#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
AATK	9625	genome.wustl.edu	37	17	79098591	79098591	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:79098591C>T	ENST00000326724.4	-	9	922	c.898G>A	c.(898-900)Gag>Aag	p.E300K	AATK_ENST00000417379.1_Missense_Mutation_p.E197K|AATK_ENST00000572339.1_5'Flank|MIR338_ENST00000390137.2_RNA|MIR657_ENST00000385003.1_RNA	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	300	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			TCCACCAGCTCTGGCGCGATC	0.672																																																	0													38.0	45.0	43.0					17																	79098591		2165	4250	6415	SO:0001583	missense	9625			AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.898G>A	17.37:g.79098591C>T	ENSP00000324196:p.Glu300Lys		O75136|Q6ZN31|Q86X28	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E300K	ENST00000326724.4	37	c.898	CCDS45807.1	17	.	.	.	.	.	.	.	.	.	.	C	33	5.229926	0.95173	.	.	ENSG00000181409	ENST00000326724;ENST00000374792	D;D	0.97529	-4.42;-4.42	3.86	3.86	0.44501	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.062472	0.64402	D	0.000007	D	0.98950	0.9643	H	0.98646	4.29	0.58432	D	0.999994	D	0.63880	0.993	D	0.62955	0.909	D	0.99126	1.0851	10	0.87932	D	0	.	14.7321	0.69388	0.0:1.0:0.0:0.0	.	300	Q6ZMQ8	LMTK1_HUMAN	K	300	ENSP00000324196:E300K;ENSP00000363924:E300K	ENSP00000324196:E300K	E	-	1	0	AATK	76713186	1.000000	0.71417	0.960000	0.40013	0.760000	0.43138	5.444000	0.66587	1.982000	0.57802	0.591000	0.81541	GAG	AATK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.672	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AATK	HGNC	protein_coding	OTTHUMT00000256055.1	C	NM_004920		79098591	-1	no_errors	ENST00000326724	ensembl	human	known	70_37	missense	SNP	0.999	T
ABCA1	19	genome.wustl.edu	37	9	107583755	107583755	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr9:107583755G>A	ENST00000374736.3	-	20	3255	c.2861C>T	c.(2860-2862)tCg>tTg	p.S954L		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	954	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	GGCGGTGCCCGAGGTCGGGGG	0.527																																																	0													57.0	52.0	54.0					9																	107583755		2203	4300	6503	SO:0001583	missense	19			AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.2861C>T	9.37:g.107583755G>A	ENSP00000363868:p.Ser954Leu		Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S954L	ENST00000374736.3	37	c.2861	CCDS6762.1	9	.	.	.	.	.	.	.	.	.	.	G	36	5.659012	0.96734	.	.	ENSG00000165029	ENST00000374736	D	0.94280	-3.39	5.7	5.7	0.88788	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.056408	0.64402	D	0.000001	D	0.96935	0.8999	M	0.89534	3.04	0.80722	D	1	D	0.55605	0.972	P	0.57371	0.819	D	0.97237	0.9888	10	0.72032	D	0.01	.	19.8306	0.96634	0.0:0.0:1.0:0.0	.	954	O95477	ABCA1_HUMAN	L	954	ENSP00000363868:S954L	ENSP00000363868:S954L	S	-	2	0	ABCA1	106623576	1.000000	0.71417	0.992000	0.48379	0.764000	0.43329	7.904000	0.87408	2.682000	0.91365	0.563000	0.77884	TCG	ABCA1	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like		0.527	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA1	HGNC	protein_coding	OTTHUMT00000053491.1	G	NM_005502		107583755	-1	no_errors	ENST00000374736	ensembl	human	known	70_37	missense	SNP	1.000	A
ACSS1	84532	genome.wustl.edu	37	20	25000666	25000666	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr20:25000666G>C	ENST00000323482.4	-	7	1305	c.1226C>G	c.(1225-1227)tCc>tGc	p.S409C	ACSS1_ENST00000542618.1_Missense_Mutation_p.S288C|ACSS1_ENST00000432802.2_Missense_Mutation_p.S409C|ACSS1_ENST00000537502.1_Missense_Mutation_p.S326C	NM_001252675.1|NM_032501.3	NP_001239604.1|NP_115890.2	Q9NUB1	ACS2L_HUMAN	acyl-CoA synthetase short-chain family member 1	409					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process (GO:0006085)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	mitochondrial matrix (GO:0005759)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	26					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GGTCCGCAGGGAGGAGCGATC	0.582																																																	0													124.0	105.0	111.0					20																	25000666		2203	4300	6503	SO:0001583	missense	84532				CCDS13167.1, CCDS58764.1, CCDS58765.1	20p11.23-p11.21	2012-07-13	2005-09-08	2005-09-08	ENSG00000154930	ENSG00000154930	6.2.1.1	"""Acyl-CoA synthetase family"""	16091	protein-coding gene	gene with protein product		614355	"""acetyl-Coenzyme A synthetase 2 (AMP forming)-like"""	ACAS2L			Standard	NM_032501		Approved	dJ568C11.3, AceCS2L, MGC33843	uc002wub.3	Q9NUB1	OTTHUMG00000032112	ENST00000323482.4:c.1226C>G	20.37:g.25000666G>C	ENSP00000316924:p.Ser409Cys		B3KXL2|B4DJZ3|D3DW48|F5H6F4|F8W7Y1|Q5TF42|Q8IV99|Q8N234|Q96JI1|Q96JX6|Q9NU28	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_Acyl-CoA_synth_DUF3448,tigrfam_Ac_CoA_lig	p.S409C	ENST00000323482.4	37	c.1226	CCDS13167.1	20	.	.	.	.	.	.	.	.	.	.	G	29.4	4.999914	0.93227	.	.	ENSG00000154930	ENST00000323482;ENST00000537502;ENST00000432802;ENST00000542618	T;T;T;T	0.57752	0.38;0.38;0.38;0.38	5.68	5.68	0.88126	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.78233	0.4251	M	0.88570	2.965	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.994;0.997;0.997	T	0.82010	-0.0669	10	0.87932	D	0	-35.7161	18.3739	0.90428	0.0:0.0:1.0:0.0	.	409;409;326	Q9NUB1-2;Q9NUB1;Q6ZV30	.;ACS2L_HUMAN;.	C	409;326;409;288	ENSP00000316924:S409C;ENSP00000439304:S326C;ENSP00000388793:S409C;ENSP00000437657:S288C	ENSP00000316924:S409C	S	-	2	0	ACSS1	24948666	1.000000	0.71417	0.935000	0.37517	0.991000	0.79684	9.352000	0.97076	2.669000	0.90835	0.563000	0.77884	TCC	ACSS1	-	pfam_AMP-dep_Synth/Lig,tigrfam_Ac_CoA_lig		0.582	ACSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSS1	HGNC	protein_coding	OTTHUMT00000078386.2	G	NM_032501		25000666	-1	no_errors	ENST00000323482	ensembl	human	known	70_37	missense	SNP	1.000	C
ACTC1	70	genome.wustl.edu	37	15	35085533	35085533	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr15:35085533G>A	ENST00000290378.4	-	3	1022	c.367C>T	c.(367-369)Cag>Tag	p.Q123*	RP11-814P5.1_ENST00000503496.1_RNA|ACTC1_ENST00000557860.1_5'Flank	NM_005159.4	NP_005150.1	P68032	ACTC_HUMAN	actin, alpha, cardiac muscle 1	123					actin filament-based movement (GO:0030048)|actin-myosin filament sliding (GO:0033275)|actomyosin structure organization (GO:0031032)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|heart contraction (GO:0060047)|muscle filament sliding (GO:0030049)|negative regulation of apoptotic process (GO:0043066)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|skeletal muscle thin filament assembly (GO:0030240)	actin filament (GO:0005884)|actomyosin, actin portion (GO:0042643)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|I band (GO:0031674)|membrane (GO:0016020)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|myosin binding (GO:0017022)			central_nervous_system(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	31		all_lung(180;2.3e-08)		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		AACATGATCTGAGTCATCTTC	0.587																																																	0													109.0	104.0	106.0					15																	35085533		2201	4298	6499	SO:0001587	stop_gained	70			BC009978	CCDS10041.1	15q14	2014-09-17	2006-08-24	2006-08-24	ENSG00000159251	ENSG00000159251			143	protein-coding gene	gene with protein product		102540	"""actin, alpha, cardiac muscle"""	ACTC		1639426	Standard	NM_005159		Approved	CMD1R	uc001ziu.1	P68032	OTTHUMG00000129675	ENST00000290378.4:c.367C>T	15.37:g.35085533G>A	ENSP00000290378:p.Gln123*		P04270	Nonsense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.Q123*	ENST00000290378.4	37	c.367	CCDS10041.1	15	.	.	.	.	.	.	.	.	.	.	G	45	11.280256	0.99541	.	.	ENSG00000159251	ENST00000290378;ENST00000544062	.	.	.	5.63	5.63	0.86233	.	0.000000	0.51477	U	0.000087	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.0442	0.97604	0.0:0.0:1.0:0.0	.	.	.	.	X	123;88	.	ENSP00000290378:Q123X	Q	-	1	0	ACTC1	32872825	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	9.869000	0.99810	2.814000	0.96858	0.655000	0.94253	CAG	ACTC1	-	pfam_Actin-like,smart_Actin-like,prints_Actin-like		0.587	ACTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTC1	HGNC	protein_coding	OTTHUMT00000251876.3	G	NM_005159		35085533	-1	no_errors	ENST00000290378	ensembl	human	known	70_37	nonsense	SNP	1.000	A
ACVR1C	130399	genome.wustl.edu	37	2	158406726	158406726	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:158406726C>T	ENST00000243349.8	-	4	1083	c.723G>A	c.(721-723)acG>acA	p.T241T	ACVR1C_ENST00000335450.7_Silent_p.T161T|ACVR1C_ENST00000348328.5_Intron|ACVR1C_ENST00000409680.3_Silent_p.T191T	NM_001111032.1|NM_145259.2	NP_001104502.1|NP_660302.2			activin A receptor, type IC											NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	42						GCAGCATGACCGTCTGGTAAA	0.423																																																	0													153.0	150.0	151.0					2																	158406726		2203	4300	6503	SO:0001819	synonymous_variant	130399			BC022530	CCDS2205.1, CCDS46432.1, CCDS46433.1, CCDS46434.1	2q24.2	2008-02-05			ENSG00000123612	ENSG00000123612			18123	protein-coding gene	gene with protein product		608981					Standard	NM_145259		Approved	ALK7, ACVRLK7	uc002tzk.4	Q8NER5	OTTHUMG00000131964	ENST00000243349.8:c.723G>A	2.37:g.158406726C>T				Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.T241	ENST00000243349.8	37	c.723	CCDS2205.1	2																																																																																			ACVR1C	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.423	ACVR1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVR1C	HGNC	protein_coding	OTTHUMT00000254924.2	C	NM_145259		158406726	-1	no_errors	ENST00000243349	ensembl	human	known	70_37	silent	SNP	0.014	T
ADCK5	203054	genome.wustl.edu	37	8	145616340	145616340	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr8:145616340G>A	ENST00000308860.6	+	6	594	c.550G>A	c.(550-552)Gag>Aag	p.E184K	CPSF1_ENST00000531727.1_5'Flank|ADCK5_ENST00000526231.2_3'UTR	NM_174922.3	NP_777582.4	Q3MIX3	ADCK5_HUMAN	aarF domain containing kinase 5	184	Protein kinase.					integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(2)|prostate(2)|skin(1)|stomach(2)	8	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;8.96e-41)|Epithelial(56;4.08e-40)|all cancers(56;4.51e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			CCAGGTGGATGAGTTGTTCCT	0.642																																																	0													53.0	53.0	53.0					8																	145616340		2203	4300	6503	SO:0001583	missense	203054			BC032402	CCDS34965.1, CCDS34965.2	8q24.3	2004-07-06			ENSG00000173137	ENSG00000173137			21738	protein-coding gene	gene with protein product							Standard	NM_174922		Approved	FLJ35454	uc003zch.3	Q3MIX3	OTTHUMG00000165190	ENST00000308860.6:c.550G>A	8.37:g.145616340G>A	ENSP00000310547:p.Glu184Lys		B3KS46|Q5U4P1|Q6P2S4|Q8N5V3	Missense_Mutation	SNP	pfam_UbiB_dom,superfamily_Kinase-like_dom	p.E184K	ENST00000308860.6	37	c.550	CCDS34965.1	8	.	.	.	.	.	.	.	.	.	.	G	9.437	1.087121	0.20390	.	.	ENSG00000173137	ENST00000308860	T	0.74002	-0.8	5.04	2.13	0.27403	Protein kinase-like domain (1);	0.319525	0.30011	N	0.010631	T	0.51924	0.1703	N	0.12502	0.225	0.80722	D	1	B	0.06786	0.001	B	0.10450	0.005	T	0.37865	-0.9687	10	0.07030	T	0.85	-16.7704	12.8604	0.57910	0.0:0.4814:0.5186:0.0	.	184	Q3MIX3	ADCK5_HUMAN	K	184	ENSP00000310547:E184K	ENSP00000310547:E184K	E	+	1	0	ADCK5	145587148	1.000000	0.71417	0.750000	0.31169	0.809000	0.45718	4.068000	0.57534	0.122000	0.18314	0.462000	0.41574	GAG	ADCK5	-	superfamily_Kinase-like_dom		0.642	ADCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCK5	HGNC	protein_coding	OTTHUMT00000382556.2	G	NM_174922		145616340	+1	no_errors	ENST00000308860	ensembl	human	known	70_37	missense	SNP	0.987	A
ADCY2	108	genome.wustl.edu	37	5	7698477	7698477	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr5:7698477G>A	ENST00000338316.4	+	7	1188	c.1099G>A	c.(1099-1101)Gaa>Aaa	p.E367K	ADCY2_ENST00000537121.1_Missense_Mutation_p.E187K	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	367					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						GGACATGTGTGAAGCCATAAA	0.403																																																	0													142.0	139.0	140.0					5																	7698477		2203	4300	6503	SO:0001583	missense	108			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.1099G>A	5.37:g.7698477G>A	ENSP00000342952:p.Glu367Lys		B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.E367K	ENST00000338316.4	37	c.1099	CCDS3872.2	5	.	.	.	.	.	.	.	.	.	.	G	23.3	4.401699	0.83120	.	.	ENSG00000078295	ENST00000338316;ENST00000541993;ENST00000537121	D;D	0.81739	-1.53;-1.53	5.8	5.8	0.92144	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	T	0.78929	0.4361	L	0.28458	0.855	0.51233	D	0.999913	P;P	0.35821	0.518;0.523	B;P	0.45913	0.417;0.497	T	0.77635	-0.2514	10	0.42905	T	0.14	.	15.5263	0.75910	0.0:0.1375:0.8625:0.0	.	187;367	B7Z2C1;Q08462	.;ADCY2_HUMAN	K	367;218;187	ENSP00000342952:E367K;ENSP00000444803:E187K	ENSP00000342952:E367K	E	+	1	0	ADCY2	7751477	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.502000	0.81614	2.748000	0.94277	0.655000	0.94253	GAA	ADCY2	-	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase		0.403	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY2	HGNC	protein_coding	OTTHUMT00000206930.2	G	NM_020546		7698477	+1	no_errors	ENST00000338316	ensembl	human	known	70_37	missense	SNP	1.000	A
ADCY3	109	genome.wustl.edu	37	2	25095469	25095469	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:25095469C>T	ENST00000260600.5	-	2	1646	c.795G>A	c.(793-795)aaG>aaA	p.K265K		NM_004036.3	NP_004027.2	O60266	ADCY3_HUMAN	adenylate cyclase 3	265					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			NS(1)|breast(5)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(4)|skin(2)	44	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					CCAGGTTCATCTTCACCTCCA	0.632																																																	0													97.0	100.0	99.0					2																	25095469		2203	4300	6503	SO:0001819	synonymous_variant	109			AF033861	CCDS1715.1	2p23.3	2013-02-04			ENSG00000138031	ENSG00000138031	4.6.1.1	"""Adenylate cyclases"""	234	protein-coding gene	gene with protein product		600291				9920776	Standard	NM_004036		Approved	AC3	uc002rfs.4	O60266	OTTHUMG00000094765	ENST00000260600.5:c.795G>A	2.37:g.25095469C>T			B3KT86|Q53T54|Q9UDB1	Silent	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.K265	ENST00000260600.5	37	c.795	CCDS1715.1	2																																																																																			ADCY3	-	NULL		0.632	ADCY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY3	HGNC	protein_coding	OTTHUMT00000211574.2	C			25095469	-1	no_errors	ENST00000260600	ensembl	human	known	70_37	silent	SNP	1.000	T
ADCY5	111	genome.wustl.edu	37	3	123010071	123010071	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr3:123010071G>A	ENST00000462833.1	-	18	4428	c.3216C>T	c.(3214-3216)gtC>gtT	p.V1072V	ADCY5_ENST00000309879.5_Silent_p.V722V|ADCY5_ENST00000491190.1_Silent_p.V730V	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	1072	Guanylate cyclase 2. {ECO:0000255|PROSITE-ProRule:PRU00099}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		AGGCGAACATGACCGCCACAC	0.587																																																	0													102.0	81.0	89.0					3																	123010071		2203	4300	6503	SO:0001819	synonymous_variant	111			U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.3216C>T	3.37:g.123010071G>A			B7Z8A6|Q7RTV7|Q8NFM3	Silent	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.V1072	ENST00000462833.1	37	c.3216	CCDS3022.1	3																																																																																			ADCY5	-	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase		0.587	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY5	HGNC	protein_coding	OTTHUMT00000355889.4	G	XM_171048		123010071	-1	no_errors	ENST00000462833	ensembl	human	known	70_37	silent	SNP	1.000	A
ADCY8	114	genome.wustl.edu	37	8	131826399	131826399	+	Silent	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr8:131826399C>G	ENST00000286355.5	-	14	4921	c.2829G>C	c.(2827-2829)ctG>ctC	p.L943L	ADCY8_ENST00000377928.3_Silent_p.L812L	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	943					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			TGTGTTCCCTCAGCTCCTTCA	0.537										HNSCC(32;0.087)																																							0													245.0	184.0	205.0					8																	131826399		2203	4300	6503	SO:0001819	synonymous_variant	114			Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.2829G>C	8.37:g.131826399C>G				Silent	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.L943	ENST00000286355.5	37	c.2829	CCDS6363.1	8																																																																																			ADCY8	-	smart_A/G_cyclase		0.537	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY8	HGNC	protein_coding	OTTHUMT00000380080.1	C			131826399	-1	no_errors	ENST00000286355	ensembl	human	known	70_37	silent	SNP	1.000	G
AFAP1L1	134265	genome.wustl.edu	37	5	148682038	148682038	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr5:148682038G>T	ENST00000296721.4	+	5	483	c.385G>T	c.(385-387)Gag>Tag	p.E129*	AFAP1L1_ENST00000522492.1_3'UTR|AFAP1L1_ENST00000515000.1_Nonsense_Mutation_p.E129*	NM_001146337.1|NM_152406.2	NP_001139809.1|NP_689619.1	Q8TED9	AF1L1_HUMAN	actin filament associated protein 1-like 1	129						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(10)|ovary(1)|pancreas(1)|skin(2)	26			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTACTATGAAGAGGCCCTTCC	0.617																																																	0													26.0	24.0	25.0					5																	148682038		2203	4296	6499	SO:0001587	stop_gained	134265			AK094067	CCDS34274.1, CCDS54932.1	5q33.1	2013-01-10			ENSG00000157510	ENSG00000157510		"""Pleckstrin homology (PH) domain containing"""	26714	protein-coding gene	gene with protein product		614410					Standard	NM_152406		Approved	FLJ36748	uc003lqh.3	Q8TED9	OTTHUMG00000163441	ENST00000296721.4:c.385G>T	5.37:g.148682038G>T	ENSP00000296721:p.Glu129*		Q08AN4|Q08AN5|Q8IW82|Q8N8Z5|Q8N9Q4	Nonsense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E129*	ENST00000296721.4	37	c.385	CCDS34274.1	5	.	.	.	.	.	.	.	.	.	.	G	38	6.719407	0.97788	.	.	ENSG00000157510	ENST00000296721;ENST00000515000	.	.	.	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	-36.8226	20.063	0.97692	0.0:0.0:1.0:0.0	.	.	.	.	X	129	.	ENSP00000296721:E129X	E	+	1	0	AFAP1L1	148662231	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.869000	0.99810	2.735000	0.93741	0.655000	0.94253	GAG	AFAP1L1	-	NULL		0.617	AFAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFAP1L1	HGNC	protein_coding	OTTHUMT00000373443.1	G	NM_152406		148682038	+1	no_errors	ENST00000296721	ensembl	human	known	70_37	nonsense	SNP	1.000	T
AGAP11	119385	genome.wustl.edu	37	10	88760503	88760503	+	RNA	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr10:88760503C>G	ENST00000444431.1	+	0	1633				RP11-96C23.5_ENST00000433214.2_RNA|RP11-96C23.14_ENST00000444180.3_RNA			Q8TF27	AGA11_HUMAN	ankyrin repeat and GTPase domain Arf GTPase activating protein 11						regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)										GAGTCATGCTCTTTACAAAGC	0.358																																																	0																																												119385					10q23.2	2013-01-11			ENSG00000151303	ENSG00000151303		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	29421	protein-coding gene	gene with protein product						11853319	Standard	NM_133447		Approved	KIAA1975	uc001kee.2	Q8TF27	OTTHUMG00000018667		10.37:g.88760503C>G			B9EIP7|D3DWE4	RNA	SNP	-	NULL	ENST00000444431.1	37	NULL		10																																																																																			AGAP11	-	-		0.358	AGAP11-001	KNOWN	basic|readthrough_transcript	processed_transcript	AGAP11	HGNC	processed_transcript	OTTHUMT00000049193.1	C	NM_133447		88760503	+1	no_errors	ENST00000444431	ensembl	human	known	70_37	rna	SNP	0.148	G
AGPAT9	84803	genome.wustl.edu	37	4	84525961	84525961	+	3'UTR	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr4:84525961G>C	ENST00000395226.2	+	0	1564				AGPAT9_ENST00000509044.1_3'UTR|AGPAT9_ENST00000264409.4_3'UTR	NM_001256421.1	NP_001243350.1	Q53EU6	GPAT3_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 9						CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|regulation of TOR signaling (GO:0032006)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(3)	13		Hepatocellular(203;0.114)				CTAGCCCTTAGAAATGGAATG	0.353																																																	0													64.0	56.0	59.0					4																	84525961		2203	4300	6503	SO:0001624	3_prime_UTR_variant	84803			AK055749	CCDS3606.1	4q21.23	2014-02-13	2008-01-29		ENSG00000138678	ENSG00000138678	2.3.1.15	"""1-acylglycerol-3-phosphate O-acyltransferases"""	28157	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, theta"""	610958	"""1-acylglycerol-3-phosphate O-acyltransferase 9 (lysophosphatidic acid acyltransferase, theta)"""			12975309	Standard	NM_001256421		Approved	MGC11324, LPAAT-theta, MAG1, HMFN0839	uc003how.4	Q53EU6	OTTHUMG00000130431	ENST00000395226.2:c.*41G>C	4.37:g.84525961G>C			Q68CJ4|Q6GPI6|Q96NA3	RNA	SNP	-	NULL	ENST00000395226.2	37	NULL	CCDS3606.1	4																																																																																			AGPAT9	-	-		0.353	AGPAT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGPAT9	HGNC	protein_coding	OTTHUMT00000252821.3	G	NM_032717		84525961	+1	no_errors	ENST00000509044	ensembl	human	putative	70_37	rna	SNP	0.003	C
AHCTF1	25909	genome.wustl.edu	37	1	247024352	247024352	+	Silent	SNP	C	C	T	rs144994178	byFrequency	TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:247024352C>T	ENST00000391829.2	-	29	4104	c.3981G>A	c.(3979-3981)ccG>ccA	p.P1327P	AHCTF1_ENST00000470300.1_5'UTR|AHCTF1_ENST00000366508.1_Silent_p.P1362P|AHCTF1_ENST00000326225.3_Silent_p.P1336P			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	1327	Disordered. {ECO:0000250}.|Necessary for nuclear localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CAAGGTCTTCCGGTGACGGTG	0.438																																					Colon(145;197 1800 4745 15099 26333)												0								C		2,4404	4.2+/-10.8	0,2,2201	99.0	87.0	91.0		4008	-1.1	0.2	1	dbSNP_134	91	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	AHCTF1	NM_015446.4		0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231		1336/2276	247024352	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	25909				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.3981G>A	1.37:g.247024352C>T			A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Silent	SNP	superfamily_Quinonprotein_ADH-like	p.P1336	ENST00000391829.2	37	c.4008		1																																																																																			AHCTF1	-	NULL		0.438	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	AHCTF1	HGNC	protein_coding		C	NM_015446		247024352	-1	no_errors	ENST00000326225	ensembl	human	known	70_37	silent	SNP	0.791	T
AHNAK2	113146	genome.wustl.edu	37	14	105413073	105413073	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr14:105413073C>G	ENST00000333244.5	-	7	8834	c.8715G>C	c.(8713-8715)aaG>aaC	p.K2905N	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2905						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CTTTGGGCATCTTGAAACTGG	0.647																																																	0													157.0	171.0	167.0					14																	105413073		1870	4078	5948	SO:0001583	missense	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.8715G>C	14.37:g.105413073C>G	ENSP00000353114:p.Lys2905Asn		Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.K2905N	ENST00000333244.5	37	c.8715	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	c	13.82	2.351928	0.41700	.	.	ENSG00000185567	ENST00000333244	T	0.01379	4.96	4.24	2.01	0.26516	.	.	.	.	.	T	0.05593	0.0147	M	0.78916	2.43	0.23204	N	0.998121	D	0.65815	0.995	D	0.63877	0.919	T	0.32561	-0.9902	9	0.23302	T	0.38	.	8.0338	0.30480	0.0:0.6583:0.0:0.3417	.	2905	Q8IVF2	AHNK2_HUMAN	N	2905	ENSP00000353114:K2905N	ENSP00000353114:K2905N	K	-	3	2	AHNAK2	104484118	0.192000	0.23301	0.976000	0.42696	0.458000	0.32498	0.162000	0.16501	0.777000	0.33496	0.485000	0.47835	AAG	AHNAK2	-	NULL		0.647	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	C	NM_138420		105413073	-1	no_errors	ENST00000333244	ensembl	human	known	70_37	missense	SNP	0.919	G
AKNA	80709	genome.wustl.edu	37	9	117119145	117119145	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr9:117119145G>A	ENST00000307564.4	-	13	3005	c.2844C>T	c.(2842-2844)atC>atT	p.I948I	AKNA_ENST00000374075.5_Silent_p.I867I|AKNA_ENST00000223791.3_Silent_p.I408I|AKNA_ENST00000374088.3_Silent_p.I948I	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	948					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						CGGGATACCTGATGTGGGAGA	0.587																																																	0													145.0	131.0	136.0					9																	117119145		2203	4300	6503	SO:0001819	synonymous_variant	80709			AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.2844C>T	9.37:g.117119145G>A			Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Silent	SNP	pfam_TF_AT-hook	p.I948	ENST00000307564.4	37	c.2844	CCDS6805.1	9																																																																																			AKNA	-	NULL		0.587	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AKNA	HGNC	protein_coding	OTTHUMT00000053767.2	G	NM_030767		117119145	-1	no_errors	ENST00000307564	ensembl	human	known	70_37	silent	SNP	0.993	A
AKR1C4	1109	genome.wustl.edu	37	10	5238643	5238643	+	Intron	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr10:5238643G>A	ENST00000380448.1	+	3	205				U8_ENST00000516100.1_RNA|AKR1CL1_ENST00000445191.1_Intron|AKR1C4_ENST00000263126.1_5'Flank			P17516	AK1C4_HUMAN	aldo-keto reductase family 1, member C4						androgen metabolic process (GO:0008209)|bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular response to jasmonic acid stimulus (GO:0071395)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase activity (GO:0047023)|bile acid transmembrane transporter activity (GO:0015125)|chlordecone reductase activity (GO:0047743)|electron carrier activity (GO:0009055)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|retinal dehydrogenase activity (GO:0001758)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(2)|stomach(2)|urinary_tract(1)	18						GATAAGAAACGAGTGAACTGG	0.358																																																	0																																										SO:0001627	intron_variant	1109			M33375	CCDS7064.1	10p15.1	2012-12-04	2012-12-04		ENSG00000198610	ENSG00000198610	1.1.1.225	"""Aldo-keto reductases"""	387	protein-coding gene	gene with protein product	"""chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4"""	600451	"""aldo-keto reductase family 1, member C4 (chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4)"""	CHDR		7789999	Standard	NM_001818		Approved	DD4, HAKRA, C11, 3-alpha-HSD, CDR, MGC22581	uc001ihw.2	P17516	OTTHUMG00000017591	ENST00000380448.1:c.-48-140G>A	10.37:g.5238643G>A			Q5T6A3|Q8WW84|Q9NS54	RNA	SNP	-	NULL	ENST00000380448.1	37	NULL	CCDS7064.1	10																																																																																			AKR1C4	-	-		0.358	AKR1C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKR1C4	HGNC	protein_coding	OTTHUMT00000046543.2	G	NM_001818		5238643	+1	no_errors	ENST00000469875	ensembl	human	known	70_37	rna	SNP	0.000	A
ALMS1	7840	genome.wustl.edu	37	2	73676904	73676904	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:73676904G>A	ENST00000264448.6	+	8	3358	c.3247G>A	c.(3247-3249)Gac>Aac	p.D1083N	ALMS1_ENST00000377715.1_Missense_Mutation_p.D1083N|ALMS1_ENST00000409009.1_Missense_Mutation_p.D1041N	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	1083	34 X 47 AA approximate tandem repeat.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						TGGACCAGCTGACCAGATGAC	0.493																																																	0													103.0	106.0	105.0					2																	73676904		1924	4131	6055	SO:0001583	missense	7840			AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.3247G>A	2.37:g.73676904G>A	ENSP00000264448:p.Asp1083Asn		Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	NULL	p.D1083N	ENST00000264448.6	37	c.3247	CCDS42697.1	2	.	.	.	.	.	.	.	.	.	.	G	17.06	3.291372	0.59976	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.18174	3.11;3.11;2.23	4.39	4.39	0.52855	.	1.147770	0.06413	N	0.720969	T	0.34483	0.0899	L	0.36672	1.1	0.09310	N	1	D;D;D	0.89917	1.0;0.999;0.996	D;D;P	0.74348	0.983;0.96;0.894	T	0.35822	-0.9773	10	0.59425	D	0.04	.	12.7635	0.57378	0.0:0.0:1.0:0.0	.	1083;1041;1083	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	N	1041;1083;1083	ENSP00000386627:D1041N;ENSP00000264448:D1083N;ENSP00000366944:D1083N	ENSP00000264448:D1083N	D	+	1	0	ALMS1	73530412	0.133000	0.22466	0.111000	0.21465	0.009000	0.06853	2.409000	0.44583	2.728000	0.93425	0.591000	0.81541	GAC	ALMS1	-	NULL		0.493	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALMS1	HGNC	protein_coding	OTTHUMT00000327776.1	G	NM_015120		73676904	+1	no_errors	ENST00000264448	ensembl	human	known	70_37	missense	SNP	0.130	A
AMOTL2	51421	genome.wustl.edu	37	3	134080426	134080426	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr3:134080426C>T	ENST00000422605.2	-	6	1669	c.1503G>A	c.(1501-1503)gaG>gaA	p.E501E	AMOTL2_ENST00000513145.1_Silent_p.E501E|AMOTL2_ENST00000514516.1_Silent_p.E559E|AMOTL2_ENST00000249883.5_Silent_p.E501E			Q9Y2J4	AMOL2_HUMAN	angiomotin like 2	501					hippo signaling (GO:0035329)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|tight junction (GO:0005923)				endometrium(8)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	19						GCTCCCGCTTCTCACAGGCTG	0.652																																																	0													21.0	24.0	23.0					3																	134080426		2198	4279	6477	SO:0001819	synonymous_variant	51421			AF175966	CCDS33860.1, CCDS63783.1, CCDS63784.1	3q21-q22	2008-07-18			ENSG00000114019	ENSG00000114019			17812	protein-coding gene	gene with protein product	"""Leman coiled-coil protein"", ""angiomotin-like protein 2"""	614658					Standard	NM_016201		Approved	LCCP	uc003eqg.1	Q9Y2J4	OTTHUMG00000159777	ENST00000422605.2:c.1503G>A	3.37:g.134080426C>T			A8K6F1|B7Z5Q1|E9PHW3|Q53EP1|Q96F99|Q9UKB4	Silent	SNP	pfam_Angiomotin_C,prints_Angiomotin	p.E501	ENST00000422605.2	37	c.1503		3																																																																																			AMOTL2	-	pfam_Angiomotin_C,prints_Angiomotin		0.652	AMOTL2-014	KNOWN	basic|appris_candidate_longest	protein_coding	AMOTL2	HGNC	protein_coding	OTTHUMT00000358149.1	C	NM_016201		134080426	-1	no_errors	ENST00000249883	ensembl	human	known	70_37	silent	SNP	1.000	T
ANGPTL5	253935	genome.wustl.edu	37	11	101771164	101771164	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr11:101771164G>A	ENST00000334289.3	-	7	1253	c.658C>T	c.(658-660)Cta>Tta	p.L220L		NM_178127.4	NP_835228.2	Q86XS5	ANGL5_HUMAN	angiopoietin-like 5	220	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.					extracellular region (GO:0005576)				breast(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|ovary(2)|skin(3)	29		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.043)		BRCA - Breast invasive adenocarcinoma(274;0.0328)		AATTAACCTAGAAGATCTCCA	0.338																																																	0													117.0	105.0	109.0					11																	101771164		2203	4299	6502	SO:0001819	synonymous_variant	253935			BC049170	CCDS8312.1	11q22.2	2013-02-06				ENSG00000187151		"""Fibrinogen C domain containing"""	19705	protein-coding gene	gene with protein product		607666				12624729	Standard	NM_178127		Approved		uc001pgl.3	Q86XS5		ENST00000334289.3:c.658C>T	11.37:g.101771164G>A			A8K658|Q86VR9	Silent	SNP	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.L220	ENST00000334289.3	37	c.658	CCDS8312.1	11																																																																																			ANGPTL5	-	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C		0.338	ANGPTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPTL5	HGNC	protein_coding	OTTHUMT00000394138.1	G	NM_178127		101771164	-1	no_errors	ENST00000334289	ensembl	human	known	70_37	silent	SNP	1.000	A
ANKHD1	54882	genome.wustl.edu	37	5	139889325	139889325	+	Missense_Mutation	SNP	C	C	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr5:139889325C>A	ENST00000360839.2	+	21	4023	c.3869C>A	c.(3868-3870)tCc>tAc	p.S1290Y	ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.S1290Y|ANKHD1_ENST00000297183.6_Missense_Mutation_p.S1290Y	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	1290						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTGTGCCTTCCTCAAGAGAT	0.428																																																	0													96.0	89.0	91.0					5																	139889325		2203	4300	6503	SO:0001583	missense	54882			AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.3869C>A	5.37:g.139889325C>A	ENSP00000354085:p.Ser1290Tyr		A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KH_dom_type_1,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_KH_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_KH_dom_type_1,prints_Ankyrin_rpt	p.S1290Y	ENST00000360839.2	37	c.3869	CCDS4225.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.5|28.5	4.921699|4.921699	0.92319|0.92319	.|.	.|.	ENSG00000131503|ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996	ENST00000246149|ENST00000360839;ENST00000422011;ENST00000297183;ENST00000253810;ENST00000310356;ENST00000235510;ENST00000421134;ENST00000412116;ENST00000532219	.|T;T;T;T;T	.|0.16073	.|2.37;2.37;2.37;2.37;2.37	5.49|5.49	5.49|5.49	0.81192|0.81192	.|Ankyrin repeat-containing domain (3);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.37183|0.37183	0.0994|0.0994	L|L	0.42008|0.42008	1.315|1.315	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.76494	.|0.999;0.998;0.997;0.998;0.995	.|D;D;D;D;D	.|0.80764	.|0.99;0.994;0.974;0.991;0.986	T|T	0.02691|0.02691	-1.1123|-1.1123	5|10	.|0.59425	.|D	.|0.04	.|.	19.7382|19.7382	0.96215|0.96215	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|501;1290;1309;1290;1290	.|E7ET58;Q8IWZ3-4;E9PDP5;Q8IWZ2;Q8IWZ3	.|.;.;.;.;ANKH1_HUMAN	T|Y	516|1290;1323;1290;1290;824;501;1309;443;1290	.|ENSP00000354085:S1290Y;ENSP00000297183:S1290Y;ENSP00000394489:S1309Y;ENSP00000405602:S443Y;ENSP00000432016:S1290Y	.|ENSP00000432016:S1290Y	P|S	+|+	1|2	0|0	ANKHD1|ANKHD1-EIF4EBP3;ANKHD1	139869509|139869509	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.818000|7.818000	0.86416|0.86416	2.741000|2.741000	0.93983|0.93983	0.585000|0.585000	0.79938|0.79938	CCT|TCC	ANKHD1	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom		0.428	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ANKHD1	HGNC	protein_coding	OTTHUMT00000251672.1	C	NM_017747		139889325	+1	no_errors	ENST00000297183	ensembl	human	known	70_37	missense	SNP	1.000	A
ANKIB1	54467	genome.wustl.edu	37	7	91936908	91936908	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr7:91936908G>A	ENST00000265742.3	+	3	800	c.424G>A	c.(424-426)Gat>Aat	p.D142N		NM_019004.1	NP_061877.1	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	142							zinc ion binding (GO:0008270)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(19)|skin(1)	41	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TGATGCTGTTGATAACAAAAA	0.368																																																	0													64.0	63.0	63.0					7																	91936908		1891	4115	6006	SO:0001583	missense	54467			AB037807	CCDS47639.1	7q21.3	2013-01-10			ENSG00000001629	ENSG00000001629		"""Ankyrin repeat domain containing"""	22215	protein-coding gene	gene with protein product							Standard	NM_019004		Approved	DKFZP434A0225, KIAA1386	uc003ulw.2	Q9P2G1	OTTHUMG00000155859	ENST00000265742.3:c.424G>A	7.37:g.91936908G>A	ENSP00000265742:p.Asp142Asn		Q6GMS4|Q6P3S9|Q9NTD7|Q9NW49	Missense_Mutation	SNP	pfam_Znf_C6HC,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Znf_RING,smart_Znf_C6HC,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Ubiquitin-int_motif,pfscan_Znf_RING	p.D142N	ENST00000265742.3	37	c.424	CCDS47639.1	7	.	.	.	.	.	.	.	.	.	.	G	34	5.311600	0.95655	.	.	ENSG00000001629	ENST00000265742	T	0.59502	0.26	5.71	5.71	0.89125	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.72630	0.3484	L	0.50993	1.605	0.58432	D	0.999999	D	0.76494	0.999	D	0.71656	0.974	T	0.72909	-0.4149	10	0.62326	D	0.03	.	19.8516	0.96743	0.0:0.0:1.0:0.0	.	142	Q9P2G1	AKIB1_HUMAN	N	142	ENSP00000265742:D142N	ENSP00000265742:D142N	D	+	1	0	ANKIB1	91774844	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.476000	0.97823	2.685000	0.91497	0.585000	0.79938	GAT	ANKIB1	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom		0.368	ANKIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKIB1	HGNC	protein_coding	OTTHUMT00000342018.1	G			91936908	+1	no_errors	ENST00000265742	ensembl	human	known	70_37	missense	SNP	1.000	A
ANO4	121601	genome.wustl.edu	37	12	101437344	101437344	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr12:101437344C>T	ENST00000392977.3	+	13	1392	c.1182C>T	c.(1180-1182)atC>atT	p.I394I	ANO4_ENST00000392979.3_Silent_p.I359I|ANO4_ENST00000299222.9_5'UTR			Q32M45	ANO4_HUMAN	anoctamin 4	394					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						CTACAGATATCATCATGTGTC	0.373										HNSCC(74;0.22)																																							0													166.0	156.0	160.0					12																	101437344		2203	4300	6503	SO:0001819	synonymous_variant	121601			AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.1182C>T	12.37:g.101437344C>T			Q8NAJ0|Q8NB39|Q8NB53	Silent	SNP	pfam_Anoctamin	p.I394	ENST00000392977.3	37	c.1182		12																																																																																			ANO4	-	pfam_Anoctamin		0.373	ANO4-002	KNOWN	basic	protein_coding	ANO4	HGNC	protein_coding	OTTHUMT00000409295.1	C	NM_178826		101437344	+1	no_errors	ENST00000392977	ensembl	human	known	70_37	silent	SNP	1.000	T
AP1G1	164	genome.wustl.edu	37	16	71798269	71798269	+	Nonsense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr16:71798269G>C	ENST00000299980.4	-	9	1343	c.902C>G	c.(901-903)tCa>tGa	p.S301*	AP1G1_ENST00000423132.2_Nonsense_Mutation_p.S304*|AP1G1_ENST00000569748.1_Nonsense_Mutation_p.S301*|AP1G1_ENST00000393512.3_Nonsense_Mutation_p.S304*|AP1G1_ENST00000433195.2_Nonsense_Mutation_p.S324*	NM_001128.5	NP_001119.3	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1 subunit	301					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|Golgi to lysosome transport (GO:0090160)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network membrane (GO:0032588)	GTP-dependent protein binding (GO:0030742)|kinesin binding (GO:0019894)|protein transporter activity (GO:0008565)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(8)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|urinary_tract(1)	28		Ovarian(137;0.125)				TCCACTCTCTGACTTAATATC	0.358																																																	0													87.0	80.0	82.0					16																	71798269		2198	4299	6497	SO:0001587	stop_gained	164			Y12226	CCDS32480.1, CCDS45522.1	16q23	2009-08-03				ENSG00000166747			555	protein-coding gene	gene with protein product	"""gamma1-adaptin"""	603533		CLAPG1, ADTG		9653655, 9733768	Standard	NM_001128		Approved		uc010cgg.3	O43747		ENST00000299980.4:c.902C>G	16.37:g.71798269G>C	ENSP00000299980:p.Ser301*		O75709|O75842|Q9UG09|Q9Y3U4	Nonsense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP1_complex_gsu,pfscan_Clathrin_g-adaptin_app	p.S324*	ENST00000299980.4	37	c.971	CCDS32480.1	16	.	.	.	.	.	.	.	.	.	.	G	46	12.748935	0.99693	.	.	ENSG00000166747	ENST00000299980;ENST00000393512;ENST00000423132;ENST00000433195;ENST00000538574;ENST00000425422	.	.	.	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-10.3742	19.3307	0.94285	0.0:0.0:1.0:0.0	.	.	.	.	X	301;304;304;324;172;386	.	ENSP00000299980:S301X	S	-	2	0	AP1G1	70355770	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.476000	0.97823	2.560000	0.86352	0.655000	0.94253	TCA	AP1G1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP1_complex_gsu		0.358	AP1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP1G1	HGNC	protein_coding	OTTHUMT00000434147.1	G			71798269	-1	no_errors	ENST00000433195	ensembl	human	known	70_37	nonsense	SNP	1.000	C
AP5M1	55745	genome.wustl.edu	37	14	57740978	57740978	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr14:57740978G>A	ENST00000261558.3	+	2	497	c.91G>A	c.(91-93)Gaa>Aaa	p.E31K	AP5M1_ENST00000431972.2_Missense_Mutation_p.E45K	NM_018229.3	NP_060699.3	Q9H0R1	AP5M1_HUMAN	adaptor-related protein complex 5, mu 1 subunit	31					endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|cytosol (GO:0005829)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)											TCCAACTGTTGAAAAACGAGC	0.348																																																	0													88.0	83.0	85.0					14																	57740978		2203	4300	6503	SO:0001583	missense	55745			AF094583	CCDS9729.1	14q22.2	2012-03-20	2012-03-20	2012-03-20	ENSG00000053770	ENSG00000053770			20192	protein-coding gene	gene with protein product	"""Mu-2 related death-inducing gene"""	614368	"""chromosome 14 open reading frame 108"", ""MU-2/AP1M2 domain containing, death-inducing"""	C14orf108, MUDENG		18395520	Standard	NM_018229		Approved	FLJ10813, MuD, mu5	uc001xcv.3	Q9H0R1	OTTHUMG00000140318	ENST00000261558.3:c.91G>A	14.37:g.57740978G>A	ENSP00000261558:p.Glu31Lys		O95354|Q6ZMD7|Q96DX3|Q9NVC5	Missense_Mutation	SNP	pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,pfscan_Clathrin_mu_C	p.E31K	ENST00000261558.3	37	c.91	CCDS9729.1	14	.	.	.	.	.	.	.	.	.	.	G	33	5.249936	0.95305	.	.	ENSG00000053770	ENST00000261558;ENST00000431972	T;T	0.58652	0.34;0.32	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.77896	0.4199	M	0.74258	2.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.78846	-0.2043	10	0.87932	D	0	.	20.14	0.98056	0.0:0.0:1.0:0.0	.	31;31	Q9H0R1;Q9H0R1-2	MUDEN_HUMAN;.	K	31;45	ENSP00000261558:E31K;ENSP00000390531:E45K	ENSP00000261558:E31K	E	+	1	0	MUDENG	56810731	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	9.378000	0.97191	2.837000	0.97791	0.591000	0.81541	GAA	AP5M1	-	NULL		0.348	AP5M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP5M1	HGNC	protein_coding	OTTHUMT00000276922.1	G	NM_018229		57740978	+1	no_errors	ENST00000261558	ensembl	human	known	70_37	missense	SNP	1.000	A
APC2	10297	genome.wustl.edu	37	19	1465202	1465202	+	Silent	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:1465202G>C	ENST00000535453.1	+	14	3615	c.1902G>C	c.(1900-1902)ctG>ctC	p.L634L	APC2_ENST00000233607.2_Silent_p.L634L|APC2_ENST00000238483.4_Silent_p.L360L|CTB-25B13.12_ENST00000588225.1_RNA|C19orf25_ENST00000588427.1_Intron			P02655	APOC2_HUMAN	adenomatosis polyposis coli 2	0					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|chylomicron remnant clearance (GO:0034382)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle clearance (GO:0034384)|lipid catabolic process (GO:0016042)|lipoprotein metabolic process (GO:0042157)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipid catabolic process (GO:0060697)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|very-low-density lipoprotein particle remodeling (GO:0034372)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|kidney(4)|large_intestine(2)|lung(5)|pancreas(1)|skin(2)	18		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCAGCATCTGACTTCGCACA	0.682																																																	0													18.0	15.0	16.0					19																	1465202		2187	4278	6465	SO:0001819	synonymous_variant	10297				CCDS12068.1	19p13.3	2013-02-14			ENSG00000115266	ENSG00000115266		"""Armadillo repeat containing"""	24036	protein-coding gene	gene with protein product	"""adenomatous polyposis coli like"""	612034				9823329, 10021369	Standard	XM_005259475		Approved	APCL	uc002lsr.1	O95996		ENST00000535453.1:c.1902G>C	19.37:g.1465202G>C			C0JYY4|Q9BS39|Q9UDE3|Q9UNK3	Silent	SNP	pfam_APC_basic_dom,pfam_APC_dom,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_SAMP,superfamily_ARM-type_fold,superfamily_Prefoldin,smart_Armadillo	p.L634	ENST00000535453.1	37	c.1902	CCDS12068.1	19																																																																																			APC2	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo		0.682	APC2-004	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	APC2	HGNC	protein_coding	OTTHUMT00000449539.2	G	NM_005883		1465202	+1	no_errors	ENST00000233607	ensembl	human	known	70_37	silent	SNP	0.997	C
ARFIP1	27236	genome.wustl.edu	37	4	153832973	153832973	+	3'UTR	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr4:153832973G>C	ENST00000451320.2	+	0	2888				ARFIP1_ENST00000353617.2_3'UTR			P53367	ARFP1_HUMAN	ADP-ribosylation factor interacting protein 1						intracellular protein transport (GO:0006886)|regulation of protein secretion (GO:0050708)	cytosol (GO:0005829)|Golgi membrane (GO:0000139)			ARFIP1/FHDC1(2)	cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	14	all_hematologic(180;0.093)					TCTTCCAGCAGAATTACTACT	0.323																																																	0																																										SO:0001624	3_prime_UTR_variant	27236			U52521	CCDS3780.1, CCDS34080.1	4q31.3	2008-08-01	2008-08-01			ENSG00000164144			21496	protein-coding gene	gene with protein product	"""arfaptin 1"""	605928				9038142, 10413101	Standard	NM_001025595		Approved	HSU52521	uc003imz.3	P53367		ENST00000451320.2:c.*1602G>C	4.37:g.153832973G>C			Q2M2X4|Q3SYL4|Q9Y2X6	RNA	SNP	-	NULL	ENST00000451320.2	37	NULL	CCDS34080.1	4																																																																																			ARFIP1	-	-		0.323	ARFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFIP1	HGNC	protein_coding	OTTHUMT00000365032.1	G	NM_014447		153832973	+1	no_errors	ENST00000510497	ensembl	human	known	70_37	rna	SNP	1.000	C
ARHGEF10	9639	genome.wustl.edu	37	8	1774297	1774297	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr8:1774297C>T	ENST00000398564.1	+	1	21	c.21C>T	c.(19-21)ctC>ctT	p.L7L	ARHGEF10_ENST00000520359.1_Intron|ARHGEF10_ENST00000398560.1_Silent_p.L7L|ARHGEF10_ENST00000262112.6_Silent_p.L7L|ARHGEF10_ENST00000518288.1_Silent_p.L7L|ARHGEF10_ENST00000349830.3_Intron			O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10	7					centrosome duplication (GO:0051298)|myelination in peripheral nervous system (GO:0022011)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cytosol (GO:0005829)	kinesin binding (GO:0019894)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(3)|large_intestine(11)|lung(11)|prostate(3)|skin(3)|stomach(3)|urinary_tract(1)	35		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		CAGGATTTCTCAGCAGTAAGA	0.383																																																	0													26.0	26.0	26.0					8																	1774297		870	1979	2849	SO:0001819	synonymous_variant	9639			AF009205	CCDS34794.1	8p23	2014-09-17			ENSG00000104728	ENSG00000104728		"""Rho guanine nucleotide exchange factors"""	14103	protein-coding gene	gene with protein product		608136				9205841, 16896804	Standard	XM_005266039		Approved	KIAA0294, Gef10	uc003wpr.3	O15013	OTTHUMG00000163626	ENST00000398564.1:c.21C>T	8.37:g.1774297C>T			O14665|Q2KHR8|Q68D55|Q8IWD9|Q8IY77	Silent	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_WD40_repeat_dom,smart_DH-domain,pfscan_DH-domain	p.L7	ENST00000398564.1	37	c.21		8																																																																																			ARHGEF10	-	NULL		0.383	ARHGEF10-203	KNOWN	basic	protein_coding	ARHGEF10	HGNC	protein_coding		C			1774297	+1	no_errors	ENST00000398564	ensembl	human	known	70_37	silent	SNP	0.000	T
ARHGEF12	23365	genome.wustl.edu	37	11	120291541	120291541	+	Silent	SNP	C	C	T	rs370997007		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr11:120291541C>T	ENST00000397843.2	+	5	445	c.279C>T	c.(277-279)ttC>ttT	p.F93F	ARHGEF12_ENST00000532993.1_5'UTR|ARHGEF12_ENST00000356641.3_Silent_p.F74F	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	93	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		ATCCAGTCTTCGTACAGTCTG	0.398			T	MLL	AML																																			Dom	yes		11	11q23.3	23365	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)		L	0								C	,	0,3916		0,0,1958	95.0	88.0	90.0		222,279	4.8	1.0	11		90	3,8311		0,3,4154	no	coding-synonymous,coding-synonymous	ARHGEF12	NM_001198665.1,NM_015313.2	,	0,3,6112	TT,TC,CC		0.0361,0.0,0.0245	,	74/1526,93/1545	120291541	3,12227	1958	4157	6115	SO:0001819	synonymous_variant	23365			AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.279C>T	11.37:g.120291541C>T			O15086|Q6P526	Silent	SNP	pfam_Regulat_G_prot_signal-like,pfam_DH-domain,pfam_PDZ,superfamily_Regulat_G_prot_signal_superfam,superfamily_DH-domain,superfamily_PDZ,smart_PDZ,smart_DH-domain,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.F74	ENST00000397843.2	37	c.222	CCDS41727.1	11																																																																																			ARHGEF12	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ		0.398	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ARHGEF12	HGNC	protein_coding	OTTHUMT00000388052.1	C	NM_015313		120291541	+1	no_errors	ENST00000356641	ensembl	human	known	70_37	silent	SNP	1.000	T
ARHGEF18	23370	genome.wustl.edu	37	19	7528832	7528832	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:7528832C>T	ENST00000359920.6	+	12	2453	c.2200C>T	c.(2200-2202)Ccc>Tcc	p.P734S	ARHGEF18_ENST00000319670.9_Missense_Mutation_p.P576S|CTD-2207O23.3_ENST00000593531.1_Silent_p.A691A	NM_001130955.1	NP_001124427.1	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 18	734					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transforming growth factor beta receptor signaling pathway (GO:0007179)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	23		Renal(5;0.0902)				CACAAACAGCCCCACCAAGAG	0.627																																																	0													22.0	24.0	23.0					19																	7528832		2191	4290	6481	SO:0001583	missense	23370			AK074372	CCDS12177.1, CCDS45946.1	19p13.3	2013-01-10	2009-06-12			ENSG00000104880		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	17090	protein-coding gene	gene with protein product	"""Rho-specific guanine nucleotide exchange factor p114"""		"""rho/rac guanine nucleotide exchange factor (GEF) 18"""			9628581, 11318610	Standard	NM_015318		Approved	P114-RhoGEF, KIAA0521, MGC15913	uc002mgi.3	Q6ZSZ5		ENST00000359920.6:c.2200C>T	19.37:g.7528832C>T	ENSP00000352995:p.Pro734Ser		A8MV62|B5ME81|O60274|Q6DD92	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.P734S	ENST00000359920.6	37	c.2200	CCDS45946.1	19	.	.	.	.	.	.	.	.	.	.	C	2.919	-0.223647	0.06061	.	.	ENSG00000104880	ENST00000319670;ENST00000359920	T;T	0.24723	1.84;1.84	4.75	3.6	0.41247	.	1.093510	0.07033	N	0.828735	T	0.18964	0.0455	L	0.38175	1.15	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.001	T	0.30416	-0.9979	10	0.07175	T	0.84	-12.6433	8.9766	0.35939	0.2778:0.7222:0.0:0.0	.	576;734	Q6ZSZ5-2;Q6ZSZ5	.;ARHGI_HUMAN	S	576;734	ENSP00000319200:P576S;ENSP00000352995:P734S	ENSP00000319200:P576S	P	+	1	0	ARHGEF18	7434832	0.000000	0.05858	0.860000	0.33809	0.305000	0.27757	-0.650000	0.05378	2.369000	0.80426	0.555000	0.69702	CCC	ARHGEF18	-	NULL		0.627	ARHGEF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGEF18	HGNC	protein_coding	OTTHUMT00000436340.1	C	NM_015318		7528832	+1	no_errors	ENST00000359920	ensembl	human	known	70_37	missense	SNP	0.014	T
ARHGEF2	9181	genome.wustl.edu	37	1	155932757	155932757	+	Silent	SNP	G	G	A	rs368444093		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:155932757G>A	ENST00000361247.4	-	8	1041	c.942C>T	c.(940-942)gtC>gtT	p.V314V	ARHGEF2_ENST00000368315.4_Silent_p.V315V|ARHGEF2_ENST00000462460.2_Silent_p.V359V|ARHGEF2_ENST00000313695.7_Silent_p.V286V|ARHGEF2_ENST00000313667.4_Silent_p.V313V|ARHGEF2_ENST00000477754.2_Intron|ARHGEF2_ENST00000368316.1_Silent_p.V286V	NM_001162383.1|NM_001162384.1	NP_001155855.1|NP_001155856.1	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 2	314	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin filament organization (GO:0007015)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular hyperosmotic response (GO:0071474)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to tumor necrosis factor (GO:0071356)|establishment of mitotic spindle orientation (GO:0000132)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of necroptotic process (GO:0060546)|negative regulation of neurogenesis (GO:0050768)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)|regulation of Rho protein signal transduction (GO:0035023)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|Rac GTPase binding (GO:0048365)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(4)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|skin(2)	40	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					AGCGATGGATGACAAAGTTCC	0.582																																					Melanoma(178;35 2768 6610 28839)												0								G	,,	0,4406		0,0,2203	64.0	63.0	63.0		942,939,858	4.9	1.0	1		63	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	ARHGEF2	NM_001162383.1,NM_001162384.1,NM_004723.3	,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	314/987,313/986,286/959	155932757	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9181			AB014551	CCDS1125.1, CCDS53375.1, CCDS53376.1	1q21-q22	2013-01-10	2009-06-12		ENSG00000116584	ENSG00000116584		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	682	protein-coding gene	gene with protein product		607560	"""rho/rac guanine nucleotide exchange factor (GEF) 2"""			9857026, 9734811	Standard	NM_004723		Approved	LFP40, GEF-H1, KIAA0651, P40	uc001fmt.2	Q92974	OTTHUMG00000017464	ENST00000361247.4:c.942C>T	1.37:g.155932757G>A			D3DVA6|O75142|Q15079|Q5VY92|Q8TDA3|Q8WUG4|Q9H023	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.V315	ENST00000361247.4	37	c.945	CCDS53376.1	1																																																																																			ARHGEF2	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain		0.582	ARHGEF2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	ARHGEF2	HGNC	protein_coding	OTTHUMT00000046204.2	G	NM_004723		155932757	-1	no_errors	ENST00000368315	ensembl	human	known	70_37	silent	SNP	1.000	A
ARHGEF5	7984	genome.wustl.edu	37	7	144060152	144060152	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr7:144060152G>C	ENST00000056217.5	+	2	564	c.390G>C	c.(388-390)caG>caC	p.Q130H		NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	130					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					GCCCCATTCAGAGTGAGCATC	0.562																																																	0													4.0	5.0	5.0					7																	144060152		1002	2210	3212	SO:0001583	missense	7984			U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.390G>C	7.37:g.144060152G>C	ENSP00000056217:p.Gln130His		A6NNJ2|Q6ZML7	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.Q130H	ENST00000056217.5	37	c.390	CCDS34771.1	7	.	.	.	.	.	.	.	.	.	.	G	13.04	2.118618	0.37436	.	.	ENSG00000050327	ENST00000056217	T	0.75589	-0.95	3.99	2.12	0.27331	.	0.312090	0.17786	U	0.162049	T	0.66307	0.2776	L	0.52573	1.65	0.09310	N	0.999999	P	0.44578	0.838	B	0.43990	0.438	T	0.56432	-0.7980	9	.	.	.	.	4.7528	0.13068	0.114:0.0:0.6748:0.2112	.	130	Q12774	ARHG5_HUMAN	H	130	ENSP00000056217:Q130H	.	Q	+	3	2	ARHGEF5	143691085	0.002000	0.14202	0.001000	0.08648	0.002000	0.02628	0.187000	0.16998	0.337000	0.23665	-0.157000	0.13467	CAG	ARHGEF5	-	NULL		0.562	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF5	HGNC	protein_coding	OTTHUMT00000349981.1	G	NM_005435		144060152	+1	no_errors	ENST00000056217	ensembl	human	known	70_37	missense	SNP	0.002	C
ARHGEF9	23229	genome.wustl.edu	37	X	63005020	63005020	+	De_novo_Start_OutOfFrame	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chrX:63005020C>T	ENST00000374878.1	-	0	393				ARHGEF9_ENST00000437457.2_Silent_p.Q2Q|MIR1468_ENST00000410600.1_RNA			O43307	ARHG9_HUMAN	Cdc42 guanine nucleotide exchange factor (GEF) 9						apoptotic signaling pathway (GO:0097190)|ion transmembrane transport (GO:0034220)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|skin(1)	35						CCCTTATCCACTGCATGGTGC	0.622																																																	0																																												23229			AB007884	CCDS35315.1, CCDS55429.1, CCDS55430.1	Xq11.1	2013-01-10			ENSG00000131089	ENSG00000131089		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14561	protein-coding gene	gene with protein product	"""collybistin"""	300429				10559246, 9455477	Standard	NM_015185		Approved	KIAA0424, PEM-2	uc011mot.2	O43307	OTTHUMG00000021700	ENST00000374878.1:c.-22G>A	X.37:g.63005020C>T			A8K1S8|B4DHC7|F8W7P8|Q5JSL6	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.Q2	ENST00000374878.1	37	c.6		X																																																																																			ARHGEF9	-	NULL		0.622	ARHGEF9-002	KNOWN	basic	protein_coding	ARHGEF9	HGNC	protein_coding	OTTHUMT00000056938.1	C			63005020	-1	no_errors	ENST00000437457	ensembl	human	known	70_37	silent	SNP	1.000	T
ARMCX4	100131755	genome.wustl.edu	37	X	100749262	100749262	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chrX:100749262G>A	ENST00000423738.3	+	2	5888	c.5686G>A	c.(5686-5688)Gag>Aag	p.E1896K		NM_001256155.1	NP_001243084.1	Q5H9R4	ARMX4_HUMAN	armadillo repeat containing, X-linked 4	176						integral component of membrane (GO:0016021)				lung(1)	1						CCCTGATATTGAGGAGATCAG	0.498																																																	0																																										SO:0001583	missense	100131755			AK096955	CCDS59170.1	Xq22	2014-03-21	2009-11-26		ENSG00000196440	ENSG00000196440		"""Armadillo repeat containing"""	28615	protein-coding gene	gene with protein product			"""chromosome X open reading frame 35"", ""armadillo repeat containing, X-linked 4 pseudogene"""	CXorf35		16221301, 22569362	Standard	NR_028407		Approved	MGC40053, GASP4	uc031tkc.1	Q5H9R4	OTTHUMG00000022030	ENST00000423738.3:c.5686G>A	X.37:g.100749262G>A	ENSP00000404304:p.Glu1896Lys		A8K928|B3KXA4|Q5H9K8|Q8N8D6	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold,pfscan_Armadillo	p.E1896K	ENST00000423738.3	37	c.5686	CCDS59170.1	X	.	.	.	.	.	.	.	.	.	.	.	6.277	0.419256	0.11870	.	.	ENSG00000196440	ENST00000423738	.	.	.	3.72	3.72	0.42706	.	.	.	.	.	T	0.37785	0.1016	.	.	.	0.23754	N	0.996937	.	.	.	.	.	.	T	0.18147	-1.0346	4	.	.	.	.	10.033	0.42111	0.0:0.0:1.0:0.0	.	.	.	.	K	2000	.	.	E	+	1	0	ARMCX4	100635918	1.000000	0.71417	1.000000	0.80357	0.347000	0.29111	3.928000	0.56506	2.120000	0.65058	0.344000	0.21773	GAG	ARMCX4	-	NULL		0.498	ARMCX4-010	PUTATIVE	upstream_ATG|upstream_uORF|basic|appris_principal|CCDS	protein_coding	ARMCX4	HGNC	protein_coding	OTTHUMT00000370455.2	G	NM_001256155		100749262	+1	no_errors	ENST00000423738	ensembl	human	putative	70_37	missense	SNP	1.000	A
ARRDC5	645432	genome.wustl.edu	37	19	4891274	4891274	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:4891274G>A	ENST00000381781.2	-	3	812	c.813C>T	c.(811-813)ttC>ttT	p.F271F	AC027319.1_ENST00000408608.1_RNA	NM_001080523.1	NP_001073992.1	A6NEK1	ARRD5_HUMAN	arrestin domain containing 5	271										endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0257)		ACGGCAGGTTGAAGGTGCTGA	0.642																																																	0													92.0	104.0	100.0					19																	4891274		2092	4210	6302	SO:0001819	synonymous_variant	645432				CCDS45929.1	19p13.3	2007-10-05				ENSG00000205784			31407	protein-coding gene	gene with protein product						12886014	Standard	NM_001080523		Approved		uc002mbm.3	A6NEK1		ENST00000381781.2:c.813C>T	19.37:g.4891274G>A				Silent	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set	p.F271	ENST00000381781.2	37	c.813	CCDS45929.1	19																																																																																			ARRDC5	-	pfam_Arrestin_C-like,superfamily_Ig_E-set		0.642	ARRDC5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ARRDC5	HGNC	protein_coding	OTTHUMT00000450443.1	G	XM_292803		4891274	-1	no_errors	ENST00000381781	ensembl	human	known	70_37	silent	SNP	0.811	A
ASB15	142685	genome.wustl.edu	37	7	123256536	123256536	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr7:123256536G>A	ENST00000451558.1	+	8	800	c.279G>A	c.(277-279)gaG>gaA	p.E93E	RP11-390E23.3_ENST00000440504.1_RNA|ASB15_ENST00000540573.1_Silent_p.E93E|ASB15_ENST00000451215.1_Silent_p.E93E|RP11-390E23.3_ENST00000418409.1_RNA|ASB15_ENST00000275699.3_Silent_p.E93E|RP11-390E23.3_ENST00000422401.1_RNA|ASB15_ENST00000434204.1_Silent_p.E93E			Q8WXK1	ASB15_HUMAN	ankyrin repeat and SOCS box containing 15	93					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|kidney(1)|large_intestine(1)|lung(6)|skin(3)	12						AAATACTTGAGATTGTTCTGG	0.343																																																	0													69.0	64.0	65.0					7																	123256536		2203	4300	6503	SO:0001819	synonymous_variant	142685			AF403033	CCDS34742.1	7q31.31	2013-01-10	2011-01-25		ENSG00000146809	ENSG00000146809		"""Ankyrin repeat domain containing"""	19767	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 15"""			12076535	Standard	XM_005250149		Approved	FLJ43370	uc003vkw.1	Q8WXK1	OTTHUMG00000157114	ENST00000451558.1:c.279G>A	7.37:g.123256536G>A			Q3ZCP3|Q3ZCP5|Q68D37	Silent	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C,prints_Ankyrin_rpt	p.E93	ENST00000451558.1	37	c.279	CCDS34742.1	7																																																																																			ASB15	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom		0.343	ASB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB15	HGNC	protein_coding	OTTHUMT00000347493.1	G			123256536	+1	no_errors	ENST00000275699	ensembl	human	known	70_37	silent	SNP	0.990	A
GPR75-ASB3	100302652	genome.wustl.edu	37	2	53897777	53897777	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:53897777G>C	ENST00000263634.3	-	10	1554	c.1420C>G	c.(1420-1422)Cta>Gta	p.L474V	GPR75-ASB3_ENST00000406687.1_Missense_Mutation_p.L401V|GPR75-ASB3_ENST00000352846.3_Missense_Mutation_p.L512V|GPR75-ASB3_ENST00000482829.1_5'UTR|ASB3_ENST00000406625.2_Missense_Mutation_p.L509V|GPR75-ASB3_ENST00000394717.2_Missense_Mutation_p.L401V	NM_016115.4	NP_057199.1			GPR75-ASB3 readthrough									p.L474L(1)									TCTGATTTTAGACTGGACCGA	0.403																																																	1	Substitution - coding silent(1)	lung(1)											74.0	71.0	72.0					2																	53897777		2203	4300	6503	SO:0001583	missense	51130				CCDS54361.1	2p16	2013-01-23			ENSG00000115239	ENSG00000115239			40043	other	readthrough							Standard	NM_001164165		Approved				OTTHUMG00000129279	ENST00000263634.3:c.1420C>G	2.37:g.53897777G>C	ENSP00000263634:p.Leu474Val			Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C,prints_Ankyrin_rpt	p.L512V	ENST00000263634.3	37	c.1534	CCDS1846.1	2	.	.	.	.	.	.	.	.	.	.	G	12.49	1.953457	0.34471	.	.	ENSG00000115239	ENST00000263634;ENST00000406625;ENST00000406687;ENST00000394717;ENST00000352846;ENST00000446049	T;T;T;T;T	0.55760	0.5;0.5;0.5;0.5;0.5	5.54	4.66	0.58398	SOCS protein, C-terminal (3);	0.085575	0.48286	D	0.000194	T	0.42720	0.1215	L	0.41906	1.305	0.32173	N	0.581407	B;B	0.20887	0.049;0.049	B;B	0.25405	0.06;0.06	T	0.51387	-0.8712	9	0.29301	T	0.29	-3.5745	10.1042	0.42524	0.0925:0.0:0.9075:0.0	.	509;474	Q2TAI4;Q9Y575	.;ASB3_HUMAN	V	474;509;401;401;512;393	ENSP00000263634:L474V;ENSP00000385085:L509V;ENSP00000384728:L401V;ENSP00000378206:L401V;ENSP00000313756:L512V	ENSP00000263634:L474V	L	-	1	2	ASB3	53751281	0.964000	0.33143	0.997000	0.53966	0.970000	0.65996	1.467000	0.35321	1.319000	0.45190	0.563000	0.77884	CTA	ASB3	-	pfam_SOCS_C,smart_SOCS_C,pfscan_SOCS_C		0.403	GPR75-ASB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB3	HGNC	protein_coding	OTTHUMT00000251402.3	G			53897777	-1	no_errors	ENST00000352846	ensembl	human	known	70_37	missense	SNP	1.000	C
ASPHD1	253982	genome.wustl.edu	37	16	29912347	29912347	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr16:29912347G>C	ENST00000308748.5	+	1	307	c.55G>C	c.(55-57)Gag>Cag	p.E19Q	SEZ6L2_ENST00000350527.3_5'Flank|SEZ6L2_ENST00000308713.5_5'Flank|SEZ6L2_ENST00000537485.1_5'Flank|SEZ6L2_ENST00000346932.5_5'Flank|ASPHD1_ENST00000483405.1_Intron	NM_181718.3	NP_859069.2	Q5U4P2	ASPH1_HUMAN	aspartate beta-hydroxylase domain containing 1	19					peptidyl-amino acid modification (GO:0018193)	integral component of membrane (GO:0016021)	dioxygenase activity (GO:0051213)			endometrium(4)|large_intestine(2)|lung(1)|prostate(1)	8						GAAGGAGAGAGAGACAGCCCA	0.622																																																	0													75.0	72.0	73.0					16																	29912347		2182	4285	6467	SO:0001583	missense	253982			AF070642	CCDS10660.1	16p11.2	2008-02-05			ENSG00000174939	ENSG00000174939			27380	protein-coding gene	gene with protein product							Standard	NM_181718		Approved		uc002dut.3	Q5U4P2	OTTHUMG00000132121	ENST00000308748.5:c.55G>C	16.37:g.29912347G>C	ENSP00000311447:p.Glu19Gln		A0AVE3|B7ZLZ3|Q8IW63|Q8N316|Q96H00	Missense_Mutation	SNP	pfam_Asp_Arg_b-Hydrxlase	p.E19Q	ENST00000308748.5	37	c.55	CCDS10660.1	16	.	.	.	.	.	.	.	.	.	.	G	9.864	1.197140	0.22037	.	.	ENSG00000174939	ENST00000414952;ENST00000308748	T;T	0.50813	0.73;0.73	1.34	1.34	0.21922	.	1.710450	0.03913	N	0.282270	T	0.31857	0.0810	N	0.14661	0.345	0.09310	N	1	B	0.18741	0.03	B	0.06405	0.002	T	0.32508	-0.9904	10	0.87932	D	0	.	6.1093	0.20092	0.0:0.0:1.0:0.0	.	19	Q5U4P2	ASPH1_HUMAN	Q	19	ENSP00000388036:E19Q;ENSP00000311447:E19Q	ENSP00000311447:E19Q	E	+	1	0	ASPHD1	29819848	0.030000	0.19436	0.010000	0.14722	0.028000	0.11728	0.419000	0.21247	1.091000	0.41335	0.407000	0.27541	GAG	ASPHD1	-	NULL		0.622	ASPHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPHD1	HGNC	protein_coding	OTTHUMT00000255163.2	G	NM_181718		29912347	+1	no_errors	ENST00000308748	ensembl	human	known	70_37	missense	SNP	0.010	C
ASPM	259266	genome.wustl.edu	37	1	197112471	197112471	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:197112471G>A	ENST00000367409.4	-	3	1167	c.911C>T	c.(910-912)tCa>tTa	p.S304L	ASPM_ENST00000294732.7_Missense_Mutation_p.S304L	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	304					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						GTTCAAAGTTGAAGAACAGTT	0.318																																																	0													73.0	74.0	73.0					1																	197112471		2203	4300	6503	SO:0001583	missense	259266			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.911C>T	1.37:g.197112471G>A	ENSP00000356379:p.Ser304Leu		Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_CH-domain,superfamily_ARM-type_fold,smart_CH-domain,smart_IQ_motif_EF-hand-BS,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS	p.S304L	ENST00000367409.4	37	c.911	CCDS1389.1	1	.	.	.	.	.	.	.	.	.	.	G	12.32	1.901598	0.33535	.	.	ENSG00000066279	ENST00000367409;ENST00000294732	T;T	0.59502	0.26;1.53	5.3	5.3	0.74995	.	0.000000	0.45606	D	0.000359	T	0.51584	0.1683	L	0.56769	1.78	0.34275	D	0.681499	B;B	0.31611	0.331;0.294	B;B	0.25884	0.064;0.038	T	0.63395	-0.6647	10	0.37606	T	0.19	.	13.6317	0.62200	0.0745:0.0:0.9255:0.0	.	304;304	Q4G1H1;Q8IZT6	.;ASPM_HUMAN	L	304	ENSP00000356379:S304L;ENSP00000294732:S304L	ENSP00000294732:S304L	S	-	2	0	ASPM	195379094	0.984000	0.35163	1.000000	0.80357	0.321000	0.28281	2.116000	0.41930	2.636000	0.89361	0.637000	0.83480	TCA	ASPM	-	NULL		0.318	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPM	HGNC	protein_coding	OTTHUMT00000088256.1	G	NM_018136		197112471	-1	no_errors	ENST00000367409	ensembl	human	known	70_37	missense	SNP	0.994	A
ATP8B4	79895	genome.wustl.edu	37	15	50152539	50152539	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr15:50152539G>C	ENST00000284509.6	-	28	3572	c.3431C>G	c.(3430-3432)tCt>tGt	p.S1144C	ATP8B4_ENST00000559829.1_Missense_Mutation_p.S1144C	NM_024837.2	NP_079113.2	Q8TF62	AT8B4_HUMAN	ATPase, class I, type 8B, member 4	1144						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(6)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|urinary_tract(1)	73		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		ATTTTTTCCAGATGTGATAAG	0.458																																																	0													143.0	133.0	136.0					15																	50152539		2196	4295	6491	SO:0001583	missense	79895			AB075819	CCDS32238.1	15q21.2	2010-04-20	2007-09-19		ENSG00000104043	ENSG00000104043		"""ATPases / P-type"""	13536	protein-coding gene	gene with protein product		609123	"""ATPase, Class I, type 8B, member 4"""			11015572	Standard	NM_024837		Approved	ATPIM, KIAA1939	uc001zxu.3	Q8TF62		ENST00000284509.6:c.3431C>G	15.37:g.50152539G>C	ENSP00000284509:p.Ser1144Cys		Q9H727	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.S1144C	ENST00000284509.6	37	c.3431	CCDS32238.1	15	.	.	.	.	.	.	.	.	.	.	G	20.7	4.038191	0.75617	.	.	ENSG00000104043	ENST00000284509	T	0.41758	0.99	5.48	4.55	0.56014	.	0.000000	0.85682	D	0.000000	T	0.69196	0.3084	M	0.88704	2.975	0.44677	D	0.997665	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.76277	-0.3018	10	0.87932	D	0	.	14.0001	0.64429	0.0:0.1529:0.8471:0.0	.	222;1144	Q6PG43;Q8TF62	.;AT8B4_HUMAN	C	1144	ENSP00000284509:S1144C	ENSP00000284509:S1144C	S	-	2	0	ATP8B4	47939831	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.865000	0.92300	1.291000	0.44653	0.455000	0.32223	TCT	ATP8B4	-	NULL		0.458	ATP8B4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8B4	HGNC	protein_coding	OTTHUMT00000418100.1	G	NM_024837		50152539	-1	no_errors	ENST00000284509	ensembl	human	known	70_37	missense	SNP	1.000	C
ATXN2	6311	genome.wustl.edu	37	12	111892862	111892862	+	Intron	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr12:111892862G>A	ENST00000377617.3	-	23	3906				ATXN2_ENST00000389153.4_Intron|ATXN2_ENST00000550104.1_Intron|ATXN2_ENST00000535949.1_Intron|ATXN2_ENST00000542287.2_Missense_Mutation_p.S1004L|ATXN2_ENST00000608853.1_Intron	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2						cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						GTAGCCTTCTGAGAGATAGAT	0.498																																																	0																																										SO:0001627	intron_variant	6311			U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.3744+970C>T	12.37:g.111892862G>A			A6NLD4|Q6ZQZ7|Q99493	Missense_Mutation	SNP	pfam_LsmAD_domain,pfam_Ataxin-2_C,superfamily_LSM_dom	p.S1004L	ENST00000377617.3	37	c.3011	CCDS31902.1	12	.	.	.	.	.	.	.	.	.	.	G	14.09	2.432029	0.43122	.	.	ENSG00000204842	ENST00000542287	.	.	.	2.71	1.78	0.24846	.	.	.	.	.	T	0.28928	0.0718	.	.	.	0.09310	N	1	B	0.18166	0.026	B	0.12837	0.008	T	0.20907	-1.0261	7	0.48119	T	0.1	.	7.4126	0.27025	0.0:0.2714:0.7286:0.0	.	1004	F8VQP2	.	L	1004	.	ENSP00000445583:S1004L	S	-	2	0	ATXN2	110377245	0.001000	0.12720	0.016000	0.15963	0.818000	0.46254	-0.032000	0.12266	0.693000	0.31634	0.305000	0.20034	TCA	ATXN2	-	NULL		0.498	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN2	HGNC	protein_coding	OTTHUMT00000257351.3	G	NM_002973		111892862	-1	no_errors	ENST00000542287	ensembl	human	putative	70_37	missense	SNP	0.008	A
BAZ1B	9031	genome.wustl.edu	37	7	72922761	72922761	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr7:72922761G>A	ENST00000339594.4	-	3	603	c.265C>T	c.(265-267)Ctg>Ttg	p.L89L	RNU6-1198P_ENST00000516904.1_RNA|BAZ1B_ENST00000404251.1_Silent_p.L89L	NM_032408.3	NP_115784.1	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	89	Mediates the tyrosine-protein kinase activity.|WAC. {ECO:0000255|PROSITE- ProRule:PRU00475}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin assembly or disassembly (GO:0006333)|chromatin-mediated maintenance of transcription (GO:0048096)|double-strand break repair (GO:0006302)|heart morphogenesis (GO:0003007)|histone phosphorylation (GO:0016572)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone kinase activity (GO:0035173)|lysine-acetylated histone binding (GO:0070577)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|vitamin D receptor activator activity (GO:0071884)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(5)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Lung NSC(55;0.0659)|all_lung(88;0.152)				ACCATTTCCAGAACAAGCTTC	0.393																																					Esophageal Squamous(112;1167 1561 21085 43672 48228)												0													157.0	137.0	143.0					7																	72922761		2203	4300	6503	SO:0001819	synonymous_variant	9031			AF084479	CCDS5549.1	7q11.23	2013-01-28			ENSG00000009954	ENSG00000009954		"""Zinc fingers, PHD-type"""	961	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 9"", ""Williams-Beuren syndrome chromosome region 10"", ""transcription factor WSTF"""	605681		WBSCR9, WBSCR10		9858827, 9828126	Standard	NM_032408		Approved	WSTF	uc003tyc.3	Q9UIG0	OTTHUMG00000023847	ENST00000339594.4:c.265C>T	7.37:g.72922761G>A			B9EGK3|D3DXE9|O95039|O95247|O95277|Q6P1K4|Q86UJ6	Silent	SNP	pfam_WSTF_Acf1_Cbp146,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,superfamily_ARM-type_fold,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_WSTF_Acf1_Cbp146,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.L89	ENST00000339594.4	37	c.265	CCDS5549.1	7																																																																																			BAZ1B	-	pfam_WSTF_Acf1_Cbp146,pfscan_WSTF_Acf1_Cbp146		0.393	BAZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ1B	HGNC	protein_coding	OTTHUMT00000252123.4	G	NM_032408		72922761	-1	no_errors	ENST00000339594	ensembl	human	known	70_37	silent	SNP	0.996	A
BCL2L13	23786	genome.wustl.edu	37	22	18138488	18138488	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr22:18138488C>G	ENST00000317582.5	+	2	358	c.11C>G	c.(10-12)tCt>tGt	p.S4C	BCL2L13_ENST00000543133.1_5'UTR|BCL2L13_ENST00000399782.1_Missense_Mutation_p.S4C|BCL2L13_ENST00000493680.1_Missense_Mutation_p.S4C|BCL2L13_ENST00000538149.1_5'UTR|BCL2L13_ENST00000355028.3_Missense_Mutation_p.S4C|BCL2L13_ENST00000418951.2_Missense_Mutation_p.S4C|BCL2L13_ENST00000337612.5_5'UTR	NM_015367.3	NP_056182.2	Q9BXK5	B2L13_HUMAN	BCL2-like 13 (apoptosis facilitator)	4					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			breast(2)|central_nervous_system(1)|large_intestine(2)|liver(2)|lung(2)|ovary(1)|skin(3)|urinary_tract(2)	15		all_epithelial(15;0.123)		Lung(27;0.199)		ATGGCGTCCTCTTCTACTGTG	0.393																																																	0													132.0	121.0	125.0					22																	18138488		2203	4300	6503	SO:0001583	missense	23786			AF146568	CCDS13746.1, CCDS59447.1, CCDS59448.1, CCDS74810.1, CCDS74811.1, CCDS74812.1, CCDS74813.1, CCDS74814.1	22q11	2014-03-07			ENSG00000099968	ENSG00000099968			17164	protein-coding gene	gene with protein product						11262395, 11381032	Standard	NM_015367		Approved	MIL1, BCL-RAMBO	uc002zmw.4	Q9BXK5	OTTHUMG00000150088	ENST00000317582.5:c.11C>G	22.37:g.18138488C>G	ENSP00000318883:p.Ser4Cys		B3KPE7|Q96B37|Q96IB7|Q9BY01|Q9HC05|Q9UFE0|Q9UKN3	Missense_Mutation	SNP	pfam_Blc2_fam,pfscan_Bcl2-like	p.S4C	ENST00000317582.5	37	c.11	CCDS13746.1	22	.	.	.	.	.	.	.	.	.	.	C	20.5	3.995778	0.74703	.	.	ENSG00000099968	ENST00000399782;ENST00000317582;ENST00000493680;ENST00000355028;ENST00000418951	T;T;T;T;T	0.32753	1.69;1.82;1.69;1.44;1.47	5.68	5.68	0.88126	.	0.114953	0.64402	D	0.000011	T	0.44393	0.1291	L	0.29908	0.895	0.80722	D	1	D;D;D	0.89917	1.0;0.984;0.997	D;P;D	0.69479	0.964;0.769;0.912	T	0.37619	-0.9698	10	0.87932	D	0	-10.7545	16.7006	0.85349	0.0:1.0:0.0:0.0	.	4;4;4	E9PDD6;Q9BXK5;Q9BXK5-2	.;B2L13_HUMAN;.	C	4	ENSP00000382682:S4C;ENSP00000318883:S4C;ENSP00000434764:S4C;ENSP00000347133:S4C;ENSP00000410019:S4C	ENSP00000318883:S4C	S	+	2	0	BCL2L13	16518488	1.000000	0.71417	0.977000	0.42913	0.971000	0.66376	3.245000	0.51407	2.664000	0.90586	0.591000	0.81541	TCT	BCL2L13	-	NULL		0.393	BCL2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL2L13	HGNC	protein_coding	OTTHUMT00000316184.1	C	NM_015367		18138488	+1	no_errors	ENST00000317582	ensembl	human	known	70_37	missense	SNP	0.995	G
BCO1	53630	genome.wustl.edu	37	16	81295871	81295871	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr16:81295871C>T	ENST00000258168.2	+	4	915	c.454C>T	c.(454-456)Ctg>Ttg	p.L152L	BCMO1_ENST00000564552.1_Silent_p.L152L|BCMO1_ENST00000425577.2_Silent_p.L83L	NM_017429.2	NP_059125.2														breast(2)|endometrium(1)|large_intestine(4)|lung(9)|prostate(3)|skin(3)|stomach(1)	23						CCCACAGACTCTGGAAACCCT	0.507																																																	0													131.0	121.0	124.0					16																	81295871		2202	4300	6502	SO:0001819	synonymous_variant	53630																														ENST00000258168.2:c.454C>T	16.37:g.81295871C>T				Silent	SNP	pfam_Carotenoid_Oase	p.L152	ENST00000258168.2	37	c.454	CCDS10934.1	16																																																																																			BCMO1	-	pfam_Carotenoid_Oase		0.507	BCMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCMO1	HGNC	protein_coding	OTTHUMT00000269056.1	C			81295871	+1	no_errors	ENST00000258168	ensembl	human	known	70_37	silent	SNP	0.970	T
BCS1L	617	genome.wustl.edu	37	2	219526522	219526522	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:219526522G>A	ENST00000431802.1	+	4	1200	c.501G>A	c.(499-501)gtG>gtA	p.V167V	ZNF142_ENST00000411696.2_5'Flank|BCS1L_ENST00000392110.2_Silent_p.V167V|ZNF142_ENST00000449707.1_5'Flank|BCS1L_ENST00000392111.2_Silent_p.V167V|BCS1L_ENST00000359273.3_Silent_p.V167V|BCS1L_ENST00000439945.1_Silent_p.V167V|BCS1L_ENST00000412366.1_Silent_p.V167V|BCS1L_ENST00000392109.1_Silent_p.V167V			Q9Y276	BCS1_HUMAN	BC1 (ubiquinol-cytochrome c reductase) synthesis-like	167					mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrial respiratory chain complex III assembly (GO:0034551)|mitochondrial respiratory chain complex IV assembly (GO:0033617)|mitochondrion organization (GO:0007005)	mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	8		Renal(207;0.0474)		Epithelial(149;7.12e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGAAGACCGTGATGTACACAG	0.527																																																	0													93.0	83.0	87.0					2																	219526522		2203	4300	6503	SO:0001819	synonymous_variant	617			AF026849	CCDS2419.1	2q35	2014-09-17	2012-10-12		ENSG00000074582	ENSG00000074582		"""ATPases / AAA-type"", ""Mitochondrial respiratory chain complex assembly factors"""	1020	protein-coding gene	gene with protein product	"""GRACILE syndrome"", ""Bjornstad syndrome"""	603647	"""BCS1 (yeast homolog)-like"", ""BCS1-like (yeast)"", ""BCS1-like (S. cerevisiae)"""			9878253, 17314340	Standard	NM_001079866		Approved	Hs.6719, BCS, h-BCS, BJS	uc002viq.3	Q9Y276	OTTHUMG00000133114	ENST00000431802.1:c.501G>A	2.37:g.219526522G>A			B3KTW9|Q7Z2V7	Silent	SNP	pfam_BCS1_N,pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.V167	ENST00000431802.1	37	c.501	CCDS2419.1	2																																																																																			BCS1L	-	pfam_BCS1_N		0.527	BCS1L-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BCS1L	HGNC	protein_coding	OTTHUMT00000336756.1	G	NM_004328		219526522	+1	no_errors	ENST00000359273	ensembl	human	known	70_37	silent	SNP	1.000	A
BCS1L	617	genome.wustl.edu	37	2	219526572	219526572	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:219526572G>A	ENST00000431802.1	+	4	1250	c.551G>A	c.(550-552)cGc>cAc	p.R184H	ZNF142_ENST00000411696.2_5'Flank|BCS1L_ENST00000392110.2_Missense_Mutation_p.R184H|ZNF142_ENST00000449707.1_5'Flank|BCS1L_ENST00000392111.2_Missense_Mutation_p.R184H|BCS1L_ENST00000359273.3_Missense_Mutation_p.R184H|BCS1L_ENST00000439945.1_Missense_Mutation_p.R184H|BCS1L_ENST00000412366.1_Missense_Mutation_p.R184H|BCS1L_ENST00000392109.1_Missense_Mutation_p.R184H			Q9Y276	BCS1_HUMAN	BC1 (ubiquinol-cytochrome c reductase) synthesis-like	184			R -> C (in MC3DN1 and BJS; with mild mitochondrial complex III deficiency; causes a decreased incorporation of the Rieske iron-sulfur protein UQCRFS1 into complex III). {ECO:0000269|PubMed:17314340, ECO:0000269|PubMed:17403714}.		mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrial respiratory chain complex III assembly (GO:0034551)|mitochondrial respiratory chain complex IV assembly (GO:0033617)|mitochondrion organization (GO:0007005)	mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	8		Renal(207;0.0474)		Epithelial(149;7.12e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TATCCACGCCGCCGGCGACCA	0.557																																																	0													71.0	66.0	68.0					2																	219526572		2203	4300	6503	SO:0001583	missense	617			AF026849	CCDS2419.1	2q35	2014-09-17	2012-10-12		ENSG00000074582	ENSG00000074582		"""ATPases / AAA-type"", ""Mitochondrial respiratory chain complex assembly factors"""	1020	protein-coding gene	gene with protein product	"""GRACILE syndrome"", ""Bjornstad syndrome"""	603647	"""BCS1 (yeast homolog)-like"", ""BCS1-like (yeast)"", ""BCS1-like (S. cerevisiae)"""			9878253, 17314340	Standard	NM_001079866		Approved	Hs.6719, BCS, h-BCS, BJS	uc002viq.3	Q9Y276	OTTHUMG00000133114	ENST00000431802.1:c.551G>A	2.37:g.219526572G>A	ENSP00000413908:p.Arg184His		B3KTW9|Q7Z2V7	Missense_Mutation	SNP	pfam_BCS1_N,pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.R184H	ENST00000431802.1	37	c.551	CCDS2419.1	2	.	.	.	.	.	.	.	.	.	.	G	28.0	4.883917	0.91814	.	.	ENSG00000074582	ENST00000430322;ENST00000456050;ENST00000443791;ENST00000359273;ENST00000392109;ENST00000392110;ENST00000392111;ENST00000412366;ENST00000439945;ENST00000431802	D;D;D;D;D;D;D;D;D;D	0.96522	-4.04;-4.04;-2.45;-2.45;-2.45;-2.45;-2.45;-2.45;-2.45;-2.45	5.86	4.98	0.66077	BCS1, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.95928	0.8674	M	0.89785	3.06	0.80722	D	1	P	0.39131	0.661	B	0.32583	0.148	D	0.95066	0.8200	10	0.35671	T	0.21	-19.272	15.1786	0.72934	0.0677:0.0:0.9323:0.0	.	184	Q9Y276	BCS1_HUMAN	H	184;184;64;184;184;184;184;184;184;184	ENSP00000398957:R184H;ENSP00000395440:R184H;ENSP00000412729:R64H;ENSP00000352219:R184H;ENSP00000375957:R184H;ENSP00000375958:R184H;ENSP00000375959:R184H;ENSP00000406494:R184H;ENSP00000404999:R184H;ENSP00000413908:R184H	ENSP00000352219:R184H	R	+	2	0	BCS1L	219234816	1.000000	0.71417	0.901000	0.35422	0.977000	0.68977	7.914000	0.87478	1.483000	0.48342	0.650000	0.86243	CGC	BCS1L	-	pfam_BCS1_N		0.557	BCS1L-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BCS1L	HGNC	protein_coding	OTTHUMT00000336756.1	G	NM_004328		219526572	+1	no_errors	ENST00000359273	ensembl	human	known	70_37	missense	SNP	1.000	A
BMI1	648	genome.wustl.edu	37	10	22618337	22618337	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr10:22618337C>T	ENST00000376663.3	+	10	1352	c.847C>T	c.(847-849)Cat>Tat	p.H283Y	RP11-573G6.9_ENST00000606988.1_lincRNA|COMMD3-BMI1_ENST00000602390.1_Missense_Mutation_p.H426Y	NM_005180.8	NP_005171.4	P35226	BMI1_HUMAN	BMI1 proto-oncogene, polycomb ring finger	283	Pro/Ser-rich.				chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|regulation of gene expression (GO:0010468)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|ubiquitin ligase complex (GO:0000151)	RING-like zinc finger domain binding (GO:0071535)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(2)|urinary_tract(1)	12						GCAGTCTCCTCATCCACAGTT	0.507																																																	0													166.0	151.0	156.0					10																	22618337		2203	4300	6503	SO:0001583	missense	648			BC011652	CCDS7138.1	10p13	2014-06-26	2014-06-26	2006-04-26	ENSG00000168283	ENSG00000168283		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	1066	protein-coding gene	gene with protein product		164831	"""polycomb group ring finger 4"", ""B lymphoma Mo-MLV insertion region 1 homolog (mouse)"""	PCGF4		8268912	Standard	NM_005180		Approved	RNF51		P35226	OTTHUMG00000017807	ENST00000376663.3:c.847C>T	10.37:g.22618337C>T	ENSP00000365851:p.His283Tyr		Q16030|Q5T8Z3|Q96F37	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.H283Y	ENST00000376663.3	37	c.847	CCDS7138.1	10	.	.	.	.	.	.	.	.	.	.	C	14.37	2.516466	0.44763	.	.	ENSG00000168283	ENST00000376691;ENST00000376663	T	0.31510	1.49	5.58	5.58	0.84498	.	0.203825	0.51477	D	0.000084	T	0.23886	0.0578	L	0.27053	0.805	0.47778	D	0.999517	P;P	0.39282	0.666;0.666	B;B	0.32022	0.139;0.139	T	0.04255	-1.0965	10	0.54805	T	0.06	-13.609	19.1861	0.93644	0.0:1.0:0.0:0.0	.	283;283	Q5U0M5;P35226	.;BMI1_HUMAN	Y	195;283	ENSP00000365851:H283Y	ENSP00000365851:H283Y	H	+	1	0	BMI1	22658343	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.456000	0.80751	2.638000	0.89438	0.650000	0.86243	CAT	BMI1	-	NULL		0.507	BMI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMI1	HGNC	protein_coding	OTTHUMT00000047176.1	C	NM_005180		22618337	+1	no_errors	ENST00000376663	ensembl	human	known	70_37	missense	SNP	1.000	T
BPIFA4P	317716	genome.wustl.edu	37	20	31789380	31789380	+	RNA	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr20:31789380G>C	ENST00000375465.3	+	0	342					NR_026760.1		Q86YQ2	LATH_HUMAN	BPI fold containing family A, member 4, pseudogene							extracellular region (GO:0005576)	lipid binding (GO:0008289)										TCTCCATCGAGAGCACCCCTC	0.512																																																	0													199.0	172.0	180.0					20																	31789380		692	1591	2283			317716			AY180924		20q11.21	2013-01-24			ENSG00000183566	ENSG00000183566		"""BPI fold containing"""	20469	pseudogene	pseudogene	"""breast cancer and salivary gland expression gene"", ""PLUNC family pseudogene"""	607627				12538848, 21787333	Standard	NR_026760		Approved	BASE	uc002wyq.2	Q86YQ2	OTTHUMG00000032251		20.37:g.31789380G>C				RNA	SNP	-	NULL	ENST00000375465.3	37	NULL		20																																																																																			BPIFA4P	-	-		0.512	BPIFA4P-003	KNOWN	basic	processed_transcript	BPIFA4P	HGNC	pseudogene	OTTHUMT00000469705.1	G	NR_026760		31789380	+1	no_errors	ENST00000375465	ensembl	human	known	70_37	rna	SNP	0.000	C
BTN2A1	11120	genome.wustl.edu	37	6	26463496	26463496	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr6:26463496C>T	ENST00000312541.5	+	4	703	c.455C>T	c.(454-456)tCa>tTa	p.S152L	BTN2A1_ENST00000469185.1_Missense_Mutation_p.S152L|BTN2A1_ENST00000429381.1_Missense_Mutation_p.S152L|BTN2A1_ENST00000541522.1_Missense_Mutation_p.S91L	NM_007049.3|NM_078476.2	NP_008980.1|NP_510961.1	Q7KYR7	BT2A1_HUMAN	butyrophilin, subfamily 2, member A1	152					lipid metabolic process (GO:0006629)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(3)	27						CCCCTCATTTCAATGAGGGGC	0.542																																																	0													54.0	57.0	56.0					6																	26463496		2203	4300	6503	SO:0001583	missense	11120			U90543	CCDS4613.1, CCDS47390.1, CCDS56404.1, CCDS56405.1	6p22.1	2014-01-14			ENSG00000112763	ENSG00000112763		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1136	protein-coding gene	gene with protein product		613590				9382921, 9149941	Standard	NM_007049		Approved	BT2.1, BTF1, BTN2.1	uc003nib.2	Q7KYR7	OTTHUMG00000014457	ENST00000312541.5:c.455C>T	6.37:g.26463496C>T	ENSP00000312158:p.Ser152Leu		B4DLP9|E9PGR4|O00475|P78408|Q59EN4|Q7KYQ7|Q7Z386|Q96AV7|Q9NU62	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,pfam_CD80_C2-set,superfamily_ConA-like_lec_gl_sf,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Ig-like	p.S152L	ENST00000312541.5	37	c.455	CCDS4613.1	6	.	.	.	.	.	.	.	.	.	.	c	6.229	0.410296	0.11812	.	.	ENSG00000112763	ENST00000312541;ENST00000541522;ENST00000429381;ENST00000265424;ENST00000469185	T;T;T;T	0.79033	-0.61;0.99;-1.23;-1.23	2.88	1.7	0.24286	.	0.473695	0.19665	N	0.108895	T	0.36303	0.0962	N	0.25144	0.715	0.09310	N	0.999999	B;B	0.10296	0.003;0.003	B;B	0.10450	0.003;0.005	T	0.19647	-1.0299	10	0.26408	T	0.33	.	3.2743	0.06893	0.6199:0.249:0.1311:0.0	.	152;152	Q96AV7;Q7KYR7	.;BT2A1_HUMAN	L	152;91;152;152;152	ENSP00000312158:S152L;ENSP00000443909:S91L;ENSP00000416945:S152L;ENSP00000419043:S152L	ENSP00000265424:S152L	S	+	2	0	BTN2A1	26571475	0.002000	0.14202	0.590000	0.28732	0.004000	0.04260	1.197000	0.32211	0.495000	0.27882	-0.367000	0.07326	TCA	BTN2A1	-	NULL		0.542	BTN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTN2A1	HGNC	protein_coding	OTTHUMT00000040122.2	C	NM_007049		26463496	+1	no_errors	ENST00000312541	ensembl	human	known	70_37	missense	SNP	0.495	T
C10orf12	26148	genome.wustl.edu	37	10	98742623	98742623	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr10:98742623G>T	ENST00000286067.2	+	1	1583	c.1476G>T	c.(1474-1476)aaG>aaT	p.K492N		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	492										NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		ATTTGGACAAGAAGAAAAAAG	0.408																																																	0													65.0	71.0	69.0					10																	98742623		2203	4300	6503	SO:0001583	missense	26148			BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.1476G>T	10.37:g.98742623G>T	ENSP00000286067:p.Lys492Asn		Q9H945|Q9Y457	Missense_Mutation	SNP	NULL	p.K492N	ENST00000286067.2	37	c.1476	CCDS7452.1	10	.	.	.	.	.	.	.	.	.	.	G	17.60	3.430399	0.62844	.	.	ENSG00000155640	ENST00000286067;ENST00000539886	T	0.11821	2.74	5.82	3.97	0.46021	.	0.448487	0.21287	N	0.077057	T	0.20700	0.0498	L	0.34521	1.04	0.33678	D	0.611772	D;D	0.63046	0.992;0.992	P;P	0.61722	0.893;0.893	T	0.19063	-1.0317	10	0.45353	T	0.12	-9.9943	9.1068	0.36703	0.2233:0.0:0.7767:0.0	.	326;492	A0PJI9;Q8N655	.;CJ012_HUMAN	N	492;326	ENSP00000286067:K492N	ENSP00000286067:K492N	K	+	3	2	C10orf12	98732613	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	2.836000	0.48183	0.816000	0.34421	0.561000	0.74099	AAG	C10orf12	-	NULL		0.408	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf12	HGNC	protein_coding	OTTHUMT00000049627.1	G	NM_015652		98742623	+1	no_errors	ENST00000286067	ensembl	human	known	70_37	missense	SNP	1.000	T
