	0.31745	-1.404000	0.02494	0.040000	0.15660	-0.302000	0.09304	CGG	PCDHGA1	-	NULL		0.582	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHGA1	HGNC	protein_coding	OTTHUMT00000374737.1	C	NM_018912		140712541	+1	no_errors	ENST00000517417	ensembl	human	known	70_37	missense	SNP	0.001	T
PCDHGB3	56102	genome.wustl.edu	37	5	140750824	140750824	+	Missense_Mutation	SNP	T	T	C			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr5:140750824T>C	ENST00000576222.1	+	1	994	c.863T>C	c.(862-864)gTg>gCg	p.V288A	PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA6_ENST00000517434.1_5'Flank|PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	288	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCAAGGAAGTGAGACAACTG	0.473																																																	0													138.0	142.0	141.0					5																	140750824		2043	4205	6248	SO:0001583	missense	56102			AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.863T>C	5.37:g.140750824T>C	ENSP00000461862:p.Val288Ala		A7E229|Q9Y5C7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V288A	ENST00000576222.1	37	c.863	CCDS58980.1	5																																																																																			PCDHGB3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.473	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB3	HGNC	protein_coding	OTTHUMT00000437094.1	T	NM_018924		140750824	+1	no_errors	ENST00000576222	ensembl	human	known	70_37	missense	SNP	0.000	C
PCED1A	64773	genome.wustl.edu	37	20	2816721	2816721	+	Missense_Mutation	SNP	T	T	C			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr20:2816721T>C	ENST00000360652.2	-	7	1583	c.1081A>G	c.(1081-1083)Aat>Gat	p.N361D	PCED1A_ENST00000356872.3_Missense_Mutation_p.N310D	NM_022760.4	NP_073597.2	Q9H1Q7	PED1A_HUMAN	PC-esterase domain containing 1A	361																	TCCACTGGATTATAGTTGAAG	0.592																																																	0													21.0	22.0	22.0					20																	2816721		2182	4267	6449	SO:0001583	missense	64773			AK026029	CCDS13035.1, CCDS59442.1	20p13	2012-06-11	2012-06-11	2012-06-11	ENSG00000132635	ENSG00000132635			16212	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 81"", ""family with sequence similarity 113, member A"""	C20orf81, FAM113A		20056006	Standard	NM_022760		Approved	bA12M19.1, FLJ22376	uc002wgz.2	Q9H1Q7	OTTHUMG00000031716	ENST00000360652.2:c.1081A>G	20.37:g.2816721T>C	ENSP00000353868:p.Asn361Asp		Q5JUA5|Q5JUA6|Q6PK19|Q86WF5|Q96CG7|Q9H1Q6|Q9H6D1	Missense_Mutation	SNP	superfamily_Esterase_SGNH_hydro-type	p.N361D	ENST00000360652.2	37	c.1081	CCDS13035.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	7.947|7.947	0.744072|0.744072	0.15710|0.15710	.|.	.|.	ENSG00000132635|ENSG00000132635	ENST00000380531|ENST00000356872;ENST00000360652	.|T;T	.|0.44482	.|0.92;0.93	3.77|3.77	2.66|2.66	0.31614|0.31614	.|.	.|0.586961	.|0.17129	.|N	.|0.185905	T|T	0.27489|0.27489	0.0675|0.0675	L|L	0.36672|0.36672	1.1|1.1	0.09310|0.09310	N|N	1|1	.|B;B;B;B	.|0.30741	.|0.135;0.189;0.293;0.189	.|B;B;B;B	.|0.25291	.|0.059;0.024;0.039;0.024	T|T	0.12682|0.12682	-1.0538|-1.0538	6|10	0.72032|0.39692	D|T	0.01|0.17	-0.2378|-0.2378	5.7939|5.7939	0.18375|0.18375	0.0:0.1217:0.0:0.8783|0.0:0.1217:0.0:0.8783	.|.	.|310;357;208;361	.|Q9H1Q7-2;D3DVX4;B4DEI2;Q9H1Q7	.|.;.;.;F113A_HUMAN	M|D	143|310;361	.|ENSP00000349334:N310D;ENSP00000353868:N361D	ENSP00000369903:I143M|ENSP00000349334:N310D	I|N	-|-	3|1	3|0	FAM113A|FAM113A	2764721|2764721	0.116000|0.116000	0.22171|0.22171	0.017000|0.017000	0.16124|0.16124	0.317000|0.317000	0.28152|0.28152	1.075000|1.075000	0.30716|0.30716	0.803000|0.803000	0.34113|0.34113	0.454000|0.454000	0.30748|0.30748	ATA|AAT	PCED1A	-	NULL		0.592	PCED1A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PCED1A	HGNC	protein_coding	OTTHUMT00000077676.2	T	NM_022760		2816721	-1	no_errors	ENST00000360652	ensembl	human	known	70_37	missense	SNP	0.027	C
PCSK5	5125	genome.wustl.edu	37	9	78799601	78799601	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr9:78799601G>T	ENST00000545128.1	+	17	2748	c.2210G>T	c.(2209-2211)tGc>tTc	p.C737F	PCSK5_ENST00000376752.4_Missense_Mutation_p.C737F	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	737	CRM (Cys-rich motif).				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						AAAAATCTTTGCCGGAAATGC	0.348																																																	0													56.0	55.0	55.0					9																	78799601		2203	4300	6503	SO:0001583	missense	5125				CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.2210G>T	9.37:g.78799601G>T	ENSP00000446280:p.Cys737Phe		F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	pfam_Peptidase_S8/S53,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53,superfamily_Galactose-bd-like,superfamily_Growth_fac_rcpt,superfamily_Prot_inh_propept,smart_Furin_repeat,smart_EG-like_dom,prints_Peptidase_S8_subtilisin-rel	p.C737F	ENST00000545128.1	37	c.2210	CCDS55320.1	9	.	.	.	.	.	.	.	.	.	.	G	20.5	3.999098	0.74818	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000376752;ENST00000424854	T;T;T	0.66460	-0.21;-0.21;-0.21	5.58	5.58	0.84498	Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.87297	0.6142	H	0.97611	4.04	0.80722	D	1	P;P	0.52316	0.952;0.72	P;B	0.57679	0.825;0.315	D	0.91474	0.5199	10	0.87932	D	0	-19.9888	19.5751	0.95439	0.0:0.0:1.0:0.0	.	737;737	Q92824;Q92824-2	PCSK5_HUMAN;.	F	737;440;737;410	ENSP00000446280:C737F;ENSP00000365943:C737F;ENSP00000411654:C410F	ENSP00000365943:C737F	C	+	2	0	PCSK5	77989421	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.961000	0.76042	2.642000	0.89623	0.561000	0.74099	TGC	PCSK5	-	superfamily_Growth_fac_rcpt,smart_Furin_repeat		0.348	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK5	HGNC	protein_coding		G			78799601	+1	no_errors	ENST00000545128	ensembl	human	known	70_37	missense	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	SO:0001583	missense	5290				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	G			178936091	+1	no_errors	ENST00000263967	ensembl	human	known	70_37	missense	SNP	1.000	A
PLXNA4	91584	genome.wustl.edu	37	7	131848964	131848964	+	Silent	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr7:131848964G>A	ENST00000359827.3	-	24	5399	c.4437C>T	c.(4435-4437)ggC>ggT	p.G1479G	PLXNA4_ENST00000321063.4_Silent_p.G1479G			Q9HCM2	PLXA4_HUMAN	plexin A4	1479					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						AGCGGGCCTCGCCCGTGATGG	0.592																																																	0													75.0	78.0	77.0					7																	131848964		2203	4300	6503	SO:0001819	synonymous_variant	91584			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.4437C>T	7.37:g.131848964G>A			A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semaphorin/CD100_Ag,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.G1479	ENST00000359827.3	37	c.4437	CCDS43646.1	7																																																																																			PLXNA4	-	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot		0.592	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	HGNC	protein_coding	OTTHUMT00000338422.2	G	NM_181775		131848964	-1	no_errors	ENST00000321063	ensembl	human	known	70_37	silent	SNP	0.001	A
PNLIPRP3	119548	genome.wustl.edu	37	10	118225615	118225615	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr10:118225615G>T	ENST00000369230.3	+	8	1008	c.862G>T	c.(862-864)Gaa>Taa	p.E288*		NM_001011709.2	NP_001011709.2	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3	288					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	triglyceride lipase activity (GO:0004806)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(29)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50				all cancers(201;0.0131)		ATTTTATGCTGAAAGCATTCT	0.318																																																	0													149.0	142.0	145.0					10																	118225615		2201	4299	6500	SO:0001587	stop_gained	119548			BC015840	CCDS31292.1	10q26.12	2014-03-14			ENSG00000203837	ENSG00000203837	3.1.1.3		23492	protein-coding gene	gene with protein product							Standard	NM_001011709		Approved		uc001lcl.4	Q17RR3	OTTHUMG00000019100	ENST00000369230.3:c.862G>T	10.37:g.118225615G>T	ENSP00000358232:p.Glu288*			Nonsense_Mutation	SNP	pfam_Lipase_N,pfam_LipOase_LH2,superfamily_Lipase_LipOase,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase,prints_Lipase_panc	p.E288*	ENST00000369230.3	37	c.862	CCDS31292.1	10	.	.	.	.	.	.	.	.	.	.	G	14.02	2.410017	0.42715	.	.	ENSG00000203837	ENST00000369230	.	.	.	4.93	1.0	0.19881	.	0.248262	0.27253	N	0.020212	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	4.8629	0.13592	0.3667:0.0:0.4995:0.1338	.	.	.	.	X	288	.	ENSP00000358232:E288X	E	+	1	0	PNLIPRP3	118215605	0.702000	0.27816	0.114000	0.21550	0.088000	0.18126	1.098000	0.31000	0.031000	0.15407	-0.793000	0.03317	GAA	PNLIPRP3	-	pfam_Lipase_N,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase		0.318	PNLIPRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNLIPRP3	HGNC	protein_coding	OTTHUMT00000050520.1	G	XM_058404		118225615	+1	no_errors	ENST00000369230	ensembl	human	known	70_37	nonsense	SNP	0.066	T