C11orf68	83638	genome.wustl.edu	37	11	65685220	65685220	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr11:65685220G>C	ENST00000530188.1	-	1	611	c.466C>G	c.(466-468)Cag>Gag	p.Q156E	C11orf68_ENST00000438576.2_Missense_Mutation_p.Q198E|DRAP1_ENST00000532933.1_5'Flank|DRAP1_ENST00000312515.2_5'Flank|C11orf68_ENST00000449692.3_Missense_Mutation_p.Q197E|DRAP1_ENST00000527119.1_5'Flank|DRAP1_ENST00000376991.2_5'Flank			Q9H3H3	CK068_HUMAN	chromosome 11 open reading frame 68	156							poly(A) RNA binding (GO:0044822)			large_intestine(1)|lung(3)	4				READ - Rectum adenocarcinoma(159;0.166)		TTGGCCACCTGAAGCTGGCCT	0.642																																																	0													37.0	36.0	37.0					11																	65685220		2201	4296	6497	SO:0001583	missense	83638			AF073483	CCDS8122.2, CCDS44652.1	11q13.1	2012-08-09			ENSG00000175573	ENSG00000175573			28801	protein-coding gene	gene with protein product	"""basophilic leukemia-expressed protein"""					16511166	Standard	NM_031450		Approved	P5326, BLES03	uc001ogi.3	Q9H3H3	OTTHUMG00000157153	ENST00000530188.1:c.466C>G	11.37:g.65685220G>C	ENSP00000433914:p.Gln156Glu		J3KQG9|Q9BT13	Missense_Mutation	SNP	pfam_DUF1917,superfamily_TIF_eIF4e-like_dom	p.Q198E	ENST00000530188.1	37	c.592		11	.	.	.	.	.	.	.	.	.	.	G	11.35	1.612752	0.28712	.	.	ENSG00000175573	ENST00000438576;ENST00000449692;ENST00000530188	T;T;T	0.38887	1.11;1.11;1.11	4.72	4.72	0.59763	Translation Initiation factor eIF- 4e-like  domain (2);	0.609726	0.17329	N	0.178210	T	0.31199	0.0789	N	0.22421	0.69	0.31304	N	0.688004	P;P	0.52170	0.939;0.951	B;B	0.43950	0.31;0.437	T	0.22941	-1.0202	10	0.38643	T	0.18	-15.3183	10.7987	0.46476	0.0:0.0:0.8108:0.1892	.	197;156	Q9H3H3-2;Q9H3H3	.;CK068_HUMAN	E	198;197;156	ENSP00000398350:Q198E;ENSP00000409681:Q197E;ENSP00000433914:Q156E	ENSP00000398350:Q198E	Q	-	1	0	C11orf68	65441796	0.316000	0.24580	0.988000	0.46212	0.839000	0.47603	2.295000	0.43576	2.345000	0.79718	0.462000	0.41574	CAG	C11orf68	-	pfam_DUF1917,superfamily_TIF_eIF4e-like_dom		0.642	C11orf68-003	PUTATIVE	basic	protein_coding	C11orf68	HGNC	protein_coding	OTTHUMT00000391173.1	G	NM_031450		65685220	-1	no_errors	ENST00000438576	ensembl	human	known	70_37	missense	SNP	0.953	C
PLET1	349633	genome.wustl.edu	37	11	112119581	112119581	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr11:112119581G>A	ENST00000338832.2	-	4	835	c.565C>T	c.(565-567)Ccc>Tcc	p.P189S	AP002884.1_ENST00000401135.1_RNA	NM_001145024.1	NP_001138496.1	Q6UQ28	PLET1_HUMAN		189					cell differentiation (GO:0030154)|negative regulation of cell-matrix adhesion (GO:0001953)|positive regulation of cell migration (GO:0030335)|wound healing, spreading of epidermal cells (GO:0035313)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)				endometrium(2)	2						TCTGTGATGGGGCTGCTGAAG	0.493																																																	0													126.0	122.0	124.0					11																	112119581		692	1591	2283	SO:0001583	missense	349633																														ENST00000338832.2:c.565C>T	11.37:g.112119581G>A	ENSP00000341412:p.Pro189Ser		Q6UQ24|Q6UQ25|Q6UQ27	Missense_Mutation	SNP	NULL	p.P189S	ENST00000338832.2	37	c.565		11	.	.	.	.	.	.	.	.	.	.	G	16.29	3.081547	0.55753	.	.	ENSG00000188771	ENST00000338832	T	0.68903	-0.36	5.22	3.21	0.36854	.	.	.	.	.	T	0.54367	0.1854	N	0.08118	0	0.09310	N	1	D	0.60160	0.987	P	0.53518	0.728	T	0.43130	-0.9410	9	0.87932	D	0	.	6.4101	0.21686	0.2207:0.0:0.7793:0.0	.	189	Q6UQ28	PLET1_HUMAN	S	189	ENSP00000341412:P189S	ENSP00000341412:P189S	P	-	1	0	C11orf34	111624791	0.949000	0.32298	0.606000	0.28943	0.003000	0.03518	1.823000	0.39062	1.432000	0.47375	0.650000	0.86243	CCC	C11orf34	-	NULL		0.493	C11orf34-201	KNOWN	basic|appris_principal	protein_coding	C11orf34	HGNC	protein_coding		G			112119581	-1	no_errors	ENST00000338832	ensembl	human	known	70_37	missense	SNP	0.095	A
C14orf39	317761	genome.wustl.edu	37	14	60921816	60921816	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr14:60921816G>C	ENST00000321731.3	-	16	1565	c.1406C>G	c.(1405-1407)tCc>tGc	p.S469C		NM_174978.2	NP_777638	Q8N1H7	S6OS1_HUMAN	chromosome 14 open reading frame 39	469					multicellular organismal development (GO:0007275)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		AAGTCCAGGGGATTCCTTTTC	0.294																																																	0													60.0	66.0	64.0					14																	60921816		2201	4293	6494	SO:0001583	missense	317761			AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008			19849	protein-coding gene	gene with protein product							Standard	NM_174978		Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.1406C>G	14.37:g.60921816G>C	ENSP00000324920:p.Ser469Cys		Q08AQ4	Missense_Mutation	SNP	NULL	p.S469C	ENST00000321731.3	37	c.1406	CCDS9746.1	14	.	.	.	.	.	.	.	.	.	.	G	19.36	3.812159	0.70797	.	.	ENSG00000179008	ENST00000321731	T	0.35605	1.3	5.84	5.84	0.93424	.	0.094532	0.47455	D	0.000236	T	0.59059	0.2166	M	0.67953	2.075	0.39979	D	0.974896	D	0.89917	1.0	D	0.76575	0.988	T	0.57464	-0.7807	9	.	.	.	-8.7423	16.8578	0.86010	0.0:0.0:1.0:0.0	.	469	Q8N1H7	S6OS1_HUMAN	C	469	ENSP00000324920:S469C	.	S	-	2	0	C14orf39	59991569	1.000000	0.71417	0.998000	0.56505	0.976000	0.68499	5.598000	0.67585	2.767000	0.95098	0.561000	0.74099	TCC	C14orf39	-	NULL		0.294	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf39	HGNC	protein_coding	OTTHUMT00000276948.1	G	NM_174978		60921816	-1	no_errors	ENST00000321731	ensembl	human	known	70_37	missense	SNP	0.993	C
C16orf96	342346	genome.wustl.edu	37	16	4625056	4625056	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr16:4625056C>T	ENST00000444310.4	+	4	690	c.690C>T	c.(688-690)acC>acT	p.T230T		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						CCATGTTCACCTCAGTGAGTG	0.582																																																	0													100.0	89.0	93.0					16																	4625056		692	1591	2283	SO:0001819	synonymous_variant	342346				CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.690C>T	16.37:g.4625056C>T				Silent	SNP	NULL	p.T230	ENST00000444310.4	37	c.690	CCDS53986.1	16																																																																																			C16orf96	-	NULL		0.582	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C16orf96	HGNC	protein_coding	OTTHUMT00000432384.1	C	NM_001145011		4625056	+1	no_errors	ENST00000444310	ensembl	human	known	70_37	silent	SNP	0.000	T
C16orf95	100506581	genome.wustl.edu	37	16	87339346	87339346	+	3'UTR	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr16:87339346G>A	ENST00000253461.4	-	0	669				C16orf95_ENST00000567970.1_Missense_Mutation_p.P227L|RP11-178L8.4_ENST00000568879.1_3'UTR|C16orf95_ENST00000562840.1_5'Flank	NM_001195125.1|NM_001256917.1	NP_001182054.1|NP_001243846.1	Q9H693	CP095_HUMAN	chromosome 16 open reading frame 95																		GATGACCCTCGGGATGGCCTG	0.672																																																	0																																										SO:0001624	3_prime_UTR_variant	100506581				CCDS54049.1, CCDS58491.1, CCDS73921.1	16q24.2	2012-10-10			ENSG00000260456	ENSG00000260456			40033	protein-coding gene	gene with protein product							Standard	NM_001195124		Approved		uc021tmh.1	Q9H693	OTTHUMG00000175680	ENST00000253461.4:c.*19C>T	16.37:g.87339346G>A				Missense_Mutation	SNP	NULL	p.P227L	ENST00000253461.4	37	c.680	CCDS54049.1	16																																																																																			C16orf95	-	NULL		0.672	C16orf95-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	C16orf95	HGNC	protein_coding	OTTHUMT00000430790.1	G	NM_001195124		87339346	-1	no_errors	ENST00000567970	ensembl	human	known	70_37	missense	SNP	0.183	A
C17orf74	201243	genome.wustl.edu	37	17	7329892	7329892	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:7329892G>A	ENST00000333870.3	+	3	656	c.582G>A	c.(580-582)ccG>ccA	p.P194P	C17orf74_ENST00000574034.1_Missense_Mutation_p.V82I|RP11-104H15.7_ENST00000575310.1_RNA	NM_175734.4	NP_783861.3	Q0P670	CQ074_HUMAN	chromosome 17 open reading frame 74	194						integral component of membrane (GO:0016021)				cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	22		Prostate(122;0.157)				TGCCCTTCCCGTATCCCAAGT	0.602																																																	0													114.0	119.0	117.0					17																	7329892		1984	4142	6126	SO:0001819	synonymous_variant	201243			BC044816	CCDS42255.1	17p13.1	2012-05-30			ENSG00000184560	ENSG00000184560			27315	protein-coding gene	gene with protein product						12477932	Standard	NM_175734		Approved		uc002ggw.3	Q0P670	OTTHUMG00000178190	ENST00000333870.3:c.582G>A	17.37:g.7329892G>A				Missense_Mutation	SNP	NULL	p.V82I	ENST00000333870.3	37	c.244	CCDS42255.1	17																																																																																			C17orf74	-	NULL		0.602	C17orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf74	HGNC	protein_coding	OTTHUMT00000440933.2	G	NM_175734		7329892	+1	no_errors	ENST00000574034	ensembl	human	putative	70_37	missense	SNP	0.001	A
SPATA45	149643	genome.wustl.edu	37	1	213009360	213009360	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:213009360C>T	ENST00000332912.3	-	2	239	c.132G>A	c.(130-132)ctG>ctA	p.L44L		NM_001024601.2	NP_001019772.1	Q537H7	SPT45_HUMAN		44										kidney(1)|large_intestine(1)|lung(1)	3						TTTGAACTCTCAGTAAGCTGA	0.463																																																	0													192.0	177.0	182.0					1																	213009360		2203	4297	6500	SO:0001819	synonymous_variant	149643																														ENST00000332912.3:c.132G>A	1.37:g.213009360C>T				Silent	SNP	NULL	p.L44	ENST00000332912.3	37	c.132	CCDS31020.1	1																																																																																			C1orf227	-	NULL		0.463	C1orf227-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf227	HGNC	protein_coding	OTTHUMT00000089672.2	C			213009360	-1	no_errors	ENST00000332912	ensembl	human	known	70_37	silent	SNP	0.020	T
CAMK2A	815	genome.wustl.edu	37	5	149644551	149644551	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr5:149644551C>T	ENST00000348628.6	-	3	850	c.185G>A	c.(184-186)cGc>cAc	p.R62H	CAMK2A_ENST00000398376.3_Missense_Mutation_p.R62H	NM_015981.3|NM_171825.2	NP_057065.2|NP_741960.1	Q9UQM7	KCC2A_HUMAN	calcium/calmodulin-dependent protein kinase II alpha	62	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|kinase activity (GO:0016301)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|skin(1)|stomach(1)	15		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCGGCAGATGCGGGCTTCACG	0.627																																																	0													45.0	49.0	48.0					5																	149644551		2004	4193	6197	SO:0001583	missense	815			AB023185	CCDS43386.1, CCDS43387.1	5q32	2013-09-20	2008-10-30		ENSG00000070808	ENSG00000070808	2.7.11.17		1460	protein-coding gene	gene with protein product	"""CaM-kinase II alpha chain"", ""calcium/calmodulin-dependent protein kinase II alpha-B subunit"", ""CaM kinase II alpha subunit"", ""CaMK-II alpha subunit"", ""calcium/calmodulin-dependent protein kinase type II alpha chain"""	114078	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha"""	CAMKA		10231032, 3475713	Standard	NM_015981		Approved	KIAA0968, CaMKIINalpha	uc003lrt.2	Q9UQM7	OTTHUMG00000134281	ENST00000348628.6:c.185G>A	5.37:g.149644551C>T	ENSP00000261793:p.Arg62His		Q9UL21|Q9Y2H4|Q9Y352	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ca/CaM-dep_prot_kinase-assoc,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R62H	ENST00000348628.6	37	c.185	CCDS43386.1	5	.	.	.	.	.	.	.	.	.	.	c	27.6	4.848224	0.91277	.	.	ENSG00000070808	ENST00000348628;ENST00000398376;ENST00000510347	T;T;T	0.66638	-0.22;-0.22;-0.22	4.6	4.6	0.57074	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	U	0.000002	T	0.77018	0.4069	L	0.54323	1.7	0.80722	D	1	D;D	0.89917	0.989;1.0	P;D	0.80764	0.77;0.994	T	0.79349	-0.1840	10	0.87932	D	0	.	13.2562	0.60081	0.0:1.0:0.0:0.0	.	62;62	Q9UQM7;A8K161	KCC2A_HUMAN;.	H	62	ENSP00000261793:R62H;ENSP00000381412:R62H;ENSP00000426607:R62H	ENSP00000261793:R62H	R	-	2	0	CAMK2A	149624744	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.110000	0.71535	2.281000	0.76405	0.306000	0.20318	CGC	CAMK2A	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.627	CAMK2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMK2A	HGNC	protein_coding	OTTHUMT00000258869.2	C	NM_015981		149644551	-1	no_errors	ENST00000398376	ensembl	human	known	70_37	missense	SNP	1.000	T
CAPN8	388743	genome.wustl.edu	37	1	223842059	223842059	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:223842059G>C	ENST00000366873.2	-	2	356	c.280C>G	c.(280-282)Cgc>Ggc	p.R94G	CAPN8_ENST00000366872.5_Missense_Mutation_p.R94G			A6NHC0	CAN8_HUMAN	calpain 8	94	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|endometrium(2)|prostate(1)	4						ATGTCTGTGCGCGTGGCTCCA	0.488																																																	0													128.0	114.0	118.0					1																	223842059		692	1591	2283	SO:0001583	missense	388743				CCDS73038.1	1q41	2013-01-10	2007-02-21		ENSG00000203697	ENSG00000203697		"""EF-hand domain containing"""	1485	protein-coding gene	gene with protein product			"""calpain 8 (nCL-2)"""			7690035, 8889549	Standard	NM_001143962		Approved	nCL-2	uc009xee.2	A6NHC0	OTTHUMG00000037378	ENST00000366873.2:c.280C>G	1.37:g.223842059G>C	ENSP00000355838:p.Arg94Gly		B2RXL2	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,pfscan_EF_HAND_2,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.R94G	ENST00000366873.2	37	c.280		1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.001606	0.74818	.	.	ENSG00000203697	ENST00000366872;ENST00000419193;ENST00000366873	D;D;D	0.92446	-3.04;-3.04;-3.04	4.93	4.93	0.64822	Peptidase C2, calpain, catalytic domain (3);	0.000000	0.64402	U	0.000001	D	0.96734	0.8934	M	0.91872	3.25	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97504	1.0062	10	0.87932	D	0	.	15.2198	0.73303	0.0:0.0:1.0:0.0	.	94	A6NHC0	CAN8_HUMAN	G	94	ENSP00000355837:R94G;ENSP00000401665:R94G;ENSP00000355838:R94G	ENSP00000355837:R94G	R	-	1	0	CAPN8	221908682	0.988000	0.35896	0.990000	0.47175	0.988000	0.76386	3.474000	0.53129	2.442000	0.82660	0.561000	0.74099	CGC	CAPN8	-	pfam_Peptidase_C2_calpain_cat,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease		0.488	CAPN8-001	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	CAPN8	HGNC	protein_coding	OTTHUMT00000171394.3	G	NM_001143962		223842059	-1	no_errors	ENST00000366872	ensembl	human	known	70_37	missense	SNP	0.989	C
CASK	8573	genome.wustl.edu	37	X	41524688	41524688	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chrX:41524688G>A	ENST00000378163.1	-	7	1024	c.550C>T	c.(550-552)Cat>Tat	p.H184Y	CASK_ENST00000378158.1_Missense_Mutation_p.H184Y|CASK_ENST00000421587.2_Missense_Mutation_p.H184Y|CASK_ENST00000378154.1_Missense_Mutation_p.H184Y|CASK_ENST00000361962.4_Missense_Mutation_p.H184Y|CASK_ENST00000442742.2_Missense_Mutation_p.H184Y|CASK_ENST00000318588.9_Missense_Mutation_p.H184Y|CASK_ENST00000378166.4_Missense_Mutation_p.H184Y			O14936	CSKP_HUMAN	calcium/calmodulin-dependent serine protein kinase (MAGUK family)	184	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium ion import (GO:0070509)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of wound healing (GO:0061045)|nucleotide phosphorylation (GO:0046939)|positive regulation of calcium ion import (GO:0090280)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	actin cytoskeleton (GO:0015629)|basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(5)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|ovary(3)|prostate(1)|stomach(1)	32						GCCATAAAATGAGGTGTTCCA	0.378																																					NSCLC(42;104 1086 3090 27189 35040)												0													76.0	63.0	67.0					X																	41524688		2203	4300	6503	SO:0001583	missense	8573			AF035582	CCDS14257.1, CCDS48094.1, CCDS48095.1	Xp11.4	2010-02-09			ENSG00000147044	ENSG00000147044			1497	protein-coding gene	gene with protein product		300172	"""trinucleotide repeat containing 8"""	TNRC8		9722958	Standard	NM_003688		Approved	LIN2, CAGH39, FGS4	uc004dfl.4	O14936	OTTHUMG00000021378	ENST00000378163.1:c.550C>T	X.37:g.41524688G>A	ENSP00000367405:p.His184Tyr		A6NES1|B7ZKY0|O43215|Q17RI4|Q59HA0|Q5VT16|Q5VT17|Q5VT18|Q5VT19|Q66T42|Q9BYH6|Q9NYB2|Q9NYB3	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Guanylate_kin,pfam_L27_C,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_L27,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,pfscan_Guanylate_kin	p.H184Y	ENST00000378163.1	37	c.550		X	.	.	.	.	.	.	.	.	.	.	G	18.31	3.595248	0.66219	.	.	ENSG00000147044	ENST00000421587;ENST00000318588;ENST00000361962;ENST00000378163;ENST00000378158;ENST00000378166;ENST00000442742;ENST00000378154	T;T;T;T;T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13	5.72	5.72	0.89469	.	0.099589	0.45361	D	0.000378	T	0.50222	0.1603	N	0.10809	0.05	0.80722	D	1	P;P;D	0.56968	0.828;0.52;0.978	B;B;B	0.44278	0.261;0.074;0.445	T	0.60831	-0.7185	10	0.72032	D	0.01	.	18.9015	0.92444	0.0:0.0:1.0:0.0	.	184;184;184	O14936-3;O14936-4;O14936-2	.;.;.	Y	184	ENSP00000400526:H184Y;ENSP00000322727:H184Y;ENSP00000354641:H184Y;ENSP00000367405:H184Y;ENSP00000367400:H184Y;ENSP00000367408:H184Y;ENSP00000398007:H184Y;ENSP00000367396:H184Y	ENSP00000322727:H184Y	H	-	1	0	CASK	41409632	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.476000	0.97823	2.410000	0.81850	0.523000	0.50628	CAT	CASK	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.378	CASK-007	KNOWN	basic|appris_candidate_longest	protein_coding	CASK	HGNC	protein_coding	OTTHUMT00000056285.1	G	NM_003688		41524688	-1	no_errors	ENST00000378163	ensembl	human	known	70_37	missense	SNP	1.000	A
DRC7	84229	genome.wustl.edu	37	16	57741510	57741510	+	Nonsense_Mutation	SNP	G	G	T	rs116685636		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr16:57741510G>T	ENST00000360716.3	+	8	1218	c.997G>T	c.(997-999)Gag>Tag	p.E333*	CCDC135_ENST00000336825.8_Nonsense_Mutation_p.E268*|CCDC135_ENST00000394337.4_Nonsense_Mutation_p.E333*			Q8IY82	CC135_HUMAN		333					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30						CACCCAGGATGAGCACTTCCT	0.567																																																	0													85.0	69.0	74.0					16																	57741510		2196	4300	6496	SO:0001587	stop_gained	84229																														ENST00000360716.3:c.997G>T	16.37:g.57741510G>T	ENSP00000353942:p.Glu333*		A8K943|Q8NAA0|Q9H080	Nonsense_Mutation	SNP	NULL	p.E333*	ENST00000360716.3	37	c.997	CCDS10787.1	16	.	.	.	.	.	.	.	.	.	.	.	14.21	2.466295	0.43839	.	.	ENSG00000159625	ENST00000394337;ENST00000336825;ENST00000360716	.	.	.	5.03	4.06	0.47325	.	0.591461	0.17583	N	0.169030	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-9.1011	12.7872	0.57512	0.0805:0.0:0.9195:0.0	.	.	.	.	X	333;268;333	.	ENSP00000338938:E268X	E	+	1	0	CCDC135	56299011	0.985000	0.35326	0.008000	0.14137	0.020000	0.10135	3.052000	0.49893	1.092000	0.41356	0.637000	0.83480	GAG	CCDC135	-	NULL		0.567	CCDC135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC135	HGNC	protein_coding	OTTHUMT00000433323.2	G			57741510	+1	no_errors	ENST00000360716	ensembl	human	known	70_37	nonsense	SNP	0.019	T
CFAP58	159686	genome.wustl.edu	37	10	106118345	106118345	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr10:106118345C>T	ENST00000369704.3	+	2	390	c.256C>T	c.(256-258)Cag>Tag	p.Q86*	CCDC147_ENST00000312902.5_5'UTR	NM_001008723.1	NP_001008723.1	Q5T655	CC147_HUMAN		86						extracellular space (GO:0005615)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	52		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		TAAGCTCTCTCAGGATGATCA	0.418																																																	0													84.0	70.0	75.0					10																	106118345		2203	4300	6503	SO:0001587	stop_gained	159686																														ENST00000369704.3:c.256C>T	10.37:g.106118345C>T	ENSP00000358718:p.Gln86*		D3DRA6|Q8NA27	Nonsense_Mutation	SNP	superfamily_Homeodomain-like	p.Q86*	ENST00000369704.3	37	c.256	CCDS31282.1	10	.	.	.	.	.	.	.	.	.	.	C	37	6.243405	0.97408	.	.	ENSG00000120051	ENST00000369704	.	.	.	5.46	5.46	0.80206	.	0.224065	0.47455	D	0.000226	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	-24.0364	16.0093	0.80385	0.1349:0.8651:0.0:0.0	.	.	.	.	X	86	.	ENSP00000358718:Q86X	Q	+	1	0	CCDC147	106108335	0.999000	0.42202	1.000000	0.80357	0.992000	0.81027	3.267000	0.51577	2.714000	0.92807	0.655000	0.94253	CAG	CCDC147	-	NULL		0.418	CCDC147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC147	HGNC	protein_coding	OTTHUMT00000050216.1	C			106118345	+1	no_errors	ENST00000369704	ensembl	human	known	70_37	nonsense	SNP	1.000	T
CCDC151	115948	genome.wustl.edu	37	19	11545671	11545671	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:11545671C>T	ENST00000356392.4	-	1	254	c.167G>A	c.(166-168)gGa>gAa	p.G56E	PRKCSH_ENST00000589838.1_5'Flank|CCDC151_ENST00000591179.1_Missense_Mutation_p.G56E|PRKCSH_ENST00000587327.1_5'Flank|PRKCSH_ENST00000591462.1_5'Flank|PRKCSH_ENST00000252455.2_5'Flank|PRKCSH_ENST00000592741.1_5'Flank|PRKCSH_ENST00000412601.1_5'Flank|CCDC151_ENST00000586836.1_Intron|CCDC151_ENST00000545100.1_Intron	NM_145045.4	NP_659482.3	A5D8V7	CC151_HUMAN	coiled-coil domain containing 151	56										endometrium(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	12						GTGGAAGGATCCTCCCTTGGA	0.592											OREG0025257	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													84.0	89.0	88.0					19																	11545671		1969	4148	6117	SO:0001583	missense	115948				CCDS42501.1	19p13.2	2014-02-20				ENSG00000198003			28303	protein-coding gene	gene with protein product		615956				24067530	Standard	NM_145045		Approved	MGC20983	uc002mrs.3	A5D8V7		ENST00000356392.4:c.167G>A	19.37:g.11545671C>T	ENSP00000348757:p.Gly56Glu	673	B4DXT0|Q96CG5	Missense_Mutation	SNP	NULL	p.G56E	ENST00000356392.4	37	c.167	CCDS42501.1	19	.	.	.	.	.	.	.	.	.	.	C	16.04	3.009095	0.54361	.	.	ENSG00000198003	ENST00000356392;ENST00000543934	T	0.11277	2.79	4.54	-3.53	0.04667	.	1.053360	0.07546	N	0.914737	T	0.10165	0.0249	L	0.54323	1.7	0.09310	N	0.999999	B;P	0.36909	0.047;0.573	B;B	0.40901	0.013;0.343	T	0.35301	-0.9794	10	0.27785	T	0.31	-0.0448	2.6153	0.04902	0.1387:0.2524:0.4275:0.1814	.	56;56	B3KPH7;A5D8V7	.;CC151_HUMAN	E	56;35	ENSP00000348757:G56E	ENSP00000348757:G56E	G	-	2	0	CCDC151	11406671	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.266000	0.08631	-0.329000	0.08527	0.655000	0.94253	GGA	CCDC151	-	NULL		0.592	CCDC151-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC151	HGNC	protein_coding	OTTHUMT00000458800.1	C	NM_145045		11545671	-1	no_errors	ENST00000356392	ensembl	human	known	70_37	missense	SNP	0.000	T
CCDC7	79741	genome.wustl.edu	37	10	32807383	32807383	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr10:32807383G>T	ENST00000362006.5	+	12	1486	c.943G>T	c.(943-945)Gaa>Taa	p.E315*	CCDC7_ENST00000277657.6_Nonsense_Mutation_p.E315*	NM_145023.4	NP_659460.3	Q96M83	CCDC7_HUMAN	coiled-coil domain containing 7	315										NS(1)|breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(2)	14		Breast(68;0.000207)|Prostate(175;0.0107)				GTTGTTATCAGAAGAGAAGTT	0.308																																																	0													82.0	90.0	87.0					10																	32807383		2202	4300	6502	SO:0001587	stop_gained	79741			BC022020	CCDS7173.1	10p11.23	2013-12-13			ENSG00000216937	ENSG00000216937			26533	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 68"""	C10orf68		12477932	Standard	NM_024688		Approved	FLJ32762, FLJ13031	uc001iwk.3	Q96M83	OTTHUMG00000150517	ENST00000362006.5:c.943G>T	10.37:g.32807383G>T	ENSP00000355078:p.Glu315*		Q5VW55|Q8IVQ0|Q8NEQ0	Nonsense_Mutation	SNP	NULL	p.E315*	ENST00000362006.5	37	c.943	CCDS7173.1	10	.	.	.	.	.	.	.	.	.	.	G	16.28	3.079783	0.55753	.	.	ENSG00000216937	ENST00000277657;ENST00000362006	.	.	.	4.67	2.75	0.32379	.	.	.	.	.	.	.	.	.	.	.	0.38659	D	0.952036	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	-1.558	6.5435	0.22392	0.1008:0.1827:0.7165:0.0	.	.	.	.	X	315	.	ENSP00000277657:E315X	E	+	1	0	CCDC7	32847389	0.955000	0.32602	0.180000	0.23079	0.018000	0.09664	1.109000	0.31135	0.449000	0.26747	-0.140000	0.14226	GAA	CCDC7	-	NULL		0.308	CCDC7-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	CCDC7	HGNC	protein_coding	OTTHUMT00000047490.1	G	NM_145023		32807383	+1	no_errors	ENST00000277657	ensembl	human	known	70_37	nonsense	SNP	0.634	T
CCDC6	8030	genome.wustl.edu	37	10	61566793	61566793	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr10:61566793C>T	ENST00000263102.6	-	6	1122	c.891G>A	c.(889-891)atG>atA	p.M297I		NM_005436.4	NP_005427.2	Q16204	CCDC6_HUMAN	coiled-coil domain containing 6	297						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	structural constituent of cytoskeleton (GO:0005200)		CCDC6/RET(4)	breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(3)|stomach(1)	18				Kidney(211;0.0597)		TCTCTTCTCTCATGTGACGTT	0.448			T	RET	NSCLC																																			Dom	yes		10	10q21	8030	coiled-coil domain containing 6		E	0													125.0	108.0	113.0					10																	61566793		2203	4300	6503	SO:0001583	missense	8030			S72869	CCDS7257.1	10q21.2	2006-11-09	2004-01-20		ENSG00000108091	ENSG00000108091			18782	protein-coding gene	gene with protein product	"""DNA segment, single copy, probe pH4 (transforming sequence, thyroid-1"""	601985	"""DNA segment on chromosome 10 (unique) 170"""	TST1, D10S170		8058316, 6745938	Standard	NM_005436		Approved	PTC, TPC, H4	uc001jks.4	Q16204	OTTHUMG00000018284	ENST00000263102.6:c.891G>A	10.37:g.61566793C>T	ENSP00000263102:p.Met297Ile		Q15250|Q6GSG7	Missense_Mutation	SNP	pfam_DUF2046	p.M297I	ENST00000263102.6	37	c.891	CCDS7257.1	10	.	.	.	.	.	.	.	.	.	.	C	12.11	1.839593	0.32513	.	.	ENSG00000108091	ENST00000263102	T	0.80123	-1.34	5.37	5.37	0.77165	.	0.104089	0.85682	D	0.000000	T	0.65123	0.2661	N	0.05441	-0.05	0.80722	D	1	B	0.11235	0.004	B	0.12156	0.007	T	0.61113	-0.7128	10	0.11182	T	0.66	-19.0243	19.1868	0.93647	0.0:1.0:0.0:0.0	.	297	Q16204	CCDC6_HUMAN	I	297	ENSP00000263102:M297I	ENSP00000263102:M297I	M	-	3	0	CCDC6	61236799	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.815000	0.86186	2.560000	0.86352	0.461000	0.40582	ATG	CCDC6	-	pfam_DUF2046		0.448	CCDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC6	HGNC	protein_coding	OTTHUMT00000048176.2	C	NM_005436		61566793	-1	no_errors	ENST00000263102	ensembl	human	known	70_37	missense	SNP	1.000	T
CCNA2	890	genome.wustl.edu	37	4	122739202	122739202	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr4:122739202G>A	ENST00000274026.5	-	7	1550	c.1247C>T	c.(1246-1248)tCa>tTa	p.S416L		NM_001237.3	NP_001228	P20248	CCNA2_HUMAN	cyclin A2	416					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic G2 DNA damage checkpoint (GO:0007095)|mitotic nuclear division (GO:0007067)|organ regeneration (GO:0031100)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|response to estradiol (GO:0032355)|response to glucagon (GO:0033762)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	12						TTCTTACTTTGAATTTTTGTA	0.378																																																	0													87.0	87.0	87.0					4																	122739202		2203	4300	6503	SO:0001583	missense	890				CCDS3723.1	4q27	2012-07-12			ENSG00000145386	ENSG00000145386			1578	protein-coding gene	gene with protein product		123835		CCNA, CCN1		1675006	Standard	NM_001237		Approved		uc003iec.4	P20248	OTTHUMG00000133072	ENST00000274026.5:c.1247C>T	4.37:g.122739202G>A	ENSP00000274026:p.Ser416Leu		A8K7B6|Q2M3U6|Q4W5P4|Q6LER8	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_A/B/D/E	p.S416L	ENST00000274026.5	37	c.1247	CCDS3723.1	4	.	.	.	.	.	.	.	.	.	.	G	20.4	3.990375	0.74589	.	.	ENSG00000145386	ENST00000274026	T	0.25912	1.77	6.08	6.08	0.98989	Cyclin, C-terminal (1);Cyclin-like (2);	0.414726	0.26750	N	0.022699	T	0.33177	0.0854	M	0.71036	2.16	0.42555	D	0.993123	B	0.31817	0.341	B	0.39617	0.305	T	0.10451	-1.0629	10	0.39692	T	0.17	.	9.6637	0.39972	0.0698:0.0:0.7885:0.1417	.	416	P20248	CCNA2_HUMAN	L	416	ENSP00000274026:S416L	ENSP00000274026:S416L	S	-	2	0	CCNA2	122958652	0.990000	0.36364	0.980000	0.43619	0.964000	0.63967	6.547000	0.73892	2.894000	0.99253	0.591000	0.81541	TCA	CCNA2	-	pfam_Cyclin_C,superfamily_Cyclin-like,pirsf_Cyclin_A/B/D/E		0.378	CCNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNA2	HGNC	protein_coding	OTTHUMT00000256712.2	G	NM_001237		122739202	-1	no_errors	ENST00000274026	ensembl	human	known	70_37	missense	SNP	0.894	A
CCNL1	57018	genome.wustl.edu	37	3	156870923	156870923	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr3:156870923C>T	ENST00000295926.3	-	4	629	c.511G>A	c.(511-513)Gat>Aat	p.D171N	CCNL1_ENST00000479052.1_5'UTR|Y_RNA_ENST00000364908.1_RNA|CCNL1_ENST00000461804.1_Missense_Mutation_p.D171N	NM_020307.2	NP_064703.1	Q9UK58	CCNL1_HUMAN	cyclin L1	171	Cyclin-like 1.				regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)|nucleus (GO:0005634)				NS(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|stomach(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0295)|Lung(72;0.0308)			TAGTTCTGATCAAGGATCAGG	0.373																																																	0													96.0	87.0	90.0					3																	156870923		2203	4300	6503	SO:0001583	missense	57018			AF180920	CCDS3178.1	3q25.31	2008-02-05			ENSG00000163660	ENSG00000163660			20569	protein-coding gene	gene with protein product		613384				11980906	Standard	NM_020307		Approved	ania-6a	uc003fbf.3	Q9UK58	OTTHUMG00000158713	ENST00000295926.3:c.511G>A	3.37:g.156870923C>T	ENSP00000295926:p.Asp171Asn		B3KMY3|Q6NVY9|Q6UWS7|Q8NI48|Q96QT0|Q9NZF3	Missense_Mutation	SNP	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_L	p.D171N	ENST00000295926.3	37	c.511	CCDS3178.1	3	.	.	.	.	.	.	.	.	.	.	C	35	5.418550	0.96092	.	.	ENSG00000163660	ENST00000461804;ENST00000295926	T;T	0.46451	0.87;0.87	5.9	5.9	0.94986	Cyclin, N-terminal (1);Cyclin-like (3);	0.000000	0.85682	D	0.000000	T	0.70202	0.3197	M	0.84156	2.68	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.982;0.999;0.998	T	0.72250	-0.4348	10	0.66056	D	0.02	-25.6637	20.2704	0.98474	0.0:1.0:0.0:0.0	.	171;171;171	Q9UK58-4;Q9UK58;C9JPL0	.;CCNL1_HUMAN;.	N	171	ENSP00000420277:D171N;ENSP00000295926:D171N	ENSP00000295926:D171N	D	-	1	0	CCNL1	158353617	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.380000	0.79704	2.793000	0.96121	0.591000	0.81541	GAT	CCNL1	-	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_L		0.373	CCNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNL1	HGNC	protein_coding	OTTHUMT00000351859.1	C	NM_020307		156870923	-1	no_errors	ENST00000295926	ensembl	human	known	70_37	missense	SNP	1.000	T
AMN	81693	genome.wustl.edu	37	14	103400107	103400107	+	IGR	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr14:103400107G>C	ENST00000299155.5	+	0	1907				CDC42BPB_ENST00000361246.2_Missense_Mutation_p.S1693C|RP11-365N19.2_ENST00000560931.1_RNA	NM_030943.3	NP_112205.2	Q9BXJ7	AMNLS_HUMAN	amnion associated transmembrane protein						cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|excretion (GO:0007588)|Golgi to plasma membrane protein transport (GO:0043001)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			kidney(2)|large_intestine(1)|lung(2)|skin(1)	6				Colorectal(3;0.00739)|READ - Rectum adenocarcinoma(2;0.0336)|Epithelial(152;0.0363)|all cancers(159;0.147)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CCTGTGGGGGGAGTTGGGGCT	0.657																																																	0													38.0	42.0	41.0					14																	103400107		2192	4289	6481	SO:0001628	intergenic_variant	9578			AF328788	CCDS9977.1	14q32.32	2014-09-17	2012-12-07		ENSG00000166126	ENSG00000166126			14604	protein-coding gene	gene with protein product		605799	"""amnionless homolog (mouse)"""			11279523	Standard	NM_030943		Approved	amnionless	uc001ymg.4	Q9BXJ7			14.37:g.103400107G>C			Q6UX83	Missense_Mutation	SNP	pfam_Citron,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,smart_PAK_box_Rho-bd,pfscan_PAK_box_Rho-bd,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd	p.S1693C	ENST00000299155.5	37	c.5078	CCDS9977.1	14	.	.	.	.	.	.	.	.	.	.	G	24.7	4.562332	0.86335	.	.	ENSG00000198752	ENST00000361246	T	0.77098	-1.07	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	D	0.88789	0.6532	M	0.80616	2.505	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.90572	0.4523	10	0.87932	D	0	.	18.1013	0.89505	0.0:0.0:1.0:0.0	.	1693	Q9Y5S2	MRCKB_HUMAN	C	1693	ENSP00000355237:S1693C	ENSP00000355237:S1693C	S	-	2	0	CDC42BPB	102469860	1.000000	0.71417	0.999000	0.59377	0.972000	0.66771	9.395000	0.97266	2.246000	0.74042	0.462000	0.41574	TCC	CDC42BPB	-	NULL		0.657	AMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPB	HGNC	protein_coding	OTTHUMT00000415704.1	G			103400107	-1	no_errors	ENST00000361246	ensembl	human	known	70_37	missense	SNP	1.000	C
AMN	81693	genome.wustl.edu	37	14	103400155	103400155	+	IGR	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr14:103400155G>C	ENST00000299155.5	+	0	1907				CDC42BPB_ENST00000361246.2_Nonsense_Mutation_p.S1677*|RP11-365N19.2_ENST00000560931.1_RNA	NM_030943.3	NP_112205.2	Q9BXJ7	AMNLS_HUMAN	amnion associated transmembrane protein						cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|excretion (GO:0007588)|Golgi to plasma membrane protein transport (GO:0043001)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			kidney(2)|large_intestine(1)|lung(2)|skin(1)	6				Colorectal(3;0.00739)|READ - Rectum adenocarcinoma(2;0.0336)|Epithelial(152;0.0363)|all cancers(159;0.147)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CGATGGAGTTGAGTGTTTGGT	0.657																																																	0													115.0	109.0	111.0					14																	103400155		2195	4290	6485	SO:0001628	intergenic_variant	9578			AF328788	CCDS9977.1	14q32.32	2014-09-17	2012-12-07		ENSG00000166126	ENSG00000166126			14604	protein-coding gene	gene with protein product		605799	"""amnionless homolog (mouse)"""			11279523	Standard	NM_030943		Approved	amnionless	uc001ymg.4	Q9BXJ7			14.37:g.103400155G>C			Q6UX83	Nonsense_Mutation	SNP	pfam_Citron,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,smart_PAK_box_Rho-bd,pfscan_PAK_box_Rho-bd,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd	p.S1677*	ENST00000299155.5	37	c.5030	CCDS9977.1	14	.	.	.	.	.	.	.	.	.	.	G	48	14.087172	0.99778	.	.	ENSG00000198752	ENST00000361246	.	.	.	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	17.8658	0.88794	0.0:0.0:1.0:0.0	.	.	.	.	X	1677	.	ENSP00000355237:S1677X	S	-	2	0	CDC42BPB	102469908	1.000000	0.71417	0.932000	0.37286	0.991000	0.79684	9.395000	0.97266	2.188000	0.69820	0.462000	0.41574	TCA	CDC42BPB	-	NULL		0.657	AMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPB	HGNC	protein_coding	OTTHUMT00000415704.1	G			103400155	-1	no_errors	ENST00000361246	ensembl	human	known	70_37	nonsense	SNP	1.000	C
CDH23	64072	genome.wustl.edu	37	10	73269977	73269977	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr10:73269977G>A	ENST00000224721.6	+	3	289	c.284G>A	c.(283-285)aGa>aAa	p.R95K	CDH23_ENST00000398809.4_Missense_Mutation_p.R95K|CDH23_ENST00000461841.3_Missense_Mutation_p.R140K|CDH23-AS1_ENST00000428918.1_RNA|CDH23_ENST00000299366.7_Missense_Mutation_p.R140K|CDH23_ENST00000398842.3_Missense_Mutation_p.R95K	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	95	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						CCACTGGACAGAGAGGTATGA	0.612																																																	0													55.0	63.0	60.0					10																	73269977		1941	4150	6091	SO:0001583	missense	64072			AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.284G>A	10.37:g.73269977G>A	ENSP00000224721:p.Arg95Lys		C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R95K	ENST00000224721.6	37	c.284		10	.	.	.	.	.	.	.	.	.	.	G	20.4	3.975869	0.74360	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000398828;ENST00000398809;ENST00000398842;ENST00000299366;ENST00000224721;ENST00000416060	T;T	0.01705	4.68;4.68	5.23	5.23	0.72850	Cadherin (5);Cadherin-like (1);	0.080835	0.46145	D	0.000318	T	0.12263	0.0298	M	0.83852	2.665	0.80722	D	1	D;B;D;B	0.59357	0.985;0.169;0.982;0.336	D;B;D;B	0.72625	0.978;0.165;0.963;0.114	T	0.00463	-1.1724	10	0.52906	T	0.07	.	18.4374	0.90652	0.0:0.0:1.0:0.0	.	95;95;95;95	A5D6V9;Q9H251;Q9H251-5;E7ESV7	.;CAD23_HUMAN;.;.	K	95;95;95;95;95;95;95;36	ENSP00000381789:R95K;ENSP00000381822:R95K	ENSP00000224721:R95K	R	+	2	0	CDH23	72939983	1.000000	0.71417	1.000000	0.80357	0.676000	0.39594	8.604000	0.90877	2.439000	0.82584	0.456000	0.33151	AGA	CDH23	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin		0.612	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	CDH23	HGNC	protein_coding	OTTHUMT00000051227.4	G	NM_052836		73269977	+1	no_errors	ENST00000224721	ensembl	human	known	70_37	missense	SNP	1.000	A
CDK10	8558	genome.wustl.edu	37	16	89762071	89762071	+	Missense_Mutation	SNP	G	G	A	rs376294252		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr16:89762071G>A	ENST00000353379.7	+	13	1097	c.1054G>A	c.(1054-1056)Gag>Aag	p.E352K	CDK10_ENST00000505473.1_Intron|CDK10_ENST00000331006.8_Missense_Mutation_p.E305K	NM_001098533.2|NM_001160367.1|NM_052988.4	NP_001092003.2|NP_001153839.1|NP_443714.3	Q15131	CDK10_HUMAN	cyclin-dependent kinase 10	352					negative regulation of cell proliferation (GO:0008285)|traversing start control point of mitotic cell cycle (GO:0007089)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			ovary(1)	1		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0276)		AGCCACCTCCGAGGGCCAGAG	0.662																																																	0								G	LYS/GLU,LYS/GLU,,LYS/GLU	0,4388		0,0,2194	23.0	29.0	27.0		823,841,,1054	4.0	0.2	16		27	2,8594		0,2,4296	no	missense,missense,intron,missense	CDK10	NM_001098533.2,NM_001160367.1,NM_052987.3,NM_052988.4	56,56,,56	0,2,6490	AA,AG,GG		0.0233,0.0,0.0154	benign,benign,,benign	275/284,281/290,,352/361	89762071	2,12982	2194	4298	6492	SO:0001583	missense	8558			L33264	CCDS10984.2, CCDS32514.1, CCDS32514.2	16q24.3	2011-11-08	2007-11-21		ENSG00000185324	ENSG00000185324		"""Cyclin-dependent kinases"""	1770	protein-coding gene	gene with protein product		603464	"""cyclin-dependent kinase (CDC2-like) 10"""			8208557, 8084611	Standard	NM_052988		Approved	PISSLRE	uc010cio.3	Q15131	OTTHUMG00000138049	ENST00000353379.7:c.1054G>A	16.37:g.89762071G>A	ENSP00000338673:p.Glu352Lys		A8K370|A8K8I6|A8MXU6|B3KQJ3|B7Z420|D3DX82|D3DX83|Q0VGZ7|Q15130|Q6PJC0	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E352K	ENST00000353379.7	37	c.1054	CCDS10984.2	16	.	.	.	.	.	.	.	.	.	.	G	14.30	2.494681	0.44352	0.0	2.33E-4	ENSG00000185324	ENST00000331006;ENST00000353379	T;T	0.71461	-0.57;-0.51	4.93	3.96	0.45880	Protein kinase-like domain (1);	0.211214	0.48286	D	0.000189	T	0.52403	0.1732	N	0.14661	0.345	0.80722	D	1	B;B	0.13594	0.001;0.008	B;B	0.08055	0.001;0.003	T	0.47711	-0.9096	10	0.45353	T	0.12	-20.7695	11.2585	0.49069	0.0:0.2173:0.6557:0.127	.	352;275	Q15131;Q15131-3	CDK10_HUMAN;.	K	305;352	ENSP00000329957:E305K;ENSP00000338673:E352K	ENSP00000329957:E305K	E	+	1	0	CDK10	88289572	1.000000	0.71417	0.206000	0.23566	0.366000	0.29705	7.080000	0.76837	1.051000	0.40369	0.650000	0.86243	GAG	CDK10	-	superfamily_Kinase-like_dom		0.662	CDK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK10	HGNC	protein_coding	OTTHUMT00000269925.2	G			89762071	+1	no_errors	ENST00000353379	ensembl	human	known	70_37	missense	SNP	0.908	A
CENPF	1063	genome.wustl.edu	37	1	214816201	214816201	+	Missense_Mutation	SNP	C	C	G	rs145589304	byFrequency	TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:214816201C>G	ENST00000366955.3	+	12	4688	c.4520C>G	c.(4519-4521)tCt>tGt	p.S1507C		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	1603	2 X 96 AA approximate tandem repeats.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GGAGATATGTCTCTTTTGAGT	0.453																																					Colon(80;575 1284 11000 14801 43496)												0													46.0	47.0	47.0					1																	214816201		2203	4300	6503	SO:0001583	missense	1063			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.4520C>G	1.37:g.214816201C>G	ENSP00000355922:p.Ser1507Cys		Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	pfam_Centromere_CenpF_N,pfam_Centromere_CenpF_leu-rich_rpt,pfam_Centromere_CenpF_Rb-prot-bd	p.S1507C	ENST00000366955.3	37	c.4520	CCDS31023.1	1	.	.	.	.	.	.	.	.	.	.	C	1.637	-0.517485	0.04171	.	.	ENSG00000117724	ENST00000366955	T	0.33654	1.4	5.14	3.24	0.37175	.	0.476527	0.15742	N	0.246853	T	0.21921	0.0528	N	0.25485	0.75	0.09310	N	1	B	0.21225	0.053	B	0.14023	0.01	T	0.17048	-1.0382	10	0.44086	T	0.13	.	4.1431	0.10203	0.204:0.5801:0.1305:0.0854	.	1507	P49454	CENPF_HUMAN	C	1507	ENSP00000355922:S1507C	ENSP00000355922:S1507C	S	+	2	0	CENPF	212882824	0.005000	0.15991	0.004000	0.12327	0.070000	0.16714	1.447000	0.35101	0.539000	0.28788	0.655000	0.94253	TCT	CENPF	-	NULL		0.453	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPF	HGNC	protein_coding	OTTHUMT00000089749.1	C	NM_016343		214816201	+1	no_errors	ENST00000366955	ensembl	human	known	70_37	missense	SNP	0.002	G
CEP95	90799	genome.wustl.edu	37	17	62533224	62533224	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:62533224G>A	ENST00000556440.2	+	19	2793	c.2283G>A	c.(2281-2283)caG>caA	p.Q761Q	CEP95_ENST00000553412.1_Silent_p.Q597Q	NM_138363.1	NP_612372.1	Q96GE4	CEP95_HUMAN	centrosomal protein 95kDa	761						centrosome (GO:0005813)|cytoplasm (GO:0005737)|spindle pole (GO:0000922)				endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)	13						AGAAATCTCAGGCCCAGGTAA	0.393																																																	0													38.0	37.0	37.0					17																	62533224		1841	4087	5928	SO:0001819	synonymous_variant	90799			AL832822	CCDS45763.1	17q24.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000258890	ENSG00000258890			25141	protein-coding gene	gene with protein product			"""coiled-coil domain containing 45"""	CCDC45		21399614	Standard	NM_138363		Approved	DKFZp667E1824	uc002jem.3	Q96GE4	OTTHUMG00000179174	ENST00000556440.2:c.2283G>A	17.37:g.62533224G>A			B4DMD2|Q96M81	Silent	SNP	superfamily_CH-domain	p.Q761	ENST00000556440.2	37	c.2283	CCDS45763.1	17																																																																																			CEP95	-	NULL		0.393	CEP95-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP95	HGNC	protein_coding	OTTHUMT00000445100.2	G	NM_138363		62533224	+1	no_errors	ENST00000556440	ensembl	human	known	70_37	silent	SNP	0.992	A
CEP112	201134	genome.wustl.edu	37	17	63739336	63739336	+	Splice_Site	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:63739336C>T	ENST00000392769.2	-	23	2676		c.e23-1		CEP112_ENST00000535342.2_Splice_Site|CEP112_ENST00000580482.1_Splice_Site|CEP112_ENST00000541355.1_Intron|CEP112_ENST00000317442.8_Splice_Site|CEP112_ENST00000537949.1_Splice_Site	NM_145036.3	NP_659473.2	Q8N8E3	CE112_HUMAN	centrosomal protein 112kDa						receptor localization to synapse (GO:0097120)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(8)|lung(11)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	28						CTGCTATGATCTAAAATGAAA	0.388																																																	0													71.0	74.0	73.0					17																	63739336		2203	4300	6503	SO:0001630	splice_region_variant	201134			AF458591	CCDS32710.1, CCDS32711.1	17q24.2	2014-02-20	2011-05-06	2011-05-06	ENSG00000154240	ENSG00000154240			28514	protein-coding gene	gene with protein product			"""coiled-coil domain containing 46"""	CCDC46		21399614	Standard	NM_145036		Approved	MGC33887	uc002jfl.3	Q8N8E3		ENST00000392769.2:c.2458-1G>A	17.37:g.63739336C>T			Q6PIB5|Q8NCR4|Q8NFR4	Splice_Site	SNP	-	e22-1	ENST00000392769.2	37	c.2458-1	CCDS32710.1	17	.	.	.	.	.	.	.	.	.	.	C	16.30	3.083549	0.55861	.	.	ENSG00000154240	ENST00000535342;ENST00000392769;ENST00000317442;ENST00000537949	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7571	0.96298	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CEP112	61169798	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.580000	0.67464	2.758000	0.94735	0.561000	0.74099	.	CEP112	-	-		0.388	CEP112-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP112	HGNC	protein_coding	OTTHUMT00000446582.1	C	NM_145036	Intron	63739336	-1	no_errors	ENST00000392769	ensembl	human	known	70_37	splice_site	SNP	1.000	T
CHAF1A	10036	genome.wustl.edu	37	19	4433403	4433403	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:4433403C>T	ENST00000301280.5	+	13	2641	c.2540C>T	c.(2539-2541)tCg>tTg	p.S847L	CTB-50L17.5_ENST00000590159.1_RNA	NM_005483.2	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	847	Binds to p60.				cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|identical protein binding (GO:0042802)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	27		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		TCGGTGCCCTCGGCCCCCAAA	0.647								Chromatin Structure																																									0													51.0	50.0	50.0					19																	4433403		2203	4300	6503	SO:0001583	missense	10036			U20979	CCDS32875.1	19p13.3	2008-07-16				ENSG00000167670			1910	protein-coding gene	gene with protein product	"""chromatin assembly factor I (150 kDa)"""	601246				7600578	Standard	NM_005483		Approved	CAF1P150, CAF1B, CAF-1, CAF1, P150, MGC71229	uc002mal.3	Q13111		ENST00000301280.5:c.2540C>T	19.37:g.4433403C>T	ENSP00000301280:p.Ser847Leu		Q6NXG5|Q7Z7K3|Q9UJY8	Missense_Mutation	SNP	pfam_CAF1A,pfam_CAF-1_p150	p.S847L	ENST00000301280.5	37	c.2540	CCDS32875.1	19	.	.	.	.	.	.	.	.	.	.	C	11.45	1.641672	0.29157	.	.	ENSG00000167670	ENST00000301280	T	0.30981	1.51	5.62	5.62	0.85841	.	.	.	.	.	T	0.31451	0.0797	M	0.63843	1.955	0.09310	N	0.999998	P	0.51449	0.945	B	0.36464	0.225	T	0.38156	-0.9674	8	.	.	.	-2.2534	15.8183	0.78621	0.0:0.8641:0.1359:0.0	.	847	Q13111	CAF1A_HUMAN	L	847	ENSP00000301280:S847L	.	S	+	2	0	CHAF1A	4384403	0.970000	0.33590	0.054000	0.19295	0.056000	0.15407	4.206000	0.58473	2.653000	0.90120	0.650000	0.86243	TCG	CHAF1A	-	NULL		0.647	CHAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHAF1A	HGNC	protein_coding	OTTHUMT00000458310.2	C	NM_005483		4433403	+1	no_errors	ENST00000301280	ensembl	human	known	70_37	missense	SNP	0.175	T
CHD5	26038	genome.wustl.edu	37	1	6214792	6214792	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:6214792G>A	ENST00000262450.3	-	5	772	c.673C>T	c.(673-675)Ccg>Tcg	p.P225S	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		ACGGCTAGCGGAGGGGAGATG	0.687																																																	0													22.0	21.0	21.0					1																	6214792		2198	4299	6497	SO:0001583	missense	26038			AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.673C>T	1.37:g.6214792G>A	ENSP00000262450:p.Pro225Ser		A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.P225S	ENST00000262450.3	37	c.673	CCDS57.1	1	.	.	.	.	.	.	.	.	.	.	G	9.388	1.074838	0.20227	.	.	ENSG00000116254	ENST00000262450	D	0.90261	-2.64	3.84	3.84	0.44239	.	0.079650	0.50627	D	0.000104	D	0.86146	0.5863	L	0.48642	1.525	0.80722	D	1	B	0.25667	0.131	B	0.19666	0.026	D	0.83875	0.0276	10	0.38643	T	0.18	-26.6664	12.6819	0.56926	0.0:0.1667:0.8333:0.0	.	225	Q8TDI0	CHD5_HUMAN	S	225	ENSP00000262450:P225S	ENSP00000262450:P225S	P	-	1	0	CHD5	6137379	0.113000	0.22115	0.908000	0.35775	0.048000	0.14542	1.051000	0.30417	1.876000	0.54355	0.313000	0.20887	CCG	CHD5	-	NULL		0.687	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD5	HGNC	protein_coding	OTTHUMT00000002823.2	G	NM_015557		6214792	-1	no_errors	ENST00000262450	ensembl	human	known	70_37	missense	SNP	0.930	A
PCGF2	7703	genome.wustl.edu	37	17	36890988	36890988	+	3'UTR	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:36890988G>C	ENST00000580830.1	-	0	2224				CISD3_ENST00000578573.1_3'UTR|RNA5SP440_ENST00000363245.1_RNA|PCGF2_ENST00000581345.1_3'UTR|PCGF2_ENST00000360797.2_3'UTR|CISD3_ENST00000439660.2_3'UTR			P35227	PCGF2_HUMAN	polycomb group ring finger 2						anterior/posterior pattern specification (GO:0009952)|cellular response to hydrogen peroxide (GO:0070301)|embryonic skeletal system morphogenesis (GO:0048704)|histone acetylation (GO:0016573)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	10	Breast(7;9.07e-22)					CAGCAGCCAAGATGGGGAGAG	0.507																																																	0																																										SO:0001624	3_prime_UTR_variant	284106			D13969	CCDS32638.1	17q12	2013-01-09	2005-01-17	2005-01-19		ENSG00000277258		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	12929	protein-coding gene	gene with protein product		600346	"""ring finger protein 110"""	ZNF144, RNF110		8325509	Standard	NM_007144		Approved	MEL-18	uc002hqp.1	P35227		ENST00000580830.1:c.*488C>G	17.37:g.36890988G>C			A6NGD8	RNA	SNP	-	NULL	ENST00000580830.1	37	NULL	CCDS32638.1	17																																																																																			CISD3	-	-		0.507	PCGF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CISD3	HGNC	protein_coding	OTTHUMT00000442246.2	G	NM_007144		36890988	+1	no_errors	ENST00000578573	ensembl	human	known	70_37	rna	SNP	0.001	C
CLCN1	1180	genome.wustl.edu	37	7	143018499	143018499	+	Missense_Mutation	SNP	C	C	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr7:143018499C>A	ENST00000343257.2	+	4	562	c.475C>A	c.(475-477)Ctg>Atg	p.L159M		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	159					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					CAGCCTTCCTCTGCAGTTCCT	0.602																																																	0													291.0	213.0	239.0					7																	143018499		2203	4300	6503	SO:0001583	missense	1180			Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.475C>A	7.37:g.143018499C>A	ENSP00000339867:p.Leu159Met		A4D2H5|Q2M202	Missense_Mutation	SNP	pfam_Cl-channel_volt-gated,pfam_Cysta_beta_synth_core,superfamily_Cl-channel_core,prints_Cl-channel_volt-gated,prints_Cl_channel-1	p.L159M	ENST00000343257.2	37	c.475	CCDS5881.1	7	.	.	.	.	.	.	.	.	.	.	.	14.98	2.696156	0.48202	.	.	ENSG00000188037	ENST00000343257	D	0.94000	-3.33	5.03	5.03	0.67393	Chloride channel, core (2);	0.154793	0.43919	D	0.000502	D	0.92195	0.7525	M	0.83223	2.63	0.38598	D	0.950599	P	0.36647	0.563	B	0.34722	0.188	D	0.92294	0.5844	10	0.48119	T	0.1	.	9.5739	0.39445	0.1425:0.7807:0.0:0.0768	.	159	P35523	CLCN1_HUMAN	M	159	ENSP00000339867:L159M	ENSP00000339867:L159M	L	+	1	2	CLCN1	142728621	0.844000	0.29557	1.000000	0.80357	0.927000	0.56198	1.722000	0.38042	2.353000	0.79882	0.555000	0.69702	CTG	CLCN1	-	superfamily_Cl-channel_core		0.602	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN1	HGNC	protein_coding	OTTHUMT00000327420.1	C	NM_000083		143018499	+1	no_errors	ENST00000343257	ensembl	human	known	70_37	missense	SNP	0.979	A
CLCNKA	1187	genome.wustl.edu	37	1	16358720	16358720	+	Silent	SNP	C	C	T	rs149572981		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:16358720C>T	ENST00000331433.4	+	17	1798	c.1779C>T	c.(1777-1779)atC>atT	p.I593I	CLCNKA_ENST00000375692.1_Silent_p.I593I|CLCNKA_ENST00000464764.1_3'UTR|CLCNKA_ENST00000420078.1_Silent_p.I593I|CLCNKA_ENST00000439316.2_Silent_p.I550I			P51800	CLCKA_HUMAN	chloride channel, voltage-sensitive Ka	593	CBS 1. {ECO:0000255|PROSITE- ProRule:PRU00703}.				excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(1)	19		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	TGGTAGGCATCGTGCAGAGGG	0.632																																																	0								C	,	1,4405		0,1,2202	40.0	40.0	40.0		1779,1779	-7.1	0.0	1	dbSNP_134	40	0,8592		0,0,4296	no	coding-synonymous,coding-synonymous	CLCNKA	NM_001042704.1,NM_004070.3	,	0,1,6498	TT,TC,CC		0.0,0.0227,0.0077	,	593/687,593/688	16358720	1,12997	2203	4296	6499	SO:0001819	synonymous_variant	1187				CCDS167.1, CCDS41269.1, CCDS57973.1	1p36	2012-09-26	2012-02-23		ENSG00000186510	ENSG00000186510		"""Ion channels / Chloride channels : Voltage-sensitive"""	2026	protein-coding gene	gene with protein product		602024	"""chloride channel Ka"""			8544406	Standard	NM_004070		Approved	hClC-Ka	uc001axu.3	P51800	OTTHUMG00000009529	ENST00000331433.4:c.1779C>T	1.37:g.16358720C>T			B4DPD3|E7EPH6|Q5T5P8|Q5T5Q4|Q7Z6D1|Q86VT1	Silent	SNP	pfam_Cl-channel_volt-gated,pfam_Cysta_beta_synth_core,superfamily_Cl-channel_core,smart_Cysta_beta_synth_core,prints_Cl-channel_volt-gated,prints_Cl_channel-K	p.I593	ENST00000331433.4	37	c.1779	CCDS167.1	1																																																																																			CLCNKA	-	pfam_Cysta_beta_synth_core,smart_Cysta_beta_synth_core		0.632	CLCNKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLCNKA	HGNC	protein_coding	OTTHUMT00000026326.1	C			16358720	+1	no_errors	ENST00000331433	ensembl	human	known	70_37	silent	SNP	0.000	T
CLEC12A	160364	genome.wustl.edu	37	12	10134688	10134688	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr12:10134688C>T	ENST00000304361.4	+	5	783	c.601C>T	c.(601-603)Cgt>Tgt	p.R201C	CLEC12A_ENST00000350667.4_Missense_Mutation_p.R168C|CLEC12A_ENST00000434319.2_Missense_Mutation_p.R201C|CLEC12A_ENST00000355690.4_Missense_Mutation_p.R211C	NM_138337.5|NM_201623.3	NP_612210.4|NP_963917.2	Q5QGZ9	CL12A_HUMAN	C-type lectin domain family 12, member A	201	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	16						AGATTCCACTCGTGGTATGAG	0.363																																					Melanoma(197;1487 2125 16611 22221 34855)												0													78.0	79.0	79.0					12																	10134688		2203	4299	6502	SO:0001583	missense	160364			AY498550	CCDS8608.1, CCDS8609.1, CCDS55803.1, CCDS73442.1	12p13.31	2010-08-17			ENSG00000172322	ENSG00000172322		"""C-type lectin domain containing"""	31713	protein-coding gene	gene with protein product		612088					Standard	NM_201623		Approved	CLL-1, MICL	uc001qwq.3	Q5QGZ9		ENST00000304361.4:c.601C>T	12.37:g.10134688C>T	ENSP00000302804:p.Arg201Cys		B2RA16|Q6P4H1|Q6RH77|Q6RH78|Q8TDQ6	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.R211C	ENST00000304361.4	37	c.631	CCDS8608.1	12	.	.	.	.	.	.	.	.	.	.	C	0.098	-1.156190	0.01686	.	.	ENSG00000172322	ENST00000355690;ENST00000304361;ENST00000434319;ENST00000350667	T;T;T;T	0.19394	2.15;2.15;3.93;2.15	4.31	-8.62	0.00881	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	.	.	.	.	T	0.06645	0.0170	N	0.19112	0.55	0.09310	N	1	B;P;P	0.50443	0.18;0.7;0.935	B;B;B	0.25405	0.01;0.06;0.058	T	0.63712	-0.6575	9	0.56958	D	0.05	.	4.1545	0.10254	0.3517:0.4058:0.1335:0.1089	.	168;201;211	Q5QGZ9-4;Q5QGZ9;Q5QGZ9-1	.;CL12A_HUMAN;.	C	211;201;201;168	ENSP00000347916:R211C;ENSP00000302804:R201C;ENSP00000405244:R201C;ENSP00000345448:R168C	ENSP00000302804:R201C	R	+	1	0	CLEC12A	10025955	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-9.417000	0.00011	-7.724000	0.00000	-2.102000	0.00361	CGT	CLEC12A	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin		0.363	CLEC12A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CLEC12A	HGNC	protein_coding	OTTHUMT00000399545.1	C	NM_138337		10134688	+1	no_errors	ENST00000355690	ensembl	human	known	70_37	missense	SNP	0.000	T
CMPK2	129607	genome.wustl.edu	37	2	7003658	7003658	+	Missense_Mutation	SNP	A	A	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:7003658A>G	ENST00000256722.5	-	2	726	c.727T>C	c.(727-729)Tgc>Cgc	p.C243R	CMPK2_ENST00000404168.1_Missense_Mutation_p.C243R|CMPK2_ENST00000458098.1_Missense_Mutation_p.C243R|CMPK2_ENST00000478738.1_5'UTR	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial	243					cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TGTTTTGGGCACTGGTCGACC	0.473																																																	0													116.0	117.0	117.0					2																	7003658		1899	4116	6015	SO:0001583	missense	129607				CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.727T>C	2.37:g.7003658A>G	ENSP00000256722:p.Cys243Arg		A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	Missense_Mutation	SNP	pirsf_UMP-CMP_kinase_mit	p.C243R	ENST00000256722.5	37	c.727	CCDS42648.1	2	.	.	.	.	.	.	.	.	.	.	A	5.876	0.345788	0.11126	.	.	ENSG00000134326	ENST00000458098;ENST00000256722;ENST00000404168	T	0.45668	0.89	5.21	5.21	0.72293	.	0.248768	0.40908	D	0.000990	T	0.33731	0.0873	L	0.41710	1.295	0.58432	D	0.999999	P;P	0.44090	0.762;0.826	B;B	0.41571	0.36;0.196	T	0.11324	-1.0592	10	0.07325	T	0.83	-21.7121	15.0828	0.72127	1.0:0.0:0.0:0.0	.	243;243	Q5EBM0-3;Q5EBM0	.;CMPK2_HUMAN	R	243	ENSP00000256722:C243R	ENSP00000256722:C243R	C	-	1	0	CMPK2	6921109	1.000000	0.71417	1.000000	0.80357	0.570000	0.35934	4.106000	0.57804	1.968000	0.57251	0.455000	0.32223	TGC	CMPK2	-	pirsf_UMP-CMP_kinase_mit		0.473	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	CMPK2	HGNC	protein_coding	OTTHUMT00000323339.2	A	NM_207315		7003658	-1	no_errors	ENST00000458098	ensembl	human	known	70_37	missense	SNP	1.000	G
CMYA5	202333	genome.wustl.edu	37	5	79034399	79034399	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr5:79034399G>A	ENST00000446378.2	+	2	9842	c.9811G>A	c.(9811-9813)Gat>Aat	p.D3271N		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	3271					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TGGTAAGGATGATTCATACCA	0.428																																																	0													96.0	92.0	93.0					5																	79034399		1874	4117	5991	SO:0001583	missense	202333			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.9811G>A	5.37:g.79034399G>A	ENSP00000394770:p.Asp3271Asn		A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.D3271N	ENST00000446378.2	37	c.9811	CCDS47238.1	5	.	.	.	.	.	.	.	.	.	.	G	16.78	3.219011	0.58560	.	.	ENSG00000164309	ENST00000446378	T	0.25250	1.81	5.89	5.89	0.94794	.	0.235594	0.29948	N	0.010784	T	0.48572	0.1507	M	0.69823	2.125	0.36536	D	0.870991	D	0.71674	0.998	P	0.61940	0.896	T	0.56745	-0.7928	10	0.72032	D	0.01	.	15.7577	0.78046	0.0:0.0:1.0:0.0	.	3271	Q8N3K9	CMYA5_HUMAN	N	3271	ENSP00000394770:D3271N	ENSP00000394770:D3271N	D	+	1	0	CMYA5	79070155	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	2.444000	0.44890	2.783000	0.95769	0.655000	0.94253	GAT	CMYA5	-	NULL		0.428	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	HGNC	protein_coding	OTTHUMT00000369497.1	G	NM_153610		79034399	+1	no_errors	ENST00000446378	ensembl	human	known	70_37	missense	SNP	1.000	A
CNIH3	149111	genome.wustl.edu	37	1	224918244	224918244	+	Silent	SNP	G	G	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:224918244G>T	ENST00000272133.3	+	4	1161	c.279G>T	c.(277-279)ctG>ctT	p.L93L	RP11-3L21.2_ENST00000431691.1_RNA	NM_152495.1	NP_689708.1	Q8TBE1	CNIH3_HUMAN	cornichon family AMPA receptor auxiliary protein 3	93					intracellular signal transduction (GO:0035556)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of membrane potential (GO:0042391)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendritic shaft (GO:0043198)|postsynaptic membrane (GO:0045211)	channel regulator activity (GO:0016247)			large_intestine(5)|lung(4)	9	Breast(184;0.218)			GBM - Glioblastoma multiforme(131;0.073)		CGCTGGGGCTGAATGTCCCTC	0.517																																																	0													134.0	107.0	116.0					1																	224918244		2197	4282	6479	SO:0001819	synonymous_variant	149111			AF070524	CCDS1544.1	1q42.12	2013-08-28	2013-08-28		ENSG00000143786	ENSG00000143786			26802	protein-coding gene	gene with protein product			"""cornichon homolog 3 (Drosophila)"""			8619474, 9110174	Standard	NM_152495		Approved	FLJ38993, CNIH-3	uc001hos.1	Q8TBE1	OTTHUMG00000037634	ENST00000272133.3:c.279G>T	1.37:g.224918244G>T				Silent	SNP	pfam_Cornichon	p.L93	ENST00000272133.3	37	c.279	CCDS1544.1	1																																																																																			CNIH3	-	pfam_Cornichon		0.517	CNIH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNIH3	HGNC	protein_coding	OTTHUMT00000091752.2	G	NM_152495		224918244	+1	no_errors	ENST00000272133	ensembl	human	known	70_37	silent	SNP	0.997	T
CNNM4	26504	genome.wustl.edu	37	2	97475253	97475253	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:97475253G>A	ENST00000377075.2	+	7	2425	c.2327G>A	c.(2326-2328)tGa>tAa	p.*776*	CNNM4_ENST00000540067.1_3'UTR|RP11-353K11.1_ENST00000608609.1_lincRNA	NM_020184.3	NP_064569.3	Q6P4Q7	CNNM4_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 4	0					biomineral tissue development (GO:0031214)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)			breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)	20						AATGCCATCTGACAGGAGGGC	0.602																																																	0													60.0	53.0	55.0					2																	97475253		2203	4300	6503	SO:0001819	synonymous_variant	26504			AB046812	CCDS2024.2	2q11.2	2014-08-08	2014-08-07		ENSG00000158158	ENSG00000158158			105	protein-coding gene	gene with protein product		607805	"""cyclin M4"""	ACDP4		21393841, 24194943	Standard	XM_005263914		Approved	KIAA1592	uc002swx.3	Q6P4Q7	OTTHUMG00000130532	ENST00000377075.2:c.2327G>A	2.37:g.97475253G>A			B7Z1U0|C7SQM3|C7SQM4|C7SQM5|Q53RE5|Q9H9G3|Q9HCI0|Q9NRN1	Silent	SNP	pfam_DUF21,pfam_Cysta_beta_synth_core,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom	p.*776	ENST00000377075.2	37	c.2327	CCDS2024.2	2																																																																																			CNNM4	-	NULL		0.602	CNNM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNNM4	HGNC	protein_coding	OTTHUMT00000252954.1	G	NM_020184		97475253	+1	no_errors	ENST00000377075	ensembl	human	known	70_37	silent	SNP	1.000	A
COASY	80347	genome.wustl.edu	37	17	40715126	40715126	+	Silent	SNP	C	C	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:40715126C>A	ENST00000393818.2	+	1	942	c.486C>A	c.(484-486)ccC>ccA	p.P162P	COASY_ENST00000449624.1_De_novo_Start_InFrame|COASY_ENST00000590958.1_Silent_p.P191P|RP11-400F19.8_ENST00000585572.1_RNA|COASY_ENST00000421097.2_Silent_p.P162P|COASY_ENST00000420359.1_Silent_p.P162P	NM_025233.6	NP_079509.5	Q13057	COASY_HUMAN	CoA synthase	162					cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|dephospho-CoA kinase activity (GO:0004140)|pantetheine-phosphate adenylyltransferase activity (GO:0004595)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	21		all_cancers(22;1.06e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)		GAGAAGTGCCCGTGGAGCCCC	0.617																																																	0													93.0	92.0	92.0					17																	40715126		2203	4300	6503	SO:0001819	synonymous_variant	80347			AF453478	CCDS11429.1, CCDS45685.1	17q12-q21	2010-04-30	2010-04-30			ENSG00000068120	2.7.7.3		29932	protein-coding gene	gene with protein product		609855	"""Coenzyme A synthase"""			11923312, 11980892	Standard	NM_025233		Approved	DPCK, NBP, CoASY, PPAT	uc010cyj.4	Q13057		ENST00000393818.2:c.486C>A	17.37:g.40715126C>A			B2RA78|B4DLU0|Q6GS23|Q8NBM7|Q8NEW1|Q8WXD4|Q9NRM3	Silent	SNP	pfam_Depp_CoAkinase,pfam_Cytidylyltransf,tigrfam_Depp_CoAkinase	p.P191	ENST00000393818.2	37	c.573	CCDS11429.1	17	.	.	.	.	.	.	.	.	.	.	C	3.620	-0.077745	0.07184	.	.	ENSG00000068120	ENST00000426807	.	.	.	5.57	-4.91	0.03085	.	.	.	.	.	T	0.48390	0.1497	.	.	.	0.24891	N	0.99216	.	.	.	.	.	.	T	0.56492	-0.7970	5	0.87932	D	0	-7.0514	12.2687	0.54693	0.0:0.3296:0.0:0.6704	.	.	.	.	S	138	.	ENSP00000390306:R138S	R	+	1	0	COASY	37968652	0.615000	0.27026	0.000000	0.03702	0.363000	0.29612	-0.214000	0.09292	-1.353000	0.02191	-0.258000	0.10820	CGT	COASY	-	NULL		0.617	COASY-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	COASY	HGNC	protein_coding	OTTHUMT00000450409.1	C	NM_025233		40715126	+1	no_errors	ENST00000590958	ensembl	human	known	70_37	silent	SNP	0.000	A
COPS4	51138	genome.wustl.edu	37	4	83987636	83987636	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr4:83987636C>T	ENST00000264389.2	+	8	1067	c.932C>T	c.(931-933)tCt>tTt	p.S311F	COPS4_ENST00000509093.1_Missense_Mutation_p.S311F|COPS4_ENST00000511653.1_Missense_Mutation_p.S311F|COPS4_ENST00000503682.1_Missense_Mutation_p.S343F	NM_016129.2	NP_057213.2	Q9BT78	CSN4_HUMAN	COP9 signalosome subunit 4	311	PCI.				cullin deneddylation (GO:0010388)|protein deneddylation (GO:0000338)	cell junction (GO:0030054)|COP9 signalosome (GO:0008180)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)				endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|urinary_tract(2)	13		Hepatocellular(203;0.114)				AATTTGTTGTCTGCAAGCAAA	0.318																																																	0													83.0	88.0	86.0					4																	83987636		2202	4295	6497	SO:0001583	missense	51138			AF100757	CCDS3600.1, CCDS58909.1	4q21.22	2013-03-14	2013-03-14		ENSG00000138663	ENSG00000138663			16702	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 4"", ""COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)"""			9707402	Standard	NM_016129		Approved	CSN4	uc003hoa.3	Q9BT78	OTTHUMG00000130298	ENST00000264389.2:c.932C>T	4.37:g.83987636C>T	ENSP00000264389:p.Ser311Phe		B3KN88|B3KST5|Q561W7|Q9NW31|Q9Y677	Missense_Mutation	SNP	pfam_PCI_dom,smart_PCI_dom	p.S311F	ENST00000264389.2	37	c.932	CCDS3600.1	4	.	.	.	.	.	.	.	.	.	.	C	22.1	4.245785	0.80024	.	.	ENSG00000138663	ENST00000509093;ENST00000264389;ENST00000509317;ENST00000503682;ENST00000511653	T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46	5.23	4.39	0.52855	Winged helix-turn-helix transcription repressor DNA-binding (1);Proteasome component (PCI) domain (2);	0.059335	0.64402	N	0.000001	T	0.57770	0.2076	M	0.83223	2.63	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.76575	0.985;0.983;0.979;0.988	T	0.64601	-0.6369	10	0.62326	D	0.03	-3.9396	13.9609	0.64177	0.0:0.9272:0.0:0.0727	.	311;343;311;311	B3KST5;D6RFN0;D6RAX7;Q9BT78	.;.;.;CSN4_HUMAN	F	311;311;199;343;311	ENSP00000425976:S311F;ENSP00000264389:S311F;ENSP00000425486:S199F;ENSP00000424791:S343F;ENSP00000424655:S311F	ENSP00000264389:S311F	S	+	2	0	COPS4	84206660	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.367000	0.79558	1.447000	0.47661	-0.140000	0.14226	TCT	COPS4	-	pfam_PCI_dom,smart_PCI_dom		0.318	COPS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPS4	HGNC	protein_coding	OTTHUMT00000252643.1	C			83987636	+1	no_errors	ENST00000264389	ensembl	human	known	70_37	missense	SNP	1.000	T
CORO7	79585	genome.wustl.edu	37	16	4410478	4410478	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr16:4410478G>A	ENST00000251166.4	-	20	2134	c.1989C>T	c.(1987-1989)gtC>gtT	p.V663V	CORO7_ENST00000423908.2_3'UTR|CORO7_ENST00000539968.1_Silent_p.V443V|CORO7_ENST00000574025.1_Silent_p.V578V|CORO7-PAM16_ENST00000572467.1_Silent_p.V663V|CORO7-PAM16_ENST00000572274.1_5'Flank|CORO7_ENST00000537233.2_Silent_p.V645V	NM_024535.4	NP_078811.3	P57737	CORO7_HUMAN	coronin 7	663					actin filament polymerization (GO:0030041)|Golgi to endosome transport (GO:0006895)|protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)			breast(3)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|prostate(2)|skin(2)|urinary_tract(2)	23						GGGGCCTGTAGACCCGCACAC	0.657																																																	0													37.0	41.0	40.0					16																	4410478		2193	4297	6490	SO:0001819	synonymous_variant	100529144			AK097238	CCDS10513.1, CCDS55982.1, CCDS58417.1	16p13.3	2013-01-10			ENSG00000262246	ENSG00000262246		"""Coronins"", ""WD repeat domain containing"""	26161	protein-coding gene	gene with protein product		611668				15327992	Standard	NM_024535		Approved	FLJ22021		P57737	OTTHUMG00000129465	ENST00000251166.4:c.1989C>T	16.37:g.4410478G>A			B4DFD6|B4DL18|I3L416|Q17RK4	Silent	SNP	pfam_DUF1900,pfam_Protein_transpt,pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V663	ENST00000251166.4	37	c.1989	CCDS10513.1	16																																																																																			CORO7-PAM16	-	pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.657	CORO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORO7-PAM16	HGNC	protein_coding	OTTHUMT00000251628.2	G	NM_024535		4410478	-1	no_errors	ENST00000572467	ensembl	human	known	70_37	silent	SNP	1.000	A
CROCCP2	84809	genome.wustl.edu	37	1	16946164	16946164	+	lincRNA	SNP	A	A	G	rs59600364		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:16946164A>G	ENST00000412962.1	-	0	1355				RP5-1182A14.5_ENST00000607700.1_lincRNA			Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											catggagcacagcaaagcctc	0.592																																																	0																																												84809			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16946164A>G			Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-		0.592	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	A	NR_026752.1		16946164	-1	no_errors	ENST00000412962	ensembl	human	known	70_37	rna	SNP	0.012	G
CRYGD	1421	genome.wustl.edu	37	2	208988953	208988953	+	Silent	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:208988953G>C	ENST00000264376.4	-	2	162	c.135C>G	c.(133-135)ctC>ctG	p.L45L		NM_006891.3	NP_008822.2	P07320	CRGD_HUMAN	crystallin, gamma D	45	Beta/gamma crystallin 'Greek key' 2. {ECO:0000255|PROSITE-ProRule:PRU00028}.				cellular response to reactive oxygen species (GO:0034614)|lens development in camera-type eye (GO:0002088)|lens fiber cell differentiation (GO:0070306)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	structural constituent of eye lens (GO:0005212)			breast(1)|endometrium(1)|lung(3)	5				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.0858)|Lung(261;0.133)		GCTGCTCATAGAGCATCCAGC	0.657																																																	0													12.0	14.0	13.0					2																	208988953		2194	4285	6479	SO:0001819	synonymous_variant	1421				CCDS2378.1	2q33.3	2013-02-14			ENSG00000118231	ENSG00000118231			2411	protein-coding gene	gene with protein product		123690		CRYG4			Standard	NM_006891		Approved		uc002vcn.4	P07320	OTTHUMG00000132944	ENST00000264376.4:c.135C>G	2.37:g.208988953G>C			Q17RF7|Q53R51|Q99681	Silent	SNP	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.L45	ENST00000264376.4	37	c.135	CCDS2378.1	2																																																																																			CRYGD	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin		0.657	CRYGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYGD	HGNC	protein_coding	OTTHUMT00000256476.2	G	NM_006891		208988953	-1	no_errors	ENST00000264376	ensembl	human	known	70_37	silent	SNP	1.000	C
CSF2RB	1439	genome.wustl.edu	37	22	37333842	37333842	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr22:37333842G>A	ENST00000403662.3	+	14	2214	c.1992G>A	c.(1990-1992)ggG>ggA	p.G664G	CSF2RB_ENST00000406230.1_Silent_p.G670G|CSF2RB_ENST00000536485.1_Silent_p.G611G|CSF2RB_ENST00000262825.5_Silent_p.G670G			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	664					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	GGGCTGCAGGGAGTCCCTCCC	0.677																																																	0													15.0	18.0	17.0					22																	37333842		2201	4294	6495	SO:0001819	synonymous_variant	1439			M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.1992G>A	22.37:g.37333842G>A			Q5JZI1|Q6ICE0	Silent	SNP	pfam_Fibronectin_type3,pfam_IL6_recept-bd,pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pirsf_IL3_rcpt_beta,pfscan_Fibronectin_type3	p.G670	ENST00000403662.3	37	c.2010	CCDS13936.1	22																																																																																			CSF2RB	-	pirsf_IL3_rcpt_beta		0.677	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF2RB	HGNC	protein_coding	OTTHUMT00000318854.1	G	NM_000395		37333842	+1	no_errors	ENST00000262825	ensembl	human	known	70_37	silent	SNP	0.001	A
CSMD1	64478	genome.wustl.edu	37	8	3889497	3889497	+	Silent	SNP	G	G	A	rs368684088		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr8:3889497G>A	ENST00000520002.1	-	4	1095	c.540C>T	c.(538-540)caC>caT	p.H180H	CSMD1_ENST00000537824.1_Silent_p.H180H|CSMD1_ENST00000602723.1_Silent_p.H180H|CSMD1_ENST00000400186.3_Silent_p.H180H|CSMD1_ENST00000542608.1_Silent_p.H180H|CSMD1_ENST00000539096.1_Silent_p.H180H|CSMD1_ENST00000602557.1_Silent_p.H180H			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	180	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.H180H(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TCAGGATGGCGTGGCCTTCCA	0.542																																																	1	Substitution - coding silent(1)	prostate(1)						G		0,4236		0,0,2118	109.0	119.0	116.0		540	-4.2	0.3	8		116	1,8499		0,1,4249	no	coding-synonymous	CSMD1	NM_033225.5		0,1,6367	AA,AG,GG		0.0118,0.0,0.0079		180/3565	3889497	1,12735	2118	4250	6368	SO:0001819	synonymous_variant	64478					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.540C>T	8.37:g.3889497G>A			Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.H180	ENST00000520002.1	37	c.540		8																																																																																			CSMD1	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.542	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	G	NM_033225		3889497	-1	no_errors	ENST00000520002	ensembl	human	known	70_37	silent	SNP	0.406	A
CSPP1	79848	genome.wustl.edu	37	8	68062107	68062107	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr8:68062107C>T	ENST00000262210.5	+	16	2081	c.2050C>T	c.(2050-2052)Cta>Tta	p.L684L	CSPP1_ENST00000412460.1_Intron	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1	719					positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)				NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			TGTTGTATCTCTAGACCCAAA	0.333																																																	0													206.0	205.0	205.0					8																	68062107		1860	4089	5949	SO:0001819	synonymous_variant	79848			AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.2050C>T	8.37:g.68062107C>T			A6ND63|Q70F00|Q8TBC1	Silent	SNP	NULL	p.L684	ENST00000262210.5	37	c.2050	CCDS43744.1	8																																																																																			CSPP1	-	NULL		0.333	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CSPP1	HGNC	protein_coding	OTTHUMT00000379254.1	C	NM_024790		68062107	+1	no_errors	ENST00000262210	ensembl	human	known	70_37	silent	SNP	1.000	T
CSMD3	114788	genome.wustl.edu	37	8	114031408	114031408	+	Splice_Site	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr8:114031408C>T	ENST00000297405.5	-	6	1162	c.918G>A	c.(916-918)tgG>tgA	p.W306*	CSMD3_ENST00000352409.3_Splice_Site_p.W306*|CSMD3_ENST00000343508.3_Splice_Site_p.W266*|CSMD3_ENST00000455883.2_Splice_Site_p.W306*	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	306	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TTCCAGATAACCTGAATTACA	0.343										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0													150.0	139.0	143.0					8																	114031408		2203	4300	6503	SO:0001630	splice_region_variant	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.918-1G>A	8.37:g.114031408C>T			Q96PZ3	Nonsense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.W306*	ENST00000297405.5	37	c.918	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	C	36	5.879227	0.97055	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000455883;ENST00000352409	.	.	.	5.6	5.6	0.85130	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	15.9288	0.79644	0.1355:0.8645:0.0:0.0	.	.	.	.	X	266;306;306;306	.	ENSP00000297405:W306X	W	-	3	0	CSMD3	114100584	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.769000	0.68865	2.639000	0.89480	0.460000	0.39030	TGG	CSMD3	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB		0.343	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	C	NM_052900	Nonsense_Mutation	114031408	-1	no_errors	ENST00000297405	ensembl	human	known	70_37	nonsense	SNP	1.000	T
CTBP1	1487	genome.wustl.edu	37	4	1219224	1219224	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr4:1219224C>T	ENST00000290921.6	-	4	652	c.471G>A	c.(469-471)caG>caA	p.Q157Q	CTBP1_ENST00000382952.3_Silent_p.Q146Q	NM_001328.2	NP_001319.1	Q13363	CTBP1_HUMAN	C-terminal binding protein 1	157					Golgi organization (GO:0007030)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone H4 acetylation (GO:0090241)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone deacetylation (GO:0031065)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of transcription by chromatin organization (GO:0034401)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|urinary_tract(1)	8			OV - Ovarian serous cystadenocarcinoma(23;0.00818)	Colorectal(103;0.2)		GCTCGACGCTCTGGACTCGTG	0.701																																																	0													29.0	21.0	24.0					4																	1219224		2168	4235	6403	SO:0001819	synonymous_variant	1487			U37408	CCDS3348.1, CCDS43203.1	4p16	2008-02-05			ENSG00000159692	ENSG00000159692			2494	protein-coding gene	gene with protein product	"""brefeldin A-ribosylated substrate"""	602618				9479502	Standard	XM_005272261		Approved	BARS	uc003gcv.1	Q13363	OTTHUMG00000089259	ENST00000290921.6:c.471G>A	4.37:g.1219224C>T			Q4W5N3|Q7Z2Q5	Silent	SNP	pfam_D-isomer_2_OHA_DH_NAD-bd,pfam_D-isomer_2_OHA_DH_cat_dom,pfam_6PGDH_NADP-bd	p.Q157	ENST00000290921.6	37	c.471	CCDS3348.1	4																																																																																			CTBP1	-	pfam_D-isomer_2_OHA_DH_NAD-bd,pfam_D-isomer_2_OHA_DH_cat_dom		0.701	CTBP1-001	KNOWN	basic|CCDS	protein_coding	CTBP1	HGNC	protein_coding	OTTHUMT00000202938.1	C	NM_001328		1219224	-1	no_errors	ENST00000290921	ensembl	human	known	70_37	silent	SNP	1.000	T
CX3CL1	6376	genome.wustl.edu	37	16	57416511	57416511	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr16:57416511C>T	ENST00000006053.6	+	3	872	c.761C>T	c.(760-762)cCc>cTc	p.P254L	CX3CL1_ENST00000563383.1_Missense_Mutation_p.P260L|CX3CL1_ENST00000565912.1_Missense_Mutation_p.P216L	NM_002996.3	NP_002987.1	P78423	X3CL1_HUMAN	chemokine (C-X3-C motif) ligand 1	254	Mucin-like stalk.				angiogenesis involved in wound healing (GO:0060055)|cell adhesion (GO:0007155)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|immune response (GO:0006955)|leukocyte adhesive activation (GO:0050902)|leukocyte chemotaxis (GO:0030595)|lymphocyte chemotaxis (GO:0048247)|macrophage chemotaxis (GO:0048246)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neutrophil chemotaxis (GO:0030593)|positive regulation of angiogenesis (GO:0045766)|positive regulation of calcium-independent cell-cell adhesion (GO:0051041)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transforming growth factor beta1 production (GO:0032914)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chemokine activity (GO:0008009)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)	5						GGACAGAGCCCCAGGCCAGAG	0.677																																																	0													35.0	40.0	38.0					16																	57416511		2197	4300	6497	SO:0001583	missense	6376			U84487	CCDS10779.1	16q13	2013-02-25	2002-08-22	2002-08-23	ENSG00000006210	ENSG00000006210		"""Endogenous ligands"""	10647	protein-coding gene	gene with protein product		601880	"""small inducible cytokine subfamily D (Cys-X3-Cys), member 1 (fractalkine, neurotactin)"""	SCYD1		9177350, 9024663	Standard	NM_002996		Approved	NTN, C3Xkine, ABCD-3, CXC3C, CXC3, fractalkine, neurotactin	uc002eli.3	P78423	OTTHUMG00000133469	ENST00000006053.6:c.761C>T	16.37:g.57416511C>T	ENSP00000006053:p.Pro254Leu		O00672	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom,prints_Chemokine_fractalkine_CX3CL1	p.P254L	ENST00000006053.6	37	c.761	CCDS10779.1	16	.	.	.	.	.	.	.	.	.	.	C	0.880	-0.729188	0.03135	.	.	ENSG00000006210	ENST00000006053	T	0.04406	3.63	4.3	1.04	0.20106	.	1.492050	0.05452	N	0.549628	T	0.02929	0.0087	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.41574	-0.9501	10	0.87932	D	0	-25.0807	3.4528	0.07505	0.2002:0.5812:0.0:0.2187	.	254	P78423	X3CL1_HUMAN	L	254	ENSP00000006053:P254L	ENSP00000006053:P254L	P	+	2	0	CX3CL1	55974012	0.000000	0.05858	0.001000	0.08648	0.049000	0.14656	-0.104000	0.10923	0.986000	0.38683	0.558000	0.71614	CCC	CX3CL1	-	NULL		0.677	CX3CL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CX3CL1	HGNC	protein_coding	OTTHUMT00000257345.3	C	NM_002996		57416511	+1	no_errors	ENST00000006053	ensembl	human	known	70_37	missense	SNP	0.000	T
DAGLA	747	genome.wustl.edu	37	11	61503241	61503241	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr11:61503241G>C	ENST00000257215.5	+	12	1359	c.1243G>C	c.(1243-1245)Gag>Cag	p.E415Q		NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	415					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		GGGTGATGCTGAGCGCCTCCC	0.677																																																	0													48.0	43.0	45.0					11																	61503241		2201	4299	6500	SO:0001583	missense	747			AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.1243G>C	11.37:g.61503241G>C	ENSP00000257215:p.Glu415Gln		A7E233|Q6WQJ0	Missense_Mutation	SNP	pfam_Lipase_3	p.E415Q	ENST00000257215.5	37	c.1243	CCDS31578.1	11	.	.	.	.	.	.	.	.	.	.	G	26.4	4.732882	0.89482	.	.	ENSG00000134780	ENST00000257215	T	0.29655	1.56	3.86	3.86	0.44501	.	0.057498	0.64402	D	0.000002	T	0.54870	0.1885	M	0.76002	2.32	0.80722	D	1	D	0.69078	0.997	D	0.81914	0.995	T	0.58457	-0.7633	10	0.42905	T	0.14	-26.8127	16.3615	0.83270	0.0:0.0:1.0:0.0	.	415	Q9Y4D2	DGLA_HUMAN	Q	415	ENSP00000257215:E415Q	ENSP00000257215:E415Q	E	+	1	0	DAGLA	61259817	1.000000	0.71417	0.998000	0.56505	0.848000	0.48234	9.204000	0.95041	2.157000	0.67596	0.462000	0.41574	GAG	DAGLA	-	pfam_Lipase_3		0.677	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAGLA	HGNC	protein_coding	OTTHUMT00000398516.1	G	NM_006133		61503241	+1	no_errors	ENST00000257215	ensembl	human	known	70_37	missense	SNP	1.000	C
DCST1	149095	genome.wustl.edu	37	1	155020577	155020577	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:155020577G>A	ENST00000295542.1	+	16	1896	c.1800G>A	c.(1798-1800)aaG>aaA	p.K600K	DCST1_ENST00000392480.1_Silent_p.K600K|RP11-307C12.11_ENST00000452962.1_RNA|DCST1_ENST00000368419.2_Silent_p.K600K|DCST1_ENST00000423025.2_Silent_p.K575K	NM_152494.3	NP_689707.2	Q5T197	DCST1_HUMAN	DC-STAMP domain containing 1	600						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	27	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			ACCTATTGAAGAAAAGAGCAG	0.552																																																	0													73.0	73.0	73.0					1																	155020577		2203	4300	6503	SO:0001819	synonymous_variant	149095			AK057347	CCDS1083.1, CCDS44235.1	1q22	2008-02-05			ENSG00000163357	ENSG00000163357			26539	protein-coding gene	gene with protein product							Standard	NM_152494		Approved	FLJ32785	uc001fgn.2	Q5T197	OTTHUMG00000041314	ENST00000295542.1:c.1800G>A	1.37:g.155020577G>A			B4DXA0|E9PHV3|Q5T198|Q6P1W6|Q71S70|Q96M70	Silent	SNP	pfam_DC_STAMP-like,pfscan_Znf_RING	p.K600	ENST00000295542.1	37	c.1800	CCDS1083.1	1																																																																																			DCST1	-	NULL		0.552	DCST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCST1	HGNC	protein_coding	OTTHUMT00000099006.1	G	NM_152494		155020577	+1	no_errors	ENST00000295542	ensembl	human	known	70_37	silent	SNP	0.994	A
DENND4A	10260	genome.wustl.edu	37	15	65983274	65983274	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr15:65983274C>T	ENST00000431932.2	-	22	3734	c.3526G>A	c.(3526-3528)Gag>Aag	p.E1176K	DENND4A_ENST00000567323.1_5'Flank|DENND4A_ENST00000443035.3_Missense_Mutation_p.E1219K	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	1176					positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						TGTTCAGTCTCAGCAACCAAA	0.413																																																	0													64.0	57.0	59.0					15																	65983274		1892	4130	6022	SO:0001583	missense	10260			AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.3526G>A	15.37:g.65983274C>T	ENSP00000396830:p.Glu1176Lys		E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Missense_Mutation	SNP	pfam_DENN_dom,pfam_dDENN_dom,pfam_uDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,tigrfam_Pentatricopeptide_repeat	p.E1219K	ENST00000431932.2	37	c.3655	CCDS45285.1	15	.	.	.	.	.	.	.	.	.	.	C	33	5.219630	0.95139	.	.	ENSG00000174485	ENST00000443035;ENST00000431932	T;T	0.10668	2.85;2.87	5.61	5.61	0.85477	.	0.757333	0.12573	N	0.457151	T	0.29749	0.0743	M	0.66939	2.045	0.80722	D	1	D;D	0.60575	0.988;0.988	P;P	0.54759	0.76;0.696	T	0.01500	-1.1339	10	0.87932	D	0	.	20.0016	0.97412	0.0:1.0:0.0:0.0	.	1219;1176	E7EPL3;Q7Z401	.;MYCPP_HUMAN	K	1219;1176	ENSP00000391167:E1219K;ENSP00000396830:E1176K	ENSP00000396830:E1176K	E	-	1	0	DENND4A	63770328	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.142000	0.77339	2.802000	0.96397	0.655000	0.94253	GAG	DENND4A	-	NULL		0.413	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND4A	HGNC	protein_coding	OTTHUMT00000419611.1	C	NM_005848		65983274	-1	no_errors	ENST00000443035	ensembl	human	known	70_37	missense	SNP	1.000	T
DENND4B	9909	genome.wustl.edu	37	1	153905691	153905691	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:153905691G>A	ENST00000361217.4	-	21	3853	c.3435C>T	c.(3433-3435)ttC>ttT	p.F1145F	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	1145	Ser-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			AAGGTGACTGGAAGGATCCAG	0.567																																																	0													51.0	55.0	53.0					1																	153905691		2051	4190	6241	SO:0001819	synonymous_variant	9909			AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.3435C>T	1.37:g.153905691G>A			Q5T4K0	Silent	SNP	pfam_DENN_dom,pfam_dDENN_dom,pfam_uDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.F1145	ENST00000361217.4	37	c.3435	CCDS44228.1	1																																																																																			DENND4B	-	NULL		0.567	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND4B	HGNC	protein_coding	OTTHUMT00000090278.2	G	XM_375806		153905691	-1	no_errors	ENST00000361217	ensembl	human	known	70_37	silent	SNP	0.024	A
DGCR6L	85359	genome.wustl.edu	37	22	20302222	20302222	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr22:20302222C>T	ENST00000248879.3	-	5	730	c.639G>A	c.(637-639)caG>caA	p.Q213Q	DGCR6L_ENST00000405465.3_Silent_p.Q175Q	NM_033257.3	NP_150282.2	Q9BY27	DGC6L_HUMAN	DiGeorge syndrome critical region gene 6-like	213						nucleus (GO:0005634)				endometrium(1)|kidney(1)|lung(2)|stomach(1)	5	Colorectal(54;0.0993)					GGCTGCCTTTCTGGTCACACT	0.637																																																	0													33.0	31.0	32.0					22																	20302222		2203	4300	6503	SO:0001819	synonymous_variant	85359			AF228708	CCDS13778.1	22q11.21	2013-02-19			ENSG00000128185	ENSG00000128185			18551	protein-coding gene	gene with protein product		609459				11157784	Standard	NM_033257		Approved	FLJ10666	uc002zrx.3	Q9BY27	OTTHUMG00000150583	ENST00000248879.3:c.639G>A	22.37:g.20302222C>T			A8K1N7|B3KMC0|D3DX29|Q9BW33	Silent	SNP	pfam_DGCR6	p.Q213	ENST00000248879.3	37	c.639	CCDS13778.1	22																																																																																			DGCR6L	-	NULL		0.637	DGCR6L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGCR6L	HGNC	protein_coding	OTTHUMT00000318970.3	C	NM_033257		20302222	-1	no_errors	ENST00000248879	ensembl	human	known	70_37	silent	SNP	0.001	T
DHX29	54505	genome.wustl.edu	37	5	54585104	54585104	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr5:54585104C>A	ENST00000251636.5	-	8	1208	c.1060G>T	c.(1060-1062)Gag>Tag	p.E354*	RP11-506H20.1_ENST00000506435.1_RNA	NM_019030.2	NP_061903.2	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	354						eukaryotic 43S preinitiation complex (GO:0016282)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation initiation factor activity (GO:0003743)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|lung(6)|ovary(4)|prostate(1)|skin(3)|urinary_tract(2)	46		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				TTACCTTTCTCTTCTTCAGTA	0.323																																																	0													43.0	44.0	44.0					5																	54585104		2200	4299	6499	SO:0001587	stop_gained	54505			AY036974	CCDS34158.1	5q11.2	2008-02-05	2003-06-13	2003-06-20	ENSG00000067248	ENSG00000067248		"""DEAH-boxes"""	15815	protein-coding gene	gene with protein product		612720	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 29"""	DDX29			Standard	XM_005248544		Approved		uc003jpx.3	Q7Z478	OTTHUMG00000162313	ENST00000251636.5:c.1060G>T	5.37:g.54585104C>A	ENSP00000251636:p.Glu354*		O75549|Q63HN0|Q63HN3|Q8IWW2|Q8N3A1|Q9UMH2	Nonsense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E354*	ENST00000251636.5	37	c.1060	CCDS34158.1	5	.	.	.	.	.	.	.	.	.	.	C	37	6.522172	0.97633	.	.	ENSG00000067248	ENST00000251636	.	.	.	6.06	4.22	0.49857	.	0.129287	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	.	16.7121	0.85388	0.0:0.6354:0.3646:0.0	.	.	.	.	X	354	.	ENSP00000251636:E354X	E	-	1	0	DHX29	54620861	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	1.942000	0.40243	0.833000	0.34828	0.650000	0.86243	GAG	DHX29	-	NULL		0.323	DHX29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX29	HGNC	protein_coding	OTTHUMT00000368532.1	C	NM_019030		54585104	-1	no_errors	ENST00000251636	ensembl	human	known	70_37	nonsense	SNP	1.000	A
DNAH10	196385	genome.wustl.edu	37	12	124359784	124359784	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr12:124359784G>A	ENST00000409039.3	+	46	7616	c.7591G>A	c.(7591-7593)Gaa>Aaa	p.E2531K		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2531	AAA 3. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CAAGGTGGATGAATATGGCAC	0.443																																																	0													29.0	28.0	28.0					12																	124359784		1999	4171	6170	SO:0001583	missense	196385			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.7591G>A	12.37:g.124359784G>A	ENSP00000386770:p.Glu2531Lys		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_PyrdxlP-dep_Trfase_major_dom,smart_AAA+_ATPase	p.E2531K	ENST00000409039.3	37	c.7591	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	G	3.350	-0.132830	0.06711	.	.	ENSG00000197653	ENST00000409039	T	0.33654	1.4	5.24	5.24	0.73138	ATPase, AAA+ type, core (1);	0.368435	0.24975	U	0.034110	T	0.26011	0.0634	N	0.20807	0.61	0.49687	D	0.999818	B	0.22683	0.073	B	0.25987	0.065	T	0.07520	-1.0768	10	0.06757	T	0.87	.	19.2576	0.93952	0.0:0.0:1.0:0.0	.	2531	Q8IVF4	DYH10_HUMAN	K	2531	ENSP00000386770:E2531K	ENSP00000386770:E2531K	E	+	1	0	DNAH10	122925737	1.000000	0.71417	0.448000	0.26945	0.075000	0.17131	5.319000	0.65835	2.621000	0.88768	0.650000	0.86243	GAA	DNAH10	-	pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase		0.443	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	G			124359784	+1	no_errors	ENST00000409039	ensembl	human	known	70_37	missense	SNP	0.999	A