PRDM11	56981	genome.wustl.edu	37	11	45204615	45204615	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr11:45204615G>A	ENST00000530656.1	+	4	529	c.529G>A	c.(529-531)Ggc>Agc	p.G177S	PRDM11_ENST00000263765.4_Missense_Mutation_p.G177S|PRDM11_ENST00000528980.1_3'UTR|PRDM11_ENST00000424263.2_Missense_Mutation_p.G143S			Q9NQV5	PRD11_HUMAN	PR domain containing 11	177	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						methyltransferase activity (GO:0008168)			endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	26						CCACATCTTCGGCCCCTATGA	0.582											OREG0020926	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									NSCLC(118;1511 1736 6472 36603 43224)												0													65.0	65.0	65.0					11																	45204615		2203	4299	6502	SO:0001583	missense	56981			AF275818	CCDS58130.1, CCDS73277.1	11p11	2008-07-21			ENSG00000019485	ENSG00000019485			13996	protein-coding gene	gene with protein product	"""PR-domain containing protein 11"""						Standard	NM_001256695		Approved	PFM8	uc031qab.1	Q9NQV5	OTTHUMG00000166478	ENST00000530656.1:c.529G>A	11.37:g.45204615G>A	ENSP00000435976:p.Gly177Ser	929	Q8N9F1	Missense_Mutation	SNP	pfscan_SET_dom	p.G177S	ENST00000530656.1	37	c.529		11	.	.	.	.	.	.	.	.	.	.	G	22.5	4.295626	0.81025	.	.	ENSG00000019485	ENST00000263765;ENST00000530656;ENST00000526442;ENST00000424263	T;T;T;T	0.60797	0.16;0.16;0.16;0.16	5.13	4.19	0.49359	SET domain (2);	0.093172	0.47093	D	0.000255	T	0.78910	0.4358	M	0.88512	2.96	0.46981	D	0.999279	D	0.89917	1.0	D	0.97110	1.0	T	0.83095	-0.0131	10	0.87932	D	0	-25.5187	13.7505	0.62904	0.0:0.154:0.846:0.0	.	177	Q9NQV5	PRD11_HUMAN	S	177;177;143;143	ENSP00000263765:G177S;ENSP00000435976:G177S;ENSP00000431898:G143S;ENSP00000394314:G143S	ENSP00000263765:G177S	G	+	1	0	PRDM11	45161191	1.000000	0.71417	0.997000	0.53966	0.847000	0.48162	8.701000	0.91331	1.115000	0.41800	0.484000	0.47621	GGC	PRDM11	-	pfscan_SET_dom		0.582	PRDM11-001	KNOWN	basic|appris_candidate_longest	protein_coding	PRDM11	HGNC	protein_coding	OTTHUMT00000389928.1	G	NM_020229		45204615	+1	no_errors	ENST00000263765	ensembl	human	known	70_37	missense	SNP	0.999	A
PRSS12	8492	genome.wustl.edu	37	4	119259365	119259365	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr4:119259365C>G	ENST00000296498.3	-	2	889	c.607G>C	c.(607-609)Gat>Cat	p.D203H		NM_003619.3	NP_003610.2	P56730	NETR_HUMAN	protease, serine, 12 (neurotrypsin, motopsin)	203	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				exocytosis (GO:0006887)|zymogen activation (GO:0031638)	axon (GO:0030424)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)|terminal bouton (GO:0043195)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(3)|kidney(1)|large_intestine(9)|lung(11)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	29						ACTGATGCATCAGAATCATCC	0.498																																																	0													112.0	100.0	104.0					4																	119259365		2203	4300	6503	SO:0001583	missense	8492			AJ001531	CCDS3709.1	4q25-q26	2010-05-07			ENSG00000164099	ENSG00000164099		"""Serine peptidases / Serine peptidases"""	9477	protein-coding gene	gene with protein product		606709				9540828, 9245503	Standard	NM_003619		Approved	BSSP-3, MRT1	uc003ica.2	P56730	OTTHUMG00000161166	ENST00000296498.3:c.607G>C	4.37:g.119259365C>G	ENSP00000296498:p.Asp203His		Q9UP16	Missense_Mutation	SNP	pfam_Srcr_rcpt,pfam_Peptidase_S1_S6,pfam_Kringle,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Srcr_rcpt-rel,superfamily_Kringle-like,smart_Kringle,smart_Srcr_rcpt-rel,smart_Peptidase_S1_S6,pfscan_Kringle,pfscan_Srcr_rcpt,pfscan_Peptidase_S1_S6,prints_Srcr_rcpt,prints_Peptidase_S1A	p.D203H	ENST00000296498.3	37	c.607	CCDS3709.1	4	.	.	.	.	.	.	.	.	.	.	C	32	5.108650	0.94292	.	.	ENSG00000164099	ENST00000296498	T	0.37915	1.17	5.4	5.4	0.78164	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.186629	0.56097	D	0.000029	T	0.64483	0.2602	M	0.84433	2.695	0.21386	N	0.999705	D	0.76494	0.999	D	0.69479	0.964	T	0.61922	-0.6963	10	0.66056	D	0.02	.	17.3434	0.87303	0.0:1.0:0.0:0.0	.	203	P56730	NETR_HUMAN	H	203	ENSP00000296498:D203H	ENSP00000296498:D203H	D	-	1	0	PRSS12	119478813	0.988000	0.35896	0.009000	0.14445	0.919000	0.55068	3.616000	0.54174	2.531000	0.85337	0.467000	0.42956	GAT	PRSS12	-	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt		0.498	PRSS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS12	HGNC	protein_coding	OTTHUMT00000256516.2	C			119259365	-1	no_errors	ENST00000296498	ensembl	human	known	70_37	missense	SNP	0.177	G
PTGFRN	5738	genome.wustl.edu	37	1	117532752	117532752	+	3'UTR	SNP	G	G	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr1:117532752G>T	ENST00000393203.2	+	0	5950					NM_020440.2	NP_065173.2	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor inhibitor						lipid particle organization (GO:0034389)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)	46	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)		CAAATTCTCAGTGATAAATAT	0.393																																																	0																																										SO:0001624	3_prime_UTR_variant	5738			AB014734	CCDS890.1	1p13.1	2013-01-29	2013-01-25		ENSG00000134247	ENSG00000134247		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9601	protein-coding gene	gene with protein product		601204	"""prostaglandin F2 receptor negative regulator"""			8655148	Standard	NM_020440		Approved	FPRP, EWI-F, CD9P-1, FLJ11001, KIAA1436, SMAP-6, CD315	uc001egv.1	Q9P2B2	OTTHUMG00000012028	ENST00000393203.2:c.*3163G>T	1.37:g.117532752G>T			Q5VVU9|Q8N2K6	RNA	SNP	-	NULL	ENST00000393203.2	37	NULL	CCDS890.1	1																																																																																			PTGFRN	-	-		0.393	PTGFRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGFRN	HGNC	protein_coding	OTTHUMT00000033271.1	G	NM_020440		117532752	+1	no_errors	ENST00000497385	ensembl	human	known	70_37	rna	SNP	1.000	T
PTPRB	5787	genome.wustl.edu	37	12	70946731	70946731	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr12:70946731G>T	ENST00000261266.5	-	19	4588	c.4559C>A	c.(4558-4560)tCc>tAc	p.S1520Y	PTPRB_ENST00000550857.1_Missense_Mutation_p.S1430Y|PTPRB_ENST00000334414.6_Missense_Mutation_p.S1738Y|PTPRB_ENST00000538708.1_Missense_Mutation_p.S1430Y|PTPRB_ENST00000451516.2_Missense_Mutation_p.S1430Y|PTPRB_ENST00000550358.1_Missense_Mutation_p.S1650Y	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1520	Fibronectin type-III 17. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CACCCGAATGGAGGCATTGTG	0.483																																																	0													147.0	144.0	145.0					12																	70946731		1961	4162	6123	SO:0001583	missense	5787			X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.4559C>A	12.37:g.70946731G>T	ENSP00000261266:p.Ser1520Tyr		B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Ricin_B_lectin,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.S1738Y	ENST00000261266.5	37	c.5213	CCDS44944.1	12	.	.	.	.	.	.	.	.	.	.	G	17.06	3.292968	0.60086	.	.	ENSG00000127329	ENST00000334414;ENST00000451516;ENST00000550358;ENST00000538708;ENST00000550857;ENST00000261266	T;T;T;T;T;T	0.03272	4.02;4.03;3.99;4.08;4.03;4.07	5.76	5.76	0.90799	Fibronectin, type III (3);	0.000000	0.85682	D	0.000000	T	0.12902	0.0313	L	0.34521	1.04	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;0.999	T	0.01520	-1.1334	10	0.59425	D	0.04	.	19.9635	0.97259	0.0:0.0:1.0:0.0	.	1430;1430;1738;1520;1650	P23467-2;F5H3G6;P23467-3;P23467;F8VU56	.;.;.;PTPRB_HUMAN;.	Y	1738;1430;1650;1430;1430;1520	ENSP00000334928:S1738Y;ENSP00000393028:S1430Y;ENSP00000448058:S1650Y;ENSP00000438927:S1430Y;ENSP00000447302:S1430Y;ENSP00000261266:S1520Y	ENSP00000261266:S1520Y	S	-	2	0	PTPRB	69232998	1.000000	0.71417	1.000000	0.80357	0.079000	0.17450	9.352000	0.97076	2.714000	0.92807	0.591000	0.81541	TCC	PTPRB	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3		0.483	PTPRB-007	KNOWN	basic|CCDS	protein_coding	PTPRB	HGNC	protein_coding	OTTHUMT00000404439.1	G			70946731	-1	no_errors	ENST00000334414	ensembl	human	known	70_37	missense	SNP	1.000	T
PTPRC	5788	genome.wustl.edu	37	1	198704312	198704314	+	In_Frame_Del	DEL	TGT	TGT	-	rs146726593	byFrequency	TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	TGT	TGT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr1:198704312_198704314delTGT	ENST00000367376.2	+	23	2499_2501	c.2328_2330delTGT	c.(2326-2331)gatgtt>gat	p.V779del	PTPRC_ENST00000352140.3_In_Frame_Del_p.V731del|PTPRC_ENST00000442510.2_In_Frame_Del_p.V781del|PTPRC_ENST00000348564.6_In_Frame_Del_p.V620del|PTPRC_ENST00000594404.1_In_Frame_Del_p.V618del	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	779	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						CTTTTGGAGATGTTGTTGTAAAG	0.31																																																	0																																										SO:0001651	inframe_deletion	5788			Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.2328_2330delTGT	1.37:g.198704318_198704320delTGT	ENSP00000356346:p.Val779del		A8K7W6|Q16614|Q9H0Y6	In_Frame_Del	DEL	pirsf_Leukocyte_common_ag,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Leukocyte_common_ag,pfam_PTP_recept_N,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.V781in_frame_del	ENST00000367376.2	37	c.2334_2336		1																																																																																			PTPRC	-	pirsf_Leukocyte_common_ag,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt		0.310	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	PTPRC	HGNC	protein_coding		TGT			198704314	+1	no_errors	ENST00000442510	ensembl	human	known	70_37	in_frame_del	DEL	0.992:0.992:0.990	-
RBMXL2	27288	genome.wustl.edu	37	11	7111523	7111523	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr11:7111523G>C	ENST00000306904.5	+	1	1359	c.1172G>C	c.(1171-1173)aGa>aCa	p.R391T		NM_014469.4	NP_055284.3	O75526	RMXL2_HUMAN	RNA binding motif protein, X-linked-like 2	391	Arg/Gly/Pro-rich.					nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15				Epithelial(150;5.14e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GGCCGGAGCAGATACTAAGCA	0.542																																																	0													10.0	11.0	11.0					11																	7111523		2191	4292	6483	SO:0001583	missense	27288			AF069682	CCDS7777.1	11p15	2013-07-16				ENSG00000170748		"""RNA binding motif (RRM) containing"""	17886	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G T"""	605444				10958650	Standard	NM_014469		Approved	HNRNPG-T, HNRPGT	uc001mfc.2	O75526		ENST00000306904.5:c.1172G>C	11.37:g.7111523G>C	ENSP00000304139:p.Arg391Thr		Q6PEZ2|Q9NQU0	Missense_Mutation	SNP	pfam_RRM_dom,pfam_RBM1CTR,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.R391T	ENST00000306904.5	37	c.1172	CCDS7777.1	11	.	.	.	.	.	.	.	.	.	.	G	16.57	3.159167	0.57368	.	.	ENSG00000170748	ENST00000306904	D	0.83673	-1.75	4.15	4.15	0.48705	.	0.000000	0.85682	U	0.000000	D	0.89396	0.6703	M	0.65498	2.005	0.45899	D	0.998743	D	0.71674	0.998	D	0.76071	0.987	D	0.90338	0.4357	10	0.87932	D	0	.	14.7432	0.69472	0.0:0.0:1.0:0.0	.	391	O75526	HNRGT_HUMAN	T	391	ENSP00000304139:R391T	ENSP00000304139:R391T	R	+	2	0	RBMXL2	7068099	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	9.013000	0.93629	2.594000	0.87642	0.655000	0.94253	AGA	RBMXL2	-	NULL		0.542	RBMXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL2	HGNC	protein_coding	OTTHUMT00000384552.1	G	NM_014469		7111523	+1	no_errors	ENST00000306904	ensembl	human	known	70_37	missense	SNP	1.000	C
REXO1	57455	genome.wustl.edu	37	19	1826912	1826912	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr19:1826912C>T	ENST00000170168.4	-	2	1970	c.1876G>A	c.(1876-1878)Gtc>Atc	p.V626I	CTB-31O20.4_ENST00000587741.1_RNA|CTB-31O20.4_ENST00000593201.1_RNA|REXO1_ENST00000587524.1_5'Flank	NM_020695.3	NP_065746.3	Q8N1G1	REXO1_HUMAN	REX1, RNA exonuclease 1 homolog (S. cerevisiae)	626						nucleus (GO:0005634)	exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	16		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCGTCTTGACGCTGGTGGAC	0.692																																																	0													16.0	12.0	13.0					19																	1826912		2195	4292	6487	SO:0001583	missense	57455			AB032964	CCDS32866.1	19p13.3	2014-05-28	2005-08-22	2005-08-22	ENSG00000079313	ENSG00000079313			24616	protein-coding gene	gene with protein product	"""elongin A binding protein 1"""	609614	"""transcription elongation factor B polypeptide 3 binding protein 1"""	TCEB3BP1		10574461	Standard	NM_020695		Approved	EloA-BP1, KIAA1138	uc002lua.4	Q8N1G1	OTTHUMG00000179991	ENST00000170168.4:c.1876G>A	19.37:g.1826912C>T	ENSP00000170168:p.Val626Ile		Q9ULT2	Missense_Mutation	SNP	pfam_Exonuclease_RNaseT/DNA_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease	p.V626I	ENST00000170168.4	37	c.1876	CCDS32866.1	19	.	.	.	.	.	.	.	.	.	.	C	29.7	5.029403	0.93518	.	.	ENSG00000079313	ENST00000170168	T	0.26810	1.71	4.25	4.25	0.50352	.	0.000000	0.64402	U	0.000001	T	0.50120	0.1597	M	0.73598	2.24	0.58432	D	0.99999	D	0.76494	0.999	D	0.72982	0.979	T	0.52946	-0.8507	10	0.44086	T	0.13	-30.4343	15.662	0.77193	0.0:1.0:0.0:0.0	.	626	Q8N1G1	REXO1_HUMAN	I	626	ENSP00000170168:V626I	ENSP00000170168:V626I	V	-	1	0	REXO1	1777912	1.000000	0.71417	0.944000	0.38274	0.844000	0.47949	7.078000	0.76821	1.926000	0.55796	0.455000	0.32223	GTC	REXO1	-	NULL		0.692	REXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REXO1	HGNC	protein_coding	OTTHUMT00000449200.1	C	NM_020695		1826912	-1	no_errors	ENST00000170168	ensembl	human	known	70_37	missense	SNP	0.998	T
RFX6	222546	genome.wustl.edu	37	6	117240424	117240424	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr6:117240424C>G	ENST00000332958.2	+	11	1163	c.1147C>G	c.(1147-1149)Ctg>Gtg	p.L383V		NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	383					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						TGTATCTTCTCTGAAACGACA	0.383																																																	0													110.0	107.0	108.0					6																	117240424		2203	4300	6503	SO:0001583	missense	222546			BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.1147C>G	6.37:g.117240424C>G	ENSP00000332208:p.Leu383Val		Q5T6B3	Missense_Mutation	SNP	pfam_DNA-bd_RFX	p.L383V	ENST00000332958.2	37	c.1147	CCDS5113.1	6	.	.	.	.	.	.	.	.	.	.	C	19.68	3.872545	0.72180	.	.	ENSG00000185002	ENST00000332958	T	0.79940	-1.32	6.08	3.34	0.38264	.	0.000000	0.64402	D	0.000001	D	0.82365	0.5021	M	0.81614	2.55	0.46078	D	0.998854	D	0.54397	0.966	P	0.55161	0.77	D	0.84524	0.0629	10	0.59425	D	0.04	-12.5759	11.5295	0.50599	0.0:0.8135:0.0:0.1865	.	383	Q8HWS3	RFX6_HUMAN	V	383	ENSP00000332208:L383V	ENSP00000332208:L383V	L	+	1	2	RFX6	117347117	0.406000	0.25344	1.000000	0.80357	0.994000	0.84299	0.570000	0.23653	1.589000	0.49982	0.591000	0.81541	CTG	RFX6	-	NULL		0.383	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX6	HGNC	protein_coding	OTTHUMT00000041970.2	C	NM_173560		117240424	+1	no_errors	ENST00000332958	ensembl	human	known	70_37	missense	SNP	0.988	G
RXFP2	122042	genome.wustl.edu	37	13	32367059	32367059	+	Silent	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr13:32367059C>T	ENST00000298386.2	+	16	1691	c.1620C>T	c.(1618-1620)gtC>gtT	p.V540V	RXFP2_ENST00000380314.1_Silent_p.V516V	NM_130806.3	NP_570718.1	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2	540					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oocyte maturation (GO:0001556)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein-hormone receptor activity (GO:0016500)			cervix(1)|endometrium(2)|large_intestine(15)|lung(13)|prostate(1)|stomach(1)	33		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)		AGACCTCAGTCATCCTCATTT	0.403																																																	0													89.0	84.0	86.0					13																	32367059		2203	4300	6503	SO:0001819	synonymous_variant	122042			AF403384	CCDS9342.1, CCDS53862.1	13q12.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000133105	ENSG00000133105		"""GPCR / Class A : Relaxin family peptide receptors"""	17318	protein-coding gene	gene with protein product		606655	"""leucine-rich repeat-containing G protein-coupled receptor 8"""	LGR8		12217959, 12970298, 15956688, 16507880	Standard	NM_130806		Approved	GREAT, GPR106, INSL3R, RXFPR2	uc001utt.3	Q8WXD0	OTTHUMG00000016690	ENST00000298386.2:c.1620C>T	13.37:g.32367059C>T			B1ALE9|Q3KU23	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_Leu-rich_rpt,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Leu-rich_rpt_typical-subtyp,pfscan_LDrepeatLR_classA_rpt,pfscan_GPCR_Rhodpsn_7TM,prints_Relaxin_rcpt,prints_GPCR_Rhodpsn,prints_Gphrmn_rcpt	p.V540	ENST00000298386.2	37	c.1620	CCDS9342.1	13																																																																																			RXFP2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.403	RXFP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RXFP2	HGNC	protein_coding	OTTHUMT00000044399.1	C	NM_130806		32367059	+1	no_errors	ENST00000298386	ensembl	human	known	70_37	silent	SNP	0.203	T