DNAH2	146754	genome.wustl.edu	37	17	7674219	7674219	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:7674219C>G	ENST00000572933.1	+	27	5790	c.4330C>G	c.(4330-4332)Ctc>Gtc	p.L1444V	DNAH2_ENST00000389173.2_Missense_Mutation_p.L1444V			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	1444	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TGAGATGATTCTCACAGTGCA	0.493																																																	0													130.0	109.0	116.0					17																	7674219		2203	4300	6503	SO:0001583	missense	146754			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.4330C>G	17.37:g.7674219C>G	ENSP00000458355:p.Leu1444Val		A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.L1444V	ENST00000572933.1	37	c.4330	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	C	24.1	4.498094	0.85069	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.62639	0.01	4.96	4.96	0.65561	Dynein heavy chain, domain-2 (1);	0.000000	0.64402	D	0.000001	T	0.79070	0.4384	M	0.79123	2.44	0.80722	D	1	D	0.65815	0.995	D	0.67382	0.951	T	0.81197	-0.1042	10	0.66056	D	0.02	.	17.5136	0.87767	0.0:1.0:0.0:0.0	.	1444	Q9P225	DYH2_HUMAN	V	1444	ENSP00000373825:L1444V	ENSP00000353818:L1444V	L	+	1	0	DNAH2	7614944	1.000000	0.71417	0.900000	0.35374	0.994000	0.84299	4.937000	0.63513	2.731000	0.93534	0.650000	0.86243	CTC	DNAH2	-	pfam_Dynein_heavy_dom-2		0.493	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	HGNC	protein_coding	OTTHUMT00000440241.1	C	NM_020877		7674219	+1	no_errors	ENST00000389173	ensembl	human	known	70_37	missense	SNP	1.000	G
DNAH5	1767	genome.wustl.edu	37	5	13885200	13885200	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr5:13885200G>A	ENST00000265104.4	-	19	2985	c.2881C>T	c.(2881-2883)Cat>Tat	p.H961Y	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	961	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TGGTTGAAATGAGAGAGTAAC	0.438									Kartagener syndrome																																								0													130.0	123.0	125.0					5																	13885200		2203	4300	6503	SO:0001583	missense	1767	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.2881C>T	5.37:g.13885200G>A	ENSP00000265104:p.His961Tyr		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.H961Y	ENST00000265104.4	37	c.2881	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	G	3.571	-0.087543	0.07097	.	.	ENSG00000039139	ENST00000265104	T	0.21191	2.02	5.73	4.85	0.62838	.	0.408512	0.29424	N	0.012182	T	0.10165	0.0249	N	0.12471	0.22	0.32861	D	0.508008	B	0.02656	0.0	B	0.04013	0.001	T	0.16129	-1.0413	10	0.02654	T	1	.	11.8043	0.52145	0.1534:0.0:0.8466:0.0	.	961	Q8TE73	DYH5_HUMAN	Y	961	ENSP00000265104:H961Y	ENSP00000265104:H961Y	H	-	1	0	DNAH5	13938200	1.000000	0.71417	0.997000	0.53966	0.865000	0.49528	2.874000	0.48483	1.411000	0.46957	0.655000	0.94253	CAT	DNAH5	-	NULL		0.438	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	G	NM_001369		13885200	-1	no_errors	ENST00000265104	ensembl	human	known	70_37	missense	SNP	1.000	A
DNAJC2	27000	genome.wustl.edu	37	7	102956536	102956536	+	Splice_Site	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr7:102956536C>T	ENST00000379263.3	-	14	1678		c.e14-1		DNAJC2_ENST00000249270.7_Splice_Site|PMPCB_ENST00000420236.2_Intron	NM_014377.1	NP_055192.1	Q99543	DNJC2_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 2						'de novo' cotranslational protein folding (GO:0051083)|chromatin modification (GO:0016568)|DNA replication (GO:0006260)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|Hsp70 protein binding (GO:0030544)|poly(A) RNA binding (GO:0044822)|ubiquitin binding (GO:0043130)	p.?(2)		endometrium(1)|kidney(9)|large_intestine(6)|lung(4)|ovary(1)	21						AACTTCCCATCTGATAGGATA	0.308																																																	2	Unknown(2)	lung(2)											54.0	49.0	51.0					7																	102956536		1803	4068	5871	SO:0001630	splice_region_variant	27000			X98260	CCDS43628.1, CCDS47679.1	7q22-q32	2011-09-02	2008-07-01	2008-07-01	ENSG00000105821	ENSG00000105821		"""Heat shock proteins / DNAJ (HSP40)"""	13192	protein-coding gene	gene with protein product		605502	"""zuotin related factor 1"""	ZRF1		8885239	Standard	NM_001129887		Approved	MPP11, MPHOSPH11, ZUO1, zuotin	uc003vbo.3	Q99543	OTTHUMG00000157202	ENST00000379263.3:c.1428-1G>A	7.37:g.102956536C>T			A4VCI0|Q9BVX1	Splice_Site	SNP	-	e14-1	ENST00000379263.3	37	c.1428-1	CCDS43628.1	7	.	.	.	.	.	.	.	.	.	.	C	24.1	4.493480	0.84962	.	.	ENSG00000105821	ENST00000249270;ENST00000379263	.	.	.	5.88	5.88	0.94601	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2266	0.98341	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DNAJC2	102743772	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.452000	0.80683	2.769000	0.95229	0.655000	0.94253	.	DNAJC2	-	-		0.308	DNAJC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC2	HGNC	protein_coding	OTTHUMT00000347891.1	C		Intron	102956536	-1	no_errors	ENST00000379263	ensembl	human	known	70_37	splice_site	SNP	1.000	T
DNAJC5B	85479	genome.wustl.edu	37	8	66989059	66989059	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr8:66989059G>A	ENST00000276570.5	+	4	571	c.284G>A	c.(283-285)gGa>gAa	p.G95E	DNAJC5B_ENST00000519330.1_3'UTR	NM_033105.4	NP_149096.2	Q9UF47	DNJ5B_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5 beta	95						membrane (GO:0016020)				endometrium(3)|large_intestine(6)|liver(1)|lung(6)|prostate(1)|skin(3)	20		Lung NSC(129;0.114)|all_lung(136;0.188)	Epithelial(68;0.0213)|all cancers(69;0.0839)|BRCA - Breast invasive adenocarcinoma(89;0.0886)|OV - Ovarian serous cystadenocarcinoma(28;0.112)			GAGCAGTTTGGAGACGAAAAC	0.443																																																	0													168.0	135.0	146.0					8																	66989059		2203	4300	6503	SO:0001583	missense	85479			AF368276	CCDS6183.1	8q13.1	2012-10-02			ENSG00000147570	ENSG00000147570		"""Heat shock proteins / DNAJ (HSP40)"""	24138	protein-coding gene	gene with protein product		613945				12477932	Standard	NM_033105		Approved	MGC26226, CSP-beta	uc003xvs.1	Q9UF47	OTTHUMG00000164470	ENST00000276570.5:c.284G>A	8.37:g.66989059G>A	ENSP00000276570:p.Gly95Glu		Q969Y8	Missense_Mutation	SNP	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.G95E	ENST00000276570.5	37	c.284	CCDS6183.1	8	.	.	.	.	.	.	.	.	.	.	G	25.4	4.636424	0.87760	.	.	ENSG00000147570	ENST00000276570;ENST00000522619	T;T	0.74632	-0.86;-0.11	5.73	5.73	0.89815	Heat shock protein DnaJ, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.89494	0.6731	M	0.90542	3.125	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.90877	0.4750	10	0.87932	D	0	.	19.8961	0.96958	0.0:0.0:1.0:0.0	.	95	Q9UF47	DNJ5B_HUMAN	E	95	ENSP00000276570:G95E;ENSP00000430196:G95E	ENSP00000276570:G95E	G	+	2	0	DNAJC5B	67151613	1.000000	0.71417	1.000000	0.80357	0.496000	0.33645	9.869000	0.99810	2.699000	0.92147	0.655000	0.94253	GGA	DNAJC5B	-	prints_Hsp_DnaJ		0.443	DNAJC5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC5B	HGNC	protein_coding	OTTHUMT00000378915.1	G	NM_033105		66989059	+1	no_errors	ENST00000276570	ensembl	human	known	70_37	missense	SNP	1.000	A
DNAL4	10126	genome.wustl.edu	37	22	39175601	39175601	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr22:39175601G>C	ENST00000216068.4	-	4	415	c.171C>G	c.(169-171)atC>atG	p.I57M	DNAL4_ENST00000486019.1_5'UTR|SUN2_ENST00000406622.1_Intron	NM_005740.2	NP_005731.1	O96015	DNAL4_HUMAN	dynein, axonemal, light chain 4	57					microtubule-based process (GO:0007017)|neurotrophin TRK receptor signaling pathway (GO:0048011)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	motor activity (GO:0003774)			lung(1)|skin(1)	2	Melanoma(58;0.04)					TTGTCTCTTTGATCATCTTGG	0.587																																																	0													92.0	72.0	79.0					22																	39175601		2203	4299	6502	SO:0001583	missense	10126			AL035366	CCDS13979.1	22q13.1	2008-06-10	2006-09-04		ENSG00000100246	ENSG00000100246		"""Axonemal dyneins"""	2955	protein-coding gene	gene with protein product		610565	"""dynein, axonemal, light polypeptide 4"", ""dynein, axonemal, light 4"""			10591208	Standard	NM_005740		Approved	dJ327J16, PIG27	uc003awj.3	O96015	OTTHUMG00000151025	ENST00000216068.4:c.171C>G	22.37:g.39175601G>C	ENSP00000216068:p.Ile57Met		Q6FGB2|Q6FGD0	Missense_Mutation	SNP	pfam_Dynein_light_chain_typ-1/2,superfamily_Dynein_light_chain_typ-1/2	p.I57M	ENST00000216068.4	37	c.171	CCDS13979.1	22	.	.	.	.	.	.	.	.	.	.	G	15.18	2.755587	0.49362	.	.	ENSG00000100246	ENST00000216068	.	.	.	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	D	0.85375	0.5682	M	0.93197	3.39	0.80722	D	1	D	0.76494	0.999	D	0.74348	0.983	D	0.88891	0.3346	9	0.87932	D	0	.	13.7681	0.63008	0.0:0.0:0.8463:0.1536	.	57	O96015	DNAL4_HUMAN	M	57	.	ENSP00000216068:I57M	I	-	3	3	DNAL4	37505547	1.000000	0.71417	0.999000	0.59377	0.094000	0.18550	4.570000	0.60872	2.435000	0.82474	0.655000	0.94253	ATC	DNAL4	-	pfam_Dynein_light_chain_typ-1/2,superfamily_Dynein_light_chain_typ-1/2		0.587	DNAL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAL4	HGNC	protein_coding	OTTHUMT00000321032.1	G	NM_005740		39175601	-1	no_errors	ENST00000216068	ensembl	human	known	70_37	missense	SNP	1.000	C
DOPEY1	23033	genome.wustl.edu	37	6	83846971	83846971	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr6:83846971C>T	ENST00000349129.2	+	21	3470	c.3210C>T	c.(3208-3210)ctC>ctT	p.L1070L	DOPEY1_ENST00000369739.3_Silent_p.L1061L|DOPEY1_ENST00000237163.5_Silent_p.L1051L	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	1070					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		ACTTTAGTCTCACTGTGAATC	0.393																																																	0													88.0	85.0	86.0					6																	83846971		2203	4299	6502	SO:0001819	synonymous_variant	23033			AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.3210C>T	6.37:g.83846971C>T			Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Silent	SNP	pfam_Dopey_N,superfamily_ARM-type_fold	p.L1070	ENST00000349129.2	37	c.3210	CCDS4996.1	6																																																																																			DOPEY1	-	superfamily_ARM-type_fold		0.393	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY1	HGNC	protein_coding	OTTHUMT00000043785.2	C	NM_015018		83846971	+1	no_errors	ENST00000349129	ensembl	human	known	70_37	silent	SNP	0.861	T
DPP8	54878	genome.wustl.edu	37	15	65744405	65744405	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr15:65744405G>C	ENST00000341861.5	-	18	3935	c.2355C>G	c.(2353-2355)atC>atG	p.I785M	DPP8_ENST00000321118.7_Missense_Mutation_p.I736M|DPP8_ENST00000339244.5_Missense_Mutation_p.I612M|DPP8_ENST00000358939.4_Missense_Mutation_p.I669M|DPP8_ENST00000300141.6_Missense_Mutation_p.I769M|DPP8_ENST00000559233.1_Missense_Mutation_p.I785M|DPP8_ENST00000560048.2_5'UTR|DPP8_ENST00000321147.6_Missense_Mutation_p.I734M	NM_197960.2	NP_932064.1	Q6V1X1	DPP8_HUMAN	dipeptidyl-peptidase 8	785					immune response (GO:0006955)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(2)|endometrium(3)|large_intestine(11)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						TATCATAGAAGATCCACAGAG	0.473																																																	0													144.0	136.0	139.0					15																	65744405		2201	4299	6500	SO:0001583	missense	54878			AF221634	CCDS10207.1, CCDS10208.1, CCDS10209.1, CCDS10210.1	15q22	2008-07-18	2006-01-12		ENSG00000074603	ENSG00000074603			16490	protein-coding gene	gene with protein product	"""dipeptidyl peptidase VIII"", ""dipeptidyl peptidase IV-related protein-1"", ""prolyl dipeptidase DPP8"""	606819	"""dipeptidylpeptidase 8"""			11012666	Standard	XM_005254500		Approved	DP8, DPRP1, MSTP141, FLJ14920, FLJ20283, MGC26191	uc002aox.3	Q6V1X1	OTTHUMG00000133150	ENST00000341861.5:c.2355C>G	15.37:g.65744405G>C	ENSP00000339208:p.Ile785Met		Q7Z4C8|Q7Z4D3|Q7Z4E1|Q8IWG7|Q8NEM5|Q96JX1|Q9HBM2|Q9HBM3|Q9HBM4|Q9HBM5|Q9NXF4	Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9,pfam_X-Pro-like_dom	p.I785M	ENST00000341861.5	37	c.2355	CCDS10207.1	15	.	.	.	.	.	.	.	.	.	.	G	11.99	1.802620	0.31869	.	.	ENSG00000074603	ENST00000341861;ENST00000358939;ENST00000300141;ENST00000321147;ENST00000321118;ENST00000339244	T;T;T;T;T;T	0.31247	1.5;1.5;1.5;1.5;1.5;1.5	5.42	2.1	0.27182	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.070597	0.64402	D	0.000018	T	0.12390	0.0301	N	0.08118	0	0.38119	D	0.937783	B;B;B;B;B;B	0.15141	0.012;0.001;0.0;0.009;0.003;0.001	B;B;B;B;B;B	0.16289	0.015;0.012;0.004;0.015;0.004;0.007	T	0.08659	-1.0711	10	0.33141	T	0.24	-5.8214	3.4589	0.07526	0.3321:0.0:0.4784:0.1896	.	612;736;769;669;734;785	C9JSG1;Q6V1X1-5;Q6V1X1-3;Q6V1X1-4;Q6V1X1-2;Q6V1X1	.;.;.;.;.;DPP8_HUMAN	M	785;669;769;734;736;612	ENSP00000339208:I785M;ENSP00000351817:I669M;ENSP00000300141:I769M;ENSP00000318111:I734M;ENSP00000316373:I736M;ENSP00000341230:I612M	ENSP00000300141:I769M	I	-	3	3	DPP8	63531458	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.901000	0.39838	0.653000	0.30826	-0.311000	0.09066	ATC	DPP8	-	pfam_Peptidase_S9,pfam_X-Pro-like_dom		0.473	DPP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DPP8	HGNC	protein_coding	OTTHUMT00000256847.1	G	NM_017743		65744405	-1	no_errors	ENST00000341861	ensembl	human	known	70_37	missense	SNP	1.000	C
DSPP	1834	genome.wustl.edu	37	4	88536886	88536886	+	Silent	SNP	C	C	T	rs111205182		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr4:88536886C>T	ENST00000282478.7	+	4	3105	c.3072C>T	c.(3070-3072)agC>agT	p.S1024S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S1024S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1024	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gcagcaatagcagtgacagca	0.517																																																	0													44.0	40.0	41.0					4																	88536886		1516	2409	3925	SO:0001819	synonymous_variant	1834			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3072C>T	4.37:g.88536886C>T			A8MUI0|O95815	Silent	SNP	NULL	p.S1024	ENST00000282478.7	37	c.3072	CCDS43248.1	4																																																																																			DSPP	-	NULL		0.517	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DSPP	HGNC	protein_coding	OTTHUMT00000363616.3	C	NM_014208		88536886	+1	no_errors	ENST00000282478	ensembl	human	known	70_37	silent	SNP	0.076	T
DSTYK	25778	genome.wustl.edu	37	1	205128678	205128678	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:205128678C>T	ENST00000367162.3	-	9	2265	c.2235G>A	c.(2233-2235)ctG>ctA	p.L745L	DSTYK_ENST00000367160.4_Intron|DSTYK_ENST00000367161.3_Silent_p.L745L	NM_015375.2	NP_056190.1	Q6XUX3	DUSTY_HUMAN	dual serine/threonine and tyrosine protein kinase	745	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to fibroblast growth factor stimulus (GO:0044344)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of kinase activity (GO:0033674)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(2)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(2)	14						TCCTTACCTTCAGCCCTGTGT	0.498																																																	0													41.0	37.0	38.0					1																	205128678		2203	4299	6502	SO:0001819	synonymous_variant	25778			AF068286	CCDS1451.1, CCDS1452.1	1q32	2008-12-18	2008-12-18	2008-12-18	ENSG00000133059	ENSG00000133059			29043	protein-coding gene	gene with protein product		612666	"""receptor interacting protein kinase 5"""	RIPK5		15178406	Standard	NM_015375		Approved	KIAA0472, DustyPK, RIP5	uc001hbw.3	Q6XUX3	OTTHUMG00000037102	ENST00000367162.3:c.2235G>A	1.37:g.205128678C>T			B7ZL64|O75060|Q17R94|Q5RKT0|Q6IN87|Q6P997|Q86Y03|Q9P1S5	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L745	ENST00000367162.3	37	c.2235	CCDS1451.1	1																																																																																			DSTYK	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.498	DSTYK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSTYK	HGNC	protein_coding	OTTHUMT00000090345.1	C	NM_015375		205128678	-1	no_errors	ENST00000367162	ensembl	human	known	70_37	silent	SNP	0.996	T
DUS3L	56931	genome.wustl.edu	37	19	5786512	5786512	+	Missense_Mutation	SNP	T	T	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:5786512T>A	ENST00000309061.7	-	10	1624	c.1528A>T	c.(1528-1530)Atg>Ttg	p.M510L	DUS3L_ENST00000320699.8_Missense_Mutation_p.M268L|CTB-54O9.9_ENST00000586012.1_5'Flank|PRR22_ENST00000419421.2_5'Flank|DUS3L_ENST00000590681.1_5'Flank	NM_020175.2	NP_064560.2	Q96G46	DUS3L_HUMAN	dihydrouridine synthase 3-like (S. cerevisiae)	510							flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA dihydrouridine synthase activity (GO:0017150)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(2)	14						CCAGTCTGCATGGCGCGGTTG	0.577																																																	0													113.0	80.0	91.0					19																	5786512		2203	4300	6503	SO:0001583	missense	56931				CCDS32880.1, CCDS54202.1	19p13.3	2014-02-12			ENSG00000141994	ENSG00000141994			26920	protein-coding gene	gene with protein product						12477932	Standard	NM_020175		Approved	DUS3, FLJ13896	uc002mdc.3	Q96G46	OTTHUMG00000162311	ENST00000309061.7:c.1528A>T	19.37:g.5786512T>A	ENSP00000311977:p.Met510Leu		Q96HM5|Q9BSU4|Q9H877|Q9NPR1	Missense_Mutation	SNP	pfam_tRNA_hU_synthase	p.M510L	ENST00000309061.7	37	c.1528	CCDS32880.1	19	.	.	.	.	.	.	.	.	.	.	T	5.234	0.228745	0.09916	.	.	ENSG00000141994	ENST00000309061;ENST00000320699	T;T	0.23950	1.88;1.88	4.94	-0.114	0.13564	Aldolase-type TIM barrel (1);	0.428768	0.26836	N	0.022252	T	0.05823	0.0152	N	0.01649	-0.78	0.27341	N	0.95651	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.39563	-0.9608	10	0.02654	T	1	-31.0223	5.3912	0.16245	0.2708:0.0:0.4174:0.3118	.	268;510	Q96G46-3;Q96G46	.;DUS3L_HUMAN	L	510;268	ENSP00000311977:M510L;ENSP00000315558:M268L	ENSP00000311977:M510L	M	-	1	0	DUS3L	5737512	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	0.729000	0.26028	0.205000	0.20568	0.444000	0.29173	ATG	DUS3L	-	pfam_tRNA_hU_synthase		0.577	DUS3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUS3L	HGNC	protein_coding	OTTHUMT00000451870.2	T	NM_020175		5786512	-1	no_errors	ENST00000309061	ensembl	human	known	70_37	missense	SNP	0.994	A
DZIP1	22873	genome.wustl.edu	37	13	96293740	96293740	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr13:96293740C>G	ENST00000376829.2	-	5	1257	c.406G>C	c.(406-408)Gag>Cag	p.E136Q	DZIP1_ENST00000361156.3_Missense_Mutation_p.E136Q|DZIP1_ENST00000347108.3_Missense_Mutation_p.E136Q|DZIP1_ENST00000466027.1_5'UTR|DZIP1_ENST00000361396.2_Missense_Mutation_p.E136Q	NM_198968.3	NP_945319.1	Q86YF9	DZIP1_HUMAN	DAZ interacting zinc finger protein 1	136					cilium assembly (GO:0042384)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(20)|lung(11)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	38	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)			GTGAGGAACTCTTGTGAGTGC	0.637																																																	0													80.0	62.0	68.0					13																	96293740		2203	4300	6503	SO:0001583	missense	22873			AB023213	CCDS9477.1, CCDS9478.1	13q32.1	2013-05-22	2013-05-22		ENSG00000134874	ENSG00000134874		"""Zinc fingers, C2H2-type"""	20908	protein-coding gene	gene with protein product		608671	"""DAZ interacting protein 1"""				Standard	NM_014934		Approved	KIAA0996, DZIP	uc001vmk.4	Q86YF9	OTTHUMG00000017224	ENST00000376829.2:c.406G>C	13.37:g.96293740C>G	ENSP00000366025:p.Glu136Gln		Q5W078|Q5W079|Q8WY45|Q8WY46|Q9UGA5|Q9Y2K0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E136Q	ENST00000376829.2	37	c.406	CCDS9478.1	13	.	.	.	.	.	.	.	.	.	.	C	14.86	2.660107	0.47572	.	.	ENSG00000134874	ENST00000347108;ENST00000361156;ENST00000361396;ENST00000376829	T;T;T;T	0.51574	0.7;0.7;0.7;0.7	4.82	4.82	0.62117	.	0.100708	0.64402	D	0.000002	T	0.62624	0.2443	L	0.46157	1.445	0.40724	D	0.982681	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.985;0.988;0.993	T	0.62473	-0.6847	10	0.38643	T	0.18	-12.9267	17.9296	0.88992	0.0:1.0:0.0:0.0	.	136;136;136	Q05D25;Q86YF9-2;Q86YF9	.;.;DZIP1_HUMAN	Q	136	ENSP00000257312:E136Q;ENSP00000355018:E136Q;ENSP00000355175:E136Q;ENSP00000366025:E136Q	ENSP00000257312:E136Q	E	-	1	0	DZIP1	95091741	1.000000	0.71417	1.000000	0.80357	0.039000	0.13416	5.907000	0.69908	2.232000	0.73038	0.655000	0.94253	GAG	DZIP1	-	NULL		0.637	DZIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DZIP1	HGNC	protein_coding	OTTHUMT00000045496.3	C	NM_014934		96293740	-1	no_errors	ENST00000347108	ensembl	human	known	70_37	missense	SNP	1.000	G
ECE2	9718	genome.wustl.edu	37	3	183995182	183995182	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr3:183995182G>A	ENST00000402825.3	+	4	760	c.760G>A	c.(760-762)Gat>Aat	p.D254N	ECE2_ENST00000404464.3_Missense_Mutation_p.D136N|ECE2_ENST00000357474.5_Missense_Mutation_p.D182N|ECE2_ENST00000359140.4_Missense_Mutation_p.D107N|EIF2B5_ENST00000444495.1_Intron	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	254	Endothelin-converting enzyme 2 region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CCCCCTGCCCGATGGGCGTTC	0.602																																																	0													51.0	52.0	52.0					3																	183995182		2203	4300	6503	SO:0001583	missense	9718			AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.760G>A	3.37:g.183995182G>A	ENSP00000384223:p.Asp254Asn		A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,pfam_Methyltransf_11,prints_Peptidase_M13_C	p.D254N	ENST00000402825.3	37	c.760	CCDS3256.2	3	.	.	.	.	.	.	.	.	.	.	G	14.06	2.422726	0.43020	.	.	ENSG00000145194	ENST00000402825;ENST00000359140;ENST00000404464;ENST00000357474;ENST00000430587	T;T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.8;-0.8	5.97	4.18	0.49190	Peptidase M13 (1);	0.247438	0.45867	N	0.000338	T	0.65123	0.2661	L	0.42632	1.34	0.48571	D	0.999672	B;B;B;B;B;B	0.13145	0.007;0.006;0.0;0.002;0.001;0.006	B;B;B;B;B;B	0.15870	0.004;0.014;0.0;0.002;0.001;0.004	T	0.59830	-0.7380	10	0.46703	T	0.11	-15.2473	9.5488	0.39297	0.231:0.0:0.769:0.0	.	107;182;136;182;107;254	B4DKF3;B7Z1P1;O60344-2;O60344-5;O60344-3;O60344	.;.;.;.;.;ECE2_HUMAN	N	254;107;136;182;128	ENSP00000384223:D254N;ENSP00000352052:D107N;ENSP00000385846:D136N;ENSP00000350066:D182N;ENSP00000398444:D128N	ENSP00000350066:D182N	D	+	1	0	ECE2	185477876	1.000000	0.71417	0.478000	0.27316	0.453000	0.32348	4.897000	0.63231	0.858000	0.35431	-0.123000	0.14984	GAT	ECE2	-	pfam_Peptidase_M13_N		0.602	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECE2	HGNC	protein_coding	OTTHUMT00000318874.3	G	NM_014693		183995182	+1	no_errors	ENST00000402825	ensembl	human	known	70_37	missense	SNP	0.987	A
EIF3D	8664	genome.wustl.edu	37	22	36907574	36907574	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr22:36907574C>G	ENST00000216190.8	-	14	1979	c.1609G>C	c.(1609-1611)Gag>Cag	p.E537Q	EIF3D_ENST00000478547.1_5'UTR|EIF3D_ENST00000405442.1_Missense_Mutation_p.E537Q|EIF3D_ENST00000541106.1_Missense_Mutation_p.E488Q	NM_003753.3	NP_003744.1			eukaryotic translation initiation factor 3, subunit D											cervix(1)|endometrium(2)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	15						tcttcctcctcctcttcctcc	0.532											OREG0026522	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													72.0	60.0	64.0					22																	36907574		2203	4300	6503	SO:0001583	missense	8664			U54558	CCDS13930.1	22q13.1	2007-07-27	2007-07-27	2007-07-27	ENSG00000100353	ENSG00000100353			3278	protein-coding gene	gene with protein product		603915	"""eukaryotic translation initiation factor 3, subunit 7 zeta, 66/67kDa"""	EIF3S7		9341143	Standard	NM_003753		Approved	eIF3-p66, eIF3-zeta, eIF3d	uc003apr.3	O15371	OTTHUMG00000150599	ENST00000216190.8:c.1609G>C	22.37:g.36907574C>G	ENSP00000216190:p.Glu537Gln	866		Missense_Mutation	SNP	pfam_EIF-3_zeta,pirsf_EIF-3_zeta	p.E537Q	ENST00000216190.8	37	c.1609	CCDS13930.1	22	.	.	.	.	.	.	.	.	.	.	C	19.34	3.808184	0.70797	.	.	ENSG00000100353	ENST00000216190;ENST00000397177;ENST00000541106;ENST00000405442	.	.	.	5.83	5.83	0.93111	.	0.121347	0.64402	D	0.000010	T	0.42877	0.1222	N	0.12569	0.235	0.58432	D	0.999998	B;B	0.26635	0.155;0.155	B;B	0.25884	0.064;0.064	T	0.25328	-1.0135	9	0.23302	T	0.38	-15.4331	19.7245	0.96157	0.0:1.0:0.0:0.0	.	488;537	B4DVY1;O15371	.;EIF3D_HUMAN	Q	537;522;488;537	.	ENSP00000216190:E537Q	E	-	1	0	EIF3D	35237520	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	7.093000	0.76937	2.757000	0.94681	0.591000	0.81541	GAG	EIF3D	-	pirsf_EIF-3_zeta		0.532	EIF3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3D	HGNC	protein_coding	OTTHUMT00000319026.1	C			36907574	-1	no_errors	ENST00000216190	ensembl	human	known	70_37	missense	SNP	0.368	G
EIF3I	8668	genome.wustl.edu	37	1	32692106	32692106	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:32692106G>A	ENST00000373586.1	+	6	575	c.503G>A	c.(502-504)gGa>gAa	p.G168E	EIF3I_ENST00000471486.1_3'UTR	NM_003757.2	NP_003748.1			eukaryotic translation initiation factor 3, subunit I											breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)				CATGAGAGTGGAGAGCTCAAC	0.463																																					Colon(102;1138 2140 2180 17876)												0													164.0	176.0	172.0					1																	32692106		2203	4300	6503	SO:0001583	missense	8668			U39067	CCDS357.1	1p34.1	2013-01-10	2007-07-27	2007-07-27	ENSG00000084623	ENSG00000084623		"""WD repeat domain containing"""	3272	protein-coding gene	gene with protein product		603911	"""eukaryotic translation initiation factor 3, subunit 2 beta, 36kDa"""	EIF3S2		7566156, 8995409	Standard	NM_003757		Approved	TRIP-1, eIF3-beta, eIF3-p36, eIF3i	uc009vuc.3	Q13347	OTTHUMG00000007364	ENST00000373586.1:c.503G>A	1.37:g.32692106G>A	ENSP00000362688:p.Gly168Glu			Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G168E	ENST00000373586.1	37	c.503	CCDS357.1	1	.	.	.	.	.	.	.	.	.	.	g	25.3	4.628513	0.87560	.	.	ENSG00000084623	ENST00000373586	D	0.84516	-1.86	4.45	4.45	0.53987	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.053959	0.85682	D	0.000000	D	0.92792	0.7708	M	0.84433	2.695	0.80722	D	1	D	0.69078	0.997	D	0.70016	0.967	D	0.94238	0.7482	10	0.87932	D	0	-26.197	17.4525	0.87596	0.0:0.0:1.0:0.0	.	168	Q13347	EIF3I_HUMAN	E	168	ENSP00000362688:G168E	ENSP00000362688:G168E	G	+	2	0	EIF3I	32464693	1.000000	0.71417	0.996000	0.52242	0.987000	0.75469	9.392000	0.97252	2.187000	0.69744	0.457000	0.33378	GGA	EIF3I	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.463	EIF3I-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3I	HGNC	protein_coding	OTTHUMT00000019282.2	G	NM_003757		32692106	+1	no_errors	ENST00000373586	ensembl	human	known	70_37	missense	SNP	1.000	A
ELF3	1999	genome.wustl.edu	37	1	201981365	201981365	+	3'UTR	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:201981365C>T	ENST00000495848.1	+	0	565				RP11-465N4.4_ENST00000419190.1_RNA|RP11-510N19.5_ENST00000504773.1_RNA|ELF3_ENST00000359651.3_Intron|ELF3_ENST00000367284.5_Intron|ELF3_ENST00000367283.3_Intron					E74-like factor 3 (ets domain transcription factor, epithelial-specific )											breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	20						GAGTCGAGTTCAGTGTGGCCG	0.637																																																	0																																										SO:0001624	3_prime_UTR_variant	1999			AF016295	CCDS1419.1	1q32.2	2008-02-05			ENSG00000163435	ENSG00000163435			3318	protein-coding gene	gene with protein product		602191		ESX		9395241, 9129154	Standard	NM_001114309		Approved	EPR-1, ESE-1, ERT	uc001gxh.4	P78545	OTTHUMG00000035867	ENST00000495848.1:c.*562C>T	1.37:g.201981365C>T				RNA	SNP	-	NULL	ENST00000495848.1	37	NULL		1																																																																																			ELF3	-	-		0.637	ELF3-006	KNOWN	basic	processed_transcript	ELF3	HGNC	protein_coding	OTTHUMT00000087363.1	C	NM_004433		201981365	+1	no_errors	ENST00000490203	ensembl	human	known	70_37	rna	SNP	0.000	T
ELMO1	9844	genome.wustl.edu	37	7	37311454	37311454	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr7:37311454G>A	ENST00000310758.4	-	5	873	c.226C>T	c.(226-228)Cga>Tga	p.R76*	ELMO1_ENST00000448602.1_Nonsense_Mutation_p.R76*|ELMO1_ENST00000442504.1_Nonsense_Mutation_p.R76*	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	76					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						GTGGTTAATCGAAGGATAGTG	0.358																																																	0													142.0	145.0	144.0					7																	37311454		2203	4300	6503	SO:0001587	stop_gained	9844			AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.226C>T	7.37:g.37311454G>A	ENSP00000312185:p.Arg76*		A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Nonsense_Mutation	SNP	pfam_DUF3361,pfam_Engulfment_cell_motility_ELMO,superfamily_ARM-type_fold	p.R76*	ENST00000310758.4	37	c.226	CCDS5449.1	7	.	.	.	.	.	.	.	.	.	.	G	41	8.766743	0.98945	.	.	ENSG00000155849	ENST00000310758;ENST00000442504;ENST00000448602;ENST00000455119;ENST00000455879;ENST00000453399	.	.	.	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.6483	0.62294	0.0:0.0:1.0:0.0	.	.	.	.	X	76	.	ENSP00000312185:R76X	R	-	1	2	ELMO1	37277979	1.000000	0.71417	0.999000	0.59377	0.965000	0.64279	3.432000	0.52824	2.941000	0.99782	0.655000	0.94253	CGA	ELMO1	-	NULL		0.358	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELMO1	HGNC	protein_coding	OTTHUMT00000219830.4	G	NM_130442		37311454	-1	no_errors	ENST00000310758	ensembl	human	known	70_37	nonsense	SNP	0.999	A
EMILIN3	90187	genome.wustl.edu	37	20	39991134	39991134	+	Missense_Mutation	SNP	C	C	G	rs199798808		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr20:39991134C>G	ENST00000332312.3	-	4	1267	c.1075G>C	c.(1075-1077)Gag>Cag	p.E359Q		NM_052846.1	NP_443078.1	Q9NT22	EMIL3_HUMAN	elastin microfibril interfacer 3	359						cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)				biliary_tract(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(3)|urinary_tract(2)	30		Myeloproliferative disorder(115;0.00425)				AGGGCCAGCTCCCGGCCATCA	0.672																																																	0								C	GLN/GLU	0,4400		0,0,2200	13.0	15.0	14.0		1075	5.1	1.0	20		14	1,8587		0,1,4293	no	missense	EMILIN3	NM_052846.1	29	0,1,6493	GG,GC,CC		0.0116,0.0,0.0077	probably-damaging	359/767	39991134	1,12987	2200	4294	6494	SO:0001583	missense	90187			AL031667	CCDS13316.1	20q12	2005-11-06	2004-03-02	2004-03-02	ENSG00000183798	ENSG00000183798		"""EMI domain containing"""	16123	protein-coding gene	gene with protein product	"""chromosome 20 open reading frame 130"""	608929	"""elastin microfibril interfacer 5"""	C20orf130, EMILIN5		12221002	Standard	NM_052846		Approved	dJ620E11.4	uc002xjy.1	Q9NT22	OTTHUMG00000046304	ENST00000332312.3:c.1075G>C	20.37:g.39991134C>G	ENSP00000332806:p.Glu359Gln		Q495S5|Q495S6|Q495S7|Q76KT4	Missense_Mutation	SNP	pfam_EMI_domain,pfscan_EMI_domain	p.E359Q	ENST00000332312.3	37	c.1075	CCDS13316.1	20	.	.	.	.	.	.	.	.	.	.	C	19.24	3.788884	0.70337	0.0	1.16E-4	ENSG00000183798	ENST00000332312	T	0.29397	1.57	5.14	5.14	0.70334	.	0.143577	0.45126	D	0.000399	T	0.55545	0.1927	M	0.68952	2.095	0.47621	D	0.999475	D	0.89917	1.0	D	0.83275	0.996	T	0.54403	-0.8299	9	.	.	.	-23.7548	18.5996	0.91244	0.0:1.0:0.0:0.0	.	359	Q9NT22	EMIL3_HUMAN	Q	359	ENSP00000332806:E359Q	.	E	-	1	0	EMILIN3	39424548	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.477000	0.60223	2.402000	0.81655	0.561000	0.74099	GAG	EMILIN3	-	NULL		0.672	EMILIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMILIN3	HGNC	protein_coding	OTTHUMT00000106876.2	C	XM_029741		39991134	-1	no_errors	ENST00000332312	ensembl	human	known	70_37	missense	SNP	1.000	G
ENO2	2026	genome.wustl.edu	37	12	7027274	7027274	+	Silent	SNP	C	C	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr12:7027274C>A	ENST00000535366.1	+	6	1241	c.615C>A	c.(613-615)acC>acA	p.T205T	ENO2_ENST00000229277.1_Silent_p.T205T|ENO2_ENST00000541477.1_Silent_p.T205T|ENO2_ENST00000545045.2_Intron|ENO2_ENST00000538763.1_Silent_p.T162T|ENO2_ENST00000544774.1_Silent_p.T162T			P09104	ENOG_HUMAN	enolase 2 (gamma, neuronal)	205					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|perikaryon (GO:0043204)|phosphopyruvate hydratase complex (GO:0000015)|photoreceptor inner segment (GO:0001917)|plasma membrane (GO:0005886)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			endometrium(3)|large_intestine(2)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						AGGATGCCACCAATGTGGGGG	0.547																																																	0													86.0	83.0	84.0					12																	7027274		2203	4300	6503	SO:0001819	synonymous_variant	2026			M22349	CCDS8570.1	12p13	2012-10-02				ENSG00000111674	4.2.1.11		3353	protein-coding gene	gene with protein product		131360					Standard	NM_001975		Approved		uc001qru.1	P09104		ENST00000535366.1:c.615C>A	12.37:g.7027274C>A			B7Z2X9|Q96J33	Silent	SNP	pfam_Enolase_C,pfam_Enolase_N,pfam_MeAsp_NH4-lyase_C,pirsf_Enolase,prints_Enolase,tigrfam_Enolase	p.T205	ENST00000535366.1	37	c.615	CCDS8570.1	12																																																																																			ENO2	-	pfam_Enolase_C,pirsf_Enolase,tigrfam_Enolase		0.547	ENO2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENO2	HGNC	protein_coding	OTTHUMT00000401786.1	C			7027274	+1	no_errors	ENST00000229277	ensembl	human	known	70_37	silent	SNP	0.996	A
AC008132.13	0	genome.wustl.edu	37	22	18841226	18841226	+	3'UTR	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr22:18841226C>T	ENST00000412938.1	+	0	2166																											CAAATGCTGCCAGGACACGGA	0.448																																																	0																																										SO:0001624	3_prime_UTR_variant	0																														ENST00000412938.1:c.*2163C>T	22.37:g.18841226C>T				RNA	SNP	-	NULL	ENST00000412938.1	37	NULL		22																																																																																			AC008103.5	-	-		0.448	AC008132.13-002	KNOWN	basic	processed_transcript	ENSG00000161103	Clone_based_vega_gene	protein_coding	OTTHUMT00000471615.1	C			18841226	+1	no_errors	ENST00000412938	ensembl	human	known	70_37	rna	SNP	0.030	T
CCDC182	101927581	genome.wustl.edu	37	17	55822601	55822601	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:55822601G>A	ENST00000299415.2	-	1	72	c.33C>T	c.(31-33)ctC>ctT	p.L11L		NM_001282544.1	NP_001269473.1																					TCACCGTCATGAGAATGGACC	0.502																																																	0																																										SO:0001819	synonymous_variant	0																														ENST00000299415.2:c.33C>T	17.37:g.55822601G>A				Silent	SNP	NULL	p.L11	ENST00000299415.2	37	c.33		17																																																																																			AC007431.1	-	NULL		0.502	AC007431.1-001	PUTATIVE	basic|appris_principal	protein_coding	ENSG00000166329	Clone_based_vega_gene	protein_coding	OTTHUMT00000255086.1	G			55822601	-1	no_errors	ENST00000299415	ensembl	human	putative	70_37	silent	SNP	0.999	A
RP11-24M17.5	0	genome.wustl.edu	37	15	76074660	76074660	+	RNA	SNP	G	G	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr15:76074660G>T	ENST00000395215.3	+	0	732				RN7SL319P_ENST00000480656.2_RNA																							AGAGAGAGATGAATATGCTCA	0.522																																																	0																																												0																															15.37:g.76074660G>T				RNA	SNP	-	NULL	ENST00000395215.3	37	NULL		15	.	.	.	.	.	.	.	.	.	.	.	2.505	-0.314392	0.05422	.	.	ENSG00000187812	ENST00000395215	.	.	.	0.789	-1.58	0.08479	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	6.6229	0.22812	0.0:0.6854:0.3146:0.0	.	.	.	.	X	231	.	ENSP00000378641:E231X	E	+	1	0	AC019294.2	73861715	0.809000	0.29036	0.006000	0.13384	0.007000	0.05969	1.117000	0.31234	-0.436000	0.07254	0.274000	0.19336	GAA	RP11-24M17.5	-	-		0.522	RP11-24M17.5-001	KNOWN	basic	processed_transcript	ENSG00000187812	Clone_based_vega_gene	pseudogene	OTTHUMT00000420501.1	G			76074660	+1	no_errors	ENST00000395215	ensembl	human	known	70_37	rna	SNP	0.960	T
KRT19P1	441160	genome.wustl.edu	37	6	72294885	72294885	+	RNA	SNP	C	C	T	rs577796217		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr6:72294885C>T	ENST00000390196.1	+	0	94																											AGATCGACAACGCCCGTCTGG	0.587													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18854	0.0		0.0	False		,,,				2504	0.0																0																																												0																															6.37:g.72294885C>T				RNA	SNP	-	NULL	ENST00000390196.1	37	NULL		6																																																																																			AL354933.1	-	-		0.587	AL354933.1-201	NOVEL	basic	miRNA	ENSG00000211530	Clone_based_ensembl_gene	miRNA		C			72294885	+1	no_errors	ENST00000390196	ensembl	human	novel	70_37	rna	SNP	1.000	T
MUC3A	4584	genome.wustl.edu	37	7	100608197	100608198	+	Intron	INS	-	-	GGG	rs373235112		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr7:100608197_100608198insGGG	ENST00000319509.7	+	6	2041				RP11-395B7.2_ENST00000434775.1_RNA|RP11-395B7.2_ENST00000420080.1_RNA			Q02505	MUC3A_HUMAN	mucin 3A, cell surface associated						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|extracellular matrix structural constituent (GO:0005201)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(32)|prostate(3)	44						GCCCCTCCACACTCCCCCAGAC	0.609																																																	0																																										SO:0001627	intron_variant	0			AF113616		7q22.1	2012-04-20	2006-03-14		ENSG00000169894	ENSG00000169894		"""Mucins"""	7513	protein-coding gene	gene with protein product		158371	"""mucin 3A, intestinal"""	MUC3		2393399, 10973822	Standard	XM_006710192		Approved		uc003uxl.1	Q02505	OTTHUMG00000157038	ENST00000319509.7:c.2042-109->GGG	7.37:g.100608197_100608198insGGG			O14650|O14651|O43418|O43421|Q02506|Q6W763|Q9H3Q7|Q9UKW9|Q9UN93|Q9UN94|Q9UN95	RNA	INS	-	NULL	ENST00000319509.7	37	NULL		7																																																																																			RP11-395B7.2	-	-		0.609	MUC3A-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_candidate_longest	protein_coding	ENSG00000225946	Clone_based_vega_gene	protein_coding	OTTHUMT00000347215.1	-	XM_001725354		100608198	-1	no_errors	ENST00000420080	ensembl	human	known	70_37	rna	INS	0.000:0.000	GGG
KRT16P6	353194	genome.wustl.edu	37	17	16723983	16723983	+	RNA	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:16723983G>A	ENST00000417510.1	-	0	683																											GCTTGGTGCGGAAGTCATCTG	0.537																																																	0																																												0																															17.37:g.16723983G>A				RNA	SNP	-	NULL	ENST00000417510.1	37	NULL		17																																																																																			AC022596.6	-	-		0.537	AC022596.6-002	KNOWN	basic	processed_transcript	ENSG00000226145	Clone_based_vega_gene	pseudogene	OTTHUMT00000131123.1	G			16723983	-1	no_errors	ENST00000417510	ensembl	human	known	70_37	rna	SNP	1.000	A
RBM8A	9939	genome.wustl.edu	37	1	145507881	145507881	+	Intron	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:145507881G>C	ENST00000330165.8	+	2	136				RP11-315I20.1_ENST00000448561.1_RNA|RP11-315I20.1_ENST00000601726.1_RNA|RP11-315I20.1_ENST00000597144.1_RNA|GNRHR2_ENST00000312753.5_RNA|RP11-315I20.1_ENST00000437797.1_RNA|RP11-315I20.1_ENST00000595494.1_RNA|RP11-315I20.1_ENST00000596355.1_RNA|RP11-315I20.1_ENST00000412239.1_RNA|RP11-315I20.1_ENST00000598103.1_RNA|RP11-315I20.1_ENST00000599147.1_RNA|RP11-315I20.1_ENST00000600340.1_RNA|RBM8A_ENST00000369307.3_Intron|RP11-315I20.1_ENST00000599469.1_RNA|RP11-315I20.1_ENST00000447686.2_RNA|RP11-315I20.1_ENST00000421764.1_RNA|RP11-315I20.1_ENST00000598354.1_RNA|RP11-315I20.1_ENST00000599626.1_RNA|RP11-315I20.1_ENST00000595518.1_RNA	NM_005105.3	NP_005096.1	Q9Y5S9	RBM8A_HUMAN	RNA binding motif protein 8A						gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CCCTTCAGGAGAAGGGAGGGC	0.507											OREG0013748	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001627	intron_variant	0			AF127761	CCDS72872.1	1q21.1	2013-02-12			ENSG00000131795			"""RNA binding motif (RRM) containing"""	9905	protein-coding gene	gene with protein product		605313		RBM8		11004516, 11013075	Standard	NM_005105		Approved	ZNRP, BOV-1A, BOV-1B, BOV-1C, RBM8B, Y14	uc001ent.2	Q9Y5S9	OTTHUMG00000013736	ENST00000330165.8:c.68-135G>C	1.37:g.145507881G>C		1695	B3KQI9|Q6FHD1|Q6IQ40|Q9GZX8|Q9NZI4	RNA	SNP	-	NULL	ENST00000330165.8	37	NULL	CCDS916.1	1																																																																																			RP11-315I20.1	-	-		0.507	RBM8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000234222	Clone_based_vega_gene	protein_coding	OTTHUMT00000038503.2	G	NM_005105		145507881	-1	no_errors	ENST00000412239	ensembl	human	known	70_37	rna	SNP	0.018	C
CNIH3	149111	genome.wustl.edu	37	1	224918072	224918072	+	Intron	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:224918072G>A	ENST00000272133.3	+	4	1080				RP11-3L21.2_ENST00000431691.1_RNA	NM_152495.1	NP_689708.1	Q8TBE1	CNIH3_HUMAN	cornichon family AMPA receptor auxiliary protein 3						intracellular signal transduction (GO:0035556)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of membrane potential (GO:0042391)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendritic shaft (GO:0043198)|postsynaptic membrane (GO:0045211)	channel regulator activity (GO:0016247)			large_intestine(5)|lung(4)	9	Breast(184;0.218)			GBM - Glioblastoma multiforme(131;0.073)		CCGTCTGTGAGAGGCAGTGTC	0.547																																																	0																																										SO:0001627	intron_variant	0			AF070524	CCDS1544.1	1q42.12	2013-08-28	2013-08-28		ENSG00000143786	ENSG00000143786			26802	protein-coding gene	gene with protein product			"""cornichon homolog 3 (Drosophila)"""			8619474, 9110174	Standard	NM_152495		Approved	FLJ38993, CNIH-3	uc001hos.1	Q8TBE1	OTTHUMG00000037634	ENST00000272133.3:c.199-92G>A	1.37:g.224918072G>A				RNA	SNP	-	NULL	ENST00000272133.3	37	NULL	CCDS1544.1	1																																																																																			RP11-3L21.2	-	-		0.547	CNIH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000229400	Clone_based_vega_gene	protein_coding	OTTHUMT00000091752.2	G	NM_152495		224918072	-1	no_errors	ENST00000431691	ensembl	human	known	70_37	rna	SNP	0.000	A
Unknown	0	genome.wustl.edu	37	7	31117	31117	+	IGR	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr7:31117G>A								None (None upstream) : AC093627.7 (39854 downstream)																							CGTTCCTGAGGAGCTGAGGAG	0.647																																																	0																																										SO:0001628	intergenic_variant	0																															7.37:g.31117G>A				RNA	SNP	-	NULL		37	NULL		7																																																																																			AC093627.6	-	-	0	0.647					ENSG00000244758	Clone_based_vega_gene			G			31117	-1	no_errors	ENST00000469418	ensembl	human	known	70_37	rna	SNP	0.062	A
RP11-643G16.4	0	genome.wustl.edu	37	14	68082425	68082425	+	RNA	SNP	G	G	C	rs571878900	byFrequency	TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr14:68082425G>C	ENST00000559968.1	+	0	780				Y_RNA_ENST00000364659.1_RNA																							AAAGAGAAATGAAAACATATA	0.448																																																	0																																												0																															14.37:g.68082425G>C				RNA	SNP	-	NULL	ENST00000559968.1	37	NULL		14																																																																																			RP11-643G16.4	-	-		0.448	RP11-643G16.4-002	KNOWN	basic	processed_transcript	ENSG00000259648	Clone_based_vega_gene	pseudogene	OTTHUMT00000417022.1	G			68082425	+1	no_errors	ENST00000559968	ensembl	human	known	70_37	rna	SNP	1.000	C
DNM1P47	100216544	genome.wustl.edu	37	15	102293062	102293064	+	RNA	DEL	CTC	CTC	-	rs4965539|rs62026972	byFrequency	TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	CTC	CTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr15:102293062_102293064delCTC	ENST00000561463.1	+	0	1108_1110									DNM1 pseudogene 47																		AGTTCATCTTCTCAGAGCTGCTG	0.576																																																	0																																												0			AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102293062_102293064delCTC				RNA	DEL	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			CTD-2611K5.6	-	-		0.576	DNM1P47-001	KNOWN	basic	processed_transcript	ENSG00000259660	Clone_based_vega_gene	pseudogene	OTTHUMT00000417589.1	CTC	NG_009149		102293064	+1	no_errors	ENST00000561463	ensembl	human	known	70_37	rna	DEL	1.000:1.000:0.999	-
NFE2L1	4779	genome.wustl.edu	37	17	46138017	46138017	+	3'UTR	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:46138017G>A	ENST00000362042.3	+	0	3949				NFE2L1_ENST00000585291.1_3'UTR|NFE2L1_ENST00000357480.5_3'UTR|RP5-890E16.4_ENST00000583349.1_RNA|NFE2L1_ENST00000361665.3_3'UTR	NM_003204.2	NP_003195.1	Q14494	NF2L1_HUMAN	nuclear factor, erythroid 2-like 1						anatomical structure morphogenesis (GO:0009653)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|inflammatory response (GO:0006954)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)			cervix(1)|endometrium(3)|kidney(9)|large_intestine(7)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GAGGAATGATGGAGAATCTAG	0.582																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK090459	CCDS11524.1	17q21.3	2013-08-23	2013-08-23			ENSG00000082641		"""basic leucine zipper proteins"""	7781	protein-coding gene	gene with protein product		163260	"""nuclear factor (erythroid-derived 2)-like 1"""	TCF11		8248256, 9501099	Standard	NM_003204		Approved	NRF1, LCR-F1, FLJ00380	uc002imz.4	Q14494		ENST00000362042.3:c.*1014G>A	17.37:g.46138017G>A			D3DTU3|D3DTU5|Q12877|Q96FN6	RNA	SNP	-	NULL	ENST00000362042.3	37	NULL	CCDS11524.1	17																																																																																			RP5-890E16.4	-	-		0.582	NFE2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000266341	Clone_based_vega_gene	protein_coding	OTTHUMT00000443019.1	G	NM_003204		46138017	-1	no_errors	ENST00000583349	ensembl	human	known	70_37	rna	SNP	0.001	A
SIX5	147912	genome.wustl.edu	37	19	46271268	46271268	+	Intron	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:46271268G>C	ENST00000317578.6	-	1	1185				SIX5_ENST00000560168.1_Intron|AC074212.6_ENST00000591530.1_RNA|AC074212.6_ENST00000590076.1_RNA|AC074212.6_ENST00000586251.1_RNA|AC074212.5_ENST00000592217.2_RNA|AC074212.5_ENST00000559756.1_RNA	NM_175875.4	NP_787071	Q8N196	SIX5_HUMAN	SIX homeobox 5						lens development in camera-type eye (GO:0002088)|negative regulation of cell proliferation (GO:0008285)|regulation of transcription, DNA-templated (GO:0006355)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00783)|GBM - Glioblastoma multiforme(486;0.0802)|Epithelial(262;0.235)		GTCCCCGGGAGAGCTGGACTT	0.721																																																	0													6.0	7.0	7.0					19																	46271268		2056	4018	6074	SO:0001627	intron_variant	0			L08835	CCDS12673.1	19q13.32	2011-06-20	2007-07-13			ENSG00000177045		"""Homeoboxes / SINE class"""	10891	protein-coding gene	gene with protein product		600963	"""sine oculis homeobox (Drosophila) homolog 5"", ""sine oculis homeobox homolog 5 (Drosophila)"""	DMAHP		8595416	Standard	NM_175875		Approved		uc002pdb.3	Q8N196		ENST00000317578.6:c.803+31C>G	19.37:g.46271268G>C				RNA	SNP	-	NULL	ENST00000317578.6	37	NULL	CCDS12673.1	19																																																																																			AC074212.6	-	-		0.721	SIX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000267395	Clone_based_vega_gene	protein_coding	OTTHUMT00000417341.3	G	NM_175875		46271268	+1	no_errors	ENST00000590076	ensembl	human	known	70_37	rna	SNP	0.000	C
ENTPD8	377841	genome.wustl.edu	37	9	140330468	140330468	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr9:140330468G>A	ENST00000472938.1	-	6	1063	c.1047C>T	c.(1045-1047)ttC>ttT	p.F349F	ENTPD8_ENST00000344119.2_Silent_p.F349F|ENTPD8_ENST00000371506.2_Silent_p.F349F			Q5MY95	ENTP8_HUMAN	ectonucleoside triphosphate diphosphohydrolase 8	349					nucleoside diphosphate biosynthetic process (GO:0009133)|nucleoside monophosphate biosynthetic process (GO:0009124)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			biliary_tract(1)|lung(4)|prostate(1)|skin(1)	7	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000224)|Epithelial(140;0.000898)		TGCTCACATAGAACTGGCCCC	0.662																																																	0													25.0	29.0	28.0					9																	140330468		2199	4299	6498	SO:0001819	synonymous_variant	377841			AY359088	CCDS7043.1, CCDS43913.1	9q34.3	2013-09-20			ENSG00000188833	ENSG00000188833			24860	protein-coding gene	gene with protein product	"""GLSR2492"""					12975309	Standard	NM_198585		Approved	UNQ2492, NTPDase-8	uc004cmw.3	Q5MY95	OTTHUMG00000131831	ENST00000472938.1:c.1047C>T	9.37:g.140330468G>A			A2BG17|Q6UVZ0	Silent	SNP	pfam_GDA1_CD39_NTPase	p.F349	ENST00000472938.1	37	c.1047	CCDS43913.1	9																																																																																			ENTPD8	-	pfam_GDA1_CD39_NTPase		0.662	ENTPD8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTPD8	HGNC	protein_coding	OTTHUMT00000355991.1	G	NM_198585		140330468	-1	no_errors	ENST00000371506	ensembl	human	known	70_37	silent	SNP	1.000	A
ENTPD8	377841	genome.wustl.edu	37	9	140330988	140330988	+	Silent	SNP	G	G	A	rs539989401		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr9:140330988G>A	ENST00000472938.1	-	5	787	c.771C>T	c.(769-771)ctC>ctT	p.L257L	ENTPD8_ENST00000344119.2_Silent_p.L257L|ENTPD8_ENST00000371506.2_Silent_p.L257L			Q5MY95	ENTP8_HUMAN	ectonucleoside triphosphate diphosphohydrolase 8	257					nucleoside diphosphate biosynthetic process (GO:0009133)|nucleoside monophosphate biosynthetic process (GO:0009124)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			biliary_tract(1)|lung(4)|prostate(1)|skin(1)	7	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000224)|Epithelial(140;0.000898)		CCAGCCCCACGAGGAGCCTGC	0.652													g|||	1	0.000199681	0.0	0.0	5008	,	,		15825	0.0		0.0	False		,,,				2504	0.001																0													27.0	26.0	26.0					9																	140330988		2194	4294	6488	SO:0001819	synonymous_variant	377841			AY359088	CCDS7043.1, CCDS43913.1	9q34.3	2013-09-20			ENSG00000188833	ENSG00000188833			24860	protein-coding gene	gene with protein product	"""GLSR2492"""					12975309	Standard	NM_198585		Approved	UNQ2492, NTPDase-8	uc004cmw.3	Q5MY95	OTTHUMG00000131831	ENST00000472938.1:c.771C>T	9.37:g.140330988G>A			A2BG17|Q6UVZ0	Silent	SNP	pfam_GDA1_CD39_NTPase	p.L257	ENST00000472938.1	37	c.771	CCDS43913.1	9																																																																																			ENTPD8	-	pfam_GDA1_CD39_NTPase		0.652	ENTPD8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTPD8	HGNC	protein_coding	OTTHUMT00000355991.1	G	NM_198585		140330988	-1	no_errors	ENST00000371506	ensembl	human	known	70_37	silent	SNP	0.475	A
ERAP1	51752	genome.wustl.edu	37	5	96112236	96112236	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr5:96112236G>C	ENST00000443439.2	-	19	2756	c.2690C>G	c.(2689-2691)tCt>tGt	p.S897C	ERAP1_ENST00000296754.3_Missense_Mutation_p.S897C	NM_001040458.1|NM_001198541.1	NP_001035548.1|NP_001185470.1	Q9NZ08	ERAP1_HUMAN	endoplasmic reticulum aminopeptidase 1	897					angiogenesis (GO:0001525)|antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|fat cell differentiation (GO:0045444)|membrane protein ectodomain proteolysis (GO:0006509)|positive regulation of angiogenesis (GO:0045766)|regulation of blood pressure (GO:0008217)|regulation of innate immune response (GO:0045088)|response to bacterium (GO:0009617)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|interleukin-1, Type II receptor binding (GO:0005151)|interleukin-6 receptor binding (GO:0005138)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|stomach(2)	19		all_cancers(142;1.75e-06)|all_epithelial(76;3.08e-09)|all_lung(232;0.000435)|Lung NSC(167;0.000601)|Ovarian(225;0.024)|Colorectal(57;0.0432)|Breast(839;0.244)		all cancers(79;7.26e-15)|COAD - Colon adenocarcinoma(37;0.071)		TTCTTTCAAAGAGCTGAAGAA	0.318																																																	0													87.0	82.0	83.0					5																	96112236		2203	4300	6503	SO:0001583	missense	51752			AB011097	CCDS4085.1, CCDS47250.1	5q15	2014-04-07			ENSG00000164307	ENSG00000164307			18173	protein-coding gene	gene with protein product	"""aminopeptidase regulator of TNFR1 shedding"", ""adipocyte-derived leucine aminopeptidase"", ""puromycin-insensitive leucyl-specific aminopeptidase"""	606832				10220586, 12189246, 16286653	Standard	NM_001198541		Approved	ARTS-1, A-LAP, PILS-AP, KIAA0525, ERAAP1	uc003kml.3	Q9NZ08	OTTHUMG00000128721	ENST00000443439.2:c.2690C>G	5.37:g.96112236G>C	ENSP00000406304:p.Ser897Cys		O60278|Q6UWY6|Q8NEL4|Q8TAD0|Q9UHF8|Q9UKY2	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.S897C	ENST00000443439.2	37	c.2690	CCDS47250.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.03|17.03	3.284243|3.284243	0.59867|0.59867	.|.	.|.	ENSG00000164307|ENSG00000164307	ENST00000512852|ENST00000296754;ENST00000443439;ENST00000414384	.|T;T	.|0.06218	.|3.33;3.33	5.97|5.97	5.97|5.97	0.96955|0.96955	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.28962|0.28962	0.0719|0.0719	M|M	0.80183|0.80183	2.485|2.485	0.52099|0.52099	D|D	0.999948|0.999948	.|P;D;D	.|0.76494	.|0.495;0.999;0.999	.|B;D;D	.|0.67231	.|0.188;0.95;0.916	T|T	0.00361|0.00361	-1.1789|-1.1789	5|10	.|0.72032	.|D	.|0.01	.|.	20.0338|20.0338	0.97549|0.97549	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|897;897;897	.|A8K6H1;Q9NZ08;Q9NZ08-2	.|.;ERAP1_HUMAN;.	V|C	76|897	.|ENSP00000296754:S897C;ENSP00000406304:S897C	.|ENSP00000296754:S897C	L|S	-|-	1|2	0|0	ERAP1|ERAP1	96137992|96137992	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.073000|7.073000	0.76784|0.76784	2.836000|2.836000	0.97738|0.97738	0.655000|0.655000	0.94253|0.94253	CTT|TCT	ERAP1	-	NULL		0.318	ERAP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ERAP1	HGNC	protein_coding	OTTHUMT00000370699.1	G	NM_016442		96112236	-1	no_errors	ENST00000296754	ensembl	human	known	70_37	missense	SNP	1.000	C
ERBB2	2064	genome.wustl.edu	37	17	37868208	37868208	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:37868208C>T	ENST00000269571.5	+	8	1088	c.929C>T	c.(928-930)tCc>tTc	p.S310F	ERBB2_ENST00000540147.1_Missense_Mutation_p.S280F|ERBB2_ENST00000540042.1_Missense_Mutation_p.S280F|ERBB2_ENST00000578199.1_Missense_Mutation_p.S280F|ERBB2_ENST00000406381.2_Missense_Mutation_p.S280F|ERBB2_ENST00000445658.2_Missense_Mutation_p.S34F|ERBB2_ENST00000584450.1_Missense_Mutation_p.S310F|ERBB2_ENST00000541774.1_Missense_Mutation_p.S295F|ERBB2_ENST00000584601.1_Missense_Mutation_p.S280F			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	310					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)	p.S310F(6)|p.S310Y(1)		NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	GACGTGGGATCCTGCACCCTC	0.582		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																														Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	7	Substitution - Missense(7)	lung(4)|urinary_tract(1)|ovary(1)|breast(1)											251.0	204.0	220.0					17																	37868208		2203	4300	6503	SO:0001583	missense	2064			X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.929C>T	17.37:g.37868208C>T	ENSP00000269571:p.Ser310Phe		B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S310F	ENST00000269571.5	37	c.929	CCDS32642.1	17	.	.	.	.	.	.	.	.	.	.	C	14.61	2.586908	0.46110	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000445658;ENST00000269571;ENST00000540147;ENST00000540042	T;T;T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11;-0.11;-0.11	5.83	5.83	0.93111	Growth factor, receptor (1);Furin-like cysteine-rich domain (1);	.	.	.	.	T	0.79375	0.4435	M	0.70842	2.15	0.53688	D	0.999977	D;D;D;D;D	0.89917	0.998;1.0;1.0;1.0;0.997	D;D;D;D;D	0.79108	0.955;0.988;0.975;0.992;0.92	T	0.79438	-0.1803	9	0.59425	D	0.04	.	18.8848	0.92372	0.0:1.0:0.0:0.0	.	34;280;295;310;310	B4DTR1;F5H1T4;P04626-4;P04626;Q9UK79	.;.;.;ERBB2_HUMAN;.	F	280;295;34;310;280;280	ENSP00000385185:S280F;ENSP00000446466:S295F;ENSP00000404047:S34F;ENSP00000269571:S310F;ENSP00000443562:S280F;ENSP00000446382:S280F	ENSP00000269571:S310F	S	+	2	0	ERBB2	35121734	1.000000	0.71417	1.000000	0.80357	0.752000	0.42762	6.178000	0.71968	2.766000	0.95052	0.491000	0.48974	TCC	ERBB2	-	pfam_Furin-like_Cys-rich_dom,superfamily_Growth_fac_rcpt,pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt		0.582	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB2	HGNC	protein_coding	OTTHUMT00000445621.2	C			37868208	+1	no_errors	ENST00000269571	ensembl	human	known	70_37	missense	SNP	1.000	T
ERCC6L2	375748	genome.wustl.edu	37	9	98643489	98643489	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr9:98643489G>A	ENST00000288985.7	+	2	723	c.418G>A	c.(418-420)Gaa>Aaa	p.E140K	ERCC6L2_ENST00000466840.1_3'UTR	NM_001010895.2	NP_001010895.1	Q5T890	ER6L2_HUMAN	excision repair cross-complementation group 6-like 2	140					DNA repair (GO:0006281)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)										CTACCAAAGAGAAGGAACCCG	0.383																																																	0													72.0	73.0	73.0					9																	98643489		2203	4300	6503	SO:0001583	missense	375748			BC022957	CCDS35072.1	9q22.32	2014-03-07	2014-03-07	2012-03-30	ENSG00000182150	ENSG00000182150			26922	protein-coding gene	gene with protein product		615667	"""chromosome 9 open reading frame 102"", ""excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2"""	C9orf102			Standard	NM_001010895		Approved	FLJ37706, RAD26L	uc004avt.4	Q5T890	OTTHUMG00000020289	ENST00000288985.7:c.418G>A	9.37:g.98643489G>A	ENSP00000288985:p.Glu140Lys		A4D997|B2RTP8|Q49AM9|Q5T892|Q8N663|Q8N9D0|Q9NPM7	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E140K	ENST00000288985.7	37	c.418	CCDS35072.1	9	.	.	.	.	.	.	.	.	.	.	G	24.4	4.526354	0.85600	.	.	ENSG00000182150	ENST00000288985	D	0.93426	-3.22	5.32	3.44	0.39384	DEAD-like helicase (1);SNF2-related (1);	0.210116	0.31279	N	0.007928	D	0.95004	0.8383	L	0.58925	1.835	0.80722	D	1	D	0.71674	0.998	D	0.70227	0.968	D	0.94788	0.7959	10	0.59425	D	0.04	-18.7524	12.1215	0.53893	0.1422:0.0:0.8578:0.0	.	140	Q5T890	RAD26_HUMAN	K	140	ENSP00000288985:E140K	ENSP00000288985:E140K	E	+	1	0	C9orf102	97683310	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.222000	0.58580	1.462000	0.47948	0.591000	0.81541	GAA	ERCC6L2	-	pfam_SNF2_N,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd		0.383	ERCC6L2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ERCC6L2	HGNC	protein_coding	OTTHUMT00000053247.2	G	NM_001010895		98643489	+1	no_errors	ENST00000288985	ensembl	human	novel	70_37	missense	SNP	1.000	A
FAM160B2	64760	genome.wustl.edu	37	8	21957333	21957333	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr8:21957333G>A	ENST00000289921.7	+	10	1316	c.1270G>A	c.(1270-1272)Gaa>Aaa	p.E424K		NM_022749.5	NP_073586.5	Q86V87	F16B2_HUMAN	family with sequence similarity 160, member B2	424										endometrium(2)|kidney(1)|lung(2)|prostate(3)|urinary_tract(1)	9						CCGGCAGCCTGAAGCCCCCGG	0.652																																																	0													34.0	40.0	38.0					8																	21957333		1993	4156	6149	SO:0001583	missense	64760			AK025454	CCDS6021.2	8p21.3	2012-11-30	2008-06-05	2008-06-05	ENSG00000158863	ENSG00000158863			16492	protein-coding gene	gene with protein product			"""retinoic acid induced 16"""	RAI16		22971576, 15626329	Standard	XR_247128		Approved	FLJ21801	uc011kyx.2	Q86V87	OTTHUMG00000097088	ENST00000289921.7:c.1270G>A	8.37:g.21957333G>A	ENSP00000289921:p.Glu424Lys		B2RDQ5|B3KNX1|Q2M211|Q71JB5|Q7L3J6|Q969T0|Q9H6W4	Missense_Mutation	SNP	pfam_RetinoicA-induced_16-like	p.E424K	ENST00000289921.7	37	c.1270	CCDS6021.2	8	.	.	.	.	.	.	.	.	.	.	.	20.4	3.977589	0.74360	.	.	ENSG00000158863	ENST00000289921	T	0.32753	1.44	5.64	4.77	0.60923	.	0.337478	0.28921	N	0.013719	T	0.47544	0.1451	M	0.61703	1.905	0.40911	D	0.984238	D	0.56287	0.975	P	0.59643	0.861	T	0.51228	-0.8732	10	0.72032	D	0.01	-2.3094	12.0307	0.53396	0.083:0.0:0.917:0.0	.	424	Q86V87	F16B2_HUMAN	K	424	ENSP00000289921:E424K	ENSP00000289921:E424K	E	+	1	0	FAM160B2	22013278	1.000000	0.71417	0.004000	0.12327	0.146000	0.21551	6.218000	0.72224	1.392000	0.46585	0.655000	0.94253	GAA	FAM160B2	-	pfam_RetinoicA-induced_16-like		0.652	FAM160B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM160B2	HGNC	protein_coding	OTTHUMT00000375334.2	G			21957333	+1	no_errors	ENST00000289921	ensembl	human	known	70_37	missense	SNP	0.926	A
FAM196B	100131897	genome.wustl.edu	37	5	169310802	169310802	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr5:169310802G>A	ENST00000377365.3	-	2	1482	c.101C>T	c.(100-102)tCc>tTc	p.S34F	DOCK2_ENST00000256935.8_Intron|DOCK2_ENST00000540750.1_Intron|DOCK2_ENST00000520908.1_Intron|DOCK2_ENST00000523351.1_Intron|FAM196B_ENST00000523970.1_5'Flank	NM_001129891.1	NP_001123363.1	A6NMK8	F196B_HUMAN	family with sequence similarity 196, member B	34										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)|skin(1)	5						CACCTGCTGGGATTTGCTCCT	0.498																																																	0													72.0	69.0	70.0					5																	169310802		692	1591	2283	SO:0001583	missense	100131897				CCDS47336.1	5q35.1	2010-02-17	2009-09-11	2009-09-11	ENSG00000204767	ENSG00000204767			37271	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 57"""	C5orf57			Standard	NM_001129891		Approved		uc003mag.2	A6NMK8	OTTHUMG00000163083	ENST00000377365.3:c.101C>T	5.37:g.169310802G>A	ENSP00000366582:p.Ser34Phe			Missense_Mutation	SNP	NULL	p.S34F	ENST00000377365.3	37	c.101	CCDS47336.1	5	.	.	.	.	.	.	.	.	.	.	G	20.8	4.051797	0.75960	.	.	ENSG00000204767	ENST00000377365	T	0.55760	0.5	5.43	5.43	0.79202	.	0.000000	0.64402	D	0.000001	T	0.72700	0.3493	M	0.66939	2.045	0.50632	D	0.999881	D	0.89917	1.0	D	0.91635	0.999	T	0.75096	-0.3438	10	0.87932	D	0	-16.0604	19.2689	0.94000	0.0:0.0:1.0:0.0	.	34	A6NMK8	F196B_HUMAN	F	34	ENSP00000366582:S34F	ENSP00000366582:S34F	S	-	2	0	FAM196B	169243380	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.744000	0.74854	2.546000	0.85860	0.655000	0.94253	TCC	FAM196B	-	NULL		0.498	FAM196B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM196B	HGNC	protein_coding	OTTHUMT00000371629.1	G	NM_001129891		169310802	-1	no_errors	ENST00000377365	ensembl	human	known	70_37	missense	SNP	1.000	A
FAM208A	23272	genome.wustl.edu	37	3	56667929	56667929	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr3:56667929G>A	ENST00000493960.2	-	18	2900	c.2890C>T	c.(2890-2892)Cgg>Tgg	p.R964W	FAM208A_ENST00000431842.2_Intron|FAM208A_ENST00000355628.5_Intron	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	964							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						TTTATTACCCGGGGGTCGTTA	0.448																																																	0													10.0	9.0	9.0					3																	56667929		690	1591	2281	SO:0001583	missense	23272			AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.2890C>T	3.37:g.56667929G>A	ENSP00000417509:p.Arg964Trp		A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Missense_Mutation	SNP	pfam_DUF3715	p.R964W	ENST00000493960.2	37	c.2890	CCDS46853.1	3	.	.	.	.	.	.	.	.	.	.	G	18.50	3.636866	0.67130	.	.	ENSG00000163946	ENST00000493960	T	0.13778	2.56	5.62	5.62	0.85841	.	.	.	.	.	T	0.31231	0.0790	L	0.46157	1.445	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.00426	-1.1746	9	0.72032	D	0.01	.	14.8175	0.70045	0.0:0.0:0.856:0.144	.	964;964	Q9UK61-3;Q9UK61	.;F208A_HUMAN	W	964	ENSP00000417509:R964W	ENSP00000417509:R964W	R	-	1	2	C3orf63	56642969	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.027000	0.49697	2.801000	0.96364	0.650000	0.86243	CGG	FAM208A	-	NULL		0.448	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	FAM208A	HGNC	protein_coding	OTTHUMT00000352352.2	G	NM_015224		56667929	-1	no_errors	ENST00000493960	ensembl	human	putative	70_37	missense	SNP	1.000	A
FAM212B	55924	genome.wustl.edu	37	1	112270351	112270351	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:112270351G>T	ENST00000357260.5	-	2	314	c.133C>A	c.(133-135)Ctc>Atc	p.L45I	FAM212B_ENST00000534365.1_Missense_Mutation_p.L45I|FAM212B_ENST00000444059.2_Missense_Mutation_p.L30I	NM_019099.4	NP_061972.1	Q9NTI7	F212B_HUMAN	family with sequence similarity 212, member B	45										cervix(1)|endometrium(1)	2						ACCTGGAGGAGCTTCAGTTCT	0.582																																																	0													97.0	90.0	92.0					1																	112270351		2203	4300	6503	SO:0001583	missense	55924			AK055667	CCDS841.1, CCDS44195.1	1p13.2	2011-11-24	2011-11-24	2011-11-24	ENSG00000197852	ENSG00000197852			28045	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 183"""	C1orf183			Standard	NM_019099		Approved	FLJ31105	uc001ebo.2	Q9NTI7	OTTHUMG00000011953	ENST00000357260.5:c.133C>A	1.37:g.112270351G>T	ENSP00000349805:p.Leu45Ile		B3KP38|B4DF94|Q9NTI6	Missense_Mutation	SNP	NULL	p.L45I	ENST00000357260.5	37	c.133	CCDS841.1	1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.342721	0.82022	.	.	ENSG00000197852	ENST00000357260;ENST00000534365;ENST00000444059;ENST00000527621	.	.	.	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.72890	0.3517	M	0.62723	1.935	0.58432	D	0.999991	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.74450	-0.3661	9	0.52906	T	0.07	-29.2698	18.1378	0.89627	0.0:0.0:1.0:0.0	.	30;45	Q9NTI7-2;Q9NTI7	.;CA183_HUMAN	I	45;45;30;54	.	ENSP00000349805:L45I	L	-	1	0	C1orf183	112071874	1.000000	0.71417	0.999000	0.59377	0.933000	0.57130	7.405000	0.80007	2.344000	0.79699	0.561000	0.74099	CTC	FAM212B	-	NULL		0.582	FAM212B-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	FAM212B	HGNC	protein_coding	OTTHUMT00000033060.2	G	NM_019099		112270351	-1	no_errors	ENST00000357260	ensembl	human	known	70_37	missense	SNP	1.000	T
FAM217A	222826	genome.wustl.edu	37	6	4069315	4069315	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr6:4069315G>A	ENST00000274673.3	-	7	1545	c.1142C>T	c.(1141-1143)tCt>tTt	p.S381F	FAM217A_ENST00000380188.2_5'UTR	NM_173563.2	NP_775834.2	Q8IXS0	F217A_HUMAN	family with sequence similarity 217, member A	381																	CAGTGGTCTAGAATTCCATCT	0.338																																																	0													111.0	117.0	115.0					6																	4069315		2203	4300	6503	SO:0001583	missense	222826			BC039349	CCDS4489.1	6p25.1	2012-02-07	2012-02-07	2012-02-07	ENSG00000145975	ENSG00000145975			21362	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 146"""	C6orf146			Standard	NM_173563		Approved	MGC43581	uc003mvx.3	Q8IXS0	OTTHUMG00000014159	ENST00000274673.3:c.1142C>T	6.37:g.4069315G>A	ENSP00000274673:p.Ser381Phe		Q5JYK1	Missense_Mutation	SNP	NULL	p.S381F	ENST00000274673.3	37	c.1142	CCDS4489.1	6	.	.	.	.	.	.	.	.	.	.	G	8.939	0.965264	0.18583	.	.	ENSG00000145975	ENST00000274673;ENST00000538080;ENST00000470599	T	0.26518	1.73	5.16	3.31	0.37934	.	0.470835	0.19934	N	0.102793	T	0.19967	0.0480	M	0.62723	1.935	0.09310	N	1	P	0.50617	0.937	P	0.51777	0.679	T	0.04621	-1.0938	10	0.87932	D	0	-2.9659	8.1696	0.31247	0.0:0.1734:0.6466:0.18	.	381	Q8IXS0	CF146_HUMAN	F	381;228;509	ENSP00000274673:S381F	ENSP00000274673:S381F	S	-	2	0	C6orf146	4014314	0.029000	0.19370	0.002000	0.10522	0.003000	0.03518	2.376000	0.44292	0.688000	0.31529	-0.321000	0.08615	TCT	FAM217A	-	NULL		0.338	FAM217A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM217A	HGNC	protein_coding	OTTHUMT00000352577.2	G	NM_173563		4069315	-1	no_errors	ENST00000274673	ensembl	human	known	70_37	missense	SNP	0.004	A
FBLN2	2199	genome.wustl.edu	37	3	13612026	13612026	+	Silent	SNP	G	G	A	rs201140245		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr3:13612026G>A	ENST00000295760.7	+	2	240	c.171G>A	c.(169-171)acG>acA	p.T57T	FBLN2_ENST00000492059.1_Silent_p.T57T|FBLN2_ENST00000535798.1_Silent_p.T83T|FBLN2_ENST00000404922.3_Silent_p.T57T	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	57	N.|Subdomain NA (Cys-rich).				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			GCTGTGCCACGTGTGTGCAGC	0.687																																																	0													8.0	12.0	10.0					3																	13612026		2072	4185	6257	SO:0001819	synonymous_variant	2199			X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.171G>A	3.37:g.13612026G>A			B7Z9C5|Q8IUI0|Q8IUI1	Silent	SNP	pfam_EGF-like_Ca-bd,pfam_Anaphylatoxin/fibulin,superfamily_Anaphylatoxin_,smart_EG-like_dom,smart_Anaphylatoxin/fibulin,smart_EGF-like_Ca-bd,pfscan_Anaphylatoxin/fibulin,pfscan_EG-like_dom	p.T57	ENST00000295760.7	37	c.171	CCDS46762.1	3																																																																																			FBLN2	-	NULL		0.687	FBLN2-002	KNOWN	basic|CCDS	protein_coding	FBLN2	HGNC	protein_coding	OTTHUMT00000340083.3	G	NM_001004019		13612026	+1	no_errors	ENST00000404922	ensembl	human	known	70_37	silent	SNP	0.002	A
FES	2242	genome.wustl.edu	37	15	91437206	91437206	+	Silent	SNP	C	C	T	rs55808877	byFrequency	TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr15:91437206C>T	ENST00000328850.3	+	18	2386	c.2244C>T	c.(2242-2244)atC>atT	p.I748I	FES_ENST00000414248.2_Silent_p.I620I|FES_ENST00000394302.1_Silent_p.I607I|FES_ENST00000450438.2_Silent_p.I620I|FES_ENST00000444422.2_Silent_p.I678I|FES_ENST00000394300.3_Silent_p.I690I	NM_002005.3	NP_001996.1	P07332	FES_HUMAN	FES proto-oncogene, tyrosine kinase	748	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of neuron projection development (GO:0010976)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of mast cell degranulation (GO:0043304)|regulation of vesicle-mediated transport (GO:0060627)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule cytoskeleton (GO:0015630)	ATP binding (GO:0005524)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol binding (GO:0035091)|protein tyrosine kinase activity (GO:0004713)			lung(2)|ovary(1)	3	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			GCTTTGGCATCTTGCTCTGGG	0.627																																																	0								C	,,,	1,4395	2.1+/-5.4	0,1,2197	169.0	176.0	174.0		2070,2034,1860,2244	4.4	1.0	15	dbSNP_129	174	10,8586	7.1+/-27.0	0,10,4288	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	FES	NM_001143783.1,NM_001143784.1,NM_001143785.1,NM_002005.3	,,,	0,11,6485	TT,TC,CC		0.1163,0.0227,0.0847	,,,	690/765,678/753,620/695,748/823	91437206	11,12981	2198	4298	6496	SO:0001819	synonymous_variant	2242			X52192	CCDS10365.1, CCDS45349.1, CCDS45350.1, CCDS45351.1	15q26.1	2014-06-26	2014-06-26		ENSG00000182511	ENSG00000182511	2.7.10.1	"""SH2 domain containing"""	3657	protein-coding gene	gene with protein product	"""Oncogene FES, feline sarcoma virus"", ""c-fes/fps protein"""	190030	"""feline sarcoma (Snyder-Theilen) viral (v-fes)/Fujinami avian sarcoma (PRCII) viral (v-fps) oncogene homolog"", ""feline sarcoma oncogene"""			1870997	Standard	NM_002005		Approved	FPS	uc002bpv.3	P07332	OTTHUMG00000044456	ENST00000328850.3:c.2244C>T	15.37:g.91437206C>T			B2R6E6|B4DUD0|E9PC94|E9PC95|Q2VXS7|Q2VXS8|Q2VXT0|Q6GTU5	Silent	SNP	pirsf_Tyr_kinase_non-rcpt_Fes_subgr,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_FCH,superfamily_Kinase-like_dom,superfamily_t-SNARE,smart_FCH,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,pfscan_FCH,pfscan_SH2,pfscan_Prot_kinase_cat_dom	p.I748	ENST00000328850.3	37	c.2244	CCDS10365.1	15																																																																																			FES	-	pirsf_Tyr_kinase_non-rcpt_Fes_subgr,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.627	FES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FES	HGNC	protein_coding	OTTHUMT00000313497.1	C	NM_002005		91437206	+1	no_errors	ENST00000328850	ensembl	human	known	70_37	silent	SNP	1.000	T
FNDC7	163479	genome.wustl.edu	37	1	109264980	109264980	+	Missense_Mutation	SNP	C	C	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:109264980C>A	ENST00000370017.3	+	5	899	c.622C>A	c.(622-624)Caa>Aaa	p.Q208K	FNDC7_ENST00000271311.2_Missense_Mutation_p.Q209K	NM_001144937.1	NP_001138409.1	Q5VTL7	FNDC7_HUMAN	fibronectin type III domain containing 7	208	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.					extracellular region (GO:0005576)				breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|skin(4)|stomach(1)|urinary_tract(1)	20		all_lung(203;0.00439)|Lung NSC(277;0.00683)|all_epithelial(167;0.00728)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.173)|all cancers(265;0.244)		TGCCAACATTCAAGTCTCTTT	0.438																																																	0													46.0	40.0	42.0					1																	109264980		692	1591	2283	SO:0001583	missense	163479				CCDS44185.1	1p13.3	2013-02-11			ENSG00000143107	ENSG00000143107		"""Fibronectin type III domain containing"""	26668	protein-coding gene	gene with protein product						12477932	Standard	NM_001144937		Approved	FLJ35838	uc001dvx.3	Q5VTL7	OTTHUMG00000011120	ENST00000370017.3:c.622C>A	1.37:g.109264980C>A	ENSP00000359034:p.Gln208Lys		A1L468|E9PAZ5|Q6PF16|Q8NA51	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.Q209K	ENST00000370017.3	37	c.625	CCDS44185.1	1	.	.	.	.	.	.	.	.	.	.	C	11.02	1.515179	0.27123	.	.	ENSG00000143107	ENST00000370017;ENST00000271311	T;T	0.52754	0.65;0.65	5.63	5.63	0.86233	.	0.374427	0.33691	N	0.004659	T	0.28599	0.0708	L	0.60455	1.87	0.38387	D	0.945308	B	0.20261	0.043	B	0.13407	0.009	T	0.11842	-1.0571	10	0.14252	T	0.57	-0.838	15.9858	0.80151	0.1351:0.8649:0.0:0.0	.	208	E9PAZ5	.	K	208;209	ENSP00000359034:Q208K;ENSP00000271311:Q209K	ENSP00000271311:Q209K	Q	+	1	0	FNDC7	109066503	0.996000	0.38824	1.000000	0.80357	0.988000	0.76386	1.555000	0.36277	2.658000	0.90341	0.455000	0.32223	CAA	FNDC7	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.438	FNDC7-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FNDC7	HGNC	protein_coding	OTTHUMT00000030589.4	C	NM_173532		109264980	+1	no_errors	ENST00000271311	ensembl	human	known	70_37	missense	SNP	1.000	A
FOSB	2354	genome.wustl.edu	37	19	45976112	45976112	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:45976112C>G	ENST00000353609.3	+	4	1451	c.859C>G	c.(859-861)Caa>Gaa	p.Q287E	ERCC1_ENST00000423698.2_Intron|FOSB_ENST00000592811.1_3'UTR|FOSB_ENST00000585836.1_Missense_Mutation_p.Q212E|FOSB_ENST00000591858.1_Missense_Mutation_p.Q248E|FOSB_ENST00000443841.2_Missense_Mutation_p.Q144E|FOSB_ENST00000586615.1_Missense_Mutation_p.Q238E|FOSB_ENST00000417353.2_Missense_Mutation_p.Q251E|FOSB_ENST00000592436.1_3'UTR	NM_006732.2	NP_006723.2	P53539	FOSB_HUMAN	FBJ murine osteosarcoma viral oncogene homolog B	287					cellular response to calcium ion (GO:0071277)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to progesterone (GO:0032570)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|pancreas(1)	13		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00814)|Epithelial(262;0.18)|GBM - Glioblastoma multiforme(486;0.242)		CAGTGAAGTTCAAGTCCTCGG	0.642																																																	0													90.0	80.0	84.0					19																	45976112		2203	4300	6503	SO:0001583	missense	2354				CCDS12664.1, CCDS46113.1	19q13.3	2013-01-10						"""basic leucine zipper proteins"""	3797	protein-coding gene	gene with protein product	"""oncogene FOS-B"", ""activator protein 1"""	164772				1301997	Standard	NM_006732		Approved	G0S3, GOSB, GOS3, AP-1, MGC42291, DKFZp686C0818	uc002pbx.4	P53539		ENST00000353609.3:c.859C>G	19.37:g.45976112C>G	ENSP00000245919:p.Gln287Glu		A8K9K5|A8VJE1|A8VJE6|A8VJF0|A8VJF3|A8VJF7|A8VJG1|A8VJG5|A8VJG9|E7EPR6|E9PHJ3|K7EMJ6|Q49AD7	Missense_Mutation	SNP	pfam_bZIP,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Fos	p.Q287E	ENST00000353609.3	37	c.859	CCDS12664.1	19	.	.	.	.	.	.	.	.	.	.	C	3.466	-0.108908	0.06924	.	.	ENSG00000125740	ENST00000353609;ENST00000417353;ENST00000455928;ENST00000443841	T;T;T	0.45668	0.89;0.89;0.89	4.89	4.89	0.63831	.	0.542711	0.19895	N	0.103643	T	0.20618	0.0496	N	0.08118	0	0.29577	N	0.849459	B;B;B;B;B	0.13594	0.0;0.002;0.008;0.008;0.004	B;B;B;B;B	0.12156	0.003;0.002;0.007;0.007;0.003	T	0.06197	-1.0840	10	0.02654	T	1	-0.5165	13.4736	0.61295	0.0:1.0:0.0:0.0	.	144;248;212;251;287	E7EPR6;A8VJF0;A8VJF3;E9PHJ3;P53539	.;.;.;.;FOSB_HUMAN	E	287;251;240;144	ENSP00000245919:Q287E;ENSP00000407207:Q251E;ENSP00000414177:Q144E	ENSP00000245919:Q287E	Q	+	1	0	FOSB	50667952	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.949000	0.49074	2.568000	0.86640	0.555000	0.69702	CAA	FOSB	-	NULL		0.642	FOSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOSB	HGNC	protein_coding	OTTHUMT00000459561.1	C	NM_006732		45976112	+1	no_errors	ENST00000353609	ensembl	human	known	70_37	missense	SNP	1.000	G
FOXM1	2305	genome.wustl.edu	37	12	2968332	2968332	+	Silent	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr12:2968332G>C	ENST00000359843.3	-	9	1832	c.1764C>G	c.(1762-1764)ctC>ctG	p.L588L	Y_RNA_ENST00000410561.1_RNA|FOXM1_ENST00000342628.2_Silent_p.L626L|AC005841.1_ENST00000382678.3_5'Flank|ITFG2_ENST00000545509.1_Intron|FOXM1_ENST00000361953.3_Silent_p.L573L	NM_021953.3	NP_068772.2	Q08050	FOXM1_HUMAN	forkhead box M1	588					cell cycle (GO:0007049)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|liver development (GO:0001889)|mitotic cell cycle (GO:0000278)|negative regulation of cell aging (GO:0090344)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of cell cycle arrest (GO:0071156)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of Ras protein signal transduction (GO:0046578)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(3)	24			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			GGGAGTAGCTGAGCTGGGAGG	0.612																																																	0													45.0	52.0	49.0					12																	2968332		2193	4288	6481	SO:0001819	synonymous_variant	2305			Y12773	CCDS8515.1, CCDS8516.1, CCDS8517.1	12p13	2007-09-18			ENSG00000111206	ENSG00000111206		"""Forkhead boxes"""	3818	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 2"""	602341		FKHL16		9032290, 9441747	Standard	NM_202002		Approved	HFH-11, trident, HNF-3, INS-1, MPP2, MPHOSPH2, TGT3	uc001qlf.3	Q08050	OTTHUMG00000168118	ENST00000359843.3:c.1764C>G	12.37:g.2968332G>C			O43258|O43259|O43260|Q4ZGG7|Q9BRL2	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.L626	ENST00000359843.3	37	c.1878	CCDS8515.1	12																																																																																			FOXM1	-	NULL		0.612	FOXM1-002	KNOWN	basic|CCDS	protein_coding	FOXM1	HGNC	protein_coding	OTTHUMT00000398272.1	G	NM_021953		2968332	-1	no_errors	ENST00000342628	ensembl	human	known	70_37	silent	SNP	0.000	C
FREM3	166752	genome.wustl.edu	37	4	144616998	144616998	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr4:144616998C>T	ENST00000329798.5	-	1	4830	c.4831G>A	c.(4831-4833)Gac>Aac	p.D1611N		NM_001168235.1	NP_001161707.1	P0C091	FREM3_HUMAN	FRAS1 related extracellular matrix 3	1611					cell adhesion (GO:0007155)|cell communication (GO:0007154)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|prostate(1)	8						TCACTGCCGTCATGCTTGTAG	0.502																																																	0													203.0	166.0	177.0					4																	144616998		692	1591	2283	SO:0001583	missense	166752			BX091796	CCDS54808.1	4q31.21	2011-06-09			ENSG00000183090	ENSG00000183090			25172	protein-coding gene	gene with protein product		608946				15345741	Standard	NM_001168235		Approved		uc021xsj.1	P0C091	OTTHUMG00000161577	ENST00000329798.5:c.4831G>A	4.37:g.144616998C>T	ENSP00000332886:p.Asp1611Asn			Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.D1611N	ENST00000329798.5	37	c.4831	CCDS54808.1	4	.	.	.	.	.	.	.	.	.	.	C	7.589	0.670324	0.14776	.	.	ENSG00000183090	ENST00000329798	T	0.51325	0.71	4.03	1.37	0.22104	.	0.140304	0.44483	N	0.000445	T	0.62889	0.2465	M	0.88640	2.97	0.53005	D	0.999966	.	.	.	.	.	.	T	0.60826	-0.7186	8	0.46703	T	0.11	-2.6421	8.1199	0.30965	0.0:0.722:0.0:0.278	.	.	.	.	N	1611	ENSP00000332886:D1611N	ENSP00000332886:D1611N	D	-	1	0	FREM3	144836448	1.000000	0.71417	0.043000	0.18650	0.002000	0.02628	4.210000	0.58500	0.061000	0.16311	-0.251000	0.11542	GAC	FREM3	-	NULL		0.502	FREM3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	FREM3	HGNC	protein_coding	OTTHUMT00000365391.1	C	XM_094074		144616998	-1	no_errors	ENST00000329798	ensembl	human	putative	70_37	missense	SNP	0.992	T
FSCB	84075	genome.wustl.edu	37	14	44974138	44974138	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr14:44974138G>A	ENST00000340446.4	-	1	2344	c.2053C>T	c.(2053-2055)Cta>Tta	p.L685L	RP11-163M18.1_ENST00000557465.1_RNA|RP11-163M18.1_ENST00000555433.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	685						sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		TCAGCTGGTAGAGACTGAACT	0.587																																																	0													32.0	40.0	37.0					14																	44974138		2202	4300	6502	SO:0001819	synonymous_variant	84075			AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.2053C>T	14.37:g.44974138G>A			Q5H9U7|Q86YI2|Q9H0J3	Silent	SNP	NULL	p.L685	ENST00000340446.4	37	c.2053	CCDS9679.1	14																																																																																			FSCB	-	NULL		0.587	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCB	HGNC	protein_coding	OTTHUMT00000276788.1	G	NM_032135		44974138	-1	no_errors	ENST00000340446	ensembl	human	known	70_37	silent	SNP	0.000	A
GBP3	2635	genome.wustl.edu	37	1	89477668	89477668	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:89477668C>T	ENST00000370481.4	-	7	1131	c.911G>A	c.(910-912)aGa>aAa	p.R304K		NM_018284.2	NP_060754.2	Q8WXF7	ATLA1_HUMAN	guanylate binding protein 3	338	GB1/RHD3-type G.				axonogenesis (GO:0007409)|cell death (GO:0008219)|endoplasmic reticulum organization (GO:0007029)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi cis cisterna (GO:0000137)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(277;0.123)		all cancers(265;0.0103)|Epithelial(280;0.0293)		CAGATCCCCTCTGCTGATAGC	0.463																																																	0													66.0	46.0	53.0					1																	89477668		2190	3946	6136	SO:0001583	missense	2635			BC063819	CCDS717.2	1p22.2	2008-02-05			ENSG00000117226	ENSG00000117226			4184	protein-coding gene	gene with protein product		600413				7518790	Standard	NM_018284		Approved	FLJ10961	uc001dmt.3	Q9H0R5	OTTHUMG00000010616	ENST00000370481.4:c.911G>A	1.37:g.89477668C>T	ENSP00000359512:p.Arg304Lys		A6NND5|A8K2C0|G5E9T1|O95890|Q69YH7|Q96FK0	Missense_Mutation	SNP	pfam_Guanylate-bd_N,pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C	p.R304K	ENST00000370481.4	37	c.911	CCDS717.2	1	.	.	.	.	.	.	.	.	.	.	C	11.86	1.765288	0.31228	.	.	ENSG00000117226	ENST00000370482;ENST00000370481;ENST00000235878	T	0.51817	0.69	3.84	1.91	0.25777	Guanylate-binding protein, C-terminal (3);	0.141130	0.64402	D	0.000007	T	0.11537	0.0281	N	0.14661	0.345	0.19775	N	0.999956	B;B	0.14805	0.003;0.011	B;B	0.18263	0.006;0.021	T	0.22382	-1.0218	10	0.52906	T	0.07	.	6.7886	0.23687	0.0:0.715:0.1806:0.1044	.	170;304	F6X827;Q9H0R5	.;GBP3_HUMAN	K	272;304;304	ENSP00000359512:R304K	ENSP00000235878:R304K	R	-	2	0	GBP3	89250256	1.000000	0.71417	0.992000	0.48379	0.355000	0.29361	1.632000	0.37102	0.393000	0.25203	0.508000	0.49915	AGA	GBP3	-	pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C		0.463	GBP3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP3	HGNC	protein_coding	OTTHUMT00000313541.3	C	NM_018284		89477668	-1	no_errors	ENST00000370481	ensembl	human	known	70_37	missense	SNP	1.000	T
GGT1	2678	genome.wustl.edu	37	22	25023584	25023584	+	Silent	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr22:25023584C>G	ENST00000400382.1	+	12	1961	c.1206C>G	c.(1204-1206)ctC>ctG	p.L402L	GGT1_ENST00000400383.1_Silent_p.L402L|GGT1_ENST00000404920.1_Silent_p.L58L|GGT1_ENST00000404532.1_Silent_p.L58L|GGT1_ENST00000404223.1_Silent_p.L58L|GGT1_ENST00000466310.1_3'UTR|GGT1_ENST00000406383.2_Silent_p.L402L|GGT1_ENST00000248923.4_Silent_p.L402L|GGT1_ENST00000403838.1_Silent_p.L58L|GGT1_ENST00000400380.1_Silent_p.L402L|GGT1_ENST00000401885.1_Silent_p.L58L			P19440	GGT1_HUMAN	gamma-glutamyltransferase 1	402					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|cysteine biosynthetic process (GO:0019344)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione catabolic process (GO:0006751)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|regulation of immune system process (GO:0002682)|regulation of inflammatory response (GO:0050727)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|xenobiotic metabolic process (GO:0006805)|zymogen activation (GO:0031638)	anchored component of external side of plasma membrane (GO:0031362)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			breast(1)|endometrium(2)|kidney(14)|large_intestine(2)|lung(6)|pancreas(1)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	40					Glutathione(DB00143)	CCATCAACCTCTAGTAGGGGC	0.647																																																	0													3.0	3.0	3.0					22																	25023584		1793	3615	5408	SO:0001819	synonymous_variant	2678			M24903	CCDS42992.1	22q11.23	2008-08-15			ENSG00000100031	ENSG00000100031	2.3.2.2	"""CD molecules"", ""Gamma-glutamyltransferases"""	4250	protein-coding gene	gene with protein product		612346		GGT		8104871, 18357469	Standard	NM_001288833		Approved	D22S672, D22S732, CD224	uc003aan.1	P19440	OTTHUMG00000030859	ENST00000400382.1:c.1206C>G	22.37:g.25023584C>G			Q08247|Q14404|Q8TBS1|Q9UMK1	Silent	SNP	pfam_GGT_peptidase,prints_GGT_peptidase,tigrfam_GGT_peptidase	p.L402	ENST00000400382.1	37	c.1206	CCDS42992.1	22																																																																																			GGT1	-	pfam_GGT_peptidase,tigrfam_GGT_peptidase		0.647	GGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GGT1	HGNC	protein_coding	OTTHUMT00000250797.1	C	NM_013430		25023584	+1	no_errors	ENST00000248923	ensembl	human	known	70_37	silent	SNP	0.998	G
GLUD1	2746	genome.wustl.edu	37	10	88811555	88811555	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr10:88811555C>G	ENST00000277865.4	-	13	1726	c.1630G>C	c.(1630-1632)Gag>Cag	p.E544Q	GLUD1_ENST00000537649.1_Missense_Mutation_p.E377Q|GLUD1_ENST00000544149.1_Missense_Mutation_p.E411Q	NM_005271.3	NP_005262.1	P00367	DHE3_HUMAN	glutamate dehydrogenase 1	544					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamine metabolic process (GO:0006541)|positive regulation of insulin secretion (GO:0032024)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|tricarboxylic acid metabolic process (GO:0072350)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|identical protein binding (GO:0042802)|leucine binding (GO:0070728)|NAD+ binding (GO:0070403)			endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(11)|prostate(1)	22					Hexachlorophene(DB00756)	AAGACTTTCTCAATGGCATTA	0.428																																																	0													249.0	216.0	227.0					10																	88811555		2203	4300	6503	SO:0001583	missense	2746			M20867	CCDS7382.1	10q23.2	2010-03-17			ENSG00000148672	ENSG00000148672	1.4.1.3		4335	protein-coding gene	gene with protein product		138130		GLUD		2757358	Standard	NM_005271		Approved	GDH	uc001keh.3	P00367	OTTHUMG00000018666	ENST00000277865.4:c.1630G>C	10.37:g.88811555C>G	ENSP00000277865:p.Glu544Gln		B3KV55|B4DGN5|Q5TBU3	Missense_Mutation	SNP	pfam_Glu/Leu/Phe/Val_DH_C,pfam_Glu/Leu/Phe/Val_DH_dimer_dom,smart_Glu/Leu/Phe/Val_DH_C,prints_Glu/Leu/Phe/Val_DH	p.E544Q	ENST00000277865.4	37	c.1630	CCDS7382.1	10	.	.	.	.	.	.	.	.	.	.	C	17.60	3.428711	0.62844	.	.	ENSG00000148672	ENST00000277865;ENST00000394415;ENST00000537649;ENST00000535802;ENST00000513510;ENST00000544149	D;D;D	0.96745	-4.11;-4.11;-4.11	4.94	4.94	0.65067	Glutamate/phenylalanine/leucine/valine dehydrogenase, C-terminal (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.94673	0.8282	M	0.70842	2.15	0.80722	D	1	P;P	0.42010	0.601;0.768	B;B	0.33454	0.164;0.088	D	0.94499	0.7708	10	0.36615	T	0.2	.	18.5437	0.91039	0.0:1.0:0.0:0.0	.	411;544	B4DGN5;P00367	.;DHE3_HUMAN	Q	544;501;377;243;476;411	ENSP00000277865:E544Q;ENSP00000439291:E377Q;ENSP00000444732:E411Q	ENSP00000277865:E544Q	E	-	1	0	GLUD1	88801535	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	7.783000	0.85696	2.478000	0.83669	0.555000	0.69702	GAG	GLUD1	-	smart_Glu/Leu/Phe/Val_DH_C		0.428	GLUD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLUD1	HGNC	protein_coding	OTTHUMT00000049188.1	C	NM_005271		88811555	-1	no_errors	ENST00000277865	ensembl	human	known	70_37	missense	SNP	1.000	G
GNRH2	2797	genome.wustl.edu	37	20	3026354	3026354	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr20:3026354C>T	ENST00000245983.2	+	4	386	c.335C>T	c.(334-336)cCc>cTc	p.P112L	GNRH2_ENST00000380346.2_Missense_Mutation_p.P104L|GNRH2_ENST00000359987.1_Missense_Mutation_p.P104L|MRPS26_ENST00000380325.3_5'Flank|GNRH2_ENST00000380347.2_Missense_Mutation_p.P105L|GNRH2_ENST00000359100.2_Missense_Mutation_p.P105L	NM_001501.1	NP_001492.1	O43555	GON2_HUMAN	gonadotropin-releasing hormone 2	112					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			ovary(1)|upper_aerodigestive_tract(1)	2						GAGCCCCGCCCCGCCCCGCCA	0.632																																																	0													49.0	52.0	51.0					20																	3026354		2203	4299	6502	SO:0001583	missense	2797			AF036329	CCDS13040.1, CCDS13041.1, CCDS13042.1	20p13	2013-02-26			ENSG00000125787	ENSG00000125787		"""Endogenous ligands"""	4420	protein-coding gene	gene with protein product		602352				9419371, 12447356	Standard	NM_178331		Approved		uc002whr.1	O43555	OTTHUMG00000031723	ENST00000245983.2:c.335C>T	20.37:g.3026354C>T	ENSP00000245983:p.Pro112Leu		Q14C68|Q14C69|Q9BYN9|Q9BYP0	Missense_Mutation	SNP	pfam_GnRH	p.P112L	ENST00000245983.2	37	c.335	CCDS13040.1	20	.	.	.	.	.	.	.	.	.	.	C	16.61	3.170127	0.57584	.	.	ENSG00000125787	ENST00000245983;ENST00000359100;ENST00000359987;ENST00000380347;ENST00000380346	T;T;T;T;T	0.55052	0.56;0.55;0.54;0.55;0.54	3.76	-3.64	0.04515	.	.	.	.	.	T	0.30166	0.0756	L	0.27053	0.805	0.09310	N	1	B;B;B	0.27732	0.006;0.187;0.187	B;B;B	0.21546	0.003;0.035;0.035	T	0.27123	-1.0083	9	0.87932	D	0	.	1.5529	0.02578	0.2187:0.3893:0.2432:0.1488	.	112;104;105	O43555;O43555-2;O43555-3	GON2_HUMAN;.;.	L	112;105;104;105;104	ENSP00000245983:P112L;ENSP00000352003:P105L;ENSP00000353077:P104L;ENSP00000369705:P105L;ENSP00000369704:P104L	ENSP00000245983:P112L	P	+	2	0	GNRH2	2974354	0.010000	0.17322	0.000000	0.03702	0.001000	0.01503	0.983000	0.29552	-0.344000	0.08338	-0.335000	0.08231	CCC	GNRH2	-	NULL		0.632	GNRH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GNRH2	HGNC	protein_coding	OTTHUMT00000077694.2	C	NM_001501		3026354	+1	no_errors	ENST00000245983	ensembl	human	known	70_37	missense	SNP	0.000	T