SEC24D	9871	genome.wustl.edu	37	4	119738426	119738426	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr4:119738426G>T	ENST00000280551.6	-	4	628	c.390C>A	c.(388-390)aaC>aaA	p.N130K	SEC24D_ENST00000419654.2_5'UTR|SEC24D_ENST00000379735.5_Missense_Mutation_p.N130K			O94855	SC24D_HUMAN	SEC24 family member D	130	Pro-rich.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37						TACCATAGCTGTTGATTTGCA	0.393																																																	0													122.0	120.0	121.0					4																	119738426		2203	4300	6503	SO:0001583	missense	9871			AB018298	CCDS3710.1	4q26	2013-10-21	2013-10-21		ENSG00000150961	ENSG00000150961			10706	protein-coding gene	gene with protein product		607186	"""SEC24 (S. cerevisiae) related gene family, member D"", ""SEC24 family, member D (S. cerevisiae)"""			9872452, 10075675	Standard	NM_014822		Approved	KIAA0755	uc003ici.4	O94855	OTTHUMG00000132957	ENST00000280551.6:c.390C>A	4.37:g.119738426G>T	ENSP00000280551:p.Asn130Lys		Q8IYI7	Missense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom	p.N130K	ENST00000280551.6	37	c.390	CCDS3710.1	4	.	.	.	.	.	.	.	.	.	.	G	9.273	1.046061	0.19748	.	.	ENSG00000150961	ENST00000280551;ENST00000379735;ENST00000503683	T;T;T	0.75367	-0.93;-0.93;0.73	5.2	3.43	0.39272	.	0.140084	0.56097	D	0.000033	T	0.54224	0.1845	L	0.27053	0.805	0.80722	D	1	P;B	0.38504	0.634;0.281	B;B	0.33620	0.167;0.056	T	0.49244	-0.8960	10	0.25106	T	0.35	-27.4279	6.8219	0.23862	0.2662:0.0:0.7338:0.0	.	130;130	O94855-2;O94855	.;SC24D_HUMAN	K	130	ENSP00000280551:N130K;ENSP00000369059:N130K;ENSP00000426309:N130K	ENSP00000280551:N130K	N	-	3	2	SEC24D	119957874	1.000000	0.71417	0.999000	0.59377	0.188000	0.23474	1.869000	0.39519	1.288000	0.44600	0.563000	0.77884	AAC	SEC24D	-	NULL		0.393	SEC24D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SEC24D	HGNC	protein_coding	OTTHUMT00000256514.4	G			119738426	-1	no_errors	ENST00000379735	ensembl	human	known	70_37	missense	SNP	1.000	T
SKOR1	390598	genome.wustl.edu	37	15	68120237	68120237	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr15:68120237G>A	ENST00000380035.2	+	2	2129	c.2071G>A	c.(2071-2073)Ggt>Agt	p.G691S	SKOR1_ENST00000554054.1_Missense_Mutation_p.G663S|SKOR1_ENST00000389002.1_Missense_Mutation_p.G647S|SKOR1_ENST00000341418.5_Splice_Site_p.A631T|SKOR1_ENST00000554240.1_Missense_Mutation_p.G652S			P84550	SKOR1_HUMAN	SKI family transcriptional corepressor 1	691					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)			endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(7)|urinary_tract(1)	23						CGGCCCAGACGGTGAACAGCC	0.746																																																	0													14.0	16.0	16.0					15																	68120237		2175	4275	6450	SO:0001583	missense	390598				CCDS58374.1	15q23	2011-08-04	2010-06-23	2010-06-23	ENSG00000188779	ENSG00000188779		"""SKI transcriptional corepressors"""	21326	protein-coding gene	gene with protein product	"""transcriptional corepressor CORL1"", ""functional smad suppressing element 15"", ""corepressor for LBX1"""	611273	"""Lbxcor1 homolog (mouse)"""	LBXCOR1		15528197	Standard	NM_001258024		Approved	CORL1, FUSSEL15	uc031qsn.1	P84550		ENST00000380035.2:c.2071G>A	15.37:g.68120237G>A	ENSP00000369374:p.Gly691Ser		A6NIP4|A6NJY0|Q2VWA5	Missense_Mutation	SNP	pfam_Transform_Ski,pfam_c-SKI_SMAD4-bd_dom,superfamily_DNA-bd_dom_put,superfamily_SAND_dom-like	p.G691S	ENST00000380035.2	37	c.2071		15	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.917|3.917	-0.018900|-0.018900	0.07681|0.07681	.|.	.|.	ENSG00000188779|ENSG00000188779	ENST00000341418|ENST00000554240;ENST00000554054;ENST00000380035;ENST00000389002	T|T;T;T;T	0.13657|0.15718	2.57|2.4;2.4;2.4;2.4	4.56|4.56	-0.736|-0.736	0.11133|0.11133	.|.	.|0.700955	.|0.12395	.|N	.|0.472645	T|T	0.06462|0.06462	0.0166|0.0166	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B	.|0.28971	.|0.229	.|B	.|0.24006	.|0.05	T|T	0.32134|0.32134	-0.9918|-0.9918	7|10	0.56958|0.35671	D|T	0.05|0.21	-0.0412|-0.0412	3.7432|3.7432	0.08539|0.08539	0.3755:0.0:0.4611:0.1634|0.3755:0.0:0.4611:0.1634	.|.	.|647	.|P84550-3	.|.	T|S	631|652;663;691;647	ENSP00000343200:A631T|ENSP00000451193:G652S;ENSP00000452361:G663S;ENSP00000369374:G691S;ENSP00000373654:G647S	ENSP00000343200:A631T|ENSP00000369374:G691S	A|G	+|+	1|1	0|0	SKOR1|SKOR1	65907291|65907291	0.814000|0.814000	0.29104|0.29104	0.000000|0.000000	0.03702|0.03702	0.225000|0.225000	0.24961|0.24961	0.830000|0.830000	0.27462|0.27462	-0.311000|-0.311000	0.08754|0.08754	-0.136000|-0.136000	0.14681|0.14681	GCT|GGT	SKOR1	-	NULL		0.746	SKOR1-003	KNOWN	not_organism_supported|basic|appris_candidate_longest	protein_coding	SKOR1	HGNC	protein_coding	OTTHUMT00000410832.1	G	NM_001031807		68120237	+1	no_errors	ENST00000380035	ensembl	human	known	70_37	missense	SNP	0.001	A
SLC44A1	23446	genome.wustl.edu	37	9	108128639	108128639	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr9:108128639G>C	ENST00000374720.3	+	12	1670	c.1423G>C	c.(1423-1425)Gca>Cca	p.A475P	SLC44A1_ENST00000374724.1_Missense_Mutation_p.A475P|SLC44A1_ENST00000343170.7_Missense_Mutation_p.A267P|SLC44A1_ENST00000374723.1_Missense_Mutation_p.A475P	NM_080546.3	NP_536856.2	Q8WWI5	CTL1_HUMAN	solute carrier family 44 (choline transporter), member 1	475	Cys-rich.				choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)			breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	38					Choline(DB00122)	AAATGCTTGTGCACGATGTGT	0.289																																																	0													70.0	70.0	70.0					9																	108128639		2203	4300	6503	SO:0001583	missense	23446			AJ420812	CCDS6763.1, CCDS75868.1	9q31.2	2014-01-28	2013-07-17	2005-09-06	ENSG00000070214	ENSG00000070214		"""CD molecules"", ""Solute carriers"""	18798	protein-coding gene	gene with protein product		606105	"""CDW92 antigen"""	CDW92		11698453, 10677542	Standard	NM_080546		Approved	CDw92, CTL1, CHTL1, CD92	uc004bcn.3	Q8WWI5	OTTHUMG00000020421	ENST00000374720.3:c.1423G>C	9.37:g.108128639G>C	ENSP00000363852:p.Ala475Pro		A6NLZ9|Q5VUB3|Q8WVB0|Q96KU3|Q9NY69	Missense_Mutation	SNP	pfam_Choline_transptr-like	p.A475P	ENST00000374720.3	37	c.1423	CCDS6763.1	9	.	.	.	.	.	.	.	.	.	.	G	25.3	4.622278	0.87460	.	.	ENSG00000070214	ENST00000374723;ENST00000374720;ENST00000374724;ENST00000343170	T;T;T;T	0.25085	1.82;1.82;1.82;1.82	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.59689	0.2212	M	0.86502	2.82	0.80722	D	1	P;B;D	0.89917	0.501;0.36;1.0	P;B;D	0.91635	0.482;0.384;0.999	T	0.64253	-0.6451	10	0.62326	D	0.03	-16.3809	19.8856	0.96911	0.0:0.0:1.0:0.0	.	475;475;475	Q8WWI5-3;Q8WWI5-2;Q8WWI5	.;.;CTL1_HUMAN	P	475;475;475;267	ENSP00000363855:A475P;ENSP00000363852:A475P;ENSP00000363856:A475P;ENSP00000341856:A267P	ENSP00000341856:A267P	A	+	1	0	SLC44A1	107168460	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.269000	0.95684	2.771000	0.95319	0.650000	0.86243	GCA	SLC44A1	-	pfam_Choline_transptr-like		0.289	SLC44A1-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC44A1	HGNC	protein_coding	OTTHUMT00000053500.1	G	NM_080546		108128639	+1	no_errors	ENST00000374720	ensembl	human	known	70_37	missense	SNP	1.000	C
SLC9A6	10479	genome.wustl.edu	37	X	135106633	135106633	+	Missense_Mutation	SNP	T	T	C			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chrX:135106633T>C	ENST00000370698.3	+	12	1546	c.1511T>C	c.(1510-1512)tTg>tCg	p.L504S	SLC9A6_ENST00000370695.4_Missense_Mutation_p.L536S|SLC9A6_ENST00000370701.1_Missense_Mutation_p.L484S	NM_006359.2	NP_006350.1	Q92581	SL9A6_HUMAN	solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6	504					axon extension (GO:0048675)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|dendrite extension (GO:0097484)|dendritic spine development (GO:0060996)|ion transport (GO:0006811)|neuron projection morphogenesis (GO:0048812)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon terminus (GO:0043679)|axonal spine (GO:0044308)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)	sodium:proton antiporter activity (GO:0015385)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(18)|ovary(2)|upper_aerodigestive_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					CTGTCATGCTTGCATATCAGG	0.378																																																	0													246.0	184.0	205.0					X																	135106633		2203	4300	6503	SO:0001583	missense	10479			AF030409	CCDS14654.1, CCDS44003.1, CCDS55504.1	Xq26.3	2013-05-22	2012-03-22		ENSG00000198689	ENSG00000198689		"""Solute carriers"""	11079	protein-coding gene	gene with protein product		300231	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 6"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 6"""			9507001	Standard	NM_001042537		Approved	NHE6, KIAA0267	uc004ezk.3	Q92581	OTTHUMG00000022498	ENST00000370698.3:c.1511T>C	X.37:g.135106633T>C	ENSP00000359732:p.Leu504Ser		A6NIQ9|A8K160|B4DU30|B7ZAE0|Q3ZCW7|Q5JPP8|Q5JPP9|Q86VS0	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_6,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.L536S	ENST00000370698.3	37	c.1607	CCDS14654.1	X	.	.	.	.	.	.	.	.	.	.	T	16.54	3.151914	0.57151	.	.	ENSG00000198689	ENST00000370701;ENST00000370698;ENST00000370695	T;T;T	0.28454	1.61;1.61;1.61	5.36	5.36	0.76844	.	0.129498	0.53938	D	0.000059	T	0.52008	0.1708	M	0.71036	2.16	0.50467	D	0.999876	D;D	0.61697	0.99;0.966	D;P	0.64321	0.924;0.842	T	0.56559	-0.7959	10	0.87932	D	0	.	13.1562	0.59518	0.0:0.0:0.0:1.0	.	536;504	Q92581-2;Q92581	.;SL9A6_HUMAN	S	484;504;536	ENSP00000359735:L484S;ENSP00000359732:L504S;ENSP00000359729:L536S	ENSP00000359729:L536S	L	+	2	0	SLC9A6	134934299	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	3.127000	0.50484	1.784000	0.52394	0.412000	0.27726	TTG	SLC9A6	-	prints_Na/H_exchanger_6,tigrfam_NaH_exchanger		0.378	SLC9A6-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	SLC9A6	HGNC	protein_coding	OTTHUMT00000058450.1	T	NM_006359		135106633	+1	no_errors	ENST00000370695	ensembl	human	known	70_37	missense	SNP	1.000	C
STK11IP	114790	genome.wustl.edu	37	2	220473076	220473076	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr2:220473076G>T	ENST00000456909.1	+	14	1617	c.1527G>T	c.(1525-1527)gaG>gaT	p.E509D	STK11IP_ENST00000295641.10_Missense_Mutation_p.E520D			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	520	Glu-rich.				protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)			breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		agaaggaggagggggagatgg	0.612																																																	0													8.0	10.0	9.0					2																	220473076		2100	4206	6306	SO:0001583	missense	114790			AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.1527G>T	2.37:g.220473076G>T	ENSP00000389383:p.Glu509Asp		Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Missense_Mutation	SNP	NULL	p.E509D	ENST00000456909.1	37	c.1527		2	.	.	.	.	.	.	.	.	.	.	G	10.38	1.334734	0.24253	.	.	ENSG00000144589	ENST00000456909;ENST00000426736;ENST00000295641	T;T	0.05717	3.4;3.4	4.82	1.62	0.23740	.	1.225880	0.06226	N	0.687849	T	0.06554	0.0168	L	0.56769	1.78	0.19575	N	0.999968	P;P;B	0.37276	0.589;0.589;0.435	B;B;B	0.32864	0.107;0.107;0.154	T	0.41305	-0.9516	10	0.18710	T	0.47	1.627	3.5592	0.07875	0.516:0.0:0.3113:0.1727	.	488;520;520	B4DUE4;Q8N1F8-2;Q8N1F8	.;.;S11IP_HUMAN	D	509;488;520	ENSP00000389383:E509D;ENSP00000295641:E520D	ENSP00000295641:E520D	E	+	3	2	STK11IP	220181320	0.002000	0.14202	0.003000	0.11579	0.016000	0.09150	-0.069000	0.11542	0.105000	0.17753	-0.367000	0.07326	GAG	STK11IP	-	NULL		0.612	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	STK11IP	HGNC	protein_coding	OTTHUMT00000131432.1	G	NM_052902		220473076	+1	no_errors	ENST00000456909	ensembl	human	novel	70_37	missense	SNP	0.041	T
STOML3	161003	genome.wustl.edu	37	13	39544498	39544498	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr13:39544498G>A	ENST00000379631.4	-	5	684	c.340C>T	c.(340-342)Cag>Tag	p.Q114*	STOML3_ENST00000423210.1_Nonsense_Mutation_p.Q105*	NM_145286.2	NP_660329.1	Q8TAV4	STML3_HUMAN	stomatin (EPB72)-like 3	114					signal transduction (GO:0007165)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)				breast(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	11		Lung NSC(96;1.42e-05)|Prostate(109;0.00851)|Breast(139;0.0199)|Lung SC(185;0.0743)		all cancers(112;2.93e-08)|Epithelial(112;3.64e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00107)|BRCA - Breast invasive adenocarcinoma(63;0.00349)|GBM - Glioblastoma multiforme(144;0.0137)		CCATCTACCTGAGTAGTTACG	0.448																																																	0													135.0	131.0	132.0					13																	39544498		2203	4300	6503	SO:0001587	stop_gained	161003			BC025760	CCDS9367.1, CCDS45040.1	13q13.2	2004-03-05			ENSG00000133115	ENSG00000133115			19420	protein-coding gene	gene with protein product		608327				12122055	Standard	NM_145286		Approved	SRO, Epb7.2l	uc001uwx.3	Q8TAV4	OTTHUMG00000016763	ENST00000379631.4:c.340C>T	13.37:g.39544498G>A	ENSP00000368952:p.Gln114*		B4E285|Q5JS35	Nonsense_Mutation	SNP	pfam_Band_7,smart_Band_7,prints_Stomatin	p.Q114*	ENST00000379631.4	37	c.340	CCDS9367.1	13	.	.	.	.	.	.	.	.	.	.	G	24.8	4.570928	0.86542	.	.	ENSG00000133115	ENST00000379631;ENST00000423210	.	.	.	5.75	4.9	0.64082	.	0.290655	0.38492	N	0.001678	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	-13.2537	12.8002	0.57582	0.0:0.0:0.7029:0.2971	.	.	.	.	X	114;105	.	ENSP00000368952:Q114X	Q	-	1	0	STOML3	38442498	0.004000	0.15560	0.628000	0.29241	0.273000	0.26683	0.759000	0.26461	1.416000	0.47057	0.563000	0.77884	CAG	STOML3	-	pfam_Band_7,smart_Band_7,prints_Stomatin		0.448	STOML3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STOML3	HGNC	protein_coding	OTTHUMT00000044604.2	G			39544498	-1	no_errors	ENST00000379631	ensembl	human	known	70_37	nonsense	SNP	0.001	A
TBX15	6913	genome.wustl.edu	37	1	119474450	119474450	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr1:119474450C>T	ENST00000369429.3	-	2	220	c.211G>A	c.(211-213)Gag>Aag	p.E71K	TBX15_ENST00000207157.3_5'UTR			Q96SF7	TBX15_HUMAN	T-box 15	71					embryonic cranial skeleton morphogenesis (GO:0048701)	Tle3-Aes complex (GO:0070722)	RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(19)|ovary(1)|pancreas(1)|skin(5)	37	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)		GTGCTCTGCTCAGAATCTGCA	0.537																																																	0																																										SO:0001583	missense	6913			AK127536	CCDS30816.1	1p11.1	2008-02-05	2004-10-05		ENSG00000092607	ENSG00000092607		"""T-boxes"""	11594	protein-coding gene	gene with protein product		604127	"""T-box 14"""	TBX14		9693034	Standard	XM_005271162		Approved		uc001ehl.1	Q96SF7	OTTHUMG00000012263	ENST00000369429.3:c.211G>A	1.37:g.119474450C>T	ENSP00000358437:p.Glu71Lys		Q08E76|Q5JT54|Q5T9S7	Missense_Mutation	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,prints_TF_T-box,pfscan_TF_T-box	p.E71K	ENST00000369429.3	37	c.211		1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.563186	0.86335	.	.	ENSG00000092607	ENST00000369429	D	0.86956	-2.19	5.91	5.91	0.95273	.	0.048972	0.85682	D	0.000000	T	0.80929	0.4718	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.78502	-0.2179	7	0.08179	T	0.78	.	20.3011	0.98612	0.0:1.0:0.0:0.0	.	.	.	.	K	71	ENSP00000358437:E71K	ENSP00000358437:E71K	E	-	1	0	TBX15	119275973	1.000000	0.71417	0.969000	0.41365	0.969000	0.65631	7.242000	0.78210	2.804000	0.96469	0.650000	0.86243	GAG	TBX15	-	NULL		0.537	TBX15-002	PUTATIVE	not_organism_supported|upstream_ATG|basic|appris_principal	protein_coding	TBX15	HGNC	protein_coding	OTTHUMT00000034351.1	C	NM_152380		119474450	-1	no_errors	ENST00000369429	ensembl	human	known	70_37	missense	SNP	1.000	T
SV2A	9900	genome.wustl.edu	37	1	149876728	149876728	+	Silent	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr1:149876728C>T	ENST00000369146.3	-	13	2557	c.2067G>A	c.(2065-2067)ctG>ctA	p.L689L		NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	689					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	ACAGGGCATTCAGGAAGCCAA	0.587																																																	0													45.0	36.0	39.0					1																	149876728		2203	4300	6503	SO:0001819	synonymous_variant	9900			AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.2067G>A	1.37:g.149876728C>T			D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Silent	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_SV2_chordata	p.L689	ENST00000369146.3	37	c.2067	CCDS940.1	1																																																																																			SV2A	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_SV2_chordata		0.587	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SV2A	HGNC	protein_coding	OTTHUMT00000033754.1	C			149876728	-1	no_errors	ENST00000369146	ensembl	human	known	70_37	silent	SNP	1.000	T
TGS1	96764	genome.wustl.edu	37	8	56698850	56698850	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr8:56698850G>T	ENST00000260129.5	+	4	870	c.393G>T	c.(391-393)aaG>aaT	p.K131N		NM_024831.6	NP_079107.6	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase 1	131					7-methylguanosine cap hypermethylation (GO:0036261)|7-methylguanosine RNA capping (GO:0009452)|cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|regulation of transcription, DNA-templated (GO:0006355)|ribonucleoprotein complex biogenesis (GO:0022613)|ribonucleoprotein complex import into nucleus (GO:0071167)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)	RNA trimethylguanosine synthase activity (GO:0071164)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			AACATCAAAAGAAATACTTAG	0.264																																					Esophageal Squamous(34;275 823 4842 34837 48447)												0													25.0	26.0	25.0					8																	56698850		2197	4294	6491	SO:0001583	missense	96764			AY028423	CCDS34894.1	8q11	2010-06-25	2010-06-25	2006-11-27	ENSG00000137574	ENSG00000137574	2.1.1.-		17843	protein-coding gene	gene with protein product		606461	"""nuclear receptor coactivator 6 interacting protein"", ""trimethylguanosine synthase homolog (S. cerevisiae)"""	NCOA6IP		11517327, 11983179, 19307714	Standard	NM_024831		Approved	PIMT	uc003xsj.4	Q96RS0	OTTHUMG00000164294	ENST00000260129.5:c.393G>T	8.37:g.56698850G>T	ENSP00000260129:p.Lys131Asn		A6NJQ5|Q5GH23|Q8TDG9|Q96QU3|Q9H5V3	Missense_Mutation	SNP	pfam_RNA_cap_Gua-N2-MeTrfase,pfam_RNA_methylase_dom,pfam_tRNA_Trfase_Trm5/Tyw2	p.K131N	ENST00000260129.5	37	c.393	CCDS34894.1	8	.	.	.	.	.	.	.	.	.	.	G	15.44	2.833036	0.50951	.	.	ENSG00000137574	ENST00000260129	T	0.17528	2.27	5.69	4.81	0.61882	.	0.197172	0.40818	N	0.001013	T	0.30978	0.0782	M	0.76574	2.34	0.30298	N	0.789713	D;D	0.59767	0.986;0.986	P;P	0.53954	0.738;0.738	T	0.33650	-0.9860	10	0.51188	T	0.08	-11.8005	9.3884	0.38359	0.203:0.0:0.797:0.0	.	131;131	B2RBJ7;Q96RS0	.;TGS1_HUMAN	N	131	ENSP00000260129:K131N	ENSP00000260129:K131N	K	+	3	2	TGS1	56861404	1.000000	0.71417	0.996000	0.52242	0.650000	0.38633	1.588000	0.36633	1.405000	0.46838	-0.140000	0.14226	AAG	TGS1	-	NULL		0.264	TGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGS1	HGNC	protein_coding	OTTHUMT00000378152.1	G	NM_024831		56698850	+1	no_errors	ENST00000260129	ensembl	human	known	70_37	missense	SNP	0.998	T