GOLGA2P5	55592	genome.wustl.edu	37	12	100550804	100550804	+	RNA	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr12:100550804G>C	ENST00000397112.4	-	0	2017				RN7SL176P_ENST00000580352.1_RNA|AC010203.1_ENST00000408843.1_RNA	NR_036632.1		Q9HBQ8	GGA2B_HUMAN								Golgi apparatus (GO:0005794)				large_intestine(1)|lung(3)	4						TGTTGCAGTCGTCCACAAGCC	0.647																																																	0													48.0	51.0	50.0					12																	100550804		2203	4300	6503			55592																															12.37:g.100550804G>C			Q9NSV2	RNA	SNP	-	NULL	ENST00000397112.4	37	NULL		12																																																																																			GOLGA2B	-	-		0.647	GOLGA2B-004	KNOWN	basic	processed_transcript	GOLGA2P5	Clone_based_vega_gene	pseudogene	OTTHUMT00000396439.2	G			100550804	-1	no_errors	ENST00000397112	ensembl	human	known	70_37	rna	SNP	0.000	C
GOLGA4	2803	genome.wustl.edu	37	3	37360673	37360673	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr3:37360673G>A	ENST00000361924.2	+	12	1907	c.1533G>A	c.(1531-1533)atG>atA	p.M511I	GOLGA4_ENST00000435830.2_3'UTR|GOLGA4_ENST00000356847.4_Missense_Mutation_p.M533I|GOLGA4_ENST00000444882.1_Intron	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	511	Glu-rich.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						AGGAACAAATGAAAGTAGCTC	0.398																																																	0													82.0	88.0	86.0					3																	37360673		2203	4300	6503	SO:0001583	missense	2803			U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.1533G>A	3.37:g.37360673G>A	ENSP00000354486:p.Met511Ile		F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Missense_Mutation	SNP	pfam_GRIP,superfamily_GRIP,superfamily_tRNA-bd_arm,superfamily_t-SNARE,superfamily_Prefoldin,smart_GRIP,pfscan_GRIP	p.M511I	ENST00000361924.2	37	c.1533	CCDS2666.1	3	.	.	.	.	.	.	.	.	.	.	G	17.89	3.498789	0.64298	.	.	ENSG00000144674	ENST00000361924;ENST00000356847;ENST00000437131	T;T;T	0.25085	1.83;1.82;1.85	6.02	5.15	0.70609	.	0.159857	0.29853	N	0.011021	T	0.30510	0.0767	L	0.59436	1.845	0.43355	D	0.995423	P;P;P	0.46512	0.794;0.794;0.879	B;B;B	0.43052	0.406;0.406;0.253	T	0.04165	-1.0972	10	0.34782	T	0.22	.	15.465	0.75394	0.0663:0.0:0.9337:0.0	.	511;533;511	Q13439-4;F8W8Q7;Q13439	.;.;GOGA4_HUMAN	I	511;533;382	ENSP00000354486:M511I;ENSP00000349305:M533I;ENSP00000405842:M382I	ENSP00000349305:M533I	M	+	3	0	GOLGA4	37335677	1.000000	0.71417	0.994000	0.49952	0.840000	0.47671	3.417000	0.52714	1.563000	0.49615	-0.150000	0.13652	ATG	GOLGA4	-	NULL		0.398	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGA4	HGNC	protein_coding	OTTHUMT00000253339.2	G	NM_002078		37360673	+1	no_errors	ENST00000361924	ensembl	human	known	70_37	missense	SNP	1.000	A
GOLGA6L10	647042	genome.wustl.edu	37	15	82637166	82637167	+	Frame_Shift_Ins	INS	-	-	CCCTCTCC			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr15:82637166_82637167insCCCTCTCC	ENST00000439287.4	-	6	1018_1019	c.919_920insGGAGAGGG	c.(919-921)gagfs	p.E307fs		NM_001164465.1	NP_001157937.1	A6NI86	GG6LA_HUMAN	golgin A6 family-like 10	307										endometrium(1)|kidney(4)	5						CAGCAGCCTCTCCCTCTCCAGC	0.634																																																	0																																										SO:0001589	frameshift_variant	647042				CCDS45325.1	15q25.2	2014-08-13	2010-02-12		ENSG00000278662				37228	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 10"", ""golgin A6 family-like 18"""	GOLGA6L18			Standard	XM_006720643		Approved		uc021ssn.1	A6NI86	OTTHUMG00000172580	ENST00000439287.4:c.912_919dupGGAGAGGG	15.37:g.82637167_82637174dupCCCTCTCC	ENSP00000388606:p.Glu307fs			Frame_Shift_Ins	INS	NULL	p.E307fs	ENST00000439287.4	37	c.920_919	CCDS45325.1	15																																																																																			GOLGA6L10	-	NULL		0.634	GOLGA6L10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA6L10	HGNC	protein_coding	OTTHUMT00000419403.2	-	NM_001164465		82637167	-1	no_errors	ENST00000439287	ensembl	human	known	70_37	frame_shift_ins	INS	0.989:0.976	CCCTCTCC
GPR45	11250	genome.wustl.edu	37	2	105859310	105859310	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:105859310G>A	ENST00000258456.1	+	1	1111	c.995G>A	c.(994-996)cGc>cAc	p.R332H		NM_007227.3	NP_009158.3	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	332						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R332H(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	28						AAAAAATTCCGCGAGGCCTGC	0.557																																																	1	Substitution - Missense(1)	stomach(1)											82.0	87.0	85.0					2																	105859310		2203	4300	6503	SO:0001583	missense	11250			AF118266	CCDS2066.1	2q11.1-q12	2012-08-21			ENSG00000135973	ENSG00000135973		"""GPCR / Class A : Orphans"""	4503	protein-coding gene	gene with protein product		604838				10036181	Standard	NM_007227		Approved	PSP24, PSP24A	uc002tco.1	Q9Y5Y3	OTTHUMG00000130805	ENST00000258456.1:c.995G>A	2.37:g.105859310G>A	ENSP00000258456:p.Arg332His		Q6NWS4|Q6NXU6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.R332H	ENST00000258456.1	37	c.995	CCDS2066.1	2	.	.	.	.	.	.	.	.	.	.	G	16.05	3.012829	0.54468	.	.	ENSG00000135973	ENST00000258456	T	0.58358	0.34	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.48059	0.1479	L	0.28115	0.83	0.54753	D	0.999987	P	0.51240	0.943	P	0.47786	0.557	T	0.40924	-0.9537	10	0.33940	T	0.23	-27.9142	17.2936	0.87163	0.0:0.0:1.0:0.0	.	332	Q9Y5Y3	GPR45_HUMAN	H	332	ENSP00000258456:R332H	ENSP00000258456:R332H	R	+	2	0	GPR45	105225742	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.545000	0.73883	2.696000	0.92011	0.456000	0.33151	CGC	GPR45	-	pfam_7TM_GPCR_olfarory/Srsx,prints_GPCR_Rhodpsn		0.557	GPR45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR45	HGNC	protein_coding	OTTHUMT00000253348.1	G	NM_007227		105859310	+1	no_errors	ENST00000258456	ensembl	human	known	70_37	missense	SNP	1.000	A
GPR98	84059	genome.wustl.edu	37	5	90106730	90106730	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr5:90106730G>A	ENST00000405460.2	+	74	15749	c.15653G>A	c.(15652-15654)gGa>gAa	p.G5218E	GPR98_ENST00000425867.2_Missense_Mutation_p.G879E	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	5218					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TCCATTCATGGAACATTCAGC	0.458																																																	0													88.0	83.0	85.0					5																	90106730		1922	4148	6070	SO:0001583	missense	84059			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.15653G>A	5.37:g.90106730G>A	ENSP00000384582:p.Gly5218Glu		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.G5218E	ENST00000405460.2	37	c.15653	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	G	15.30	2.791991	0.50102	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.33654	1.4;1.4	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.57888	0.2084	L	0.56769	1.78	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.54886	-0.8226	9	.	.	.	.	18.8078	0.92045	0.0:0.0:1.0:0.0	.	879;5218;879	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	E	5218;5218;879	ENSP00000384582:G5218E;ENSP00000392618:G879E	.	G	+	2	0	GPR98	90142486	1.000000	0.71417	0.162000	0.22713	0.108000	0.19459	7.413000	0.80104	2.524000	0.85096	0.563000	0.77884	GGA	GPR98	-	NULL		0.458	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2	G	NM_032119		90106730	+1	no_errors	ENST00000405460	ensembl	human	known	70_37	missense	SNP	0.994	A
GRIK5	2901	genome.wustl.edu	37	19	42558573	42558573	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:42558573G>A	ENST00000262895.3	-	8	954	c.955C>T	c.(955-957)Cga>Tga	p.R319*	GRIK5_ENST00000301218.4_Nonsense_Mutation_p.R319*|GRIK5_ENST00000593562.1_Nonsense_Mutation_p.R319*	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5	319					cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				TTCAGCTCTCGGACAGCGCTC	0.632																																																	0													73.0	57.0	62.0					19																	42558573		2203	4300	6503	SO:0001587	stop_gained	2901				CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.955C>T	19.37:g.42558573G>A	ENSP00000262895:p.Arg319*		Q8WWG8	Nonsense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.R319*	ENST00000262895.3	37	c.955	CCDS12595.1	19	.	.	.	.	.	.	.	.	.	.	G	36	5.841662	0.97016	.	.	ENSG00000105737	ENST00000262895;ENST00000301218	.	.	.	5.14	2.7	0.31948	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	.	13.5495	0.61723	0.0:0.0:0.6708:0.3292	.	.	.	.	X	319	.	ENSP00000262895:R319X	R	-	1	2	GRIK5	47250413	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	2.742000	0.47434	1.273000	0.44346	-0.293000	0.09583	CGA	GRIK5	-	pfam_ANF_lig-bd_rcpt		0.632	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK5	HGNC	protein_coding	OTTHUMT00000463453.1	G			42558573	-1	no_errors	ENST00000301218	ensembl	human	known	70_37	nonsense	SNP	0.998	A
GRIN2D	2906	genome.wustl.edu	37	19	48908030	48908030	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:48908030G>A	ENST00000263269.3	+	3	593	c.505G>A	c.(505-507)Gag>Aag	p.E169K		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	169					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CTCTTCCACCGAGCAACAGCT	0.602																																																	0													122.0	117.0	119.0					19																	48908030		2203	4300	6503	SO:0001583	missense	2906			U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.505G>A	19.37:g.48908030G>A	ENSP00000263269:p.Glu169Lys			Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.E169K	ENST00000263269.3	37	c.505	CCDS12719.1	19	.	.	.	.	.	.	.	.	.	.	G	17.46	3.394275	0.62066	.	.	ENSG00000105464	ENST00000263269	D	0.92545	-3.06	5.03	5.03	0.67393	Extracellular ligand-binding receptor (1);	0.127607	0.50627	D	0.000117	D	0.86715	0.5999	L	0.42744	1.35	0.49483	D	0.999793	P	0.42010	0.768	B	0.34652	0.187	D	0.86558	0.1839	10	0.42905	T	0.14	.	11.841	0.52355	0.0857:0.0:0.9143:0.0	.	169	O15399	NMDE4_HUMAN	K	169	ENSP00000263269:E169K	ENSP00000263269:E169K	E	+	1	0	GRIN2D	53599842	1.000000	0.71417	0.956000	0.39512	0.990000	0.78478	6.652000	0.74377	2.522000	0.85027	0.650000	0.86243	GAG	GRIN2D	-	pfam_ANF_lig-bd_rcpt		0.602	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2D	HGNC	protein_coding	OTTHUMT00000466121.1	G			48908030	+1	no_errors	ENST00000263269	ensembl	human	known	70_37	missense	SNP	0.993	A
HARBI1	283254	genome.wustl.edu	37	11	46637297	46637297	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr11:46637297G>C	ENST00000326737.3	-	2	738	c.491C>G	c.(490-492)tCc>tGc	p.S164C	ATG13_ENST00000359513.4_5'Flank|ATG13_ENST00000524625.1_5'Flank|ATG13_ENST00000434074.1_5'Flank|ATG13_ENST00000528494.1_5'Flank|ATG13_ENST00000312040.4_5'Flank|ATG13_ENST00000451945.1_5'Flank|ATG13_ENST00000529655.1_5'Flank|ATG13_ENST00000530500.1_5'Flank|ATG13_ENST00000526508.1_5'Flank	NM_173811.3	NP_776172.1	Q96MB7	HARB1_HUMAN	harbinger transposase derived 1	164						centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nuclease activity (GO:0004518)			large_intestine(1)|prostate(1)|upper_aerodigestive_tract(1)	3						GTTCACATAGGAGAGGTCTTC	0.517																																																	0													193.0	197.0	195.0					11																	46637297		2201	4299	6500	SO:0001583	missense	283254			AK057237	CCDS7920.1	11p11.2	2008-07-10	2008-07-01	2008-07-01	ENSG00000180423	ENSG00000180423			26522	protein-coding gene	gene with protein product		615086	"""chromosome 11 open reading frame 77"""	C11orf77		15169610, 18339812	Standard	NM_173811		Approved	FLJ32675	uc001ncy.3	Q96MB7	OTTHUMG00000166537	ENST00000326737.3:c.491C>G	11.37:g.46637297G>C	ENSP00000317743:p.Ser164Cys		D3DQP9	Missense_Mutation	SNP	pfam_Harbinger_derived_prot_plant	p.S164C	ENST00000326737.3	37	c.491	CCDS7920.1	11	.	.	.	.	.	.	.	.	.	.	G	23.9	4.472278	0.84533	.	.	ENSG00000180423	ENST00000326737	.	.	.	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.75391	0.3843	L	0.53249	1.67	0.80722	D	1	D	0.61697	0.99	D	0.67231	0.95	T	0.75340	-0.3352	9	0.48119	T	0.1	-13.5457	18.8631	0.92281	0.0:0.0:1.0:0.0	.	164	Q96MB7	HARB1_HUMAN	C	164	.	ENSP00000317743:S164C	S	-	2	0	HARBI1	46593873	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.170000	0.71920	2.462000	0.83206	0.655000	0.94253	TCC	HARBI1	-	pfam_Harbinger_derived_prot_plant		0.517	HARBI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HARBI1	HGNC	protein_coding	OTTHUMT00000390291.1	G	NM_173811		46637297	-1	no_errors	ENST00000326737	ensembl	human	known	70_37	missense	SNP	1.000	C
MROH7	374977	genome.wustl.edu	37	1	55145575	55145575	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:55145575C>T	ENST00000421030.2	+	13	2523	c.2238C>T	c.(2236-2238)atC>atT	p.I746I	MROH7_ENST00000545244.1_Silent_p.I314I|MROH7_ENST00000454855.2_Silent_p.I264I|MROH7_ENST00000339553.5_Silent_p.I746I|MROH7-TTC4_ENST00000414150.2_Silent_p.I746I|MROH7_ENST00000395690.2_Silent_p.I746I|MROH7_ENST00000409996.1_Silent_p.I314I	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	746						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											TCCCAGAAATCATGCAAGGCA	0.657																																																	0													83.0	92.0	89.0					1																	55145575		1997	4166	6163	SO:0001819	synonymous_variant	374977			AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.2238C>T	1.37:g.55145575C>T			A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Silent	SNP	superfamily_ARM-type_fold	p.I746	ENST00000421030.2	37	c.2238	CCDS41342.2	1																																																																																			HEATR8	-	superfamily_ARM-type_fold		0.657	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR8	HGNC	protein_coding	OTTHUMT00000346978.1	C	NM_198547		55145575	+1	no_errors	ENST00000421030	ensembl	human	known	70_37	silent	SNP	1.000	T
HECA	51696	genome.wustl.edu	37	6	139487903	139487903	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr6:139487903G>C	ENST00000367658.2	+	2	1039	c.754G>C	c.(754-756)Gag>Cag	p.E252Q	RP1-225E12.2_ENST00000588638.1_RNA|RP1-225E12.2_ENST00000588529.1_RNA|RP1-225E12.3_ENST00000585874.1_RNA|RP1-225E12.2_ENST00000586266.1_RNA|RP1-225E12.2_ENST00000415194.2_RNA|RP1-225E12.2_ENST00000590679.1_RNA|RP1-225E12.2_ENST00000586229.1_RNA|RP1-225E12.2_ENST00000589192.1_RNA|RP1-225E12.2_ENST00000587577.1_RNA|RP1-225E12.2_ENST00000591102.1_RNA	NM_016217.2	NP_057301.1	Q9UBI9	HDC_HUMAN	headcase homolog (Drosophila)	252					respiratory tube development (GO:0030323)	membrane (GO:0016020)				endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)	15				GBM - Glioblastoma multiforme(68;0.000252)|OV - Ovarian serous cystadenocarcinoma(155;0.000387)		GAACTCCCAGGAGAAGGCAGT	0.672																																																	0													15.0	18.0	17.0					6																	139487903		2199	4300	6499	SO:0001583	missense	51696			AB033492	CCDS5194.1	6q23-q24	2010-11-25			ENSG00000112406	ENSG00000112406			21041	protein-coding gene	gene with protein product		607977				11696983, 19643820	Standard	NM_016217		Approved	HDCL, hHDC, HDC, dJ225E12.1	uc003qin.3	Q9UBI9	OTTHUMG00000015686	ENST00000367658.2:c.754G>C	6.37:g.139487903G>C	ENSP00000356630:p.Glu252Gln			Missense_Mutation	SNP	superfamily_Glycoside_hydrolase_SF	p.E252Q	ENST00000367658.2	37	c.754	CCDS5194.1	6	.	.	.	.	.	.	.	.	.	.	G	22.7	4.325641	0.81580	.	.	ENSG00000112406	ENST00000367658	.	.	.	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.58708	0.2141	L	0.27053	0.805	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.58803	-0.7572	9	0.41790	T	0.15	.	18.7842	0.91947	0.0:0.0:1.0:0.0	.	252	Q9UBI9	HDC_HUMAN	Q	252	.	ENSP00000356630:E252Q	E	+	1	0	HECA	139529596	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	9.128000	0.94424	2.676000	0.91093	0.655000	0.94253	GAG	HECA	-	NULL		0.672	HECA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECA	HGNC	protein_coding	OTTHUMT00000042456.1	G	NM_016217		139487903	+1	no_errors	ENST00000367658	ensembl	human	known	70_37	missense	SNP	1.000	C
HECTD4	283450	genome.wustl.edu	37	12	112681469	112681469	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr12:112681469C>T	ENST00000430131.2	-	30	4625	c.3480G>A	c.(3478-3480)ctG>ctA	p.L1160L	HECTD4_ENST00000550722.1_Silent_p.L1436L|HECTD4_ENST00000377560.5_Silent_p.L1410L			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	1160					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										GCTGCCCTAGCAGGACACTGT	0.582																																																	0													73.0	78.0	76.0					12																	112681469		2195	4291	6486	SO:0001819	synonymous_variant	283450			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.3480G>A	12.37:g.112681469C>T			L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Silent	SNP	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl_sf,smart_HECT,pfscan_HECT	p.L1410	ENST00000430131.2	37	c.4230		12																																																																																			HECTD4	-	NULL		0.582	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		C	NM_173813		112681469	-1	no_errors	ENST00000377560	ensembl	human	known	70_37	silent	SNP	1.000	T
HECTD4	283450	genome.wustl.edu	37	12	112686184	112686184	+	Silent	SNP	T	T	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr12:112686184T>C	ENST00000430131.2	-	25	3962	c.2817A>G	c.(2815-2817)ttA>ttG	p.L939L	HECTD4_ENST00000550722.1_Silent_p.L1215L|HECTD4_ENST00000377560.5_Silent_p.L1189L			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	939					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										TTTTACATAATAAATCATATT	0.348																																																	0													59.0	57.0	57.0					12																	112686184		1829	4086	5915	SO:0001819	synonymous_variant	283450			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.2817A>G	12.37:g.112686184T>C			L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Silent	SNP	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl_sf,smart_HECT,pfscan_HECT	p.L1189	ENST00000430131.2	37	c.3567		12																																																																																			HECTD4	-	NULL		0.348	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		T	NM_173813		112686184	-1	no_errors	ENST00000377560	ensembl	human	known	70_37	silent	SNP	0.836	C
HEPH	9843	genome.wustl.edu	37	X	65486316	65486316	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chrX:65486316G>A	ENST00000343002.2	+	20	3943	c.3279G>A	c.(3277-3279)gtG>gtA	p.V1093V	HEPH_ENST00000374727.3_Silent_p.V1096V|HEPH_ENST00000419594.1_Silent_p.V904V|HEPH_ENST00000441993.2_Silent_p.V1095V|HEPH_ENST00000336279.5_Silent_p.V826V|HEPH_ENST00000519389.1_Silent_p.V1147V			Q9BQS7	HEPH_HUMAN	hephaestin	1093					cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)	p.V1093V(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						AAGGCAATGTGAAGATGCTGG	0.463																																																	1	Substitution - coding silent(1)	urinary_tract(1)											237.0	165.0	189.0					X																	65486316		2203	4300	6503	SO:0001819	synonymous_variant	9843			AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.3279G>A	X.37:g.65486316G>A			B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Silent	SNP	pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Cupredoxin	p.V1147	ENST00000343002.2	37	c.3441		X																																																																																			HEPH	-	NULL		0.463	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	HEPH	HGNC	protein_coding	OTTHUMT00000056995.1	G	NM_138737		65486316	+1	no_errors	ENST00000519389	ensembl	human	known	70_37	silent	SNP	0.107	A
HERC2P9	440248	genome.wustl.edu	37	15	28882584	28882584	+	IGR	SNP	C	C	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr15:28882584C>A								GOLGA8G (104441 upstream) : HERC2P9 (17003 downstream)																							TTTGCAGACTCATCAAGAACA	0.378																																																	0																																										SO:0001628	intergenic_variant	440248																															15.37:g.28882584C>A				RNA	SNP	-	NULL		37	NULL		15																																																																																			HERC2P9	-	-	0	0.378					HERC2P9	HGNC			C			28882584	+1	no_errors	ENST00000529353	ensembl	human	known	70_37	rna	SNP	1.000	A
HES1	3280	genome.wustl.edu	37	3	193855740	193855740	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr3:193855740C>T	ENST00000232424.3	+	4	797	c.561C>T	c.(559-561)ctC>ctT	p.L187L		NM_005524.3	NP_005515.1	P30042	ES1_HUMAN	hes family bHLH transcription factor 1	0						mitochondrion (GO:0005739)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	6	all_cancers(143;7.3e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;3.65e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.48e-05)		CGCCGCCACTCGTGCCCATcc	0.801																																																	0													2.0	3.0	3.0					3																	193855740		1266	2855	4121	SO:0001819	synonymous_variant	3280			L19314	CCDS3305.1	3q28-q29	2013-10-17	2013-10-17	2003-01-10	ENSG00000114315	ENSG00000114315		"""Basic helix-loop-helix proteins"""	5192	protein-coding gene	gene with protein product		139605	"""hairy homolog (Drosophila)"", ""hairy and enhancer of split 1, (Drosophila)"""	HRY		8020957	Standard	NM_005524		Approved	FLJ20408, HES-1, Hes1, bHLHb39	uc003ftq.2	Q14469	OTTHUMG00000155984	ENST00000232424.3:c.561C>T	3.37:g.193855740C>T			A6NFJ6|A6NJY7|O00650|O00660|O15011|O15012|P55346|P78474|Q92505|Q92507	Silent	SNP	pfam_Orange,pfam_HLH_dom,superfamily_HLH_dom,smart_HLH_dom,smart_Orange_subgr,pfscan_Orange,pfscan_HLH_dom	p.L187	ENST00000232424.3	37	c.561	CCDS3305.1	3																																																																																			HES1	-	NULL		0.801	HES1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HES1	HGNC	protein_coding	OTTHUMT00000342632.1	C			193855740	+1	no_errors	ENST00000232424	ensembl	human	known	70_37	silent	SNP	0.966	T
HIST1H4I	8294	genome.wustl.edu	37	6	27107193	27107193	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr6:27107193C>T	ENST00000354348.2	+	1	118	c.106C>T	c.(106-108)Cgg>Tgg	p.R36W	HIST1H2BK_ENST00000396891.4_Intron	NM_003495.2	NP_003486.1	P62805	H4_HUMAN	histone cluster 1, H4i	36					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			lung(1)	1						GCCAGCCATTCGGCGCCTTGC	0.632			T	BCL6	NHL																																			Dom	yes		6	6p21.3	8294	"""histone 1, H4i (H4FM)"""		L	0													51.0	53.0	52.0					6																	27107193		2203	4300	6503	SO:0001583	missense	8294			AB000905	CCDS4620.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198339	ENSG00000276180		"""Histones / Replication-dependent"""	4793	protein-coding gene	gene with protein product		602833	"""H4 histone family, member M"", ""histone 1, H4i"""	H4FM		8988030, 9439656, 12408966	Standard	NM_003495		Approved	H4/m	uc003niy.1	P62805	OTTHUMG00000014471	ENST00000354348.2:c.106C>T	6.37:g.27107193C>T	ENSP00000346316:p.Arg36Trp		A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	p.R36W	ENST00000354348.2	37	c.106	CCDS4620.1	6	.	.	.	.	.	.	.	.	.	.	.	15.28	2.785860	0.49997	.	.	ENSG00000198339	ENST00000354348	T	0.69561	-0.41	3.95	2.04	0.26737	.	0.000000	0.40818	U	0.001009	D	0.82309	0.5009	H	0.97758	4.07	0.48341	D	0.999631	.	.	.	.	.	.	D	0.85396	0.1128	8	0.87932	D	0	.	10.6547	0.45667	0.3463:0.6537:0.0:0.0	.	.	.	.	W	36	ENSP00000346316:R36W	ENSP00000346316:R36W	R	+	1	2	HIST1H4I	27215172	1.000000	0.71417	0.693000	0.30195	0.059000	0.15707	4.271000	0.58902	0.364000	0.24374	-0.182000	0.12963	CGG	HIST1H4I	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4		0.632	HIST1H4I-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4I	HGNC	protein_coding	OTTHUMT00000040139.1	C	NM_003495		27107193	+1	no_errors	ENST00000354348	ensembl	human	known	70_37	missense	SNP	1.000	T
HIVEP2	3097	genome.wustl.edu	37	6	143091947	143091947	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr6:143091947G>C	ENST00000367604.1	-	4	4568	c.3929C>G	c.(3928-3930)tCt>tGt	p.S1310C	HIVEP2_ENST00000012134.2_Missense_Mutation_p.S1310C|HIVEP2_ENST00000367603.2_Missense_Mutation_p.S1310C			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1310					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		AACCTGCTCAGAGGGCGTTTC	0.507																																					Esophageal Squamous(107;843 1510 13293 16805 42198)												0													140.0	140.0	140.0					6																	143091947		1915	4126	6041	SO:0001583	missense	3097			M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.3929C>G	6.37:g.143091947G>C	ENSP00000356576:p.Ser1310Cys		Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S1310C	ENST00000367604.1	37	c.3929	CCDS43510.1	6	.	.	.	.	.	.	.	.	.	.	G	12.56	1.974334	0.34848	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.02837	4.14;4.14;4.14	5.97	5.97	0.96955	.	0.449425	0.27730	N	0.018084	T	0.02418	0.0074	L	0.55481	1.735	0.29630	N	0.845554	P	0.50710	0.938	B	0.40101	0.319	T	0.41342	-0.9514	10	0.45353	T	0.12	-14.3537	20.428	0.99075	0.0:0.0:1.0:0.0	.	1310	P31629	ZEP2_HUMAN	C	1310	ENSP00000356576:S1310C;ENSP00000356575:S1310C;ENSP00000012134:S1310C	ENSP00000012134:S1310C	S	-	2	0	HIVEP2	143133640	0.998000	0.40836	0.791000	0.31998	0.582000	0.36321	2.899000	0.48679	2.837000	0.97791	0.655000	0.94253	TCT	HIVEP2	-	NULL		0.507	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP2	HGNC	protein_coding	OTTHUMT00000042495.1	G			143091947	-1	no_errors	ENST00000012134	ensembl	human	known	70_37	missense	SNP	0.872	C
HRC	3270	genome.wustl.edu	37	19	49656988	49656988	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:49656988C>G	ENST00000252825.4	-	1	1693	c.1507G>C	c.(1507-1509)Gag>Cag	p.E503Q	HRC_ENST00000595625.1_Missense_Mutation_p.E503Q	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	503					cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		TCTCCCTGCTCTGAACTTTCA	0.542																																					Melanoma(37;75 1097 24567 25669 30645)												0													116.0	98.0	104.0					19																	49656988		2203	4300	6503	SO:0001583	missense	3270				CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.1507G>C	19.37:g.49656988C>G	ENSP00000252825:p.Glu503Gln		Q504Y6	Missense_Mutation	SNP	pfam_Hist_rich_Ca-bd	p.E503Q	ENST00000252825.4	37	c.1507	CCDS12759.1	19	.	.	.	.	.	.	.	.	.	.	C	5.291	0.239095	0.10023	.	.	ENSG00000130528	ENST00000252825;ENST00000391863	T	0.59083	0.29	2.63	0.148	0.14843	.	.	.	.	.	T	0.61350	0.2340	L	0.42245	1.32	0.09310	N	1	D	0.63880	0.993	D	0.72982	0.979	T	0.48399	-0.9039	9	0.49607	T	0.09	-5.9179	3.8872	0.09103	0.0:0.5976:0.2497:0.1527	.	503	P23327	SRCH_HUMAN	Q	503;202	ENSP00000252825:E503Q	ENSP00000252825:E503Q	E	-	1	0	HRC	54348800	0.000000	0.05858	0.007000	0.13788	0.046000	0.14306	-0.342000	0.07801	0.129000	0.18514	0.462000	0.41574	GAG	HRC	-	NULL		0.542	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRC	HGNC	protein_coding	OTTHUMT00000465649.1	C	NM_002152		49656988	-1	no_errors	ENST00000252825	ensembl	human	known	70_37	missense	SNP	0.125	G
HRC	3270	genome.wustl.edu	37	19	49657295	49657295	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:49657295C>G	ENST00000252825.4	-	1	1386	c.1200G>C	c.(1198-1200)aaG>aaC	p.K400N	HRC_ENST00000595625.1_Missense_Mutation_p.K400N	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	400					cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		CTTCATCACTCTTGTGGCCTC	0.517																																					Melanoma(37;75 1097 24567 25669 30645)												0													118.0	110.0	113.0					19																	49657295		2203	4300	6503	SO:0001583	missense	3270				CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.1200G>C	19.37:g.49657295C>G	ENSP00000252825:p.Lys400Asn		Q504Y6	Missense_Mutation	SNP	pfam_Hist_rich_Ca-bd	p.K400N	ENST00000252825.4	37	c.1200	CCDS12759.1	19	.	.	.	.	.	.	.	.	.	.	C	7.117	0.577121	0.13686	.	.	ENSG00000130528	ENST00000252825;ENST00000391863;ENST00000434964	T	0.32515	1.45	3.18	2.07	0.26955	.	.	.	.	.	T	0.21801	0.0525	N	0.19112	0.55	0.09310	N	1	P	0.47409	0.895	P	0.47044	0.535	T	0.10245	-1.0638	9	0.20519	T	0.43	-7.4699	7.3737	0.26817	0.2747:0.7253:0.0:0.0	.	400	P23327	SRCH_HUMAN	N	400;99;370	ENSP00000252825:K400N	ENSP00000252825:K400N	K	-	3	2	HRC	54349107	0.004000	0.15560	0.013000	0.15412	0.197000	0.23852	1.159000	0.31749	0.392000	0.25172	0.462000	0.41574	AAG	HRC	-	NULL		0.517	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRC	HGNC	protein_coding	OTTHUMT00000465649.1	C	NM_002152		49657295	-1	no_errors	ENST00000252825	ensembl	human	known	70_37	missense	SNP	0.051	G
HTR4	3360	genome.wustl.edu	37	5	147845452	147845452	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr5:147845452G>A	ENST00000314512.6	-	7	1276	c.1113C>T	c.(1111-1113)ttC>ttT	p.F371F	HTR4_ENST00000521735.1_Silent_p.F371F|HTR4_ENST00000354217.2_Intron|HTR4_ENST00000521530.1_Intron	NM_199453.3	NP_955525.1	Q13639	5HT4R_HUMAN	5-hydroxytryptamine (serotonin) receptor 4, G protein-coupled	0					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|regulation of appetite (GO:0032098)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Cinitapride(DB08810)|Cisapride(DB00604)|Ergoloid mesylate(DB01049)|Metoclopramide(DB01233)|Ondansetron(DB00904)	GTCTATTGCAGAAGAGCAGGA	0.438																																					GBM(120;370 1604 14007 17804 41573)												0													148.0	159.0	155.0					5																	147845452		2203	4300	6503	SO:0001819	synonymous_variant	3360			Y08756	CCDS4291.1, CCDS34270.1, CCDS34271.1, CCDS34272.1, CCDS34273.1, CCDS34273.2, CCDS75353.1	5q31-q33	2012-08-08	2012-02-03		ENSG00000164270	ENSG00000164270		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5299	protein-coding gene	gene with protein product		602164	"""5-hydroxytryptamine (serotonin) receptor 4"""			9371406, 9276448	Standard	NM_199453		Approved	5-HT4	uc021yfj.1	Q13639	OTTHUMG00000129931	ENST00000314512.6:c.1113C>T	5.37:g.147845452G>A			C4WYH4|Q546Q1|Q684M0|Q712M9|Q96KH9|Q96KI0|Q9H199|Q9NY73|Q9UBM6|Q9UBT4|Q9UE22|Q9UE23|Q9UQR6	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_5HT4_rcpt,prints_GPCR_Rhodpsn	p.F371	ENST00000314512.6	37	c.1113	CCDS34271.1	5																																																																																			HTR4	-	NULL		0.438	HTR4-201	KNOWN	basic|CCDS	protein_coding	HTR4	HGNC	protein_coding	OTTHUMT00000374235.1	G	NM_000870		147845452	-1	no_errors	ENST00000314512	ensembl	human	known	70_37	silent	SNP	1.000	A
HUWE1	10075	genome.wustl.edu	37	X	53579732	53579732	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chrX:53579732C>T	ENST00000342160.3	-	61	9074	c.8617G>A	c.(8617-8619)Gac>Aac	p.D2873N	HUWE1_ENST00000262854.6_Missense_Mutation_p.D2873N			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2873					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						GCTGAAGTGTCACCCACAGCC	0.587																																																	0													47.0	42.0	44.0					X																	53579732		2203	4300	6503	SO:0001583	missense	10075			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.8617G>A	X.37:g.53579732C>T	ENSP00000340648:p.Asp2873Asn		O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/transl_elong_EF1B_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.D2873N	ENST00000342160.3	37	c.8617	CCDS35301.1	X	.	.	.	.	.	.	.	.	.	.	C	11.88	1.770881	0.31320	.	.	ENSG00000086758	ENST00000342160;ENST00000262854	T;T	0.37058	1.22;1.22	5.88	5.88	0.94601	.	0.430064	0.22128	N	0.064222	T	0.23886	0.0578	N	0.08118	0	0.33931	D	0.642082	B;B	0.02656	0.0;0.0	B;B	0.06405	0.0;0.002	T	0.18241	-1.0343	10	0.40728	T	0.16	.	17.8502	0.88744	0.0:1.0:0.0:0.0	.	2873;2873	Q7Z6Z7;Q7Z6Z7-2	HUWE1_HUMAN;.	N	2873	ENSP00000340648:D2873N;ENSP00000262854:D2873N	ENSP00000262854:D2873N	D	-	1	0	HUWE1	53596457	.	.	0.998000	0.56505	0.598000	0.36846	.	.	2.489000	0.83994	0.600000	0.82982	GAC	HUWE1	-	NULL		0.587	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	C	XM_497119		53579732	-1	no_errors	ENST00000262854	ensembl	human	known	70_37	missense	SNP	1.000	T
IMP4	92856	genome.wustl.edu	37	2	131103843	131103843	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:131103843G>A	ENST00000259239.3	+	8	1467	c.759G>A	c.(757-759)ctG>ctA	p.L253L	IMP4_ENST00000409935.1_Intron	NM_033416.1	NP_219484.1	Q96G21	IMP4_HUMAN	IMP4, U3 small nucleolar ribonucleoprotein	253	Brix. {ECO:0000255|PROSITE- ProRule:PRU00034}.				rRNA processing (GO:0006364)	nucleolus (GO:0005730)|ribonucleoprotein complex (GO:0030529)				central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|urinary_tract(1)	18	Colorectal(110;0.1)					GCTTTGAGCTGAAGCGTGAGT	0.612																																																	0													88.0	77.0	80.0					2																	131103843		2203	4300	6503	SO:0001819	synonymous_variant	92856			BC010042	CCDS2160.1	2q21.1	2014-02-19	2014-02-19		ENSG00000136718	ENSG00000136718			30856	protein-coding gene	gene with protein product		612981	"""IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast)"""			8619474, 9110174, 12655004	Standard	NM_033416		Approved	MGC19606, BXDC4	uc002tra.1	Q96G21	OTTHUMG00000131627	ENST00000259239.3:c.759G>A	2.37:g.131103843G>A			Q3ZTT3	Silent	SNP	pfam_Brix,superfamily_Anticodon-bd,smart_Brix,pfscan_Brix	p.L253	ENST00000259239.3	37	c.759	CCDS2160.1	2																																																																																			IMP4	-	pfam_Brix,superfamily_Anticodon-bd,smart_Brix,pfscan_Brix		0.612	IMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMP4	HGNC	protein_coding	OTTHUMT00000254520.2	G	NM_033416		131103843	+1	no_errors	ENST00000259239	ensembl	human	known	70_37	silent	SNP	0.985	A
ING4	51147	genome.wustl.edu	37	12	6761909	6761909	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr12:6761909G>T	ENST00000396807.4	-	5	457	c.419C>A	c.(418-420)gCt>gAt	p.A140D	ING4_ENST00000412586.2_Missense_Mutation_p.A137D|ING4_ENST00000341550.4_Missense_Mutation_p.A139D|ING4_ENST00000423703.2_Missense_Mutation_p.A140D|ING4_ENST00000486287.1_5'UTR|ING4_ENST00000446105.2_Missense_Mutation_p.A136D|ING4_ENST00000444704.2_Missense_Mutation_p.A116D	NM_001127582.1|NM_001127585.1|NM_001127586.1|NM_016162.3	NP_001121054.1|NP_001121057.1|NP_001121058.1|NP_057246.2	Q9UNL4	ING4_HUMAN	inhibitor of growth family, member 4	140					apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|chromatin organization (GO:0006325)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|protein acetylation (GO:0006473)	histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			central_nervous_system(3)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)	10						AGCACGAGCAGCTTTCTTCTC	0.532																																																	0													95.0	100.0	98.0					12																	6761909		2203	4300	6503	SO:0001583	missense	51147			AF063594	CCDS8555.1, CCDS44812.1, CCDS44813.1, CCDS44814.1, CCDS44815.1, CCDS44816.1	12p13.32	2013-01-28			ENSG00000111653	ENSG00000111653		"""Zinc fingers, PHD-type"""	19423	protein-coding gene	gene with protein product		608524				12750254	Standard	NM_001127582		Approved	p29ING4, my036	uc001qpw.4	Q9UNL4	OTTHUMG00000141274	ENST00000396807.4:c.419C>A	12.37:g.6761909G>T	ENSP00000380024:p.Ala140Asp		A4KYM4|A4KYM6|D3DUR8|Q0EF62|Q0EF63|Q4VBQ6|Q96E15|Q9H3J0	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.A140D	ENST00000396807.4	37	c.419	CCDS44813.1	12	.	.	.	.	.	.	.	.	.	.	G	9.848	1.192838	0.21954	.	.	ENSG00000111653	ENST00000341550;ENST00000396807;ENST00000446105;ENST00000444704;ENST00000423703;ENST00000412586	T;T;T;T;T	0.42513	1.05;0.98;0.99;0.98;0.97	4.59	4.59	0.56863	.	0.207947	0.40728	N	0.001026	T	0.36441	0.0967	L	0.48642	1.525	0.35123	D	0.767265	P;P;P;B;B;P	0.48503	0.551;0.911;0.835;0.004;0.005;0.745	B;P;P;B;B;B	0.45232	0.274;0.467;0.474;0.015;0.009;0.282	T	0.37549	-0.9701	10	0.13108	T	0.6	-1.1156	11.1231	0.48302	0.0844:0.0:0.9156:0.0	.	116;140;136;137;140;139	Q9UNL4-3;A4KYM6;Q9UNL4-4;Q9UNL4-5;Q9UNL4;Q4VBQ6	.;.;.;.;ING4_HUMAN;.	D	139;140;136;116;140;137	ENSP00000343396:A139D;ENSP00000380024:A140D;ENSP00000415903:A136D;ENSP00000397343:A116D;ENSP00000412705:A137D	ENSP00000343396:A139D	A	-	2	0	ING4	6632170	1.000000	0.71417	0.486000	0.27416	0.998000	0.95712	2.734000	0.47368	2.386000	0.81285	0.555000	0.69702	GCT	ING4	-	NULL		0.532	ING4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ING4	HGNC	protein_coding	OTTHUMT00000280467.2	G	NM_198287		6761909	-1	no_errors	ENST00000396807	ensembl	human	known	70_37	missense	SNP	0.927	T
INTU	27152	genome.wustl.edu	37	4	128564836	128564836	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr4:128564836G>C	ENST00000335251.6	+	2	410	c.307G>C	c.(307-309)Gaa>Caa	p.E103Q	INTU_ENST00000296461.5_Missense_Mutation_p.E103Q	NM_015693.3	NP_056508.2	Q9ULD6	INTU_HUMAN	inturned planar cell polarity protein	103					cilium assembly (GO:0042384)|hair follicle morphogenesis (GO:0031069)|keratinocyte differentiation (GO:0030216)|limb development (GO:0060173)|negative regulation of cell division (GO:0051782)|negative regulation of keratinocyte proliferation (GO:0010839)|nervous system development (GO:0007399)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)				breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	43						TGACTACAAAGAAAGAAAAAA	0.358																																																	0													85.0	93.0	90.0					4																	128564836		2203	4300	6503	SO:0001583	missense	27152			BC051698	CCDS34061.1	4q28.2	2013-03-05	2013-03-05	2006-10-24	ENSG00000164066	ENSG00000164066			29239	protein-coding gene	gene with protein product		610621	"""PDZ domain containing 6"", ""inturned planar cell polarity effector homolog (Drosophila)"""	PDZK6, PDZD6		10574462, 21761479	Standard	NM_015693		Approved	KIAA1284	uc003ifk.2	Q9ULD6	OTTHUMG00000161202	ENST00000335251.6:c.307G>C	4.37:g.128564836G>C	ENSP00000334003:p.Glu103Gln		A1L4N5|D6RAE6|D6RBT4|Q4W5I8|Q86V55	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E103Q	ENST00000335251.6	37	c.307	CCDS34061.1	4	.	.	.	.	.	.	.	.	.	.	G	13.09	2.132384	0.37630	.	.	ENSG00000164066	ENST00000504491;ENST00000335251;ENST00000296461	T	0.46063	0.88	5.1	5.1	0.69264	.	0.254278	0.40064	N	0.001181	T	0.36608	0.0973	L	0.57536	1.79	0.37013	D	0.895846	P	0.47910	0.902	B	0.40864	0.342	T	0.35895	-0.9770	10	0.27785	T	0.31	-16.8428	9.4408	0.38668	0.0928:0.0:0.9072:0.0	.	103	Q9ULD6	PDZD6_HUMAN	Q	84;103;103	ENSP00000296461:E103Q	ENSP00000296461:E103Q	E	+	1	0	INTU	128784286	1.000000	0.71417	0.981000	0.43875	0.204000	0.24138	4.607000	0.61133	2.652000	0.90054	0.655000	0.94253	GAA	INTU	-	NULL		0.358	INTU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	INTU	HGNC	protein_coding	OTTHUMT00000364147.2	G	XM_371707		128564836	+1	no_errors	ENST00000335251	ensembl	human	known	70_37	missense	SNP	0.998	C
IQCE	23288	genome.wustl.edu	37	7	2608599	2608599	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr7:2608599G>A	ENST00000402050.2	+	3	280	c.96G>A	c.(94-96)agG>agA	p.R32R	IQCE_ENST00000404984.1_Intron|IQCE_ENST00000325979.7_Intron|IQCE_ENST00000438376.2_Silent_p.R16R	NM_001100390.1|NM_152558.3	NP_001093860.1|NP_689771.3	Q6IPM2	IQCE_HUMAN	IQ motif containing E	32						mitochondrion (GO:0005739)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		AAGCAAAAAGGAAAGCTTTCC	0.512																																																	0													78.0	78.0	78.0					7																	2608599		2014	4179	6193	SO:0001819	synonymous_variant	23288			AL136792	CCDS43542.1, CCDS47527.1, CCDS47527.2, CCDS75559.1, CCDS75560.1	7p22.3	2006-04-12			ENSG00000106012	ENSG00000106012			29171	protein-coding gene	gene with protein product						10470851	Standard	XR_242067		Approved	KIAA1023	uc003smo.4	Q6IPM2	OTTHUMG00000152047	ENST00000402050.2:c.96G>A	7.37:g.2608599G>A			Q4G0P7|Q6P7T4|Q9H0H7|Q9UPX7	Silent	SNP	pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.R32	ENST00000402050.2	37	c.96	CCDS43542.1	7																																																																																			IQCE	-	NULL		0.512	IQCE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IQCE	HGNC	protein_coding	OTTHUMT00000325063.2	G	NM_152558		2608599	+1	no_errors	ENST00000402050	ensembl	human	known	70_37	silent	SNP	0.311	A
IQSEC2	23096	genome.wustl.edu	37	X	53272579	53272579	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chrX:53272579G>A	ENST00000375368.5	-	8	2994	c.2794C>T	c.(2794-2796)Cgg>Tgg	p.R932W	IQSEC2_ENST00000396435.3_Missense_Mutation_p.R942W|IQSEC2_ENST00000375365.2_Missense_Mutation_p.R737W			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	932					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						TCGTTGGTCCGCAGTTCACGC	0.592																																																	0													80.0	50.0	60.0					X																	53272579		2183	4230	6413	SO:0001583	missense	23096			AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.2794C>T	X.37:g.53272579G>A	ENSP00000364517:p.Arg932Trp		B3KT97|C7SDG1|O60275|Q5JUX1	Missense_Mutation	SNP	pfam_Sec7,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7	p.R942W	ENST00000375368.5	37	c.2824		X	.	.	.	.	.	.	.	.	.	.	G	19.38	3.816687	0.70912	.	.	ENSG00000124313	ENST00000396435;ENST00000375368;ENST00000375365	T;T;T	0.13420	2.59;2.59;2.62	5.28	-0.377	0.12501	.	0.000000	0.85682	D	0.000000	T	0.24547	0.0595	L	0.59436	1.845	0.49299	D	0.999774	D;D	0.65815	0.995;0.992	P;P	0.54924	0.764;0.707	T	0.08006	-1.0743	10	0.87932	D	0	.	15.4534	0.75294	0.0:0.0:0.3236:0.6764	.	942;737	Q5JU85-2;Q5JU85-3	.;.	W	942;932;737	ENSP00000379712:R942W;ENSP00000364517:R932W;ENSP00000364514:R737W	ENSP00000364514:R737W	R	-	1	2	IQSEC2	53289304	0.000000	0.05858	0.989000	0.46669	0.994000	0.84299	-0.019000	0.12546	-0.102000	0.12197	-0.237000	0.12165	CGG	IQSEC2	-	superfamily_Sec7		0.592	IQSEC2-201	KNOWN	basic	protein_coding	IQSEC2	HGNC	protein_coding		G	XM_291345		53272579	-1	no_errors	ENST00000396435	ensembl	human	known	70_37	missense	SNP	0.774	A
ITGA1	3672	genome.wustl.edu	37	5	52223484	52223484	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr5:52223484G>A	ENST00000282588.6	+	20	3142	c.2684G>A	c.(2683-2685)aGa>aAa	p.R895K		NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1	895					activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				TTCCTGAGAAGAGGAGAGATG	0.333																																																	0													121.0	117.0	118.0					5																	52223484		2203	4300	6503	SO:0001583	missense	3672			X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.2684G>A	5.37:g.52223484G>A	ENSP00000282588:p.Arg895Lys		B2RNU0	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.R895K	ENST00000282588.6	37	c.2684	CCDS3955.1	5	.	.	.	.	.	.	.	.	.	.	G	0.027	-1.360539	0.01245	.	.	ENSG00000213949	ENST00000282588	T	0.52754	0.65	5.53	-5.72	0.02406	Integrin alpha-2 (1);	1.183960	0.05651	N	0.585176	T	0.20210	0.0486	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.27331	-1.0077	10	0.13853	T	0.58	.	8.9146	0.35574	0.3795:0.3854:0.235:0.0	.	895	P56199	ITA1_HUMAN	K	895	ENSP00000282588:R895K	ENSP00000282588:R895K	R	+	2	0	ITGA1	52259241	0.218000	0.23608	0.031000	0.17742	0.440000	0.31957	-0.387000	0.07361	-1.668000	0.01471	-0.797000	0.03246	AGA	ITGA1	-	pfam_Integrin_alpha-2		0.333	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA1	HGNC	protein_coding	OTTHUMT00000253855.3	G	NM_181501		52223484	+1	no_errors	ENST00000282588	ensembl	human	known	70_37	missense	SNP	0.000	A
ITGA11	22801	genome.wustl.edu	37	15	68624304	68624304	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr15:68624304C>T	ENST00000315757.7	-	14	1749	c.1663G>A	c.(1663-1665)Gat>Aat	p.D555N	ITGA11_ENST00000423218.2_Missense_Mutation_p.D555N	NM_001004439.1	NP_001004439.1	Q9UKX5	ITA11_HUMAN	integrin, alpha 11	555					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|collagen-activated signaling pathway (GO:0038065)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|osteoblast differentiation (GO:0001649)|substrate-dependent cell migration (GO:0006929)	focal adhesion (GO:0005925)|integrin alpha11-beta1 complex (GO:0034681)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(6)|lung(22)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	52						TTGTAGGAATCCTGGTTGAGG	0.537																																																	0													63.0	61.0	62.0					15																	68624304		1976	4158	6134	SO:0001583	missense	22801			AF109681	CCDS45291.1	15q22.3-q23	2010-03-23				ENSG00000137809		"""Integrins"""	6136	protein-coding gene	gene with protein product		604789				10486209	Standard	NM_001004439		Approved	HsT18964	uc002ari.3	Q9UKX5		ENST00000315757.7:c.1663G>A	15.37:g.68624304C>T	ENSP00000327290:p.Asp555Asn		J3KQM2|Q8WYI8|Q9UKQ1	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.D555N	ENST00000315757.7	37	c.1663	CCDS45291.1	15	.	.	.	.	.	.	.	.	.	.	C	23.8	4.459963	0.84317	.	.	ENSG00000137809	ENST00000315757;ENST00000423218;ENST00000535491;ENST00000537153	D;D	0.93488	-3.23;-3.23	4.67	4.67	0.58626	.	0.102837	0.64402	D	0.000005	D	0.97266	0.9106	H	0.94542	3.55	0.52099	D	0.99994	D;P	0.55172	0.97;0.933	P;P	0.59948	0.847;0.866	D	0.98616	1.0665	10	0.87932	D	0	.	16.6017	0.84817	0.0:1.0:0.0:0.0	.	555;555	A8K8T0;Q9UKX5	.;ITA11_HUMAN	N	555;555;190;555	ENSP00000327290:D555N;ENSP00000403392:D555N	ENSP00000327290:D555N	D	-	1	0	ITGA11	66411358	1.000000	0.71417	0.897000	0.35233	0.300000	0.27592	7.422000	0.80217	2.152000	0.67230	0.456000	0.33151	GAT	ITGA11	-	pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha		0.537	ITGA11-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGA11	HGNC	protein_coding		C	NM_012211		68624304	-1	no_errors	ENST00000315757	ensembl	human	known	70_37	missense	SNP	1.000	T
ITGA11	22801	genome.wustl.edu	37	15	68649528	68649528	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr15:68649528C>T	ENST00000315757.7	-	7	796	c.710G>A	c.(709-711)gGa>gAa	p.G237E	ITGA11_ENST00000562826.1_5'UTR|ITGA11_ENST00000423218.2_Missense_Mutation_p.G237E	NM_001004439.1	NP_001004439.1	Q9UKX5	ITA11_HUMAN	integrin, alpha 11	237	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|collagen-activated signaling pathway (GO:0038065)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|osteoblast differentiation (GO:0001649)|substrate-dependent cell migration (GO:0006929)	focal adhesion (GO:0005925)|integrin alpha11-beta1 complex (GO:0034681)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(6)|lung(22)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	52						GGTCTCTGTTCCTCCTCTCTG	0.423																																																	0													82.0	81.0	81.0					15																	68649528		1926	4138	6064	SO:0001583	missense	22801			AF109681	CCDS45291.1	15q22.3-q23	2010-03-23				ENSG00000137809		"""Integrins"""	6136	protein-coding gene	gene with protein product		604789				10486209	Standard	NM_001004439		Approved	HsT18964	uc002ari.3	Q9UKX5		ENST00000315757.7:c.710G>A	15.37:g.68649528C>T	ENSP00000327290:p.Gly237Glu		J3KQM2|Q8WYI8|Q9UKQ1	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.G237E	ENST00000315757.7	37	c.710	CCDS45291.1	15	.	.	.	.	.	.	.	.	.	.	C	31	5.076930	0.94000	.	.	ENSG00000137809	ENST00000315757;ENST00000423218;ENST00000537153	T;T	0.61510	0.1;0.1	5.09	5.09	0.68999	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	T	0.80757	0.4684	M	0.90252	3.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84157	0.0426	10	0.52906	T	0.07	.	17.5009	0.87731	0.0:1.0:0.0:0.0	.	237;237	A8K8T0;Q9UKX5	.;ITA11_HUMAN	E	237	ENSP00000327290:G237E;ENSP00000403392:G237E	ENSP00000327290:G237E	G	-	2	0	ITGA11	66436582	1.000000	0.71417	0.987000	0.45799	0.990000	0.78478	7.790000	0.85794	2.368000	0.80403	0.561000	0.74099	GGA	ITGA11	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.423	ITGA11-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGA11	HGNC	protein_coding		C	NM_012211		68649528	-1	no_errors	ENST00000315757	ensembl	human	known	70_37	missense	SNP	1.000	T
KCNA10	3744	genome.wustl.edu	37	1	111060863	111060863	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:111060863C>T	ENST00000369771.2	-	1	934	c.547G>A	c.(547-549)Gaa>Aaa	p.E183K		NM_005549.2	NP_005540.1	Q16322	KCA10_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 10	183					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|intracellular cyclic nucleotide activated cation channel activity (GO:0005221)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(3)|skin(1)|urinary_tract(1)	35		all_cancers(81;4.57e-06)|all_epithelial(167;1.52e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|all cancers(265;0.0874)|Colorectal(144;0.103)|Epithelial(280;0.116)|LUSC - Lung squamous cell carcinoma(189;0.134)	Dalfampridine(DB06637)	ATGAAGCCTTCATCCTCCCGG	0.517																																																	0													125.0	123.0	123.0					1																	111060863		2203	4300	6503	SO:0001583	missense	3744			U96110	CCDS826.1	1p13.1	2012-07-05			ENSG00000143105	ENSG00000143105		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6219	protein-coding gene	gene with protein product		602420				16382104	Standard	NM_005549		Approved	Kv1.8	uc001dzt.1	Q16322	OTTHUMG00000022785	ENST00000369771.2:c.547G>A	1.37:g.111060863C>T	ENSP00000358786:p.Glu183Lys			Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,pfam_PKD1_2_channel,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.E183K	ENST00000369771.2	37	c.547	CCDS826.1	1	.	.	.	.	.	.	.	.	.	.	C	17.64	3.439557	0.63067	.	.	ENSG00000143105	ENST00000369771	T	0.77877	-1.13	5.69	5.69	0.88448	BTB/POZ-like (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.78648	0.4316	M	0.91140	3.18	0.80722	D	1	B	0.27351	0.176	B	0.23419	0.046	T	0.80120	-0.1515	10	0.66056	D	0.02	.	18.3695	0.90402	0.0:1.0:0.0:0.0	.	183	Q16322	KCA10_HUMAN	K	183	ENSP00000358786:E183K	ENSP00000358786:E183K	E	-	1	0	KCNA10	110862386	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.682000	0.91365	0.655000	0.94253	GAA	KCNA10	-	superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl_volt-dep_Kv1		0.517	KCNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA10	HGNC	protein_coding	OTTHUMT00000059081.1	C	NM_005549		111060863	-1	no_errors	ENST00000369771	ensembl	human	known	70_37	missense	SNP	1.000	T
KCNA5	3741	genome.wustl.edu	37	12	5154481	5154481	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr12:5154481G>A	ENST00000252321.3	+	1	1397	c.1168G>A	c.(1168-1170)Ggg>Agg	p.G390R		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	390					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	CGGCCAGAATGGGCAGCAGGC	0.627																																																	0													49.0	45.0	46.0					12																	5154481		2203	4300	6503	SO:0001583	missense	3741			M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.1168G>A	12.37:g.5154481G>A	ENSP00000252321:p.Gly390Arg		Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,pfam_PKD1_2_channel,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.5,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.G390R	ENST00000252321.3	37	c.1168	CCDS8536.1	12	.	.	.	.	.	.	.	.	.	.	G	15.49	2.849249	0.51270	.	.	ENSG00000130037	ENST00000252321	D	0.97752	-4.52	4.87	4.87	0.63330	Ion transport (1);	1.620480	0.06014	U	0.650130	D	0.96941	0.9001	L	0.42744	1.35	0.58432	D	0.999991	B	0.28636	0.218	B	0.35353	0.201	D	0.87203	0.2242	10	0.66056	D	0.02	.	17.2051	0.86915	0.0:0.0:1.0:0.0	.	390	P22460	KCNA5_HUMAN	R	390	ENSP00000252321:G390R	ENSP00000252321:G390R	G	+	1	0	KCNA5	5024742	1.000000	0.71417	0.994000	0.49952	0.912000	0.54170	6.176000	0.71955	2.536000	0.85505	0.561000	0.74099	GGG	KCNA5	-	pfam_Ion_trans_dom		0.627	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA5	HGNC	protein_coding	OTTHUMT00000398925.2	G	NM_002234		5154481	+1	no_errors	ENST00000252321	ensembl	human	known	70_37	missense	SNP	1.000	A
KCNAB1	7881	genome.wustl.edu	37	3	155861124	155861124	+	Intron	SNP	G	G	A	rs370874801		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr3:155861124G>A	ENST00000490337.1	+	1	339				KCNAB1_ENST00000471742.1_Missense_Mutation_p.E53K|KCNAB1_ENST00000389636.5_Intron	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1						learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			TGGAGCAGCCGAACAGAAATA	0.502																																																	0								G	LYS/GLU,	0,4406		0,0,2203	70.0	67.0	68.0		157,	5.2	0.1	3		68	1,8599	1.2+/-3.3	0,1,4299	no	missense,intron	KCNAB1	NM_003471.3,NM_172160.2	56,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	53/409,	155861124	1,13005	2203	4300	6503	SO:0001627	intron_variant	7881			U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.275+22449G>A	3.37:g.155861124G>A			A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_K_chnl_volt-dep_bsu_KCNAB-rel,prints_K_chnl_volt-dep_bsu_KCNAB1,prints_K_chnl_volt-dep_bsu_KCNAB3,tigrfam_K_chnl_volt-dep_bsu_KCNAB	p.E53K	ENST00000490337.1	37	c.157	CCDS3174.1	3	.	.	.	.	.	.	.	.	.	.	G	15.43	2.830602	0.50845	0.0	1.16E-4	ENSG00000169282	ENST00000471742	T	0.06768	3.26	5.17	5.17	0.71159	.	.	.	.	.	T	0.04952	0.0133	.	.	.	0.80722	D	1	B	0.23249	0.082	B	0.12156	0.007	T	0.21415	-1.0246	8	0.06099	T	0.92	.	16.5305	0.84357	0.0:0.0:1.0:0.0	.	53	Q14722-3	.	K	53	ENSP00000418956:E53K	ENSP00000418956:E53K	E	+	1	0	KCNAB1	157343818	1.000000	0.71417	0.057000	0.19452	0.952000	0.60782	6.386000	0.73186	2.562000	0.86427	0.561000	0.74099	GAA	KCNAB1	-	NULL		0.502	KCNAB1-002	KNOWN	basic|CCDS	protein_coding	KCNAB1	HGNC	protein_coding	OTTHUMT00000351411.1	G	NM_003471		155861124	+1	no_errors	ENST00000471742	ensembl	human	known	70_37	missense	SNP	0.585	A
KCTD3	51133	genome.wustl.edu	37	1	215760001	215760001	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:215760001C>T	ENST00000259154.4	+	9	1084	c.790C>T	c.(790-792)Cag>Tag	p.Q264*		NM_016121.3	NP_057205.2	Q9Y597	KCTD3_HUMAN	potassium channel tetramerization domain containing 3	264					protein homooligomerization (GO:0051260)					breast(4)|endometrium(2)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)	33				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		GTGGAGTGTTCAGGATGGGGG	0.393																																																	0													182.0	182.0	182.0					1																	215760001		2203	4300	6503	SO:0001587	stop_gained	51133			AK024547	CCDS1515.1	1q41	2013-06-20	2013-06-20		ENSG00000136636	ENSG00000136636			21305	protein-coding gene	gene with protein product		613272	"""potassium channel tetramerisation domain containing 3"""			10508479	Standard	NM_016121		Approved	NY-REN-45	uc001hks.3	Q9Y597	OTTHUMG00000037019	ENST00000259154.4:c.790C>T	1.37:g.215760001C>T	ENSP00000259154:p.Gln264*		A0AV15|D3DTA6|Q49AG7|Q504Q9|Q6PJN6|Q8ND58|Q8NDJ0|Q8WX16	Nonsense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,superfamily_WD40_repeat_dom,smart_BTB/POZ-like,smart_WD40_repeat,pfscan_BTB/POZ-like	p.Q264*	ENST00000259154.4	37	c.790	CCDS1515.1	1	.	.	.	.	.	.	.	.	.	.	C	40	8.421629	0.98803	.	.	ENSG00000136636	ENST00000259154	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-21.8499	19.1816	0.93625	0.0:1.0:0.0:0.0	.	.	.	.	X	264	.	ENSP00000259154:Q264X	Q	+	1	0	KCTD3	213826624	1.000000	0.71417	0.231000	0.23993	0.988000	0.76386	4.663000	0.61532	2.779000	0.95612	0.591000	0.81541	CAG	KCTD3	-	superfamily_WD40_repeat_dom		0.393	KCTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD3	HGNC	protein_coding	OTTHUMT00000089871.2	C	NM_016121		215760001	+1	no_errors	ENST00000259154	ensembl	human	known	70_37	nonsense	SNP	1.000	T
KIAA0100	9703	genome.wustl.edu	37	17	26970655	26970655	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:26970655G>A	ENST00000528896.2	-	3	295	c.221C>T	c.(220-222)tCc>tTc	p.S74F	KIAA0100_ENST00000389003.3_5'UTR|KIAA0100_ENST00000544884.1_5'UTR	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	74						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					GAGTTTGCTGGAAATCCACAG	0.453																																																	0													125.0	126.0	125.0					17																	26970655		2203	4300	6503	SO:0001583	missense	9703			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.221C>T	17.37:g.26970655G>A	ENSP00000436773:p.Ser74Phe		A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	pfam_FMP27_C,pfam_FMP27_N,pfam_FMP27_GFWDK_dom	p.S74F	ENST00000528896.2	37	c.221	CCDS32595.1	17	.	.	.	.	.	.	.	.	.	.	G	26.5	4.742105	0.89573	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896	T	0.27104	1.69	5.6	5.6	0.85130	FMP27, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.43656	0.1257	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.91635	0.999;0.996	T	0.28713	-1.0035	10	0.59425	D	0.04	.	19.6224	0.95663	0.0:0.0:1.0:0.0	.	74;74	F6XS94;Q14667	.;K0100_HUMAN	F	74	ENSP00000436773:S74F	ENSP00000005905:S74F	S	-	2	0	KIAA0100	23994782	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.242000	0.89818	2.630000	0.89119	0.655000	0.94253	TCC	KIAA0100	-	pfam_FMP27_N		0.453	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0100	HGNC	protein_coding	OTTHUMT00000390571.3	G	NM_014680		26970655	-1	no_errors	ENST00000005905	ensembl	human	known	70_37	missense	SNP	1.000	A
KLB	152831	genome.wustl.edu	37	4	39448764	39448764	+	Silent	SNP	C	C	T	rs202121733	byFrequency	TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr4:39448764C>T	ENST00000257408.4	+	4	2515	c.2418C>T	c.(2416-2418)ctC>ctT	p.L806L		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	806	Glycosyl hydrolase-1 2.				carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						TGCCGCGCCTCACCGAGGCCG	0.662													C|||	31	0.0061901	0.0	0.0	5008	,	,		17781	0.0		0.0	False		,,,				2504	0.0317																0													30.0	31.0	31.0					4																	39448764		2203	4295	6498	SO:0001819	synonymous_variant	152831			AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.2418C>T	4.37:g.39448764C>T			Q2M3K8	Silent	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.L806	ENST00000257408.4	37	c.2418	CCDS3451.1	4																																																																																			KLB	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF		0.662	KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLB	HGNC	protein_coding	OTTHUMT00000250429.1	C	NM_175737		39448764	+1	no_errors	ENST00000257408	ensembl	human	known	70_37	silent	SNP	1.000	T
KLHDC7A	127707	genome.wustl.edu	37	1	18808487	18808487	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:18808487G>T	ENST00000400664.1	+	1	1064	c.1012G>T	c.(1012-1014)Gac>Tac	p.D338Y		NM_152375.2	NP_689588.2	Q5VTJ3	KLD7A_HUMAN	kelch domain containing 7A	338						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	22		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CCAAGCCGGTGACACAAAGGG	0.682																																																	0													13.0	17.0	15.0					1																	18808487		2131	4196	6327	SO:0001583	missense	127707			AK096072	CCDS185.2	1p36.13	2008-02-05			ENSG00000179023	ENSG00000179023			26791	protein-coding gene	gene with protein product							Standard	NM_152375		Approved	FLJ38753	uc001bax.3	Q5VTJ3	OTTHUMG00000002431	ENST00000400664.1:c.1012G>T	1.37:g.18808487G>T	ENSP00000383505:p.Asp338Tyr		Q8N8W6	Missense_Mutation	SNP	pfam_Kelch_1,smart_Kelch_1	p.D338Y	ENST00000400664.1	37	c.1012	CCDS185.2	1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.136525	0.77662	.	.	ENSG00000179023	ENST00000400664;ENST00000540290	T	0.73363	-0.74	4.99	0.804	0.18697	.	1.587130	0.04063	N	0.306691	T	0.73999	0.3659	N	0.22421	0.69	0.09310	N	1	P;D	0.61080	0.531;0.989	B;P	0.57283	0.17;0.817	T	0.62148	-0.6915	10	0.72032	D	0.01	.	7.9554	0.30040	0.4672:0.0:0.5328:0.0	.	275;338	A7E2V3;Q5VTJ3	.;KLD7A_HUMAN	Y	338;275	ENSP00000383505:D338Y	ENSP00000383505:D338Y	D	+	1	0	KLHDC7A	18681074	0.000000	0.05858	0.001000	0.08648	0.725000	0.41563	0.080000	0.14802	0.128000	0.18479	0.313000	0.20887	GAC	KLHDC7A	-	NULL		0.682	KLHDC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC7A	HGNC	protein_coding	OTTHUMT00000006923.3	G	NM_152375		18808487	+1	no_errors	ENST00000400664	ensembl	human	known	70_37	missense	SNP	0.000	T
KLHDC7A	127707	genome.wustl.edu	37	1	18808567	18808567	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:18808567G>C	ENST00000400664.1	+	1	1144	c.1092G>C	c.(1090-1092)gaG>gaC	p.E364D		NM_152375.2	NP_689588.2	Q5VTJ3	KLD7A_HUMAN	kelch domain containing 7A	364						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	22		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		GCCGGAAGGAGAGCCTTCTGC	0.697																																																	0													13.0	16.0	15.0					1																	18808567		2103	4219	6322	SO:0001583	missense	127707			AK096072	CCDS185.2	1p36.13	2008-02-05			ENSG00000179023	ENSG00000179023			26791	protein-coding gene	gene with protein product							Standard	NM_152375		Approved	FLJ38753	uc001bax.3	Q5VTJ3	OTTHUMG00000002431	ENST00000400664.1:c.1092G>C	1.37:g.18808567G>C	ENSP00000383505:p.Glu364Asp		Q8N8W6	Missense_Mutation	SNP	pfam_Kelch_1,smart_Kelch_1	p.E364D	ENST00000400664.1	37	c.1092	CCDS185.2	1	.	.	.	.	.	.	.	.	.	.	G	6.649	0.488186	0.12641	.	.	ENSG00000179023	ENST00000400664;ENST00000540290	T	0.73681	-0.77	5.16	0.87	0.19102	.	0.865482	0.09963	N	0.733210	T	0.62024	0.2394	L	0.38175	1.15	0.24650	N	0.993526	B;B	0.10296	0.002;0.003	B;B	0.10450	0.003;0.005	T	0.42378	-0.9455	10	0.12103	T	0.63	.	11.4488	0.50140	0.0739:0.5004:0.4257:0.0	.	301;364	A7E2V3;Q5VTJ3	.;KLD7A_HUMAN	D	364;301	ENSP00000383505:E364D	ENSP00000383505:E364D	E	+	3	2	KLHDC7A	18681154	0.131000	0.22433	0.863000	0.33907	0.027000	0.11550	0.029000	0.13666	0.173000	0.19788	0.313000	0.20887	GAG	KLHDC7A	-	NULL		0.697	KLHDC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC7A	HGNC	protein_coding	OTTHUMT00000006923.3	G	NM_152375		18808567	+1	no_errors	ENST00000400664	ensembl	human	known	70_37	missense	SNP	0.791	C
KRT36	8689	genome.wustl.edu	37	17	39644584	39644584	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:39644584C>G	ENST00000328119.6	-	3	609	c.610G>C	c.(610-612)Gat>Cat	p.D204H	KRT36_ENST00000393986.2_Missense_Mutation_p.D154H	NM_003771.4	NP_003762.1	O76013	KRT36_HUMAN	keratin 36	204	Coil 1B.|Rod.				regulation of keratinocyte differentiation (GO:0045616)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural constituent of epidermis (GO:0030280)			breast(2)|cervix(1)|kidney(2)|large_intestine(3)|lung(8)|skin(1)	17		Breast(137;0.000286)				GTCAGCTCATCCAGGATCCTA	0.587																																																	0													108.0	97.0	100.0					17																	39644584		2203	4300	6503	SO:0001583	missense	8689			Y16792	CCDS11395.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000126337	ENSG00000126337		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6454	protein-coding gene	gene with protein product		604540	"""keratin, hair, acidic, 6"""	KRTHA6		9756910, 16831889	Standard	XM_005257762		Approved		uc002hwt.3	O76013	OTTHUMG00000133431	ENST00000328119.6:c.610G>C	17.37:g.39644584C>G	ENSP00000329165:p.Asp204His		Q86XG4	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_I	p.D204H	ENST00000328119.6	37	c.610	CCDS11395.1	17	.	.	.	.	.	.	.	.	.	.	C	29.5	5.008178	0.93346	.	.	ENSG00000126337	ENST00000393986;ENST00000328119	D;D	0.91945	-2.94;-2.94	5.69	5.69	0.88448	Filament (1);	0.000000	0.52532	D	0.000076	D	0.97791	0.9275	H	0.97659	4.05	0.58432	D	0.999999	D	0.89917	1.0	D	0.77004	0.989	D	0.98713	1.0705	10	0.87932	D	0	.	19.8047	0.96525	0.0:1.0:0.0:0.0	.	204	O76013	KRT36_HUMAN	H	154;204	ENSP00000377555:D154H;ENSP00000329165:D204H	ENSP00000329165:D204H	D	-	1	0	KRT36	36898110	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	6.070000	0.71220	2.692000	0.91855	0.563000	0.77884	GAT	KRT36	-	pfam_F,superfamily_Prefoldin,prints_Keratin_I		0.587	KRT36-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT36	HGNC	protein_coding	OTTHUMT00000259508.1	C	NM_003771		39644584	-1	no_errors	ENST00000328119	ensembl	human	known	70_37	missense	SNP	1.000	G
KRT15	3866	genome.wustl.edu	37	17	39673157	39673157	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:39673157C>T	ENST00000254043.3	-	3	4226	c.641G>A	c.(640-642)cGa>cAa	p.R214Q	KRT15_ENST00000393974.3_Missense_Mutation_p.R49Q|KRT15_ENST00000393981.3_Missense_Mutation_p.R49Q|KRT15_ENST00000393976.2_Missense_Mutation_p.R214Q	NM_002275.3	NP_002266	P19012	K1C15_HUMAN	keratin 15	214	Coil 1B.|Rod.				epidermis development (GO:0008544)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16		Breast(137;0.000286)				ATCCAGGACTCGGCGCAAGCC	0.592																																																	0													69.0	66.0	67.0					17																	39673157		2203	4300	6503	SO:0001583	missense	3866				CCDS11398.1	17q21.2	2013-06-20			ENSG00000171346	ENSG00000171346		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6421	protein-coding gene	gene with protein product	"""keratin-15, basic"", ""keratin-15, beta"", ""type I cytoskeletal 15"", ""cytokeratin 15"""	148030				16831889	Standard	NM_002275		Approved	K15, CK15, K1CO	uc002hwy.3	P19012	OTTHUMG00000133435	ENST00000254043.3:c.641G>A	17.37:g.39673157C>T	ENSP00000254043:p.Arg214Gln		B3KQY1|B3KRA2|E0CX14|Q53XV8|Q9BUG4	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_I	p.R214Q	ENST00000254043.3	37	c.641	CCDS11398.1	17	.	.	.	.	.	.	.	.	.	.	C	16.38	3.106194	0.56291	.	.	ENSG00000171346	ENST00000254043;ENST00000393974;ENST00000393976;ENST00000393981;ENST00000458290	D;D;D;D;D	0.89617	-2.54;-2.54;-2.54;-2.54;-2.54	4.87	3.9	0.45041	Filament (1);	0.000000	0.47852	D	0.000219	D	0.91078	0.7192	M	0.62154	1.92	0.25595	N	0.986652	D;P;P	0.67145	0.996;0.902;0.902	P;B;P	0.62560	0.904;0.34;0.54	D	0.83797	0.0234	10	0.72032	D	0.01	.	7.753	0.28909	0.0:0.7365:0.0:0.2635	.	49;214;214	A8MT21;B3KVF5;P19012	.;.;K1C15_HUMAN	Q	214;49;214;49;49	ENSP00000254043:R214Q;ENSP00000377544:R49Q;ENSP00000377546:R214Q;ENSP00000377550:R49Q;ENSP00000409282:R49Q	ENSP00000254043:R214Q	R	-	2	0	KRT15	36926683	0.000000	0.05858	0.998000	0.56505	0.136000	0.21042	-0.429000	0.06982	1.275000	0.44379	0.655000	0.94253	CGA	KRT15	-	pfam_F,prints_Keratin_I		0.592	KRT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT15	HGNC	protein_coding	OTTHUMT00000257301.1	C	NM_002275		39673157	-1	no_errors	ENST00000254043	ensembl	human	known	70_37	missense	SNP	0.596	T
KRT6B	3854	genome.wustl.edu	37	12	52841348	52841348	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr12:52841348G>A	ENST00000252252.3	-	8	1481	c.1434C>T	c.(1432-1434)ggC>ggT	p.G478G		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	478	Tail.				ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		CAACGCCTTCGCCATTCAGCC	0.552																																																	0													133.0	105.0	115.0					12																	52841348		2203	4300	6503	SO:0001819	synonymous_variant	3854			BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.1434C>T	12.37:g.52841348G>A			P48669	Silent	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.G478	ENST00000252252.3	37	c.1434	CCDS8828.1	12																																																																																			KRT6B	-	NULL		0.552	KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT6B	HGNC	protein_coding	OTTHUMT00000404969.1	G	NM_005555		52841348	-1	no_errors	ENST00000252252	ensembl	human	known	70_37	silent	SNP	0.786	A
KRT6B	3854	genome.wustl.edu	37	12	52842665	52842665	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr12:52842665G>A	ENST00000252252.3	-	6	1211	c.1164C>T	c.(1162-1164)atC>atT	p.I388I		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	388	Coil 2.|Rod.				ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		TCAGCCTCTGGATCATGCGGT	0.522																																																	0													122.0	99.0	107.0					12																	52842665		2203	4297	6500	SO:0001819	synonymous_variant	3854			BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.1164C>T	12.37:g.52842665G>A			P48669	Silent	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.I388	ENST00000252252.3	37	c.1164	CCDS8828.1	12																																																																																			KRT6B	-	pfam_F,superfamily_Prefoldin		0.522	KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT6B	HGNC	protein_coding	OTTHUMT00000404969.1	G	NM_005555		52842665	-1	no_errors	ENST00000252252	ensembl	human	known	70_37	silent	SNP	1.000	A
KRT76	51350	genome.wustl.edu	37	12	53170949	53170949	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr12:53170949C>T	ENST00000332411.2	-	1	180	c.127G>A	c.(127-129)Gcc>Acc	p.A43T		NM_015848.4	NP_056932.2	Q01546	K22O_HUMAN	keratin 76	43	Head.				cytoskeleton organization (GO:0007010)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						AAGCCACAGGCCCCTCCACCA	0.647																																																	0													49.0	63.0	58.0					12																	53170949		2203	4300	6503	SO:0001583	missense	51350			M99063	CCDS8838.1	12q13.13	2013-06-25			ENSG00000185069	ENSG00000185069		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24430	protein-coding gene	gene with protein product						1282112, 16831889	Standard	NM_015848		Approved	HUMCYT2A, KRT2B, KRT2P	uc001sax.3	Q01546	OTTHUMG00000169797	ENST00000332411.2:c.127G>A	12.37:g.53170949C>T	ENSP00000330101:p.Ala43Thr		B4DRR3|Q7Z795	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II,prints_Keratin_I	p.A43T	ENST00000332411.2	37	c.127	CCDS8838.1	12	.	.	.	.	.	.	.	.	.	.	c	14.14	2.445123	0.43429	.	.	ENSG00000185069	ENST00000332411	D	0.85773	-2.03	4.61	3.7	0.42460	.	0.149575	0.31123	N	0.008205	D	0.85535	0.5719	L	0.56769	1.78	0.34749	D	0.73158	D	0.57257	0.979	P	0.54270	0.747	D	0.86032	0.1514	10	0.21014	T	0.42	.	10.0864	0.42421	0.0:0.783:0.1407:0.0762	.	43	Q01546	K22O_HUMAN	T	43	ENSP00000330101:A43T	ENSP00000330101:A43T	A	-	1	0	KRT76	51457216	0.000000	0.05858	1.000000	0.80357	0.534000	0.34807	-0.037000	0.12164	1.514000	0.48869	0.650000	0.86243	GCC	KRT76	-	NULL		0.647	KRT76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT76	HGNC	protein_coding	OTTHUMT00000405928.1	C	NM_015848		53170949	-1	no_errors	ENST00000332411	ensembl	human	known	70_37	missense	SNP	1.000	T
KYNU	8942	genome.wustl.edu	37	2	143799741	143799741	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:143799741G>A	ENST00000264170.4	+	14	1656	c.1398G>A	c.(1396-1398)taG>taA	p.*466*	KYNU_ENST00000409512.1_Silent_p.*466*	NM_003937.2	NP_003928.1			kynureninase											large_intestine(10)|liver(1)|lung(18)|prostate(3)|skin(4)	36				BRCA - Breast invasive adenocarcinoma(221;0.072)		CAAAAAATTAGCAGTGTTTTC	0.323																																																	0													63.0	66.0	65.0					2																	143799741		2203	4300	6503	SO:0001819	synonymous_variant	8942			U57721	CCDS2183.1, CCDS33299.1	2q22.2	2010-11-23	2010-11-23		ENSG00000115919	ENSG00000115919	3.7.1.3		6469	protein-coding gene	gene with protein product	"""L-kynurenine hydrolase"""	605197	"""kynureninase (L-kynurenine hydrolase)"""			8706755, 9180257	Standard	NM_001199241		Approved		uc002tvl.3	Q16719	OTTHUMG00000131829	ENST00000264170.4:c.1398G>A	2.37:g.143799741G>A				Silent	SNP	pfam_Aminotrans_V/Cys_dSase,superfamily_PyrdxlP-dep_Trfase_major_dom,tigrfam_Kynureninase	p.*466	ENST00000264170.4	37	c.1398	CCDS2183.1	2																																																																																			KYNU	-	NULL		0.323	KYNU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KYNU	HGNC	protein_coding	OTTHUMT00000254772.1	G	NM_001032998		143799741	+1	no_errors	ENST00000264170	ensembl	human	known	70_37	silent	SNP	0.000	A
LAMA2	3908	genome.wustl.edu	37	6	129612791	129612791	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr6:129612791G>A	ENST00000421865.2	+	20	2831	c.2782G>A	c.(2782-2784)Gag>Aag	p.E928K		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	928	Laminin EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		CTCTTTCTCTGAGGTTTGCCA	0.453																																																	0													91.0	81.0	84.0					6																	129612791		2203	4300	6503	SO:0001583	missense	3908			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.2782G>A	6.37:g.129612791G>A	ENSP00000400365:p.Glu928Lys		Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_B_type_IV,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,superfamily_t-SNARE,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.E928K	ENST00000421865.2	37	c.2782	CCDS5138.1	6	.	.	.	.	.	.	.	.	.	.	G	14.45	2.539427	0.45176	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.61274	0.12	5.78	5.78	0.91487	EGF-like, laminin (3);	0.133771	0.49305	D	0.000152	T	0.40171	0.1106	L	0.48642	1.525	0.47659	D	0.999485	P;P	0.41131	0.739;0.571	B;B	0.42959	0.403;0.243	T	0.26538	-1.0100	10	0.10111	T	0.7	.	16.6056	0.84827	0.0:0.1299:0.8701:0.0	.	928;928	A6NF00;P24043	.;LAMA2_HUMAN	K	928	ENSP00000400365:E928K	ENSP00000346769:E928K	E	+	1	0	LAMA2	129654484	1.000000	0.71417	0.375000	0.26029	0.666000	0.39218	3.792000	0.55476	2.894000	0.99253	0.591000	0.81541	GAG	LAMA2	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin		0.453	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	HGNC	protein_coding	OTTHUMT00000042180.1	G			129612791	+1	no_errors	ENST00000421865	ensembl	human	known	70_37	missense	SNP	0.878	A
LAMA5	3911	genome.wustl.edu	37	20	60899537	60899537	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr20:60899537C>G	ENST00000252999.3	-	42	5669	c.5603G>C	c.(5602-5604)gGa>gCa	p.G1868A		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	1868	Laminin EGF-like 17. {ECO:0000255|PROSITE-ProRule:PRU00460}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GTCTGAGTGTCCATGGCACTG	0.627																																																	0													54.0	45.0	48.0					20																	60899537		2200	4299	6499	SO:0001583	missense	3911			AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.5603G>C	20.37:g.60899537C>G	ENSP00000252999:p.Gly1868Ala		Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_I,pfam_Laminin_G,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N,pfscan_TNFR/NGFR_Cys_rich_reg	p.G1868A	ENST00000252999.3	37	c.5603	CCDS33502.1	20	.	.	.	.	.	.	.	.	.	.	C	21.2	4.115431	0.77323	.	.	ENSG00000130702	ENST00000252999	T	0.66280	-0.2	4.55	4.55	0.56014	TNFR/CD27/30/40/95 cysteine-rich region (1);EGF-like, laminin (3);	0.000000	0.85682	U	0.000000	D	0.84889	0.5572	H	0.94964	3.605	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89996	0.4111	10	0.87932	D	0	.	17.2958	0.87170	0.0:1.0:0.0:0.0	.	1868	O15230	LAMA5_HUMAN	A	1868	ENSP00000252999:G1868A	ENSP00000252999:G1868A	G	-	2	0	LAMA5	60332932	1.000000	0.71417	0.989000	0.46669	0.286000	0.27126	7.424000	0.80242	2.074000	0.62210	0.579000	0.79373	GGA	LAMA5	-	pfam_EGF_laminin,smart_EG-like_dom,smart_EGF_laminin,pfscan_EGF_laminin,pfscan_TNFR/NGFR_Cys_rich_reg		0.627	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA5	HGNC	protein_coding	OTTHUMT00000080014.2	C	NM_005560		60899537	-1	no_errors	ENST00000252999	ensembl	human	known	70_37	missense	SNP	1.000	G
LAMTOR2	28956	genome.wustl.edu	37	1	156024646	156024646	+	5'UTR	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:156024646C>T	ENST00000368305.4	+	0	104				LAMTOR2_ENST00000368302.3_5'UTR|LAMTOR2_ENST00000489664.1_3'UTR|UBQLN4_ENST00000472638.1_5'Flank|LAMTOR2_ENST00000368304.5_5'UTR|UBQLN4_ENST00000368309.3_5'Flank	NM_014017.3	NP_054736.1	Q9Y2Q5	LTOR2_HUMAN	late endosomal/lysosomal adaptor, MAPK and MTOR activator 2						activation of MAPKK activity (GO:0000186)|cell growth (GO:0016049)|cellular protein localization (GO:0034613)|cellular response to amino acid stimulus (GO:0071230)|positive regulation of GTPase activity (GO:0043547)|positive regulation of TOR signaling (GO:0032008)	extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|Ragulator complex (GO:0071986)				breast(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	7						CCTCGGAGATCTGGGTGCAAA	0.647																																																	0													33.0	28.0	30.0					1																	156024646		2203	4300	6503	SO:0001623	5_prime_UTR_variant	28956			BC024190	CCDS1128.1, CCDS44243.1	1q22	2014-09-17	2011-02-15	2011-02-15	ENSG00000116586	ENSG00000116586			29796	protein-coding gene	gene with protein product	"""mitogen activated protein binding protein interacting protein"", ""MAPKSP1 adaptor protein"", ""endosomal adaptor protein"""	610389	"""roadblock domain containing 3"""	ROBLD3		11042152	Standard	NM_014017		Approved	MAPBPIP, MAPKSP1AP, p14, ENDAP, Ragulator2	uc001fnb.3	Q9Y2Q5	OTTHUMG00000017462	ENST00000368305.4:c.-35C>T	1.37:g.156024646C>T			Q5VY97|Q5VY98|Q5VY99	RNA	SNP	-	NULL	ENST00000368305.4	37	NULL	CCDS1128.1	1																																																																																			LAMTOR2	-	-		0.647	LAMTOR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMTOR2	HGNC	protein_coding	OTTHUMT00000046197.1	C	NM_014017		156024646	+1	no_errors	ENST00000489664	ensembl	human	known	70_37	rna	SNP	0.000	T
LAMC1	3915	genome.wustl.edu	37	1	183102564	183102564	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:183102564C>T	ENST00000258341.4	+	22	3985	c.3728C>T	c.(3727-3729)tCa>tTa	p.S1243L		NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	1243	Domain II and I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						AAGAACATCTCACAGGATCTG	0.448																																																	0													135.0	131.0	133.0					1																	183102564		2203	4300	6503	SO:0001583	missense	3915			J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.3728C>T	1.37:g.183102564C>T	ENSP00000258341:p.Ser1243Leu		Q5VYE7	Missense_Mutation	SNP	pfam_Laminin_N,pfam_EGF_laminin,pfam_Laminin_B_type_IV,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.S1243L	ENST00000258341.4	37	c.3728	CCDS1351.1	1	.	.	.	.	.	.	.	.	.	.	C	11.41	1.629096	0.28978	.	.	ENSG00000135862	ENST00000258341	T	0.20598	2.06	5.41	5.41	0.78517	.	0.057215	0.64402	D	0.000002	T	0.17916	0.0430	L	0.41236	1.265	0.54753	D	0.999989	B	0.12013	0.005	B	0.08055	0.003	T	0.09292	-1.0681	10	0.02654	T	1	.	19.1481	0.93476	0.0:1.0:0.0:0.0	.	1243	P11047	LAMC1_HUMAN	L	1243	ENSP00000258341:S1243L	ENSP00000258341:S1243L	S	+	2	0	LAMC1	181369187	1.000000	0.71417	0.960000	0.40013	0.966000	0.64601	6.965000	0.76067	2.692000	0.91855	0.563000	0.77884	TCA	LAMC1	-	NULL		0.448	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC1	HGNC	protein_coding	OTTHUMT00000085954.2	C	NM_002293		183102564	+1	no_errors	ENST00000258341	ensembl	human	known	70_37	missense	SNP	1.000	T
LAMTOR4	389541	genome.wustl.edu	37	7	99747121	99747121	+	Splice_Site	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr7:99747121G>A	ENST00000341942.5	+	2	69		c.e2-1		LAMTOR4_ENST00000441173.1_Splice_Site|LAMTOR4_ENST00000468582.1_Splice_Site	NM_001008395.2	NP_001008396.1	Q0VGL1	LTOR4_HUMAN	late endosomal/lysosomal adaptor, MAPK and MTOR activator 4						cellular response to amino acid stimulus (GO:0071230)|positive regulation of GTPase activity (GO:0043547)|positive regulation of TOR signaling (GO:0032008)|protein localization to lysosome (GO:0061462)|regulation of cell size (GO:0008361)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|Ragulator complex (GO:0071986)											TTACCCACTAGACTTCTGCGC	0.587																																																	0													174.0	170.0	171.0					7																	99747121		2203	4300	6503	SO:0001630	splice_region_variant	389541				CCDS34702.1	7q22	2012-09-24	2012-09-24	2012-09-24	ENSG00000188186	ENSG00000188186			33772	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 59"""	C7orf59		22980980	Standard	NM_001008395		Approved		uc003utq.2	Q0VGL1	OTTHUMG00000154854	ENST00000341942.5:c.4-1G>A	7.37:g.99747121G>A				Splice_Site	SNP	-	e2-1	ENST00000341942.5	37	c.4-1	CCDS34702.1	7	.	.	.	.	.	.	.	.	.	.	.	23.1	4.371870	0.82573	.	.	ENSG00000188186	ENST00000341942;ENST00000441173	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8574	0.70347	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C7orf59	99585057	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	5.847000	0.69451	2.579000	0.87056	0.540000	0.68198	.	LAMTOR4	-	-		0.587	LAMTOR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMTOR4	HGNC	protein_coding	OTTHUMT00000337373.2	G	NM_001008395	Intron	99747121	+1	no_errors	ENST00000341942	ensembl	human	known	70_37	splice_site	SNP	0.998	A
LARP4B	23185	genome.wustl.edu	37	10	876851	876851	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr10:876851C>T	ENST00000316157.3	-	8	857	c.817G>A	c.(817-819)Gat>Aat	p.D273N		NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	273	RRM.				positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						AACCAATTATCATTATATGCA	0.299																																																	0													99.0	108.0	105.0					10																	876851		2201	4297	6498	SO:0001583	missense	23185			D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.817G>A	10.37:g.876851C>T	ENSP00000326128:p.Asp273Asn		A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Missense_Mutation	SNP	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,pfscan_Lupus_La_RNA-bd	p.D273N	ENST00000316157.3	37	c.817	CCDS31131.1	10	.	.	.	.	.	.	.	.	.	.	C	16.31	3.087990	0.55968	.	.	ENSG00000107929	ENST00000316157	T	0.35048	1.33	4.94	4.94	0.65067	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.000000	0.85682	D	0.000000	T	0.35595	0.0937	N	0.04994	-0.135	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.10497	-1.0627	10	0.05436	T	0.98	-2.5957	18.5277	0.90978	0.0:1.0:0.0:0.0	.	273	Q92615	LAR4B_HUMAN	N	273	ENSP00000326128:D273N	ENSP00000326128:D273N	D	-	1	0	LARP4B	866851	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.820000	0.62671	2.451000	0.82905	0.563000	0.77884	GAT	LARP4B	-	NULL		0.299	LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP4B	HGNC	protein_coding	OTTHUMT00000046395.2	C	NM_015155		876851	-1	no_errors	ENST00000316157	ensembl	human	known	70_37	missense	SNP	1.000	T
LASP1	3927	genome.wustl.edu	37	17	37034359	37034359	+	Missense_Mutation	SNP	C	C	G	rs533471690		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:37034359C>G	ENST00000318008.6	+	2	421	c.90C>G	c.(88-90)ttC>ttG	p.F30L	LASP1_ENST00000433206.2_Missense_Mutation_p.P3A|LASP1_ENST00000435347.3_Missense_Mutation_p.F30L	NM_006148.2	NP_006139.1	Q14847	LASP1_HUMAN	LIM and SH3 protein 1	30	LIM zinc-binding. {ECO:0000255|PROSITE- ProRule:PRU00125}.				ion transport (GO:0006811)|positive regulation of signal transduction (GO:0009967)	cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	ion transmembrane transporter activity (GO:0015075)|SH3/SH2 adaptor activity (GO:0005070)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(2)|lung(4)|urinary_tract(2)	9						AAGCATGCTTCCATTGCGAGA	0.532			T	MLL	AML																																			Dom	yes		17	17q11-q21.3	3927	LIM and SH3 protein 1		L	0													142.0	120.0	128.0					17																	37034359		2203	4300	6503	SO:0001583	missense	3927				CCDS11331.1, CCDS62164.1	17q11-q21.3	2008-07-18			ENSG00000002834	ENSG00000002834			6513	protein-coding gene	gene with protein product		602920				7490069	Standard	NM_006148		Approved	MLN50, Lasp-1	uc010cvq.3	Q14847	OTTHUMG00000133182	ENST00000318008.6:c.90C>G	17.37:g.37034359C>G	ENSP00000325240:p.Phe30Leu		B4DGQ0|Q96ED2|Q96IG0	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_Znf_LIM,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Znf_LIM,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Znf_LIM,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_SH3_domain	p.F30L	ENST00000318008.6	37	c.90	CCDS11331.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.06|16.06	3.014608|3.014608	0.54468|0.54468	.|.	.|.	ENSG00000002834|ENSG00000002834	ENST00000318008;ENST00000443937;ENST00000435347|ENST00000433206	D;D;D|T	0.92199|0.37584	-2.99;-2.99;-2.99|1.19	5.72|5.72	4.52|4.52	0.55395|0.55395	Zinc finger, LIM-type (5);|.	0.046134|.	0.85682|.	D|.	0.000000|.	T|T	0.41673|0.41673	0.1169|0.1169	M|M	0.79343|0.79343	2.45|2.45	0.26157|0.26157	N|N	0.980064|0.980064	B;P|B	0.35401|0.14438	0.243;0.499|0.01	B;B|B	0.44133|0.15052	0.168;0.442|0.012	T|T	0.41052|0.41052	-0.9530|-0.9530	10|9	0.54805|0.87932	T|D	0.06|0	.|.	10.8939|10.8939	0.47010|0.47010	0.0:0.8822:0.0:0.1178|0.0:0.8822:0.0:0.1178	.|.	30;30|3	B4DJI4;Q14847|B4DGQ0	.;LASP1_HUMAN|.	L|A	30|3	ENSP00000325240:F30L;ENSP00000414803:F30L;ENSP00000392853:F30L|ENSP00000401048:P3A	ENSP00000325240:F30L|ENSP00000401048:P3A	F|P	+|+	3|1	2|0	LASP1|LASP1	34287885|34287885	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.896000|3.896000	0.56266|0.56266	1.083000|1.083000	0.41159|0.41159	0.561000|0.561000	0.74099|0.74099	TTC|CCA	LASP1	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM		0.532	LASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LASP1	HGNC	protein_coding	OTTHUMT00000256890.3	C	NM_006148		37034359	+1	no_errors	ENST00000318008	ensembl	human	known	70_37	missense	SNP	1.000	G
LCE1E	353135	genome.wustl.edu	37	1	152759813	152759824	+	In_Frame_Del	DEL	CTCCCAAGTGCA	CTCCCAAGTGCA	-	rs548297341		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	CTCCCAAGTGCA	CTCCCAAGTGCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:152759813_152759824delCTCCCAAGTGCA	ENST00000368770.3	+	2	91_102	c.38_49delCTCCCAAGTGCA	c.(37-51)cctcccaagtgcact>cct	p.PKCT14del	LCE1E_ENST00000368771.1_In_Frame_Del_p.PKCT14del	NM_178353.1	NP_848130.1	Q5T753	LCE1E_HUMAN	late cornified envelope 1E	14	Cys-rich.				keratinization (GO:0031424)					lung(5)|stomach(1)	6	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGCCAGCCCCctcccaagtgcactcccaagtg	0.604																																																	0																																										SO:0001651	inframe_deletion	353135			BC038391	CCDS1024.1	1q21.3	2008-02-05			ENSG00000186226	ENSG00000186226		"""Late cornified envelopes"""	29466	protein-coding gene	gene with protein product		612607				11698679	Standard	NM_178353		Approved	LEP5	uc001fan.3	Q5T753	OTTHUMG00000012405	ENST00000368770.3:c.38_49delCTCCCAAGTGCA	1.37:g.152759813_152759824delCTCCCAAGTGCA	ENSP00000357759:p.Pro14_Thr17del		D3DV30	In_Frame_Del	DEL	NULL	p.TPKC17in_frame_del	ENST00000368770.3	37	c.38_49	CCDS1024.1	1																																																																																			LCE1E	-	NULL		0.604	LCE1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE1E	HGNC	protein_coding	OTTHUMT00000034525.1	CTCCCAAGTGCA	NM_178353		152759824	+1	no_errors	ENST00000368770	ensembl	human	known	70_37	in_frame_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.999:0.993:0.980:0.785:0.777	-
LCE1E	353135	genome.wustl.edu	37	1	152759824	152759824	+	Missense_Mutation	SNP	A	A	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:152759824A>C	ENST00000368770.3	+	2	102	c.49A>C	c.(49-51)Act>Cct	p.T17P	LCE1E_ENST00000368771.1_Missense_Mutation_p.T17P	NM_178353.1	NP_848130.1	Q5T753	LCE1E_HUMAN	late cornified envelope 1E	17	Cys-rich.				keratinization (GO:0031424)					lung(5)|stomach(1)	6	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			tcccaagtgcactcccaagtg	0.602																																																	0													102.0	108.0	106.0					1																	152759824		2203	4300	6503	SO:0001583	missense	353135			BC038391	CCDS1024.1	1q21.3	2008-02-05			ENSG00000186226	ENSG00000186226		"""Late cornified envelopes"""	29466	protein-coding gene	gene with protein product		612607				11698679	Standard	NM_178353		Approved	LEP5	uc001fan.3	Q5T753	OTTHUMG00000012405	ENST00000368770.3:c.49A>C	1.37:g.152759824A>C	ENSP00000357759:p.Thr17Pro		D3DV30	Missense_Mutation	SNP	NULL	p.T17P	ENST00000368770.3	37	c.49	CCDS1024.1	1	.	.	.	.	.	.	.	.	.	.	A	9.288	1.049982	0.19827	.	.	ENSG00000186226	ENST00000368771;ENST00000368770	T;T	0.03689	3.84;3.84	3.38	-3.26	0.05064	.	.	.	.	.	T	0.00440	0.0014	N	0.00991	-1.07	0.20638	N	0.99988	B	0.02656	0.0	B	0.04013	0.001	T	0.48525	-0.9028	9	0.87932	D	0	.	6.8416	0.23965	0.2511:0.625:0.1239:0.0	.	17	Q5T753	LCE1E_HUMAN	P	17	ENSP00000357760:T17P;ENSP00000357759:T17P	ENSP00000357759:T17P	T	+	1	0	LCE1E	151026448	0.000000	0.05858	0.876000	0.34364	0.922000	0.55478	-1.901000	0.01597	-0.276000	0.09206	0.421000	0.28195	ACT	LCE1E	-	NULL		0.602	LCE1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE1E	HGNC	protein_coding	OTTHUMT00000034525.1	A	NM_178353		152759824	+1	no_errors	ENST00000368770	ensembl	human	known	70_37	missense	SNP	0.777	C