THBS4	7060	genome.wustl.edu	37	5	79335943	79335943	+	Silent	SNP	C	C	T	rs367779999		TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr5:79335943C>T	ENST00000350881.2	+	2	322	c.132C>T	c.(130-132)ggC>ggT	p.G44G	THBS4_ENST00000511733.1_5'UTR	NM_003248.4	NP_003239.2	P35443	TSP4_HUMAN	thrombospondin 4	44	Laminin G-like.				behavioral response to pain (GO:0048266)|endothelial cell-cell adhesion (GO:0071603)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|positive regulation of cell division (GO:0051781)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of tissue remodeling (GO:0034103)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|tissue remodeling (GO:0048771)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)|integrin binding (GO:0005178)	p.G44G(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|stomach(3)	34		Lung NSC(167;0.00328)|all_lung(232;0.00355)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-45)|Epithelial(54;1.77e-39)|all cancers(79;3.2e-34)		TAAACCCAGGCGCTCTGCTGC	0.488																																																	1	Substitution - coding silent(1)	large_intestine(1)						C		2,4404	4.2+/-10.8	0,2,2201	77.0	79.0	79.0		132	-10.6	0.0	5		79	0,8600		0,0,4300	no	coding-synonymous	THBS4	NM_003248.4		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		44/962	79335943	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	7060				CCDS4049.1	5q13	2008-05-15			ENSG00000113296	ENSG00000113296			11788	protein-coding gene	gene with protein product		600715				7852353	Standard	NM_003248		Approved		uc021yaw.1	P35443	OTTHUMG00000108173	ENST00000350881.2:c.132C>T	5.37:g.79335943C>T			B2R909|Q86TG2	Silent	SNP	pfam_Thrombospondin_C,pfam_Thbs/COMP_coiled-coil,pfam_Thrombospondin_3-like_rpt,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.G44	ENST00000350881.2	37	c.132	CCDS4049.1	5																																																																																			THBS4	-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G		0.488	THBS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS4	HGNC	protein_coding	OTTHUMT00000226977.1	C			79335943	+1	no_errors	ENST00000350881	ensembl	human	known	70_37	silent	SNP	0.000	T
TNFRSF10C	8794	genome.wustl.edu	37	8	22974403	22974403	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr8:22974403G>A	ENST00000356864.3	+	5	1171	c.639G>A	c.(637-639)atG>atA	p.M213I	TNFRSF10C_ENST00000540813.1_Missense_Mutation_p.M111I	NM_003841.3	NP_003832	O14798	TR10C_HUMAN	tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain	213					apoptotic process (GO:0006915)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|large_intestine(6)|lung(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	15		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0147)|COAD - Colon adenocarcinoma(73;0.0612)		AAGAGACAATGACCACCAGCC	0.602																																																	0													62.0	70.0	67.0					8																	22974403		2203	4298	6501	SO:0001583	missense	8794			AF012536	CCDS6037.1	8p22-p21	2006-02-22			ENSG00000173535	ENSG00000173535		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11906	protein-coding gene	gene with protein product		603613				9314565, 9325248	Standard	NM_003841		Approved	DcR1, TRAILR3, LIT, TRID, CD263	uc003xcy.3	O14798	OTTHUMG00000097844	ENST00000356864.3:c.639G>A	8.37:g.22974403G>A	ENSP00000349324:p.Met213Ile		O14755|Q08AS6|Q6FH98|Q6UXM5	Missense_Mutation	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_10	p.M213I	ENST00000356864.3	37	c.639	CCDS6037.1	8	.	.	.	.	.	.	.	.	.	.	G	4.380	0.070127	0.08436	.	.	ENSG00000173535	ENST00000356864;ENST00000540813;ENST00000544885	T;T	0.63580	-0.05;1.01	0.493	0.493	0.16878	.	37.699200	0.00766	N	0.001165	T	0.43986	0.1272	N	0.14661	0.345	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.23476	-1.0187	10	0.18710	T	0.47	.	6.8883	0.24214	1.0E-4:0.0:0.9999:0.0	.	213	O14798	TR10C_HUMAN	I	213;111;213	ENSP00000349324:M213I;ENSP00000437612:M111I	ENSP00000349324:M213I	M	+	3	0	TNFRSF10C	23030348	0.004000	0.15560	0.003000	0.11579	0.151000	0.21798	-0.079000	0.11357	0.547000	0.28938	0.064000	0.15345	ATG	TNFRSF10C	-	NULL		0.602	TNFRSF10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF10C	HGNC	protein_coding	OTTHUMT00000215134.3	G			22974403	+1	no_errors	ENST00000356864	ensembl	human	known	70_37	missense	SNP	0.022	A
TNRC6A	27327	genome.wustl.edu	37	16	24826503	24826503	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr16:24826503C>T	ENST00000395799.3	+	19	4837	c.4708C>T	c.(4708-4710)Cca>Tca	p.P1570S	CTD-2515A14.1_ENST00000568895.1_RNA|TNRC6A_ENST00000315183.7_Missense_Mutation_p.P1521S|TNRC6A_ENST00000432286.2_Missense_Mutation_p.P48S	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1570					cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		GGAAGAGTCTCCATTTGTTCC	0.433																																																	0													145.0	135.0	138.0					16																	24826503		2197	4300	6497	SO:0001583	missense	27327			U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.4708C>T	16.37:g.24826503C>T	ENSP00000379144:p.Pro1570Ser		C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense_Mutation	SNP	pfam_Argonaute_hook_dom,superfamily_UBA-like	p.P1570S	ENST00000395799.3	37	c.4708	CCDS10624.2	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.53|13.53	2.265644|2.265644	0.40095|0.40095	.|.	.|.	ENSG00000090905|ENSG00000090905	ENST00000315183;ENST00000395799;ENST00000432286|ENST00000450465	T;T|.	0.11604|.	2.77;2.76|.	5.92|5.92	5.92|5.92	0.95590|0.95590	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.57504|0.57504	0.2058|0.2058	L|L	0.28344|0.28344	0.845|0.845	0.80722|0.80722	D|D	1|1	B;B;P;P|.	0.42203|.	0.291;0.008;0.773;0.615|.	B;B;B;B|.	0.38428|.	0.104;0.013;0.273;0.158|.	T|T	0.60388|0.60388	-0.7273|-0.7273	10|6	0.10902|0.87932	T|D	0.67|0	-8.2019|-8.2019	14.4704|14.4704	0.67512|0.67512	0.0:0.9301:0.0:0.0699|0.0:0.9301:0.0:0.0699	.|.	237;709;1521;1570|.	B3KSX2;C9JA83;Q8NDV7-6;Q8NDV7|.	.;.;.;TNR6A_HUMAN|.	S|F	1521;1570;48|460	ENSP00000326900:P1521S;ENSP00000379144:P1570S|.	ENSP00000326900:P1521S|ENSP00000404278:S460F	P|S	+|+	1|2	0|0	TNRC6A|TNRC6A	24734004|24734004	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	5.020000|5.020000	0.64066|0.64066	2.809000|2.809000	0.96659|0.96659	0.655000|0.655000	0.94253|0.94253	CCA|TCC	TNRC6A	-	NULL		0.433	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	TNRC6A	HGNC	protein_coding	OTTHUMT00000214081.1	C	NM_020847		24826503	+1	no_errors	ENST00000395799	ensembl	human	known	70_37	missense	SNP	1.000	T
TRMT1	55621	genome.wustl.edu	37	19	13227106	13227106	+	Silent	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr19:13227106C>T	ENST00000592062.1	-	3	678	c.108G>A	c.(106-108)gcG>gcA	p.A36A	TRMT1_ENST00000221504.8_Silent_p.A36A|TRMT1_ENST00000592892.1_5'UTR|TRMT1_ENST00000437766.1_Silent_p.A36A|TRMT1_ENST00000357720.4_Silent_p.A36A|NACC1_ENST00000292431.4_5'Flank			Q9NXH9	TRM1_HUMAN	tRNA methyltransferase 1 homolog (S. cerevisiae)	36							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA (guanine-N2-)-methyltransferase activity (GO:0004809)|tRNA binding (GO:0000049)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(19;6.08e-22)	GBM - Glioblastoma multiforme(1328;0.0356)		CGTTCTCCATCGCTGCTGTAT	0.612																																																	0													70.0	71.0	71.0					19																	13227106		2203	4300	6503	SO:0001819	synonymous_variant	55621			AF196479	CCDS12293.1, CCDS45997.1	19p13.13	2012-06-12	2012-06-12						25980	protein-coding gene	gene with protein product		611669				10982862	Standard	NM_001142554		Approved	FLJ20244, TRM1	uc002mwl.3	Q9NXH9		ENST00000592062.1:c.108G>A	19.37:g.13227106C>T			O76103|Q548Y5|Q8WVA6	Silent	SNP	pfam_TRM1,pfam_Znf_CCCH,pfam_tRNA_Trfase_Trm5/Tyw2,smart_Znf_CCCH,tigrfam_TRM1	p.A36	ENST00000592062.1	37	c.108	CCDS12293.1	19																																																																																			TRMT1	-	NULL		0.612	TRMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT1	HGNC	protein_coding	OTTHUMT00000452780.2	C	NM_017722		13227106	-1	no_errors	ENST00000357720	ensembl	human	known	70_37	silent	SNP	0.000	T
TTLL10	254173	genome.wustl.edu	37	1	1111303	1111303	+	Intron	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr1:1111303C>T	ENST00000379290.1	+	3	146				TTLL10-AS1_ENST00000379317.1_RNA|TTLL10_ENST00000379289.1_Intron			Q6ZVT0	TTL10_HUMAN	tubulin tyrosine ligase-like family, member 10						cellular protein modification process (GO:0006464)					haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(2)|skin(1)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;4.75e-36)|OV - Ovarian serous cystadenocarcinoma(86;5.82e-22)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		TGCTCCCAGCCGCTGTGCAGG	0.677																																																	0																																										SO:0001627	intron_variant	100506376			AK093438	CCDS8.1, CCDS44036.1	1p36.33	2014-01-28	2005-07-29	2005-07-29	ENSG00000162571	ENSG00000162571		"""Tubulin tyrosine ligase-like family"""	26693	protein-coding gene	gene with protein product			"""tubulin tyrosine ligase-like family, member 5"""	TTLL5		15890843	Standard	NM_153254		Approved	FLJ36119	uc001acy.2	Q6ZVT0	OTTHUMG00000000851	ENST00000379290.1:c.-28+1434C>T	1.37:g.1111303C>T			B1AMF6|Q5T2W4|Q5T2W5|Q8N9X2	RNA	SNP	-	NULL	ENST00000379290.1	37	NULL	CCDS44036.1	1																																																																																			TTLL10-AS1	-	-		0.677	TTLL10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL10-AS1	HGNC	protein_coding	OTTHUMT00000002421.3	C	NM_153254		1111303	-1	no_errors	ENST00000379317	ensembl	human	known	70_37	rna	SNP	0.109	T
TUBG1	7283	genome.wustl.edu	37	17	40765904	40765904	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr17:40765904G>A	ENST00000251413.3	+	8	793	c.731G>A	c.(730-732)cGc>cAc	p.R244H		NM_001070.4	NP_001061.2	P23258	TBG1_HUMAN	tubulin, gamma 1	244					cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|meiotic spindle organization (GO:0000212)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	apical part of cell (GO:0045177)|cell leading edge (GO:0031252)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|gamma-tubulin complex (GO:0000930)|nonmotile primary cilium (GO:0031513)|pericentriolar material (GO:0000242)|polar microtubule (GO:0005827)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	12		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.129)	Vinblastine(DB00570)	ACCACCCTGCGCTACCCTGGC	0.607																																					Colon(20;114 698 11420 22864)												0													244.0	184.0	204.0					17																	40765904		2203	4300	6503	SO:0001583	missense	7283			BC000619	CCDS11433.1	17q21.31	2010-03-15	2000-01-20		ENSG00000131462	ENSG00000131462		"""Tubulins"""	12417	protein-coding gene	gene with protein product		191135	"""tubulin, gamma polypeptide"""	TUBG		1904010	Standard	NM_001070		Approved	TUBGCP1	uc002ian.3	P23258		ENST00000251413.3:c.731G>A	17.37:g.40765904G>A	ENSP00000251413:p.Arg244His		Q53X79|Q9BW59	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_myosin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Gamma_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin,prints_Alpha_tubulin	p.R244H	ENST00000251413.3	37	c.731	CCDS11433.1	17	.	.	.	.	.	.	.	.	.	.	G	26.3	4.724829	0.89298	.	.	ENSG00000131462	ENST00000251413	T	0.74526	-0.85	4.41	4.41	0.53225	Tubulin/FtsZ, GTPase domain (3);	0.000000	0.85682	D	0.000000	D	0.90109	0.6910	H	0.96489	3.83	0.80722	D	1	D	0.89917	1.0	D	0.71184	0.972	D	0.93443	0.6795	10	0.87932	D	0	-9.1978	16.2703	0.82612	0.0:0.0:1.0:0.0	.	244	P23258	TBG1_HUMAN	H	244	ENSP00000251413:R244H	ENSP00000251413:R244H	R	+	2	0	TUBG1	38019430	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.372000	0.97165	2.321000	0.78463	0.650000	0.86243	CGC	TUBG1	-	superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase		0.607	TUBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBG1	HGNC	protein_coding	OTTHUMT00000450548.1	G	NM_001070		40765904	+1	no_errors	ENST00000251413	ensembl	human	known	70_37	missense	SNP	1.000	A
USP21	27005	genome.wustl.edu	37	1	161134399	161134399	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr1:161134399C>T	ENST00000289865.8	+	10	1602	c.1381C>T	c.(1381-1383)Ctc>Ttc	p.L461F	PPOX_ENST00000535223.1_5'Flank|PPOX_ENST00000352210.5_5'Flank|PPOX_ENST00000544598.1_5'Flank|USP21_ENST00000493054.1_3'UTR|USP21_ENST00000368001.1_Missense_Mutation_p.L461F|USP21_ENST00000368002.3_Missense_Mutation_p.L461F|PPOX_ENST00000432542.2_5'Flank|PPOX_ENST00000367999.4_5'Flank	NM_012475.4	NP_036607.3	Q9UK80	UBP21_HUMAN	ubiquitin specific peptidase 21	461	USP.				histone deubiquitination (GO:0016578)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	cysteine-type peptidase activity (GO:0008234)|metal ion binding (GO:0046872)|NEDD8-specific protease activity (GO:0019784)|transcription coactivator activity (GO:0003713)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|prostate(3)	29	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			AATCCTCGTGCTCCATATCCT	0.403																																																	0													94.0	85.0	88.0					1																	161134399		2203	4300	6503	SO:0001583	missense	27005			AF177758	CCDS30920.1	1q22	2008-04-11	2005-08-08		ENSG00000143258	ENSG00000143258		"""Ubiquitin-specific peptidases"""	12620	protein-coding gene	gene with protein product		604729	"""ubiquitin specific protease 21"""	USP23		12838346, 10799498	Standard	XM_006711273		Approved	USP16	uc010pkd.2	Q9UK80	OTTHUMG00000033154	ENST00000289865.8:c.1381C>T	1.37:g.161134399C>T	ENSP00000289865:p.Leu461Phe		Q59H60|Q5BKT5|Q5VTW9|Q5VTX0|Q9BTV1|Q9HBS2|Q9NYN4	Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.L461F	ENST00000289865.8	37	c.1381	CCDS30920.1	1	.	.	.	.	.	.	.	.	.	.	C	18.68	3.676558	0.67928	.	.	ENSG00000143258	ENST00000368002;ENST00000289865;ENST00000368001	T;T;T	0.03717	3.83;3.83;3.83	5.09	5.09	0.68999	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.197869	0.40640	N	0.001051	T	0.07458	0.0188	L	0.35644	1.08	0.46078	D	0.99885	D	0.76494	0.999	D	0.69824	0.966	T	0.25257	-1.0137	10	0.87932	D	0	.	17.4411	0.87565	0.0:1.0:0.0:0.0	.	461	Q9UK80	UBP21_HUMAN	F	461	ENSP00000356981:L461F;ENSP00000289865:L461F;ENSP00000356980:L461F	ENSP00000289865:L461F	L	+	1	0	USP21	159401023	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.001000	0.40825	2.632000	0.89209	0.555000	0.69702	CTC	USP21	-	pfam_Peptidase_C19,pfscan_Peptidase_C19		0.403	USP21-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	USP21	HGNC	protein_coding	OTTHUMT00000080801.1	C			161134399	+1	no_errors	ENST00000289865	ensembl	human	known	70_37	missense	SNP	1.000	T
WDFY4	57705	genome.wustl.edu	37	10	49997929	49997929	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr10:49997929C>T	ENST00000325239.5	+	21	3992	c.3965C>T	c.(3964-3966)tCa>tTa	p.S1322L	WDFY4_ENST00000413659.2_Intron	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	1322						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						ATGAACATTTCATCCCGTGAC	0.522																																																	0													174.0	141.0	151.0					10																	49997929		692	1591	2283	SO:0001583	missense	57705			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.3965C>T	10.37:g.49997929C>T	ENSP00000320563:p.Ser1322Leu		B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S1322L	ENST00000325239.5	37	c.3965	CCDS44385.1	10	.	.	.	.	.	.	.	.	.	.	C	17.78	3.473034	0.63737	.	.	ENSG00000128815	ENST00000426033;ENST00000325239	T	0.60672	0.17	5.28	4.38	0.52667	.	0.509988	0.18101	N	0.151676	T	0.51295	0.1666	M	0.62723	1.935	0.80722	D	1	P	0.44734	0.842	B	0.40165	0.321	T	0.51220	-0.8733	9	.	.	.	.	7.3266	0.26560	0.1772:0.736:0.0:0.0868	.	1322	Q6ZS81	WDFY4_HUMAN	L	1322	ENSP00000320563:S1322L	.	S	+	2	0	WDFY4	49667935	0.972000	0.33761	0.997000	0.53966	0.957000	0.61999	2.297000	0.43593	1.360000	0.45960	-0.253000	0.11424	TCA	WDFY4	-	NULL		0.522	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		C	XM_033379		49997929	+1	no_errors	ENST00000325239	ensembl	human	known	70_37	missense	SNP	0.988	T
TSIX	9383	genome.wustl.edu	37	X	73044562	73044562	+	lincRNA	SNP	G	G	A	rs188756044		TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chrX:73044562G>A	ENST00000604411.1	+	0	32523				XIST_ENST00000429829.1_lincRNA	NR_003255.2				TSIX transcript, XIST antisense RNA																		AGTGACTTTCGGTCTGGATCT	0.323																																																	0													52.0	53.0	53.0					X																	73044562		876	1991	2867			7503					Xq13.2	2012-10-19	2012-08-15			ENSG00000270641		"""Long non-coding RNAs"", ""-"""	12377	non-coding RNA	RNA, long non-coding	"""XIST antisense RNA (non-protein coding)"", ""long intergenic non-protein coding RNA 13"""	300181	"""X (inactive)-specific transcript, antisense"", ""TSIX transcript, XIST antisense RNA (non-protein coding)"""			10192391	Standard	NR_003255		Approved	NCRNA00013, XIST-AS1, LINC00013	uc004ebn.2				X.37:g.73044562G>A				RNA	SNP	-	NULL	ENST00000604411.1	37	NULL		X																																																																																			XIST	-	-		0.323	TSIX-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000469120.1	G	NR_003255		73044562	-1	no_errors	ENST00000429829	ensembl	human	known	70_37	rna	SNP	0.001	A