LGALS3BP	3959	genome.wustl.edu	37	17	76970878	76970878	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:76970878C>A	ENST00000262776.3	-	4	576	c.268G>T	c.(268-270)Gag>Tag	p.E90*	LGALS3BP_ENST00000591778.1_Nonsense_Mutation_p.E90*|LGALS3BP_ENST00000585407.1_Nonsense_Mutation_p.E90*	NM_005567.3	NP_005558.1	Q08380	LG3BP_HUMAN	lectin, galactoside-binding, soluble, 3 binding protein	90	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.				cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|central_nervous_system(5)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17			BRCA - Breast invasive adenocarcinoma(99;0.0677)|OV - Ovarian serous cystadenocarcinoma(97;0.139)			CACTGGACCTCATCCAGCATG	0.642																																					GBM(89;1105 1755 18102 21513)												0													68.0	55.0	59.0					17																	76970878		2203	4300	6503	SO:0001587	stop_gained	3959			L13210	CCDS11759.1	17q25	2014-07-09				ENSG00000108679		"""BTB/POZ domain containing"", ""Endogenous ligands"""	6564	protein-coding gene	gene with protein product	"""L3 antigen"", ""Mac-2-binding protein"", ""serum protein 90K"", ""transport and golgi organization 10 homolog B (Drosophila)"""	600626				7698018, 8034587, 8390986	Standard	NM_005567		Approved	MAC-2-BP, 90K, BTBD17B, TANGO10B, M2BP, gp90, CyCAP	uc002jwh.3	Q08380		ENST00000262776.3:c.268G>T	17.37:g.76970878C>A	ENSP00000262776:p.Glu90*		Q7M4S0|Q9UCH8|Q9UCH9|Q9UCI0	Nonsense_Mutation	SNP	pfam_Srcr_rcpt,pfam_BACK,superfamily_Srcr_rcpt-rel,superfamily_BTB/POZ_fold,smart_Srcr_rcpt-rel,smart_BACK,pfscan_BTB/POZ-like,pfscan_Srcr_rcpt,prints_Srcr_rcpt	p.E90*	ENST00000262776.3	37	c.268	CCDS11759.1	17	.	.	.	.	.	.	.	.	.	.	C	17.24	3.339552	0.60963	.	.	ENSG00000108679	ENST00000262776	.	.	.	3.22	2.24	0.28232	.	0.000000	0.34580	N	0.003859	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-22.0586	6.3972	0.21618	0.0:0.8626:0.0:0.1374	.	.	.	.	X	90	.	ENSP00000262776:E90X	E	-	1	0	LGALS3BP	74482473	0.032000	0.19561	0.429000	0.26710	0.151000	0.21798	0.875000	0.28079	0.918000	0.36919	0.313000	0.20887	GAG	LGALS3BP	-	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt,prints_Srcr_rcpt		0.642	LGALS3BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGALS3BP	HGNC	protein_coding	OTTHUMT00000437785.3	C	NM_005567		76970878	-1	no_errors	ENST00000262776	ensembl	human	known	70_37	nonsense	SNP	0.519	A
LGI4	163175	genome.wustl.edu	37	19	35625543	35625543	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:35625543C>T	ENST00000310123.3	-	1	561	c.42G>A	c.(40-42)gcG>gcA	p.A14A	LGI4_ENST00000493050.1_Intron|LGI4_ENST00000591633.1_Silent_p.A14A|LGI4_ENST00000392225.3_Silent_p.A14A	NM_139284.2	NP_644813.1	Q8N135	LGI4_HUMAN	leucine-rich repeat LGI family, member 4	14					adult locomotory behavior (GO:0008344)|glial cell proliferation (GO:0014009)|myelination in peripheral nervous system (GO:0022011)|neuron maturation (GO:0042551)	extracellular space (GO:0005615)				endometrium(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	all_lung(56;7.56e-09)|Lung NSC(56;1.1e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.54e-20)|OV - Ovarian serous cystadenocarcinoma(14;1.33e-18)|all cancers(14;4.27e-17)|LUSC - Lung squamous cell carcinoma(66;0.0849)			CCACCACCCCCGCCCCAGCCA	0.706																																																	0													15.0	19.0	17.0					19																	35625543		2183	4280	6463	SO:0001819	synonymous_variant	163175			AJ487519	CCDS12444.1	19q13.13	2008-07-03			ENSG00000153902	ENSG00000153902			18712	protein-coding gene	gene with protein product		608303				12023020	Standard	NM_139284		Approved		uc002nxx.2	Q8N135	OTTHUMG00000044558	ENST00000310123.3:c.42G>A	19.37:g.35625543C>T			B2RN53|B9EGS7|Q5M8T1	Silent	SNP	pfam_EPTP,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_EAR	p.A14	ENST00000310123.3	37	c.42	CCDS12444.1	19																																																																																			LGI4	-	NULL		0.706	LGI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGI4	HGNC	protein_coding	OTTHUMT00000103963.1	C			35625543	-1	no_errors	ENST00000310123	ensembl	human	known	70_37	silent	SNP	0.000	T
LIMK2	3985	genome.wustl.edu	37	22	31674413	31674413	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr22:31674413G>A	ENST00000331728.4	+	16	2017	c.1903G>A	c.(1903-1905)Gac>Aac	p.D635N	LIMK2_ENST00000333611.4_Missense_Mutation_p.D614N|LIMK2_ENST00000444929.2_Missense_Mutation_p.D389N|LIMK2_ENST00000467301.1_3'UTR	NM_005569.3	NP_005560.1	P53671	LIMK2_HUMAN	LIM domain kinase 2	635					phosphorylation (GO:0016310)|spermatogenesis (GO:0007283)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(4)|skin(1)	29						CCTGACCCGGGACTCACCTCC	0.672																																																	0													80.0	87.0	85.0					22																	31674413		2203	4300	6503	SO:0001583	missense	3985			D45906	CCDS13891.1, CCDS13892.1, CCDS33637.1	22q12	2005-01-21			ENSG00000182541	ENSG00000182541			6614	protein-coding gene	gene with protein product		601988				8537403, 10591208	Standard	NM_005569		Approved		uc003akh.3	P53671	OTTHUMG00000151251	ENST00000331728.4:c.1903G>A	22.37:g.31674413G>A	ENSP00000332687:p.Asp635Asn		A8K6H5|Q7KZ80|Q7L3H5|Q96E10|Q99464|Q9UFU0	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Znf_LIM,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_PDZ,smart_Znf_LIM,smart_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_LIM,pfscan_PDZ,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D635N	ENST00000331728.4	37	c.1903	CCDS13891.1	22	.	.	.	.	.	.	.	.	.	.	.	18.22	3.575780	0.65878	.	.	ENSG00000182541	ENST00000444929;ENST00000331728;ENST00000436394;ENST00000333611	T;T;T	0.74209	-0.82;-0.72;-0.78	5.37	4.35	0.52113	.	.	.	.	.	T	0.59891	0.2227	N	0.17474	0.49	0.44762	D	0.997767	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.09377	0.004;0.001;0.001	T	0.56208	-0.8017	9	0.49607	T	0.09	.	13.2054	0.59793	0.0769:0.0:0.9231:0.0	.	667;389;635	F5GY29;E7EUC1;P53671	.;.;LIMK2_HUMAN	N	389;635;667;614	ENSP00000409522:D389N;ENSP00000332687:D635N;ENSP00000330470:D614N	ENSP00000332687:D635N	D	+	1	0	LIMK2	30004413	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.110000	0.71535	1.255000	0.44051	0.563000	0.77884	GAC	LIMK2	-	NULL		0.672	LIMK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIMK2	HGNC	protein_coding	OTTHUMT00000321911.1	G	NM_016733		31674413	+1	no_errors	ENST00000331728	ensembl	human	known	70_37	missense	SNP	1.000	A
GPAA1P2	106481722	genome.wustl.edu	37	2	111144433	111144433	+	RNA	SNP	T	T	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:111144433T>C	ENST00000488671.1	-	0	1082				AC112229.4_ENST00000606848.1_RNA																							AGCTGCAGTATTAGGTAGATC	0.622																																																	0																																												100288570																															2.37:g.111144433T>C				RNA	SNP	-	NULL	ENST00000488671.1	37	NULL		2																																																																																			RP13-1039J1.2	-	-		0.622	RP13-1039J1.4-001	KNOWN	not_organism_supported|basic|readthrough_transcript	processed_transcript	LOC100288570	Clone_based_vega_gene	processed_transcript	OTTHUMT00000472131.1	T			111144433	-1	no_errors	ENST00000488671	ensembl	human	known	70_37	rna	SNP	0.998	C
LOC146880	146880	genome.wustl.edu	37	17	62746746	62746746	+	RNA	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:62746746C>G	ENST00000400873.3	-	0	2480					NR_026899.1																						GAGTTGCAGTCAGATACGGAG	0.557																																																	0																																												146880																															17.37:g.62746746C>G				RNA	SNP	-	NULL	ENST00000400873.3	37	NULL		17																																																																																			hsa-mir-6080	-	-		0.557	hsa-mir-6080.1-201	KNOWN	basic	processed_transcript	LOC146880	miRBase	processed_transcript		C			62746746	-1	no_errors	ENST00000400873	ensembl	human	known	70_37	rna	SNP	1.000	G
LINC01105	150622	genome.wustl.edu	37	2	6112096	6112096	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:6112096C>G	ENST00000391666.2	+	1	385	c.40C>G	c.(40-42)Ctc>Gtc	p.L14V	AC073479.1_ENST00000431188.1_RNA																							CCTAGGGAATCTCCATGCTGG	0.448																																																	0																																										SO:0001583	missense	400940																														ENST00000391666.2:c.40C>G	2.37:g.6112096C>G	ENSP00000475464:p.Leu14Val			RNA	SNP	-	NULL	ENST00000391666.2	37	NULL		2																																																																																			AC073479.1	-	-		0.448	FLJ30594-201	KNOWN	basic|appris_principal	protein_coding	LOC400940	Clone_based_vega_gene	protein_coding		C			6112096	+1	no_errors	ENST00000391666	ensembl	human	known	70_37	rna	SNP	0.000	G
LONRF1	91694	genome.wustl.edu	37	8	12594230	12594230	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr8:12594230G>T	ENST00000398246.3	-	6	1500	c.1431C>A	c.(1429-1431)ttC>ttA	p.F477L	LONRF1_ENST00000533751.1_Missense_Mutation_p.F120L|LONRF1_ENST00000530693.1_5'Flank	NM_152271.3	NP_689484.3	Q17RB8	LONF1_HUMAN	LON peptidase N-terminal domain and ring finger 1	477							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)	p.F477F(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)|upper_aerodigestive_tract(2)	19				READ - Rectum adenocarcinoma(644;0.236)		GAGAACACTCGAAATCTGAGA	0.313																																																	1	Substitution - coding silent(1)	large_intestine(1)											75.0	70.0	71.0					8																	12594230		1819	4071	5890	SO:0001583	missense	91694			AK074329	CCDS5987.2	8p23.1	2013-01-09			ENSG00000154359	ENSG00000154359		"""RING-type (C3HC4) zinc fingers"""	26302	protein-coding gene	gene with protein product						18253036	Standard	XM_005273685		Approved	FLJ23749, RNF191	uc003wwd.1	Q17RB8	OTTHUMG00000165475	ENST00000398246.3:c.1431C>A	8.37:g.12594230G>T	ENSP00000381298:p.Phe477Leu		B4DM29|B4DU84|Q8TEA0|Q9BSV1	Missense_Mutation	SNP	pfam_Pept_S16_N,pfam_Znf_C3HC4_RING-type,superfamily_PUA-like_domain,smart_TPR_repeat,smart_Znf_RING,smart_Pept_S16_N,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.F477L	ENST00000398246.3	37	c.1431	CCDS5987.2	8	.	.	.	.	.	.	.	.	.	.	G	9.142	1.014166	0.19277	.	.	ENSG00000154359	ENST00000398246;ENST00000533751;ENST00000524526	T;T;T	0.16196	2.36;2.36;2.36	4.98	2.53	0.30540	Zinc finger, RING/FYVE/PHD-type (1);	0.105811	0.64402	D	0.000009	T	0.07413	0.0187	N	0.01817	-0.705	0.80722	D	1	B;B	0.26577	0.126;0.153	B;B	0.36766	0.148;0.232	T	0.34254	-0.9836	10	0.18710	T	0.47	-21.4805	9.4726	0.38851	0.847:0.0:0.153:0.0	.	466;477	Q17RB8-2;Q17RB8	.;LONF1_HUMAN	L	477;120;80	ENSP00000381298:F477L;ENSP00000432130:F120L;ENSP00000433327:F80L	ENSP00000381298:F477L	F	-	3	2	LONRF1	12638601	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	1.111000	0.31159	0.407000	0.25591	-0.312000	0.09012	TTC	LONRF1	-	NULL		0.313	LONRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LONRF1	HGNC	protein_coding	OTTHUMT00000251693.2	G	NM_152271		12594230	-1	no_errors	ENST00000398246	ensembl	human	known	70_37	missense	SNP	1.000	T
PLPPR4	9890	genome.wustl.edu	37	1	99766487	99766487	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:99766487G>A	ENST00000370185.3	+	5	1254	c.757G>A	c.(757-759)Gca>Aca	p.A253T	LPPR4_ENST00000457765.1_Missense_Mutation_p.A253T|LPPR4_ENST00000370184.1_Missense_Mutation_p.A95T	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		253					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		TTCTCAACATGCAACCCTTGC	0.398																																																	0													310.0	281.0	291.0					1																	99766487		2203	4300	6503	SO:0001583	missense	9890																														ENST00000370185.3:c.757G>A	1.37:g.99766487G>A	ENSP00000359204:p.Ala253Thr		E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Missense_Mutation	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.A253T	ENST00000370185.3	37	c.757	CCDS757.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.388932	0.95988	.	.	ENSG00000117600	ENST00000370185;ENST00000457765;ENST00000263178;ENST00000370184	T;T;T	0.74947	-0.89;-0.89;-0.89	5.31	5.31	0.75309	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.81346	0.4803	L	0.49126	1.545	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.81953	-0.0697	10	0.62326	D	0.03	-25.8407	19.3304	0.94283	0.0:0.0:1.0:0.0	.	253;253	E7EPS1;Q7Z2D5	.;LPPR4_HUMAN	T	253;253;253;95	ENSP00000359204:A253T;ENSP00000394913:A253T;ENSP00000359203:A95T	ENSP00000263178:A253T	A	+	1	0	RP4-788L13.1	99539075	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	9.813000	0.99286	2.645000	0.89757	0.591000	0.81541	GCA	LPPR4	-	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase		0.398	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPPR4	Uniprot_genename	protein_coding	OTTHUMT00000029670.2	G			99766487	+1	no_errors	ENST00000370185	ensembl	human	known	70_37	missense	SNP	1.000	A
LRRC16A	55604	genome.wustl.edu	37	6	25452453	25452454	+	Intron	INS	-	-	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr6:25452453_25452454insT	ENST00000329474.6	+	8	982				LRRC16A_ENST00000377969.3_Intron	NM_001173977.1|NM_017640.5	NP_001167448.1|NP_060110.4	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A						actin filament organization (GO:0007015)|barbed-end actin filament uncapping (GO:0051638)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|lamellipodium assembly (GO:0030032)|negative regulation of barbed-end actin filament capping (GO:2000813)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of lamellipodium organization (GO:1902745)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|ruffle organization (GO:0031529)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|lamellipodium (GO:0030027)|nucleus (GO:0005634)	protein complex binding (GO:0032403)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	50						TTCTCAGGCAATTTTTTTTTTT	0.441																																																	0																																										SO:0001627	intron_variant	55604			AK000055	CCDS54973.1	6p22.1	2010-09-10	2008-02-12	2008-02-12	ENSG00000079691	ENSG00000079691			21581	protein-coding gene	gene with protein product	"""capping protein, Arp2/3, and Myosin-I Linker homolog 1 (Dictyostelium)"""	609593	"""leucine rich repeat containing 16"""	LRRC16		19846667	Standard	NM_017640		Approved	dJ501N12.1, FLJ20048, CARMIL, CARMIL1	uc011djw.2	Q5VZK9	OTTHUMG00000014393	ENST00000329474.6:c.614+1514->T	6.37:g.25452464_25452464dupT			B8X1J0|Q6ZUH5|Q6ZW07|Q9NXU7	RNA	INS	-	NULL	ENST00000329474.6	37	NULL	CCDS54973.1	6																																																																																			LRRC16A	-	-		0.441	LRRC16A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRC16A	HGNC	protein_coding	OTTHUMT00000040045.2	-	NM_017640		25452454	+1	no_errors	ENST00000461945	ensembl	human	known	70_37	rna	INS	0.000:0.000	T
LRRC24	441381	genome.wustl.edu	37	8	145747964	145747964	+	Silent	SNP	G	G	C	rs377306762		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr8:145747964G>C	ENST00000529415.2	-	5	1554	c.1437C>G	c.(1435-1437)ctC>ctG	p.L479L	LRRC24_ENST00000533758.1_Silent_p.L476L|LRRC14_ENST00000292524.1_3'UTR			Q50LG9	LRC24_HUMAN	leucine rich repeat containing 24	479						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(1)|lung(1)	5	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			CCTCGGCGAAGAGCGGCTTGG	0.701																																																	0													7.0	9.0	8.0					8																	145747964		2099	4150	6249	SO:0001819	synonymous_variant	441381			AB178281	CCDS34969.1	8q24.3	2013-01-11			ENSG00000254402	ENSG00000254402		"""Immunoglobulin superfamily / I-set domain containing"""	28947	protein-coding gene	gene with protein product						7584026	Standard	NM_001024678		Approved	LRRC14OS	uc003zdm.3	Q50LG9	OTTHUMG00000165180	ENST00000529415.2:c.1437C>G	8.37:g.145747964G>C				Silent	SNP	pfam_Ig_I-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L479	ENST00000529415.2	37	c.1437	CCDS34969.1	8																																																																																			LRRC24	-	NULL		0.701	LRRC24-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRRC24	HGNC	protein_coding	OTTHUMT00000382501.2	G	NM_001024678		145747964	-1	no_errors	ENST00000529415	ensembl	human	known	70_37	silent	SNP	0.474	C
LY86	9450	genome.wustl.edu	37	6	6649893	6649893	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr6:6649893G>A	ENST00000379953.2	+	5	740	c.388G>A	c.(388-390)Gaa>Aaa	p.E130K	LY86_ENST00000230568.4_Missense_Mutation_p.E130K			O95711	LY86_HUMAN	lymphocyte antigen 86	130					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)				large_intestine(2)|lung(6)	8	Ovarian(93;0.0377)					CAATAATCCTGAATTTACTAT	0.313																																																	0													91.0	88.0	89.0					6																	6649893		2203	4300	6503	SO:0001583	missense	9450			AF057178	CCDS4498.1	6p24.3	2010-07-08			ENSG00000112799	ENSG00000112799			16837	protein-coding gene	gene with protein product		605241				9763566	Standard	NM_004271		Approved	MD-1, dJ80N2.1	uc003mwy.1	O95711	OTTHUMG00000014190	ENST00000379953.2:c.388G>A	6.37:g.6649893G>A	ENSP00000369286:p.Glu130Lys		Q9UQC4	Missense_Mutation	SNP	pfam_MD-2_lipid-recog,superfamily_Ig_E-set,smart_MD-2_lipid-recog	p.E130K	ENST00000379953.2	37	c.388	CCDS4498.1	6	.	.	.	.	.	.	.	.	.	.	g	0.007	-1.934277	0.00488	.	.	ENSG00000112799	ENST00000379953;ENST00000230568	T;T	0.46451	0.87;0.87	4.93	3.01	0.34805	MD-2-related lipid-recognition (2);Immunoglobulin E-set (1);	0.857811	0.10143	N	0.710618	T	0.05914	0.0154	N	0.08118	0	0.09310	N	1	B	0.12630	0.006	B	0.12156	0.007	T	0.40478	-0.9561	10	0.06891	T	0.86	-7.8118	5.6577	0.17652	0.101:0.0:0.706:0.193	.	130	O95711	LY86_HUMAN	K	130	ENSP00000369286:E130K;ENSP00000230568:E130K	ENSP00000230568:E130K	E	+	1	0	LY86	6594892	0.007000	0.16637	0.180000	0.23079	0.112000	0.19704	1.214000	0.32419	1.205000	0.43262	0.645000	0.84053	GAA	LY86	-	pfam_MD-2_lipid-recog,superfamily_Ig_E-set,smart_MD-2_lipid-recog		0.313	LY86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LY86	HGNC	protein_coding	OTTHUMT00000039762.2	G			6649893	+1	no_errors	ENST00000230568	ensembl	human	known	70_37	missense	SNP	0.025	A
LYST	1130	genome.wustl.edu	37	1	235944211	235944211	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:235944211C>G	ENST00000389794.3	-	16	5342	c.5168G>C	c.(5167-5169)aGa>aCa	p.R1723T	LYST_ENST00000536965.1_3'UTR|LYST_ENST00000389793.2_Missense_Mutation_p.R1723T			Q99698	LYST_HUMAN	lysosomal trafficking regulator	1723					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			AAAAAGTTCTCTGATTTGTTC	0.284																																																	0													36.0	38.0	37.0					1																	235944211		2203	4300	6503	SO:0001583	missense	1130			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.5168G>C	1.37:g.235944211C>G	ENSP00000374444:p.Arg1723Thr		O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R1723T	ENST00000389794.3	37	c.5168	CCDS31062.1	1	.	.	.	.	.	.	.	.	.	.	C	16.77	3.215819	0.58452	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.61980	0.06;0.06	5.05	5.05	0.67936	.	0.258102	0.44483	D	0.000445	T	0.54334	0.1852	L	0.54323	1.7	0.80722	D	1	P	0.45348	0.856	B	0.41440	0.357	T	0.58008	-0.7712	10	0.49607	T	0.09	.	6.8928	0.24238	0.0:0.7811:0.0:0.2189	.	1723	Q99698	LYST_HUMAN	T	1723	ENSP00000374444:R1723T;ENSP00000374443:R1723T	ENSP00000374443:R1723T	R	-	2	0	LYST	234010834	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.808000	0.47963	2.506000	0.84524	0.467000	0.42956	AGA	LYST	-	superfamily_ARM-type_fold		0.284	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYST	HGNC	protein_coding	OTTHUMT00000097533.5	C			235944211	-1	no_errors	ENST00000389793	ensembl	human	known	70_37	missense	SNP	1.000	G
MAGEA4	4103	genome.wustl.edu	37	X	151093052	151093052	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chrX:151093052C>T	ENST00000360243.2	+	3	1183	c.916C>T	c.(916-918)Cgt>Tgt	p.R306C	MAGEA4_ENST00000370337.4_Missense_Mutation_p.R306C|MAGEA4_ENST00000370340.3_Missense_Mutation_p.R306C|MAGEA4_ENST00000370335.1_Missense_Mutation_p.R306C|MAGEA4_ENST00000393921.1_Missense_Mutation_p.R306C|MAGEA4_ENST00000393920.1_Missense_Mutation_p.R306C|MAGEA4_ENST00000276344.2_Missense_Mutation_p.R306C	NM_001011550.1	NP_001011550.1	P43358	MAGA4_HUMAN	melanoma antigen family A, 4	306	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(2)|central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)	27	Acute lymphoblastic leukemia(192;6.56e-05)					CCCATCCCTGCGTGAAGCAGC	0.582																																																	0													96.0	92.0	93.0					X																	151093052		2203	4300	6503	SO:0001583	missense	4103				CCDS14702.1	Xq28	2009-03-13			ENSG00000147381	ENSG00000147381			6802	protein-coding gene	gene with protein product	"""melanoma-associated antigen 4"", ""cancer/testis antigen family 1, member 4"""	300175		MAGE4		8575766	Standard	XM_005274677		Approved	MAGE4A, MAGE4B, MAGE-41, MAGE-X2, MGC21336, CT1.4	uc004ffa.3	P43358	OTTHUMG00000024174	ENST00000360243.2:c.916C>T	X.37:g.151093052C>T	ENSP00000353379:p.Arg306Cys		Q14798	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.R306C	ENST00000360243.2	37	c.916	CCDS14702.1	X	.	.	.	.	.	.	.	.	.	.	C	11.75	1.730633	0.30684	.	.	ENSG00000147381	ENST00000276344;ENST00000393921;ENST00000370337;ENST00000393920;ENST00000370340;ENST00000370335;ENST00000360243	T;T;T;T;T;T;T	0.01548	4.78;4.78;4.78;4.78;4.78;4.78;4.78	2.49	1.34	0.21922	.	0.561963	0.19945	N	0.102555	T	0.01061	0.0035	N	0.12182	0.205	0.09310	N	1	D	0.63880	0.993	B	0.42522	0.39	T	0.53251	-0.8465	9	.	.	.	.	3.4434	0.07472	0.0:0.2215:0.0:0.7785	.	306	P43358	MAGA4_HUMAN	C	306	ENSP00000276344:R306C;ENSP00000377498:R306C;ENSP00000359362:R306C;ENSP00000377497:R306C;ENSP00000359365:R306C;ENSP00000359360:R306C;ENSP00000353379:R306C	.	R	+	1	0	MAGEA4	150843708	0.044000	0.20184	0.000000	0.03702	0.007000	0.05969	0.734000	0.26101	0.286000	0.22352	0.292000	0.19580	CGT	MAGEA4	-	pfscan_MAGE		0.582	MAGEA4-010	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEA4	HGNC	protein_coding	OTTHUMT00000060898.1	C	NM_002362		151093052	+1	no_errors	ENST00000276344	ensembl	human	known	70_37	missense	SNP	0.000	T
MAN2B1	4125	genome.wustl.edu	37	19	12758053	12758053	+	Missense_Mutation	SNP	T	T	G	rs148080695	byFrequency	TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:12758053T>G	ENST00000456935.2	-	23	2957	c.2917A>C	c.(2917-2919)Aac>Cac	p.N973H	CTD-2192J16.22_ENST00000597692.1_Missense_Mutation_p.K159T|MAN2B1_ENST00000221363.4_Missense_Mutation_p.N972H	NM_000528.3|NM_001173498.1	NP_000519.2|NP_001166969.1	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	973					cellular protein modification process (GO:0006464)|mannose metabolic process (GO:0006013)|protein deglycosylation (GO:0006517)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						CCACCTGTGTTTGTTGTCCAC	0.647																																																	0													75.0	77.0	76.0					19																	12758053		2203	4300	6503	SO:0001583	missense	4125				CCDS32919.1, CCDS54224.1	19p13.2	2013-09-20			ENSG00000104774	ENSG00000104774	3.2.1.24		6826	protein-coding gene	gene with protein product		609458		MANB			Standard	NM_000528		Approved	LAMAN	uc002mub.2	O00754	OTTHUMG00000156397	ENST00000456935.2:c.2917A>C	19.37:g.12758053T>G	ENSP00000395473:p.Asn973His		G5E928|O15330|Q16680|Q93094|Q9BW13	Missense_Mutation	SNP	pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_core,pfam_Glyco_hydro_38_cen_dom,superfamily_Glyco_hydro-type_carb-bd,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.N973H	ENST00000456935.2	37	c.2917	CCDS32919.1	19	.	.	.	.	.	.	.	.	.	.	T	10.64	1.406543	0.25378	.	.	ENSG00000104774	ENST00000456935;ENST00000536796;ENST00000221363	D;D	0.81739	-1.53;-1.53	5.75	-4.52	0.03472	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	1.465370	0.04220	N	0.333346	T	0.67449	0.2894	N	0.24115	0.695	0.09310	N	1	B;B	0.12013	0.004;0.005	B;B	0.14578	0.007;0.011	T	0.54476	-0.8288	10	0.44086	T	0.13	-8.1837	9.013	0.36153	0.0:0.5257:0.1291:0.3453	.	972;973	G5E928;O00754	.;MA2B1_HUMAN	H	973;912;972	ENSP00000395473:N973H;ENSP00000221363:N972H	ENSP00000221363:N972H	N	-	1	0	MAN2B1	12619053	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.120000	0.03273	-0.949000	0.03663	-0.250000	0.11733	AAC	MAN2B1	-	pfam_Glyco_hydro_38_C,superfamily_Glyco_hydro-type_carb-bd		0.647	MAN2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAN2B1	HGNC	protein_coding	OTTHUMT00000344062.1	T			12758053	-1	no_errors	ENST00000456935	ensembl	human	known	70_37	missense	SNP	0.000	G
MAN2B1	4125	genome.wustl.edu	37	19	12758083	12758083	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:12758083C>T	ENST00000456935.2	-	23	2927	c.2887G>A	c.(2887-2889)Gag>Aag	p.E963K	CTD-2192J16.22_ENST00000597692.1_Missense_Mutation_p.R149Q|MAN2B1_ENST00000221363.4_Missense_Mutation_p.E962K	NM_000528.3|NM_001173498.1	NP_000519.2|NP_001166969.1	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	963					cellular protein modification process (GO:0006464)|mannose metabolic process (GO:0006013)|protein deglycosylation (GO:0006517)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						GAGGCTGCCTCGCGGAGCTGG	0.657																																																	0													76.0	77.0	77.0					19																	12758083		2203	4300	6503	SO:0001583	missense	4125				CCDS32919.1, CCDS54224.1	19p13.2	2013-09-20			ENSG00000104774	ENSG00000104774	3.2.1.24		6826	protein-coding gene	gene with protein product		609458		MANB			Standard	NM_000528		Approved	LAMAN	uc002mub.2	O00754	OTTHUMG00000156397	ENST00000456935.2:c.2887G>A	19.37:g.12758083C>T	ENSP00000395473:p.Glu963Lys		G5E928|O15330|Q16680|Q93094|Q9BW13	Missense_Mutation	SNP	pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_core,pfam_Glyco_hydro_38_cen_dom,superfamily_Glyco_hydro-type_carb-bd,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.E963K	ENST00000456935.2	37	c.2887	CCDS32919.1	19	.	.	.	.	.	.	.	.	.	.	C	10.67	1.414776	0.25465	.	.	ENSG00000104774	ENST00000456935;ENST00000536796;ENST00000221363	D;D	0.83335	-1.71;-1.71	5.84	-2.67	0.06059	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	1.567730	0.03921	N	0.283564	T	0.65026	0.2652	N	0.14661	0.345	0.09310	N	1	B;B	0.16166	0.007;0.016	B;B	0.14023	0.006;0.01	T	0.51317	-0.8721	10	0.13108	T	0.6	-6.1568	4.6096	0.12395	0.3917:0.3704:0.0:0.238	.	962;963	G5E928;O00754	.;MA2B1_HUMAN	K	963;902;962	ENSP00000395473:E963K;ENSP00000221363:E962K	ENSP00000221363:E962K	E	-	1	0	MAN2B1	12619083	0.002000	0.14202	0.000000	0.03702	0.040000	0.13550	0.235000	0.17948	-0.140000	0.11394	0.561000	0.74099	GAG	MAN2B1	-	pfam_Glyco_hydro_38_C,superfamily_Glyco_hydro-type_carb-bd		0.657	MAN2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAN2B1	HGNC	protein_coding	OTTHUMT00000344062.1	C			12758083	-1	no_errors	ENST00000456935	ensembl	human	known	70_37	missense	SNP	0.000	T
MAP1A	4130	genome.wustl.edu	37	15	43813757	43813757	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr15:43813757C>T	ENST00000300231.5	+	4	536	c.86C>T	c.(85-87)tCa>tTa	p.S29L	MAP1A_ENST00000399453.1_Missense_Mutation_p.S29L|MAP1A_ENST00000382031.1_Missense_Mutation_p.S267L			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	29					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	CCCCCCACCTCAGGGGGCTTC	0.577																																																	0													72.0	75.0	74.0					15																	43813757		2116	4237	6353	SO:0001583	missense	4130			U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.86C>T	15.37:g.43813757C>T	ENSP00000300231:p.Ser29Leu		O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	NULL	p.S29L	ENST00000300231.5	37	c.86	CCDS42031.1	15	.	.	.	.	.	.	.	.	.	.	C	17.42	3.384577	0.61845	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231;ENST00000442025	T;T;T	0.03889	3.77;3.77;3.77	4.92	4.92	0.64577	.	.	.	.	.	T	0.24812	0.0602	M	0.81682	2.555	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00819	-1.1553	9	0.87932	D	0	-11.1838	18.6574	0.91459	0.0:1.0:0.0:0.0	.	29	P78559	MAP1A_HUMAN	L	267;29;29;29	ENSP00000371462:S267L;ENSP00000382380:S29L;ENSP00000300231:S29L	ENSP00000300231:S29L	S	+	2	0	MAP1A	41601049	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.609000	0.82925	2.720000	0.93068	0.561000	0.74099	TCA	MAP1A	-	NULL		0.577	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP1A	HGNC	protein_coding	OTTHUMT00000132894.5	C	NM_002373		43813757	+1	no_errors	ENST00000399453	ensembl	human	known	70_37	missense	SNP	1.000	T
MAP1A	4130	genome.wustl.edu	37	15	43815050	43815050	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr15:43815050C>G	ENST00000300231.5	+	4	1829	c.1379C>G	c.(1378-1380)tCc>tGc	p.S460C	MAP1A_ENST00000399453.1_Missense_Mutation_p.S460C|MAP1A_ENST00000382031.1_Missense_Mutation_p.S698C			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	460	9 X 3 AA repeats of K-K-[DE].|Lys-rich (basic).				microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	AAGAAGATTTCCAAGCCAGAC	0.478																																																	0													39.0	38.0	38.0					15																	43815050		1922	4126	6048	SO:0001583	missense	4130			U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.1379C>G	15.37:g.43815050C>G	ENSP00000300231:p.Ser460Cys		O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	NULL	p.S460C	ENST00000300231.5	37	c.1379	CCDS42031.1	15	.	.	.	.	.	.	.	.	.	.	C	11.08	1.532415	0.27387	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231;ENST00000442025	T;T;T	0.01584	4.76;4.75;4.75	5.5	4.58	0.56647	.	0.000000	0.33610	N	0.004728	T	0.03348	0.0097	M	0.73962	2.25	0.34843	D	0.740859	P	0.42941	0.794	B	0.39027	0.288	T	0.33292	-0.9874	10	0.56958	D	0.05	-6.9202	10.0614	0.42277	0.0:0.7905:0.1386:0.0709	.	460	P78559	MAP1A_HUMAN	C	698;460;460;460	ENSP00000371462:S698C;ENSP00000382380:S460C;ENSP00000300231:S460C	ENSP00000300231:S460C	S	+	2	0	MAP1A	41602342	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.931000	0.70113	1.563000	0.49615	0.650000	0.86243	TCC	MAP1A	-	NULL		0.478	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP1A	HGNC	protein_coding	OTTHUMT00000132894.5	C	NM_002373		43815050	+1	no_errors	ENST00000399453	ensembl	human	known	70_37	missense	SNP	0.971	G
MAP1A	4130	genome.wustl.edu	37	15	43815251	43815251	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr15:43815251C>T	ENST00000300231.5	+	4	2030	c.1580C>T	c.(1579-1581)tCa>tTa	p.S527L	MAP1A_ENST00000399453.1_Missense_Mutation_p.S527L|MAP1A_ENST00000382031.1_Missense_Mutation_p.S765L			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	527	9 X 3 AA repeats of K-K-[DE].				microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	GTCCTATCCTCACCAGAGGAC	0.572																																																	0																																										SO:0001583	missense	4130			U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.1580C>T	15.37:g.43815251C>T	ENSP00000300231:p.Ser527Leu		O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	NULL	p.S527L	ENST00000300231.5	37	c.1580	CCDS42031.1	15	.	.	.	.	.	.	.	.	.	.	C	16.87	3.243333	0.58995	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231;ENST00000442025	T;T;T	0.49139	0.79;0.79;0.79	5.39	5.39	0.77823	.	0.000000	0.27406	N	0.019519	T	0.71517	0.3349	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73764	-0.3880	10	0.72032	D	0.01	-12.9988	19.3562	0.94414	0.0:1.0:0.0:0.0	.	527	P78559	MAP1A_HUMAN	L	765;527;527;527	ENSP00000371462:S765L;ENSP00000382380:S527L;ENSP00000300231:S527L	ENSP00000300231:S527L	S	+	2	0	MAP1A	41602543	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.869000	0.69613	2.804000	0.96469	0.655000	0.94253	TCA	MAP1A	-	NULL		0.572	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP1A	HGNC	protein_coding	OTTHUMT00000132894.5	C	NM_002373		43815251	+1	no_errors	ENST00000399453	ensembl	human	known	70_37	missense	SNP	1.000	T
MAPK15	225689	genome.wustl.edu	37	8	144802739	144802739	+	Intron	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr8:144802739C>T	ENST00000338033.4	+	9	898				RP11-429J17.5_ENST00000527908.1_RNA|MAPK15_ENST00000395108.2_Missense_Mutation_p.S248L	NM_139021.2	NP_620590.2	Q8TD08	MK15_HUMAN	mitogen-activated protein kinase 15						MAPK cascade (GO:0000165)|negative regulation of DNA replication (GO:0008156)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|response to estradiol (GO:0032355)	extracellular region (GO:0005576)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|SH3 domain binding (GO:0017124)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|stomach(1)	12	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GCCTGCAGGTCAGGCACAGGG	0.672																																																	0													3.0	3.0	3.0					8																	144802739		812	1889	2701	SO:0001627	intron_variant	225689			AY065978	CCDS6409.2	8q24.3	2011-06-09			ENSG00000181085	ENSG00000181085		"""Mitogen-activated protein kinase cascade / Kinases"""	24667	protein-coding gene	gene with protein product	"""extracellular signal regulated kinase 8"""					11875070	Standard	XM_006716528		Approved	ERK8, ERK7	uc003yzj.3	Q8TD08	OTTHUMG00000146450	ENST00000338033.4:c.780-134C>T	8.37:g.144802739C>T			Q2TCF9|Q8N362	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S248L	ENST00000338033.4	37	c.743	CCDS6409.2	8	.	.	.	.	.	.	.	.	.	.	c	13.04	2.119100	0.37436	.	.	ENSG00000181085	ENST00000395108	T	0.73469	-0.75	2.51	-5.03	0.02973	.	.	.	.	.	T	0.66858	0.2832	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.63296	-0.6669	6	0.87932	D	0	.	5.9505	0.19245	0.2833:0.4538:0.2628:0.0	.	.	.	.	L	248	ENSP00000378540:S248L	ENSP00000378540:S248L	S	+	2	0	MAPK15	144874727	0.000000	0.05858	0.000000	0.03702	0.206000	0.24218	-0.904000	0.04080	-1.704000	0.01407	0.460000	0.39030	TCA	MAPK15	-	smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.672	MAPK15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK15	HGNC	protein_coding	OTTHUMT00000300348.1	C	NM_139021		144802739	+1	no_errors	ENST00000395108	ensembl	human	known	70_37	missense	SNP	0.000	T
MAPK15	225689	genome.wustl.edu	37	8	144803953	144803953	+	Missense_Mutation	SNP	C	C	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr8:144803953C>A	ENST00000338033.4	+	13	1480	c.1361C>A	c.(1360-1362)tCc>tAc	p.S454Y	RP11-429J17.5_ENST00000527908.1_RNA	NM_139021.2	NP_620590.2	Q8TD08	MK15_HUMAN	mitogen-activated protein kinase 15	454					MAPK cascade (GO:0000165)|negative regulation of DNA replication (GO:0008156)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|response to estradiol (GO:0032355)	extracellular region (GO:0005576)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|SH3 domain binding (GO:0017124)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|stomach(1)	12	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GCTGCGCCCTCCCTGACCTCC	0.687																																																	0													40.0	50.0	47.0					8																	144803953		2009	4147	6156	SO:0001583	missense	225689			AY065978	CCDS6409.2	8q24.3	2011-06-09			ENSG00000181085	ENSG00000181085		"""Mitogen-activated protein kinase cascade / Kinases"""	24667	protein-coding gene	gene with protein product	"""extracellular signal regulated kinase 8"""					11875070	Standard	XM_006716528		Approved	ERK8, ERK7	uc003yzj.3	Q8TD08	OTTHUMG00000146450	ENST00000338033.4:c.1361C>A	8.37:g.144803953C>A	ENSP00000337691:p.Ser454Tyr		Q2TCF9|Q8N362	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S454Y	ENST00000338033.4	37	c.1361	CCDS6409.2	8	.	.	.	.	.	.	.	.	.	.	c	13.89	2.373449	0.42105	.	.	ENSG00000181085	ENST00000338033	T	0.75260	-0.92	3.23	3.23	0.37069	.	0.063724	0.64402	U	0.000004	T	0.76198	0.3954	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.68192	0.956	T	0.73855	-0.3851	10	0.32370	T	0.25	.	11.9211	0.52793	0.0:1.0:0.0:0.0	.	454	Q8TD08	MK15_HUMAN	Y	454	ENSP00000337691:S454Y	ENSP00000337691:S454Y	S	+	2	0	MAPK15	144875941	0.046000	0.20272	0.445000	0.26908	0.037000	0.13140	3.732000	0.55021	1.634000	0.50500	0.306000	0.20318	TCC	MAPK15	-	NULL		0.687	MAPK15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK15	HGNC	protein_coding	OTTHUMT00000300348.1	C	NM_139021		144803953	+1	no_errors	ENST00000338033	ensembl	human	known	70_37	missense	SNP	0.902	A
MAPKAPK2	9261	genome.wustl.edu	37	1	206904053	206904053	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:206904053G>A	ENST00000367103.3	+	6	905	c.712G>A	c.(712-714)Gag>Aag	p.E238K	MAPKAPK2_ENST00000294981.4_Missense_Mutation_p.E238K	NM_004759.4|NM_032960.3	NP_004750.1|NP_116584.2	P49137	MAPK2_HUMAN	mitogen-activated protein kinase-activated protein kinase 2	238	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|activation of MAPK activity (GO:0000187)|arachidonic acid metabolic process (GO:0019369)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|G2 DNA damage checkpoint (GO:0031572)|gene expression (GO:0010467)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|leukotriene metabolic process (GO:0006691)|macropinocytosis (GO:0044351)|MAPK cascade (GO:0000165)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of interleukin-6 production (GO:0032675)|regulation of tumor necrosis factor production (GO:0032680)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	19	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			GCTGGGTCCAGAGAAGTATGA	0.572																																																	0													134.0	123.0	127.0					1																	206904053		2203	4300	6503	SO:0001583	missense	9261			U12779	CCDS1466.1, CCDS31001.1	1q32	2008-02-05			ENSG00000162889	ENSG00000162889			6887	protein-coding gene	gene with protein product		602006				8179591, 8280084	Standard	NM_004759		Approved		uc001hem.2	P49137	OTTHUMG00000036342	ENST00000367103.3:c.712G>A	1.37:g.206904053G>A	ENSP00000356070:p.Glu238Lys		Q5SY30|Q5SY41|Q8IYD6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E238K	ENST00000367103.3	37	c.712	CCDS31001.1	1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.969648	0.92855	.	.	ENSG00000162889	ENST00000294981;ENST00000367103	T;T	0.64618	-0.11;-0.11	5.83	4.91	0.64330	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.60405	0.2266	N	0.10760	0.04	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.91635	0.961;0.999	T	0.59873	-0.7372	9	0.16896	T	0.51	-30.719	15.6615	0.77190	0.0:0.1376:0.8624:0.0	.	238;238	P49137;P49137-2	MAPK2_HUMAN;.	K	238	ENSP00000294981:E238K;ENSP00000356070:E238K	ENSP00000294981:E238K	E	+	1	0	MAPKAPK2	204970676	1.000000	0.71417	0.996000	0.52242	0.968000	0.65278	9.777000	0.99008	1.450000	0.47717	0.655000	0.94253	GAG	MAPKAPK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.572	MAPKAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPKAPK2	HGNC	protein_coding	OTTHUMT00000088465.1	G	NM_004759		206904053	+1	no_errors	ENST00000367103	ensembl	human	known	70_37	missense	SNP	1.000	A
MAPT	4137	genome.wustl.edu	37	17	44068843	44068843	+	Silent	SNP	G	G	A	rs139748238		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:44068843G>A	ENST00000571987.1	+	8	1398	c.1398G>A	c.(1396-1398)acG>acA	p.T466T	MAPT_ENST00000535772.1_Silent_p.T149T|MAPT_ENST00000347967.5_Silent_p.T55T|MAPT_ENST00000420682.2_Silent_p.T120T|MAPT_ENST00000576518.1_Silent_p.T80T|MAPT_ENST00000446361.3_Silent_p.T91T|MAPT_ENST00000570299.1_3'UTR|MAPT_ENST00000344290.5_Silent_p.T466T|MAPT_ENST00000574436.1_Silent_p.T149T|MAPT_ENST00000431008.3_Silent_p.T149T|MAPT_ENST00000334239.8_Silent_p.T91T|MAPT_ENST00000351559.5_Silent_p.T149T|MAPT_ENST00000415613.2_Silent_p.T466T|MAPT_ENST00000262410.5_Silent_p.T466T|MAPT_ENST00000340799.5_Silent_p.T120T			P10636	TAU_HUMAN	microtubule-associated protein tau	466					adult walking behavior (GO:0007628)|apoptotic process (GO:0006915)|axon cargo transport (GO:0008088)|axon extension (GO:0048675)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|generation of neurons (GO:0048699)|microtubule cytoskeleton organization (GO:0000226)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of microtubule polymerization (GO:0031116)|regulation of autophagy (GO:0010506)|regulation of microtubule polymerization (GO:0031113)|regulation of microtubule-based movement (GO:0060632)	axon (GO:0030424)|axoneme (GO:0005930)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|growth cone (GO:0030426)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nuclear periphery (GO:0034399)|plasma membrane (GO:0005886)|tubulin complex (GO:0045298)	apolipoprotein binding (GO:0034185)|enzyme binding (GO:0019899)|lipoprotein particle binding (GO:0071813)|microtubule binding (GO:0008017)|SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		Melanoma(429;0.216)			Docetaxel(DB01248)|Paclitaxel(DB01229)	ATGGTAAAACGAAGATCGCCA	0.577																																																	0								G	,,,,,,,	0,4406		0,0,2203	103.0	116.0	112.0		1398,360,360,447,447,273,1398,273	-3.9	1.0	17	dbSNP_134	112	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	MAPT	NM_001123066.3,NM_001123067.3,NM_001203251.1,NM_001203252.1,NM_005910.5,NM_016834.4,NM_016835.4,NM_016841.4	,,,,,,,	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	,,,,,,,	466/777,120/413,120/382,149/411,149/442,91/384,466/759,91/353	44068843	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	4137			J03778	CCDS11499.1, CCDS11500.1, CCDS11501.1, CCDS11502.1, CCDS45715.1, CCDS45716.1, CCDS56033.1	17q21	2014-09-17			ENSG00000186868	ENSG00000186868			6893	protein-coding gene	gene with protein product	"""G protein beta1/gamma2 subunit-interacting factor 1"", ""microtubule-associated protein tau, isoform 4"", ""protein phosphatase 1, regulatory subunit 103"""	157140		DDPAC, MAPTL		7936241, 3131773	Standard	NM_001123067		Approved	MTBT1, tau, PPND, FTDP-17, TAU, MSTD, MTBT2, FLJ31424, MGC138549, PPP1R103	uc010dau.3	P10636	OTTHUMG00000168833	ENST00000571987.1:c.1398G>A	17.37:g.44068843G>A			P18518|Q14799|Q15549|Q15550|Q15551|Q1RMF6|Q53YB1|Q5CZI7|Q5XWF0|Q6QT54|Q9UDJ3|Q9UMH0|Q9UQ96	Silent	SNP	pfam_Tau/MAP_tubulin-bd_rpt,prints_Tau_protein	p.T466	ENST00000571987.1	37	c.1398	CCDS11501.1	17																																																																																			MAPT	-	NULL		0.577	MAPT-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	MAPT	HGNC	protein_coding	OTTHUMT00000440133.1	G	NM_016835		44068843	+1	no_errors	ENST00000344290	ensembl	human	known	70_37	silent	SNP	0.736	A
MAS1	4142	genome.wustl.edu	37	6	160328744	160328744	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr6:160328744G>A	ENST00000252660.4	+	1	771	c.757G>A	c.(757-759)Gag>Aag	p.E253K		NM_002377.2	NP_002368.1	P04201	MAS_HUMAN	MAS1 proto-oncogene, G protein-coupled receptor	253					activation of NF-kappaB-inducing kinase activity (GO:0007250)|anatomical structure morphogenesis (GO:0009653)|cell proliferation (GO:0008283)|cellular response to peptide hormone stimulus (GO:0071375)|G-protein coupled receptor signaling pathway (GO:0007186)|hippocampus development (GO:0021766)|male gonad development (GO:0008584)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of inositol phosphate biosynthetic process (GO:0060732)|protein kinase C signaling (GO:0070528)|regulation of inflammatory response (GO:0050727)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	angiotensin receptor activity (GO:0001595)|angiotensin type II receptor activity (GO:0004945)|G-protein coupled receptor activity (GO:0004930)|peptide binding (GO:0042277)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	23		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.44e-18)|BRCA - Breast invasive adenocarcinoma(81;5.6e-06)		GCTGTACTATGAGTATTGGTC	0.458																																																	0													131.0	122.0	125.0					6																	160328744		2203	4300	6503	SO:0001583	missense	4142			M13150	CCDS5272.1	6q24-q27	2014-06-26	2014-06-26		ENSG00000130368	ENSG00000130368		"""GPCR / Class A : Orphans"""	6899	protein-coding gene	gene with protein product		165180	"""MAS1 oncogene"""				Standard	NM_002377		Approved		uc003qsz.3	P04201	OTTHUMG00000015944	ENST00000252660.4:c.757G>A	6.37:g.160328744G>A	ENSP00000252660:p.Glu253Lys		E1P5B3|Q2TBC9|Q6FG47	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Proto-oncogene_Mas,prints_GPCR_Rhodpsn	p.E253K	ENST00000252660.4	37	c.757	CCDS5272.1	6	.	.	.	.	.	.	.	.	.	.	G	11.15	1.553587	0.27739	.	.	ENSG00000130368	ENST00000252660	T	0.36878	1.23	5.2	4.27	0.50696	GPCR, rhodopsin-like superfamily (1);	0.272836	0.26103	N	0.026338	T	0.12347	0.0300	N	0.22421	0.69	0.37751	D	0.925977	B	0.18968	0.032	B	0.20955	0.032	T	0.04976	-1.0914	10	0.28530	T	0.3	.	11.5879	0.50929	0.0:0.2755:0.7245:0.0	.	253	P04201	MAS_HUMAN	K	253	ENSP00000252660:E253K	ENSP00000252660:E253K	E	+	1	0	MAS1	160248734	0.873000	0.30073	0.986000	0.45419	0.648000	0.38561	1.522000	0.35921	2.407000	0.81776	0.655000	0.94253	GAG	MAS1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Proto-oncogene_Mas		0.458	MAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAS1	HGNC	protein_coding	OTTHUMT00000042930.2	G	NM_002377		160328744	+1	no_errors	ENST00000252660	ensembl	human	known	70_37	missense	SNP	1.000	A
MB21D2	151963	genome.wustl.edu	37	3	192517146	192517146	+	Missense_Mutation	SNP	C	C	G	rs368937752		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr3:192517146C>G	ENST00000392452.2	-	2	825	c.505G>C	c.(505-507)Gat>Cat	p.D169H		NM_178496.3	NP_848591.2	Q8IYB1	M21D2_HUMAN	Mab-21 domain containing 2	169							protein complex binding (GO:0032403)			endometrium(3)|kidney(1)|large_intestine(4)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	31						TTGATGTGATCTACAATGGTG	0.473																																																	0													89.0	89.0	89.0					3																	192517146		2203	4300	6503	SO:0001583	missense	151963			AK056276	CCDS3302.2	3q28-q29	2011-02-23	2011-02-23	2011-02-23	ENSG00000180611	ENSG00000180611			30438	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 59"""	C3orf59		12477932	Standard	NM_178496		Approved		uc011bsp.2	Q8IYB1	OTTHUMG00000155768	ENST00000392452.2:c.505G>C	3.37:g.192517146C>G	ENSP00000376246:p.Asp169His		Q86VD8	Missense_Mutation	SNP	pfam_Mab-21_dom	p.D169H	ENST00000392452.2	37	c.505	CCDS3302.2	3	.	.	.	.	.	.	.	.	.	.	C	19.83	3.900650	0.72754	.	.	ENSG00000180611	ENST00000392452	T	0.50813	0.73	5.63	5.63	0.86233	.	0.046649	0.85682	D	0.000000	T	0.60715	0.2290	L	0.44542	1.39	0.80722	D	1	D	0.56746	0.977	P	0.61477	0.889	T	0.60596	-0.7232	10	0.59425	D	0.04	.	18.6978	0.91607	0.0:1.0:0.0:0.0	.	169	Q8IYB1	M21D2_HUMAN	H	169	ENSP00000376246:D169H	ENSP00000376246:D169H	D	-	1	0	MB21D2	193999840	1.000000	0.71417	0.867000	0.34043	0.962000	0.63368	7.818000	0.86416	2.652000	0.90054	0.655000	0.94253	GAT	MB21D2	-	NULL		0.473	MB21D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MB21D2	HGNC	protein_coding	OTTHUMT00000341543.1	C	NM_178496		192517146	-1	no_errors	ENST00000392452	ensembl	human	known	70_37	missense	SNP	1.000	G
MED12	9968	genome.wustl.edu	37	X	70341568	70341568	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chrX:70341568C>T	ENST00000374080.3	+	7	1035	c.1003C>T	c.(1003-1005)Cag>Tag	p.Q335*	MED12_ENST00000333646.6_Nonsense_Mutation_p.Q335*|MED12_ENST00000374102.1_Nonsense_Mutation_p.Q335*			Q93074	MED12_HUMAN	mediator complex subunit 12	335					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					CCCTGCTCCTCAGCCCCCAAC	0.567			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																																	Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	0													92.0	98.0	96.0					X																	70341568		2134	4222	6356	SO:0001587	stop_gained	9968			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.1003C>T	X.37:g.70341568C>T	ENSP00000363193:p.Gln335*		O15410|O75557|Q9UHV6|Q9UND7	Nonsense_Mutation	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12_catenin-bd,pfam_Mediator_Med12	p.Q335*	ENST00000374080.3	37	c.1003	CCDS43970.1	X	.	.	.	.	.	.	.	.	.	.	.	38	6.997639	0.97990	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	-15.7917	18.7005	0.91618	0.0:1.0:0.0:0.0	.	.	.	.	X	335;335;335;335;303	.	ENSP00000333125:Q335X	Q	+	1	0	MED12	70258293	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	5.399000	0.66314	2.615000	0.88500	0.597000	0.82753	CAG	MED12	-	pfam_Mediator_Med12_LCEWAV		0.567	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	HGNC	protein_coding	OTTHUMT00000057105.1	C	NM_005120		70341568	+1	no_errors	ENST00000333646	ensembl	human	known	70_37	nonsense	SNP	1.000	T
MEF2D	4209	genome.wustl.edu	37	1	156444993	156444993	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:156444993G>A	ENST00000348159.4	-	9	1393	c.913C>T	c.(913-915)Cat>Tat	p.H305Y	MEF2D_ENST00000360595.3_Missense_Mutation_p.H298Y|MEF2D_ENST00000368240.2_Missense_Mutation_p.H298Y|MEF2D_ENST00000353795.3_Missense_Mutation_p.H259Y|MEF2D_ENST00000340875.5_Missense_Mutation_p.H304Y|MEF2D_ENST00000464356.2_Missense_Mutation_p.H297Y	NM_005920.2	NP_005911.1	Q14814	MEF2D_HUMAN	myocyte enhancer factor 2D	305					adult heart development (GO:0007512)|apoptotic process (GO:0006915)|chondrocyte differentiation (GO:0002062)|endochondral ossification (GO:0001958)|muscle organ development (GO:0007517)|nervous system development (GO:0007399)|osteoblast differentiation (GO:0001649)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|histone deacetylase binding (GO:0042826)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	15	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GTGAGCGAATGAGTAGACTGG	0.577																																																	0													88.0	79.0	82.0					1																	156444993		2203	4300	6503	SO:0001583	missense	4209			BC054520	CCDS1143.1, CCDS60304.1	1q12-q23	2008-02-05	2007-04-24		ENSG00000116604	ENSG00000116604		"""Myocyte enhancer factors"""	6997	protein-coding gene	gene with protein product		600663				8269842	Standard	NM_005920		Approved		uc001fpb.4	Q14814	OTTHUMG00000033095	ENST00000348159.4:c.913C>T	1.37:g.156444993G>A	ENSP00000271555:p.His305Tyr		D3DVC0|Q14815|Q5T9U5|Q5T9U6	Missense_Mutation	SNP	pfam_TF_MADSbox,pfam_HJURP_C,superfamily_TF_MADSbox,smart_TF_MADSbox,pfscan_TF_MADSbox,prints_TF_MADSbox	p.H305Y	ENST00000348159.4	37	c.913	CCDS1143.1	1	.	.	.	.	.	.	.	.	.	.	G	31	5.062193	0.93846	.	.	ENSG00000116604	ENST00000348159;ENST00000340875;ENST00000368240;ENST00000353795;ENST00000360595;ENST00000454816	T;T;T;T;T;T	0.25085	1.82;1.82;1.82;1.82;1.82;1.82	5.43	5.43	0.79202	.	0.052229	0.85682	D	0.000000	T	0.24736	0.0600	L	0.44542	1.39	0.50813	D	0.999899	P;P;P	0.51653	0.947;0.825;0.871	P;B;P	0.49387	0.521;0.296;0.609	T	0.01096	-1.1453	10	0.87932	D	0	-24.6702	17.9827	0.89146	0.0:0.0:1.0:0.0	.	310;305;298	Q4LE66;Q14814;Q14814-4	.;MEF2D_HUMAN;.	Y	305;304;298;259;298;297	ENSP00000271555:H305Y;ENSP00000343159:H304Y;ENSP00000357223:H298Y;ENSP00000344705:H259Y;ENSP00000353803:H298Y;ENSP00000388505:H297Y	ENSP00000343159:H304Y	H	-	1	0	MEF2D	154711617	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.916000	0.92745	2.833000	0.97629	0.655000	0.94253	CAT	MEF2D	-	NULL		0.577	MEF2D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MEF2D	HGNC	protein_coding	OTTHUMT00000080562.2	G	NM_005920		156444993	-1	no_errors	ENST00000348159	ensembl	human	known	70_37	missense	SNP	1.000	A
MEX3D	399664	genome.wustl.edu	37	19	1556729	1556729	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:1556729G>A	ENST00000402693.4	-	2	788	c.789C>T	c.(787-789)gcC>gcT	p.A263A	AC027307.2_ENST00000581992.1_RNA|AC027307.1_ENST00000410788.1_RNA|MEX3D_ENST00000388824.6_Silent_p.A263A	NM_203304.3	NP_976049.3	Q86XN8	MEX3D_HUMAN	mex-3 RNA binding family member D	263					mRNA destabilization (GO:0061157)|mRNA localization resulting in posttranscriptional regulation of gene expression (GO:0010609)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	AU-rich element binding (GO:0017091)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(1)|lung(3)	4		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCCCTGGGCGGCGCCGGGCA	0.711																																																	0													16.0	19.0	18.0					19																	1556729		2191	4273	6464	SO:0001819	synonymous_variant	399664			AB107353	CCDS32865.2	19p13.3	2013-08-21	2013-08-21	2007-07-18	ENSG00000181588	ENSG00000181588		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	16734	protein-coding gene	gene with protein product	"""bcl-2 ARE RNA binding protein"""	611009	"""ring finger and KH domain containing 1"", ""mex-3 homolog D (C. elegans)"""	RKHD1		17267406	Standard	NM_203304		Approved	Tino, KIAA2031, OK/SW-cl.4, RNF193	uc010dsn.3	Q86XN8	OTTHUMG00000150369	ENST00000402693.4:c.789C>T	19.37:g.1556729G>A			A0PJL8|A1L023|E9PAL6|Q71M49	Silent	SNP	pfam_KH_dom_type_1,smart_KH_dom,pfscan_Znf_RING,pfscan_KH_dom_type_1	p.A263	ENST00000402693.4	37	c.789	CCDS32865.2	19																																																																																			MEX3D	-	NULL		0.711	MEX3D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MEX3D	HGNC	protein_coding	OTTHUMT00000317870.2	G	NM_203304		1556729	-1	no_errors	ENST00000388824	ensembl	human	known	70_37	silent	SNP	0.011	A
MFI2	4241	genome.wustl.edu	37	3	196753546	196753546	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr3:196753546C>T	ENST00000296350.5	-	3	402	c.289G>A	c.(289-291)Gaa>Aaa	p.E97K	MFI2_ENST00000296351.4_Missense_Mutation_p.E97K	NM_005929.5	NP_005920.2	P08582	TRFM_HUMAN	antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5	97	Transferrin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00741}.				cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of plasminogen activation (GO:0010756)	anchored component of plasma membrane (GO:0046658)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ferric iron binding (GO:0008199)|iron ion binding (GO:0005506)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|prostate(1)	20	all_cancers(143;3.95e-09)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.55e-24)|all cancers(36;2.87e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00536)		TCGTACACTTCGCCCACCACC	0.622																																																	0													100.0	82.0	88.0					3																	196753546		2203	4300	6503	SO:0001583	missense	4241				CCDS3325.1, CCDS3326.1	3q28-q29	2012-10-02			ENSG00000163975	ENSG00000163975		"""CD molecules"""	7037	protein-coding gene	gene with protein product	"""melanotransferrin"", ""membrane-bound transferrin-like protein"""	155750					Standard	NM_033316		Approved	CD228, FLJ38863, MAP97, MGC4856, MTF1	uc003fxk.4	P08582	OTTHUMG00000155518	ENST00000296350.5:c.289G>A	3.37:g.196753546C>T	ENSP00000296350:p.Glu97Lys		Q9BQE2	Missense_Mutation	SNP	pfam_Transferrin_fam,smart_Transferrin_fam,pirsf_Transferrin,prints_Transferrin_fam	p.E97K	ENST00000296350.5	37	c.289	CCDS3325.1	3	.	.	.	.	.	.	.	.	.	.	C	25.7	4.661370	0.88154	.	.	ENSG00000163975	ENST00000296350;ENST00000296351;ENST00000439320	T;T;T	0.51071	1.8;0.72;0.72	5.02	5.02	0.67125	.	0.048269	0.85682	D	0.000000	T	0.78904	0.4357	H	0.96833	3.89	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.997	D;D;P	0.66979	0.914;0.948;0.873	D	0.86897	0.2052	10	0.87932	D	0	-15.8492	17.3936	0.87439	0.0:1.0:0.0:0.0	.	97;97;97	P08582-2;Q53XS6;P08582	.;.;TRFM_HUMAN	K	97	ENSP00000296350:E97K;ENSP00000296351:E97K;ENSP00000393439:E97K	ENSP00000296350:E97K	E	-	1	0	MFI2	198237943	1.000000	0.71417	0.815000	0.32552	0.726000	0.41606	6.914000	0.75764	2.329000	0.79093	0.555000	0.69702	GAA	MFI2	-	pfam_Transferrin_fam,smart_Transferrin_fam,pirsf_Transferrin		0.622	MFI2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MFI2	HGNC	protein_coding	OTTHUMT00000340458.1	C			196753546	-1	no_errors	ENST00000296350	ensembl	human	known	70_37	missense	SNP	1.000	T
MICALL2	79778	genome.wustl.edu	37	7	1474750	1474750	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr7:1474750C>T	ENST00000297508.7	-	16	2800	c.2625G>A	c.(2623-2625)atG>atA	p.M875I	MICALL2_ENST00000405088.4_Missense_Mutation_p.M663I|MICALL2_ENST00000471899.1_Intron	NM_182924.3	NP_891554.1	Q8IY33	MILK2_HUMAN	MICAL-like 2	875	Mediates interaction with RAB13 and is required for transition from the closed to the opened conformation. {ECO:0000250}.				actin cytoskeleton reorganization (GO:0031532)|actin filament polymerization (GO:0030041)|endocytic recycling (GO:0032456)|neuron projection development (GO:0031175)|substrate adhesion-dependent cell spreading (GO:0034446)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin filament binding (GO:0051015)|filamin binding (GO:0031005)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(8)|ovary(2)|skin(2)	19		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		GCTTCTCAATCATGTCCCGCA	0.652																																																	0													107.0	99.0	101.0					7																	1474750		2202	4299	6501	SO:0001583	missense	79778			BC037988	CCDS5324.1	7p22.3	2006-11-24			ENSG00000164877	ENSG00000164877			29672	protein-coding gene	gene with protein product	"""junctional Rab13-binding protein"""					12110185, 16525024	Standard	NM_182924		Approved	MGC46023, FLJ23471, MICAL-L2, JRAB	uc003skj.4	Q8IY33	OTTHUMG00000119021	ENST00000297508.7:c.2625G>A	7.37:g.1474750C>T	ENSP00000297508:p.Met875Ile		D3YTD2|Q7RTP4|Q7Z655|Q8TEQ4|Q9H5F9	Missense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Znf_LIM,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM	p.M875I	ENST00000297508.7	37	c.2625	CCDS5324.1	7	.	.	.	.	.	.	.	.	.	.	C	11.54	1.669877	0.29693	.	.	ENSG00000164877	ENST00000405088;ENST00000297508	T;T	0.72835	2.2;-0.69	3.92	3.92	0.45320	.	0.366501	0.20114	N	0.098959	T	0.58793	0.2147	L	0.32530	0.975	0.47123	D	0.999321	P;P	0.43477	0.808;0.709	B;B	0.36719	0.231;0.133	T	0.66244	-0.5972	10	0.56958	D	0.05	.	14.7234	0.69326	0.0:1.0:0.0:0.0	.	875;663	Q8IY33;D3YTD2	MILK2_HUMAN;.	I	663;875	ENSP00000385928:M663I;ENSP00000297508:M875I	ENSP00000297508:M875I	M	-	3	0	MICALL2	1441276	1.000000	0.71417	0.998000	0.56505	0.039000	0.13416	3.216000	0.51176	2.025000	0.59659	0.555000	0.69702	ATG	MICALL2	-	NULL		0.652	MICALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICALL2	HGNC	protein_coding	OTTHUMT00000239223.2	C	NM_182924		1474750	-1	no_errors	ENST00000297508	ensembl	human	known	70_37	missense	SNP	1.000	T
MINK1	50488	genome.wustl.edu	37	17	4794980	4794980	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:4794980G>A	ENST00000355280.6	+	16	2166	c.1970G>A	c.(1969-1971)tGg>tAg	p.W657*	MINK1_ENST00000347992.7_Nonsense_Mutation_p.W657*|MINK1_ENST00000453408.3_Nonsense_Mutation_p.W637*	NM_001024937.3|NM_015716.4|NM_153827.4	NP_001020108.1|NP_056531.1|NP_722549.2			misshapen-like kinase 1											central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)|stomach(1)	6						CCCCCAGCCTGGGTCCGCCCA	0.632																																																	0													13.0	16.0	15.0					17																	4794980		1976	4146	6122	SO:0001587	stop_gained	50488			AY775058	CCDS45588.1, CCDS45589.1, CCDS45590.1	17p13.2	2011-04-14	2010-06-24		ENSG00000141503	ENSG00000141503			17565	protein-coding gene	gene with protein product	"""misshapen/NIK-related kinase"""	609426	"""misshapen-like kinase 1 (zebrafish)"""			10708748, 12087176	Standard	NM_015716		Approved	B55, MINK, ZC3, MAP4K6, YSK2	uc010vsl.2	Q8N4C8		ENST00000355280.6:c.1970G>A	17.37:g.4794980G>A	ENSP00000347427:p.Trp657*			Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_cat_dom	p.W657*	ENST00000355280.6	37	c.1970	CCDS45588.1	17	.	.	.	.	.	.	.	.	.	.	G	41	8.768482	0.98945	.	.	ENSG00000141503	ENST00000355280;ENST00000453408;ENST00000347992	.	.	.	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.8757	0.79159	0.0:0.0:1.0:0.0	.	.	.	.	X	657;637;657	.	ENSP00000269296:W657X	W	+	2	0	MINK1	4735756	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.016000	0.93645	2.615000	0.88500	0.561000	0.74099	TGG	MINK1	-	NULL		0.632	MINK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MINK1	HGNC	protein_coding	OTTHUMT00000439801.1	G	NM_015716		4794980	+1	no_errors	ENST00000355280	ensembl	human	known	70_37	nonsense	SNP	1.000	A
MIR654	724024	genome.wustl.edu	37	14	101506099	101506099	+	RNA	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr14:101506099C>T	ENST00000385199.1	+	0	0				MIR300_ENST00000401138.1_RNA|MIR376C_ENST00000607441.1_RNA|AL132709.2_ENST00000579587.1_RNA|MIR376A1_ENST00000584362.1_RNA	NR_030390.1				microRNA 654																		TTTTCAGTATCAAATGCTGCT	0.423																																																	0													66.0	61.0	62.0					14																	101506099		1567	3581	5148			442913					14q32.31	2011-09-12		2008-12-18	ENSG00000207934	ENSG00000207934		"""ncRNAs / Micro RNAs"""	32910	non-coding RNA	RNA, micro				MIRN654			Standard	NR_030390		Approved	hsa-mir-654	uc021sda.1				14.37:g.101506099C>T				RNA	SNP	-	NULL	ENST00000385199.1	37	NULL		14																																																																																			MIR376C	-	-		0.423	MIR654-201	KNOWN	basic	miRNA	MIR376C	HGNC	miRNA		C	NR_030390		101506099	+1	no_errors	ENST00000459389	ensembl	human	known	70_37	rna	SNP	1.000	T
NDUFAF3	25915	genome.wustl.edu	37	3	49057611	49057611	+	5'Flank	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr3:49057611G>A	ENST00000326925.6	+	0	0				DALRD3_ENST00000441576.2_5'Flank|DALRD3_ENST00000496568.1_Intron|DALRD3_ENST00000440857.1_Intron|NDUFAF3_ENST00000395458.2_5'Flank|NDUFAF3_ENST00000451378.2_5'Flank|MIR425_ENST00000362162.1_RNA|DALRD3_ENST00000313778.5_Intron|DALRD3_ENST00000341949.4_5'Flank|NDUFAF3_ENST00000326912.4_5'Flank|MIR191_ENST00000384873.1_RNA|DALRD3_ENST00000395462.4_5'Flank	NM_199069.1	NP_951032.1	Q9BU61	NDUF3_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 3						mitochondrial respiratory chain complex I assembly (GO:0032981)	mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(4)	8						CGACATTCCCGATGGCTTCTC	0.597																																																	0													74.0	73.0	73.0					3																	49057611		1568	3582	5150	SO:0001631	upstream_gene_variant	494337				CCDS2784.1, CCDS2785.1	3p21.31	2012-10-12	2012-05-08	2009-03-18	ENSG00000178057	ENSG00000178057		"""Mitochondrial respiratory chain complex assembly factors"""	29918	protein-coding gene	gene with protein product		612911	"""chromosome 3 open reading frame 60"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 3"""	C3orf60		12653254, 9349717	Standard	NM_199069		Approved	MGC10527, DKFZP564J0123, E3-3, 2P1	uc003cvq.3	Q9BU61	OTTHUMG00000156773		3.37:g.49057611G>A	Exception_encountered			RNA	SNP	-	NULL	ENST00000326925.6	37	NULL	CCDS2784.1	3																																																																																			MIR425	-	-		0.597	NDUFAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR425	HGNC	protein_coding	OTTHUMT00000345683.2	G	NM_199069		49057611	-1	no_errors	ENST00000362162	ensembl	human	known	70_37	rna	SNP	1.000	A
MMS19	64210	genome.wustl.edu	37	10	99238091	99238091	+	Silent	SNP	G	G	A	rs572827758		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr10:99238091G>A	ENST00000438925.2	-	4	653	c.318C>T	c.(316-318)atC>atT	p.I106I	MMS19_ENST00000327238.10_Silent_p.I106I|MMS19_ENST00000327277.7_5'UTR|MMS19_ENST00000370782.2_Silent_p.I106I|MMS19_ENST00000483626.1_5'UTR|MMS19_ENST00000355839.6_Silent_p.I106I	NM_022362.4	NP_071757.4	Q96T76	MMS19_HUMAN	MMS19 nucleotide excision repair homolog (S. cerevisiae)	106					cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|iron-sulfur cluster assembly (GO:0016226)|nucleotide-excision repair (GO:0006289)|phosphorelay signal transduction system (GO:0000160)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	CIA complex (GO:0097361)|cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|membrane (GO:0016020)|MMXD complex (GO:0071817)|nucleus (GO:0005634)|spindle (GO:0005819)	estrogen receptor binding (GO:0030331)|protein binding, bridging (GO:0030674)|receptor signaling complex scaffold activity (GO:0030159)|transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|stomach(1)	16		Colorectal(252;0.0846)		Epithelial(162;3.33e-10)|all cancers(201;2.74e-08)		GGACAGATGGGATCACAAGAT	0.458								Direct reversal of damage																																									0													107.0	79.0	88.0					10																	99238091		2203	4299	6502	SO:0001819	synonymous_variant	64210			AF007151	CCDS7464.1, CCDS73177.1	10q24-q25	2007-08-15	2007-08-15	2007-08-15	ENSG00000155229	ENSG00000155229			13824	protein-coding gene	gene with protein product	"""MET18 homolog (S. cerevisiae)"""	614777		MMS19L		11071939	Standard	NM_022362		Approved	MET18, hMMS19	uc001kns.4	Q96T76	OTTHUMG00000018857	ENST00000438925.2:c.318C>T	10.37:g.99238091G>A			B0QZ75|B3KPE5|B4DQX2|B4E2I3|D3DR55|F8W9Y2|Q17RZ8|Q5T455|Q66K82|Q7L4W8|Q969Z1|Q96DF1|Q96MR1|Q96RK5|Q96SK1|Q9BUE2|Q9BYS9	Silent	SNP	pfam_Tscrpt_MMS19_N,superfamily_ARM-type_fold	p.I106	ENST00000438925.2	37	c.318	CCDS7464.1	10																																																																																			MMS19	-	superfamily_ARM-type_fold		0.458	MMS19-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MMS19	HGNC	protein_coding	OTTHUMT00000049706.2	G			99238091	-1	no_errors	ENST00000370782	ensembl	human	known	70_37	silent	SNP	0.977	A
MKI67	4288	genome.wustl.edu	37	10	129903836	129903836	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr10:129903836C>T	ENST00000368654.3	-	13	6643	c.6268G>A	c.(6268-6270)Gag>Aag	p.E2090K	MKI67_ENST00000368653.3_Missense_Mutation_p.E1730K	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	2090	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				GTTGATTCCTCAGTGTGGTCT	0.502																																																	0													298.0	290.0	293.0					10																	129903836		2203	4300	6503	SO:0001583	missense	4288			X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.6268G>A	10.37:g.129903836C>T	ENSP00000357643:p.Glu2090Lys		Q5VWH2	Missense_Mutation	SNP	pfam_K167R,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.E2090K	ENST00000368654.3	37	c.6268	CCDS7659.1	10	.	.	.	.	.	.	.	.	.	.	C	8.753	0.921762	0.17982	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.01279	5.06;5.07	4.15	-2.17	0.07059	.	1.534330	0.04022	N	0.299871	T	0.01254	0.0041	L	0.38175	1.15	0.09310	N	1	B;B;B	0.16603	0.018;0.018;0.01	B;B;B	0.22880	0.042;0.042;0.019	T	0.46925	-0.9156	10	0.07030	T	0.85	.	2.0625	0.03595	0.1393:0.246:0.1231:0.4916	.	2089;1730;2090	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	K	2090;1730;2089	ENSP00000357643:E2090K;ENSP00000357642:E1730K	ENSP00000357642:E1730K	E	-	1	0	MKI67	129793826	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.294000	0.08309	-0.556000	0.06134	0.655000	0.94253	GAG	MKI67	-	NULL		0.502	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKI67	HGNC	protein_coding	OTTHUMT00000050999.1	C	NM_002417		129903836	-1	no_errors	ENST00000368654	ensembl	human	known	70_37	missense	SNP	0.000	T
MMS22L	253714	genome.wustl.edu	37	6	97702483	97702483	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr6:97702483G>A	ENST00000275053.4	-	10	1334	c.1069C>T	c.(1069-1071)Cat>Tat	p.H357Y	MMS22L_ENST00000369251.2_Missense_Mutation_p.H357Y	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	357					double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)		p.H357Y(1)		breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						GATGCTACATGAGTAATAATC	0.338																																																	1	Substitution - Missense(1)	large_intestine(1)											118.0	119.0	119.0					6																	97702483		2203	4300	6503	SO:0001583	missense	253714				CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.1069C>T	6.37:g.97702483G>A	ENSP00000275053:p.His357Tyr		D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.H357Y	ENST00000275053.4	37	c.1069	CCDS5039.1	6	.	.	.	.	.	.	.	.	.	.	G	21.3	4.124581	0.77436	.	.	ENSG00000146263	ENST00000275053;ENST00000369251;ENST00000510018;ENST00000482634	T;T;T;T	0.36340	1.26;1.26;1.26;1.26	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.50205	0.1602	M	0.74258	2.255	0.52501	D	0.999951	D;D	0.61697	0.99;0.99	P;P	0.60609	0.877;0.877	T	0.56721	-0.7932	10	0.87932	D	0	-5.3487	16.6752	0.85277	0.0:0.0:1.0:0.0	.	357;357	E2QRD4;Q6ZRQ5	.;MMS22_HUMAN	Y	357;357;245;49	ENSP00000275053:H357Y;ENSP00000358254:H357Y;ENSP00000427288:H245Y;ENSP00000421225:H49Y	ENSP00000275053:H357Y	H	-	1	0	MMS22L	97809204	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.130000	0.64745	2.364000	0.80123	0.655000	0.94253	CAT	MMS22L	-	NULL		0.338	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMS22L	HGNC	protein_coding	OTTHUMT00000041573.3	G	NM_198468		97702483	-1	no_errors	ENST00000275053	ensembl	human	known	70_37	missense	SNP	1.000	A
MPHOSPH9	10198	genome.wustl.edu	37	12	123702952	123702952	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr12:123702952C>G	ENST00000606320.1	-	6	1173	c.967G>C	c.(967-969)Gag>Cag	p.E323Q	MPHOSPH9_ENST00000392425.3_Missense_Mutation_p.E171Q|MPHOSPH9_ENST00000302349.5_Missense_Mutation_p.E171Q|MPHOSPH9_ENST00000541076.2_Missense_Mutation_p.E293Q			Q99550	MPP9_HUMAN	M-phase phosphoprotein 9	323						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(18)|prostate(2)|skin(1)	33	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)		TTACTTTGCTCATTTCCTTGT	0.408																																																	0													283.0	240.0	255.0					12																	123702952		2203	4300	6503	SO:0001583	missense	10198			X98258	CCDS9243.1, CCDS9243.2	12q24	2008-03-03			ENSG00000051825	ENSG00000051825			7215	protein-coding gene	gene with protein product		605501				8885239	Standard	NM_022782		Approved	MPP9	uc001uel.3	Q99550	OTTHUMG00000168849	ENST00000606320.1:c.967G>C	12.37:g.123702952C>G	ENSP00000475489:p.Glu323Gln		A1L486|A6NEE2|B3KR87|Q9H976|U3KQ28	Missense_Mutation	SNP	superfamily_Prefoldin	p.E171Q	ENST00000606320.1	37	c.511		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.66|18.66	3.671131|3.671131	0.67814|0.67814	.|.	.|.	ENSG00000051825|ENSG00000257076	ENST00000302349;ENST00000541076|ENST00000539336	T;T|.	0.41065|.	1.01;1.04|.	4.93|4.93	4.93|4.93	0.64822|0.64822	.|.	0.370404|.	0.25352|.	N|.	0.031291|.	T|.	0.58779|.	0.2146|.	M|M	0.64997|0.64997	1.995|1.995	0.09310|0.09310	N|N	1|1	D|.	0.89917|.	1.0|.	D|.	0.87578|.	0.998|.	T|.	0.52939|.	-0.8508|.	10|.	0.51188|.	T|.	0.08|.	-13.7252|-13.7252	16.2915|16.2915	0.82755|0.82755	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	171|.	Q99550|.	MPP9_HUMAN|.	Q|S	171|180	ENSP00000303597:E171Q;ENSP00000445859:E171Q|.	ENSP00000303597:E171Q|.	E|X	-|-	1|2	0|2	MPHOSPH9|RP11-546D6.2	122268905|122268905	0.942000|0.942000	0.31987|0.31987	0.009000|0.009000	0.14445|0.14445	0.069000|0.069000	0.16628|0.16628	4.302000|4.302000	0.59092|0.59092	2.444000|2.444000	0.82710|0.82710	0.555000|0.555000	0.69702|0.69702	GAG|TGA	MPHOSPH9	-	NULL		0.408	MPHOSPH9-030	NOVEL	basic	protein_coding	MPHOSPH9	HGNC	protein_coding	OTTHUMT00000471390.2	C			123702952	-1	no_errors	ENST00000541076	ensembl	human	known	70_37	missense	SNP	0.137	G
MPP1	4354	genome.wustl.edu	37	X	154020470	154020470	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chrX:154020470C>A	ENST00000369534.3	-	2	340	c.193G>T	c.(193-195)Gag>Tag	p.E65*	MPP1_ENST00000462825.1_Intron|MPP1_ENST00000413259.3_Nonsense_Mutation_p.E35*|MPP1_ENST00000393531.1_Nonsense_Mutation_p.E65*	NM_001166460.1|NM_001166461.1|NM_002436.3	NP_001159932.1|NP_001159933.1|NP_002427.1	Q00013	EM55_HUMAN	membrane protein, palmitoylated 1, 55kDa	65					nucleotide phosphorylation (GO:0046939)|regulation of neutrophil chemotaxis (GO:0090022)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(9)|ovary(2)|prostate(1)	21	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TTCCGCACCTCCTGTCCCTTG	0.562																																																	0													112.0	93.0	100.0					X																	154020470		2203	4300	6503	SO:0001587	stop_gained	4354				CCDS14762.1, CCDS55544.1, CCDS55545.1	Xq28	2008-03-04	2002-08-29		ENSG00000130830	ENSG00000130830			7219	protein-coding gene	gene with protein product		305360	"""membrane protein, palmitoylated 1 (55kD)"""	DXS552E		1713685	Standard	NM_002436		Approved	PEMP	uc004fmp.2	Q00013	OTTHUMG00000024244	ENST00000369534.3:c.193G>T	X.37:g.154020470C>A	ENSP00000358547:p.Glu65*		B4DZV5|G3XAI1|Q2TSB6|Q5J7V5	Nonsense_Mutation	SNP	pfam_Guanylate_kin,pfam_PDZ,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_PDZ,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.E65*	ENST00000369534.3	37	c.193	CCDS14762.1	X	.	.	.	.	.	.	.	.	.	.	C	19.68	3.871988	0.72180	.	.	ENSG00000130830	ENST00000369534;ENST00000413259;ENST00000393531;ENST00000393529;ENST00000369531	.	.	.	5.3	4.42	0.53409	.	0.207328	0.49305	D	0.000143	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.7251	0.62754	0.0:0.8483:0.1517:0.0	.	.	.	.	X	65;35;65;19;65	.	ENSP00000358544:E65X	E	-	1	0	MPP1	153673664	0.996000	0.38824	0.842000	0.33263	0.259000	0.26198	3.325000	0.52030	0.988000	0.38734	-0.229000	0.12294	GAG	MPP1	-	superfamily_PDZ		0.562	MPP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MPP1	HGNC	protein_coding	OTTHUMT00000061191.3	C	NM_002436		154020470	-1	no_errors	ENST00000369534	ensembl	human	known	70_37	nonsense	SNP	1.000	A
MRPL15	29088	genome.wustl.edu	37	8	55060161	55060161	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr8:55060161C>G	ENST00000260102.4	+	5	847	c.773C>G	c.(772-774)aCt>aGt	p.T258S		NM_014175.3	NP_054894.1	Q9P015	RM15_HUMAN	mitochondrial ribosomal protein L15	258					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)|skin(3)	10		Lung NSC(129;0.109)|all_epithelial(80;0.134)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;4.3e-07)|Epithelial(17;5.79e-05)|all cancers(17;0.000458)			ATGCTCTGTACTAGGAAGGAT	0.413																																																	0													76.0	76.0	76.0					8																	55060161		2203	4300	6503	SO:0001583	missense	29088			AB051619	CCDS6158.1	8q11.2-q13	2012-09-13			ENSG00000137547	ENSG00000137547		"""Mitochondrial ribosomal proteins / large subunits"""	14054	protein-coding gene	gene with protein product		611828				11543634	Standard	NM_014175		Approved	RPML7, MRP-L7, HSPC145, L15mt, MRP-L15	uc003xsa.2	Q9P015	OTTHUMG00000164315	ENST00000260102.4:c.773C>G	8.37:g.55060161C>G	ENSP00000260102:p.Thr258Ser		Q96Q54|Q9H0Y1	Missense_Mutation	SNP	pfam_Ribosomal_L18e/L15P,superfamily_Ribosomal_L18e/L15P	p.T258S	ENST00000260102.4	37	c.773	CCDS6158.1	8	.	.	.	.	.	.	.	.	.	.	C	2.838	-0.241133	0.05906	.	.	ENSG00000137547	ENST00000260102	T	0.61510	0.1	5.33	5.33	0.75918	.	0.504438	0.25302	N	0.031656	T	0.44052	0.1275	L	0.31664	0.95	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.14559	-1.0468	10	0.10377	T	0.69	-35.547	15.4085	0.74900	0.0:0.8608:0.1392:0.0	.	258	Q9P015	RM15_HUMAN	S	258	ENSP00000260102:T258S	ENSP00000260102:T258S	T	+	2	0	MRPL15	55222714	0.099000	0.21834	0.354000	0.25760	0.750000	0.42670	1.724000	0.38064	2.484000	0.83849	0.650000	0.86243	ACT	MRPL15	-	NULL		0.413	MRPL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL15	HGNC	protein_coding	OTTHUMT00000378254.1	C	NM_014175		55060161	+1	no_errors	ENST00000260102	ensembl	human	known	70_37	missense	SNP	0.102	G
MRPL9	65005	genome.wustl.edu	37	1	151733963	151733963	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:151733963C>T	ENST00000368830.3	-	5	636	c.552G>A	c.(550-552)ctG>ctA	p.L184L	MRPL9_ENST00000368829.3_Intron|OAZ3_ENST00000453029.2_5'Flank|OAZ3_ENST00000479764.1_5'Flank|RP11-98D18.3_ENST00000512280.1_RNA|MRPL9_ENST00000467306.1_5'UTR|OAZ3_ENST00000321531.5_5'Flank|OAZ3_ENST00000315067.8_5'Flank|RP11-98D18.15_ENST00000601684.1_RNA	NM_031420.2	NP_113608.1	Q9BYD2	RM09_HUMAN	mitochondrial ribosomal protein L9	184					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	12	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TTTCAGGGTTCAGCTCCCATT	0.468																																																	0													115.0	105.0	109.0					1																	151733963		2203	4300	6503	SO:0001819	synonymous_variant	65005			AK026363	CCDS1003.1, CCDS72916.1	1q21	2012-09-13			ENSG00000143436	ENSG00000143436		"""Mitochondrial ribosomal proteins / large subunits"""	14277	protein-coding gene	gene with protein product		611824					Standard	XM_005245455		Approved		uc001eyv.3	Q9BYD2	OTTHUMG00000013063	ENST00000368830.3:c.552G>A	1.37:g.151733963C>T			B2RD99|Q5SZR2|Q9BSW8	Silent	SNP	pfam_Ribosomal_L9_N,superfamily_Ribosomal_L9/RNase_H1_N	p.L184	ENST00000368830.3	37	c.552	CCDS1003.1	1																																																																																			MRPL9	-	NULL		0.468	MRPL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL9	HGNC	protein_coding	OTTHUMT00000036653.2	C	NM_031420		151733963	-1	no_errors	ENST00000368830	ensembl	human	known	70_37	silent	SNP	0.998	T
MSX1	4487	genome.wustl.edu	37	4	4864524	4864524	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr4:4864524G>A	ENST00000382723.4	+	2	800	c.566G>A	c.(565-567)cGc>cAc	p.R189H	MSX1_ENST00000468421.1_3'UTR	NM_002448.3	NP_002439.2	P28360	MSX1_HUMAN	msh homeobox 1	189					activation of meiosis (GO:0090427)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway involved in heart development (GO:0061312)|bone morphogenesis (GO:0060349)|cartilage morphogenesis (GO:0060536)|cell morphogenesis (GO:0000902)|cellular response to nicotine (GO:0071316)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic nail plate morphogenesis (GO:0035880)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|mammary gland epithelium development (GO:0061180)|mesenchymal cell proliferation (GO:0010463)|midbrain development (GO:0030901)|middle ear morphogenesis (GO:0042474)|muscle organ development (GO:0007517)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pituitary gland development (GO:0021983)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902255)|positive regulation of mesenchymal cell apoptotic process (GO:2001055)|protein localization to nucleus (GO:0034504)|protein stabilization (GO:0050821)|regulation of odontogenesis (GO:0042481)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			endometrium(3)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	11				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		GCGCTGGAGCGCAAGTTCCGC	0.647																																																	0													47.0	56.0	53.0					4																	4864524		2202	4299	6501	SO:0001583	missense	4487			M97676	CCDS3378.2	4p16.2	2011-06-20	2006-11-21		ENSG00000163132	ENSG00000163132		"""Homeoboxes / ANTP class : NKL subclass"""	7391	protein-coding gene	gene with protein product		142983	"""msh (Drosophila) homeo box homolog 1 (formerly homeo box 7)"", ""msh homeobox homolog 1 (Drosophila)"""	HOX7		1685479, 1973146	Standard	NM_002448		Approved	HYD1, OFC5	uc003gif.3	P28360	OTTHUMG00000090335	ENST00000382723.4:c.566G>A	4.37:g.4864524G>A	ENSP00000372170:p.Arg189His		A0SZU5|A8K3M1|Q96NY4	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.R189H	ENST00000382723.4	37	c.566	CCDS3378.2	4	.	.	.	.	.	.	.	.	.	.	G	27.4	4.827022	0.90955	.	.	ENSG00000163132	ENST00000382723	D	0.95238	-3.65	4.84	4.84	0.62591	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.95645	0.8584	L	0.45422	1.42	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.96078	0.9051	10	0.87932	D	0	-5.9381	14.8085	0.69977	0.0:0.0:0.8555:0.1445	.	183	P28360	MSX1_HUMAN	H	189	ENSP00000372170:R189H	ENSP00000372170:R189H	R	+	2	0	MSX1	4915425	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	5.612000	0.67681	2.391000	0.81399	0.462000	0.41574	CGC	MSX1	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain		0.647	MSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSX1	HGNC	protein_coding	OTTHUMT00000206700.3	G			4864524	+1	no_errors	ENST00000382723	ensembl	human	known	70_37	missense	SNP	1.000	A
MTCH1	23787	genome.wustl.edu	37	6	36949434	36949434	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr6:36949434C>T	ENST00000373627.5	-	2	460	c.336G>A	c.(334-336)ccG>ccA	p.P112P	MTCH1_ENST00000538808.1_Intron|MTCH1_ENST00000373616.5_Silent_p.P112P	NM_001271641.1	NP_001258570.1	Q9NZJ7	MTCH1_HUMAN	mitochondrial carrier 1	112					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|neuronal ion channel clustering (GO:0045161)|positive regulation of apoptotic process (GO:0043065)|regulation of signal transduction (GO:0009966)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	6						TGGGGGGCATCGGCTCATGAC	0.567																																																	0													52.0	47.0	49.0					6																	36949434		2203	4300	6503	SO:0001819	synonymous_variant	23787			AF151822	CCDS4828.1, CCDS64411.1	6p21.2	2013-05-22	2011-05-19		ENSG00000137409	ENSG00000137409		"""Solute carriers"""	17586	protein-coding gene	gene with protein product	"""solute carrier family 25, member 49"""	610449	"""mitochondrial carrier homolog 1 (C. elegans)"""			12377771	Standard	NM_014341		Approved	CGI-64, PSAP, SLC25A49	uc003ond.2	Q9NZJ7	OTTHUMG00000014614	ENST00000373627.5:c.336G>A	6.37:g.36949434C>T			A8KAX5|B2RCE3|Q6PK60|Q6UX45|Q7L465|Q9BW23|Q9NZR6|Q9UJZ5	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.P112	ENST00000373627.5	37	c.336		6																																																																																			MTCH1	-	superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier		0.567	MTCH1-008	KNOWN	basic|appris_principal	protein_coding	MTCH1	HGNC	protein_coding	OTTHUMT00000040396.1	C	NM_014341		36949434	-1	no_errors	ENST00000373627	ensembl	human	known	70_37	silent	SNP	0.995	T
MTO1	25821	genome.wustl.edu	37	6	74183257	74183257	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr6:74183257G>A	ENST00000370300.4	+	4	795	c.705G>A	c.(703-705)ttG>ttA	p.L235L	MTO1_ENST00000370305.1_Silent_p.L161L|MTO1_ENST00000415954.2_Silent_p.L235L|MTO1_ENST00000498286.1_Silent_p.L235L	NM_012123.3|NM_133645.2	NP_036255.2|NP_598400.1	Q9Y2Z2	MTO1_HUMAN	mitochondrial tRNA translation optimization 1	235					mitochondrial tRNA wobble uridine modification (GO:0070899)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)	27						TGGGAAGGTTGAAGACTGGGA	0.458																																																	0													161.0	145.0	150.0					6																	74183257		2203	4300	6503	SO:0001819	synonymous_variant	25821			AF132937	CCDS4979.1, CCDS34485.1, CCDS47452.1	6q14.1	2013-05-07	2013-05-07		ENSG00000135297	ENSG00000135297			19261	protein-coding gene	gene with protein product		614667	"""mitochondrial translation optimization 1 homolog (S. cerevisiae)"""			12011058, 22608499	Standard	NM_012123		Approved		uc003pgy.4	Q9Y2Z2	OTTHUMG00000015032	ENST00000370300.4:c.705G>A	6.37:g.74183257G>A			B3KQB5|Q5SWL2|Q5SWL3|Q5SWL4|Q8NDN7|Q8WZ57|Q96FE6|Q9BS06	Silent	SNP	pfam_GIDA-rel,pfam_FAD_bind_dom,prints_FAD_pyr_nucl-diS_OxRdtase,tigrfam_GidA	p.L235	ENST00000370300.4	37	c.705	CCDS4979.1	6																																																																																			MTO1	-	pfam_GIDA-rel,tigrfam_GidA		0.458	MTO1-003	KNOWN	basic|CCDS	protein_coding	MTO1	HGNC	protein_coding	OTTHUMT00000041215.2	G	NM_012123		74183257	+1	no_errors	ENST00000415954	ensembl	human	known	70_37	silent	SNP	1.000	A
MUC12	10071	genome.wustl.edu	37	7	100637074	100637074	+	Missense_Mutation	SNP	G	G	A	rs200730762	byFrequency	TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr7:100637074G>A	ENST00000379442.3	+	5	3659	c.3659G>A	c.(3658-3660)cGc>cAc	p.R1220H	MUC12_ENST00000536621.1_Missense_Mutation_p.R1077H			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	1220	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						ACAACCTCACGCATCAGTCCA	0.512													g|||	147	0.029353	0.0121	0.0389	5008	,	,		29769	0.0109		0.0209	False		,,,				2504	0.0736																0													9.0	8.0	8.0					7																	100637074		555	1239	1794	SO:0001583	missense	10071			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.3659G>A	7.37:g.100637074G>A	ENSP00000368755:p.Arg1220His		A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.R1220H	ENST00000379442.3	37	c.3659		7	.	.	.	.	.	.	.	.	.	.	g	0.099	-1.155707	0.01686	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.13657	2.57;2.57	0.713	-1.43	0.08884	.	.	.	.	.	T	0.05777	0.0151	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.33369	-0.9871	7	0.40728	T	0.16	.	3.6003	0.08021	0.0:0.2214:0.4862:0.2924	.	.	.	.	H	1220;1077	ENSP00000368755:R1220H;ENSP00000441929:R1077H	ENSP00000368755:R1220H	R	+	2	0	MUC12	100423794	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-3.324000	0.00512	-1.374000	0.02131	-1.406000	0.01132	CGC	MUC12	-	NULL		0.512	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	G	XM_379904		100637074	+1	no_errors	ENST00000379442	ensembl	human	known	70_37	missense	SNP	0.000	A
MYH15	22989	genome.wustl.edu	37	3	108224626	108224626	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr3:108224626C>T	ENST00000273353.3	-	3	255	c.199G>A	c.(199-201)Gag>Aag	p.E67K		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	67						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						CCTTTTACCTCAGCCTCGATA	0.358																																																	0													207.0	192.0	196.0					3																	108224626		1872	4132	6004	SO:0001583	missense	22989			AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.199G>A	3.37:g.108224626C>T	ENSP00000273353:p.Glu67Lys			Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,superfamily_Lambda_DNA-bd_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.E67K	ENST00000273353.3	37	c.199	CCDS43127.1	3	.	.	.	.	.	.	.	.	.	.	C	5.963	0.361716	0.11296	.	.	ENSG00000144821	ENST00000273353	D	0.83250	-1.7	3.41	1.57	0.23409	Myosin, N-terminal, SH3-like (1);	.	.	.	.	D	0.85440	0.5697	L	0.60455	1.87	0.34508	D	0.706795	P	0.51933	0.949	D	0.62955	0.909	D	0.83854	0.0264	9	0.26408	T	0.33	.	8.4374	0.32795	0.0:0.7533:0.1563:0.0904	.	67	Q9Y2K3	MYH15_HUMAN	K	67	ENSP00000273353:E67K	ENSP00000273353:E67K	E	-	1	0	MYH15	109707316	0.022000	0.18835	0.466000	0.27168	0.071000	0.16799	0.806000	0.27126	0.430000	0.26230	0.561000	0.74099	GAG	MYH15	-	pfam_Myosin_N		0.358	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH15	HGNC	protein_coding	OTTHUMT00000353935.1	C	XM_036988		108224626	-1	no_errors	ENST00000273353	ensembl	human	known	70_37	missense	SNP	0.679	T
MYO6	4646	genome.wustl.edu	37	6	76596683	76596683	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr6:76596683C>G	ENST00000369977.3	+	25	2769	c.2630C>G	c.(2629-2631)tCt>tGt	p.S877C	MYO6_ENST00000369985.4_Missense_Mutation_p.S877C|MYO6_ENST00000369981.3_Missense_Mutation_p.S877C|MYO6_ENST00000369975.1_Missense_Mutation_p.S877C	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	877					actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		CTGGAAATTTCTATTGATACT	0.299																																																	0													71.0	75.0	74.0					6																	76596683		2203	4300	6503	SO:0001583	missense	4646			U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.2630C>G	6.37:g.76596683C>G	ENSP00000358994:p.Ser877Cys		A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.S877C	ENST00000369977.3	37	c.2630	CCDS34487.1	6	.	.	.	.	.	.	.	.	.	.	C	12.65	2.002235	0.35320	.	.	ENSG00000196586	ENST00000428345;ENST00000369981;ENST00000369985;ENST00000369977;ENST00000369975	D;D;T;T	0.89485	-2.5;-2.52;1.48;1.9	5.64	5.64	0.86602	.	0.107745	0.64402	D	0.000005	D	0.86585	0.5968	L	0.46157	1.445	0.58432	D	0.999999	B;P	0.51791	0.02;0.948	B;P	0.47376	0.005;0.545	D	0.86550	0.1834	10	0.46703	T	0.11	.	19.7048	0.96068	0.0:1.0:0.0:0.0	.	877;877	Q9UM54-2;Q9UM54-1	.;.	C	877	ENSP00000358998:S877C;ENSP00000359002:S877C;ENSP00000358994:S877C;ENSP00000358992:S877C	ENSP00000358992:S877C	S	+	2	0	MYO6	76653403	1.000000	0.71417	1.000000	0.80357	0.095000	0.18619	7.378000	0.79679	2.627000	0.88993	0.655000	0.94253	TCT	MYO6	-	NULL		0.299	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO6	HGNC	protein_coding	OTTHUMT00000041279.2	C	NM_004999		76596683	+1	no_errors	ENST00000369981	ensembl	human	known	70_37	missense	SNP	1.000	G
MYO7A	4647	genome.wustl.edu	37	11	76892542	76892542	+	Silent	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr11:76892542C>G	ENST00000409709.3	+	23	3083	c.2811C>G	c.(2809-2811)gtC>gtG	p.V937V	MYO7A_ENST00000409619.2_Silent_p.V926V|MYO7A_ENST00000409893.1_Silent_p.V937V|MYO7A_ENST00000458637.2_Silent_p.V937V	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	937					actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						ATGAGCCTGTCAATCACTCAG	0.617																																																	0													52.0	59.0	57.0					11																	76892542		1993	4142	6135	SO:0001819	synonymous_variant	4647			U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.2811C>G	11.37:g.76892542C>G			B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_FERM_N,pfam_IQ_motif_EF-hand-BS,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.V937	ENST00000409709.3	37	c.2811	CCDS53683.1	11																																																																																			MYO7A	-	NULL		0.617	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	MYO7A	HGNC	protein_coding	OTTHUMT00000328133.1	C	NM_000260		76892542	+1	no_errors	ENST00000409709	ensembl	human	known	70_37	silent	SNP	1.000	G
MYT1L	23040	genome.wustl.edu	37	2	1820058	1820058	+	Intron	SNP	G	G	A	rs573753991		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:1820058G>A	ENST00000399161.2	-	22	3828				MYT1L_ENST00000407844.1_Intron|MYT1L_ENST00000471668.1_5'UTR|MYT1L_ENST00000428368.2_Intron	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like						cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		TCTGAGCTACGCTGTATGGAT	0.493																																																	0																																										SO:0001627	intron_variant	23040			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.3081-7119C>T	2.37:g.1820058G>A			A7E2C7|B2RP54|Q6IQ17|Q9UPP6	RNA	SNP	-	NULL	ENST00000399161.2	37	NULL		2																																																																																			MYT1L	-	-		0.493	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	HGNC	protein_coding	OTTHUMT00000322493.1	G	NM_015025		1820058	-1	no_errors	ENST00000471668	ensembl	human	known	70_37	rna	SNP	0.003	A
NAA16	79612	genome.wustl.edu	37	13	41936628	41936628	+	Intron	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr13:41936628G>A	ENST00000379406.3	+	13	1863				NAA16_ENST00000497143.1_3'UTR|NAA16_ENST00000379367.3_Intron	NM_024561.4	NP_078837.3	Q6N069	NAA16_HUMAN	N(alpha)-acetyltransferase 16, NatA auxiliary subunit						N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ribosome binding (GO:0043022)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|urinary_tract(2)	31						ACACACAGCTGATGGCAACCT	0.383																																																	0																																										SO:0001627	intron_variant	79612			AL833341	CCDS9379.1, CCDS45044.1	13q14.11	2013-01-10	2010-01-14	2010-01-14	ENSG00000172766	ENSG00000172766		"""N(alpha)-acetyltransferase subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	26164	protein-coding gene	gene with protein product			"""NMDA receptor regulated 1-like"""	NARG1L		11483580, 19660095	Standard	NM_024561		Approved	FLJ22054, MGC40612, PRO2435	uc001uyf.2	Q6N069	OTTHUMG00000016791	ENST00000379406.3:c.1539+333G>A	13.37:g.41936628G>A			B0QZ59|Q5VSP9|Q6P2D5|Q8N5J3|Q8N870	RNA	SNP	-	NULL	ENST00000379406.3	37	NULL	CCDS9379.1	13																																																																																			NAA16	-	-		0.383	NAA16-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA16	HGNC	protein_coding	OTTHUMT00000044672.2	G	NM_018527		41936628	+1	no_errors	ENST00000497143	ensembl	human	known	70_37	rna	SNP	0.545	A