XPNPEP2	7512	genome.wustl.edu	37	X	128902410	128902410	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chrX:128902410G>C	ENST00000371106.3	+	21	2166	c.1974G>C	c.(1972-1974)tgG>tgC	p.W658C		NM_003399.5	NP_003390.4	O43895	XPP2_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound	658						anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(3)|kidney(3)|large_intestine(5)|liver(1)|lung(20)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	37						CCGCCTCCTGGGCCTCTGTGT	0.617																																																	0													32.0	34.0	33.0					X																	128902410		2203	4300	6503	SO:0001583	missense	7512			U90724	CCDS14613.1	Xq25	2008-02-05			ENSG00000122121	ENSG00000122121	3.4.11.9		12823	protein-coding gene	gene with protein product		300145				9375790, 9628831	Standard	NM_003399		Approved		uc004eut.1	O43895	OTTHUMG00000022373	ENST00000371106.3:c.1974G>C	X.37:g.128902410G>C	ENSP00000360147:p.Trp658Cys		A0AV16|O75994	Missense_Mutation	SNP	pfam_Pept_M24_structural-domain,pfam_Creatinase,superfamily_Pept_M24_structural-domain	p.W658C	ENST00000371106.3	37	c.1974	CCDS14613.1	X	.	.	.	.	.	.	.	.	.	.	G	9.188	1.025306	0.19433	.	.	ENSG00000122121	ENST00000371106	T	0.42513	0.97	4.74	1.77	0.24775	.	0.891913	0.09610	N	0.778966	T	0.21881	0.0527	N	0.08118	0	0.09310	N	0.999998	P	0.36495	0.556	B	0.34038	0.174	T	0.12656	-1.0539	10	0.51188	T	0.08	-13.7933	7.7438	0.28856	0.0929:0.2993:0.6077:0.0	.	658	O43895	XPP2_HUMAN	C	658	ENSP00000360147:W658C	ENSP00000360147:W658C	W	+	3	0	XPNPEP2	128730091	0.064000	0.20934	0.001000	0.08648	0.011000	0.07611	0.893000	0.28336	0.410000	0.25675	-0.226000	0.12346	TGG	XPNPEP2	-	NULL		0.617	XPNPEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPNPEP2	HGNC	protein_coding	OTTHUMT00000058210.1	G	NM_003399		128902410	+1	no_errors	ENST00000371106	ensembl	human	known	70_37	missense	SNP	0.002	C
ZC3H12A	80149	genome.wustl.edu	37	1	37946015	37946015	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr1:37946015G>A	ENST00000373087.6	+	3	684	c.568G>A	c.(568-570)Gac>Aac	p.D190N		NM_025079.2	NP_079355.2			zinc finger CCCH-type containing 12A											NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GCCTCGGCCCGACGTGCCCAT	0.622																																																	0													64.0	54.0	57.0					1																	37946015		2203	4300	6503	SO:0001583	missense	80149				CCDS417.1	1p34.3	2012-07-05			ENSG00000163874	ENSG00000163874		"""Zinc fingers, CCCH-type domain containing"""	26259	protein-coding gene	gene with protein product	"""MCP induced protein 1"""	610562				18178554, 22055188	Standard	NM_025079		Approved	FLJ23231, MCPIP1	uc001cbb.4	Q5D1E8	OTTHUMG00000004221	ENST00000373087.6:c.568G>A	1.37:g.37946015G>A	ENSP00000362179:p.Asp190Asn			Missense_Mutation	SNP	pfam_RNase_Zc3h12	p.D190N	ENST00000373087.6	37	c.568	CCDS417.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.201995	0.94997	.	.	ENSG00000163874	ENST00000373087;ENST00000373082	T	0.46451	0.87	4.8	4.8	0.61643	Ribonuclease Zc3h12a-like (1);	0.051083	0.85682	D	0.000000	T	0.59649	0.2209	L	0.50847	1.595	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.58624	-0.7604	10	0.42905	T	0.14	-19.5756	18.2296	0.89929	0.0:0.0:1.0:0.0	.	190	Q5D1E8	ZC12A_HUMAN	N	190	ENSP00000362179:D190N	ENSP00000362174:D190N	D	+	1	0	ZC3H12A	37718602	1.000000	0.71417	0.657000	0.29651	0.967000	0.64934	9.414000	0.97362	2.387000	0.81309	0.563000	0.77884	GAC	ZC3H12A	-	pfam_RNase_Zc3h12		0.622	ZC3H12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H12A	HGNC	protein_coding	OTTHUMT00000012154.2	G	NM_025079		37946015	+1	no_errors	ENST00000373082	ensembl	human	known	70_37	missense	SNP	0.999	A
ZNF462	58499	genome.wustl.edu	37	9	109689443	109689443	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr9:109689443G>A	ENST00000277225.5	+	3	3539	c.3250G>A	c.(3250-3252)Gag>Aag	p.E1084K	ZNF462_ENST00000441147.2_5'Flank|ZNF462_ENST00000457913.1_Missense_Mutation_p.E1084K			Q96JM2	ZN462_HUMAN	zinc finger protein 462	1084					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						ATTATCATTTGAGGTGGGTGC	0.512																																																	0													86.0	86.0	86.0					9																	109689443		2203	4300	6503	SO:0001583	missense	58499			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.3250G>A	9.37:g.109689443G>A	ENSP00000277225:p.Glu1084Lys		Q5T0T4|Q8N408	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E1084K	ENST00000277225.5	37	c.3250	CCDS35096.1	9	.	.	.	.	.	.	.	.	.	.	G	18.53	3.643016	0.67244	.	.	ENSG00000148143	ENST00000277225;ENST00000457913	T;T	0.05855	3.38;3.83	5.6	5.6	0.85130	.	0.251853	0.43579	D	0.000545	T	0.08891	0.0220	L	0.43152	1.355	0.80722	D	1	B;B	0.29136	0.234;0.053	B;B	0.25506	0.061;0.019	T	0.14504	-1.0470	10	0.44086	T	0.13	.	19.6224	0.95663	0.0:0.0:1.0:0.0	.	1084;1084	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	K	1084	ENSP00000277225:E1084K;ENSP00000414570:E1084K	ENSP00000277225:E1084K	E	+	1	0	ZNF462	108729264	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.003000	0.76310	2.630000	0.89119	0.655000	0.94253	GAG	ZNF462	-	NULL		0.512	ZNF462-001	KNOWN	basic|CCDS	protein_coding	ZNF462	HGNC	protein_coding	OTTHUMT00000053532.2	G	NM_021224		109689443	+1	no_errors	ENST00000457913	ensembl	human	known	70_37	missense	SNP	1.000	A
ZNF597	146434	genome.wustl.edu	37	16	3490819	3490819	+	Missense_Mutation	SNP	C	C	A			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr16:3490819C>A	ENST00000301744.4	-	3	383	c.148G>T	c.(148-150)Gcg>Tcg	p.A50S	NAA60_ENST00000407558.4_5'Flank|NAA60_ENST00000573580.1_5'Flank|NAA60_ENST00000424546.2_5'Flank|NAA60_ENST00000608722.1_5'Flank	NM_152457.1	NP_689670.1	Q96LX8	ZN597_HUMAN	zinc finger protein 597	50	KRAB.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	13						ATCAAAGCCGCATCCTCCAAA	0.468																																																	0													112.0	94.0	100.0					16																	3490819		2197	4300	6497	SO:0001583	missense	146434			AK057633	CCDS10505.1	16p13.3	2013-01-08			ENSG00000167981	ENSG00000167981		"""Zinc fingers, C2H2-type"", ""-"""	26573	protein-coding gene	gene with protein product		614685				12477932	Standard	NM_152457		Approved	FLJ33071	uc002cvd.3	Q96LX8	OTTHUMG00000129359	ENST00000301744.4:c.148G>T	16.37:g.3490819C>A	ENSP00000301744:p.Ala50Ser			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A50S	ENST00000301744.4	37	c.148	CCDS10505.1	16	.	.	.	.	.	.	.	.	.	.	C	3.730	-0.055686	0.07362	.	.	ENSG00000167981	ENST00000301744	T	0.01705	4.68	4.07	0.672	0.17935	Krueppel-associated box (3);	0.855079	0.09759	N	0.759494	T	0.01189	0.0039	N	0.08118	0	0.09310	N	1	B	0.22414	0.069	B	0.19666	0.026	T	0.48456	-0.9034	10	0.87932	D	0	2.6413	5.6344	0.17528	0.0:0.557:0.0:0.443	.	50	Q96LX8	ZN597_HUMAN	S	50	ENSP00000301744:A50S	ENSP00000301744:A50S	A	-	1	0	ZNF597	3430820	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.323000	0.19593	0.064000	0.16427	-0.251000	0.11542	GCG	ZNF597	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box		0.468	ZNF597-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF597	HGNC	protein_coding	OTTHUMT00000251511.2	C	NM_152457		3490819	-1	no_errors	ENST00000301744	ensembl	human	known	70_37	missense	SNP	0.000	A
ZNF677	342926	genome.wustl.edu	37	19	53741496	53741496	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2RO-01A-11D-A18J-09	TCGA-EK-A2RO-10A-01D-A18J-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	24177940-975d-4c45-9c43-7862c8e036bb	c386a7c5-17a6-449d-9a30-7066e3c23e6b	g.chr19:53741496C>G	ENST00000598513.1	-	5	634	c.484G>C	c.(484-486)Gac>Cac	p.D162H	CTD-2245F17.6_ENST00000596041.1_RNA|ZNF677_ENST00000333952.4_Missense_Mutation_p.D162H	NM_182609.2	NP_872415.1	Q86XU0	ZN677_HUMAN	zinc finger protein 677	162					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(13)|lung(6)|ovary(1)|pancreas(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(134;0.00352)		AATGGCTTGTCATGGATGAAA	0.308																																																	0													100.0	98.0	99.0					19																	53741496		2203	4297	6500	SO:0001583	missense	342926			BC050038	CCDS12861.1	19q13.42	2013-01-08				ENSG00000197928		"""Zinc fingers, C2H2-type"", ""-"""	28730	protein-coding gene	gene with protein product	"""hypothetical protein MGC48625"""					12477932	Standard	NM_182609		Approved	MGC48625	uc002qbg.1	Q86XU0		ENST00000598513.1:c.484G>C	19.37:g.53741496C>G	ENSP00000469391:p.Asp162His			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D162H	ENST00000598513.1	37	c.484	CCDS12861.1	19	.	.	.	.	.	.	.	.	.	.	C	8.925	0.962124	0.18583	.	.	ENSG00000197928	ENST00000333952	T	0.07216	3.21	2.6	1.52	0.23074	.	1.627630	0.04015	N	0.298893	T	0.06234	0.0161	N	0.14661	0.345	0.09310	N	1	B	0.18461	0.028	B	0.12156	0.007	T	0.36432	-0.9748	10	0.72032	D	0.01	.	5.7447	0.18114	0.0:0.844:0.0:0.156	.	162	Q86XU0	ZN677_HUMAN	H	162	ENSP00000334394:D162H	ENSP00000334394:D162H	D	-	1	0	ZNF677	58433308	0.000000	0.05858	0.001000	0.08648	0.015000	0.08874	0.226000	0.17776	0.627000	0.30340	0.655000	0.94253	GAC	ZNF677	-	NULL		0.308	ZNF677-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF677	HGNC	protein_coding	OTTHUMT00000464189.1	C	NM_182609		53741496	-1	no_errors	ENST00000333952	ensembl	human	known	70_37	missense	SNP	0.002	G