NARFL	64428	genome.wustl.edu	37	16	787284	787284	+	Missense_Mutation	SNP	C	C	T	rs376966046		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr16:787284C>T	ENST00000251588.2	-	3	224	c.208G>A	c.(208-210)Gac>Aac	p.D70N	NARFL_ENST00000568545.1_5'UTR|NARFL_ENST00000301694.5_Missense_Mutation_p.D70N|NARFL_ENST00000540986.1_5'UTR	NM_022493.1	NP_071938.1	Q9H6Q4	NARFL_HUMAN	nuclear prelamin A recognition factor-like	70					hematopoietic progenitor cell differentiation (GO:0002244)|iron-sulfur cluster assembly (GO:0016226)|oxygen homeostasis (GO:0032364)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	CIA complex (GO:0097361)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|large_intestine(1)|lung(7)	9		Hepatocellular(780;0.0218)				GCCAGGCAGTCGTTTAGCGAG	0.617																																																	0								C	ASN/ASP	1,4399	2.1+/-5.4	0,1,2199	123.0	112.0	116.0		208	4.7	0.9	16		116	0,8598		0,0,4299	no	missense	NARFL	NM_022493.1	23	0,1,6498	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	70/477	787284	1,12997	2200	4299	6499	SO:0001583	missense	64428			AY129231	CCDS10425.1	16p13.3	2009-12-17			ENSG00000103245	ENSG00000103245			14179	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 1"""	611118				16956324	Standard	NM_022493		Approved	FLJ21988, PRN, HPRN, IOP1	uc002cjr.3	Q9H6Q4	OTTHUMG00000122093	ENST00000251588.2:c.208G>A	16.37:g.787284C>T	ENSP00000251588:p.Asp70Asn		A1L385|B3KTJ3|Q53GC6|Q96S10|Q9H6J8	Missense_Mutation	SNP	pfam_Fe_hydrogenase_lsu_C,pfam_Fe_hydrogenase_ssu-like,superfamily_Fe_hydrogenase,smart_Fe_hydrogenase_ssu-like	p.D70N	ENST00000251588.2	37	c.208	CCDS10425.1	16	.	.	.	.	.	.	.	.	.	.	C	20.2	3.957778	0.73902	2.27E-4	0.0	ENSG00000103245	ENST00000251588;ENST00000301694	T;T	0.55588	0.51;0.51	4.68	4.68	0.58851	Iron hydrogenase (1);	0.000000	0.85682	D	0.000000	T	0.80502	0.4635	H	0.95402	3.665	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.998	D	0.85792	0.1368	10	0.48119	T	0.1	-13.1932	16.5777	0.84705	0.0:1.0:0.0:0.0	.	70;70;70	B4DT78;B4DEE7;Q9H6Q4	.;.;NARFL_HUMAN	N	70	ENSP00000251588:D70N;ENSP00000301694:D70N	ENSP00000251588:D70N	D	-	1	0	NARFL	727285	1.000000	0.71417	0.919000	0.36401	0.025000	0.11179	7.411000	0.80078	2.179000	0.69175	0.511000	0.50034	GAC	NARFL	-	superfamily_Fe_hydrogenase		0.617	NARFL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NARFL	HGNC	protein_coding	OTTHUMT00000242855.1	C	NM_022493		787284	-1	no_errors	ENST00000251588	ensembl	human	known	70_37	missense	SNP	1.000	T
NBAS	51594	genome.wustl.edu	37	2	15307270	15307270	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:15307270C>A	ENST00000281513.5	-	52	7043	c.7018G>T	c.(7018-7020)Gaa>Taa	p.E2340*	NBAS_ENST00000441750.1_Nonsense_Mutation_p.E2220*	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	2340					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						GCTTCGGCTTCATGGCCGGCC	0.632																																																	0													40.0	44.0	43.0					2																	15307270		2203	4300	6503	SO:0001587	stop_gained	51594			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.7018G>T	2.37:g.15307270C>A	ENSP00000281513:p.Glu2340*		O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Nonsense_Mutation	SNP	pfam_Sec39,superfamily_Quino_amine_DH_bsu	p.E2340*	ENST00000281513.5	37	c.7018	CCDS1685.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	41|41	8.994952|8.994952	0.99029|0.99029	.|.	.|.	ENSG00000151779|ENSG00000151779	ENST00000441750;ENST00000281513;ENST00000433283|ENST00000442506	.|.	.|.	.|.	5.19|5.19	-3.62|-3.62	0.04543|0.04543	.|.	1.009800|.	0.07919|.	N|.	0.975638|.	.|T	.|0.50650	.|0.1628	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.47886	.|-0.9082	.|4	0.87932|.	D|.	0|.	.|.	7.4804|7.4804	0.27402|0.27402	0.0:0.2969:0.3986:0.3044|0.0:0.2969:0.3986:0.3044	.|.	.|.	.|.	.|.	X|I	2220;2340;153|1387	.|.	ENSP00000281513:E2340X|.	E|M	-|-	1|3	0|0	NBAS|NBAS	15224721|15224721	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	0.736000|0.736000	0.26130|0.26130	-0.604000|-0.604000	0.05760|0.05760	-1.934000|-1.934000	0.00508|0.00508	GAA|ATG	NBAS	-	NULL		0.632	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBAS	HGNC	protein_coding	OTTHUMT00000241638.1	C	NM_015909		15307270	-1	no_errors	ENST00000281513	ensembl	human	known	70_37	nonsense	SNP	0.000	A
NBPF12	149013	genome.wustl.edu	37	1	146408047	146408047	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:146408047G>C	ENST00000442909.2	+	15	2517	c.1681G>C	c.(1681-1683)Gaa>Caa	p.E561Q	NBPF12_ENST00000439206.2_Intron|NBPF12_ENST00000309471.8_Missense_Mutation_p.E215Q|NBPF12_ENST00000446760.2_Missense_Mutation_p.E290Q			Q5TAG4	NBPFC_HUMAN	neuroblastoma breakpoint family, member 12	0						cytoplasm (GO:0005737)				ovary(2)	2						GAACATTCTAGAAATCAATGA	0.527																																																	0																																										SO:0001583	missense	149013			BG154169	CCDS72881.1	1q21.1	2013-01-17	2011-06-28	2011-06-28	ENSG00000186275	ENSG00000268043		"""neuroblastoma breakpoint family"""	24297	protein-coding gene	gene with protein product		608607	"""KIAA1245"""	KIAA1245		11948409	Standard	NM_001278141		Approved	COAS1		Q5TAG4	OTTHUMG00000043708	ENST00000442909.2:c.1681G>C	1.37:g.146408047G>C	ENSP00000391116:p.Glu561Gln		O95877	Missense_Mutation	SNP	pfam_NBPF_dom	p.E290Q	ENST00000442909.2	37	c.868		1	.	.	.	.	.	.	.	.	.	.	N	9.380	1.072718	0.20147	.	.	ENSG00000186275	ENST00000446760;ENST00000442909;ENST00000309471	T;T;T	0.03301	4.06;3.98;4.02	0.962	-0.079	0.13712	.	.	.	.	.	T	0.01287	0.0042	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.47394	-0.9121	6	0.52906	T	0.07	.	3.4437	0.07473	0.2938:0.0:0.7062:0.0	.	.	.	.	Q	290;561;215	ENSP00000396525:E290Q;ENSP00000391116:E561Q;ENSP00000311131:E215Q	ENSP00000311131:E215Q	E	+	1	0	NBPF12	146706982	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.818000	0.04467	0.019000	0.15079	-0.476000	0.04901	GAA	NBPF12	-	NULL		0.527	NBPF12-001	NOVEL	basic|appris_principal	protein_coding	NBPF12	HGNC	protein_coding	OTTHUMT00000102086.3	G	XM_003119146		146408047	+1	no_errors	ENST00000446760	ensembl	human	known	70_37	missense	SNP	0.001	C
NCOA6	23054	genome.wustl.edu	37	20	33328193	33328193	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr20:33328193G>A	ENST00000374796.2	-	12	8437	c.5867C>T	c.(5866-5868)tCc>tTc	p.S1956F	NCOA6_ENST00000359003.2_Missense_Mutation_p.S1956F			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1956	EP300/CRSP3-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						TTCTGGATGGGATCCCACCTT	0.502																																																	0													72.0	62.0	65.0					20																	33328193		2203	4300	6503	SO:0001583	missense	23054			AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.5867C>T	20.37:g.33328193G>A	ENSP00000363929:p.Ser1956Phe		A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Missense_Mutation	SNP	NULL	p.S1956F	ENST00000374796.2	37	c.5867	CCDS13241.1	20	.	.	.	.	.	.	.	.	.	.	G	15.40	2.820963	0.50633	.	.	ENSG00000198646	ENST00000374796;ENST00000359003	T;T	0.24350	1.86;1.86	5.27	5.27	0.74061	.	0.117418	0.37577	N	0.002039	T	0.20941	0.0504	N	0.14661	0.345	0.36250	D	0.853873	B	0.22480	0.07	B	0.31016	0.123	T	0.19844	-1.0293	10	0.66056	D	0.02	-2.2549	17.2575	0.87061	0.0:0.0:1.0:0.0	.	1956	Q14686	NCOA6_HUMAN	F	1956	ENSP00000363929:S1956F;ENSP00000351894:S1956F	ENSP00000351894:S1956F	S	-	2	0	NCOA6	32791854	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.129000	0.42055	2.758000	0.94735	0.561000	0.74099	TCC	NCOA6	-	NULL		0.502	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA6	HGNC	protein_coding	OTTHUMT00000078811.2	G	NM_014071		33328193	-1	no_errors	ENST00000359003	ensembl	human	known	70_37	missense	SNP	1.000	A
NDUFS3	4722	genome.wustl.edu	37	11	47602402	47602402	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr11:47602402G>A	ENST00000263774.4	+	4	329	c.247G>A	c.(247-249)Gag>Aag	p.E83K	NDUFS3_ENST00000528192.1_Missense_Mutation_p.E83K|KBTBD4_ENST00000430070.2_5'Flank|KBTBD4_ENST00000395288.2_5'Flank|NDUFS3_ENST00000533507.1_3'UTR|KBTBD4_ENST00000533290.1_5'Flank|NDUFS3_ENST00000534716.2_Missense_Mutation_p.E83K|KBTBD4_ENST00000526005.1_5'Flank|NDUFS3_ENST00000534208.1_3'UTR|KBTBD4_ENST00000525720.1_5'Flank	NM_004551.2	NP_004542.1	O75489	NDUS3_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)	83					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of cell growth (GO:0030308)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|NADH dehydrogenase activity (GO:0003954)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)	9					Doxorubicin(DB00997)	CTGCTTCAATGAGTTAGAGGT	0.493																																					Pancreas(15;551 601 22438 23457 52512)												0													204.0	173.0	183.0					11																	47602402		2201	4298	6499	SO:0001583	missense	4722			AF067139	CCDS7941.1	11p11.11	2011-08-03	2002-08-29		ENSG00000213619	ENSG00000213619	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7710	protein-coding gene	gene with protein product	"""complex I 30kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 3, mitochondrial"""	603846	"""NADH dehydrogenase (ubiquinone) Fe-S protein 3 (30kD) (NADH-coenzyme Q reductase)"""			9763677	Standard	NM_004551		Approved	CI-30	uc001nga.2	O75489	OTTHUMG00000166893	ENST00000263774.4:c.247G>A	11.37:g.47602402G>A	ENSP00000263774:p.Glu83Lys		B2R9J1|B4DFM8|Q9UNQ8	Missense_Mutation	SNP	pfam_NADH_UbQ_OxRdtase_30kDa_su,tigrfam_NADH_DH_suC	p.E83K	ENST00000263774.4	37	c.247	CCDS7941.1	11	.	.	.	.	.	.	.	.	.	.	G	20.9	4.068295	0.76301	.	.	ENSG00000213619	ENST00000263774;ENST00000528192;ENST00000530295;ENST00000534716	D;T;D	0.86694	-2.16;2.25;-2.16	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	D	0.90909	0.7143	M	0.89534	3.04	0.80722	D	1	B;B;B	0.33940	0.122;0.433;0.235	B;B;B	0.35039	0.081;0.194;0.162	D	0.90800	0.4693	10	0.72032	D	0.01	-16.5821	20.2789	0.98501	0.0:0.0:1.0:0.0	.	83;83;9	B4DFM8;O75489;Q9UF24	.;NDUS3_HUMAN;.	K	83;83;61;83	ENSP00000263774:E83K;ENSP00000432099:E83K;ENSP00000434970:E83K	ENSP00000263774:E83K	E	+	1	0	NDUFS3	47558978	1.000000	0.71417	1.000000	0.80357	0.565000	0.35776	9.476000	0.97823	2.788000	0.95919	0.650000	0.86243	GAG	NDUFS3	-	NULL		0.493	NDUFS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFS3	HGNC	protein_coding	OTTHUMT00000391749.1	G	NM_004551		47602402	+1	no_errors	ENST00000263774	ensembl	human	known	70_37	missense	SNP	1.000	A
NFKB1	4790	genome.wustl.edu	37	4	103518705	103518705	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr4:103518705G>A	ENST00000505458.1	+	15	1798	c.1521G>A	c.(1519-1521)caG>caA	p.Q507Q	NFKB1_ENST00000600343.1_Silent_p.Q327Q|NFKB1_ENST00000226574.4_Silent_p.Q508Q|NFKB1_ENST00000394820.4_Silent_p.Q507Q			P19838	NFKB1_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1	507	Interaction with CFLAR.				apoptotic process (GO:0006915)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nicotine (GO:0071316)|cellular response to peptide hormone stimulus (GO:0071375)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of cytokine production (GO:0001818)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-12 biosynthetic process (GO:0045083)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|response to copper ion (GO:0046688)|response to oxidative stress (GO:0006979)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I-kappaB/NF-kappaB complex (GO:0033256)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleic acid binding transcription factor activity (GO:0001071)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			biliary_tract(1)|breast(4)|endometrium(2)|large_intestine(6)|lung(7)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	27		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.59e-08)	Acetylsalicylic acid(DB00945)|Pranlukast(DB01411)|Thalidomide(DB01041)|Triflusal(DB08814)	AGGCTATGCAGCTTGCAAAGA	0.493																																																	0													110.0	100.0	104.0					4																	103518705		2203	4300	6503	SO:0001819	synonymous_variant	4790			M58603	CCDS3657.1, CCDS54783.1	4q24	2013-01-10	2008-07-28		ENSG00000109320	ENSG00000109320		"""Ankyrin repeat domain containing"""	7794	protein-coding gene	gene with protein product		164011				1992489	Standard	NM_003998		Approved	KBF1, p105, NFKB-p50, p50, NF-kappaB, NFkappaB, NF-kB1	uc011cep.2	P19838	OTTHUMG00000161080	ENST00000505458.1:c.1521G>A	4.37:g.103518705G>A			A8K5Y5|B3KVE8|Q68D84|Q86V43|Q8N4X7|Q9NZC0	Silent	SNP	pfam_RHD,pfam_Ankyrin_rpt,pfam_Death,superfamily_p53-like_TF_DNA-bd,superfamily_Ankyrin_rpt-contain_dom,superfamily_Ig_E-set,superfamily_DEATH-like,smart_IPT_TIG_rcpt,smart_Ankyrin_rpt,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_RHD,prints_NF_Rel_dor,prints_Ankyrin_rpt	p.Q508	ENST00000505458.1	37	c.1524	CCDS54783.1	4																																																																																			NFKB1	-	NULL		0.493	NFKB1-003	KNOWN	alternative_5_UTR|non_canonical_polymorphism|basic|appris_candidate|CCDS	protein_coding	NFKB1	HGNC	protein_coding	OTTHUMT00000363411.1	G			103518705	+1	no_errors	ENST00000226574	ensembl	human	known	70_37	silent	SNP	1.000	A
NLRC3	197358	genome.wustl.edu	37	16	3594300	3594300	+	RNA	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr16:3594300C>G	ENST00000301749.7	-	0	3206				LA16c-390H2.4_ENST00000573820.1_RNA|NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000603507.1_RNA|NLRC3_ENST00000448023.2_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CGCACACGCTCCGTCATCCCC	0.592																																																	0													72.0	77.0	75.0					16																	3594300		2097	4226	6323			197358			BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		16.37:g.3594300C>G			Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase	p.G980A	ENST00000301749.7	37	c.2939		16	.	.	.	.	.	.	.	.	.	.	C	16.38	3.108432	0.56291	.	.	ENSG00000167984	ENST00000301749;ENST00000359128;ENST00000448023	T;T;T	0.76578	-1.03;-1.03;-1.03	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	D	0.89241	0.6659	M	0.90198	3.095	0.26403	N	0.976381	D	0.89917	1.0	D	0.87578	0.998	T	0.82868	-0.0244	10	0.34782	T	0.22	.	14.3517	0.66708	0.0:1.0:0.0:0.0	.	980	C9JLH9	.	A	934;905;980	ENSP00000301749:G934A;ENSP00000352039:G905A;ENSP00000414415:G980A	ENSP00000301749:G934A	G	-	2	0	NLRC3	3534301	0.998000	0.40836	0.644000	0.29465	0.201000	0.24016	5.371000	0.66150	2.769000	0.95229	0.644000	0.83932	GGA	NLRC3	-	smart_Leu-rich_rpt_RNase_inh_sub-typ		0.592	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	NLRC3	HGNC	polymorphic_pseudogene		C	NM_178844		3594300	-1	no_errors	ENST00000448023	ensembl	human	known	70_37	missense	SNP	0.875	G
NLRP14	338323	genome.wustl.edu	37	11	7083724	7083724	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr11:7083724C>T	ENST00000299481.4	+	10	3311	c.2965C>T	c.(2965-2967)Cag>Tag	p.Q989*		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	989					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		CTGTAACATTCAGAGGCTCGG	0.403																																																	0													131.0	122.0	125.0					11																	7083724		2201	4296	6497	SO:0001587	stop_gained	338323			BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.2965C>T	11.37:g.7083724C>T	ENSP00000299481:p.Gln989*		Q7RTR6	Nonsense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.Q989*	ENST00000299481.4	37	c.2965	CCDS7776.1	11	.	.	.	.	.	.	.	.	.	.	C	42	9.210843	0.99101	.	.	ENSG00000158077	ENST00000299481	.	.	.	4.84	0.398	0.16319	.	0.191128	0.25916	N	0.027477	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	.	8.5211	0.33275	0.0:0.4206:0.4894:0.09	.	.	.	.	X	989	.	ENSP00000299481:Q989X	Q	+	1	0	NLRP14	7040300	0.002000	0.14202	0.954000	0.39281	0.773000	0.43773	-0.087000	0.11215	-0.002000	0.14469	0.655000	0.94253	CAG	NLRP14	-	smart_Leu-rich_rpt_RNase_inh_sub-typ		0.403	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP14	HGNC	protein_coding	OTTHUMT00000384551.1	C	NM_176822		7083724	+1	no_errors	ENST00000299481	ensembl	human	known	70_37	nonsense	SNP	0.993	T
NOL3	8996	genome.wustl.edu	37	16	67208229	67208229	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr16:67208229G>C	ENST00000568146.1	+	2	210	c.157G>C	c.(157-159)Gat>Cat	p.D53H	NOL3_ENST00000268605.7_Missense_Mutation_p.D53H|KIAA0895L_ENST00000563831.2_5'Flank|NOL3_ENST00000564053.1_Missense_Mutation_p.D115H|NOL3_ENST00000432069.2_Missense_Mutation_p.D53H			O60936	NOL3_HUMAN	nucleolar protein 3 (apoptosis repressor with CARD domain)	53	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of gene expression (GO:0010468)|response to hypoxia (GO:0001666)|response to injury involved in regulation of muscle adaptation (GO:0014876)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|sarcoplasm (GO:0016528)	identical protein binding (GO:0042802)|RNA binding (GO:0003723)			ovary(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		TGCACTGCCTGATGCCGAGCG	0.716																																																	0													8.0	10.0	10.0					16																	67208229		2065	4164	6229	SO:0001583	missense	8996			AF043244	CCDS42176.1, CCDS58473.1, CCDS61960.1	16q22.1	2008-08-27				ENSG00000140939			7869	protein-coding gene	gene with protein product		605235				9560245	Standard	NM_001276312		Approved	ARC, NOP30, MYP, CARD2	uc010vjd.3	O60936		ENST00000568146.1:c.157G>C	16.37:g.67208229G>C	ENSP00000454598:p.Asp53His		B4DFL0|O60937	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like,smart_CARD,pfscan_CARD	p.D53H	ENST00000568146.1	37	c.157	CCDS58473.1	16	.	.	.	.	.	.	.	.	.	.	g	13.01	2.109467	0.37242	.	.	ENSG00000140939	ENST00000432069;ENST00000268605	T;T	0.20881	2.04;2.04	4.93	3.98	0.46160	DEATH-like (2);Caspase Recruitment (3);	0.215770	0.31897	N	0.006881	T	0.37156	0.0993	L	0.54323	1.7	0.21256	N	0.999746	D;D	0.76494	0.999;0.999	D;D	0.71870	0.975;0.966	T	0.09400	-1.0676	10	0.87932	D	0	-5.6303	9.2774	0.37707	0.101:0.0:0.899:0.0	.	53;115	O60936;B4DFL0	NOL3_HUMAN;.	H	53	ENSP00000399831:D53H;ENSP00000268605:D53H	ENSP00000268605:D53H	D	+	1	0	NOL3	65765730	0.981000	0.34729	0.068000	0.19968	0.025000	0.11179	3.692000	0.54727	1.092000	0.41356	-0.401000	0.06369	GAT	NOL3	-	pfam_CARD,superfamily_DEATH-like,smart_CARD,pfscan_CARD		0.716	NOL3-003	KNOWN	basic|CCDS	protein_coding	NOL3	HGNC	protein_coding	OTTHUMT00000422746.1	G			67208229	+1	no_errors	ENST00000568146	ensembl	human	known	70_37	missense	SNP	0.320	C
NOTCH2	4853	genome.wustl.edu	37	1	120458453	120458453	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:120458453G>A	ENST00000256646.2	-	34	7111	c.6892C>T	c.(6892-6894)Cgg>Tgg	p.R2298W		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	2298					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAGGGCTCCCGAGGGGTGGTT	0.612			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																															Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0													59.0	63.0	62.0					1																	120458453		2203	4299	6502	SO:0001583	missense	4853	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.6892C>T	1.37:g.120458453G>A	ENSP00000256646:p.Arg2298Trp		Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	pirsf_Notch,pfam_EG-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,pfam_EGF_extracell,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_2,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.R2298W	ENST00000256646.2	37	c.6892	CCDS908.1	1	.	.	.	.	.	.	.	.	.	.	G	16.69	3.192482	0.58017	.	.	ENSG00000134250	ENST00000256646	D	0.83506	-1.73	5.5	5.5	0.81552	.	0.238762	0.21720	U	0.070137	T	0.76248	0.3961	L	0.36672	1.1	0.58432	D	0.999992	D	0.71674	0.998	P	0.49387	0.609	T	0.80339	-0.1424	10	0.72032	D	0.01	.	13.9444	0.64075	0.0:0.0:0.8384:0.1616	.	2298	Q04721	NOTC2_HUMAN	W	2298	ENSP00000256646:R2298W	ENSP00000256646:R2298W	R	-	1	2	NOTCH2	120259976	0.272000	0.24172	0.986000	0.45419	0.946000	0.59487	1.200000	0.32247	2.588000	0.87417	0.561000	0.74099	CGG	NOTCH2	-	pirsf_Notch,prints_Notch_2		0.612	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH2	HGNC	protein_coding	OTTHUMT00000033679.1	G	NM_024408		120458453	-1	no_errors	ENST00000256646	ensembl	human	known	70_37	missense	SNP	0.981	A
NPC1L1	29881	genome.wustl.edu	37	7	44561742	44561742	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr7:44561742C>T	ENST00000289547.4	-	11	2792	c.2737G>A	c.(2737-2739)Gag>Aag	p.E913K	NPC1L1_ENST00000546276.1_Missense_Mutation_p.E867K|NPC1L1_ENST00000381160.3_Missense_Mutation_p.E913K	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	913					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	ATCCCAGCCTCGCTGGAGAAG	0.542																																																	0													86.0	81.0	83.0					7																	44561742		2203	4300	6503	SO:0001583	missense	29881				CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.2737G>A	7.37:g.44561742C>T	ENSP00000289547:p.Glu913Lys		A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.E913K	ENST00000289547.4	37	c.2737	CCDS5491.1	7	.	.	.	.	.	.	.	.	.	.	.	0.240	-1.014237	0.02095	.	.	ENSG00000015520	ENST00000289547;ENST00000381160;ENST00000546276	D;D;D	0.94046	-3.34;-3.34;-3.2	5.2	-2.28	0.06826	.	0.781728	0.12088	N	0.500653	D	0.84092	0.5396	L	0.42744	1.35	0.09310	N	1	B;B;B	0.27765	0.146;0.005;0.188	B;B;B	0.15870	0.011;0.005;0.014	T	0.70450	-0.4868	10	0.07175	T	0.84	-6.3521	4.6129	0.12411	0.2173:0.287:0.0:0.4957	.	867;913;913	B7ZLE6;Q17RV5;D3DVK9	.;.;.	K	913;913;867	ENSP00000289547:E913K;ENSP00000370552:E913K;ENSP00000438033:E867K	ENSP00000289547:E913K	E	-	1	0	NPC1L1	44528267	0.000000	0.05858	0.001000	0.08648	0.308000	0.27856	-0.568000	0.05909	-0.078000	0.12730	-0.215000	0.12644	GAG	NPC1L1	-	NULL		0.542	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	NPC1L1	HGNC	protein_coding	OTTHUMT00000251256.1	C	NM_013389		44561742	-1	no_errors	ENST00000289547	ensembl	human	known	70_37	missense	SNP	0.001	T
NPIPA1	9284	genome.wustl.edu	37	16	15022324	15022324	+	3'UTR	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr16:15022324G>C	ENST00000472413.1	+	0	1828							Q9UND3	NPIA1_HUMAN	nuclear pore complex interacting protein family, member A1						mRNA transport (GO:0051028)|protein transport (GO:0015031)	nuclear pore (GO:0005643)											TGCAGGCAGAGACCACCGCGG	0.697																																																	0																																										SO:0001624	3_prime_UTR_variant	9284			AC002045	CCDS10557.1	16p13.11	2013-06-11	2013-06-11	2013-06-11	ENSG00000183426	ENSG00000183426			7909	protein-coding gene	gene with protein product		606406	"""nuclear pore complex interacting protein"""	NPIP		11586358, 18055785	Standard	NM_006985		Approved	morpheus	uc002dcy.4	Q9UND3	OTTHUMG00000090663	ENST00000472413.1:c.*1825G>C	16.37:g.15022324G>C			O15102	RNA	SNP	-	NULL	ENST00000472413.1	37	NULL		16																																																																																			NPIP	-	-		0.697	NPIPA1-002	KNOWN	basic|readthrough_transcript	processed_transcript	NPIP	HGNC	protein_coding	OTTHUMT00000207327.1	G	NM_006985		15022324	+1	no_errors	ENST00000472413	ensembl	human	known	70_37	rna	SNP	1.000	C
NRXN1	9378	genome.wustl.edu	37	2	50573974	50573974	+	Intron	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:50573974C>T	ENST00000406316.2	-	18	4841				NRXN1_ENST00000405472.3_Intron|NRXN1_ENST00000342183.5_Silent_p.P38P|NRXN1_ENST00000331040.5_Intron|NRXN1_ENST00000401710.1_Intron|NRXN1_ENST00000404971.1_Intron|NRXN1_ENST00000401669.2_Intron|NRXN1_ENST00000406859.3_Intron|NRXN1_ENST00000402717.3_Intron	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1						adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TGAGGGTGAGCGGGACTATCC	0.726																																																	0													30.0	26.0	27.0					2																	50573974		2202	4300	6502	SO:0001627	intron_variant	9378			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.3365-109866G>A	2.37:g.50573974C>T			A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Silent	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_Neurexin-like,pfscan_Laminin_G	p.P38	ENST00000406316.2	37	c.114	CCDS54360.1	2																																																																																			NRXN1	-	NULL		0.726	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	HGNC	protein_coding	OTTHUMT00000325291.2	C			50573974	-1	no_errors	ENST00000342183	ensembl	human	known	70_37	silent	SNP	0.992	T
NUMB	8650	genome.wustl.edu	37	14	73759577	73759577	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr14:73759577G>A	ENST00000355058.3	-	8	593	c.315C>T	c.(313-315)ctC>ctT	p.L105L	NUMB_ENST00000556772.1_5'UTR|NUMB_ENST00000454166.4_Silent_p.L105L|NUMB_ENST00000555738.2_Silent_p.L94L|NUMB_ENST00000544991.3_Silent_p.L105L|NUMB_ENST00000555394.1_Silent_p.L105L|NUMB_ENST00000554546.1_Silent_p.L94L|NUMB_ENST00000560335.1_Silent_p.L105L|NUMB_ENST00000555238.1_Silent_p.L105L|NUMB_ENST00000356296.4_Silent_p.L105L|NUMB_ENST00000554521.2_Silent_p.L94L|NUMB_ENST00000535282.1_Silent_p.L94L|NUMB_ENST00000359560.3_Silent_p.L94L|NUMB_ENST00000559312.1_Silent_p.L105L|NUMB_ENST00000557597.1_Silent_p.L94L			P49757	NUMB_HUMAN	numb homolog (Drosophila)	105	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|lateral ventricle development (GO:0021670)|lung epithelial cell differentiation (GO:0060487)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of protein localization to plasma membrane (GO:1903077)|neuroblast division in subventricular zone (GO:0021849)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration (GO:0030335)|positive regulation of neurogenesis (GO:0050769)|positive regulation of polarized epithelial cell differentiation (GO:0030862)	apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00471)|OV - Ovarian serous cystadenocarcinoma(108;0.161)		GGTCAACTATGAGGTCCTAGA	0.428																																																	0													83.0	79.0	80.0					14																	73759577		2203	4300	6503	SO:0001819	synonymous_variant	8650			L40393	CCDS9814.1, CCDS32115.1, CCDS32116.1, CCDS55927.1	14q24.3	2011-11-25	2001-11-28			ENSG00000133961			8060	protein-coding gene	gene with protein product		603728	"""numb (Drosophila) homolog"", ""chromosome 14 open reading frame 41"""	C14orf41			Standard	NM_003744		Approved		uc001xny.1	P49757		ENST00000355058.3:c.315C>T	14.37:g.73759577G>A			B1P2N5|B1P2N6|B1P2N7|B1P2N8|B1P2N9|B4E2B1|Q6NUQ7|Q86SY1|Q8WW73|Q9UBG1|Q9UEQ4|Q9UKE8|Q9UKE9|Q9UKF0|Q9UQJ4	Silent	SNP	pfam_Numb_domain,pfam_PTyr_interaction_dom,pfam_PTB,smart_PTyr_interaction_dom,pirsf_Numb/numb-like,pfscan_PTyr_interaction_dom	p.L105	ENST00000355058.3	37	c.315	CCDS32116.1	14																																																																																			NUMB	-	pfam_PTyr_interaction_dom,pfam_PTB,smart_PTyr_interaction_dom,pirsf_Numb/numb-like,pfscan_PTyr_interaction_dom		0.428	NUMB-201	KNOWN	basic|CCDS	protein_coding	NUMB	HGNC	protein_coding	OTTHUMT00000414416.1	G			73759577	-1	no_errors	ENST00000355058	ensembl	human	known	70_37	silent	SNP	1.000	A
NXPH3	11248	genome.wustl.edu	37	17	47656636	47656636	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:47656636G>C	ENST00000328741.5	+	2	1095	c.733G>C	c.(733-735)Gat>Cat	p.D245H	RP5-1029K10.4_ENST00000503624.1_RNA|NXPH3_ENST00000513748.1_Intron	NM_007225.2	NP_009156.2	O95157	NXPH3_HUMAN	neurexophilin 3	245	V (Cys-rich).				neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				endometrium(2)|large_intestine(3)|lung(4)|pancreas(1)|skin(2)	12	all_cancers(4;7.45e-14)|Breast(4;1.08e-27)|all_epithelial(4;2.27e-17)					CTACCATAGTGATACCCCCTA	0.597																																																	0													40.0	41.0	41.0					17																	47656636		2203	4300	6503	SO:0001583	missense	11248			AF043468	CCDS11550.1	17q	2008-07-03				ENSG00000182575			8077	protein-coding gene	gene with protein product		604636				9570794	Standard	NM_007225		Approved	NPH3	uc002ipa.3	O95157		ENST00000328741.5:c.733G>C	17.37:g.47656636G>C	ENSP00000329295:p.Asp245His		Q8NDC3|Q8TBF6|Q9ULR1	Missense_Mutation	SNP	pfam_NXPH/NXPE,pirsf_Neurexophilin	p.D245H	ENST00000328741.5	37	c.733	CCDS11550.1	17	.	.	.	.	.	.	.	.	.	.	G	14.82	2.648848	0.47362	.	.	ENSG00000182575	ENST00000328741	.	.	.	4.35	3.39	0.38822	.	0.374603	0.29822	N	0.011105	T	0.51449	0.1675	M	0.63428	1.95	0.23304	N	0.997945	P	0.46512	0.879	P	0.56398	0.797	T	0.40887	-0.9539	9	0.72032	D	0.01	-4.005	7.0553	0.25095	0.2771:0.0:0.7229:0.0	.	245	O95157	NXPH3_HUMAN	H	245	.	ENSP00000329295:D245H	D	+	1	0	NXPH3	45011635	0.903000	0.30736	0.914000	0.36105	0.973000	0.67179	2.826000	0.48104	1.053000	0.40415	0.561000	0.74099	GAT	NXPH3	-	pfam_NXPH/NXPE,pirsf_Neurexophilin		0.597	NXPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXPH3	HGNC	protein_coding	OTTHUMT00000365143.1	G			47656636	+1	no_errors	ENST00000328741	ensembl	human	known	70_37	missense	SNP	0.122	C
OBSCN	84033	genome.wustl.edu	37	1	228539032	228539032	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:228539032G>T	ENST00000422127.1	+	78	18474	c.18430G>T	c.(18430-18432)Gac>Tac	p.D6144Y	OBSCN_ENST00000366707.4_Missense_Mutation_p.D3778Y|OBSCN_ENST00000284548.11_Missense_Mutation_p.D6144Y|OBSCN_ENST00000570156.2_Missense_Mutation_p.D7101Y|OBSCN_ENST00000366709.4_Missense_Mutation_p.D3263Y	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	6144	Ig-like 53.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GTGGTACAAGGACGGGGCCCT	0.642																																																	0													24.0	30.0	28.0					1																	228539032		2073	4164	6237	SO:0001583	missense	84033			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.18430G>T	1.37:g.228539032G>T	ENSP00000409493:p.Asp6144Tyr		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.D6144Y	ENST00000422127.1	37	c.18430	CCDS58065.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.90|19.90	3.913363|3.913363	0.72983|0.72983	.|.	.|.	ENSG00000154358|ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709|ENST00000441106	T;T;T;T|.	0.75938|.	-0.98;1.25;-0.98;1.25|.	5.34|5.34	5.34|5.34	0.76211|0.76211	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.000000|.	0.64402|.	D|.	0.000001|.	D|D	0.86640|0.86640	0.5981|0.5981	M|M	0.92784|0.92784	3.345|3.345	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.77557|.	0.99;0.983|.	D|D	0.89750|0.89750	0.3939|0.3939	10|5	0.87932|.	D|.	0|.	.|.	19.0276|19.0276	0.92939|0.92939	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	6144;6144|.	Q5VST9;Q5VST9-3|.	OBSCN_HUMAN;.|.	Y|V	6144;6144;3778;3263|760	ENSP00000284548:D6144Y;ENSP00000409493:D6144Y;ENSP00000355668:D3778Y;ENSP00000355670:D3263Y|.	ENSP00000284548:D6144Y|.	D|G	+|+	1|2	0|0	OBSCN|OBSCN	226605655|226605655	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.076000|0.076000	0.17211|0.17211	6.239000|6.239000	0.72356|0.72356	2.523000|2.523000	0.85059|0.85059	0.491000|0.491000	0.48974|0.48974	GAC|GGA	OBSCN	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like		0.642	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		G	NM_052843		228539032	+1	no_errors	ENST00000422127	ensembl	human	known	70_37	missense	SNP	1.000	T
OR11H12	440153	genome.wustl.edu	37	14	19377728	19377728	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr14:19377728C>T	ENST00000550708.1	+	1	207	c.135C>T	c.(133-135)ctC>ctT	p.L45L		NM_001013354.1|NM_001197287.1	NP_001013372.1|NP_001184216.1	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H, member 12	45						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TCTTCTCACTCTTTACTACAA	0.423																																																	0													58.0	62.0	61.0					14																	19377728		2196	4293	6489	SO:0001819	synonymous_variant	440153				CCDS32017.1	14q11.2	2013-01-25			ENSG00000257115	ENSG00000257115		"""GPCR / Class A : Olfactory receptors"""	30738	protein-coding gene	gene with protein product							Standard	NM_001013354		Approved		uc010tkp.2	B2RN74	OTTHUMG00000170298	ENST00000550708.1:c.135C>T	14.37:g.19377728C>T				Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L45	ENST00000550708.1	37	c.135	CCDS32017.1	14																																																																																			OR11H12	-	prints_GPCR_Rhodpsn		0.423	OR11H12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11H12	HGNC	protein_coding	OTTHUMT00000408402.1	C	NM_001013354		19377728	+1	no_errors	ENST00000550708	ensembl	human	known	70_37	silent	SNP	0.982	T
OR13C9	286362	genome.wustl.edu	37	9	107379792	107379792	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr9:107379792C>G	ENST00000259362.1	-	1	693	c.694G>C	c.(694-696)Gag>Cag	p.E232Q		NM_001001956.1	NP_001001956.1	Q8NGT0	O13C9_HUMAN	olfactory receptor, family 13, subfamily C, member 9	232						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(9)|prostate(1)|skin(4)	22						CTTCTCCCCTCAGAGGAGTGA	0.428																																																	0													77.0	75.0	75.0					9																	107379792		2202	4300	6502	SO:0001583	missense	286362				CCDS35093.1	9q31.1	2013-09-24			ENSG00000136839	ENSG00000136839		"""GPCR / Class A : Olfactory receptors"""	15104	protein-coding gene	gene with protein product							Standard	NM_001001956		Approved		uc011lvr.2	Q8NGT0	OTTHUMG00000020416	ENST00000259362.1:c.694G>C	9.37:g.107379792C>G	ENSP00000259362:p.Glu232Gln		Q6IFL2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.E232Q	ENST00000259362.1	37	c.694	CCDS35093.1	9	.	.	.	.	.	.	.	.	.	.	C	11.32	1.602652	0.28534	.	.	ENSG00000136839	ENST00000259362	T	0.00076	8.76	4.46	3.56	0.40772	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	D	0.000198	T	0.00210	0.0006	L	0.60012	1.86	0.09310	N	1	B	0.29552	0.248	B	0.37731	0.257	T	0.13308	-1.0514	10	0.52906	T	0.07	.	6.9863	0.24731	0.0:0.7974:0.0:0.2026	.	232	Q8NGT0	O13C9_HUMAN	Q	232	ENSP00000259362:E232Q	ENSP00000259362:E232Q	E	-	1	0	OR13C9	106419613	0.050000	0.20438	0.995000	0.50966	0.972000	0.66771	0.732000	0.26072	1.077000	0.40990	-0.135000	0.14842	GAG	OR13C9	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.428	OR13C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C9	HGNC	protein_coding	OTTHUMT00000053490.1	C			107379792	-1	no_errors	ENST00000259362	ensembl	human	known	70_37	missense	SNP	0.248	G
OR51D1	390038	genome.wustl.edu	37	11	4661050	4661050	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr11:4661050C>T	ENST00000357605.2	+	1	106	c.30C>T	c.(28-30)atC>atT	p.I10I		NM_001004751.2	NP_001004751.1	Q8NGF3	O51D1_HUMAN	olfactory receptor, family 51, subfamily D, member 1	10						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|liver(2)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	27		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGGTCCCTATCATAGCCACTT	0.488																																																	0													146.0	139.0	141.0					11																	4661050		2201	4298	6499	SO:0001819	synonymous_variant	390038			AB065855	CCDS31357.1	11p15.4	2012-08-09			ENSG00000197428	ENSG00000197428		"""GPCR / Class A : Olfactory receptors"""	15193	protein-coding gene	gene with protein product							Standard	NM_001004751		Approved	OR51D1Q	uc010qyk.2	Q8NGF3	OTTHUMG00000165724	ENST00000357605.2:c.30C>T	11.37:g.4661050C>T			B9EIK4	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I10	ENST00000357605.2	37	c.30	CCDS31357.1	11																																																																																			OR51D1	-	NULL		0.488	OR51D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51D1	HGNC	protein_coding	OTTHUMT00000385956.1	C	NM_001004751		4661050	+1	no_errors	ENST00000357605	ensembl	human	known	70_37	silent	SNP	0.007	T
OR5L2	26338	genome.wustl.edu	37	11	55595001	55595001	+	Silent	SNP	T	T	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr11:55595001T>C	ENST00000378397.1	+	1	307	c.307T>C	c.(307-309)Ttg>Ctg	p.L103L		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	103						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				GCAATTCTACTTGTTTTGCAC	0.473										HNSCC(27;0.073)																																							0													188.0	178.0	181.0					11																	55595001		2200	4296	6496	SO:0001819	synonymous_variant	26338			AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product						1370859	Standard	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812	ENST00000378397.1:c.307T>C	11.37:g.55595001T>C			Q6IF66|Q96RB2	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L103	ENST00000378397.1	37	c.307	CCDS31511.1	11																																																																																			OR5L2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.473	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5L2	HGNC	protein_coding	OTTHUMT00000391516.1	T	NM_001004739		55595001	+1	no_errors	ENST00000378397	ensembl	human	known	70_37	silent	SNP	0.006	C
OR1S1	219959	genome.wustl.edu	37	11	57982597	57982597	+	Silent	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr11:57982597C>G	ENST00000309433.6	+	1	381	c.381C>G	c.(379-381)ctC>ctG	p.L127L		NM_001004458.1	NP_001004458.1	Q8NH92	OR1S1_HUMAN	olfactory receptor, family 1, subfamily S, member 1	127						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(24)|kidney(1)|large_intestine(1)|liver(1)|lung(10)|prostate(1)|skin(2)|stomach(3)|urinary_tract(3)	48		Breast(21;0.0589)				ACAATTTGCTCTTGGGGACCA	0.448																																																	0													183.0	173.0	176.0					11																	57982597		2201	4296	6497	SO:0001819	synonymous_variant	219959			BK004299	CCDS31546.1	11q12.1	2012-08-09			ENSG00000172774	ENSG00000172774		"""GPCR / Class A : Olfactory receptors"""	8227	protein-coding gene	gene with protein product							Standard	NM_001004458		Approved	OST034	uc010rkc.2	Q8NH92	OTTHUMG00000167463	ENST00000309433.6:c.381C>G	11.37:g.57982597C>G			Q6IFG3	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L127	ENST00000309433.6	37	c.381	CCDS31546.1	11																																																																																			OR1S1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.448	OR1S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1S1	HGNC	protein_coding	OTTHUMT00000394705.1	C	NM_001004458		57982597	+1	no_errors	ENST00000309433	ensembl	human	known	70_37	silent	SNP	0.000	G
OR6N1	128372	genome.wustl.edu	37	1	158735560	158735560	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:158735560G>A	ENST00000335094.2	-	1	932	c.913C>T	c.(913-915)Cta>Tta	p.L305L		NM_001005185.1	NP_001005185.1	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N, member 1	305						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_hematologic(112;0.0378)					ATTCTCTTTAGCTGCCTCCTC	0.572																																																	0													149.0	145.0	146.0					1																	158735560		2203	4300	6503	SO:0001819	synonymous_variant	128372			BK004199	CCDS30905.1	1q23.1	2012-08-09			ENSG00000197403	ENSG00000197403		"""GPCR / Class A : Olfactory receptors"""	15034	protein-coding gene	gene with protein product							Standard	NM_001005185		Approved		uc010piq.2	Q8NGY5	OTTHUMG00000022774	ENST00000335094.2:c.913C>T	1.37:g.158735560G>A			Q5VUU8|Q96R35	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L305	ENST00000335094.2	37	c.913	CCDS30905.1	1																																																																																			OR6N1	-	NULL		0.572	OR6N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6N1	HGNC	protein_coding	OTTHUMT00000059067.1	G	NM_001005185		158735560	-1	no_errors	ENST00000335094	ensembl	human	known	70_37	silent	SNP	0.101	A
OR6N1	128372	genome.wustl.edu	37	1	158735609	158735609	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:158735609G>A	ENST00000335094.2	-	1	883	c.864C>T	c.(862-864)ttC>ttT	p.F288F		NM_001005185.1	NP_001005185.1	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N, member 1	288						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_hematologic(112;0.0378)					AGCTGTAGATGAAGGGGTTGA	0.527																																																	0													165.0	160.0	162.0					1																	158735609		2203	4300	6503	SO:0001819	synonymous_variant	128372			BK004199	CCDS30905.1	1q23.1	2012-08-09			ENSG00000197403	ENSG00000197403		"""GPCR / Class A : Olfactory receptors"""	15034	protein-coding gene	gene with protein product							Standard	NM_001005185		Approved		uc010piq.2	Q8NGY5	OTTHUMG00000022774	ENST00000335094.2:c.864C>T	1.37:g.158735609G>A			Q5VUU8|Q96R35	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F288	ENST00000335094.2	37	c.864	CCDS30905.1	1																																																																																			OR6N1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn		0.527	OR6N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6N1	HGNC	protein_coding	OTTHUMT00000059067.1	G	NM_001005185		158735609	-1	no_errors	ENST00000335094	ensembl	human	known	70_37	silent	SNP	1.000	A
OR6N1	128372	genome.wustl.edu	37	1	158736267	158736267	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:158736267G>A	ENST00000335094.2	-	1	225	c.206C>T	c.(205-207)tCa>tTa	p.S69L		NM_001005185.1	NP_001005185.1	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N, member 1	69						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_hematologic(112;0.0378)					GCCAAGCTCTGAGAAGGAGAG	0.498																																																	0													88.0	84.0	85.0					1																	158736267		2203	4300	6503	SO:0001583	missense	128372			BK004199	CCDS30905.1	1q23.1	2012-08-09			ENSG00000197403	ENSG00000197403		"""GPCR / Class A : Olfactory receptors"""	15034	protein-coding gene	gene with protein product							Standard	NM_001005185		Approved		uc010piq.2	Q8NGY5	OTTHUMG00000022774	ENST00000335094.2:c.206C>T	1.37:g.158736267G>A	ENSP00000335535:p.Ser69Leu		Q5VUU8|Q96R35	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S69L	ENST00000335094.2	37	c.206	CCDS30905.1	1	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.569417	0.00133	.	.	ENSG00000197403	ENST00000335094	T	0.00784	5.7	5.1	3.98	0.46160	GPCR, rhodopsin-like superfamily (1);	0.444320	0.16288	N	0.221006	T	0.00073	0.0002	N	0.00133	-2.03	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.14504	-1.0470	10	0.06757	T	0.87	-1.4837	9.3285	0.38008	0.912:0.0:0.088:0.0	.	69	Q8NGY5	OR6N1_HUMAN	L	69	ENSP00000335535:S69L	ENSP00000335535:S69L	S	-	2	0	OR6N1	157002891	0.000000	0.05858	0.126000	0.21872	0.149000	0.21700	1.102000	0.31050	0.956000	0.37904	-0.302000	0.09304	TCA	OR6N1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.498	OR6N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6N1	HGNC	protein_coding	OTTHUMT00000059067.1	G	NM_001005185		158736267	-1	no_errors	ENST00000335094	ensembl	human	known	70_37	missense	SNP	0.005	A
OR6N1	128372	genome.wustl.edu	37	1	158736386	158736386	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:158736386G>A	ENST00000335094.2	-	1	106	c.87C>T	c.(85-87)ctC>ctT	p.L29L		NM_001005185.1	NP_001005185.1	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N, member 1	29						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_hematologic(112;0.0378)					GAAGCAACAAGAGGAAGAGAT	0.502																																																	0													81.0	79.0	80.0					1																	158736386		2203	4300	6503	SO:0001819	synonymous_variant	128372			BK004199	CCDS30905.1	1q23.1	2012-08-09			ENSG00000197403	ENSG00000197403		"""GPCR / Class A : Olfactory receptors"""	15034	protein-coding gene	gene with protein product							Standard	NM_001005185		Approved		uc010piq.2	Q8NGY5	OTTHUMG00000022774	ENST00000335094.2:c.87C>T	1.37:g.158736386G>A			Q5VUU8|Q96R35	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L29	ENST00000335094.2	37	c.87	CCDS30905.1	1																																																																																			OR6N1	-	prints_GPCR_Rhodpsn		0.502	OR6N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6N1	HGNC	protein_coding	OTTHUMT00000059067.1	G	NM_001005185		158736386	-1	no_errors	ENST00000335094	ensembl	human	known	70_37	silent	SNP	0.002	A
OSTM1	28962	genome.wustl.edu	37	6	108365368	108365368	+	3'UTR	SNP	G	G	C	rs542711668		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr6:108365368G>C	ENST00000193322.3	-	0	1711				OSTM1_ENST00000492130.1_5'UTR	NM_014028.3	NP_054747.2	Q86WC4	OSTM1_HUMAN	osteopetrosis associated transmembrane protein 1						ion transmembrane transport (GO:0034220)|osteoclast differentiation (GO:0030316)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	8		all_cancers(87;3.82e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000195)|Colorectal(196;0.0293)|all_lung(197;0.0938)		BRCA - Breast invasive adenocarcinoma(108;0.0131)|Epithelial(106;0.0438)|OV - Ovarian serous cystadenocarcinoma(136;0.0571)|all cancers(137;0.0581)		AGTCAAGTAAGAAACCAGTTA	0.264																																					Melanoma(162;1427 1909 3096 17430 21396)												0																																										SO:0001624	3_prime_UTR_variant	28962			AF533891	CCDS5062.1	6q21	2014-06-17			ENSG00000081087	ENSG00000081087			21652	protein-coding gene	gene with protein product	"""CLCN7 accessory beta subunit"""	607649				12627228, 21527911	Standard	NM_014028		Approved	HSPC019, GL	uc003psd.3	Q86WC4	OTTHUMG00000015317	ENST00000193322.3:c.*621C>G	6.37:g.108365368G>C			E1P5E3|Q5R391|Q6PCA7|Q7RTW6|Q8NC29|Q8TC82|Q9Y2S9	RNA	SNP	-	NULL	ENST00000193322.3	37	NULL	CCDS5062.1	6																																																																																			OSTM1	-	-		0.264	OSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSTM1	HGNC	protein_coding	OTTHUMT00000041709.3	G	NM_014028		108365368	-1	no_errors	ENST00000492130	ensembl	human	known	70_37	rna	SNP	1.000	C
OXLD1	339229	genome.wustl.edu	37	17	79632238	79632238	+	Missense_Mutation	SNP	C	C	T	rs573397609	byFrequency	TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:79632238C>T	ENST00000374741.3	-	2	447	c.437G>A	c.(436-438)gGa>gAa	p.G146E	CCDC137_ENST00000329214.8_5'Flank|OXLD1_ENST00000571503.1_3'UTR|OXLD1_ENST00000573786.1_5'UTR|PDE6G_ENST00000574777.1_5'Flank|PDE6G_ENST00000571224.1_5'Flank	NM_001039842.1	NP_001034931.1	Q5BKU9	OXLD1_HUMAN	oxidoreductase-like domain containing 1	146						mitochondrion (GO:0005739)											GGCTCAGCCTCCGCACCTGGT	0.657													C|||	4	0.000798722	0.0	0.0	5008	,	,		15699	0.0		0.0	False		,,,				2504	0.0041																0													38.0	39.0	38.0					17																	79632238		2203	4300	6503	SO:0001583	missense	339229				CCDS32766.1	17q25.3	2012-07-20	2012-07-20	2012-07-20	ENSG00000204237	ENSG00000204237			27901	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 90"""	C17orf90			Standard	NM_001039842		Approved	MGC104712	uc002kba.3	Q5BKU9	OTTHUMG00000178063	ENST00000374741.3:c.437G>A	17.37:g.79632238C>T	ENSP00000363873:p.Gly146Glu		A6ND24	Missense_Mutation	SNP	pfam_Oxidoreductase-like_N	p.G146E	ENST00000374741.3	37	c.437	CCDS32766.1	17	.	.	.	.	.	.	.	.	.	.	C	14.30	2.494944	0.44352	.	.	ENSG00000204237	ENST00000374741	.	.	.	4.65	1.0	0.19881	.	0.823089	0.10013	N	0.726989	T	0.34106	0.0886	L	0.51422	1.61	0.09310	N	1	B	0.12013	0.005	B	0.11329	0.006	T	0.37526	-0.9702	9	0.87932	D	0	-7.6468	4.6896	0.12774	0.0:0.4381:0.1623:0.3996	.	146	Q5BKU9	CQ090_HUMAN	E	146	.	ENSP00000363873:G146E	G	-	2	0	C17orf90	77242643	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.636000	0.24644	0.416000	0.25844	-0.768000	0.03414	GGA	OXLD1	-	NULL		0.657	OXLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OXLD1	HGNC	protein_coding	OTTHUMT00000440380.1	C	NM_001039842		79632238	-1	no_errors	ENST00000374741	ensembl	human	known	70_37	missense	SNP	0.000	T
PARD6B	84612	genome.wustl.edu	37	20	49366649	49366649	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr20:49366649C>T	ENST00000371610.2	+	3	986	c.743C>T	c.(742-744)cCg>cTg	p.P248L	PARD6B_ENST00000396039.1_Intron	NM_032521.2	NP_115910.1	Q9BYG5	PAR6B_HUMAN	par-6 family cell polarity regulator beta	248	Interaction with PARD3 and CDC42. {ECO:0000250}.|PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell junction assembly (GO:0034329)|cell-cell junction assembly (GO:0007043)|cell-cell junction organization (GO:0045216)|establishment or maintenance of cell polarity (GO:0007163)|protein complex assembly (GO:0006461)|regulation of cell migration (GO:0030334)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				NS(1)|breast(1)|endometrium(1)|kidney(4)|lung(3)|urinary_tract(1)	11						ACAGTGAGACCGGCAAACCAG	0.443																																																	0													129.0	124.0	125.0					20																	49366649		2203	4300	6503	SO:0001583	missense	84612			AB044555	CCDS33485.1	20q13.13	2013-08-28	2013-08-28		ENSG00000124171	ENSG00000124171			16245	protein-coding gene	gene with protein product		608975	"""par-6 (partitioning defective 6, C.elegans) homolog beta"", ""par-6 partitioning defective 6 homolog beta (C. elegans)"""			11260256	Standard	NM_032521		Approved	PAR-6B	uc002xvo.3	Q9BYG5	OTTHUMG00000032732	ENST00000371610.2:c.743C>T	20.37:g.49366649C>T	ENSP00000360672:p.Pro248Leu		A2A2A7|Q9Y510	Missense_Mutation	SNP	pfam_OPR_PB1,pfam_PDZ,superfamily_PDZ,smart_OPR_PB1,smart_PDZ,pfscan_PDZ	p.P248L	ENST00000371610.2	37	c.743	CCDS33485.1	20	.	.	.	.	.	.	.	.	.	.	C	31	5.068220	0.93950	.	.	ENSG00000124171	ENST00000371610	T	0.20200	2.09	6.02	6.02	0.97574	PDZ/DHR/GLGF (3);	0.000000	0.85682	D	0.000000	T	0.62024	0.2394	H	0.94886	3.595	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.71354	-0.4618	10	0.87932	D	0	-22.0075	20.5407	0.99260	0.0:1.0:0.0:0.0	.	248	Q9BYG5	PAR6B_HUMAN	L	248	ENSP00000360672:P248L	ENSP00000360672:P248L	P	+	2	0	PARD6B	48800056	1.000000	0.71417	0.226000	0.23910	0.962000	0.63368	7.416000	0.80143	2.865000	0.98341	0.655000	0.94253	CCG	PARD6B	-	superfamily_PDZ,smart_PDZ,pfscan_PDZ		0.443	PARD6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARD6B	HGNC	protein_coding	OTTHUMT00000079697.2	C	NM_032521		49366649	+1	no_errors	ENST00000371610	ensembl	human	known	70_37	missense	SNP	1.000	T
PBX1	5087	genome.wustl.edu	37	1	164761826	164761826	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:164761826G>C	ENST00000420696.2	+	3	549	c.361G>C	c.(361-363)Gag>Cag	p.E121Q	PBX1_ENST00000367897.1_Missense_Mutation_p.E121Q|PBX1_ENST00000540236.1_Missense_Mutation_p.E121Q|PBX1_ENST00000540246.1_Missense_Mutation_p.E16Q|PBX1_ENST00000401534.1_Missense_Mutation_p.E121Q|PBX1_ENST00000559240.1_Missense_Mutation_p.E121Q|PBX1_ENST00000560641.1_Missense_Mutation_p.E16Q	NM_001204961.1|NM_001204963.1|NM_002585.3	NP_001191890.1|NP_001191892.1|NP_002576.1	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1	121					adrenal gland development (GO:0030325)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic hemopoiesis (GO:0035162)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system development (GO:0048706)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|proximal/distal pattern formation (GO:0009954)|regulation of ossification (GO:0030278)|sex differentiation (GO:0007548)|spleen development (GO:0048536)|steroid biosynthetic process (GO:0006694)|thymus development (GO:0048538)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		EWSR1/PBX1(3)	large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4						GGCGGGGCCTGAGAAGGGCGG	0.627			T	"""TCF3, EWSR1"""	"""pre B-ALL, myoepithelioma"""																																			Dom	yes		1	1q23	5087	pre-B-cell leukemia transcription factor 1		"""L, M"""	0													25.0	29.0	27.0					1																	164761826		2203	4300	6503	SO:0001583	missense	5087			M86546	CCDS1246.1, CCDS55654.1	1q23.3	2011-06-20	2007-01-30		ENSG00000185630	ENSG00000185630		"""Homeoboxes / TALE class"""	8632	protein-coding gene	gene with protein product		176310	"""pre-B-cell leukemia transcription factor 1"""				Standard	NM_002585		Approved		uc001gct.3	P40424	OTTHUMG00000034307	ENST00000420696.2:c.361G>C	1.37:g.164761826G>C	ENSP00000405890:p.Glu121Gln		B4DSC1|F5H4U9|Q5T488	Missense_Mutation	SNP	pfam_PBX,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.E121Q	ENST00000420696.2	37	c.361	CCDS1246.1	1	.	.	.	.	.	.	.	.	.	.	G	30	5.057493	0.93846	.	.	ENSG00000185630	ENST00000340699;ENST00000420696;ENST00000367897;ENST00000540236;ENST00000401534;ENST00000540246	T;T;T;T;T;T	0.35421	1.31;1.31;1.31;1.31;1.31;1.31	5.5	5.5	0.81552	PBX (1);	0.000000	0.85682	D	0.000000	T	0.50922	0.1644	M	0.83483	2.645	0.09310	N	1.0	P;P;P;P;P	0.45531	0.624;0.645;0.86;0.795;0.645	B;P;P;P;P	0.53549	0.42;0.643;0.729;0.714;0.643	T	0.53507	-0.8429	9	0.49607	T	0.09	-16.0398	18.9768	0.92740	0.0:0.0:1.0:0.0	.	16;121;121;121;121	B7Z774;A8K5V0;F5H4U9;P40424;Q53YC7	.;.;.;PBX1_HUMAN;.	Q	121;121;121;121;121;16	ENSP00000341455:E121Q;ENSP00000405890:E121Q;ENSP00000356872:E121Q;ENSP00000439943:E121Q;ENSP00000384856:E121Q;ENSP00000440869:E16Q	ENSP00000341455:E121Q	E	+	1	0	PBX1	163028450	1.000000	0.71417	0.957000	0.39632	0.918000	0.54935	6.181000	0.71988	2.555000	0.86185	0.563000	0.77884	GAG	PBX1	-	pfam_PBX		0.627	PBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PBX1	HGNC	protein_coding	OTTHUMT00000082864.4	G	NM_002585		164761826	+1	no_errors	ENST00000420696	ensembl	human	known	70_37	missense	SNP	1.000	C
PCDH15	65217	genome.wustl.edu	37	10	55582734	55582734	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr10:55582734C>T	ENST00000320301.6	-	33	5146	c.4752G>A	c.(4750-4752)ctG>ctA	p.L1584L	PCDH15_ENST00000395432.2_Silent_p.L1544L|PCDH15_ENST00000437009.1_Silent_p.L1515L|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000395438.1_Intron|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395430.1_Silent_p.L1581L|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395433.1_Silent_p.L1561L|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395445.1_Intron|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000361849.3_Silent_p.L1586L|PCDH15_ENST00000409834.1_Intron	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1584					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				CTTTCCTCATCAGCCTCCTGG	0.463										HNSCC(58;0.16)																																							0													108.0	103.0	105.0					10																	55582734		2203	4299	6502	SO:0001819	synonymous_variant	65217			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.4752G>A	10.37:g.55582734C>T			A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L1584	ENST00000320301.6	37	c.4752	CCDS7248.1	10																																																																																			PCDH15	-	NULL		0.463	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000048121.2	C	NM_033056		55582734	-1	no_errors	ENST00000320301	ensembl	human	known	70_37	silent	SNP	0.000	T
PCDHB4	56131	genome.wustl.edu	37	5	140501901	140501901	+	Silent	SNP	G	G	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr5:140501901G>T	ENST00000194152.1	+	1	321	c.321G>T	c.(319-321)gtG>gtT	p.V107V	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	107	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATTTCCAAGTGTTCCTGGAAA	0.448																																																	0													53.0	58.0	56.0					5																	140501901		2203	4300	6503	SO:0001819	synonymous_variant	56131			AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.321G>T	5.37:g.140501901G>T			Q4V761	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V107	ENST00000194152.1	37	c.321	CCDS4246.1	5																																																																																			PCDHB4	-	pfam_Cadherin_N		0.448	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB4	HGNC	protein_coding	OTTHUMT00000251812.2	G	NM_018938		140501901	+1	no_errors	ENST00000194152	ensembl	human	known	70_37	silent	SNP	0.011	T
PCED1B	91523	genome.wustl.edu	37	12	47629918	47629918	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr12:47629918G>A	ENST00000546455.1	+	4	1803	c.1072G>A	c.(1072-1074)Gat>Aat	p.D358N	PCED1B_ENST00000432328.1_Missense_Mutation_p.D358N|RP11-493L12.3_ENST00000547748.1_RNA			Q96HM7	PED1B_HUMAN	PC-esterase domain containing 1B	358	Pro-rich.						hydrolase activity (GO:0016787)										TTGCCATTCAGATGTCCCCTC	0.527																																																	0													172.0	167.0	169.0					12																	47629918		2203	4300	6503	SO:0001583	missense	91523			BC016154	CCDS8752.1	12q13.11	2012-06-11	2012-06-11	2012-06-11	ENSG00000179715	ENSG00000179715			28255	protein-coding gene	gene with protein product			"""family with sequence similarity 113, member B"""	FAM113B		20056006	Standard	NM_138371		Approved	MGC16044	uc001rpq.3	Q96HM7	OTTHUMG00000169617	ENST00000546455.1:c.1072G>A	12.37:g.47629918G>A	ENSP00000446688:p.Asp358Asn		Q96B20	Missense_Mutation	SNP	superfamily_Esterase_SGNH_hydro-type	p.D358N	ENST00000546455.1	37	c.1072	CCDS8752.1	12	.	.	.	.	.	.	.	.	.	.	G	15.24	2.774880	0.49786	.	.	ENSG00000179715	ENST00000546455;ENST00000432328	T;T	0.34859	1.34;1.34	4.14	3.25	0.37280	.	0.205989	0.26935	N	0.021760	T	0.39009	0.1062	L	0.32530	0.975	0.09310	N	1	D	0.64830	0.994	P	0.59221	0.854	T	0.08046	-1.0741	10	0.46703	T	0.11	-3.6655	7.9477	0.29995	0.11:0.0:0.89:0.0	.	358	Q96HM7	F113B_HUMAN	N	358	ENSP00000446688:D358N;ENSP00000396040:D358N	ENSP00000396040:D358N	D	+	1	0	FAM113B	45916185	0.101000	0.21875	0.003000	0.11579	0.000000	0.00434	3.596000	0.54024	1.326000	0.45319	-0.136000	0.14681	GAT	PCED1B	-	NULL		0.527	PCED1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCED1B	HGNC	protein_coding	OTTHUMT00000405079.1	G	NM_138371		47629918	+1	no_errors	ENST00000432328	ensembl	human	known	70_37	missense	SNP	0.003	A
PCGF3	10336	genome.wustl.edu	37	4	728784	728784	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr4:728784G>A	ENST00000362003.5	+	5	569	c.174G>A	c.(172-174)gtG>gtA	p.V58V	PCGF3_ENST00000470161.2_Silent_p.V58V|PCGF3_ENST00000521023.2_Silent_p.V24V|PCGF3_ENST00000505655.2_Silent_p.V58V	NM_006315.4	NP_006306.2	Q3KNV8	PCGF3_HUMAN	polycomb group ring finger 3	58					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(1)	7						GCAGGATTGTGATCCACCAGA	0.607																																																	0													50.0	58.0	56.0					4																	728784		2022	4176	6198	SO:0001819	synonymous_variant	10336			AK093869	CCDS3339.2	4p16.3	2013-01-09	2005-01-17	2005-01-19	ENSG00000185619	ENSG00000185619		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	10066	protein-coding gene	gene with protein product			"""ring finger protein 3"""	RNF3			Standard	XM_005272250		Approved	FLJ36550, DONG1, RNF3A, MGC40413	uc003gbe.3	Q3KNV8	OTTHUMG00000119000	ENST00000362003.5:c.174G>A	4.37:g.728784G>A			D3DVN1|O15262	Silent	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.V58	ENST00000362003.5	37	c.174	CCDS3339.2	4																																																																																			PCGF3	-	NULL		0.607	PCGF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCGF3	HGNC	protein_coding	OTTHUMT00000239197.2	G	NM_006315		728784	+1	no_errors	ENST00000362003	ensembl	human	known	70_37	silent	SNP	0.989	A
PCSK2	5126	genome.wustl.edu	37	20	17434536	17434536	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr20:17434536G>C	ENST00000262545.2	+	9	1350	c.1035G>C	c.(1033-1035)gaG>gaC	p.E345D	PCSK2_ENST00000377899.1_Missense_Mutation_p.E326D|PCSK2_ENST00000536609.1_Missense_Mutation_p.E310D	NM_002594.3	NP_002585.2	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	345	Peptidase S8.				cellular protein metabolic process (GO:0044267)|embryo development (GO:0009790)|enkephalin processing (GO:0034230)|insulin processing (GO:0030070)|islet amyloid polypeptide processing (GO:0034231)|nervous system development (GO:0007399)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|perikaryon (GO:0043204)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|lung(17)|ovary(3)|pancreas(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	53					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TGTACGACGAGAGCTGCTCTT	0.587																																																	0													143.0	108.0	119.0					20																	17434536		2203	4300	6503	SO:0001583	missense	5126			AK312341	CCDS13125.1, CCDS56179.1, CCDS56180.1	20p11.2	2008-08-01			ENSG00000125851	ENSG00000125851			8744	protein-coding gene	gene with protein product	"""neuroendocrine convertase 2"", ""KEX2-like endoprotease 2"""	162151		NEC2		1765368	Standard	NM_001201528		Approved	PC2, SPC2	uc002wpm.3	P16519	OTTHUMG00000031941	ENST00000262545.2:c.1035G>C	20.37:g.17434536G>C	ENSP00000262545:p.Glu345Asp		B1ANH9|B4DFQ3|Q14927|Q5JYQ1|Q8IWA8|Q9NQG3|Q9NUG1|Q9UJC6	Missense_Mutation	SNP	pfam_Peptidase_S8/S53,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.E345D	ENST00000262545.2	37	c.1035	CCDS13125.1	20	.	.	.	.	.	.	.	.	.	.	G	22.0	4.232650	0.79688	.	.	ENSG00000125851	ENST00000377899;ENST00000262545;ENST00000536609	T;T;T	0.44083	0.93;0.93;0.93	5.69	4.56	0.56223	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	T	0.60894	0.2304	M	0.77313	2.365	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.63804	-0.6554	10	0.87932	D	0	-41.0636	7.6973	0.28602	0.2121:0.0:0.7879:0.0	.	310;345	B4DFQ3;P16519	.;NEC2_HUMAN	D	326;345;310	ENSP00000367131:E326D;ENSP00000262545:E345D;ENSP00000437458:E310D	ENSP00000262545:E345D	E	+	3	2	PCSK2	17382536	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	3.335000	0.52105	2.692000	0.91855	0.655000	0.94253	GAG	PCSK2	-	pfam_Peptidase_S8/S53,superfamily_Peptidase_S8/S53		0.587	PCSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK2	HGNC	protein_coding	OTTHUMT00000078120.2	G	NM_002594		17434536	+1	no_errors	ENST00000262545	ensembl	human	known	70_37	missense	SNP	1.000	C
PDE4DIP	9659	genome.wustl.edu	37	1	144952297	144952297	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:144952297G>A	ENST00000369354.3	-	4	611	c.422C>T	c.(421-423)tCa>tTa	p.S141L	PDE4DIP_ENST00000369359.4_Missense_Mutation_p.S278L|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.S278L|PDE4DIP_ENST00000369347.4_Missense_Mutation_p.S141L|PDE4DIP_ENST00000369351.3_Missense_Mutation_p.S141L|PDE4DIP_ENST00000369349.3_Missense_Mutation_p.S141L|PDE4DIP_ENST00000369348.3_Missense_Mutation_p.S278L|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.S141L|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.S207L			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	141					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)	p.S141*(2)|p.S278*(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CAGTTTCTCTGAGAGCTCCAG	0.522			T	PDGFRB	MPD																																			Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	3	Substitution - Nonsense(3)	lung(3)											28.0	30.0	30.0					1																	144952297		2199	4274	6473	SO:0001583	missense	9659			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.422C>T	1.37:g.144952297G>A	ENSP00000358360:p.Ser141Leu		A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	pfam_Spindle_assoc,superfamily_ARM-type_fold	p.S141L	ENST00000369354.3	37	c.422	CCDS30824.1	1	.	.	.	.	.	.	.	.	.	.	G	11.12	1.546394	0.27652	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359;ENST00000369351;ENST00000369349;ENST00000530078;ENST00000534536;ENST00000369347;ENST00000369348;ENST00000533259	T;T;T;T;T;T;T;T;T;T;T	0.41758	4.71;4.81;4.81;4.81;4.81;3.8;3.81;1.87;1.87;3.05;0.99	4.78	3.87	0.44632	.	.	.	.	.	T	0.18425	0.0442	L	0.54323	1.7	0.20638	N	0.99988	B;B;B	0.31077	0.001;0.307;0.026	B;B;B	0.27170	0.005;0.077;0.014	T	0.18366	-1.0339	9	0.72032	D	0.01	.	6.6025	0.22708	0.0964:0.1813:0.7223:0.0	.	141;207;141	Q5VU43-7;Q5VU43-3;Q5VU43	.;.;MYOME_HUMAN	L	207;141;141;278;278;141;141;207;144;141;278;64	ENSP00000327209:S207L;ENSP00000358360:S141L;ENSP00000358363:S141L;ENSP00000435654:S278L;ENSP00000358366:S278L;ENSP00000358357:S141L;ENSP00000358355:S141L;ENSP00000435920:S144L;ENSP00000358353:S141L;ENSP00000358354:S278L;ENSP00000437202:S64L	ENSP00000327209:S207L	S	-	2	0	PDE4DIP	143663654	0.105000	0.21958	0.966000	0.40874	0.950000	0.60333	2.111000	0.41883	1.243000	0.43853	0.561000	0.74099	TCA	PDE4DIP	-	NULL		0.522	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000038858.2	G	NM_022359		144952297	-1	no_errors	ENST00000369356	ensembl	human	known	70_37	missense	SNP	0.168	A
PDZRN3	23024	genome.wustl.edu	37	3	73450114	73450114	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr3:73450114C>T	ENST00000263666.4	-	5	1327	c.1213G>A	c.(1213-1215)Gac>Aac	p.D405N	PDZRN3_ENST00000466348.1_5'UTR|PDZRN3_ENST00000466780.1_Missense_Mutation_p.D62N|PDZRN3_ENST00000535920.1_Missense_Mutation_p.D127N|PDZRN3_ENST00000479530.1_Missense_Mutation_p.D122N|PDZRN3_ENST00000462146.2_Missense_Mutation_p.D62N	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	405					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		TGATGGATGTCTCCAATGTAG	0.438																																																	0													182.0	177.0	179.0					3																	73450114		2203	4300	6503	SO:0001583	missense	23024			AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.1213G>A	3.37:g.73450114C>T	ENSP00000263666:p.Asp405Asn		A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Missense_Mutation	SNP	pfam_PDZ,pfam_Znf_C3HC4_RING-type,superfamily_PDZ,superfamily_TRAF-like,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING,pfscan_Znf_TRAF	p.D405N	ENST00000263666.4	37	c.1213	CCDS33789.1	3	.	.	.	.	.	.	.	.	.	.	C	14.49	2.551958	0.45487	.	.	ENSG00000121440	ENST00000263666;ENST00000535920;ENST00000462146;ENST00000466780;ENST00000479530;ENST00000416926;ENST00000492909	T;T;T;T;T;T	0.09911	2.93;3.68;3.59;3.59;3.64;3.64	5.12	3.05	0.35203	.	0.623108	0.17669	N	0.166051	T	0.04907	0.0132	N	0.03608	-0.345	0.27280	N	0.958118	B;B;B;B	0.09022	0.0;0.002;0.0;0.0	B;B;B;B	0.12156	0.005;0.007;0.002;0.005	T	0.34527	-0.9825	10	0.30854	T	0.27	.	10.4966	0.44780	0.0:0.7833:0.0:0.2167	.	127;122;122;405	F5H8I9;B7ZAG0;B7Z5X9;Q9UPQ7	.;.;.;PZRN3_HUMAN	N	405;127;62;62;122;405;103	ENSP00000263666:D405N;ENSP00000442026:D127N;ENSP00000418168:D62N;ENSP00000418484:D62N;ENSP00000418624:D122N;ENSP00000419250:D103N	ENSP00000263666:D405N	D	-	1	0	PDZRN3	73532804	1.000000	0.71417	0.644000	0.29465	0.994000	0.84299	2.467000	0.45093	1.163000	0.42636	0.555000	0.69702	GAC	PDZRN3	-	NULL		0.438	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZRN3	HGNC	protein_coding	OTTHUMT00000352460.1	C	XM_041363		73450114	-1	no_errors	ENST00000263666	ensembl	human	known	70_37	missense	SNP	0.998	T
PECR	55825	genome.wustl.edu	37	2	216930051	216930051	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:216930051G>A	ENST00000265322.7	-	3	482	c.408C>T	c.(406-408)ttC>ttT	p.F136F	PECR_ENST00000497889.1_5'UTR	NM_018441.5	NP_060911.2	Q9BY49	PECR_HUMAN	peroxisomal trans-2-enoyl-CoA reductase	136					fatty acid biosynthetic process (GO:0006633)|oxidation-reduction process (GO:0055114)|phytol metabolic process (GO:0033306)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	receptor binding (GO:0005102)|trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)			endometrium(2)|kidney(1)|liver(1)|lung(9)|stomach(1)	14		Renal(323;0.0327)		Epithelial(149;3.8e-06)|all cancers(144;0.000272)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Adenine(DB00173)	TGCACATGTAGAAGGTACCCG	0.478																																																	0													136.0	130.0	132.0					2																	216930051		2203	4300	6503	SO:0001819	synonymous_variant	55825			AF119841	CCDS33375.1	2q35	2011-09-14			ENSG00000115425	ENSG00000115425	1.3.1.38	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18281	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 29C, member 1"""	605843				10811639, 11669066, 19027726	Standard	NM_018441		Approved	HSA250303, TERP, SDR29C1	uc002vft.3	Q9BY49	OTTHUMG00000154825	ENST00000265322.7:c.408C>T	2.37:g.216930051G>A			B2RE42|Q53TC4|Q6IAK9|Q9NRD4|Q9NY60|Q9P1A4	Silent	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_NADP_OxRdtase_F420,prints_Glc/ribitol_DH,prints_DHB_DH	p.F136	ENST00000265322.7	37	c.408	CCDS33375.1	2																																																																																			PECR	-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_DHB_DH		0.478	PECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PECR	HGNC	protein_coding	OTTHUMT00000337277.1	G	NM_018441		216930051	-1	no_errors	ENST00000265322	ensembl	human	known	70_37	silent	SNP	1.000	A
PGK1	5230	genome.wustl.edu	37	X	77378488	77378488	+	Intron	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chrX:77378488G>A	ENST00000373316.4	+	7	923				PGK1_ENST00000537456.1_Intron|PGK1_ENST00000442431.1_Intron	NM_000291.3	NP_000282.1	P00558	PGK1_HUMAN	phosphoglycerate kinase 1						carbohydrate metabolic process (GO:0005975)|epithelial cell differentiation (GO:0030855)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	24					Lamivudine(DB00709)	AGCTCTCCATGATAATAGCAG	0.368																																																	0													69.0	55.0	60.0					X																	77378488		2203	4300	6503	SO:0001627	intron_variant	5230			L00159	CCDS14438.1	Xq13.3	2011-03-17			ENSG00000102144	ENSG00000102144	2.7.2.3		8896	protein-coding gene	gene with protein product		311800				6188151, 6099325	Standard	NM_000291		Approved		uc004ecz.4	P00558	OTTHUMG00000021888	ENST00000373316.4:c.756+42G>A	X.37:g.77378488G>A			A8K4W6|B7Z7A9|Q5J7W1|Q6IBT6|Q8NI87	RNA	SNP	-	NULL	ENST00000373316.4	37	NULL	CCDS14438.1	X																																																																																			PGK1	-	-		0.368	PGK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGK1	HGNC	protein_coding	OTTHUMT00000057310.1	G			77378488	+1	no_errors	ENST00000474281	ensembl	human	known	70_37	rna	SNP	0.000	A
PHF13	148479	genome.wustl.edu	37	1	6680211	6680211	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:6680211C>T	ENST00000377648.4	+	3	872	c.490C>T	c.(490-492)Ccc>Tcc	p.P164S	PHF13_ENST00000495385.1_Intron	NM_153812.2	NP_722519.2	Q86YI8	PHF13_HUMAN	PHD finger protein 13	164					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(1)|lung(3)	7	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;1.46e-33)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000501)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|STAD - Stomach adenocarcinoma(132;0.0165)|READ - Rectum adenocarcinoma(331;0.0642)		CCCCCAGGCTCCCAGCGACCC	0.592																																																	0													29.0	33.0	32.0					1																	6680211		2203	4300	6503	SO:0001583	missense	148479			AK027492	CCDS85.1	1p36.23	2013-01-28			ENSG00000116273	ENSG00000116273		"""Zinc fingers, PHD-type"""	22983	protein-coding gene	gene with protein product							Standard	NM_153812		Approved	MGC43399	uc001aob.4	Q86YI8	OTTHUMG00000001439	ENST00000377648.4:c.490C>T	1.37:g.6680211C>T	ENSP00000366876:p.Pro164Ser		B3KUQ7|Q59FB6|Q5TH65|Q8N551|Q9UJP2	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD	p.P164S	ENST00000377648.4	37	c.490	CCDS85.1	1	.	.	.	.	.	.	.	.	.	.	C	6.747	0.506637	0.12883	.	.	ENSG00000116273	ENST00000377648	T	0.49720	0.77	5.77	1.13	0.20643	.	0.507150	0.21892	N	0.067567	T	0.23611	0.0571	N	0.21448	0.665	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.14896	-1.0456	10	0.09084	T	0.74	-4.8482	3.6336	0.08141	0.3145:0.3843:0.2226:0.0786	.	164	Q86YI8	PHF13_HUMAN	S	164	ENSP00000366876:P164S	ENSP00000366876:P164S	P	+	1	0	PHF13	6602798	0.000000	0.05858	0.014000	0.15608	0.773000	0.43773	0.358000	0.20216	0.316000	0.23135	0.561000	0.74099	CCC	PHF13	-	NULL		0.592	PHF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF13	HGNC	protein_coding	OTTHUMT00000004201.1	C	NM_153812		6680211	+1	no_errors	ENST00000377648	ensembl	human	known	70_37	missense	SNP	0.000	T
PIGG	54872	genome.wustl.edu	37	4	493078	493078	+	5'UTR	SNP	G	G	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr4:493078G>T	ENST00000453061.2	+	0	60				ZNF721_ENST00000338977.5_5'Flank|PIGG_ENST00000503111.1_5'UTR|PIGG_ENST00000383028.4_5'UTR|ZNF721_ENST00000511833.2_5'Flank|PIGG_ENST00000536264.1_5'UTR|PIGG_ENST00000296306.7_5'UTR|PIGG_ENST00000509768.1_5'UTR|PIGG_ENST00000504346.1_5'UTR|PIGG_ENST00000502311.1_3'UTR|PIGG_ENST00000310340.5_5'UTR	NM_001127178.1	NP_001120650.1	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class G						C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	CP2 mannose-ethanolamine phosphotransferase activity (GO:0051267)|phosphotransferase activity, for other substituted phosphate groups (GO:0016780)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	39						GCAGCAGGGCGAGGCTCCAGG	0.667																																																	0													20.0	21.0	21.0					4																	493078		2201	4298	6499	SO:0001623	5_prime_UTR_variant	54872				CCDS3336.1, CCDS46992.1, CCDS75080.1, CCDS75081.1, CCDS75082.1, CCDS75083.1	4p16.3	2013-02-26	2006-06-28		ENSG00000174227	ENSG00000174227		"""Phosphatidylinositol glycan anchor biosynthesis"""	25985	protein-coding gene	gene with protein product			"""phosphatidylinositol glycan, class G"""			15632136	Standard	XM_005272287		Approved	FLJ20265, GPI7, LAS21	uc003gak.4	Q5H8A4	OTTHUMG00000112457	ENST00000453061.2:c.-47G>T	4.37:g.493078G>T			B4DKC7|Q2TAK5|Q6UX31|Q7L5Y4|Q8N866|Q8NCC9|Q96SY9|Q9BVT7|Q9NXG5	RNA	SNP	-	NULL	ENST00000453061.2	37	NULL	CCDS46992.1	4																																																																																			PIGG	-	-		0.667	PIGG-001	KNOWN	basic|CCDS	protein_coding	PIGG	HGNC	protein_coding	OTTHUMT00000357494.1	G	NM_017733		493078	+1	no_errors	ENST00000502311	ensembl	human	known	70_37	rna	SNP	0.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	SO:0001583	missense	5290				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	G			178936091	+1	no_errors	ENST00000263967	ensembl	human	known	70_37	missense	SNP	1.000	A
PKD2L1	9033	genome.wustl.edu	37	10	102057296	102057296	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr10:102057296C>T	ENST00000318222.3	-	5	1181	c.799G>A	c.(799-801)Gga>Aga	p.G267R	PKD2L1_ENST00000353274.3_Missense_Mutation_p.G267R|PKD2L1_ENST00000338519.3_Intron	NM_001253837.1|NM_016112.2	NP_001240766.1|NP_057196.2	Q9P0L9	PK2L1_HUMAN	polycystic kidney disease 2-like 1	267					cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|detection of mechanical stimulus (GO:0050982)|potassium ion transmembrane transport (GO:0071805)|protein homotrimerization (GO:0070207)|sensory perception of sour taste (GO:0050915)|smoothened signaling pathway (GO:0007224)|sodium ion transmembrane transport (GO:0035725)	calcium channel complex (GO:0034704)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	alpha-actinin binding (GO:0051393)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-activated potassium channel activity (GO:0015269)|cation channel activity (GO:0005261)|cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|sodium channel activity (GO:0005272)|sour taste receptor activity (GO:0033040)			NS(2)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	43		Colorectal(252;0.117)		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)		TAGCCACCTCCGCTGTAGCTT	0.627																																																	0													55.0	50.0	52.0					10																	102057296		2203	4300	6503	SO:0001583	missense	9033			AF094827	CCDS7492.1	10q24.31	2011-12-16			ENSG00000107593	ENSG00000107593		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9011	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 3"""	604532		PKD2L, PKDL		9878261, 9748274	Standard	NM_016112		Approved	PCL, TRPP3	uc001kqx.1	Q9P0L9	OTTHUMG00000018910	ENST00000318222.3:c.799G>A	10.37:g.102057296C>T	ENSP00000325296:p.Gly267Arg		O75972|Q5W039|Q9UP35|Q9UPA2	Missense_Mutation	SNP	pfam_PKD1_2_channel,pfam_Ion_trans_dom,prints_PKD_2,prints_PKD_1	p.G267R	ENST00000318222.3	37	c.799	CCDS7492.1	10	.	.	.	.	.	.	.	.	.	.	C	31	5.081419	0.94050	.	.	ENSG00000107593	ENST00000353274;ENST00000318222;ENST00000339977	T;T	0.70986	-0.53;-0.53	5.53	5.53	0.82687	Polycystin cation channel, PKD1/PKD2 (1);	0.000000	0.85682	D	0.000000	D	0.86230	0.5883	M	0.85373	2.75	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.87641	0.2522	10	0.62326	D	0.03	-9.9864	18.4373	0.90650	0.0:1.0:0.0:0.0	.	220;267	Q1L4F0;Q9P0L9	.;PK2L1_HUMAN	R	267	ENSP00000266049:G267R;ENSP00000325296:G267R	ENSP00000325296:G267R	G	-	1	0	PKD2L1	102047286	1.000000	0.71417	0.998000	0.56505	0.957000	0.61999	7.755000	0.85180	2.593000	0.87608	0.561000	0.74099	GGA	PKD2L1	-	pfam_PKD1_2_channel		0.627	PKD2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD2L1	HGNC	protein_coding	OTTHUMT00000049863.2	C	NM_016112		102057296	-1	no_errors	ENST00000318222	ensembl	human	known	70_37	missense	SNP	1.000	T
PLEKHG1	57480	genome.wustl.edu	37	6	151089860	151089860	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr6:151089860C>T	ENST00000358517.2	+	3	709	c.498C>T	c.(496-498)atC>atT	p.I166I	PLEKHG1_ENST00000367328.1_Silent_p.I166I			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	166	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		TACAGGATATCTACCACTTCA	0.383																																																	0													100.0	92.0	95.0					6																	151089860		2203	4300	6503	SO:0001819	synonymous_variant	57480			AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.498C>T	6.37:g.151089860C>T			Q5T1F2	Silent	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.I166	ENST00000358517.2	37	c.498	CCDS34552.1	6																																																																																			PLEKHG1	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain		0.383	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHG1	HGNC	protein_coding	OTTHUMT00000042691.1	C			151089860	+1	no_errors	ENST00000358517	ensembl	human	known	70_37	silent	SNP	1.000	T
PLEKHH1	57475	genome.wustl.edu	37	14	68042668	68042668	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr14:68042668C>G	ENST00000329153.5	+	16	2430	c.2298C>G	c.(2296-2298)atC>atG	p.I766M	PLEKHH1_ENST00000417684.2_5'Flank	NM_020715.2	NP_065766.1	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1	766	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytoskeleton (GO:0005856)				endometrium(2)|kidney(4)|lung(12)|urinary_tract(1)	19				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		CCCTGGTGATCCACCCCACAG	0.567																																																	0													70.0	75.0	73.0					14																	68042668		2044	4183	6227	SO:0001583	missense	57475			AB033026	CCDS45128.1	14q24.1	2013-01-10				ENSG00000054690		"""Pleckstrin homology (PH) domain containing"""	17733	protein-coding gene	gene with protein product						10574462	Standard	NM_020715		Approved	KIAA1200	uc001xjl.1	Q9ULM0		ENST00000329153.5:c.2298C>G	14.37:g.68042668C>G	ENSP00000330278:p.Ile766Met		A6H8X6|Q6PJL4|Q6ZWC7	Missense_Mutation	SNP	pfam_Pleckstrin_homology,pfam_MyTH4_dom,pfam_FERM_central,superfamily_FERM_central,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology	p.I766M	ENST00000329153.5	37	c.2298	CCDS45128.1	14	.	.	.	.	.	.	.	.	.	.	C	16.36	3.100860	0.56183	.	.	ENSG00000054690	ENST00000329153	T	0.34472	1.36	4.71	1.9	0.25705	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.055341	0.64402	D	0.000001	T	0.50480	0.1618	M	0.73217	2.22	0.80722	D	1	D	0.63046	0.992	D	0.64237	0.923	T	0.50346	-0.8839	10	0.87932	D	0	.	7.1376	0.25537	0.0:0.6117:0.0:0.3883	.	766	Q9ULM0	PKHH1_HUMAN	M	766	ENSP00000330278:I766M	ENSP00000330278:I766M	I	+	3	3	PLEKHH1	67112421	0.999000	0.42202	0.998000	0.56505	0.993000	0.82548	0.543000	0.23237	0.702000	0.31825	0.549000	0.68633	ATC	PLEKHH1	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.567	PLEKHH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHH1	HGNC	protein_coding	OTTHUMT00000412730.3	C	XM_031054		68042668	+1	no_errors	ENST00000329153	ensembl	human	known	70_37	missense	SNP	0.998	G
PNPLA8	50640	genome.wustl.edu	37	7	108136892	108136892	+	Intron	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr7:108136892C>G	ENST00000422087.1	-	8	2032				PNPLA8_ENST00000436062.1_Intron|PNPLA8_ENST00000388728.5_Intron|PNPLA8_ENST00000426128.2_Intron|PNPLA8_ENST00000483879.1_5'UTR|PNPLA8_ENST00000257694.8_Intron|PNPLA8_ENST00000453144.1_Intron	NM_015723.3	NP_056538.1	Q9NP80	PLPL8_HUMAN	patatin-like phospholipase domain containing 8						arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|cell death (GO:0008219)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|linoleic acid metabolic process (GO:0043651)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylcholine catabolic process (GO:0034638)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylethanolamine catabolic process (GO:0046338)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|calcium-independent phospholipase A2 activity (GO:0047499)|lysophospholipase activity (GO:0004622)			breast(5)|endometrium(1)|kidney(3)|large_intestine(5)|lung(12)|upper_aerodigestive_tract(3)	29						TCTAATTAGTCAAATAATTTA	0.244																																																	0																																										SO:0001627	intron_variant	50640			AF217519	CCDS34733.1, CCDS59075.1, CCDS59508.1	7q31	2012-07-31			ENSG00000135241	ENSG00000135241		"""Patatin-like phospholipase domain containing"""	28900	protein-coding gene	gene with protein product		612123				10744668, 10833412, 16799181, 19029121	Standard	NM_015723		Approved	IPLA2G, IPLA2-2, iPLA2gamma	uc003vfj.2	Q9NP80	OTTHUMG00000154870	ENST00000422087.1:c.1625+135G>C	7.37:g.108136892C>G			A4D0S1|C9JZI4|O95035|Q8N3I3|Q9H7T5|Q9NR17|Q9NUN2|Q9NZ79	RNA	SNP	-	NULL	ENST00000422087.1	37	NULL	CCDS34733.1	7																																																																																			PNPLA8	-	-		0.244	PNPLA8-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PNPLA8	HGNC	protein_coding	OTTHUMT00000337475.1	C	NM_015723		108136892	-1	no_errors	ENST00000483879	ensembl	human	known	70_37	rna	SNP	0.000	G
POLR2C	5432	genome.wustl.edu	37	16	57496672	57496673	+	Missense_Mutation	DNP	GG	GG	AA			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr16:57496672_57496673GG>AA	ENST00000219252.5	+	1	374_375	c.36_37GG>AA	c.(34-39)acGGag>acAAag	p.E13K	AC009052.12_ENST00000567090.1_RNA|POLR2C_ENST00000564651.1_3'UTR	NM_032940.2	NP_116558.1	P19387	RPB3_HUMAN	polymerase (RNA) II (DNA directed) polypeptide C, 33kDa	13					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(2)|upper_aerodigestive_tract(1)	10						TGCGGATCACGGAGCTCACTGA	0.673											OREG0023826	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001583	missense	5432				CCDS10782.1	16q13-q21	2013-01-21	2002-08-29		ENSG00000102978	ENSG00000102978		"""RNA polymerase subunits"""	9189	protein-coding gene	gene with protein product	"""RNA polymerase II subunit 3"""	180663	"""polymerase (RNA) II (DNA directed) polypeptide C (33kD)"""			8034326	Standard	NM_032940		Approved	RPB3	uc002elt.1	P19387	OTTHUMG00000133464	Exception_encountered	16.37:g.57496672_57496673delinsAA	ENSP00000219252:p.Glu13Lys	1023	O15161	Silent|Missense_Mutation	SNP	pfam_DNA-dir_RNA_pol_insert,pfam_DNA-dir_RNA_pol_dimersation,superfamily_DNA-dir_RNA_pol_insert,superfamily_DNA-dir_RNA_pol_RBP11-like,smart_DNA-dir_RNA_pol_RpoA/D/Rpb3	p.T12|p.E13K	ENST00000219252.5	37	c.36|c.37	CCDS10782.1	16																																																																																			POLR2C	-	superfamily_DNA-dir_RNA_pol_RBP11-like		0.673	POLR2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2C	HGNC	protein_coding	OTTHUMT00000257340.3	G	NM_032940		57496672|57496673	+1	no_errors	ENST00000219252	ensembl	human	known	70_37	silent|missense	SNP	0.910|1.000	A
POLR3B	55703	genome.wustl.edu	37	12	106773811	106773811	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr12:106773811C>G	ENST00000228347.4	+	9	839	c.617C>G	c.(616-618)tCt>tGt	p.S206C	POLR3B_ENST00000539066.1_Missense_Mutation_p.S148C	NM_018082.5	NP_060552.4	Q9NW08	RPC2_HUMAN	polymerase (RNA) III (DNA directed) polypeptide B	206					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(22)|ovary(1)|prostate(3)|skin(3)|urinary_tract(2)	57						ACTCATAGCTCTACCCATGAG	0.348																																																	0													125.0	110.0	115.0					12																	106773811		2203	4300	6503	SO:0001583	missense	55703			AY092084	CCDS9105.1, CCDS53824.1	12q23.3	2014-08-12			ENSG00000013503	ENSG00000013503		"""RNA polymerase subunits"""	30348	protein-coding gene	gene with protein product		614366				12391170	Standard	NM_018082		Approved	RPC2, FLJ10388	uc001tlp.3	Q9NW08	OTTHUMG00000170077	ENST00000228347.4:c.617C>G	12.37:g.106773811C>G	ENSP00000228347:p.Ser206Cys		A8K6H0|B3KV73|F5H1E6|Q9NW59	Missense_Mutation	SNP	pfam_DNA-dir_RNA_pol_su2_6,pfam_RNA_pol_bsu_protrusion,pfam_RNA_pol_Rpb2_7,pfam_RNA_pol_Rpb2_2,pfam_RNA_pol_Rpb2_3,pfam_RNA_pol_Rpb2_4,pfam_RNA_pol_Rpb2_5	p.S206C	ENST00000228347.4	37	c.617	CCDS9105.1	12	.	.	.	.	.	.	.	.	.	.	C	24.1	4.494749	0.85069	.	.	ENSG00000013503	ENST00000228347;ENST00000551370;ENST00000539066	T;T	0.66815	-0.23;-0.23	5.71	5.71	0.89125	RNA polymerase, beta subunit, protrusion (1);RNA polymerase Rpb2, domain 2 (1);	0.000000	0.85682	D	0.000000	T	0.79353	0.4431	M	0.91612	3.225	0.80722	D	1	P	0.35982	0.531	B	0.43155	0.41	T	0.78339	-0.2242	10	0.27785	T	0.31	-18.627	19.4464	0.94849	0.0:1.0:0.0:0.0	.	206	Q9NW08	RPC2_HUMAN	C	206;206;148	ENSP00000228347:S206C;ENSP00000445721:S148C	ENSP00000228347:S206C	S	+	2	0	POLR3B	105297941	1.000000	0.71417	0.995000	0.50966	0.985000	0.73830	7.362000	0.79507	2.694000	0.91930	0.585000	0.79938	TCT	POLR3B	-	pfam_RNA_pol_bsu_protrusion,pfam_RNA_pol_Rpb2_2		0.348	POLR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3B	HGNC	protein_coding	OTTHUMT00000407166.1	C	NM_018082		106773811	+1	no_errors	ENST00000228347	ensembl	human	known	70_37	missense	SNP	1.000	G
POTEH	23784	genome.wustl.edu	37	22	16287509	16287509	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr22:16287509G>C	ENST00000343518.6	-	1	428	c.377C>G	c.(376-378)tCt>tGt	p.S126C		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	126										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						CTTCATAGCAGAGTCGTCGTG	0.612																																																	0													61.0	71.0	68.0					22																	16287509		1932	3700	5632	SO:0001583	missense	23784			AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.377C>G	22.37:g.16287509G>C	ENSP00000340610:p.Ser126Cys		A2CEK4|A6NCI1|A9Z1W0	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.S126C	ENST00000343518.6	37	c.377	CCDS46658.1	22	.	.	.	.	.	.	.	.	.	.	.	8.396	0.840806	0.16891	.	.	ENSG00000198062	ENST00000359587;ENST00000343518;ENST00000355872	T	0.27557	1.66	.	.	.	.	.	.	.	.	T	0.45074	0.1324	L	0.55481	1.735	0.09310	N	1	D	0.76494	0.999	D	0.78314	0.991	T	0.22208	-1.0223	7	0.87932	D	0	.	.	.	.	.	126	Q6S545	POTEH_HUMAN	C	89;126;126	ENSP00000340610:S126C	ENSP00000340610:S126C	S	-	2	0	POTEH	14667509	0.016000	0.18221	0.004000	0.12327	0.004000	0.04260	0.315000	0.19451	0.269000	0.21961	0.274000	0.19336	TCT	POTEH	-	NULL		0.612	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	POTEH	HGNC	protein_coding	OTTHUMT00000276918.4	G	NM_001136213		16287509	-1	no_errors	ENST00000343518	ensembl	human	known	70_37	missense	SNP	0.005	C
PPFIA3	8541	genome.wustl.edu	37	19	49652868	49652868	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:49652868G>A	ENST00000334186.4	+	28	3768	c.3419G>A	c.(3418-3420)cGa>cAa	p.R1140Q	PPFIA3_ENST00000602351.1_Missense_Mutation_p.R1131Q	NM_003660.2	NP_003651.1	O75145	LIPA3_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3	1140					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|presynaptic active zone (GO:0048786)				NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(16)|pancreas(1)|prostate(1)|skin(4)|urinary_tract(1)	35		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		AAGGACCTCCGAGGCGTAACT	0.647																																																	0													40.0	40.0	40.0					19																	49652868		2203	4300	6503	SO:0001583	missense	8541			AF034800	CCDS12758.1	19q13.33	2013-09-23			ENSG00000177380	ENSG00000177380		"""Sterile alpha motif (SAM) domain containing"""	9247	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase, receptor type, f polypeptide, alpha 3"", ""liprin-alpha 3"", ""liprin"""	603144				9624153, 9734811	Standard	NM_003660		Approved	KIAA0654, LPNA3, MGC126567, MGC126569	uc002pmr.3	O75145	OTTHUMG00000183213	ENST00000334186.4:c.3419G>A	19.37:g.49652868G>A	ENSP00000335614:p.Arg1140Gln		A8K142|Q3MJA0|Q9H8B5|Q9UEW4	Missense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.R1140Q	ENST00000334186.4	37	c.3419	CCDS12758.1	19	.	.	.	.	.	.	.	.	.	.	G	27.5	4.834526	0.91036	.	.	ENSG00000177380	ENST00000334186	T	0.18657	2.2	4.12	4.12	0.48240	.	0.000000	0.39341	U	0.001386	T	0.37919	0.1021	L	0.46157	1.445	0.80722	D	1	D;D	0.89917	0.996;1.0	P;D	0.66716	0.873;0.946	T	0.15407	-1.0438	10	0.54805	T	0.06	-5.7059	15.6618	0.77193	0.0:0.0:1.0:0.0	.	1131;1140	O75145-2;O75145	.;LIPA3_HUMAN	Q	1140	ENSP00000335614:R1140Q	ENSP00000335614:R1140Q	R	+	2	0	PPFIA3	54344680	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.218000	0.65257	2.299000	0.77371	0.462000	0.41574	CGA	PPFIA3	-	NULL		0.647	PPFIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPFIA3	HGNC	protein_coding	OTTHUMT00000465688.1	G	NM_003660		49652868	+1	no_errors	ENST00000334186	ensembl	human	known	70_37	missense	SNP	1.000	A
PPP1R10	5514	genome.wustl.edu	37	6	30572132	30572132	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr6:30572132C>T	ENST00000376511.2	-	13	1811	c.1259G>A	c.(1258-1260)cGa>cAa	p.R420Q		NM_002714.3	NP_002705.2	Q96QC0	PP1RA_HUMAN	protein phosphatase 1, regulatory subunit 10	420	Essential for PPP1CA inhibition. {ECO:0000250}.|Interaction with WDR82. {ECO:0000250}.				protein import into nucleus (GO:0006606)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|PTW/PP1 phosphatase complex (GO:0072357)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein phosphatase inhibitor activity (GO:0004864)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(1)	25						CCTCTTACCTCGTTCAGTTTC	0.438																																																	0													135.0	150.0	144.0					6																	30572132		1511	2709	4220	SO:0001583	missense	5514			Y13247	CCDS4681.1	6p21.3	2012-04-17	2011-10-04		ENSG00000204569	ENSG00000204569		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9284	protein-coding gene	gene with protein product	"""phosphatase 1 nuclear targeting subunit"", ""HLA-C associated transcript 53"""	603771	"""protein phosphatase 1, regulatory (inhibitor) subunit 10"""			9461602, 9784381	Standard	NM_002714		Approved	PNUTS, FB19, CAT53, p99	uc003nqn.2	Q96QC0	OTTHUMG00000031259	ENST00000376511.2:c.1259G>A	6.37:g.30572132C>T	ENSP00000365694:p.Arg420Gln		O00405	Missense_Mutation	SNP	pfam_TFIIS_N,pfam_Znf_CCCH,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub,smart_Znf_CCCH	p.R420Q	ENST00000376511.2	37	c.1259	CCDS4681.1	6	.	.	.	.	.	.	.	.	.	.	C	20.6	4.020961	0.75275	.	.	ENSG00000204569	ENST00000376511	T	0.65364	-0.15	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.71617	0.3361	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.74928	-0.3497	10	0.87932	D	0	-11.6741	16.8816	0.86064	0.0:1.0:0.0:0.0	.	420	Q96QC0	PP1RA_HUMAN	Q	420	ENSP00000365694:R420Q	ENSP00000365694:R420Q	R	-	2	0	PPP1R10	30680111	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.793000	0.75130	2.514000	0.84764	0.591000	0.81541	CGA	PPP1R10	-	NULL		0.438	PPP1R10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R10	HGNC	protein_coding	OTTHUMT00000076556.2	C	NM_002714		30572132	-1	no_errors	ENST00000376511	ensembl	human	known	70_37	missense	SNP	1.000	T
PPP6R3	55291	genome.wustl.edu	37	11	68312351	68312351	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr11:68312351G>A	ENST00000393800.2	+	4	527	c.273G>A	c.(271-273)caG>caA	p.Q91Q	PPP6R3_ENST00000265636.5_Silent_p.Q91Q|PPP6R3_ENST00000265637.4_Silent_p.Q91Q|PPP6R3_ENST00000524845.1_Silent_p.Q91Q|PPP6R3_ENST00000393799.2_Silent_p.Q91Q|PPP6R3_ENST00000534534.1_De_novo_Start_InFrame|PPP6R3_ENST00000527403.2_Silent_p.Q91Q|PPP6R3_ENST00000529710.1_Silent_p.Q91Q|PPP6R3_ENST00000393801.3_Silent_p.Q91Q|PPP6R3_ENST00000524904.1_Silent_p.Q91Q	NM_001164161.1|NM_001164162.1|NM_001164163.1	NP_001157633.1|NP_001157634.1|NP_001157635.1	Q5H9R7	PP6R3_HUMAN	protein phosphatase 6, regulatory subunit 3	91					regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			breast(2)|endometrium(6)|kidney(3)|large_intestine(10)|liver(2)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						ATGTCTCCCAGATGAATGATA	0.348																																																	0													99.0	96.0	97.0					11																	68312351		2200	4294	6494	SO:0001819	synonymous_variant	55291			AF264779	CCDS8182.1, CCDS53671.1, CCDS53672.1, CCDS53673.1, CCDS53674.1, CCDS53675.1	11q13	2012-04-17	2010-06-28	2010-06-28	ENSG00000110075	ENSG00000110075		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	1173	protein-coding gene	gene with protein product	"""sporulation-induced transcript 4-associated protein"""	610879	"""chromosome 11 open reading frame 23"", ""SAPS domain family, member 3"""	C11orf23, SAPS3		11401438, 16769727	Standard	NM_018312		Approved	SAPLa, DKFZp781E2374, DKFZp781O2362, DKFZp781E17107, SAP190, SAPL, PP6R3, FLJ11058, FLJ43065, KIAA1558, MGC125711, MGC125712	uc001onv.3	Q5H9R7		ENST00000393800.2:c.273G>A	11.37:g.68312351G>A			Q3B7I1|Q3I4Y0|Q3KR35|Q68CR3|Q7L4R8|Q8N3B2|Q96MB2|Q9H2K5|Q9H2K6|Q9HCL4|Q9NUY3	Silent	SNP	pfam_SAPS,superfamily_ARM-type_fold	p.Q91	ENST00000393800.2	37	c.273	CCDS53672.1	11																																																																																			PPP6R3	-	NULL		0.348	PPP6R3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP6R3	HGNC	protein_coding	OTTHUMT00000395275.1	G	NM_018312		68312351	+1	no_errors	ENST00000393799	ensembl	human	known	70_37	silent	SNP	1.000	A
PREPL	9581	genome.wustl.edu	37	2	44586667	44586667	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:44586667C>T	ENST00000409936.1	-	2	625	c.188G>A	c.(187-189)aGa>aAa	p.R63K	CAMKMT_ENST00000402247.1_5'Flank|PREPL_ENST00000410081.1_Missense_Mutation_p.R63K|PREPL_ENST00000260648.6_Missense_Mutation_p.R63K|PREPL_ENST00000540817.1_Intron|PREPL_ENST00000409957.1_Intron|PREPL_ENST00000378511.3_Missense_Mutation_p.R63K|CAMKMT_ENST00000378494.3_5'Flank|CAMKMT_ENST00000407131.1_5'Flank|PREPL_ENST00000541738.1_Intron|PREPL_ENST00000378520.3_Missense_Mutation_p.R63K|CAMKMT_ENST00000403853.3_5'Flank|PREPL_ENST00000409411.1_Intron|PREPL_ENST00000409272.1_Missense_Mutation_p.R63K	NM_001171606.1	NP_001165077.1	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like	63						cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(19)|ovary(1)|prostate(1)|skin(2)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TGGGATGTTTCTTGCTAACTC	0.308																																																	0													151.0	152.0	152.0					2																	44586667		2203	4300	6503	SO:0001583	missense	9581			AB007896	CCDS33190.1, CCDS42675.1, CCDS42676.1, CCDS54353.1	2p22.1	2008-02-05			ENSG00000138078	ENSG00000138078			30228	protein-coding gene	gene with protein product		609557				11524703	Standard	NM_006036		Approved	KIAA0436	uc002ruk.2	Q4J6C6	OTTHUMG00000152791	ENST00000409936.1:c.188G>A	2.37:g.44586667C>T	ENSP00000386543:p.Arg63Lys		A7E2X6|D6W5A3|O43163|Q4J6C3|Q4J6C4|Q4ZG39|Q6ZMW7|Q96DW7	Missense_Mutation	SNP	pfam_Peptidase_S9,pfam_Peptidase_S9A_B_C_N,superfamily_Peptidase_S9A_B_C_N,prints_Peptidase_S9A	p.R63K	ENST00000409936.1	37	c.188	CCDS33190.1	2	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676552	0.88445	.	.	ENSG00000138078	ENST00000409936;ENST00000260648;ENST00000409272;ENST00000410081;ENST00000378520;ENST00000378511;ENST00000438314	.	.	.	5.27	5.27	0.74061	.	0.285555	0.30686	N	0.009090	T	0.47655	0.1457	N	0.08118	0	0.80722	D	1	D;D;D	0.61697	0.959;0.99;0.983	D;D;P	0.72982	0.937;0.979;0.708	T	0.35847	-0.9772	9	0.06365	T	0.9	-7.2031	14.2767	0.66184	0.0:1.0:0.0:0.0	.	63;63;63	Q4J6C6-3;Q4J6C6-2;Q4J6C6	.;.;PPCEL_HUMAN	K	63	.	ENSP00000260648:R63K	R	-	2	0	PREPL	44440171	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.235000	0.51328	2.735000	0.93741	0.655000	0.94253	AGA	PREPL	-	NULL		0.308	PREPL-008	KNOWN	basic|appris_principal|CCDS	protein_coding	PREPL	HGNC	protein_coding	OTTHUMT00000327900.1	C	NM_006036		44586667	-1	no_errors	ENST00000260648	ensembl	human	known	70_37	missense	SNP	1.000	T
PRPF18	8559	genome.wustl.edu	37	10	13658486	13658486	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr10:13658486G>A	ENST00000378572.3	+	9	1041	c.881G>A	c.(880-882)aGa>aAa	p.R294K		NM_003675.3	NP_003666.1	Q99633	PRP18_HUMAN	pre-mRNA processing factor 18	294					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	potassium channel inhibitor activity (GO:0019870)			central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(5)|prostate(1)	17						AGAACTGGCAGAGAAAAGATT	0.453																																																	0													126.0	119.0	121.0					10																	13658486		2203	4300	6503	SO:0001583	missense	8559			U51990	CCDS7100.1	10p12.33	2013-06-10	2013-06-10		ENSG00000165630	ENSG00000165630			17351	protein-coding gene	gene with protein product		604993	"""PRP18 pre-mRNA processing factor 18 homolog (yeast)"", ""PRP18 pre-mRNA processing factor 18 homolog (S. cerevisiae)"""			9000057	Standard	XM_005252634		Approved	hPrp18	uc001imp.3	Q99633	OTTHUMG00000017702	ENST00000378572.3:c.881G>A	10.37:g.13658486G>A	ENSP00000367835:p.Arg294Lys		Q5T9P9|Q9BUI9	Missense_Mutation	SNP	pfam_Prp18,pfam_PRP4,superfamily_Prp18,smart_SFM	p.R294K	ENST00000378572.3	37	c.881	CCDS7100.1	10	.	.	.	.	.	.	.	.	.	.	G	32	5.121619	0.94385	.	.	ENSG00000165630	ENST00000378572	.	.	.	5.34	5.34	0.76211	Prp18 (3);	0.000000	0.85682	D	0.000000	D	0.87144	0.6104	M	0.94142	3.5	0.58432	D	0.999999	D	0.65815	0.995	D	0.70487	0.969	D	0.90673	0.4599	8	.	.	.	-15.7045	19.0325	0.92963	0.0:0.0:1.0:0.0	.	294	Q99633	PRP18_HUMAN	K	294	.	.	R	+	2	0	PRPF18	13698492	1.000000	0.71417	0.652000	0.29579	0.920000	0.55202	9.843000	0.99491	2.488000	0.83962	0.650000	0.86243	AGA	PRPF18	-	pfam_Prp18,superfamily_Prp18		0.453	PRPF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF18	HGNC	protein_coding	OTTHUMT00000046879.1	G			13658486	+1	no_errors	ENST00000378572	ensembl	human	known	70_37	missense	SNP	0.711	A
PRPF4	9128	genome.wustl.edu	37	9	116045017	116045017	+	Intron	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr9:116045017G>C	ENST00000374198.4	+	4	585				PRPF4_ENST00000488937.1_3'UTR|PRPF4_ENST00000374199.4_Intron	NM_001244926.1|NM_004697.4	NP_001231855.1|NP_004688.2	O43172	PRP4_HUMAN	pre-mRNA processing factor 4						gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 snRNP (GO:0071001)				NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)	23						AGAAGAGGTAGAACATGTCTT	0.378																																																	0													76.0	74.0	75.0					9																	116045017		2203	4300	6503	SO:0001627	intron_variant	9128			AF001687	CCDS6791.1, CCDS59142.1	9q31-q33	2013-10-03	2013-10-03		ENSG00000136875	ENSG00000136875		"""WD repeat domain containing"""	17349	protein-coding gene	gene with protein product	"""PRP4/STK/WD splicing factor"", ""U4/U6 small nuclear ribonucleoprotein Prp4"""	607795	"""PRP4 pre-mRNA processing factor 4 homolog (yeast)"""			9257651, 9404889	Standard	NM_004697		Approved	Prp4p, HPRP4, HPRP4P, PRP4, SNRNP60	uc004bgx.3	O43172	OTTHUMG00000020517	ENST00000374198.4:c.483+4G>C	9.37:g.116045017G>C			O43445|O43864|Q5T1M8|Q96DG2|Q96IK4	RNA	SNP	-	NULL	ENST00000374198.4	37	NULL	CCDS6791.1	9																																																																																			PRPF4	-	-		0.378	PRPF4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRPF4	HGNC	protein_coding	OTTHUMT00000053708.2	G	NM_004697		116045017	+1	no_errors	ENST00000488937	ensembl	human	known	70_37	rna	SNP	0.620	C
PRRX1	5396	genome.wustl.edu	37	1	170699449	170699449	+	Intron	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:170699449G>A	ENST00000239461.6	+	3	912				PRRX1_ENST00000476867.2_Intron|PRRX1_ENST00000367760.3_Missense_Mutation_p.E211K	NM_022716.2	NP_073207.1	P54821	PRRX1_HUMAN	paired related homeobox 1						artery morphogenesis (GO:0048844)|cartilage development (GO:0051216)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|inner ear morphogenesis (GO:0042472)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|palate development (GO:0060021)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)	nucleolus (GO:0005730)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			large_intestine(2)|ovary(1)	3	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TTGTTTACACGAGGGGCTTCA	0.478																																																	0													198.0	197.0	197.0					1																	170699449		2203	4300	6503	SO:0001627	intron_variant	5396			M95929	CCDS1290.1, CCDS1291.1	1q24.3	2011-06-20	2003-11-12	2003-11-14	ENSG00000116132	ENSG00000116132		"""Homeoboxes / PRD class"""	9142	protein-coding gene	gene with protein product		167420	"""paired mesoderm homeo box 1"""	PMX1		1509260	Standard	NM_006902		Approved	PHOX1	uc001ghf.3	P54821	OTTHUMG00000035231	ENST00000239461.6:c.599+3907G>A	1.37:g.170699449G>A			B5BUM7|O60807	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.E211K	ENST00000239461.6	37	c.631	CCDS1290.1	1	.	.	.	.	.	.	.	.	.	.	G	17.49	3.402367	0.62288	.	.	ENSG00000116132	ENST00000367760;ENST00000495280	D	0.90732	-2.72	5.67	5.67	0.87782	.	.	.	.	.	D	0.92054	0.7482	.	.	.	0.28156	N	0.929194	D	0.59767	0.986	D	0.68192	0.956	D	0.86646	0.1895	8	0.25751	T	0.34	.	16.4923	0.84205	0.0:0.0:1.0:0.0	.	211	P54821-2	.	K	211;56	ENSP00000356734:E211K	ENSP00000239461:E211K	E	+	1	0	PRRX1	168966073	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.886000	0.56190	2.677000	0.91161	0.655000	0.94253	GAG	PRRX1	-	NULL		0.478	PRRX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRX1	HGNC	protein_coding	OTTHUMT00000085236.3	G	NM_006902		170699449	+1	no_errors	ENST00000367760	ensembl	human	known	70_37	missense	SNP	1.000	A
PSMD6	9861	genome.wustl.edu	37	3	64009002	64009002	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr3:64009002G>A	ENST00000295901.4	-	1	234	c.94C>T	c.(94-96)Cgc>Tgc	p.R32C	PSMD6_ENST00000394431.2_Intron|PSMD6_ENST00000492933.1_Missense_Mutation_p.R32C|PSMD6_ENST00000482510.1_Intron	NM_014814.1	NP_055629.1	Q15008	PSMD6_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 6	32					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATPase activity (GO:0016887)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(1)|skin(1)	13		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000805)|Kidney(15;0.00188)|KIRC - Kidney renal clear cell carcinoma(15;0.00212)		GCGTCTCCGCGGTGCTCGGGC	0.711																																																	0													15.0	16.0	16.0					3																	64009002		2196	4289	6485	SO:0001583	missense	9861			AF215935	CCDS2901.1, CCDS63677.1, CCDS63678.1, CCDS63679.1	3p14.1	2008-05-22			ENSG00000163636	ENSG00000163636		"""Proteasome (prosome, macropain) subunits"""	9564	protein-coding gene	gene with protein product						10723133	Standard	NM_001271779		Approved	S10, p44S10, KIAA0107, Rpn7	uc003dmb.2	Q15008	OTTHUMG00000158765	ENST00000295901.4:c.94C>T	3.37:g.64009002G>A	ENSP00000295901:p.Arg32Cys		A8K2E0|E9PHI9|Q6UV22	Missense_Mutation	SNP	pfam_26S_proteasome_reg_su-Rpn7,pfam_PCI_dom,smart_PCI_dom	p.R32C	ENST00000295901.4	37	c.94	CCDS2901.1	3	.	.	.	.	.	.	.	.	.	.	G	31	5.058926	0.93846	.	.	ENSG00000163636	ENST00000295901;ENST00000492933;ENST00000478185	.	.	.	5.19	5.19	0.71726	.	0.105732	0.64402	D	0.000004	T	0.58921	0.2156	L	0.36672	1.1	0.80722	D	1	P;D	0.53312	0.834;0.959	B;P	0.49361	0.416;0.608	T	0.61402	-0.7070	9	0.52906	T	0.07	.	18.6966	0.91603	0.0:0.0:1.0:0.0	.	32;32	C9IZE4;Q15008	.;PSMD6_HUMAN	C	32	.	ENSP00000295901:R32C	R	-	1	0	PSMD6	63984042	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	6.880000	0.75578	2.586000	0.87340	0.467000	0.42956	CGC	PSMD6	-	NULL		0.711	PSMD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD6	HGNC	protein_coding	OTTHUMT00000352082.1	G	NM_014814		64009002	-1	no_errors	ENST00000295901	ensembl	human	known	70_37	missense	SNP	1.000	A
PTENP1	11191	genome.wustl.edu	37	9	33676899	33676899	+	RNA	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr9:33676899G>A	ENST00000532280.1	-	0	598					NR_023917.1				phosphatase and tensin homolog pseudogene 1 (functional)																		GGGAGAAGACGAATAATCCTC	0.697																																																	0																																												11191			AF023139, BC038293, BY797336		9p13.3	2014-09-11	2014-01-16		ENSG00000237984	ENSG00000237984		"""-"""	9589	pseudogene	pseudogene		613531	"""phosphatase and tensin homolog pseudogene 1"""			9393738, 9620558	Standard	NR_023917		Approved	PTEN2, psiPTEN, PTH2, PTEN-rs, PTENpg1	uc003zth.4		OTTHUMG00000000410		9.37:g.33676899G>A				RNA	SNP	-	NULL	ENST00000532280.1	37	NULL		9																																																																																			PTENP1	-	-		0.697	PTENP1-002	KNOWN	basic	processed_transcript	PTENP1	HGNC	pseudogene	OTTHUMT00000395145.1	G	NR_023917		33676899	-1	no_errors	ENST00000532280	ensembl	human	known	70_37	rna	SNP	1.000	A
PIKFYVE	200576	genome.wustl.edu	37	2	209224921	209224921	+	IGR	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:209224921G>A	ENST00000264380.4	+	0	9901				PTH2R_ENST00000413482.1_3'UTR	NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing						cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						TACGATAAATGAAAGCATTTC	0.428																																																	0																																										SO:0001628	intergenic_variant	5746			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945		2.37:g.209224921G>A			Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	RNA	SNP	-	NULL	ENST00000264380.4	37	NULL	CCDS2382.1	2																																																																																			PTH2R	-	-		0.428	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTH2R	HGNC	protein_coding	OTTHUMT00000256477.2	G	NM_015040		209224921	+1	no_errors	ENST00000413482	ensembl	human	known	70_37	rna	SNP	0.011	A
MED25	81857	genome.wustl.edu	37	19	50342092	50342092	+	IGR	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:50342092G>C	ENST00000312865.6	+	0	2332				PTOV1-AS1_ENST00000600742.1_RNA|PTOV1-AS1_ENST00000596521.1_RNA	NM_030973.3	NP_112235.2	Q71SY5	MED25_HUMAN	mediator complex subunit 25						cell death (GO:0008219)|gene expression (GO:0010467)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of chromatin binding (GO:0035563)|positive regulation of mediator complex assembly (GO:2001178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|transcription factor binding (GO:0008134)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	17		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00822)|GBM - Glioblastoma multiforme(134;0.0122)		ggtttgttttgaaaagcgaat	0.468																																					GBM(51;894 1657 37868)												0																																										SO:0001628	intergenic_variant	100506033			AL136746	CCDS33075.1	19q13.3	2014-09-17	2007-07-30			ENSG00000104973			28845	protein-coding gene	gene with protein product		610197	"""mediator of RNA polymerase II transcription, subunit 25 homolog (S. cerevisiae)"""			9110174, 11230166	Standard	NM_030973		Approved	ARC92, ACID1, TCBAP0758, DKFZp434K0512	uc002ppw.2	Q71SY5			19.37:g.50342092G>C			A8K095|B9TX30|O95783|Q6P143|Q6QMH5|Q707U4|Q8TB55|Q9H0L5|Q9HB34	RNA	SNP	-	NULL	ENST00000312865.6	37	NULL	CCDS33075.1	19																																																																																			PTOV1-AS1	-	-		0.468	MED25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTOV1-AS1	HGNC	protein_coding	OTTHUMT00000465316.1	G	NM_030973		50342092	-1	no_errors	ENST00000596521	ensembl	human	known	70_37	rna	SNP	0.002	C
PTPRU	10076	genome.wustl.edu	37	1	29652207	29652207	+	IGR	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:29652207C>G	ENST00000345512.3	+	0	4470				PTPRU_ENST00000460170.2_3'UTR|PTPRU_ENST00000428026.2_3'UTR|PTPRU_ENST00000356870.3_3'UTR|PTPRU_ENST00000323874.8_3'UTR|PTPRU_ENST00000373779.3_3'UTR	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U						canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		ACTGCACACTCAGGGCCAGAC	0.617																																																	0													74.0	68.0	70.0					1																	29652207		2203	4300	6503	SO:0001628	intergenic_variant	10076			U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699		1.37:g.29652207C>G			A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	RNA	SNP	-	NULL	ENST00000345512.3	37	NULL	CCDS334.1	1																																																																																			PTPRU	-	-		0.617	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRU	HGNC	protein_coding	OTTHUMT00000010447.1	C			29652207	+1	no_errors	ENST00000465525	ensembl	human	known	70_37	rna	SNP	0.857	G
TBC1D1	23216	genome.wustl.edu	37	4	37962321	37962321	+	Intron	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr4:37962321C>G	ENST00000261439.4	+	3	772				PTTG2_ENST00000504686.1_Missense_Mutation_p.S89C|TBC1D1_ENST00000508802.1_Intron	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1						membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						CCAAGCTTTTCTGCCAAAAAG	0.403																																																	0													80.0	90.0	87.0					4																	37962321		2198	4300	6498	SO:0001627	intron_variant	10744			AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.418-53809C>G	4.37:g.37962321C>G			B7Z3D9|E9PGH8|Q96K82|Q9UPP4	Missense_Mutation	SNP	pfam_Securin_separation_inhibitor	p.S89C	ENST00000261439.4	37	c.266	CCDS33972.1	4	.	.	.	.	.	.	.	.	.	.	C	4.790	0.146893	0.09134	.	.	ENSG00000250254	ENST00000504686	T	0.50001	0.76	1.9	-0.0852	0.13687	.	.	.	.	.	T	0.36276	0.0961	L	0.46157	1.445	0.09310	N	1	B	0.21821	0.061	B	0.23716	0.048	T	0.37079	-0.9721	9	0.59425	D	0.04	.	3.823	0.08843	0.0:0.5434:0.0:0.4566	.	89	Q9NZH5-2	.	C	89	ENSP00000424261:S89C	ENSP00000424261:S89C	S	+	2	0	PTTG2	37638716	0.000000	0.05858	0.038000	0.18304	0.005000	0.04900	0.089000	0.15002	0.117000	0.18138	-0.384000	0.06662	TCT	PTTG2	-	pfam_Securin_separation_inhibitor		0.403	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTTG2	HGNC	protein_coding	OTTHUMT00000317443.2	C	NM_015173		37962321	+1	no_errors	ENST00000504686	ensembl	human	known	70_37	missense	SNP	0.016	G
RAB11FIP1	80223	genome.wustl.edu	37	8	37729590	37729590	+	Silent	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr8:37729590G>C	ENST00000330843.4	-	4	2742	c.2730C>G	c.(2728-2730)ctC>ctG	p.L910L	RAB11FIP1_ENST00000522727.1_Intron|RAB11FIP1_ENST00000523182.1_5'UTR|RAB11FIP1_ENST00000287263.4_Intron|RAB11FIP1_ENST00000524118.1_Intron	NM_001002814.2	NP_001002814.2	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 (class I)	910					protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(4)|endometrium(3)|large_intestine(6)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	49		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			CCATCCTAAAGAGTGGAGTGT	0.557																																																	0													76.0	73.0	74.0					8																	37729590		2203	4300	6503	SO:0001819	synonymous_variant	80223			AK092296	CCDS34881.1, CCDS34882.1	8p11.22	2005-10-04			ENSG00000156675	ENSG00000156675			30265	protein-coding gene	gene with protein product		608737				11786538, 11495908	Standard	NM_001002814		Approved	RCP, FLJ22622, FLJ22524, Rab11-FIP1	uc003xkm.2	Q6WKZ4	OTTHUMG00000164026	ENST00000330843.4:c.2730C>G	8.37:g.37729590G>C			J3KNP0|Q307T1|Q6AZK4|Q6WKZ2|Q6WKZ6|Q86YV4|Q8TDL1|Q9H642	Silent	SNP	pfam_Rab-bd_FIP-RBD,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.L910	ENST00000330843.4	37	c.2730	CCDS34882.1	8																																																																																			RAB11FIP1	-	NULL		0.557	RAB11FIP1-002	KNOWN	basic|CCDS	protein_coding	RAB11FIP1	HGNC	protein_coding	OTTHUMT00000376816.1	G	NM_025151		37729590	-1	no_errors	ENST00000330843	ensembl	human	known	70_37	silent	SNP	0.000	C
PXDNL	137902	genome.wustl.edu	37	8	52321474	52321474	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr8:52321474C>T	ENST00000356297.4	-	17	2810	c.2710G>A	c.(2710-2712)Gag>Aag	p.E904K	PXDNL_ENST00000543296.1_Missense_Mutation_p.E904K	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	904					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GATTCCCGCTCCGAGCTCCCG	0.592																																																	0													39.0	44.0	42.0					8																	52321474		1986	4151	6137	SO:0001583	missense	137902				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2710G>A	8.37:g.52321474C>T	ENSP00000348645:p.Glu904Lys		B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like,prints_Haem_peroxidase_animal_subgr	p.E904K	ENST00000356297.4	37	c.2710	CCDS47855.1	8	.	.	.	.	.	.	.	.	.	.	C	7.877	0.729466	0.15507	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.70399	-0.48;-0.48	4.03	3.1	0.35709	.	0.373843	0.22372	N	0.060930	T	0.59238	0.2179	L	0.43598	1.365	0.27373	N	0.955632	B	0.32382	0.368	B	0.32211	0.142	T	0.47381	-0.9122	10	0.25106	T	0.35	.	10.2879	0.43577	0.1993:0.8006:0.0:0.0	.	904	A1KZ92	PXDNL_HUMAN	K	904	ENSP00000348645:E904K;ENSP00000444865:E904K	ENSP00000348645:E904K	E	-	1	0	PXDNL	52484027	0.915000	0.31059	0.002000	0.10522	0.132000	0.20833	2.639000	0.46570	0.607000	0.29982	0.561000	0.74099	GAG	PXDNL	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal		0.592	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDNL	HGNC	protein_coding	OTTHUMT00000377905.1	C	NM_144651		52321474	-1	no_errors	ENST00000356297	ensembl	human	known	70_37	missense	SNP	0.683	T
RALGPS2	55103	genome.wustl.edu	37	1	178855222	178855222	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:178855222G>A	ENST00000367635.3	+	13	1497	c.1159G>A	c.(1159-1161)Gaa>Aaa	p.E387K	RALGPS2_ENST00000477383.1_3'UTR|RALGPS2_ENST00000367634.2_Missense_Mutation_p.E387K	NM_152663.3	NP_689876.2	Q86X27	RGPS2_HUMAN	Ral GEF with PH domain and SH3 binding motif 2	387					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	29						AGGCCAAGCTGAAAGTTCTAC	0.403																																																	0													79.0	81.0	80.0					1																	178855222		2203	4300	6503	SO:0001583	missense	55103			AK098470	CCDS1325.1, CCDS65733.1	1q24	2013-01-11			ENSG00000116191	ENSG00000116191		"""Pleckstrin homology (PH) domain containing"""	30279	protein-coding gene	gene with protein product						10747847, 12102558	Standard	NM_152663		Approved	KIAA0351, FLJ10244, FLJ25604	uc001glz.3	Q86X27	OTTHUMG00000035076	ENST00000367635.3:c.1159G>A	1.37:g.178855222G>A	ENSP00000356607:p.Glu387Lys		B7Z7B1|Q5T5Z1|Q5VZ67|Q9NW78	Missense_Mutation	SNP	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_RasGRF_CDC25	p.E387K	ENST00000367635.3	37	c.1159	CCDS1325.1	1	.	.	.	.	.	.	.	.	.	.	G	18.77	3.694960	0.68386	.	.	ENSG00000116191	ENST00000367635;ENST00000367634;ENST00000324778;ENST00000535251	T;T;T	0.45668	0.89;0.89;0.89	5.55	5.55	0.83447	.	0.246014	0.41194	D	0.000923	T	0.41373	0.1156	L	0.54323	1.7	0.80722	D	1	B;B	0.33964	0.434;0.434	B;B	0.31442	0.085;0.13	T	0.20638	-1.0269	10	0.29301	T	0.29	.	19.111	0.93317	0.0:0.0:1.0:0.0	.	387;387	B7Z7B1;Q86X27	.;RGPS2_HUMAN	K	387;387;352;36	ENSP00000356607:E387K;ENSP00000356606:E387K;ENSP00000313613:E352K	ENSP00000313613:E352K	E	+	1	0	RALGPS2	177121845	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	9.255000	0.95524	2.623000	0.88846	0.655000	0.94253	GAA	RALGPS2	-	NULL		0.403	RALGPS2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RALGPS2	HGNC	protein_coding	OTTHUMT00000084926.2	G	NM_152663		178855222	+1	no_errors	ENST00000367635	ensembl	human	known	70_37	missense	SNP	1.000	A
RAPGEF4	11069	genome.wustl.edu	37	2	173882163	173882163	+	Missense_Mutation	SNP	C	C	G	rs17853965		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:173882163C>G	ENST00000397081.3	+	21	2082	c.1939C>G	c.(1939-1941)Ctt>Gtt	p.L647V	RAPGEF4_ENST00000540783.1_Missense_Mutation_p.L494V|RAPGEF4_ENST00000409036.1_Missense_Mutation_p.L647V|RAPGEF4_ENST00000397087.3_Missense_Mutation_p.L503V|RAPGEF4_ENST00000535187.1_Missense_Mutation_p.L427V|RAPGEF4_ENST00000539331.1_Missense_Mutation_p.L494V|RAPGEF4_ENST00000538974.1_Missense_Mutation_p.L476V|RAPGEF4_ENST00000264111.6_Missense_Mutation_p.L646V	NM_007023.3	NP_008954.2	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4	647				L -> I (in Ref. 5; AAH40183). {ECO:0000305}.	blood coagulation (GO:0007596)|calcium ion-dependent exocytosis (GO:0017156)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|insulin secretion (GO:0030073)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of exocytosis (GO:0017157)|regulation of insulin secretion (GO:0050796)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(14)|lung(13)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47			OV - Ovarian serous cystadenocarcinoma(117;0.194)			GCACAAGGTTCTTTTGCAACA	0.493																																																	0													86.0	81.0	83.0					2																	173882163		1923	4128	6051	SO:0001583	missense	11069			U78516	CCDS42775.1, CCDS42776.1, CCDS63060.1, CCDS63061.1, CCDS74604.1	2q31-q32	2008-02-05	2004-03-26		ENSG00000091428	ENSG00000091428			16626	protein-coding gene	gene with protein product	"""cAMP-regulated guanine nucleotide exchange factor II"", "" exchange protein directly activated by cAMP 2"""	606058	"""RAP guanine-nucleotide-exchange factor (GEF) 4"""			10777494, 9856955	Standard	NM_007023		Approved	cAMP-GEFII, CGEF2	uc002uhv.4	Q8WZA2	OTTHUMG00000133677	ENST00000397081.3:c.1939C>G	2.37:g.173882163C>G	ENSP00000380271:p.Leu647Val		B2R7R3|B7Z283|B7Z3T6|B7Z912|O95636|Q8IXK6|Q8TAA4	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_cNMP-bd_dom,pfam_DEP_dom,pfam_Ras-like_Gua-exchang_fac_N,pfam_Ras-assoc,superfamily_Ras_GEF_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_DEP_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_cNMP-bd_dom,pfscan_DEP_dom,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N,prints_cAMP/cGMP_kin	p.L647V	ENST00000397081.3	37	c.1939	CCDS42775.1	2	.	.	.	.	.	.	.	.	.	.	C	13.44	2.237686	0.39598	.	.	ENSG00000091428	ENST00000264111;ENST00000397081;ENST00000409036;ENST00000397087;ENST00000538974;ENST00000540783;ENST00000539331;ENST00000535187	T;T;T;T;T;T;T;T	0.33654	1.4;1.4;1.4;1.4;1.4;1.4;1.4;1.4	5.46	5.46	0.80206	Ras guanine nucleotide exchange factor, domain (1);	0.169731	0.53938	D	0.000057	T	0.39489	0.1080	L	0.59436	1.845	0.49915	D	0.999834	B;B	0.17465	0.022;0.002	B;B	0.18561	0.022;0.004	T	0.13469	-1.0508	10	0.29301	T	0.29	.	19.7373	0.96212	0.0:1.0:0.0:0.0	.	503;647	Q8WZA2-3;Q8WZA2	.;RPGF4_HUMAN	V	646;647;647;503;476;494;494;427	ENSP00000264111:L646V;ENSP00000380271:L647V;ENSP00000387104:L647V;ENSP00000380276:L503V;ENSP00000440135:L476V;ENSP00000440250:L494V;ENSP00000437384:L494V;ENSP00000438011:L427V	ENSP00000264111:L646V	L	+	1	0	RAPGEF4	173590409	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.604000	0.61112	2.753000	0.94483	0.555000	0.69702	CTT	RAPGEF4	-	superfamily_Ras_GEF_dom		0.493	RAPGEF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAPGEF4	HGNC	protein_coding	OTTHUMT00000257864.2	C	NM_007023		173882163	+1	no_errors	ENST00000397081	ensembl	human	known	70_37	missense	SNP	1.000	G
RASSF2	9770	genome.wustl.edu	37	20	4764157	4764157	+	3'UTR	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr20:4764157G>C	ENST00000379400.3	-	0	1938				RASSF2_ENST00000478553.1_5'UTR|RASSF2_ENST00000379376.2_3'UTR	NM_014737.2	NP_055552.1	P50749	RASF2_HUMAN	Ras association (RalGDS/AF-6) domain family member 2						bone remodeling (GO:0046849)|cell cycle (GO:0007049)|epidermal growth factor receptor signaling pathway via I-kappaB kinase/NF-kappaB cascade (GO:0038168)|homeostasis of number of cells (GO:0048872)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|ossification (GO:0001503)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|pancreas(2)|prostate(2)|skin(2)	34						CATGGAGGCAGAGATGGAGGC	0.448																																					Melanoma(158;1891 3343 50738)												0																																										SO:0001624	3_prime_UTR_variant	9770			D79990	CCDS13083.1	20p13	2011-08-12	2008-02-22		ENSG00000101265	ENSG00000101265			9883	protein-coding gene	gene with protein product	"""centromere protein 34"""	609492				8724849, 15806169	Standard	NM_014737		Approved	KIAA0168, CENP-34	uc002wld.3	P50749	OTTHUMG00000031790	ENST00000379400.3:c.*762C>G	20.37:g.4764157G>C			A6NIX9|A8K5Z3|Q17S06|Q53HD0|Q6AHZ2|Q8IZA5	RNA	SNP	-	NULL	ENST00000379400.3	37	NULL	CCDS13083.1	20																																																																																			RASSF2	-	-		0.448	RASSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASSF2	HGNC	protein_coding	OTTHUMT00000077828.1	G	NM_014737		4764157	-1	no_errors	ENST00000478553	ensembl	human	known	70_37	rna	SNP	0.000	C
RBL1	5933	genome.wustl.edu	37	20	35690616	35690616	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr20:35690616C>G	ENST00000373664.3	-	8	1020	c.954G>C	c.(952-954)gaG>gaC	p.E318D	RBL1_ENST00000344359.3_Missense_Mutation_p.E318D	NM_002895.2	NP_002886.2	P28749	RBL1_HUMAN	retinoblastoma-like 1	318					chromatin modification (GO:0016568)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription factor binding (GO:0008134)			NS(1)|breast(1)|endometrium(7)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	42		Myeloproliferative disorder(115;0.00878)				AAAAGATCCTCTCATCAAAAT	0.408																																																	0													144.0	127.0	133.0					20																	35690616		2203	4300	6503	SO:0001583	missense	5933			L14812	CCDS13289.1, CCDS13290.1	20q11.23	2014-03-11	2014-03-11		ENSG00000080839	ENSG00000080839			9893	protein-coding gene	gene with protein product		116957				1833063	Standard	NM_183404		Approved	p107, cp107, PRB1	uc002xgi.3	P28749	OTTHUMG00000032406	ENST00000373664.3:c.954G>C	20.37:g.35690616C>G	ENSP00000362768:p.Glu318Asp		A8K2W5|Q4VXA0|Q8N5K6|Q9H1L5|Q9H1M1	Missense_Mutation	SNP	pfam_RB_A,pfam_RB_B,pfam_DUF3452_retinoblatoma-assoc,pfam_Rb_C,superfamily_Cyclin-like,smart_Cyclin-like	p.E318D	ENST00000373664.3	37	c.954	CCDS13289.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.50|19.50	3.838973|3.838973	0.71373|0.71373	.|.	.|.	ENSG00000080839|ENSG00000080839	ENST00000373664;ENST00000344359|ENST00000525052	D;D|.	0.96522|.	-3.8;-4.04|.	5.04|5.04	2.98|2.98	0.34508|0.34508	.|.	0.100769|.	0.64402|.	D|.	0.000002|.	T|T	0.75273|0.75273	0.3827|0.3827	M|M	0.86864|0.86864	2.845|2.845	0.51767|0.51767	D|D	0.999933|0.999933	D;D|.	0.89917|.	0.998;1.0|.	D;D|.	0.77557|.	0.949;0.99|.	T|T	0.77040|0.77040	-0.2735|-0.2735	10|5	0.62326|.	D|.	0.03|.	-16.7788|-16.7788	9.4088|9.4088	0.38477|0.38477	0.0:0.7565:0.0:0.2435|0.0:0.7565:0.0:0.2435	.|.	318;318|.	P28749-2;P28749|.	.;RBL1_HUMAN|.	D|T	318|123	ENSP00000362768:E318D;ENSP00000343646:E318D|.	ENSP00000343646:E318D|.	E|R	-|-	3|2	2|0	RBL1|RBL1	35124030|35124030	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	3.605000|3.605000	0.54088|0.54088	1.350000|1.350000	0.45770|0.45770	-0.140000|-0.140000	0.14226|0.14226	GAG|AGA	RBL1	-	NULL		0.408	RBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBL1	HGNC	protein_coding	OTTHUMT00000079067.2	C	NM_002895		35690616	-1	no_errors	ENST00000373664	ensembl	human	known	70_37	missense	SNP	1.000	G
RBM12B-AS1	55472	genome.wustl.edu	37	8	94752736	94752736	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr8:94752736G>T	ENST00000391680.1	+	1	388	c.256G>T	c.(256-258)Gag>Tag	p.E86*	RBM12B_ENST00000399300.2_Intron|RP11-10N23.5_ENST00000523945.1_RNA|RBM12B_ENST00000517700.1_Intron|RBM12B_ENST00000520961.1_5'Flank			Q9P1G2	RBAS1_HUMAN	RBM12B antisense RNA 1	86																	TAACTCGCCAGAGGGTGAACT	0.537																																																	0																																										SO:0001587	stop_gained	55472			AF116672		8q22.1	2012-10-12	2012-08-15	2012-04-11	ENSG00000212998			"""Long non-coding RNAs"""	28818	non-coding RNA	RNA, long non-coding			"""chromosome 8 open reading frame 39"", ""RBM12B antisense RNA 1 (non-protein coding)"""	C8orf39			Standard	NR_027259		Approved	PRO1905	uc011lgj.1	Q9P1G2		ENST00000391680.1:c.256G>T	8.37:g.94752736G>T	ENSP00000375562:p.Glu86*			Nonsense_Mutation	SNP	NULL	p.E86*	ENST00000391680.1	37	c.256		8	.	.	.	.	.	.	.	.	.	.	G	18.81	3.702456	0.68501	.	.	ENSG00000212998	ENST00000391680	.	.	.	3.68	-7.36	0.01417	.	.	.	.	.	.	.	.	.	.	.	0.31809	N	0.627402	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	3.0687	0.06222	0.2742:0.1079:0.4526:0.1653	.	.	.	.	X	86	.	ENSP00000375562:E86X	E	+	1	0	C8orf39	94821912	0.000000	0.05858	0.000000	0.03702	0.656000	0.38851	-2.543000	0.00934	-3.470000	0.00157	-0.479000	0.04858	GAG	RBM12B-AS1	-	NULL		0.537	RBM12B-AS1-201	KNOWN	basic|appris_principal	protein_coding	RBM12B-AS1	HGNC	protein_coding		G	NR_027259		94752736	+1	no_errors	ENST00000391680	ensembl	human	known	70_37	nonsense	SNP	0.000	T
RBM6	10180	genome.wustl.edu	37	3	50095409	50095409	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr3:50095409G>A	ENST00000266022.4	+	9	2201	c.1942G>A	c.(1942-1944)Gag>Aag	p.E648K	RBM6_ENST00000441115.1_3'UTR|RBM6_ENST00000422955.1_Missense_Mutation_p.E126K|RBM6_ENST00000539992.1_5'UTR|RBM6_ENST00000443081.1_Missense_Mutation_p.E516K|RBM6_ENST00000442092.1_Missense_Mutation_p.E126K	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	648					RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		ATGGTCTGGAGAGACACGCCA	0.493																																																	0													74.0	76.0	75.0					3																	50095409		2203	4300	6503	SO:0001583	missense	10180			AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.1942G>A	3.37:g.50095409G>A	ENSP00000266022:p.Glu648Lys		O60549|O75524|Q86SS3	Missense_Mutation	SNP	pfam_G_patch_dom,smart_RRM_dom,smart_G_patch_dom,pfscan_G_patch_dom,pfscan_RRM_dom	p.E648K	ENST00000266022.4	37	c.1942	CCDS2809.1	3	.	.	.	.	.	.	.	.	.	.	G	17.06	3.293190	0.60086	.	.	ENSG00000004534	ENST00000442092;ENST00000266022;ENST00000443081;ENST00000422955;ENST00000446471	T;T;T;T	0.35421	1.31;1.31;1.31;1.31	5.71	5.71	0.89125	.	0.579013	0.18096	N	0.151837	T	0.21631	0.0521	N	0.14661	0.345	0.80722	D	1	B;B	0.23377	0.002;0.084	B;B	0.15870	0.004;0.014	T	0.09164	-1.0687	9	.	.	.	-1.5107	12.4127	0.55476	0.0767:0.0:0.9233:0.0	.	516;648	E9PGM9;P78332	.;RBM6_HUMAN	K	126;648;516;126;126	ENSP00000393530:E126K;ENSP00000266022:E648K;ENSP00000396466:E516K;ENSP00000392939:E126K	.	E	+	1	0	RBM6	50070413	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	4.470000	0.60175	2.711000	0.92665	0.650000	0.86243	GAG	RBM6	-	NULL		0.493	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM6	HGNC	protein_coding	OTTHUMT00000345528.4	G	NM_005777		50095409	+1	no_errors	ENST00000266022	ensembl	human	known	70_37	missense	SNP	0.999	A
RBM5	10181	genome.wustl.edu	37	3	50138005	50138005	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr3:50138005G>C	ENST00000347869.3	+	6	625	c.450G>C	c.(448-450)ttG>ttC	p.L150F	RBM5_ENST00000469838.1_3'UTR	NM_005778.3	NP_005769.1	P52756	RBM5_HUMAN	RNA binding motif protein 5	150	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(3)|large_intestine(4)|lung(6)|prostate(2)	19				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TTTATCACTTGCAAGATGCTA	0.413																																																	0													151.0	126.0	134.0					3																	50138005		2203	4300	6503	SO:0001583	missense	10181			U23946	CCDS2810.1	3p21.3	2013-08-15			ENSG00000003756	ENSG00000003756		"""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9902	protein-coding gene	gene with protein product		606884				10352938, 23935508	Standard	NM_005778		Approved	LUCA15, H37	uc003cyg.3	P52756	OTTHUMG00000156785	ENST00000347869.3:c.450G>C	3.37:g.50138005G>C	ENSP00000343054:p.Leu150Phe		B2RA45|B4DM16|B4DMF9|B4DZ63|Q93021|Q9BU14|Q9HDA6|Q9UKY8|Q9UL24	Missense_Mutation	SNP	pfam_G_patch_dom,pfam_RRM_dom,pfam_Znf_RanBP2,smart_RRM_dom,smart_Znf_RanBP2,smart_G_patch_dom,pfscan_Znf_RanBP2,pfscan_Znf_C2H2,pfscan_G_patch_dom,pfscan_RRM_dom	p.L150F	ENST00000347869.3	37	c.450	CCDS2810.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.92|13.92	2.379516|2.379516	0.42207|0.42207	.|.	.|.	ENSG00000003756|ENSG00000003756	ENST00000404526;ENST00000536082|ENST00000347869;ENST00000543047	.|T	.|0.08458	.|3.09	6.04|6.04	6.04|6.04	0.98038|0.98038	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.|0.069445	.|0.64402	.|D	.|0.000011	T|T	0.15739|0.15739	0.0379|0.0379	M|M	0.80982|0.80982	2.52|2.52	0.80722|0.80722	D|D	1|1	.|B	.|0.10296	.|0.003	.|B	.|0.17098	.|0.017	T|T	0.00975|0.00975	-1.1494|-1.1494	6|10	0.87932|0.41790	D|T	0|0.15	-7.1693|-7.1693	15.1859|15.1859	0.73002|0.73002	0.0:0.0:0.8266:0.1734|0.0:0.0:0.8266:0.1734	.|.	.|150	.|P52756	.|RBM5_HUMAN	P|F	120;102|150;149	.|ENSP00000343054:L150F	ENSP00000384872:A120P|ENSP00000343054:L150F	A|L	+|+	1|3	0|2	RBM5|RBM5	50113009|50113009	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	6.412000|6.412000	0.73303|0.73303	2.873000|2.873000	0.98535|0.98535	0.561000|0.561000	0.74099|0.74099	GCA|TTG	RBM5	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom		0.413	RBM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM5	HGNC	protein_coding	OTTHUMT00000345797.3	G	NM_005778		50138005	+1	no_errors	ENST00000347869	ensembl	human	known	70_37	missense	SNP	1.000	C
RFX4	5992	genome.wustl.edu	37	12	107109195	107109195	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr12:107109195C>G	ENST00000392842.1	+	11	1425	c.1011C>G	c.(1009-1011)atC>atG	p.I337M	RFX4_ENST00000229387.5_Missense_Mutation_p.I243M|RP11-482D24.3_ENST00000552415.1_RNA|RP11-144F15.1_ENST00000551505.1_Intron|RFX4_ENST00000357881.4_Missense_Mutation_p.I346M	NM_213594.2	NP_998759.1	Q33E94	RFX4_HUMAN	regulatory factor X, 4 (influences HLA class II expression)	337	Necessary for dimerization.				cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|dorsal spinal cord development (GO:0021516)|midbrain development (GO:0030901)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein processing (GO:0070613)|telencephalon development (GO:0021537)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(20)|pancreas(1)|upper_aerodigestive_tract(1)	35						GAACAGTGATCCACAGTGCAG	0.453																																																	0													177.0	132.0	147.0					12																	107109195		2203	4300	6503	SO:0001583	missense	5992			AB044245	CCDS9106.1, CCDS9108.1, CCDS55880.1	12q24	2008-08-05			ENSG00000111783	ENSG00000111783			9985	protein-coding gene	gene with protein product		603958				8600444, 11682486	Standard	NM_213594		Approved		uc001tlt.3	Q33E94	OTTHUMG00000169173	ENST00000392842.1:c.1011C>G	12.37:g.107109195C>G	ENSP00000376585:p.Ile337Met		A8K5Y0|B2RDW4|Q33DW6|Q33DW7|Q33E95|Q6YM53|Q8MHQ1|Q8NC78|Q8NDF9|Q8SNA1|Q96S80|Q9BXI0	Missense_Mutation	SNP	pfam_DNA-bd_RFX	p.I346M	ENST00000392842.1	37	c.1038	CCDS9106.1	12	.	.	.	.	.	.	.	.	.	.	C	16.02	3.003125	0.54254	.	.	ENSG00000111783	ENST00000392842;ENST00000357881;ENST00000266774;ENST00000229387	T;T;T	0.44881	0.91;0.91;0.91	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.59335	0.2186	L	0.54323	1.7	0.53688	D	0.999975	P;D;D;D	0.60575	0.573;0.988;0.988;0.98	P;D;D;D	0.72338	0.468;0.977;0.977;0.924	T	0.57481	-0.7804	10	0.52906	T	0.07	-15.9224	14.7596	0.69596	0.1445:0.8555:0.0:0.0	.	243;346;346;337	B2RDW4;Q33E94-2;Q33E94-4;Q33E94	.;.;.;RFX4_HUMAN	M	337;346;346;243	ENSP00000376585:I337M;ENSP00000350552:I346M;ENSP00000229387:I243M	ENSP00000229387:I243M	I	+	3	3	RFX4	105633325	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.252000	0.43196	2.736000	0.93811	0.655000	0.94253	ATC	RFX4	-	NULL		0.453	RFX4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX4	HGNC	protein_coding	OTTHUMT00000402707.1	C	NM_032491		107109195	+1	no_errors	ENST00000357881	ensembl	human	known	70_37	missense	SNP	1.000	G
RNASEL	6041	genome.wustl.edu	37	1	182555233	182555233	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:182555233C>G	ENST00000367559.3	-	2	962	c.709G>C	c.(709-711)Gaa>Caa	p.E237Q	RNASEL_ENST00000444138.1_Missense_Mutation_p.E237Q|RNASEL_ENST00000539397.1_Missense_Mutation_p.E237Q	NM_021133.3	NP_066956.1	Q05823	RN5A_HUMAN	ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent)	237	2-5A binding (P-loop) 1.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|mRNA processing (GO:0006397)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA processing (GO:0006364)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(1)	27						TTCCCTCTTTCTCCCCTCACA	0.512																																																	0													74.0	70.0	71.0					1																	182555233		2203	4300	6503	SO:0001583	missense	6041			L10381	CCDS1347.1	1q25	2013-01-10			ENSG00000135828	ENSG00000135828	3.1.26.-	"""Ankyrin repeat domain containing"""	10050	protein-coding gene	gene with protein product		180435	"""prostate cancer 1"""	RNS4, PRCA1		7514564	Standard	NM_021133		Approved		uc009wxz.2	Q05823	OTTHUMG00000035213	ENST00000367559.3:c.709G>C	1.37:g.182555233C>G	ENSP00000356530:p.Glu237Gln		Q5W0L2|Q6AI46	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KEN_RNase_activator,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Ankyrin_rpt-contain_dom,superfamily_Kinase-like_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_PUG-dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_cat_dom,prints_Ankyrin_rpt	p.E237Q	ENST00000367559.3	37	c.709	CCDS1347.1	1	.	.	.	.	.	.	.	.	.	.	C	17.08	3.297972	0.60086	.	.	ENSG00000135828	ENST00000367559;ENST00000444138;ENST00000539397	T;T;T	0.23147	1.92;1.92;1.92	4.58	3.67	0.42095	Ankyrin repeat-containing domain (4);	0.210741	0.33346	N	0.005007	T	0.33818	0.0876	L	0.36672	1.1	0.29122	N	0.880202	D;D;D	0.71674	0.998;0.998;0.996	P;P;P	0.58577	0.841;0.841;0.571	T	0.13308	-1.0514	10	0.52906	T	0.07	-15.9476	12.1568	0.54081	0.0:0.915:0.0:0.085	.	237;237;237	Q5W0L2;Q6AI46;Q05823	.;.;RN5A_HUMAN	Q	237	ENSP00000356530:E237Q;ENSP00000411147:E237Q;ENSP00000440844:E237Q	ENSP00000356530:E237Q	E	-	1	0	RNASEL	180821856	0.999000	0.42202	0.056000	0.19401	0.705000	0.40729	2.588000	0.46137	0.941000	0.37499	0.557000	0.71058	GAA	RNASEL	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.512	RNASEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASEL	HGNC	protein_coding	OTTHUMT00000085189.1	C	NM_021133		182555233	-1	no_errors	ENST00000367559	ensembl	human	known	70_37	missense	SNP	0.701	G
RNF17	56163	genome.wustl.edu	37	13	25444740	25444740	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr13:25444740C>G	ENST00000255324.5	+	32	4362	c.4310C>G	c.(4309-4311)tCt>tGt	p.S1437C	RNF17_ENST00000339524.3_Missense_Mutation_p.S447C|RNF17_ENST00000381921.1_Missense_Mutation_p.S1395C	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	1437					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		ATAGAAACTTCTAACCAGTCT	0.413																																																	0													111.0	107.0	108.0					13																	25444740		2203	4300	6503	SO:0001583	missense	56163			AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.4310C>G	13.37:g.25444740C>G	ENSP00000255324:p.Ser1437Cys		Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor,pfscan_Znf_RING	p.S1437C	ENST00000255324.5	37	c.4310	CCDS9308.2	13	.	.	.	.	.	.	.	.	.	.	c	0.003	-2.517275	0.00151	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000418120;ENST00000339524	T;T;T;T	0.22336	3.49;3.51;2.75;1.96	5.0	-1.27	0.09347	.	1.054840	0.07413	N	0.892704	T	0.07728	0.0194	N	0.04203	-0.255	0.09310	N	1	B;B;B;B	0.06786	0.0;0.001;0.0;0.0	B;B;B;B	0.08055	0.001;0.003;0.0;0.001	T	0.33033	-0.9884	10	0.36615	T	0.2	0.0124	0.6765	0.00867	0.2726:0.2465:0.3153:0.1656	.	1433;447;1431;1437	B7Z7S1;Q5T6R1;Q9BXT8-5;Q9BXT8	.;.;.;RNF17_HUMAN	C	1437;1395;761;447	ENSP00000255324:S1437C;ENSP00000371346:S1395C;ENSP00000388892:S761C;ENSP00000344776:S447C	ENSP00000255324:S1437C	S	+	2	0	RNF17	24342740	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.212000	0.09319	-0.173000	0.10761	-1.105000	0.02106	TCT	RNF17	-	NULL		0.413	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF17	HGNC	protein_coding	OTTHUMT00000044217.1	C	NM_031994		25444740	+1	no_errors	ENST00000255324	ensembl	human	known	70_37	missense	SNP	0.000	G
RORA	6095	genome.wustl.edu	37	15	60803666	60803666	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr15:60803666C>T	ENST00000335670.6	-	5	679	c.579G>A	c.(577-579)ctG>ctA	p.L193L	RORA_ENST00000449337.2_Silent_p.L138L|RP11-219B17.1_ENST00000559902.1_RNA|RP11-219B17.1_ENST00000558140.1_RNA|RORA_ENST00000560004.1_5'UTR|RORA_ENST00000261523.5_Silent_p.L226L|RP11-219B17.1_ENST00000501579.2_RNA|RP11-219B17.1_ENST00000558235.1_RNA|RP11-219B17.1_ENST00000559824.1_RNA|RORA_ENST00000309157.4_Silent_p.L218L	NM_134261.2	NP_599023.1	P35398	RORA_HUMAN	RAR-related orphan receptor A	193	Hinge.				angiogenesis (GO:0001525)|cellular response to hypoxia (GO:0071456)|cellular response to sterol (GO:0036315)|cerebellar granule cell precursor proliferation (GO:0021930)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|circadian regulation of gene expression (GO:0032922)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|muscle cell differentiation (GO:0042692)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|nitric oxide biosynthetic process (GO:0006809)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of cholesterol homeostasis (GO:2000188)|regulation of glucose metabolic process (GO:0010906)|regulation of macrophage activation (GO:0043030)|regulation of smoothened signaling pathway (GO:0008589)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription involved in cell fate commitment (GO:0060850)|regulation of transcription, DNA-templated (GO:0006355)|T-helper 17 cell differentiation (GO:0072539)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	direct ligand regulated sequence-specific DNA binding transcription factor activity (GO:0098531)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|oxysterol binding (GO:0008142)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator binding (GO:0001223)|transcription corepressor binding (GO:0001222)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	21						GAAGTTCCGTCAGCCCGTTGG	0.607																																																	0													195.0	142.0	160.0					15																	60803666		2203	4300	6503	SO:0001819	synonymous_variant	6095			U04897	CCDS10177.1, CCDS10178.1, CCDS10179.1, CCDS45271.1	15q21-q22	2013-01-16			ENSG00000069667	ENSG00000069667		"""Nuclear hormone receptors"""	10258	protein-coding gene	gene with protein product		600825				7926749	Standard	NM_134261		Approved	RZRA, ROR1, ROR2, ROR3, NR1F1	uc002agv.3	P35398	OTTHUMG00000132769	ENST00000335670.6:c.579G>A	15.37:g.60803666C>T			P35397|P35399|P45445|Q495X4|Q96H83	Silent	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_ROR_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_ThyrH_rcpt	p.L226	ENST00000335670.6	37	c.678	CCDS10177.1	15																																																																																			RORA	-	NULL		0.607	RORA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RORA	HGNC	protein_coding	OTTHUMT00000256142.2	C			60803666	-1	no_errors	ENST00000261523	ensembl	human	known	70_37	silent	SNP	0.940	T
RPGR	6103	genome.wustl.edu	37	X	38180282	38180282	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chrX:38180282G>A	ENST00000339363.3	-	4	475	c.308C>T	c.(307-309)aCa>aTa	p.T103I	TM4SF2_ENST00000465127.1_Intron|RPGR_ENST00000378505.2_Missense_Mutation_p.T103I|RPGR_ENST00000338898.3_Missense_Mutation_p.T103I|RPGR_ENST00000309513.3_Missense_Mutation_p.T103I|RPGR_ENST00000318842.7_Missense_Mutation_p.T103I|RPGR_ENST00000342811.3_Missense_Mutation_p.T103I			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator	103					cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						CACTATACCTGTTGACACCAG	0.368																																																	0													102.0	91.0	94.0					X																	38180282		2202	4300	6502	SO:0001583	missense	6103			U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.308C>T	X.37:g.38180282G>A	ENSP00000343671:p.Thr103Ile		B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Missense_Mutation	SNP	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.T103I	ENST00000339363.3	37	c.308		X	.	.	.	.	.	.	.	.	.	.	G	20.7	4.041843	0.75732	.	.	ENSG00000156313	ENST00000339363;ENST00000309513;ENST00000338898;ENST00000318842;ENST00000342811;ENST00000378505	D;D;D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73;-1.73;-1.73	6.07	6.07	0.98685	.	0.000000	0.85682	U	0.000000	D	0.95114	0.8417	H	0.97783	4.075	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.96541	0.9400	10	0.87932	D	0	.	19.5515	0.95323	0.0:0.0:1.0:0.0	.	103;103	E9PE28;Q92834-2	.;.	I	103	ENSP00000343671:T103I;ENSP00000308783:T103I;ENSP00000340208:T103I;ENSP00000322219:T103I;ENSP00000339531:T103I;ENSP00000367766:T103I	ENSP00000308783:T103I	T	-	2	0	RPGR	38065226	1.000000	0.71417	1.000000	0.80357	0.383000	0.30230	9.357000	0.97099	2.573000	0.86826	0.538000	0.68166	ACA	RPGR	-	superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens		0.368	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	RPGR	HGNC	protein_coding		G	NM_000328		38180282	-1	no_errors	ENST00000378505	ensembl	human	known	70_37	missense	SNP	1.000	A
RSRC1	51319	genome.wustl.edu	37	3	157920935	157920935	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr3:157920935G>A	ENST00000295930.3	+	4	557	c.395G>A	c.(394-396)cGg>cAg	p.R132Q	RSRC1_ENST00000480820.1_Missense_Mutation_p.R132Q|RSRC1_ENST00000312179.6_Intron|RSRC1_ENST00000475278.2_Missense_Mutation_p.R132Q|RSRC1_ENST00000496268.1_3'UTR|RSRC1_ENST00000464171.1_Intron	NM_001271838.1|NM_016625.2	NP_001258767.1|NP_057709.2	Q96IZ7	RSRC1_HUMAN	arginine/serine-rich coiled-coil 1	132	Arg/Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)|nucleocytoplasmic transport (GO:0006913)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)				cervix(1)|endometrium(2)|large_intestine(3)|lung(11)|upper_aerodigestive_tract(1)	18			Lung(72;0.00416)|LUSC - Lung squamous cell carcinoma(72;0.00575)			ACGCGTAGTCGGTCTCGGGAT	0.448																																																	0													116.0	118.0	117.0					3																	157920935		2203	4300	6503	SO:0001583	missense	51319			AF208853	CCDS3181.1, CCDS63822.1	3q25.32	2009-09-09			ENSG00000174891	ENSG00000174891			24152	protein-coding gene	gene with protein product	"""splicing factor, arginine/serine-rich 21"""	613352				15798186, 19065146	Standard	NM_001271838		Approved	MGC12197, BM-011, SRrp53, SFRS21	uc003fbu.2	Q96IZ7	OTTHUMG00000158758	ENST00000295930.3:c.395G>A	3.37:g.157920935G>A	ENSP00000295930:p.Arg132Gln		A8K2R9|Q96QK2|Q9NZE5	Missense_Mutation	SNP	NULL	p.R132Q	ENST00000295930.3	37	c.395	CCDS3181.1	3	.	.	.	.	.	.	.	.	.	.	G	13.59	2.282478	0.40394	.	.	ENSG00000174891	ENST00000480820;ENST00000494002;ENST00000295930;ENST00000471994;ENST00000475278;ENST00000476899	.	.	.	5.04	4.1	0.47936	.	0.164390	0.48767	D	0.000164	T	0.24160	0.0585	L	0.52573	1.65	0.09310	N	1	P	0.38370	0.628	B	0.25405	0.06	T	0.35276	-0.9795	9	0.59425	D	0.04	.	6.1695	0.20408	0.1618:0.1625:0.6757:0.0	.	132	Q96IZ7	RSRC1_HUMAN	Q	132	.	ENSP00000295930:R132Q	R	+	2	0	RSRC1	159403629	0.864000	0.29904	0.817000	0.32601	0.989000	0.77384	3.063000	0.49978	2.502000	0.84385	0.591000	0.81541	CGG	RSRC1	-	NULL		0.448	RSRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSRC1	HGNC	protein_coding	OTTHUMT00000352063.2	G	NM_016625		157920935	+1	no_errors	ENST00000295930	ensembl	human	known	70_37	missense	SNP	0.031	A
RTL1	388015	genome.wustl.edu	37	14	101348269	101348269	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr14:101348269C>T	ENST00000534062.1	-	1	2915	c.2857G>A	c.(2857-2859)Gat>Aat	p.D953N	MIR433_ENST00000384837.1_RNA|MIR127_ENST00000384876.1_RNA|MIR432_ENST00000606207.1_RNA|MIR431_ENST00000385266.1_RNA|MIR136_ENST00000385207.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	953					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						GAGGCTAGATCCTCTGTGTTG	0.527																																																	0													93.0	93.0	93.0					14																	101348269		1568	3582	5150	SO:0001583	missense	388015				CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.2857G>A	14.37:g.101348269C>T	ENSP00000435342:p.Asp953Asn		E9PKS8	Missense_Mutation	SNP	pfam_Retrotrans_gag,superfamily_Peptidase_aspartic	p.D953N	ENST00000534062.1	37	c.2857	CCDS53910.1	14	.	.	.	.	.	.	.	.	.	.	C	13.31	2.200234	0.38905	.	.	ENSG00000254656	ENST00000534062	T	0.39787	1.06	3.39	3.39	0.38822	.	0.000000	0.35677	N	0.003050	T	0.20659	0.0497	N	0.17082	0.46	0.27674	N	0.946678	B	0.32781	0.384	B	0.33196	0.159	T	0.22871	-1.0204	10	0.02654	T	1	.	8.9291	0.35659	0.0:0.7713:0.2287:0.0	.	953	E9PKS8	.	N	953	ENSP00000435342:D953N	ENSP00000435342:D953N	D	-	1	0	RTL1	100418022	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.272000	0.51616	2.210000	0.71456	0.555000	0.69702	GAT	RTL1	-	NULL		0.527	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTL1	HGNC	protein_coding	OTTHUMT00000395127.1	C	NM_001134888		101348269	-1	no_errors	ENST00000534062	ensembl	human	known	70_37	missense	SNP	1.000	T
RUFY1	80230	genome.wustl.edu	37	5	179013335	179013335	+	Intron	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr5:179013335G>C	ENST00000319449.4	+	8	1038				RUFY1_ENST00000393438.2_Intron|RUFY1_ENST00000377001.2_Missense_Mutation_p.E344Q|RUFY1_ENST00000437570.2_Intron	NM_025158.4	NP_079434.3	Q96T51	RUFY1_HUMAN	RUN and FYVE domain containing 1						endocytosis (GO:0006897)|regulation of endocytosis (GO:0030100)	cytoplasm (GO:0005737)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	lipid binding (GO:0008289)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCACTAGGAAGAGAGAATGAA	0.547										HNSCC(44;0.11)																																							0																																										SO:0001627	intron_variant	80230			AF361055	CCDS4445.2, CCDS34312.1	5q35.3	2008-02-05			ENSG00000176783	ENSG00000176783		"""Zinc fingers, FYVE domain containing"""	19760	protein-coding gene	gene with protein product		610327				11877430	Standard	NM_001040451		Approved	FLJ22251, ZFYVE12, RABIP4	uc003mka.2	Q96T51	OTTHUMG00000130913	ENST00000319449.4:c.1026+469G>C	5.37:g.179013335G>C			Q59FF3|Q71S93|Q9H6I3	Missense_Mutation	SNP	pfam_Run,smart_Run,pfscan_Run	p.E344Q	ENST00000319449.4	37	c.1030	CCDS4445.2	5	.	.	.	.	.	.	.	.	.	.	G	14.47	2.544809	0.45280	.	.	ENSG00000176783	ENST00000377001	T	0.24908	1.83	5.33	4.46	0.54185	.	.	.	.	.	T	0.23014	0.0556	.	.	.	0.29385	N	0.863004	.	.	.	.	.	.	T	0.11941	-1.0567	6	0.24483	T	0.36	.	9.8622	0.41120	0.0916:0.0:0.9084:0.0	.	.	.	.	Q	344	ENSP00000366200:E344Q	ENSP00000366200:E344Q	E	+	1	0	RUFY1	178945941	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.758000	0.47565	1.513000	0.48852	0.644000	0.83932	GAG	RUFY1	-	NULL		0.547	RUFY1-001	KNOWN	basic|CCDS	protein_coding	RUFY1	HGNC	protein_coding	OTTHUMT00000253505.2	G	NM_001040451		179013335	+1	no_errors	ENST00000377001	ensembl	human	known	70_37	missense	SNP	1.000	C
SCLY	51540	genome.wustl.edu	37	2	239005466	239005466	+	Missense_Mutation	SNP	G	G	A	rs150718596		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:239005466G>A	ENST00000555827.1	+	11	1197	c.1133G>A	c.(1132-1134)cGa>cAa	p.R378Q	SCLY_ENST00000422984.2_Missense_Mutation_p.R284Q|SCLY_ENST00000429612.2_Missense_Mutation_p.R172Q|SCLY_ENST00000254663.6_Missense_Mutation_p.R386Q			Q96I15	SCLY_HUMAN	selenocysteine lyase	378					cellular amino acid metabolic process (GO:0006520)	cytosol (GO:0005829)	pyridoxal phosphate binding (GO:0030170)|selenocysteine lyase activity (GO:0009000)|transferase activity (GO:0016740)			endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	22		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;1.37e-23)|OV - Ovarian serous cystadenocarcinoma(60;4.6e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;8.25e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000128)|Lung(119;0.0118)|LUSC - Lung squamous cell carcinoma(224;0.0285)		GCGCAGTGCCGAGTGCTGATG	0.662																																					Melanoma(24;424 891 11947 32582 36034)|Ovarian(46;648 1065 26199 32764 45893)												0									GLN/ARG	0,4402		0,0,2201	37.0	34.0	35.0		1157	0.8	0.1	2	dbSNP_134	35	1,8597	1.2+/-3.3	0,1,4298	no	missense	SCLY	NM_016510.5	43	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	benign	386/454	239005466	1,12999	2201	4299	6500	SO:0001583	missense	51540			AF175767	CCDS2524.1, CCDS2524.2	2q37.3	2008-02-05			ENSG00000132330	ENSG00000132330			18161	protein-coding gene	gene with protein product	"""putative selenocysteine lyase"""	611056				10692412	Standard	NM_016510		Approved	SCL	uc010fyv.4	Q96I15	OTTHUMG00000133336	ENST00000555827.1:c.1133G>A	2.37:g.239005466G>A	ENSP00000450613:p.Arg378Gln		B9A068|J3KN06|Q53SN1|Q53SN8|Q7L670|Q9NVT7|Q9NZR7	Missense_Mutation	SNP	pfam_Aminotrans_V/Cys_dSase,superfamily_PyrdxlP-dep_Trfase_major_dom,pirsf_Cysteine_dSase_NifS	p.R386Q	ENST00000555827.1	37	c.1157		2	.	.	.	.	.	.	.	.	.	.	g	4.747	0.138939	0.09083	0.0	1.16E-4	ENSG00000132330	ENST00000254663;ENST00000555827;ENST00000422984;ENST00000429612;ENST00000450965	D;D;D;T;D	0.86956	-2.19;-2.19;-2.19;0.98;-2.19	4.7	0.797	0.18654	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.437153	0.23224	N	0.050532	T	0.73713	0.3622	N	0.17872	0.535	0.22903	N	0.998581	B;B;B	0.20052	0.019;0.009;0.041	B;B;B	0.13407	0.009;0.001;0.005	T	0.60115	-0.7326	10	0.36615	T	0.2	-38.6402	6.9664	0.24625	0.4765:0.0:0.5235:0.0	.	284;172;378	E7ESG3;E7ESH3;Q96I15	.;.;SCLY_HUMAN	Q	386;378;284;172;208	ENSP00000254663:R386Q;ENSP00000450613:R378Q;ENSP00000416865:R284Q;ENSP00000393694:R172Q;ENSP00000414053:R208Q	ENSP00000254663:R378Q	R	+	2	0	SCLY	238670205	1.000000	0.71417	0.059000	0.19551	0.005000	0.04900	1.343000	0.33930	0.076000	0.16826	0.558000	0.71614	CGA	SCLY	-	pfam_Aminotrans_V/Cys_dSase,superfamily_PyrdxlP-dep_Trfase_major_dom,pirsf_Cysteine_dSase_NifS		0.662	SCLY-204	KNOWN	basic|appris_candidate	protein_coding	SCLY	HGNC	protein_coding		G	NM_016510		239005466	+1	no_errors	ENST00000254663	ensembl	human	known	70_37	missense	SNP	0.400	A
SCN11A	11280	genome.wustl.edu	37	3	38888598	38888598	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr3:38888598C>T	ENST00000302328.3	-	26	5161	c.4963G>A	c.(4963-4965)Gag>Aag	p.E1655K	SCN11A_ENST00000450244.1_Missense_Mutation_p.E1655K|SCN11A_ENST00000456224.3_Missense_Mutation_p.E1617K	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1655					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CGCAAAGGCTCAGGCAAGGCA	0.413																																																	0													93.0	97.0	95.0					3																	38888598		2203	4300	6503	SO:0001583	missense	11280			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.4963G>A	3.37:g.38888598C>T	ENSP00000307599:p.Glu1655Lys		A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.E1655K	ENST00000302328.3	37	c.4963	CCDS33737.1	3	.	.	.	.	.	.	.	.	.	.	C	15.58	2.876429	0.51801	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224	D;D;D	0.96011	-3.88;-3.88;-3.84	5.46	4.58	0.56647	.	0.104765	0.64402	N	0.000005	D	0.93478	0.7919	M	0.72118	2.19	0.34631	D	0.719653	B	0.27498	0.18	B	0.23150	0.044	D	0.94094	0.7356	10	0.62326	D	0.03	.	9.7221	0.40308	0.0:0.7856:0.1406:0.0738	.	1655	Q9UI33	SCNBA_HUMAN	K	1655;1655;1617	ENSP00000307599:E1655K;ENSP00000400945:E1655K;ENSP00000416757:E1617K	ENSP00000307599:E1655K	E	-	1	0	SCN11A	38863602	0.000000	0.05858	0.894000	0.35097	0.851000	0.48451	0.828000	0.27435	1.295000	0.44724	0.650000	0.86243	GAG	SCN11A	-	NULL		0.413	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN11A	HGNC	protein_coding	OTTHUMT00000109746.4	C	NM_014139		38888598	-1	no_errors	ENST00000302328	ensembl	human	known	70_37	missense	SNP	0.880	T
SCN3A	6328	genome.wustl.edu	37	2	165956849	165956849	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:165956849C>G	ENST00000360093.3	-	22	4420	c.3929G>C	c.(3928-3930)aGa>aCa	p.R1310T	SCN3A_ENST00000283254.7_Missense_Mutation_p.R1310T|SCN3A_ENST00000409101.3_Missense_Mutation_p.R1261T	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1310					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCTTAGAGGTCTTAAAGCTCT	0.388																																																	0													83.0	82.0	82.0					2																	165956849		2203	4300	6503	SO:0001583	missense	6328			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.3929G>C	2.37:g.165956849C>G	ENSP00000353206:p.Arg1310Thr		Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfscan_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.R1310T	ENST00000360093.3	37	c.3929		2	.	.	.	.	.	.	.	.	.	.	C	16.73	3.204433	0.58234	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	D;D;D;D	0.99607	-6.27;-6.27;-6.27;-6.27	5.35	4.46	0.54185	Ion transport (1);	0.085246	0.51477	D	0.000098	D	0.99883	0.9944	H	0.99990	5.32	0.80722	D	1	D;P;B;B;D	0.89917	1.0;0.474;0.288;0.288;1.0	D;B;B;B;D	0.97110	1.0;0.259;0.109;0.109;1.0	D	0.95718	0.8764	10	0.87932	D	0	.	16.3215	0.82952	0.0:0.8674:0.1326:0.0	.	1310;1261;1261;1261;1310	Q9NY46;E7EUE6;Q9NY46-2;Q9NY46-4;Q9NY46-3	SCN3A_HUMAN;.;.;.;.	T	1310;1310;1261;1261	ENSP00000353206:R1310T;ENSP00000283254:R1310T;ENSP00000386726:R1261T;ENSP00000403348:R1261T	ENSP00000283254:R1310T	R	-	2	0	SCN3A	165665095	1.000000	0.71417	1.000000	0.80357	0.167000	0.22549	7.776000	0.85560	1.375000	0.46248	-0.274000	0.10170	AGA	SCN3A	-	pfam_Ion_trans_dom		0.388	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	HGNC	protein_coding		C	NM_006922		165956849	-1	no_errors	ENST00000283254	ensembl	human	known	70_37	missense	SNP	1.000	G
SDE2	163859	genome.wustl.edu	37	1	226180117	226180117	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:226180117C>G	ENST00000272091.7	-	4	520	c.502G>C	c.(502-504)Gag>Cag	p.E168Q		NM_152608.3	NP_689821.3	Q6IQ49	SDE2_HUMAN	SDE2 telomere maintenance homolog (S. pombe)	168																	ACGGAATCCTCCAGACGCTCA	0.562																																																	0													81.0	80.0	80.0					1																	226180117		1958	4171	6129	SO:0001583	missense	163859			BC071563	CCDS41473.1	1q42.12	2012-06-26	2012-06-26	2012-06-26	ENSG00000143751	ENSG00000143751			26643	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 55"""	C1orf55		21333630	Standard	NM_152608		Approved	FLJ35382	uc001hpu.4	Q6IQ49	OTTHUMG00000037504	ENST00000272091.7:c.502G>C	1.37:g.226180117C>G	ENSP00000272091:p.Glu168Gln		A8K4P3|Q5TD36|Q6ZS26|Q8NAG7	Missense_Mutation	SNP	superfamily_Mopterin_synth/thiamin_S_b	p.E168Q	ENST00000272091.7	37	c.502	CCDS41473.1	1	.	.	.	.	.	.	.	.	.	.	C	20.0	3.930233	0.73327	.	.	ENSG00000143751	ENST00000272091;ENST00000366818;ENST00000366817	T;T	0.62232	0.74;0.04	5.35	4.43	0.53597	.	0.108809	0.64402	D	0.000002	T	0.77046	0.4073	M	0.69823	2.125	0.53688	D	0.999973	D;D	0.89917	1.0;0.997	D;D	0.79784	0.993;0.932	T	0.77056	-0.2729	10	0.38643	T	0.18	-11.0773	15.3915	0.74747	0.1405:0.8594:0.0:0.0	.	156;168	Q6IQ49-2;Q6IQ49	.;CA055_HUMAN	Q	168;156;73	ENSP00000272091:E168Q;ENSP00000355782:E73Q	ENSP00000272091:E168Q	E	-	1	0	C1orf55	224246740	1.000000	0.71417	1.000000	0.80357	0.684000	0.39900	7.729000	0.84864	1.250000	0.43966	-0.187000	0.12897	GAG	SDE2	-	NULL		0.562	SDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDE2	HGNC	protein_coding	OTTHUMT00000091310.1	C	NM_152608		226180117	-1	no_errors	ENST00000272091	ensembl	human	known	70_37	missense	SNP	1.000	G
SEC14L2	23541	genome.wustl.edu	37	22	30793105	30793105	+	5'UTR	SNP	G	G	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr22:30793105G>T	ENST00000312932.9	+	0	260				SEC14L2_ENST00000402592.3_5'UTR|SEC14L2_ENST00000403484.1_5'UTR|SEC14L2_ENST00000405717.3_5'UTR|SEC14L2_ENST00000459728.1_3'UTR	NM_012429.3	NP_036561.1	O76054	S14L2_HUMAN	SEC14-like 2 (S. cerevisiae)						positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cholesterol biosynthetic process (GO:0045540)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|urinary_tract(1)	10					Vitamin E(DB00163)	GTTGAGCCACGATGAGCGGCA	0.701																																																	0													13.0	10.0	11.0					22																	30793105		2066	4043	6109	SO:0001623	5_prime_UTR_variant	23541			AL096881	CCDS13876.1, CCDS46685.1, CCDS56228.1	22q12.2	2010-08-19	2001-11-28		ENSG00000100003	ENSG00000100003			10699	protein-coding gene	gene with protein product	"""supernatant protein factor"""	607558	"""SEC14 (S. cerevisiae)-like 2"""	C22orf6		10591208	Standard	NM_033382		Approved	TAP, SPF, KIAA1186, KIAA1658	uc003ahr.3	O76054	OTTHUMG00000151024	ENST00000312932.9:c.-1G>T	22.37:g.30793105G>T			B7Z8Q1|F5H3U4|Q53EQ2|Q6PD61|Q9ULN4	RNA	SNP	-	NULL	ENST00000312932.9	37	NULL	CCDS13876.1	22																																																																																			SEC14L2	-	-		0.701	SEC14L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC14L2	HGNC	protein_coding	OTTHUMT00000321018.4	G	NM_012429		30793105	+1	no_errors	ENST00000459728	ensembl	human	known	70_37	rna	SNP	0.986	T
SEMA6A	57556	genome.wustl.edu	37	5	115822519	115822519	+	Silent	SNP	G	G	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr5:115822519G>T	ENST00000343348.6	-	10	1675	c.888C>A	c.(886-888)ctC>ctA	p.L296L	CTB-118N6.3_ENST00000508640.1_RNA|CTB-118N6.3_ENST00000514214.1_RNA|SEMA6A_ENST00000257414.8_Silent_p.L296L|SEMA6A_ENST00000510263.1_Silent_p.L296L|CTB-118N6.3_ENST00000510682.1_RNA|SEMA6A_ENST00000503962.1_5'Flank	NM_020796.3	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A	296	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|centrosome localization (GO:0051642)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|positive regulation of neuron migration (GO:2001224)|semaphorin-plexin signaling pathway (GO:0071526)	axon (GO:0030424)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		TAACTGCCTGGAGAATGTTGA	0.473																																																	0													128.0	125.0	126.0					5																	115822519		2000	4196	6196	SO:0001819	synonymous_variant	57556			AB037789	CCDS47256.1, CCDS75288.1	5q23.1	2014-07-29			ENSG00000092421			"""Semaphorins"""	10738	protein-coding gene	gene with protein product	"""sema VIa"""	605885		SEMAQ		9204478, 10993894	Standard	XM_006714663		Approved	KIAA1368, SEMA6A1, SEMA, HT018	uc010jck.3	Q9H2E6	OTTHUMG00000162987	ENST00000343348.6:c.888C>A	5.37:g.115822519G>T			Q9P2H9	Silent	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,pfscan_Semaphorin/CD100_Ag	p.L296	ENST00000343348.6	37	c.888	CCDS47256.1	5																																																																																			SEMA6A	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag		0.473	SEMA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA6A	HGNC	protein_coding	OTTHUMT00000371270.1	G	NM_020796		115822519	-1	no_errors	ENST00000257414	ensembl	human	known	70_37	silent	SNP	0.695	T
SEMG2	6407	genome.wustl.edu	37	20	43850898	43850898	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr20:43850898G>A	ENST00000372769.3	+	2	715	c.625G>A	c.(625-627)Gag>Aag	p.E209K		NM_003008.2	NP_002999.1	Q02383	SEMG2_HUMAN	semenogelin II	209	Repeat-rich region.				sexual reproduction (GO:0019953)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Myeloproliferative disorder(115;0.0122)				ACAACAACGTGAGACTAAAAA	0.398																																																	0													89.0	82.0	84.0					20																	43850898		2203	4300	6503	SO:0001583	missense	6407				CCDS13346.1	20q12-q13.1	2008-07-02			ENSG00000124157	ENSG00000124157			10743	protein-coding gene	gene with protein product	"""Semenogelin 2"""	182141				1517240, 9523691	Standard	NM_003008		Approved	SGII	uc002xnk.3	Q02383	OTTHUMG00000032566	ENST00000372769.3:c.625G>A	20.37:g.43850898G>A	ENSP00000361855:p.Glu209Lys		Q53ZU2|Q6X2M5|Q6X2M6	Missense_Mutation	SNP	pfam_Semenogelin	p.E209K	ENST00000372769.3	37	c.625	CCDS13346.1	20	.	.	.	.	.	.	.	.	.	.	G	10.62	1.400474	0.25291	.	.	ENSG00000124157	ENST00000372769	T	0.12984	2.63	1.38	-2.75	0.05914	.	.	.	.	.	T	0.26085	0.0636	M	0.71036	2.16	0.09310	N	1	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.87578	0.994;0.998;0.998	T	0.21415	-1.0246	9	0.62326	D	0.03	.	0.4182	0.00452	0.3178:0.258:0.2469:0.1773	.	209;209;209	A8K6Z6;Q6IRW3;Q02383	.;.;SEMG2_HUMAN	K	209	ENSP00000361855:E209K	ENSP00000361855:E209K	E	+	1	0	SEMG2	43284312	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.643000	0.05421	-1.990000	0.00978	-0.768000	0.03414	GAG	SEMG2	-	pfam_Semenogelin		0.398	SEMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMG2	HGNC	protein_coding	OTTHUMT00000079417.1	G	NM_003008		43850898	+1	no_errors	ENST00000372769	ensembl	human	known	70_37	missense	SNP	0.000	A
SENP5	205564	genome.wustl.edu	37	3	196613394	196613394	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr3:196613394C>T	ENST00000323460.5	+	2	1591	c.1342C>T	c.(1342-1344)Ctc>Ttc	p.L448F	SENP5_ENST00000419026.1_Intron|SENP5_ENST00000445299.2_Missense_Mutation_p.L448F	NM_152699.4	NP_689912.2	Q96HI0	SENP5_HUMAN	SUMO1/sentrin specific peptidase 5	448					cell cycle (GO:0007049)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)			NS(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(14)|skin(1)	32	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)		GGATGGATCTCTCAAGCAGAG	0.478																																					Ovarian(47;891 1095 11174 13858 51271)												0													106.0	99.0	102.0					3																	196613394		2203	4300	6503	SO:0001583	missense	205564			BC030705	CCDS3322.1	3q29	2005-08-17	2005-08-17		ENSG00000119231	ENSG00000119231			28407	protein-coding gene	gene with protein product		612845	"""SUMO1/sentrin specific protease 5"""			12477932	Standard	NM_152699		Approved	MGC27076	uc003fwz.4	Q96HI0	OTTHUMG00000155527	ENST00000323460.5:c.1342C>T	3.37:g.196613394C>T	ENSP00000327197:p.Leu448Phe		B4DY82|Q96SA5	Missense_Mutation	SNP	pfam_Peptidase_C48,pfscan_Peptidase_C48	p.L448F	ENST00000323460.5	37	c.1342	CCDS3322.1	3	.	.	.	.	.	.	.	.	.	.	C	11.17	1.558754	0.27827	.	.	ENSG00000119231	ENST00000323460;ENST00000445299	T;T	0.37058	1.22;1.22	5.4	2.56	0.30785	.	0.429779	0.19646	N	0.109322	T	0.21186	0.0510	L	0.29908	0.895	0.30017	N	0.814663	B;B	0.09022	0.002;0.002	B;B	0.08055	0.003;0.003	T	0.13202	-1.0518	10	0.45353	T	0.12	0.0068	2.1514	0.03801	0.1574:0.5126:0.153:0.177	.	448;448	B4DY82;Q96HI0	.;SENP5_HUMAN	F	448	ENSP00000327197:L448F;ENSP00000390231:L448F	ENSP00000327197:L448F	L	+	1	0	SENP5	198097791	0.003000	0.15002	0.939000	0.37840	0.999000	0.98932	-0.033000	0.12246	0.310000	0.22990	0.655000	0.94253	CTC	SENP5	-	NULL		0.478	SENP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SENP5	HGNC	protein_coding	OTTHUMT00000340524.1	C	NM_152699		196613394	+1	no_errors	ENST00000323460	ensembl	human	known	70_37	missense	SNP	0.486	T
SEPT6	23157	genome.wustl.edu	37	X	118763247	118763247	+	Intron	SNP	A	A	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chrX:118763247A>T	ENST00000343984.5	-	9	1545				SEPT6_ENST00000354228.4_Intron|SEPT6_ENST00000489216.1_Intron|SEPT6_ENST00000394617.2_3'UTR|SEPT6_ENST00000394616.4_3'UTR|SEPT6_ENST00000354416.3_Intron|SEPT6_ENST00000467310.1_Intron|SEPT6_ENST00000360156.7_Intron|SEPT6_ENST00000394610.1_Intron	NM_015129.5	NP_055944.2	Q14141	SEPT6_HUMAN	septin 6						cytokinesis (GO:0000910)|viral process (GO:0016032)	axon terminus (GO:0043679)|kinetochore (GO:0000776)|septin complex (GO:0031105)|synaptic vesicle (GO:0008021)	GTP binding (GO:0005525)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(3)	17						AGGAGGAAAGAGAAGGCACCA	0.582			T	MLL	AML																																			Dom	yes		X	Xq24	23157	septin 6		L	0													82.0	86.0	84.0					X																	118763247		2203	4300	6503	SO:0001627	intron_variant	23157			D50918	CCDS14583.1, CCDS14584.1, CCDS14585.1	Xq24	2013-01-21			ENSG00000125354	ENSG00000125354		"""Septins"""	15848	protein-coding gene	gene with protein product		300683				8590280, 10744683	Standard	NM_015129		Approved	KIAA0128, SEP2, SEPT2, MGC16619, MGC20339	uc004erv.3	Q14141	OTTHUMG00000022280	ENST00000343984.5:c.1280+33T>A	X.37:g.118763247A>T			Q5JTK0|Q969W5|Q96A13|Q96GR1|Q96P86|Q96P87	RNA	SNP	-	NULL	ENST00000343984.5	37	NULL	CCDS14584.1	X																																																																																			SEPT6	-	-		0.582	SEPT6-001	KNOWN	basic|CCDS	protein_coding	SEPT6	HGNC	protein_coding	OTTHUMT00000058059.1	A	NM_145802		118763247	-1	no_errors	ENST00000481072	ensembl	human	known	70_37	rna	SNP	0.000	T
SEPT9	10801	genome.wustl.edu	37	17	75398515	75398515	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:75398515G>A	ENST00000427177.1	+	3	577	c.451G>A	c.(451-453)Gag>Aag	p.E151K	SEPT9_ENST00000431235.2_5'UTR|SEPT9_ENST00000585930.1_5'Flank|SEPT9_ENST00000590294.1_Missense_Mutation_p.E133K|SEPT9_ENST00000592420.1_5'UTR|SEPT9_ENST00000427674.2_5'UTR|SEPT9_ENST00000423034.2_Missense_Mutation_p.E144K|SEPT9_ENST00000449803.2_5'UTR|SEPT9_ENST00000588690.1_5'UTR|SEPT9_ENST00000591198.1_Missense_Mutation_p.E132K|SEPT9_ENST00000329047.8_Missense_Mutation_p.E133K	NM_001113491.1	NP_001106963.1	Q9UHD8	SEPT9_HUMAN	septin 9	151					cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|protein heterooligomerization (GO:0051291)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(2)	16			BRCA - Breast invasive adenocarcinoma(99;0.153)			TCGGAGGACGGAGATCACCAT	0.701																																																	0													14.0	19.0	17.0					17																	75398515		2187	4281	6468	SO:0001583	missense	10801			AB023208	CCDS45790.1, CCDS45791.1, CCDS45792.1, CCDS45793.1, CCDS45794.1, CCDS45795.1, CCDS74166.1	17q25.3	2014-09-17	2005-01-11	2005-01-12	ENSG00000184640	ENSG00000184640		"""Septins"""	7323	protein-coding gene	gene with protein product	"""Ov/Br septin"""	604061	"""MLL septin-like fusion"""	MSF		10339604, 10485469	Standard	NM_006640		Approved	MSF1, KIAA0991, PNUTL4, AF17q25, SeptD1	uc002jts.4	Q9UHD8		ENST00000427177.1:c.451G>A	17.37:g.75398515G>A	ENSP00000391249:p.Glu151Lys		A8K2V3|B3KPM0|B4DTL9|B4E0N2|B4E274|B7Z654|Q96QF3|Q96QF4|Q96QF5|Q9HA04|Q9UG40|Q9Y5W4	Missense_Mutation	SNP	pfam_Cell_div_GTP-bd,pfam_Ribosome_biogen_GTPase_RsgA,pfam_AIG1	p.E151K	ENST00000427177.1	37	c.451	CCDS45790.1	17	.	.	.	.	.	.	.	.	.	.	G	21.1	4.098573	0.76870	.	.	ENSG00000184640	ENST00000427177;ENST00000329047;ENST00000423034	T;T;T	0.40225	1.04;1.04;1.06	5.25	5.25	0.73442	.	4.873430	0.00559	N	0.000265	T	0.62097	0.2400	L	0.34521	1.04	0.80722	D	1	D;D;D;D	0.76494	0.972;0.999;0.998;0.976	P;D;D;P	0.71656	0.737;0.974;0.957;0.696	T	0.42699	-0.9436	10	0.51188	T	0.08	.	17.8243	0.88660	0.0:0.0:1.0:0.0	.	132;144;133;151	Q9UHD8-7;Q9UHD8-5;Q9UHD8-2;Q9UHD8	.;.;.;SEPT9_HUMAN	K	151;133;144	ENSP00000391249:E151K;ENSP00000329161:E133K;ENSP00000405877:E144K	ENSP00000329161:E133K	E	+	1	0	SEPT9	72910110	1.000000	0.71417	1.000000	0.80357	0.138000	0.21146	8.300000	0.89948	2.441000	0.82636	0.561000	0.74099	GAG	SEPT9	-	NULL		0.701	SEPT9-001	KNOWN	basic|CCDS	protein_coding	SEPT9	HGNC	protein_coding	OTTHUMT00000436304.2	G	NM_006640		75398515	+1	no_errors	ENST00000427177	ensembl	human	known	70_37	missense	SNP	1.000	A
SERP1	27230	genome.wustl.edu	37	3	150264652	150264652	+	5'UTR	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr3:150264652C>T	ENST00000479209.1	-	0	543				EIF2A_ENST00000273435.5_Intron|EIF2A_ENST00000460851.1_Intron|EIF2A_ENST00000487799.1_Intron|EIF2A_ENST00000406576.3_Intron|SERP1_ENST00000491660.1_5'Flank|SERP1_ENST00000487153.1_5'Flank|SERP1_ENST00000239944.2_5'Flank			Q9Y6X1	SERP1_HUMAN	stress-associated endoplasmic reticulum protein 1						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|endoplasmic reticulum unfolded protein response (GO:0030968)|glucose metabolic process (GO:0006006)|multicellular organismal aging (GO:0010259)|muscle organ morphogenesis (GO:0048644)|plasma membrane organization (GO:0007009)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin secretion (GO:0032024)|positive regulation of organ growth (GO:0046622)|positive regulation of translation (GO:0045727)|post-embryonic development (GO:0009791)|protein glycosylation (GO:0006486)|protein transport (GO:0015031)|response to stress (GO:0006950)|skeletal system development (GO:0001501)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|ribosome (GO:0005840)				large_intestine(1)|lung(3)	4			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			TCTCTTTCTTCAGACTAGTTT	0.522																																																	0													64.0	68.0	67.0					3																	150264652		1839	4079	5918	SO:0001623	5_prime_UTR_variant	27230			AK125413	CCDS3150.1	3q25.1	2007-12-07	2007-12-07		ENSG00000120742	ENSG00000120742			10759	protein-coding gene	gene with protein product	"""ribosome associated membrane protein 4"""					10601334, 11230166	Standard	NM_014445		Approved	RAMP4, FLJ43424	uc003exy.3	Q9Y6X1	OTTHUMG00000159769	ENST00000479209.1:c.-730G>A	3.37:g.150264652C>T			D3DNI6	RNA	SNP	-	NULL	ENST00000479209.1	37	NULL	CCDS3150.1	3																																																																																			SERP1	-	-		0.522	SERP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERP1	HGNC	protein_coding	OTTHUMT00000357239.1	C	NM_014445		150264652	-1	no_errors	ENST00000491195	ensembl	human	putative	70_37	rna	SNP	0.000	T
SERPINA5	5104	genome.wustl.edu	37	14	95053975	95053975	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr14:95053975G>A	ENST00000554866.1	+	2	390	c.276G>A	c.(274-276)ctG>ctA	p.L92L	SERPINA5_ENST00000553780.1_Silent_p.L92L|SERPINA5_ENST00000554276.1_Silent_p.L92L|SERPINA5_ENST00000329597.7_Silent_p.L92L			P05154	IPSP_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5	92					fusion of sperm to egg plasma membrane (GO:0007342)|lipid transport (GO:0006869)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|spermatogenesis (GO:0007283)	acrosomal membrane (GO:0002080)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|platelet alpha granule (GO:0031091)|platelet dense tubular network (GO:0031094)|protein C inhibitor-coagulation factor V complex (GO:0097181)|protein C inhibitor-coagulation factor Xa complex (GO:0097182)|protein C inhibitor-coagulation factor XI complex (GO:0097183)|protein C inhibitor-KLK3 complex (GO:0036029)|protein C inhibitor-plasma kallikrein complex (GO:0036030)|protein C inhibitor-PLAT complex (GO:0036026)|protein C inhibitor-PLAU complex (GO:0036027)|protein C inhibitor-thrombin complex (GO:0036028)|protein C inhibitor-TMPRSS11E complex (GO:0036025)|protein C inhibitor-TMPRSS7 complex (GO:0036024)|protein complex (GO:0043234)	acrosin binding (GO:0032190)|glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|phosphatidylcholine binding (GO:0031210)|protease binding (GO:0002020)|retinoic acid binding (GO:0001972)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(3)|large_intestine(5)|lung(18)|ovary(2)|skin(5)|upper_aerodigestive_tract(3)	36				COAD - Colon adenocarcinoma(157;0.21)	Drotrecogin alfa(DB00055)|Urokinase(DB00013)	TGCAGATCCTGGAGGGCCTGG	0.597																																																	0													25.0	27.0	26.0					14																	95053975		2203	4300	6503	SO:0001819	synonymous_variant	5104			M68516	CCDS9928.1	14q32.1	2014-02-18	2005-08-18		ENSG00000188488	ENSG00000188488		"""Serine (or cysteine) peptidase inhibitors"""	8723	protein-coding gene	gene with protein product		601841	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5"""	PLANH3, PCI		1714450, 8381582, 24172014	Standard	NM_000624		Approved	PAI3, PROCI	uc001ydm.3	P05154	OTTHUMG00000170860	ENST00000554866.1:c.276G>A	14.37:g.95053975G>A			Q07616|Q9UG30	Silent	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.L92	ENST00000554866.1	37	c.276	CCDS9928.1	14																																																																																			SERPINA5	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.597	SERPINA5-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SERPINA5	HGNC	protein_coding	OTTHUMT00000410726.1	G	NM_000624		95053975	+1	no_errors	ENST00000329597	ensembl	human	known	70_37	silent	SNP	0.031	A
SERPINA3	12	genome.wustl.edu	37	14	95081043	95081043	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr14:95081043C>T	ENST00000467132.1	+	2	1413	c.265C>T	c.(265-267)Ctg>Ttg	p.L89L	SERPINA3_ENST00000393080.4_Silent_p.L89L|SERPINA3_ENST00000482740.1_5'Flank|RP11-986E7.7_ENST00000553947.1_3'UTR|SERPINA3_ENST00000393078.3_Silent_p.L89L			P01011	AACT_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3	89					acute-phase response (GO:0006953)|inflammatory response (GO:0006954)|maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of endopeptidase activity (GO:0010951)|regulation of lipid metabolic process (GO:0019216)|regulation of proteolysis (GO:0030162)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	DNA binding (GO:0003677)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(17)|ovary(2)|pancreas(1)|skin(3)|stomach(1)	40		all_cancers(154;0.0525)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)		CTTCCTGTCTCTGGGGGCCCA	0.527																																																	0													82.0	81.0	81.0					14																	95081043		2203	4300	6503	SO:0001819	synonymous_variant	12			K01500	CCDS32150.1	14q32.1	2014-06-03	2005-08-18		ENSG00000196136	ENSG00000196136		"""Serine (or cysteine) peptidase inhibitors"""	16	protein-coding gene	gene with protein product		107280	"""alpha-1-antichymotrypsin"", ""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3"""	AACT		3260956, 24172014	Standard	NM_001085		Approved	ACT, alpha-1-antichymotrypsin	uc001ydp.3	P01011	OTTHUMG00000029851	ENST00000467132.1:c.265C>T	14.37:g.95081043C>T			B3KVQ7|Q13703|Q2TU87|Q2TU88|Q59GP9|Q6LBY8|Q6LDT7|Q6NSC9|Q8N177|Q96DW8|Q9UC47|Q9UNU9	Silent	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.L114	ENST00000467132.1	37	c.340	CCDS32150.1	14																																																																																			SERPINA3	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.527	SERPINA3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SERPINA3	HGNC	protein_coding	OTTHUMT00000268080.3	C	NM_001085		95081043	+1	no_errors	ENST00000553947	ensembl	human	known	70_37	silent	SNP	1.000	T
SERPIND1	3053	genome.wustl.edu	37	22	21141329	21141329	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr22:21141329G>A	ENST00000215727.5	+	5	1758	c.1475G>A	c.(1474-1476)aGa>aAa	p.R492K	PI4KA_ENST00000572273.1_Intron|PI4KA_ENST00000466162.1_Intron|PI4KA_ENST00000255882.6_Intron|SERPIND1_ENST00000406799.1_Missense_Mutation_p.R492K	NM_000185.3	NP_000176.2	P05546	HEP2_HUMAN	serpin peptidase inhibitor, clade D (heparin cofactor), member 1	492					blood coagulation (GO:0007596)|chemotaxis (GO:0006935)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.R492T(2)		breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(11;6.16e-25)|all_epithelial(7;1.02e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)		Ardeparin(DB00407)|Sulodexide(DB06271)	TTCATGGGAAGAGTGGCCAAC	0.562																																																	2	Substitution - Missense(2)	endometrium(2)											77.0	66.0	70.0					22																	21141329		2203	4300	6503	SO:0001583	missense	3053			M12849	CCDS13783.1	22q11.21	2014-02-18	2005-08-18		ENSG00000099937	ENSG00000099937		"""Serine (or cysteine) peptidase inhibitors"""	4838	protein-coding gene	gene with protein product	"""heparin cofactor II"""	142360	"""serine (or cysteine) proteinase inhibitor, clade D (heparin cofactor), member 1"""	HCF2		1671335, 24172014	Standard	XM_005261597		Approved	HC-II, HLS2, HC2, D22S673	uc002ztb.1	P05546	OTTHUMG00000150755	ENST00000215727.5:c.1475G>A	22.37:g.21141329G>A	ENSP00000215727:p.Arg492Lys		B2RAI1|D3DX34|Q6IBZ5	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom,prints_Prot_inh_Lserp2	p.R492K	ENST00000215727.5	37	c.1475	CCDS13783.1	22	.	.	.	.	.	.	.	.	.	.	G	19.32	3.804561	0.70682	.	.	ENSG00000099937	ENST00000215727;ENST00000406799	D;D	0.84442	-1.85;-1.85	4.72	2.58	0.30949	Serpin domain (3);	0.101636	0.64402	N	0.000006	D	0.86830	0.6027	L	0.45137	1.4	0.44110	D	0.99688	P;P	0.47677	0.899;0.899	P;P	0.62885	0.908;0.908	T	0.83229	-0.0064	10	0.32370	T	0.25	.	11.2207	0.48853	0.1518:0.0:0.8482:0.0	.	492;492	Q8IVC0;P05546	.;HEP2_HUMAN	K	492	ENSP00000215727:R492K;ENSP00000384050:R492K	ENSP00000215727:R492K	R	+	2	0	SERPIND1	19471329	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	5.637000	0.67854	0.587000	0.29643	0.655000	0.94253	AGA	SERPIND1	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.562	SERPIND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPIND1	HGNC	protein_coding	OTTHUMT00000319961.1	G	NM_000185		21141329	+1	no_errors	ENST00000215727	ensembl	human	known	70_37	missense	SNP	0.951	A
SGOL2	151246	genome.wustl.edu	37	2	201437743	201437743	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:201437743G>T	ENST00000357799.4	+	7	2772	c.2674G>T	c.(2674-2676)Gat>Tat	p.D892Y		NM_001160033.1|NM_001160046.1|NM_152524.5	NP_001153505.1|NP_001153518.1|NP_689737.4	Q562F6	SGOL2_HUMAN	shugoshin-like 2 (S. pombe)	892					meiotic sister chromatid cohesion, centromeric (GO:0051754)|mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)				NS(2)|breast(2)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	46						GTATGTTACTGATAGGAAATC	0.294																																																	0													78.0	81.0	80.0					2																	201437743		1795	4032	5827	SO:0001583	missense	151246			AY094614	CCDS42796.1	2q33.2	2008-02-05			ENSG00000163535	ENSG00000163535			30812	protein-coding gene	gene with protein product		612425					Standard	NM_001160046		Approved	TRIPIN, FLJ25211	uc002uvw.2	Q562F6	OTTHUMG00000154535	ENST00000357799.4:c.2674G>T	2.37:g.201437743G>T	ENSP00000350447:p.Asp892Tyr		Q53RR9|Q53T20|Q86XY4|Q8IWK2|Q8IZK1|Q8N1Q5|Q96LQ3	Missense_Mutation	SNP	NULL	p.D892Y	ENST00000357799.4	37	c.2674	CCDS42796.1	2	.	.	.	.	.	.	.	.	.	.	G	6.625	0.483698	0.12581	.	.	ENSG00000163535	ENST00000357799	T	0.15256	2.44	4.39	1.39	0.22231	.	0.503070	0.16799	N	0.199070	T	0.28830	0.0715	L	0.57536	1.79	0.09310	N	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.66351	0.943;0.943;0.943	T	0.04621	-1.0938	10	0.72032	D	0.01	-9.1629	4.4233	0.11492	0.1869:0.1929:0.6201:0.0	.	892;892;892	B7Z7S9;Q562F6-2;Q562F6	.;.;SGOL2_HUMAN	Y	892	ENSP00000350447:D892Y	ENSP00000350447:D892Y	D	+	1	0	SGOL2	201145988	0.004000	0.15560	0.049000	0.19019	0.070000	0.16714	1.022000	0.30052	0.614000	0.30107	0.585000	0.79938	GAT	SGOL2	-	NULL		0.294	SGOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGOL2	HGNC	protein_coding	OTTHUMT00000335834.1	G	NM_152524		201437743	+1	no_errors	ENST00000357799	ensembl	human	known	70_37	missense	SNP	0.062	T
SHCBP1L	81626	genome.wustl.edu	37	1	182869349	182869349	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:182869349C>T	ENST00000367547.3	-	10	1967	c.1731G>A	c.(1729-1731)ttG>ttA	p.L577L	SHCBP1L_ENST00000488956.1_5'UTR|SHCBP1L_ENST00000423786.1_Silent_p.L458L	NM_030933.2	NP_112195.2	Q9BZQ2	SHP1L_HUMAN	SHC SH2-domain binding protein 1-like	649										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|pancreas(1)|prostate(1)|skin(2)	15						TAGTCATCTTCAATTTGGGTG	0.284																																																	0													40.0	41.0	40.0					1																	182869349		2194	4294	6488	SO:0001819	synonymous_variant	81626			AF288397	CCDS30955.1	1q25	2011-01-24	2011-01-24	2011-01-24	ENSG00000157060	ENSG00000157060			16788	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 14"""	C1orf14		11318611	Standard	NM_030933		Approved		uc001gpu.3	Q9BZQ2	OTTHUMG00000035419	ENST00000367547.3:c.1731G>A	1.37:g.182869349C>T			Q4G195|Q9BZQ3|Q9H2B6	Silent	SNP	superfamily_Pectin_lyase_fold/virulence,smart_Carb-bd_sugar_hydrolysis-dom,smart_PbH1	p.L577	ENST00000367547.3	37	c.1731	CCDS30955.1	1																																																																																			SHCBP1L	-	superfamily_Pectin_lyase_fold/virulence,smart_PbH1		0.284	SHCBP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHCBP1L	HGNC	protein_coding	OTTHUMT00000085956.1	C	NM_030933		182869349	-1	no_errors	ENST00000367547	ensembl	human	known	70_37	silent	SNP	0.998	T
SIGLEC22P	114195	genome.wustl.edu	37	19	51715073	51715073	+	RNA	SNP	C	C	T	rs534216719		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:51715073C>T	ENST00000602065.1	+	0	473									sialic acid binding Ig-like lectin 22, pseudogene																		CCAGCATCTTCATCCCGAGGA	0.627																																																	0																																												114195					19q13.41	2014-03-20	2010-02-04	2010-02-04	ENSG00000268849	ENSG00000268849		"""Sialic acid binding Ig-like lectins"""	15611	pseudogene	pseudogene			"""sialic acid binding Ig-like lectin, pseudogene 6"""	SIGLECP6		11546777	Standard	NG_004737		Approved				OTTHUMG00000183132		19.37:g.51715073C>T				RNA	SNP	-	NULL	ENST00000602065.1	37	NULL		19																																																																																			SIGLEC22P	-	-		0.627	SIGLEC22P-001	KNOWN	basic	processed_transcript	SIGLEC22P	HGNC	pseudogene	OTTHUMT00000465192.1	C	NG_004737		51715073	+1	no_errors	ENST00000602065	ensembl	human	known	70_37	rna	SNP	0.000	T
SIX5	147912	genome.wustl.edu	37	19	46268897	46268897	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:46268897C>T	ENST00000317578.6	-	3	2463	c.2082G>A	c.(2080-2082)ctG>ctA	p.L694L	SIX5_ENST00000560168.1_3'UTR|AC074212.6_ENST00000590076.1_RNA|AC074212.5_ENST00000592217.2_RNA|AC074212.5_ENST00000559756.1_RNA	NM_175875.4	NP_787071	Q8N196	SIX5_HUMAN	SIX homeobox 5	694					lens development in camera-type eye (GO:0002088)|negative regulation of cell proliferation (GO:0008285)|regulation of transcription, DNA-templated (GO:0006355)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00783)|GBM - Glioblastoma multiforme(486;0.0802)|Epithelial(262;0.235)		CTGGCAGCCTCAGCACGGTGT	0.677																																																	0													35.0	41.0	39.0					19																	46268897		2203	4300	6503	SO:0001819	synonymous_variant	147912			L08835	CCDS12673.1	19q13.32	2011-06-20	2007-07-13			ENSG00000177045		"""Homeoboxes / SINE class"""	10891	protein-coding gene	gene with protein product		600963	"""sine oculis homeobox (Drosophila) homolog 5"", ""sine oculis homeobox homolog 5 (Drosophila)"""	DMAHP		8595416	Standard	NM_175875		Approved		uc002pdb.3	Q8N196		ENST00000317578.6:c.2082G>A	19.37:g.46268897C>T				Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.L694	ENST00000317578.6	37	c.2082	CCDS12673.1	19																																																																																			SIX5	-	NULL		0.677	SIX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIX5	HGNC	protein_coding	OTTHUMT00000417341.3	C	NM_175875		46268897	-1	no_errors	ENST00000317578	ensembl	human	known	70_37	silent	SNP	1.000	T
SIX5	147912	genome.wustl.edu	37	19	46268958	46268958	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:46268958C>T	ENST00000317578.6	-	3	2402	c.2021G>A	c.(2020-2022)gGa>gAa	p.G674E	SIX5_ENST00000560168.1_3'UTR|AC074212.6_ENST00000590076.1_RNA|AC074212.5_ENST00000592217.2_RNA|AC074212.5_ENST00000559756.1_RNA	NM_175875.4	NP_787071	Q8N196	SIX5_HUMAN	SIX homeobox 5	674					lens development in camera-type eye (GO:0002088)|negative regulation of cell proliferation (GO:0008285)|regulation of transcription, DNA-templated (GO:0006355)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00783)|GBM - Glioblastoma multiforme(486;0.0802)|Epithelial(262;0.235)		CCCCTCTGTTCCTGCGCTTAG	0.697																																																	0													33.0	39.0	37.0					19																	46268958		2201	4300	6501	SO:0001583	missense	147912			L08835	CCDS12673.1	19q13.32	2011-06-20	2007-07-13			ENSG00000177045		"""Homeoboxes / SINE class"""	10891	protein-coding gene	gene with protein product		600963	"""sine oculis homeobox (Drosophila) homolog 5"", ""sine oculis homeobox homolog 5 (Drosophila)"""	DMAHP		8595416	Standard	NM_175875		Approved		uc002pdb.3	Q8N196		ENST00000317578.6:c.2021G>A	19.37:g.46268958C>T	ENSP00000316842:p.Gly674Glu			Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.G674E	ENST00000317578.6	37	c.2021	CCDS12673.1	19	.	.	.	.	.	.	.	.	.	.	c	13.61	2.289353	0.40494	.	.	ENSG00000177045	ENST00000317578	D	0.95690	-3.78	4.09	1.83	0.25207	.	1.618590	0.03283	N	0.186439	D	0.89357	0.6692	N	0.08118	0	0.09310	N	1	B	0.32968	0.392	B	0.25987	0.065	T	0.82208	-0.0571	10	0.66056	D	0.02	-0.2891	10.1407	0.42734	0.0:0.604:0.396:0.0	.	674	Q8N196	SIX5_HUMAN	E	674	ENSP00000316842:G674E	ENSP00000316842:G674E	G	-	2	0	SIX5	50960798	0.001000	0.12720	0.068000	0.19968	0.618000	0.37518	0.402000	0.20965	0.340000	0.23745	-0.304000	0.09214	GGA	SIX5	-	NULL		0.697	SIX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIX5	HGNC	protein_coding	OTTHUMT00000417341.3	C	NM_175875		46268958	-1	no_errors	ENST00000317578	ensembl	human	known	70_37	missense	SNP	0.042	T
SIX5	147912	genome.wustl.edu	37	19	46270372	46270372	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:46270372C>T	ENST00000317578.6	-	2	1226	c.845G>A	c.(844-846)cGa>cAa	p.R282Q	SIX5_ENST00000560168.1_3'UTR|AC074212.6_ENST00000590076.1_RNA|AC074212.5_ENST00000592217.2_RNA|AC074212.5_ENST00000559756.1_RNA	NM_175875.4	NP_787071	Q8N196	SIX5_HUMAN	SIX homeobox 5	282					lens development in camera-type eye (GO:0002088)|negative regulation of cell proliferation (GO:0008285)|regulation of transcription, DNA-templated (GO:0006355)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00783)|GBM - Glioblastoma multiforme(486;0.0802)|Epithelial(262;0.235)		CTCAGGACTTCGGCTGGACTC	0.682																																																	0													19.0	20.0	20.0					19																	46270372		2191	4275	6466	SO:0001583	missense	147912			L08835	CCDS12673.1	19q13.32	2011-06-20	2007-07-13			ENSG00000177045		"""Homeoboxes / SINE class"""	10891	protein-coding gene	gene with protein product		600963	"""sine oculis homeobox (Drosophila) homolog 5"", ""sine oculis homeobox homolog 5 (Drosophila)"""	DMAHP		8595416	Standard	NM_175875		Approved		uc002pdb.3	Q8N196		ENST00000317578.6:c.845G>A	19.37:g.46270372C>T	ENSP00000316842:p.Arg282Gln			Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.R282Q	ENST00000317578.6	37	c.845	CCDS12673.1	19	.	.	.	.	.	.	.	.	.	.	c	13.78	2.339038	0.41398	.	.	ENSG00000177045	ENST00000317578	D	0.90004	-2.6	4.83	1.11	0.20524	.	0.242826	0.27245	N	0.020242	T	0.72787	0.3504	N	0.24115	0.695	0.49687	D	0.999819	D	0.55172	0.97	B	0.33799	0.17	T	0.69525	-0.5122	10	0.44086	T	0.13	-0.9428	5.2605	0.15571	0.0:0.489:0.3329:0.1781	.	282	Q8N196	SIX5_HUMAN	Q	282	ENSP00000316842:R282Q	ENSP00000316842:R282Q	R	-	2	0	SIX5	50962212	0.893000	0.30496	0.417000	0.26559	0.948000	0.59901	2.080000	0.41586	1.000000	0.39049	0.561000	0.74099	CGA	SIX5	-	NULL		0.682	SIX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIX5	HGNC	protein_coding	OTTHUMT00000417341.3	C	NM_175875		46270372	-1	no_errors	ENST00000317578	ensembl	human	known	70_37	missense	SNP	0.671	T
SIX5	147912	genome.wustl.edu	37	19	46271604	46271604	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:46271604C>T	ENST00000317578.6	-	1	880	c.499G>A	c.(499-501)Gcg>Acg	p.A167T	SIX5_ENST00000560168.1_Intron|AC074212.6_ENST00000586251.1_RNA|AC074212.6_ENST00000591530.1_RNA|AC074212.6_ENST00000590076.1_RNA|AC074212.6_ENST00000586498.1_RNA|AC074212.5_ENST00000592217.2_RNA|AC074212.5_ENST00000559756.1_RNA	NM_175875.4	NP_787071	Q8N196	SIX5_HUMAN	SIX homeobox 5	167					lens development in camera-type eye (GO:0002088)|negative regulation of cell proliferation (GO:0008285)|regulation of transcription, DNA-templated (GO:0006355)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00783)|GBM - Glioblastoma multiforme(486;0.0802)|Epithelial(262;0.235)		TGGTAGCGCGCGCGCAGGTAG	0.701																																																	0													8.0	9.0	9.0					19																	46271604		2166	4213	6379	SO:0001583	missense	147912			L08835	CCDS12673.1	19q13.32	2011-06-20	2007-07-13			ENSG00000177045		"""Homeoboxes / SINE class"""	10891	protein-coding gene	gene with protein product		600963	"""sine oculis homeobox (Drosophila) homolog 5"", ""sine oculis homeobox homolog 5 (Drosophila)"""	DMAHP		8595416	Standard	NM_175875		Approved		uc002pdb.3	Q8N196		ENST00000317578.6:c.499G>A	19.37:g.46271604C>T	ENSP00000316842:p.Ala167Thr			Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.A167T	ENST00000317578.6	37	c.499	CCDS12673.1	19	.	.	.	.	.	.	.	.	.	.	c	33	5.224242	0.95139	.	.	ENSG00000177045	ENST00000317578	D	0.95069	-3.6	3.59	3.59	0.41128	.	0.210963	0.39083	N	0.001476	D	0.96122	0.8736	M	0.63428	1.95	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.96319	0.9235	10	0.87932	D	0	-15.631	13.0904	0.59164	0.0:1.0:0.0:0.0	.	167	Q8N196	SIX5_HUMAN	T	167	ENSP00000316842:A167T	ENSP00000316842:A167T	A	-	1	0	SIX5	50963444	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.635000	0.67841	2.010000	0.58986	0.561000	0.74099	GCG	SIX5	-	NULL		0.701	SIX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIX5	HGNC	protein_coding	OTTHUMT00000417341.3	C	NM_175875		46271604	-1	no_errors	ENST00000317578	ensembl	human	known	70_37	missense	SNP	1.000	T
SIGLEC9	27180	genome.wustl.edu	37	19	51631765	51631765	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:51631765C>T	ENST00000250360.3	+	6	1268	c.1201C>T	c.(1201-1203)Cag>Tag	p.Q401*	SIGLEC9_ENST00000440804.3_Nonsense_Mutation_p.Q401*	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	401					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		TTCAGCCTCTCAGGTGAGTGA	0.582																																																	0													94.0	81.0	85.0					19																	51631765		2203	4300	6503	SO:0001587	stop_gained	27180			AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.1201C>T	19.37:g.51631765C>T	ENSP00000250360:p.Gln401*		Q6GTU4|Q9BYI9	Nonsense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like	p.Q401*	ENST00000250360.3	37	c.1201	CCDS12825.1	19	.	.	.	.	.	.	.	.	.	.	.	16.32	3.089411	0.55968	.	.	ENSG00000129450	ENST00000440804;ENST00000250360	.	.	.	2.11	-0.447	0.12234	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	6.1017	0.20051	0.5437:0.4563:0.0:0.0	.	.	.	.	X	401	.	ENSP00000250360:Q401X	Q	+	1	0	SIGLEC9	56323577	0.222000	0.23652	0.089000	0.20774	0.017000	0.09413	0.218000	0.17622	-0.023000	0.13963	0.407000	0.27541	CAG	SIGLEC9	-	NULL		0.582	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIGLEC9	HGNC	protein_coding	OTTHUMT00000464224.1	C	NM_014441		51631765	+1	no_errors	ENST00000440804	ensembl	human	known	70_37	nonsense	SNP	0.106	T
SIGLEC5	8778	genome.wustl.edu	37	19	52115604	52115604	+	Silent	SNP	C	C	T	rs147945480		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:52115604C>T	ENST00000534261.2	-	10	1935	c.1536G>A	c.(1534-1536)ttG>ttA	p.L512L	SIGLEC5_ENST00000429354.3_Silent_p.L512L|SIGLEC5_ENST00000599649.1_Silent_p.L512L|SIGLEC5_ENST00000222107.4_Silent_p.L512L|SIGLEC5_ENST00000570106.2_Silent_p.L512L			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	512					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		TTTGTTCTTCCAAGGGAGGGG	0.562													C|||	1	0.000199681	0.0	0.0	5008	,	,		17948	0.0		0.0	False		,,,				2504	0.001																0								C		1,4405	2.1+/-5.4	0,1,2202	108.0	108.0	108.0		1536	-7.0	0.0	19	dbSNP_134	108	0,8600		0,0,4300	no	coding-synonymous	SIGLEC5	NM_003830.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		512/552	52115604	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	8778			U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.1536G>A	19.37:g.52115604C>T				Silent	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L512	ENST00000534261.2	37	c.1536	CCDS33088.1	19																																																																																			SIGLEC5	-	NULL		0.562	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	SIGLEC5	HGNC	protein_coding	OTTHUMT00000466897.2	C	NM_003830		52115604	-1	no_errors	ENST00000222107	ensembl	human	known	70_37	silent	SNP	0.000	T
SLC12A1	6557	genome.wustl.edu	37	15	48584057	48584057	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr15:48584057G>A	ENST00000558405.1	+	23	2970	c.2956G>A	c.(2956-2958)Gag>Aag	p.E986K	SLC12A1_ENST00000396577.3_Missense_Mutation_p.E986K|SLC12A1_ENST00000380993.3_Missense_Mutation_p.E986K			Q13621	S12A1_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 1	986					cell death (GO:0008219)|chemical homeostasis (GO:0048878)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|kidney development (GO:0001822)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:potassium:chloride symporter activity (GO:0008511)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|prostate(2)|skin(1)	59		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Potassium Chloride(DB00761)|Quinethazone(DB01325)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	GCCAAACAAAGAGAGGTATGA	0.323																																																	0													51.0	50.0	50.0					15																	48584057		2194	4290	6484	SO:0001583	missense	6557				CCDS10129.2, CCDS53940.1	15q15-q21	2013-07-18	2013-07-18		ENSG00000074803	ENSG00000074803		"""Solute carriers"""	10910	protein-coding gene	gene with protein product		600839				8640224	Standard	NM_000338		Approved	NKCC2	uc010bem.3	Q13621	OTTHUMG00000131495	ENST00000558405.1:c.2956G>A	15.37:g.48584057G>A	ENSP00000453409:p.Glu986Lys		A8JYA2|E9PDW4	Missense_Mutation	SNP	pfam_AA-permease_dom,pfam_AA_permease_N,prints_Na/K/Cl_cotranspt2,prints_Na/K/Cl_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.E986K	ENST00000558405.1	37	c.2956	CCDS10129.2	15	.	.	.	.	.	.	.	.	.	.	G	18.02	3.531025	0.64972	.	.	ENSG00000074803	ENST00000380993;ENST00000396577	D;D	0.85702	-2.02;-2.02	5.44	5.44	0.79542	.	0.057932	0.64402	D	0.000001	D	0.83843	0.5342	L	0.45228	1.405	0.80722	D	1	P;P	0.47841	0.899;0.901	B;P	0.45681	0.421;0.49	T	0.82394	-0.0479	10	0.30854	T	0.27	.	18.8581	0.92262	0.0:0.0:1.0:0.0	.	986;986	E9PDW4;Q13621	.;S12A1_HUMAN	K	986	ENSP00000370381:E986K;ENSP00000379822:E986K	ENSP00000370381:E986K	E	+	1	0	SLC12A1	46371349	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.203000	0.58453	2.545000	0.85829	0.655000	0.94253	GAG	SLC12A1	-	tigrfam_Na/K/Cl_cotransptS		0.323	SLC12A1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC12A1	HGNC	protein_coding	OTTHUMT00000417131.1	G			48584057	+1	no_errors	ENST00000380993	ensembl	human	known	70_37	missense	SNP	1.000	A
SLC15A4	121260	genome.wustl.edu	37	12	129299439	129299439	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr12:129299439G>A	ENST00000266771.5	-	2	762	c.723C>T	c.(721-723)ctC>ctT	p.L241L	SLC15A4_ENST00000539703.1_5'UTR	NM_145648.3	NP_663623.1	Q8N697	S15A4_HUMAN	solute carrier family 15 (oligopeptide transporter), member 4	241					ion transport (GO:0006811)|oligopeptide transport (GO:0006857)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	L-histidine transmembrane transporter activity (GO:0005290)|symporter activity (GO:0015293)			endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|skin(1)	22	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.69e-06)|Epithelial(86;1.17e-05)|all cancers(50;5.07e-05)		TCTGGCCACAGAGGAAGACCA	0.517																																																	0													172.0	155.0	161.0					12																	129299439		2203	4300	6503	SO:0001819	synonymous_variant	121260			AY038999	CCDS9264.1	12q24.32	2013-07-18	2013-07-18		ENSG00000139370	ENSG00000139370		"""Solute carriers"""	23090	protein-coding gene	gene with protein product		615806	"""solute carrier family 15, member 4"""			11741232	Standard	NM_145648		Approved	PHT1, PTR4	uc001uhu.2	Q8N697	OTTHUMG00000168415	ENST00000266771.5:c.723C>T	12.37:g.129299439G>A			A6H8Y9|B3KTK1|Q71M34|Q7Z5F8|Q8TAH0	Silent	SNP	pfam_POT_fam,pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.L241	ENST00000266771.5	37	c.723	CCDS9264.1	12																																																																																			SLC15A4	-	pfam_POT_fam,pfam_MFS,superfamily_MFS_dom_general_subst_transpt		0.517	SLC15A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC15A4	HGNC	protein_coding	OTTHUMT00000399663.1	G	NM_145648		129299439	-1	no_errors	ENST00000266771	ensembl	human	known	70_37	silent	SNP	0.993	A
SLC16A5	9121	genome.wustl.edu	37	17	73096055	73096055	+	Intron	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:73096055G>A	ENST00000450736.2	+	4	758				SLC16A5_ENST00000580123.1_Intron|SLC16A5_ENST00000329783.4_Intron|SLC16A5_ENST00000585293.1_3'UTR|SLC16A5_ENST00000538213.2_Intron			O15375	MOT6_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 5						monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	all_lung(278;0.226)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Pyruvic acid(DB00119)	GGTGCAGGTGGAAGGCCCCAG	0.617																																																	0													15.0	12.0	13.0					17																	73096055		2162	4224	6386	SO:0001627	intron_variant	9121			U59299	CCDS11713.1	17q25.1	2013-07-18	2013-07-18		ENSG00000170190	ENSG00000170190		"""Solute carriers"""	10926	protein-coding gene	gene with protein product		603879	"""solute carrier family 16 (monocarboxylic acid transporters), member 5"", ""solute carrier family 16, member 5 (monocarboxylic acid transporter 6)"""			9425115	Standard	NM_004695		Approved	MCT5, MCT6	uc002jmr.4	O15375	OTTHUMG00000179277	ENST00000450736.2:c.344-47G>A	17.37:g.73096055G>A			B4E288	RNA	SNP	-	NULL	ENST00000450736.2	37	NULL	CCDS11713.1	17																																																																																			SLC16A5	-	-		0.617	SLC16A5-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC16A5	HGNC	protein_coding	OTTHUMT00000445547.1	G	NM_004695		73096055	+1	no_errors	ENST00000582048	ensembl	human	known	70_37	rna	SNP	0.000	A
SLC18A1	6570	genome.wustl.edu	37	8	20004823	20004823	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr8:20004823G>A	ENST00000276373.5	-	15	1676	c.1410C>T	c.(1408-1410)gtC>gtT	p.V470V	SLC18A1_ENST00000519026.1_Silent_p.V438V|SLC18A1_ENST00000437980.1_Intron|SLC18A1_ENST00000440926.1_Silent_p.V470V|SLC18A1_ENST00000265808.7_Silent_p.V438V|SLC18A1_ENST00000381608.4_Intron	NM_003053.3	NP_003044.1	P54219	VMAT1_HUMAN	solute carrier family 18 (vesicular monoamine transporter), member 1	470					monoamine transport (GO:0015844)|neurotransmitter transport (GO:0006836)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	drug transmembrane transporter activity (GO:0015238)|monoamine transmembrane transporter activity (GO:0008504)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29				Colorectal(74;0.0747)	Ephedra(DB01363)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Reserpine(DB00206)	GTGGAGCATAGACGATGTTGA	0.507																																																	0													94.0	80.0	85.0					8																	20004823		2203	4300	6503	SO:0001819	synonymous_variant	6570				CCDS6013.1, CCDS47814.1, CCDS47815.1	8p21.3	2013-07-18	2013-07-18		ENSG00000036565	ENSG00000036565		"""Solute carriers"""	10934	protein-coding gene	gene with protein product		193002		VMAT1, VAT1			Standard	NM_003053		Approved	CGAT	uc003wzm.3	P54219	OTTHUMG00000097017	ENST00000276373.5:c.1410C>T	8.37:g.20004823G>A			E9PDJ5|Q9BRE4	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Multidrug-R	p.V470	ENST00000276373.5	37	c.1410	CCDS6013.1	8																																																																																			SLC18A1	-	superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.507	SLC18A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC18A1	HGNC	protein_coding	OTTHUMT00000214106.1	G			20004823	-1	no_errors	ENST00000276373	ensembl	human	known	70_37	silent	SNP	0.130	A
SLC19A3	80704	genome.wustl.edu	37	2	228552884	228552884	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:228552884G>A	ENST00000258403.3	-	5	1383	c.1312C>T	c.(1312-1314)Cag>Tag	p.Q438*	SLC19A3_ENST00000409287.1_Intron|SLC19A3_ENST00000541617.1_Nonsense_Mutation_p.Q434*	NM_025243.3	NP_079519.1	Q9BZV2	S19A3_HUMAN	solute carrier family 19 (thiamine transporter), member 3	438					small molecule metabolic process (GO:0044281)|thiamine transmembrane transport (GO:0071934)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	thiamine uptake transmembrane transporter activity (GO:0015403)			breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|skin(3)	30		Renal(207;0.0112)|all_lung(227;0.0335)|Lung NSC(271;0.142)|all_hematologic(139;0.21)|Esophageal squamous(248;0.236)		Epithelial(121;1.58e-10)|all cancers(144;8.55e-08)|Lung(261;0.00948)|LUSC - Lung squamous cell carcinoma(224;0.0125)	L-Cysteine(DB00151)	CAGCTTACCTGAATGCTGACT	0.383																																																	0													141.0	128.0	133.0					2																	228552884		2203	4300	6503	SO:0001587	stop_gained	80704			AF271633	CCDS2468.1	2q37	2013-07-18	2013-07-18		ENSG00000135917	ENSG00000135917		"""Solute carriers"""	16266	protein-coding gene	gene with protein product	"""thiamine transporter 2"""	606152	"""solute carrier family 19, member 3"""			11136550, 15871139	Standard	XM_005246871		Approved	THTR2	uc002vpi.3	Q9BZV2	OTTHUMG00000133185	ENST00000258403.3:c.1312C>T	2.37:g.228552884G>A	ENSP00000258403:p.Gln438*			Nonsense_Mutation	SNP	pfam_Folate_carrier,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pirsf_Folate_carrier,tigrfam_Folate_carrier	p.Q438*	ENST00000258403.3	37	c.1312	CCDS2468.1	2	.	.	.	.	.	.	.	.	.	.	G	38	6.673914	0.97751	.	.	ENSG00000135917	ENST00000258403;ENST00000541617	.	.	.	5.44	5.44	0.79542	.	0.173233	0.44097	D	0.000484	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-16.9469	19.454	0.94880	0.0:0.0:1.0:0.0	.	.	.	.	X	438;434	.	ENSP00000258403:Q438X	Q	-	1	0	SLC19A3	228261128	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.545000	0.90657	2.831000	0.97527	0.650000	0.86243	CAG	SLC19A3	-	pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,pirsf_Folate_carrier,tigrfam_Folate_carrier		0.383	SLC19A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC19A3	HGNC	protein_coding	OTTHUMT00000256894.1	G			228552884	-1	no_errors	ENST00000258403	ensembl	human	known	70_37	nonsense	SNP	1.000	A
SLC25A32	81034	genome.wustl.edu	37	8	104413815	104413815	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr8:104413815G>A	ENST00000297578.4	-	6	907	c.741C>T	c.(739-741)gtC>gtT	p.V247V	SLC25A32_ENST00000543107.1_Silent_p.V115V|SLC25A32_ENST00000523701.1_5'UTR	NM_030780.3	NP_110407.2	Q9H2D1	MFTC_HUMAN	solute carrier family 25 (mitochondrial folate carrier), member 32	247					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|mitochondrial transport (GO:0006839)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	folic acid transporter activity (GO:0008517)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	9			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)		Folic Acid(DB00158)	GAGCTCTTACGACTTGATATG	0.378																																																	0													157.0	143.0	148.0					8																	104413815		2203	4300	6503	SO:0001819	synonymous_variant	81034			AF283645	CCDS6300.1	8q22.3	2013-05-22	2013-03-15		ENSG00000164933	ENSG00000164933		"""Solute carriers"""	29683	protein-coding gene	gene with protein product		610815	"""solute carrier family 25, member 32"""			10978331	Standard	NM_030780		Approved	MFTC	uc003yll.4	Q9H2D1	OTTHUMG00000164790	ENST00000297578.4:c.741C>T	8.37:g.104413815G>A			Q96JZ6|Q96SU7	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_uncoupling	p.V247	ENST00000297578.4	37	c.741	CCDS6300.1	8																																																																																			SLC25A32	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier		0.378	SLC25A32-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A32	HGNC	protein_coding	OTTHUMT00000380290.2	G	NM_030780		104413815	-1	no_errors	ENST00000297578	ensembl	human	known	70_37	silent	SNP	0.989	A
SLC25A41	284427	genome.wustl.edu	37	19	6433595	6433595	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:6433595G>T	ENST00000321510.6	-	1	178	c.110C>A	c.(109-111)cCt>cAt	p.P37H	SLC25A23_ENST00000601760.1_5'Flank	NM_173637.3	NP_775908.2			solute carrier family 25, member 41											large_intestine(1)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	6						tgggggtggaggcggaggttg	0.572																																																	0													53.0	52.0	53.0					19																	6433595		1918	4112	6030	SO:0001583	missense	284427			AK097761	CCDS45937.1	19p13.3	2013-05-22			ENSG00000181240	ENSG00000181240		"""Solute carriers"""	28533	protein-coding gene	gene with protein product		610822				16949250	Standard	NM_173637		Approved	FLJ40442, MGC34725, APC4	uc010dus.3	Q8N5S1		ENST00000321510.6:c.110C>A	19.37:g.6433595G>T	ENSP00000322649:p.Pro37His			Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.P37H	ENST00000321510.6	37	c.110	CCDS45937.1	19	.	.	.	.	.	.	.	.	.	.	G	10.66	1.412949	0.25465	.	.	ENSG00000181240	ENST00000321510;ENST00000458275	T;D	0.85411	-1.37;-1.98	3.05	2.0	0.26442	.	0.174717	0.35378	U	0.003246	T	0.75961	0.3921	N	0.08118	0	0.09310	N	1	D	0.60160	0.987	P	0.54372	0.75	T	0.67205	-0.5729	10	0.87932	D	0	.	6.0043	0.19537	0.1467:0.0:0.8533:0.0	.	37	Q8N5S1	S2541_HUMAN	H	37	ENSP00000322649:P37H;ENSP00000405411:P37H	ENSP00000322649:P37H	P	-	2	0	SLC25A41	6384595	0.141000	0.22595	0.074000	0.20217	0.043000	0.13939	1.854000	0.39368	0.881000	0.35993	0.306000	0.20318	CCT	SLC25A41	-	NULL		0.572	SLC25A41-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A41	HGNC	protein_coding	OTTHUMT00000462222.1	G	NM_173637		6433595	-1	no_errors	ENST00000321510	ensembl	human	known	70_37	missense	SNP	0.068	T
SLC25A44	9673	genome.wustl.edu	37	1	156163946	156163946	+	5'UTR	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:156163946C>T	ENST00000359511.4	+	0	67				SNORA26_ENST00000516427.1_RNA|SLC25A44_ENST00000423538.2_5'UTR	NM_014655.2	NP_055470.1	Q96H78	S2544_HUMAN	solute carrier family 25, member 44						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Hepatocellular(266;0.158)					AGACGGCATTCGCTGGGAACG	0.632																																																	0																																										SO:0001623	5_prime_UTR_variant	9673			AB007915	CCDS1133.1, CCDS72943.1	1q22	2013-05-22			ENSG00000160785	ENSG00000160785		"""Solute carriers"""	29036	protein-coding gene	gene with protein product		610824				16949250	Standard	NM_001286184		Approved	FLJ90431, KIAA0446	uc001fnp.3	Q96H78	OTTHUMG00000014816	ENST00000359511.4:c.-106C>T	1.37:g.156163946C>T			O75034	RNA	SNP	-	NULL	ENST00000359511.4	37	NULL	CCDS1133.1	1																																																																																			SLC25A44	-	-		0.632	SLC25A44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A44	HGNC	protein_coding	OTTHUMT00000040856.1	C	NM_014655		156163946	+1	no_errors	ENST00000468973	ensembl	human	known	70_37	rna	SNP	0.001	T
SLC2A12	154091	genome.wustl.edu	37	6	134350293	134350293	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr6:134350293G>T	ENST00000275230.5	-	2	825	c.670C>A	c.(670-672)Ctg>Atg	p.L224M		NM_145176.2	NP_660159.1	Q8TD20	GTR12_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 12	224					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			NS(1)|breast(1)|large_intestine(6)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	17	Breast(56;0.214)|Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0101)|GBM - Glioblastoma multiforme(68;0.0123)		TTCATCACCAGAAACCGAGGG	0.453																																					Melanoma(122;1663 1672 14489 35294 41228)												0													74.0	77.0	76.0					6																	134350293		2203	4300	6503	SO:0001583	missense	154091			AL035699	CCDS5169.1	6q23.2	2013-05-22			ENSG00000146411	ENSG00000146411		"""Solute carriers"""	18067	protein-coding gene	gene with protein product		610372				11780753, 11832379	Standard	XM_006715349		Approved	GLUT12, GLUT8	uc003qem.1	Q8TD20	OTTHUMG00000015611	ENST00000275230.5:c.670C>A	6.37:g.134350293G>T	ENSP00000275230:p.Leu224Met		B3KV17|Q7Z6U3|Q96MR8	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Sugar/inositol_transpt	p.L224M	ENST00000275230.5	37	c.670	CCDS5169.1	6	.	.	.	.	.	.	.	.	.	.	G	16.62	3.173494	0.57584	.	.	ENSG00000146411	ENST00000275230	T	0.80824	-1.42	5.4	4.53	0.55603	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.64402	D	0.000001	D	0.89476	0.6726	M	0.90977	3.165	0.54753	D	0.999987	D	0.89917	1.0	D	0.81914	0.995	D	0.91727	0.5393	10	0.66056	D	0.02	-9.6921	14.2069	0.65739	0.0724:0.0:0.9276:0.0	.	224	Q8TD20	GTR12_HUMAN	M	224	ENSP00000275230:L224M	ENSP00000275230:L224M	L	-	1	2	SLC2A12	134391986	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.134000	0.64770	1.284000	0.44531	0.467000	0.42956	CTG	SLC2A12	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.453	SLC2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A12	HGNC	protein_coding	OTTHUMT00000042302.1	G			134350293	-1	no_errors	ENST00000275230	ensembl	human	known	70_37	missense	SNP	1.000	T
SLC44A2	57153	genome.wustl.edu	37	19	10754060	10754060	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:10754060G>A	ENST00000335757.5	+	22	2496	c.2120G>A	c.(2119-2121)tGa>tAa	p.*707*	SLC44A2_ENST00000586078.1_3'UTR|SLC44A2_ENST00000407327.4_Silent_p.*705*			Q8IWA5	CTL2_HUMAN	solute carrier family 44 (choline transporter), member 2	0					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|endometrium(5)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27			Epithelial(33;8.7e-06)|all cancers(31;2.77e-05)		Choline(DB00122)	GCGGAGTCCTGAAGGCCCCGT	0.587																																																	0													35.0	33.0	33.0					19																	10754060		2203	4300	6503	SO:0001819	synonymous_variant	57153			AF070636	CCDS12245.1, CCDS54216.1	19p13.2	2014-08-12	2013-07-17		ENSG00000129353	ENSG00000129353		"""Solute carriers"""	17292	protein-coding gene	gene with protein product		606106				10677542, 15715662	Standard	NM_001145056		Approved	CTL2	uc002mpf.3	Q8IWA5	OTTHUMG00000180585	ENST00000335757.5:c.2120G>A	19.37:g.10754060G>A			B2RBB1|B3KNH3|B4DFJ0|F2Q9D7|Q658V1|Q658Z2|Q6PJV7|Q8N2F0|Q9NY68	Silent	SNP	pfam_Choline_transptr-like	p.*707	ENST00000335757.5	37	c.2120	CCDS12245.1	19																																																																																			SLC44A2	-	NULL		0.587	SLC44A2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC44A2	HGNC	protein_coding	OTTHUMT00000452045.1	G			10754060	+1	no_errors	ENST00000335757	ensembl	human	known	70_37	silent	SNP	0.494	A
SLC9A2	6549	genome.wustl.edu	37	2	103322309	103322309	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:103322309C>T	ENST00000233969.2	+	11	2124	c.1982C>T	c.(1981-1983)tCc>tTc	p.S661F		NM_003048.3	NP_003039.2	Q9UBY0	SL9A2_HUMAN	solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2	661					ion transport (GO:0006811)|protein localization (GO:0008104)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			breast(5)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42						TTACAGGCTTCCACTTCAACC	0.294																																																	0													46.0	51.0	49.0					2																	103322309		2198	4296	6494	SO:0001583	missense	6549				CCDS2062.1	2q11.2	2013-05-22	2012-03-22		ENSG00000115616	ENSG00000115616		"""Solute carriers"""	11072	protein-coding gene	gene with protein product		600530	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 2"""	NHE2			Standard	NM_003048		Approved		uc002tca.3	Q9UBY0	OTTHUMG00000130778	ENST00000233969.2:c.1982C>T	2.37:g.103322309C>T	ENSP00000233969:p.Ser661Phe		B2RMS2	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_2,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.S661F	ENST00000233969.2	37	c.1982	CCDS2062.1	2	.	.	.	.	.	.	.	.	.	.	C	16.56	3.157334	0.57259	.	.	ENSG00000115616	ENST00000233969	T	0.56776	0.44	6.06	6.06	0.98353	.	0.200970	0.44285	D	0.000469	T	0.46367	0.1389	L	0.29908	0.895	0.44388	D	0.99729	B	0.06786	0.001	B	0.04013	0.001	T	0.27640	-1.0068	10	0.56958	D	0.05	.	19.6125	0.95613	0.0:1.0:0.0:0.0	.	661	Q9UBY0	SL9A2_HUMAN	F	661	ENSP00000233969:S661F	ENSP00000233969:S661F	S	+	2	0	SLC9A2	102688741	0.991000	0.36638	0.989000	0.46669	0.952000	0.60782	3.226000	0.51254	2.879000	0.98667	0.650000	0.86243	TCC	SLC9A2	-	NULL		0.294	SLC9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A2	HGNC	protein_coding	OTTHUMT00000253292.2	C			103322309	+1	no_errors	ENST00000233969	ensembl	human	known	70_37	missense	SNP	0.999	T
SLFN14	342618	genome.wustl.edu	37	17	33879989	33879989	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:33879989G>C	ENST00000415846.3	-	3	1699	c.1664C>G	c.(1663-1665)tCc>tGc	p.S555C	RP11-1094M14.12_ENST00000588445.1_RNA	NM_001129820.1	NP_001123292.1	P0C7P3	SLN14_HUMAN	schlafen family member 14	555							ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(3)	9						AAGAGATCTGGAGGACAGGGA	0.522																																																	0													113.0	111.0	112.0					17																	33879989		692	1591	2283	SO:0001583	missense	342618				CCDS45650.1	17q12	2009-09-22				ENSG00000236320			32689	protein-coding gene	gene with protein product		614958				9846487	Standard	NM_001129820		Approved		uc010ctu.1	P0C7P3		ENST00000415846.3:c.1664C>G	17.37:g.33879989G>C	ENSP00000391101:p.Ser555Cys		B2RTW9	Missense_Mutation	SNP	pfam_ATPase_AAA-4	p.S555C	ENST00000415846.3	37	c.1664	CCDS45650.1	17	.	.	.	.	.	.	.	.	.	.	G	14.50	2.552656	0.45487	.	.	ENSG00000236320	ENST00000415846	T	0.01963	4.53	5.19	4.15	0.48705	.	.	.	.	.	T	0.07413	0.0187	L	0.57536	1.79	0.09310	N	1	D	0.76494	0.999	P	0.61328	0.887	T	0.18935	-1.0321	9	0.72032	D	0.01	-12.3087	7.8025	0.29183	0.1131:0.0:0.8869:0.0	.	555	P0C7P3	SLN14_HUMAN	C	555	ENSP00000391101:S555C	ENSP00000391101:S555C	S	-	2	0	SLFN14	30904102	0.717000	0.27966	0.110000	0.21437	0.755000	0.42902	2.372000	0.44257	2.699000	0.92147	0.655000	0.94253	TCC	SLFN14	-	NULL		0.522	SLFN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLFN14	HGNC	protein_coding	OTTHUMT00000448928.1	G	NM_001129820		33879989	-1	no_errors	ENST00000415846	ensembl	human	known	70_37	missense	SNP	0.127	C
SLFNL1	200172	genome.wustl.edu	37	1	41486318	41486318	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:41486318C>T	ENST00000359345.1	-	1	2591	c.15G>A	c.(13-15)aaG>aaA	p.K5K	SLFNL1_ENST00000302946.8_Silent_p.K5K|SLFNL1_ENST00000372613.2_Silent_p.K5K|SLFNL1_ENST00000397197.2_Silent_p.K5K|SLFNL1_ENST00000439569.2_Silent_p.K5K|SLFNL1_ENST00000372611.1_Silent_p.K5K	NM_144990.3	NP_659427.3	Q499Z3	SLNL1_HUMAN	schlafen-like 1	5							ATP binding (GO:0005524)			endometrium(3)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0393)				GCACTGATCTCTTCATGGGGG	0.592																																																	0													32.0	33.0	33.0					1																	41486318		2203	4299	6502	SO:0001819	synonymous_variant	200172			BC022037	CCDS460.1, CCDS72766.1	1p34.2	2008-02-05			ENSG00000171790	ENSG00000171790			26313	protein-coding gene	gene with protein product							Standard	NM_144990		Approved	FLJ23878	uc001cgm.2	Q499Z3	OTTHUMG00000005719	ENST00000359345.1:c.15G>A	1.37:g.41486318C>T			A8K8D1|Q49AG8|Q5VW72|Q5VW74|Q8N7V7|Q8TCH6|Q8WVZ8	Silent	SNP	pfam_ATPase_AAA-4	p.K5	ENST00000359345.1	37	c.15	CCDS460.1	1																																																																																			SLFNL1	-	NULL		0.592	SLFNL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLFNL1	HGNC	protein_coding	OTTHUMT00000015650.1	C	NM_144990		41486318	-1	no_errors	ENST00000302946	ensembl	human	known	70_37	silent	SNP	0.962	T
SMEK2	57223	genome.wustl.edu	37	2	55844379	55844379	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:55844379C>T	ENST00000345102.5	-	1	344	c.43G>A	c.(43-45)Gaa>Aaa	p.E15K	SMEK2_ENST00000477749.1_5'UTR|RP11-554J4.1_ENST00000608113.1_RNA|SMEK2_ENST00000407823.3_Missense_Mutation_p.E15K|SMEK2_ENST00000272313.5_Missense_Mutation_p.E15K	NM_001122964.1	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 (Dictyostelium)	15	WH1.				positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TGCCGGTCTTCGTTCAGGGTA	0.652																																																	0													76.0	64.0	68.0					2																	55844379		2203	4300	6503	SO:0001583	missense	57223			AB037808	CCDS1855.1, CCDS46289.1, CCDS62913.1	2p16.1	2008-09-15			ENSG00000138041				29267	protein-coding gene	gene with protein product		610352				16085932, 18614045	Standard	NM_001122964		Approved	PSY2, FLFL2, KIAA1387, FLJ31474	uc002rzc.3	Q5MIZ7	OTTHUMG00000129336	ENST00000345102.5:c.43G>A	2.37:g.55844379C>T	ENSP00000339769:p.Glu15Lys		Q6P9B0|Q86XB8|Q9BQJ0|Q9BRK2|Q9H913|Q9P2G0	Missense_Mutation	SNP	pfam_DUF625,superfamily_ARM-type_fold	p.E15K	ENST00000345102.5	37	c.43	CCDS46289.1	2	.	.	.	.	.	.	.	.	.	.	C	28.2	4.897587	0.91962	.	.	ENSG00000138041	ENST00000272313;ENST00000407823;ENST00000345102	T;T;T	0.43688	0.94;0.94;0.94	5.06	5.06	0.68205	Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.46908	0.1417	M	0.64567	1.98	0.80722	D	1	P;P;B	0.50710	0.938;0.5;0.237	B;B;B	0.43701	0.428;0.102;0.036	T	0.50259	-0.8849	10	0.45353	T	0.12	-10.7814	18.6177	0.91308	0.0:1.0:0.0:0.0	.	15;15;15	Q5MIZ7-2;Q5MIZ7;Q5MIZ7-3	.;P4R3B_HUMAN;.	K	15	ENSP00000272313:E15K;ENSP00000385912:E15K;ENSP00000339769:E15K	ENSP00000272313:E15K	E	-	1	0	SMEK2	55697883	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.345000	0.79337	2.636000	0.89361	0.561000	0.74099	GAA	SMEK2	-	NULL		0.652	SMEK2-002	NOVEL	basic|CCDS	protein_coding	SMEK2	HGNC	protein_coding	OTTHUMT00000251483.1	C	NM_020463		55844379	-1	no_errors	ENST00000272313	ensembl	human	known	70_37	missense	SNP	1.000	T
SNX15	29907	genome.wustl.edu	37	11	64807250	64807250	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr11:64807250C>G	ENST00000377244.3	+	8	1145	c.1015C>G	c.(1015-1017)Caa>Gaa	p.Q339E	SAC3D1_ENST00000531072.1_5'Flank|SNX15_ENST00000352068.5_Missense_Mutation_p.Q253E|RP11-399J13.3_ENST00000301886.3_3'UTR|SAC3D1_ENST00000398846.1_5'Flank	NM_013306.4|NM_147777.3	NP_037438.2|NP_680086.2	Q9NRS6	SNX15_HUMAN	sorting nexin 15	339	MIT.				intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14						GCACCTGTCTCAACTCCCACC	0.642																																					Esophageal Squamous(56;269 1304 3324 8253)												0													72.0	54.0	60.0					11																	64807250		2201	4297	6498	SO:0001583	missense	29907			AF175267	CCDS8089.1, CCDS8090.1	11q12	2008-05-22			ENSG00000110025	ENSG00000110025		"""Sorting nexins"""	14978	protein-coding gene	gene with protein product		605964				11208079	Standard	NM_013306		Approved			Q9NRS6	OTTHUMG00000037387	ENST00000377244.3:c.1015C>G	11.37:g.64807250C>G	ENSP00000366452:p.Gln339Glu		E5KQS6|Q9NRS5	Missense_Mutation	SNP	pfam_MIT,pfam_Phox,superfamily_Phox,smart_Phox,smart_MIT,pfscan_Phox	p.Q339E	ENST00000377244.3	37	c.1015	CCDS8089.1	11	.	.	.	.	.	.	.	.	.	.	C	9.117	1.008063	0.19199	.	.	ENSG00000110025	ENST00000377244;ENST00000352068	T;T	0.28069	1.63;1.63	3.68	-0.615	0.11587	MIT (1);	0.369348	0.20736	N	0.086628	T	0.14442	0.0349	N	0.19112	0.55	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.06405	0.002;0.002	T	0.11012	-1.0605	10	0.39692	T	0.17	-17.1942	3.354	0.07163	0.1817:0.4897:0.0:0.3286	.	253;339	E5KQS6;Q9NRS6	.;SNX15_HUMAN	E	339;253	ENSP00000366452:Q339E;ENSP00000316410:Q253E	ENSP00000316410:Q253E	Q	+	1	0	SNX15	64563826	0.050000	0.20438	0.006000	0.13384	0.002000	0.02628	0.594000	0.24014	-0.232000	0.09811	-0.145000	0.13849	CAA	SNX15	-	smart_MIT		0.642	SNX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX15	HGNC	protein_coding	OTTHUMT00000091004.3	C			64807250	+1	no_errors	ENST00000377244	ensembl	human	known	70_37	missense	SNP	0.021	G
SON	6651	genome.wustl.edu	37	21	34926794	34926794	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr21:34926794G>C	ENST00000356577.4	+	3	5732	c.5257G>C	c.(5257-5259)Gaa>Caa	p.E1753Q	SON_ENST00000381692.2_Intron|SON_ENST00000300278.4_Missense_Mutation_p.E1753Q|SON_ENST00000381679.4_Missense_Mutation_p.E1753Q|SON_ENST00000290239.6_Missense_Mutation_p.E1753Q	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1753					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						AGCTGGCATTGAAGGACCTTT	0.443																																																	0													130.0	124.0	126.0					21																	34926794		2203	4300	6503	SO:0001583	missense	6651			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.5257G>C	21.37:g.34926794G>C	ENSP00000348984:p.Glu1753Gln		D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	pfam_G_patch_dom,superfamily_WD40_repeat_dom,smart_G_patch_dom,pfscan_G_patch_dom,pfscan_Ds-RNA-bd	p.E1753Q	ENST00000356577.4	37	c.5257	CCDS13629.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.93|14.93	2.682440|2.682440	0.47991|0.47991	.|.	.|.	ENSG00000159140|ENSG00000159140	ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679|ENST00000436227	T;T;T;T|.	0.20463|.	2.32;2.27;2.24;2.07|.	5.6|5.6	3.68|3.68	0.42216|0.42216	.|.	0.119412|.	0.37857|.	N|.	0.001915|.	T|T	0.42337|0.42337	0.1198|0.1198	L|L	0.56769|0.56769	1.78|1.78	0.26073|0.26073	N|N	0.981194|0.981194	P;B;B;B;D|.	0.71674|.	0.713;0.147;0.23;0.23;0.998|.	B;B;B;B;D|.	0.79784|.	0.225;0.035;0.077;0.077;0.993|.	T|T	0.33701|0.33701	-0.9858|-0.9858	10|5	0.30078|.	T|.	0.28|.	.|.	5.2916|5.2916	0.15729|0.15729	0.1773:0.1694:0.6533:0.0|0.1773:0.1694:0.6533:0.0	.|.	1753;1753;1434;1753;1753|.	P18583-10;P18583;P18583-2;P18583-3;P18583-6|.	.;SON_HUMAN;.;.;.|.	Q|F	1753|747	ENSP00000348984:E1753Q;ENSP00000290239:E1753Q;ENSP00000300278:E1753Q;ENSP00000371095:E1753Q|.	ENSP00000290239:E1753Q|.	E|L	+|+	1|3	0|2	SON|SON	33848664|33848664	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	3.348000|3.348000	0.52209|0.52209	1.358000|1.358000	0.45922|0.45922	0.591000|0.591000	0.81541|0.81541	GAA|TTG	SON	-	NULL		0.443	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SON	HGNC	protein_coding	OTTHUMT00000140978.2	G	NM_138927		34926794	+1	no_errors	ENST00000356577	ensembl	human	known	70_37	missense	SNP	0.900	C
SOX17	64321	genome.wustl.edu	37	8	55371672	55371673	+	In_Frame_Ins	INS	-	-	AGA			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr8:55371672_55371673insAGA	ENST00000297316.4	+	2	566_567	c.362_363insAGA	c.(361-366)gcagag>gcAGAagag	p.122_123insE		NM_022454.3	NP_071899.1	Q9H6I2	SOX17_HUMAN	SRY (sex determining region Y)-box 17	122					angiogenesis (GO:0001525)|canonical Wnt signaling pathway (GO:0060070)|cardiac cell fate determination (GO:0060913)|cardiogenic plate morphogenesis (GO:0003142)|cell migration involved in gastrulation (GO:0042074)|common bile duct development (GO:0061009)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cell differentiation (GO:0060956)|endocardium formation (GO:0060214)|endoderm formation (GO:0001706)|endodermal cell fate determination (GO:0007493)|endodermal digestive tract morphogenesis (GO:0061031)|gall bladder development (GO:0061010)|heart formation (GO:0060914)|heart looping (GO:0001947)|inner cell mass cellular morphogenesis (GO:0001828)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell growth (GO:0030308)|negative regulation of mesodermal cell fate specification (GO:0042662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell differentiation (GO:0045597)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein destabilization (GO:0031648)|protein stabilization (GO:0050821)|regulation of cardiac cell fate specification (GO:2000043)|regulation of embryonic development (GO:0045995)|regulation of stem cell division (GO:2000035)|regulation of stem cell proliferation (GO:0072091)|regulation of transcription from RNA polymerase II promoter involved in definitive endodermal cell fate specification (GO:0060807)|regulation of transcription, DNA-templated (GO:0006355)|renal system development (GO:0072001)|rostrocaudal neural tube patterning (GO:0021903)|signal transduction involved in regulation of gene expression (GO:0023019)|spermatogenesis (GO:0007283)|stem cell fate specification (GO:0048866)|vasculogenesis (GO:0001570)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			endometrium(6)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)	18		Lung NSC(129;0.109)|all_epithelial(80;0.176)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;1.9e-07)|Epithelial(17;1.7e-05)|all cancers(17;0.000159)			GTGGAGGAGGCAGAGCGGCTGC	0.683																																																	0																																										SO:0001652	inframe_insertion	64321			AB073988	CCDS6159.1	8q11.23	2014-09-04			ENSG00000164736	ENSG00000164736		"""SRY (sex determining region Y)-boxes"""	18122	protein-coding gene	gene with protein product		610928				11786926	Standard	NM_022454		Approved		uc003xsb.4	Q9H6I2	OTTHUMG00000164377	ENST00000297316.4:c.363_365dupAGA	8.37:g.55371673_55371675dupAGA	ENSP00000297316:p.Glu122_Glu122dup			In_Frame_Ins	INS	pfam_Sox_C_TAD,pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.123in_frame_insE	ENST00000297316.4	37	c.362_363	CCDS6159.1	8																																																																																			SOX17	-	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily		0.683	SOX17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX17	HGNC	protein_coding	OTTHUMT00000378526.2	-			55371673	+1	no_errors	ENST00000297316	ensembl	human	known	70_37	in_frame_ins	INS	1.000:0.996	AGA
SPAG17	200162	genome.wustl.edu	37	1	118526482	118526482	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:118526482C>G	ENST00000336338.5	-	42	5889	c.5824G>C	c.(5824-5826)Gaa>Caa	p.E1942Q	SPAG17_ENST00000492438.1_5'UTR	NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1942						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		TTTGCATCTTCATTTTTCTTT	0.308																																																	0													151.0	144.0	146.0					1																	118526482		2202	4300	6502	SO:0001583	missense	200162				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.5824G>C	1.37:g.118526482C>G	ENSP00000337804:p.Glu1942Gln		Q8NAZ1|Q9NT21	Missense_Mutation	SNP	NULL	p.E1942Q	ENST00000336338.5	37	c.5824	CCDS899.1	1	.	.	.	.	.	.	.	.	.	.	C	12.75	2.030990	0.35797	.	.	ENSG00000155761	ENST00000336338;ENST00000437255	T	0.19105	2.17	4.9	1.97	0.26223	.	0.781535	0.12041	N	0.505085	T	0.07683	0.0193	M	0.70595	2.14	0.09310	N	1	P	0.40731	0.728	B	0.36244	0.22	T	0.28650	-1.0037	10	0.19147	T	0.46	.	7.2464	0.26124	0.0:0.7198:0.0:0.2802	.	1942	Q6Q759	SPG17_HUMAN	Q	1942;422	ENSP00000337804:E1942Q	ENSP00000337804:E1942Q	E	-	1	0	SPAG17	118328005	0.000000	0.05858	0.001000	0.08648	0.070000	0.16714	-0.412000	0.07132	0.339000	0.23719	0.655000	0.94253	GAA	SPAG17	-	NULL		0.308	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG17	HGNC	protein_coding	OTTHUMT00000033723.1	C	NM_206996		118526482	-1	no_errors	ENST00000336338	ensembl	human	known	70_37	missense	SNP	0.004	G
SPATS2	65244	genome.wustl.edu	37	12	49888630	49888630	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr12:49888630C>T	ENST00000553127.1	+	8	884	c.371C>T	c.(370-372)tCa>tTa	p.S124L	SPATS2_ENST00000321898.6_Missense_Mutation_p.S124L|SPATS2_ENST00000552918.1_Missense_Mutation_p.S124L|SPATS2_ENST00000552557.1_3'UTR			Q86XZ4	SPAS2_HUMAN	spermatogenesis associated, serine-rich 2	124						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(1)|prostate(1)|urinary_tract(4)	21						GCGCCTTCCTCAGAGAAAGGT	0.453																																																	0													72.0	62.0	65.0					12																	49888630		2203	4300	6503	SO:0001583	missense	65244			AK023179	CCDS31794.1	12q13.12	2009-06-12							18650	protein-coding gene	gene with protein product		611667				11944913, 17989879	Standard	NM_023071		Approved	SPATA10, SCR59, FLJ13117	uc001rud.2	Q86XZ4		ENST00000553127.1:c.371C>T	12.37:g.49888630C>T	ENSP00000448228:p.Ser124Leu		A8K8G9|Q9H7D4|Q9H8Y7|Q9H8Z8	Missense_Mutation	SNP	pfam_DUF1387,superfamily_UBA-like	p.S124L	ENST00000553127.1	37	c.371	CCDS31794.1	12	.	.	.	.	.	.	.	.	.	.	C	13.17	2.157836	0.38119	.	.	ENSG00000123352	ENST00000553127;ENST00000321898;ENST00000552918;ENST00000395063	.	.	.	5.58	4.5	0.54988	.	0.196422	0.35805	N	0.002961	T	0.52901	0.1763	L	0.46157	1.445	0.80722	D	1	B	0.12013	0.005	B	0.14023	0.01	T	0.46816	-0.9164	8	.	.	.	-8.0081	12.6044	0.56514	0.0:0.9056:0.0:0.0944	.	124	Q86XZ4	SPAS2_HUMAN	L	124	.	.	S	+	2	0	SPATS2	48174897	0.999000	0.42202	1.000000	0.80357	0.977000	0.68977	2.357000	0.44125	2.608000	0.88229	0.655000	0.94253	TCA	SPATS2	-	pfam_DUF1387		0.453	SPATS2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SPATS2	HGNC	protein_coding	OTTHUMT00000404023.1	C	NM_023071		49888630	+1	no_errors	ENST00000321898	ensembl	human	known	70_37	missense	SNP	0.995	T
SPATS2	65244	genome.wustl.edu	37	12	49919880	49919880	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr12:49919880C>G	ENST00000553127.1	+	15	1993	c.1480C>G	c.(1480-1482)Cag>Gag	p.Q494E	SPATS2_ENST00000321898.6_Missense_Mutation_p.Q494E|SPATS2_ENST00000552918.1_Missense_Mutation_p.Q494E			Q86XZ4	SPAS2_HUMAN	spermatogenesis associated, serine-rich 2	494						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(1)|prostate(1)|urinary_tract(4)	21						TGCTCCATCTCAGGCACCAGG	0.537																																																	0													145.0	121.0	129.0					12																	49919880		2203	4300	6503	SO:0001583	missense	65244			AK023179	CCDS31794.1	12q13.12	2009-06-12							18650	protein-coding gene	gene with protein product		611667				11944913, 17989879	Standard	NM_023071		Approved	SPATA10, SCR59, FLJ13117	uc001rud.2	Q86XZ4		ENST00000553127.1:c.1480C>G	12.37:g.49919880C>G	ENSP00000448228:p.Gln494Glu		A8K8G9|Q9H7D4|Q9H8Y7|Q9H8Z8	Missense_Mutation	SNP	pfam_DUF1387,superfamily_UBA-like	p.Q494E	ENST00000553127.1	37	c.1480	CCDS31794.1	12	.	.	.	.	.	.	.	.	.	.	C	12.12	1.843758	0.32606	.	.	ENSG00000123352	ENST00000553127;ENST00000321898;ENST00000552918;ENST00000395063	.	.	.	4.26	4.26	0.50523	.	0.372397	0.27886	N	0.017457	T	0.48537	0.1505	L	0.34521	1.04	0.80722	D	1	B	0.27791	0.189	B	0.29785	0.107	T	0.50320	-0.8842	9	0.48119	T	0.1	-4.6443	15.0587	0.71936	0.0:1.0:0.0:0.0	.	494	Q86XZ4	SPAS2_HUMAN	E	494	.	ENSP00000326841:Q494E	Q	+	1	0	SPATS2	48206147	0.687000	0.27671	0.925000	0.36789	0.892000	0.51952	4.387000	0.59626	2.690000	0.91761	0.579000	0.79373	CAG	SPATS2	-	NULL		0.537	SPATS2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SPATS2	HGNC	protein_coding	OTTHUMT00000404023.1	C	NM_023071		49919880	+1	no_errors	ENST00000321898	ensembl	human	known	70_37	missense	SNP	0.886	G
SPG7	6687	genome.wustl.edu	37	16	89623345	89623345	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr16:89623345G>A	ENST00000268704.2	+	17	2247	c.2232G>A	c.(2230-2232)gaG>gaA	p.E744E	SPG7_ENST00000565891.1_3'UTR	NM_003119.2	NP_003110.1	Q9UQ90	SPG7_HUMAN	spastic paraplegia 7 (pure and complicated autosomal recessive)	744					anterograde axon cargo transport (GO:0008089)|cell death (GO:0008219)|mitochondrion organization (GO:0007005)|nervous system development (GO:0007399)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|peptidase activity (GO:0008233)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|urinary_tract(1)	20		all_hematologic(23;0.00824)|Colorectal(91;0.102)		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)		AGGACATTGAGGCTCTCATTG	0.562																																																	0													102.0	101.0	102.0					16																	89623345		2198	4300	6498	SO:0001819	synonymous_variant	6687			Y16610	CCDS10977.1, CCDS10978.1	16q24.3	2010-04-21	2007-04-23		ENSG00000197912	ENSG00000197912		"""ATPases / AAA-type"""	11237	protein-coding gene	gene with protein product	"""paraplegin"""	602783	"""cell matrix adhesion regulator"""	CMAR		9635427, 9634528	Standard	XM_006721264		Approved	CAR, SPG5C	uc002fnj.3	Q9UQ90	OTTHUMG00000138046	ENST00000268704.2:c.2232G>A	16.37:g.89623345G>A			O75756|Q2TB70|Q58F00|Q96IB0	Silent	SNP	pfam_Peptidase_M41,pfam_ATPase_AAA_core,pfam_Pept_M41_FtsH_extracell,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase,tigrfam_FtsH	p.E744	ENST00000268704.2	37	c.2232	CCDS10977.1	16																																																																																			SPG7	-	pfam_Peptidase_M41,tigrfam_FtsH		0.562	SPG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPG7	HGNC	protein_coding	OTTHUMT00000269921.2	G	NM_003119		89623345	+1	no_errors	ENST00000268704	ensembl	human	known	70_37	silent	SNP	1.000	A
SPSB2	84727	genome.wustl.edu	37	12	6981681	6981681	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr12:6981681C>T	ENST00000524270.1	-	2	571	c.385G>A	c.(385-387)Gag>Aag	p.E129K	SPSB2_ENST00000523102.1_Missense_Mutation_p.E129K|SPSB2_ENST00000519357.1_Missense_Mutation_p.E129K|LRRC23_ENST00000433346.1_5'Flank|RPL13P5_ENST00000412023.1_RNA	NM_032641.3	NP_116030.1	Q99619	SPSB2_HUMAN	splA/ryanodine receptor domain and SOCS box containing 2	129	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				kidney(2)|lung(2)|upper_aerodigestive_tract(1)	5						CCCCACGACTCGCTGTTGCTG	0.701											OREG0021639	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													38.0	42.0	40.0					12																	6981681		2203	4299	6502	SO:0001583	missense	84727			AF403027	CCDS8567.1	12p13.31	2008-02-05				ENSG00000111671			29522	protein-coding gene	gene with protein product		611658				8723724, 12076535	Standard	NM_001146316		Approved	GRCC9, SSB-2	uc001qrl.3	Q99619		ENST00000524270.1:c.385G>A	12.37:g.6981681C>T	ENSP00000428338:p.Glu129Lys	638	B7Z4W1|D3DUT0	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_SOCS_C,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,smart_SOCS_C,pfscan_B30.2/SPRY,pfscan_SOCS_C	p.E129K	ENST00000524270.1	37	c.385	CCDS8567.1	12	.	.	.	.	.	.	.	.	.	.	C	22.3	4.267112	0.80469	.	.	ENSG00000111671	ENST00000523102;ENST00000524270;ENST00000519357	T;T;T	0.40756	1.02;1.02;1.02	3.93	3.02	0.34903	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.078219	0.47852	D	0.000205	T	0.45397	0.1340	M	0.75615	2.305	0.33469	D	0.585947	D;P	0.57899	0.981;0.854	P;B	0.49192	0.602;0.153	T	0.58713	-0.7588	10	0.42905	T	0.14	.	5.5212	0.16933	0.0:0.6828:0.207:0.1103	.	129;129	B7Z4W1;Q99619	.;SPSB2_HUMAN	K	129	ENSP00000430872:E129K;ENSP00000428338:E129K;ENSP00000431037:E129K	ENSP00000431037:E129K	E	-	1	0	SPSB2	6851942	1.000000	0.71417	1.000000	0.80357	0.725000	0.41563	4.787000	0.62432	0.961000	0.38030	-0.302000	0.09304	GAG	SPSB2	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY		0.701	SPSB2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SPSB2	HGNC	protein_coding	OTTHUMT00000375721.1	C	NM_032641		6981681	-1	no_errors	ENST00000523102	ensembl	human	known	70_37	missense	SNP	1.000	T
SRGAP1	57522	genome.wustl.edu	37	12	64410757	64410757	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr12:64410757G>T	ENST00000355086.3	+	4	978	c.454G>T	c.(454-456)Gag>Tag	p.E152*	SRGAP1_ENST00000543397.1_Nonsense_Mutation_p.E112*|SRGAP1_ENST00000357825.3_Nonsense_Mutation_p.E152*	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	152	F-BAR domain.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		CCAACTTCATGAGGATTTAAT	0.284																																																	0													124.0	123.0	123.0					12																	64410757		2202	4300	6502	SO:0001587	stop_gained	57522			AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.454G>T	12.37:g.64410757G>T	ENSP00000347198:p.Glu152*		Q9H8A3|Q9P2P2	Nonsense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FCH,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Fuc/Ara_isomerase_C,smart_FCH,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.E152*	ENST00000355086.3	37	c.454	CCDS8967.1	12	.	.	.	.	.	.	.	.	.	.	G	49	15.407188	0.99833	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	.	.	.	5.58	5.58	0.84498	.	0.000000	0.35067	U	0.003461	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7364	0.91756	0.0:0.0:1.0:0.0	.	.	.	.	X	152;152;112	.	.	E	+	1	0	SRGAP1	62697024	1.000000	0.71417	1.000000	0.80357	0.504000	0.33889	7.551000	0.82182	2.802000	0.96397	0.655000	0.94253	GAG	SRGAP1	-	NULL		0.284	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRGAP1	HGNC	protein_coding	OTTHUMT00000400896.1	G			64410757	+1	no_errors	ENST00000355086	ensembl	human	known	70_37	nonsense	SNP	1.000	T
SRPK2	6733	genome.wustl.edu	37	7	104809665	104809665	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr7:104809665G>A	ENST00000393651.3	-	4	364	c.277C>T	c.(277-279)Cat>Tat	p.H93Y	SRPK2_ENST00000489828.1_Missense_Mutation_p.H82Y|SRPK2_ENST00000357311.3_Missense_Mutation_p.H82Y	NM_182692.1	NP_872634.1			SRSF protein kinase 2											NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(11)|large_intestine(6)|lung(4)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	35						CTAATAACATGATACCGGCCA	0.378																																																	0													129.0	117.0	121.0					7																	104809665		2203	4300	6503	SO:0001583	missense	6733			U88666	CCDS5735.1, CCDS34724.1	7q22-q31.1	2010-06-23	2010-06-23		ENSG00000135250	ENSG00000135250			11306	protein-coding gene	gene with protein product	"""SR protein kinase 2"", ""serine/arginine-rich splicing factor kinase 2"""	602980	"""SFRS protein kinase 2"""			8208298, 9472028	Standard	NM_182692		Approved	SFRSK2	uc003vcv.4	P78362	OTTHUMG00000157405	ENST00000393651.3:c.277C>T	7.37:g.104809665G>A	ENSP00000377262:p.His93Tyr			Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.H93Y	ENST00000393651.3	37	c.277	CCDS34724.1	7	.	.	.	.	.	.	.	.	.	.	G	15.98	2.993989	0.54041	.	.	ENSG00000135250	ENST00000393651;ENST00000357311;ENST00000489828;ENST00000482897;ENST00000460391	T;T;T;T;T	0.21543	2.0;2.0;2.0;2.0;2.0	5.61	5.61	0.85477	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.37046	0.0989	L	0.28694	0.88	0.80722	D	1	D;D	0.62365	0.991;0.982	D;D	0.70716	0.965;0.97	T	0.06625	-1.0816	10	0.52906	T	0.07	-18.6729	19.6378	0.95744	0.0:0.0:1.0:0.0	.	93;82	P78362-2;P78362	.;SRPK2_HUMAN	Y	93;82;82;130;82	ENSP00000377262:H93Y;ENSP00000349863:H82Y;ENSP00000419791:H82Y;ENSP00000419240:H130Y;ENSP00000417357:H82Y	ENSP00000349863:H82Y	H	-	1	0	SRPK2	104596901	1.000000	0.71417	0.997000	0.53966	0.999000	0.98932	9.781000	0.99029	2.631000	0.89168	0.655000	0.94253	CAT	SRPK2	-	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.378	SRPK2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRPK2	HGNC	protein_coding	OTTHUMT00000348723.1	G	NM_182691		104809665	-1	no_errors	ENST00000393651	ensembl	human	known	70_37	missense	SNP	1.000	A
SSH2	85464	genome.wustl.edu	37	17	27959008	27959008	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:27959008C>T	ENST00000269033.3	-	15	3274	c.3123G>A	c.(3121-3123)ctG>ctA	p.L1041L	SSH2_ENST00000540801.1_Silent_p.L1068L|RP11-68I3.2_ENST00000581474.1_RNA	NM_001282129.1|NM_033389.2	NP_001269058.1|NP_203747.2	Q76I76	SSH2_HUMAN	slingshot protein phosphatase 2	1041					actin cytoskeleton organization (GO:0030036)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)		SSH2/SUZ12(2)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TCACTTTCCTCAGCCCTTGCT	0.488																																																	0													133.0	120.0	124.0					17																	27959008		2203	4300	6503	SO:0001819	synonymous_variant	85464			AB072359	CCDS11253.1, CCDS74024.1	17q11.2	2013-03-05	2013-03-05		ENSG00000141298	ENSG00000141298		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30580	protein-coding gene	gene with protein product		606779	"""slingshot homolog 2 (Drosophila)"""			11832213, 11214970	Standard	XM_005258059		Approved	KIAA1725	uc002heo.1	Q76I76	OTTHUMG00000132752	ENST00000269033.3:c.3123G>A	17.37:g.27959008C>T			Q8TDB5|Q8WYL1|Q8WYL2|Q96F40|Q96H36|Q9C0D8	Silent	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_DEK_C,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.L1041	ENST00000269033.3	37	c.3123	CCDS11253.1	17																																																																																			SSH2	-	NULL		0.488	SSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSH2	HGNC	protein_coding	OTTHUMT00000256116.1	C	NM_033389		27959008	-1	no_errors	ENST00000269033	ensembl	human	known	70_37	silent	SNP	0.640	T
ST3GAL1	6482	genome.wustl.edu	37	8	134488145	134488145	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr8:134488145C>T	ENST00000319914.5	-	4	1150	c.123G>A	c.(121-123)caG>caA	p.Q41Q	ST3GAL1_ENST00000519435.1_5'Flank|ST3GAL1_ENST00000399640.2_Silent_p.Q41Q|ST3GAL1_ENST00000521180.1_Silent_p.Q41Q|ST3GAL1_ENST00000522652.1_Silent_p.Q41Q			Q11201	SIA4A_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 1	41					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylneuraminate metabolic process (GO:0006054)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein phosphorylation (GO:0006468)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)			endometrium(3)|large_intestine(2)|lung(11)|prostate(1)	17	all_epithelial(106;1.53e-23)|Lung NSC(106;3.15e-07)|all_lung(105;1.26e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.00721)			CCAGGACCATCTGCTTGGGGA	0.587																																																	0													102.0	85.0	91.0					8																	134488145		2203	4300	6503	SO:0001819	synonymous_variant	6482			L29555	CCDS6373.1	8q24.22	2013-03-01	2003-01-14	2005-02-07	ENSG00000008513	ENSG00000008513	2.4.99.4	"""Sialyltransferases"""	10862	protein-coding gene	gene with protein product	"""ST3Gal I"""	607187	"""sialyltransferase 4A (beta-galactosidase alpha-2,3-sialytransferase)"""	SIAT4A		10504389, 7655169	Standard	NM_003033		Approved	ST3O, SIATFL, ST3GalA.1	uc003yuk.2	Q11201	OTTHUMG00000164534	ENST00000319914.5:c.123G>A	8.37:g.134488145C>T			O60677|Q9UN51	Silent	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.Q41	ENST00000319914.5	37	c.123	CCDS6373.1	8																																																																																			ST3GAL1	-	pirsf_Sialyl_trans		0.587	ST3GAL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ST3GAL1	HGNC	protein_coding	OTTHUMT00000379132.1	C	NM_003033		134488145	-1	no_errors	ENST00000319914	ensembl	human	known	70_37	silent	SNP	0.681	T
STAT4	6775	genome.wustl.edu	37	2	191922751	191922751	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:191922751C>T	ENST00000392320.2	-	13	1513	c.1199G>A	c.(1198-1200)cGa>cAa	p.R400Q	STAT4_ENST00000358470.4_Missense_Mutation_p.R400Q	NM_003151.3	NP_003142.1	Q14765	STAT4_HUMAN	signal transducer and activator of transcription 4	400					cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(4)|endometrium(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)			TACCAAATGTCGAAATTCTAC	0.363																																																	0													75.0	75.0	75.0					2																	191922751		2203	4300	6503	SO:0001583	missense	6775				CCDS2310.1	2q32.2-q32.3	2013-02-14			ENSG00000138378	ENSG00000138378		"""SH2 domain containing"""	11365	protein-coding gene	gene with protein product		600558				8007943, 8700208	Standard	NM_003151		Approved		uc002usn.2	Q14765	OTTHUMG00000132700	ENST00000392320.2:c.1199G>A	2.37:g.191922751C>T	ENSP00000376134:p.Arg400Gln		Q96NZ6	Missense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,pfscan_SH2	p.R400Q	ENST00000392320.2	37	c.1199	CCDS2310.1	2	.	.	.	.	.	.	.	.	.	.	C	30	5.053764	0.93793	.	.	ENSG00000138378	ENST00000358470;ENST00000392320	T;T	0.80304	-1.36;-1.36	5.38	5.38	0.77491	STAT transcription factor, DNA-binding, subdomain (1);STAT transcription factor, DNA-binding (1);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.87637	0.6227	M	0.84683	2.71	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.998	P;P;P	0.50708	0.648;0.648;0.648	D	0.89649	0.3868	10	0.72032	D	0.01	-33.9759	19.5078	0.95127	0.0:1.0:0.0:0.0	.	309;400;400	Q53S87;B4DV04;Q14765	.;.;STAT4_HUMAN	Q	400	ENSP00000351255:R400Q;ENSP00000376134:R400Q	ENSP00000351255:R400Q	R	-	2	0	STAT4	191630996	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	5.478000	0.66806	2.694000	0.91930	0.585000	0.79938	CGA	STAT4	-	pfam_STAT_TF_DNA-bd,superfamily_p53-like_TF_DNA-bd		0.363	STAT4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	STAT4	HGNC	protein_coding	OTTHUMT00000335586.1	C	NM_003151		191922751	-1	no_errors	ENST00000358470	ensembl	human	known	70_37	missense	SNP	1.000	T
STK36	27148	genome.wustl.edu	37	2	219563736	219563736	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:219563736C>T	ENST00000295709.3	+	26	3748	c.3469C>T	c.(3469-3471)Ctg>Ttg	p.L1157L	STK36_ENST00000392105.3_Silent_p.L1136L|STK36_ENST00000392106.2_Silent_p.L1136L|STK36_ENST00000440309.1_Silent_p.L1157L	NM_015690.4	NP_056505.2			serine/threonine kinase 36											biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		GCTCAGCCTTCTGCTGCTTGG	0.607																																																	0													63.0	64.0	64.0					2																	219563736		2203	4300	6503	SO:0001819	synonymous_variant	27148			AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.3469C>T	2.37:g.219563736C>T				Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L1157	ENST00000295709.3	37	c.3469	CCDS2421.1	2																																																																																			STK36	-	superfamily_ARM-type_fold		0.607	STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK36	HGNC	protein_coding	OTTHUMT00000256723.2	C			219563736	+1	no_errors	ENST00000295709	ensembl	human	known	70_37	silent	SNP	0.986	T
STX11	8676	genome.wustl.edu	37	6	144508280	144508280	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr6:144508280C>T	ENST00000367568.4	+	2	699	c.516C>T	c.(514-516)gtC>gtT	p.V172V		NM_003764.3	NP_003755.2	O75558	STX11_HUMAN	syntaxin 11	172					cytotoxic T cell degranulation (GO:0043316)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|natural killer cell degranulation (GO:0043320)|neutrophil degranulation (GO:0043312)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	SNAP receptor activity (GO:0005484)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	12				OV - Ovarian serous cystadenocarcinoma(155;2.17e-06)|GBM - Glioblastoma multiforme(68;0.0492)		GCAAGGAAGTCTCGGGCGACC	0.622									Familial Hemophagocytic Lymphohistiocytosis																																								0													53.0	56.0	55.0					6																	144508280		2203	4300	6503	SO:0001819	synonymous_variant	8676	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	AF044309	CCDS5205.1	6q24.1	2014-09-17			ENSG00000135604	ENSG00000135604			11429	protein-coding gene	gene with protein product		605014				9553086	Standard	NM_003764		Approved		uc003qks.4	O75558	OTTHUMG00000015739	ENST00000367568.4:c.516C>T	6.37:g.144508280C>T			E1P598|O75378|O95148|Q5TCL6	Silent	SNP	pfam_T_SNARE_dom,pfam_Syntaxin_N,superfamily_t-SNARE,smart_Syntaxin_N,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.V172	ENST00000367568.4	37	c.516	CCDS5205.1	6																																																																																			STX11	-	superfamily_t-SNARE		0.622	STX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX11	HGNC	protein_coding	OTTHUMT00000042544.1	C			144508280	+1	no_errors	ENST00000367568	ensembl	human	known	70_37	silent	SNP	0.989	T
SUN2	25777	genome.wustl.edu	37	22	39144780	39144780	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr22:39144780G>A	ENST00000405510.1	-	8	981	c.623C>T	c.(622-624)tCg>tTg	p.S208L	RP3-508I15.14_ENST00000416406.1_RNA|SUN2_ENST00000216064.4_Missense_Mutation_p.S208L|SUN2_ENST00000405018.1_Missense_Mutation_p.S229L|SUN2_ENST00000406622.1_Missense_Mutation_p.S208L|SUN2_ENST00000411587.2_Missense_Mutation_p.S197L	NM_001199580.1	NP_001186509.1	Q9UH99	SUN2_HUMAN	Sad1 and UNC84 domain containing 2	208					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|mitotic spindle organization (GO:0007052)|nuclear envelope organization (GO:0006998)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)	condensed nuclear chromosome (GO:0000794)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|SUN-KASH complex (GO:0034993)	identical protein binding (GO:0042802)|lamin binding (GO:0005521)|microtubule binding (GO:0008017)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|skin(2)|stomach(1)	15						CTTCAGGGACGAGAAGCGCCT	0.647																																																	0													100.0	88.0	92.0					22																	39144780		2203	4300	6503	SO:0001583	missense	25777			AF202723	CCDS13978.1, CCDS56231.1	22q12-q13	2010-05-18	2010-05-18	2010-01-27	ENSG00000100242	ENSG00000100242			14210	protein-coding gene	gene with protein product		613569	"""unc-84 homolog B (C. elegans)"""	UNC84B		10508607, 10375507	Standard	NM_015374		Approved		uc010gxq.2	Q9UH99	OTTHUMG00000151031	ENST00000405510.1:c.623C>T	22.37:g.39144780G>A	ENSP00000385740:p.Ser208Leu		B0QY62|O75156|Q2NKN8|Q2T9F7|Q504T5|Q6B4H1|Q7Z3E3	Missense_Mutation	SNP	pfam_Sad1_UNC_C,superfamily_Galactose-bd-like	p.S208L	ENST00000405510.1	37	c.623	CCDS13978.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.28|16.28	3.077445|3.077445	0.55753|0.55753	.|.	.|.	ENSG00000100242|ENSG00000100242	ENST00000430185|ENST00000405510;ENST00000216064;ENST00000405018;ENST00000406622;ENST00000411587;ENST00000438058	.|T;T;T;T;T;T	.|0.33216	.|2.66;2.66;2.64;2.66;2.67;1.42	4.73|4.73	4.73|4.73	0.59995|0.59995	.|.	.|0.551536	.|0.15814	.|N	.|0.243310	T|T	0.21145|0.21145	0.0509|0.0509	L|L	0.27053|0.27053	0.805|0.805	0.35570|0.35570	D|D	0.805403|0.805403	.|D;D;D;P;P	.|0.54772	.|0.968;0.968;0.968;0.954;0.913	.|B;B;B;B;B	.|0.35770	.|0.137;0.178;0.178;0.21;0.11	T|T	0.35276|0.35276	-0.9795|-0.9795	5|10	.|0.51188	.|T	.|0.08	-9.0249|-9.0249	15.8309|15.8309	0.78749|0.78749	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|197;243;208;229;208	.|B4DIU6;B4E2A6;Q2T9F7;B0QY62;Q9UH99	.|.;.;.;.;SUN2_HUMAN	C|L	65|208;208;229;208;197;162	.|ENSP00000385740:S208L;ENSP00000216064:S208L;ENSP00000385616:S229L;ENSP00000383992:S208L;ENSP00000395601:S197L;ENSP00000406941:S162L	.|ENSP00000216064:S208L	R|S	-|-	1|2	0|0	SUN2|SUN2	37474726|37474726	1.000000|1.000000	0.71417|0.71417	0.936000|0.936000	0.37596|0.37596	0.577000|0.577000	0.36160|0.36160	5.330000|5.330000	0.65899|0.65899	2.327000|2.327000	0.79052|0.79052	0.561000|0.561000	0.74099|0.74099	CGT|TCG	SUN2	-	NULL		0.647	SUN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUN2	HGNC	protein_coding	OTTHUMT00000321057.1	G	XM_039332		39144780	-1	no_errors	ENST00000216064	ensembl	human	known	70_37	missense	SNP	0.982	A
SYNE2	23224	genome.wustl.edu	37	14	64593336	64593336	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr14:64593336G>A	ENST00000344113.4	+	73	13940	c.13728G>A	c.(13726-13728)aaG>aaA	p.K4576K	ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000555002.1_Silent_p.K1210K|SYNE2_ENST00000358025.3_Silent_p.K4576K|SYNE2_ENST00000394768.2_Silent_p.K961K|SYNE2_ENST00000554584.1_Silent_p.K4527K|SYNE2_ENST00000357395.3_Silent_p.K961K	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4576					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TTGAGTTGAAGAAACTTTATT	0.488																																																	0													131.0	135.0	134.0					14																	64593336		2203	4300	6503	SO:0001819	synonymous_variant	23224			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.13728G>A	14.37:g.64593336G>A			Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.K4576	ENST00000344113.4	37	c.13728	CCDS41963.1	14																																																																																			SYNE2	-	NULL		0.488	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	G	NM_182914		64593336	+1	no_errors	ENST00000358025	ensembl	human	known	70_37	silent	SNP	1.000	A
SYT14	255928	genome.wustl.edu	37	1	210194437	210194437	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:210194437G>A	ENST00000472886.1	+	4	294	c.280G>A	c.(280-282)Gaa>Aaa	p.E94K	SYT14_ENST00000367019.1_Missense_Mutation_p.E94K|SYT14_ENST00000534859.1_Missense_Mutation_p.E94K|SYT14_ENST00000367015.1_Missense_Mutation_p.E56K|SYT14_ENST00000271745.7_3'UTR|SYT14_ENST00000537238.1_Missense_Mutation_p.E56K|SYT14_ENST00000399639.2_Missense_Mutation_p.E94K|SYT14_ENST00000422431.1_Missense_Mutation_p.E139K			Q8NB59	SYT14_HUMAN	synaptotagmin XIV	94					cell death (GO:0008219)	integral component of membrane (GO:0016021)	phospholipid binding (GO:0005543)			endometrium(4)|large_intestine(11)|lung(17)|ovary(1)|prostate(1)|skin(3)	37				OV - Ovarian serous cystadenocarcinoma(81;0.085)		AAGTGAAGATGAAGCGCTGGG	0.393																																																	0													119.0	111.0	113.0					1																	210194437		2203	4300	6503	SO:0001583	missense	255928			AK091517	CCDS31014.1, CCDS53470.1, CCDS58058.1	1q32.2	2013-01-21			ENSG00000143469	ENSG00000143469		"""Synaptotagmins"""	23143	protein-coding gene	gene with protein product		610949					Standard	NM_001256006		Approved	sytXIV, FLJ34198	uc001hhs.5	Q8NB59	OTTHUMG00000036652	ENST00000472886.1:c.280G>A	1.37:g.210194437G>A	ENSP00000418901:p.Glu94Lys		B1AJU0|B1AJU1|F5H426|Q5THX7|Q707N3|Q707N4|Q707N5|Q707N6|Q707N7	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.E139K	ENST00000472886.1	37	c.415	CCDS31014.1	1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.029333	0.93518	.	.	ENSG00000143469	ENST00000422431;ENST00000534859;ENST00000399639;ENST00000537238;ENST00000367019;ENST00000472886;ENST00000367015	T;T;T;T;T;T;T	0.25250	2.93;2.78;1.81;3.04;2.81;3.07;3.04	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.46946	0.1419	L	0.47716	1.5	0.80722	D	1	D;D;D;D	0.76494	0.988;0.999;0.996;0.988	P;D;D;P	0.73708	0.761;0.922;0.981;0.778	T	0.38824	-0.9643	10	0.72032	D	0.01	-13.2581	19.5011	0.95095	0.0:0.0:1.0:0.0	.	122;94;94;139	A1L3Y1;Q8NB59;Q8NB59-6;F5H426	.;SYT14_HUMAN;.;.	K	139;94;94;56;94;94;56	ENSP00000389039:E139K;ENSP00000442891:E94K;ENSP00000445837:E94K;ENSP00000437423:E56K;ENSP00000355986:E94K;ENSP00000418901:E94K;ENSP00000355982:E56K	ENSP00000355982:E56K	E	+	1	0	SYT14	208261060	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.054000	0.89451	2.687000	0.91594	0.650000	0.86243	GAA	SYT14	-	NULL		0.393	SYT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT14	HGNC	protein_coding	OTTHUMT00000089124.1	G	NM_153262		210194437	+1	no_errors	ENST00000422431	ensembl	human	known	70_37	missense	SNP	1.000	A
SYT3	84258	genome.wustl.edu	37	19	51133404	51133404	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:51133404G>A	ENST00000338916.4	-	3	1332	c.699C>T	c.(697-699)ctC>ctT	p.L233L	SYT3_ENST00000544769.1_Silent_p.L233L|SYT3_ENST00000600079.1_Silent_p.L233L|SYT3_ENST00000593901.1_Silent_p.L233L	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	233					calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		TCTGCTGGGTGAGGGGTCGGG	0.642																																																	0													15.0	16.0	16.0					19																	51133404		2202	4295	6497	SO:0001819	synonymous_variant	84258			AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.699C>T	19.37:g.51133404G>A			Q8N5Z1|Q8N640	Silent	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_Synaptotagmin,prints_C2_dom	p.L233	ENST00000338916.4	37	c.699	CCDS12798.1	19																																																																																			SYT3	-	NULL		0.642	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SYT3	HGNC	protein_coding	OTTHUMT00000464910.1	G	NM_032298		51133404	-1	no_errors	ENST00000338916	ensembl	human	known	70_37	silent	SNP	1.000	A
TAF1L	138474	genome.wustl.edu	37	9	32631089	32631089	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr9:32631089C>T	ENST00000242310.4	-	1	4578	c.4489G>A	c.(4489-4491)Gat>Aat	p.D1497N	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1497					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		AGTTTTTCATCACAGAGATCC	0.408																																																	0													185.0	173.0	177.0					9																	32631089		2203	4300	6503	SO:0001583	missense	138474			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.4489G>A	9.37:g.32631089C>T	ENSP00000418379:p.Asp1497Asn		Q0VG57	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.D1497N	ENST00000242310.4	37	c.4489	CCDS35003.1	9	.	.	.	.	.	.	.	.	.	.	C	14.78	2.637167	0.47049	.	.	ENSG00000122728	ENST00000242310	T	0.18016	2.24	0.489	0.489	0.16854	Bromodomain (3);	0.098105	0.64402	D	0.000002	T	0.08670	0.0215	N	0.22421	0.69	0.37761	D	0.926339	B	0.15930	0.015	B	0.15052	0.012	T	0.25984	-1.0116	10	0.16420	T	0.52	.	6.7111	0.23278	0.0:0.9999:0.0:1.0E-4	.	1497	Q8IZX4	TAF1L_HUMAN	N	1497	ENSP00000418379:D1497N	ENSP00000418379:D1497N	D	-	1	0	TAF1L	32621089	1.000000	0.71417	0.993000	0.49108	0.433000	0.31745	4.506000	0.60428	0.514000	0.28300	0.205000	0.17691	GAT	TAF1L	-	pirsf_TAF1_animal,superfamily_Bromodomain,smart_Bromodomain		0.408	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2	C			32631089	-1	no_errors	ENST00000242310	ensembl	human	known	70_37	missense	SNP	1.000	T
TAF1L	138474	genome.wustl.edu	37	9	32631755	32631755	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr9:32631755C>G	ENST00000242310.4	-	1	3912	c.3823G>C	c.(3823-3825)Gag>Cag	p.E1275Q	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1275					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TCAGGACGCTCTTTCATTTTC	0.483																																																	0													115.0	113.0	114.0					9																	32631755		2203	4300	6503	SO:0001583	missense	138474			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.3823G>C	9.37:g.32631755C>G	ENSP00000418379:p.Glu1275Gln		Q0VG57	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.E1275Q	ENST00000242310.4	37	c.3823	CCDS35003.1	9	.	.	.	.	.	.	.	.	.	.	C	13.74	2.327843	0.41197	.	.	ENSG00000122728	ENST00000242310	T	0.09163	3.01	1.56	1.56	0.23342	.	0.096378	0.64402	D	0.000001	T	0.05777	0.0151	N	0.19112	0.55	0.45403	D	0.998383	B	0.25955	0.138	B	0.24269	0.052	T	0.39542	-0.9609	10	0.14252	T	0.57	.	8.618	0.33845	0.0:1.0:0.0:0.0	.	1275	Q8IZX4	TAF1L_HUMAN	Q	1275	ENSP00000418379:E1275Q	ENSP00000418379:E1275Q	E	-	1	0	TAF1L	32621755	1.000000	0.71417	0.530000	0.27963	0.410000	0.31052	5.096000	0.64535	0.507000	0.28148	0.195000	0.17529	GAG	TAF1L	-	pirsf_TAF1_animal		0.483	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2	C			32631755	-1	no_errors	ENST00000242310	ensembl	human	known	70_37	missense	SNP	1.000	G
TAF1L	138474	genome.wustl.edu	37	9	32634881	32634881	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr9:32634881C>T	ENST00000242310.4	-	1	786	c.697G>A	c.(697-699)Ggg>Agg	p.G233R	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	233					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TGCATAATCCCAGCCAATGGA	0.463																																																	0													137.0	125.0	129.0					9																	32634881		2203	4300	6503	SO:0001583	missense	138474			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.697G>A	9.37:g.32634881C>T	ENSP00000418379:p.Gly233Arg		Q0VG57	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.G233R	ENST00000242310.4	37	c.697	CCDS35003.1	9	.	.	.	.	.	.	.	.	.	.	C	10.27	1.305016	0.23736	.	.	ENSG00000122728	ENST00000242310	T	0.08370	3.1	1.04	1.04	0.20106	.	0.000000	0.85682	D	0.000000	T	0.08714	0.0216	M	0.67953	2.075	0.50467	D	0.999872	P	0.37824	0.609	B	0.34590	0.186	T	0.17531	-1.0366	10	0.38643	T	0.18	.	7.4859	0.27432	0.0:1.0:0.0:0.0	.	233	Q8IZX4	TAF1L_HUMAN	R	233	ENSP00000418379:G233R	ENSP00000418379:G233R	G	-	1	0	TAF1L	32624881	1.000000	0.71417	0.455000	0.27031	0.134000	0.20937	4.928000	0.63447	0.507000	0.28148	0.195000	0.17529	GGG	TAF1L	-	pirsf_TAF1_animal		0.463	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2	C			32634881	-1	no_errors	ENST00000242310	ensembl	human	known	70_37	missense	SNP	1.000	T
TAP2	6891	genome.wustl.edu	37	6	32798442	32798442	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr6:32798442C>T	ENST00000452392.2	-	8	1587	c.1414G>A	c.(1414-1416)Gac>Aac	p.D472N	TAP2_ENST00000374897.2_Missense_Mutation_p.D472N|TAP2_ENST00000374899.4_Missense_Mutation_p.D472N|TAP2_ENST00000485701.1_5'Flank			Q9UDX4	S14L3_HUMAN	transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)	25						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)									Vitamin E(DB00163)	AAGGAGACGTCTTGGAATTTC	0.547																																																	0													72.0	65.0	68.0					6																	32798442		1511	2709	4220	SO:0001583	missense	6891			M74447	CCDS4755.1	6p21.3	2014-09-17			ENSG00000204267	ENSG00000204267		"""ATP binding cassette transporters / subfamily B"""	44	protein-coding gene	gene with protein product		170261		ABCB3		1529427, 1946428, 16395595	Standard	NM_001290043		Approved	PSF2, RING11, D6S217E	uc003ocd.3	Q03519	OTTHUMG00000031068	ENST00000452392.2:c.1414G>A	6.37:g.32798442C>T	ENSP00000391806:p.Asp472Asn		E7EN74|E9PE57|Q495V8|Q495W0|Q495W1	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,prints_ABC_B3,prints_ABC_B2,tigrfam_Ag_transporter2	p.D472N	ENST00000452392.2	37	c.1414		6	.	.	.	.	.	.	.	.	.	.	C	3.228	-0.158065	0.06544	.	.	ENSG00000204267;ENSG00000204267;ENSG00000204267;ENSG00000250264	ENST00000556934;ENST00000374899;ENST00000374897;ENST00000452392	D;D;D	0.89939	-2.59;-2.59;-2.59	5.48	3.61	0.41365	ABC transporter-like (1);	0.313497	0.27004	N	0.021406	T	0.60907	0.2305	L	0.28458	0.855	0.27620	N	0.948395	B;B;B;B	0.09022	0.002;0.001;0.001;0.001	B;B;B;B	0.12156	0.007;0.003;0.003;0.003	T	0.42137	-0.9469	9	0.02654	T	1	-25.5439	7.583	0.27976	0.0:0.7256:0.0:0.2744	.	472;473;472;472	E7ENX8;Q59H06;Q03519;Q9UP03	.;.;TAP2_HUMAN;.	N	472	ENSP00000364034:D472N;ENSP00000364032:D472N;ENSP00000391806:D472N	ENSP00000364032:D472N	D	-	1	0	XXbac-BPG246D15.9;TAP2	32906420	0.000000	0.05858	0.006000	0.13384	0.239000	0.25481	-0.140000	0.10342	0.598000	0.29829	0.643000	0.83706	GAC	TAP2	-	pfscan_ABC_transporter-like,tigrfam_Ag_transporter2		0.547	TAP2-001	NOVEL	mRNA_end_NF|cds_end_NF|basic|appris_principal|readthrough_transcript|exp_conf	protein_coding	TAP2	HGNC	protein_coding	OTTHUMT00000361828.1	C	NM_000544		32798442	-1	no_errors	ENST00000374897	ensembl	human	known	70_37	missense	SNP	0.028	T
TBC1D10A	83874	genome.wustl.edu	37	22	30714650	30714650	+	Intron	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr22:30714650C>T	ENST00000215790.7	-	1	374				TBC1D10A_ENST00000403477.3_Intron|TBC1D10A_ENST00000490449.1_Intron	NM_031937.2	NP_114143.1	Q9BXI6	TB10A_HUMAN	TBC1 domain family, member 10A						activation of cysteine-type endopeptidase activity (GO:0097202)|positive regulation of proteolysis (GO:0045862)|retrograde transport, endosome to Golgi (GO:0042147)	extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rab GTPase activator activity (GO:0005097)			cervix(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	23						CTTCCTACCTCTCCATCAGCC	0.547																																																	0																																										SO:0001627	intron_variant	83874			AF331038	CCDS13874.1, CCDS56227.1	22q12.2	2013-07-09	2005-03-10	2005-03-10	ENSG00000099992	ENSG00000099992			23609	protein-coding gene	gene with protein product	"""EBP50-PDZ interactor of 64 kD"""	610020	"""TBC1 domain family, member 10"""	TBC1D10		11285285, 20404108	Standard	NM_001204240		Approved	EPI64, AC004997.C22.2	uc010gvu.3	Q9BXI6	OTTHUMG00000150924	ENST00000215790.7:c.209+8011G>A	22.37:g.30714650C>T			B3KXT8|O76053|Q20WK7|Q543A2	Silent	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.E2	ENST00000215790.7	37	c.6	CCDS13874.1	22																																																																																			TBC1D10A	-	NULL		0.547	TBC1D10A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TBC1D10A	HGNC	protein_coding	OTTHUMT00000320550.1	C	NM_031937		30714650	-1	no_errors	ENST00000433426	ensembl	human	known	70_37	silent	SNP	0.004	T
TBC1D17	79735	genome.wustl.edu	37	19	50386048	50386048	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:50386048G>A	ENST00000221543.5	+	8	1125	c.826G>A	c.(826-828)Gag>Aag	p.E276K	TBC1D17_ENST00000535102.2_Missense_Mutation_p.E243K	NM_024682.2	NP_078958	Q9HA65	TBC17_HUMAN	TBC1 domain family, member 17	276	Required for interaction with OPTN.				autophagy (GO:0006914)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	Rab GTPase activator activity (GO:0005097)			NS(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	15		all_lung(116;0.000338)|Lung NSC(112;0.000446)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.017)		GCCAACCGTGGAGCGGGGCCC	0.672																																																	0													18.0	21.0	20.0					19																	50386048		2202	4295	6497	SO:0001583	missense	79735			AK090606	CCDS12785.1, CCDS54294.1	19q13.33	2013-07-09				ENSG00000104946			25699	protein-coding gene	gene with protein product						22854040	Standard	NM_024682		Approved	FLJ12168	uc002pqo.3	Q9HA65		ENST00000221543.5:c.826G>A	19.37:g.50386048G>A	ENSP00000221543:p.Glu276Lys		B4DT12|B9A6L8|F5H1W7	Missense_Mutation	SNP	pfam_DUF3548,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.E276K	ENST00000221543.5	37	c.826	CCDS12785.1	19	.	.	.	.	.	.	.	.	.	.	G	1.250	-0.618853	0.03663	.	.	ENSG00000104946	ENST00000221543;ENST00000535102	T;T	0.09445	2.98;2.99	4.89	0.0328	0.14177	.	1.002150	0.08037	N	0.994445	T	0.07279	0.0184	L	0.41632	1.29	0.28179	N	0.92825	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.44772	-0.9306	10	0.16896	T	0.51	-12.876	1.4896	0.02454	0.2372:0.139:0.4661:0.1577	.	243;276	F5H1W7;Q9HA65	.;TBC17_HUMAN	K	276;243	ENSP00000221543:E276K;ENSP00000446323:E243K	ENSP00000221543:E276K	E	+	1	0	TBC1D17	55077860	0.988000	0.35896	0.997000	0.53966	0.078000	0.17371	0.988000	0.29616	0.271000	0.22005	-0.291000	0.09656	GAG	TBC1D17	-	NULL		0.672	TBC1D17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D17	HGNC	protein_coding	OTTHUMT00000466404.1	G	NM_024682		50386048	+1	no_errors	ENST00000221543	ensembl	human	known	70_37	missense	SNP	0.649	A
TCEB3	6924	genome.wustl.edu	37	1	24082354	24082354	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:24082354C>T	ENST00000418390.2	+	8	2162	c.1891C>T	c.(1891-1893)Caa>Taa	p.Q631*	TCEB3_ENST00000609199.1_Nonsense_Mutation_p.Q605*	NM_003198.2	NP_003189.2	Q14241	ELOA1_HUMAN	transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)	631	Activation domain. {ECO:0000250}.|F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.42e-24)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;4.74e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|KIRC - Kidney renal clear cell carcinoma(1967;0.00334)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		AGAAACAGATCAATTATGGAA	0.408																																																	0													70.0	71.0	71.0					1																	24082354		2203	4300	6503	SO:0001587	stop_gained	6924			L47345	CCDS239.2	1p36.1	2010-06-22	2002-08-29		ENSG00000011007	ENSG00000011007			11620	protein-coding gene	gene with protein product		600786	"""transcription elongation factor B (SIII), polypeptide 3 (110kD, elongin A)"""			8586449, 7660129	Standard	NM_003198		Approved	SIII, TCEB3A	uc001bho.3	Q14241	OTTHUMG00000002957	ENST00000418390.2:c.1891C>T	1.37:g.24082354C>T	ENSP00000395574:p.Gln631*		B2R7Q8|Q8IXH1	Nonsense_Mutation	SNP	pfam_RNA_pol_II_trans_fac_SIII_A,pfam_TFIIS_N,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub,pfscan_F-box_dom_cyclin-like	p.Q631*	ENST00000418390.2	37	c.1891	CCDS239.2	1	.	.	.	.	.	.	.	.	.	.	C	41	8.713166	0.98925	.	.	ENSG00000011007	ENST00000418390	.	.	.	5.51	5.51	0.81932	.	0.000000	0.56097	D	0.000024	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	-19.4828	19.782	0.96420	0.0:1.0:0.0:0.0	.	.	.	.	X	631	.	ENSP00000395574:Q631X	Q	+	1	0	TCEB3	23954941	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.090000	0.57693	2.757000	0.94681	0.462000	0.41574	CAA	TCEB3	-	pfam_RNA_pol_II_trans_fac_SIII_A,pfscan_F-box_dom_cyclin-like		0.408	TCEB3-001	KNOWN	basic|CCDS	protein_coding	TCEB3	HGNC	protein_coding	OTTHUMT00000008230.2	C	NM_003198		24082354	+1	no_errors	ENST00000418390	ensembl	human	known	70_37	nonsense	SNP	1.000	T
TCF20	6942	genome.wustl.edu	37	22	42605914	42605914	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr22:42605914G>A	ENST00000359486.3	-	1	5534	c.5398C>T	c.(5398-5400)Cgg>Tgg	p.R1800W	TCF20_ENST00000404876.1_Missense_Mutation_p.R101W|TCF20_ENST00000335626.4_Missense_Mutation_p.R1800W	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	1800					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						GACAGGGACCGAGGGCCTCCA	0.612																																																	0													61.0	68.0	66.0					22																	42605914		2203	4300	6503	SO:0001583	missense	6942			U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.5398C>T	22.37:g.42605914G>A	ENSP00000352463:p.Arg1800Trp		A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	smart_Znf_PHD	p.R1800W	ENST00000359486.3	37	c.5398	CCDS14033.1	22	.	.	.	.	.	.	.	.	.	.	G	18.91	3.722746	0.68959	.	.	ENSG00000100207	ENST00000359486;ENST00000335626;ENST00000404876	T;T;T	0.72394	-0.26;-0.26;-0.65	6.07	6.07	0.98685	.	0.091019	0.48286	D	0.000199	T	0.81917	0.4924	L	0.54323	1.7	0.47374	D	0.999403	D;D	0.89917	1.0;1.0	D;D	0.70016	0.967;0.928	T	0.82123	-0.0613	10	0.87932	D	0	-24.8661	18.8245	0.92111	0.0:0.0:1.0:0.0	.	1800;1800	Q9UGU0-2;Q9UGU0	.;TCF20_HUMAN	W	1800;1800;101	ENSP00000352463:R1800W;ENSP00000335561:R1800W;ENSP00000385531:R101W	ENSP00000335561:R1800W	R	-	1	2	TCF20	40935858	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.827000	0.55745	2.884000	0.98904	0.655000	0.94253	CGG	TCF20	-	NULL		0.612	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF20	HGNC	protein_coding	OTTHUMT00000320531.1	G	NM_181492		42605914	-1	no_errors	ENST00000359486	ensembl	human	known	70_37	missense	SNP	1.000	A
TDRD1	56165	genome.wustl.edu	37	10	115947675	115947675	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr10:115947675G>C	ENST00000369280.1	+	2	545	c.85G>C	c.(85-87)Gag>Cag	p.E29Q	TDRD1_ENST00000369282.1_Missense_Mutation_p.E29Q|TDRD1_ENST00000369281.2_Missense_Mutation_p.E29Q|TDRD1_ENST00000422662.1_5'UTR|TDRD1_ENST00000251864.2_Missense_Mutation_p.E29Q			Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	29					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		ATTTAATTTTGAGAAAAATGA	0.393																																																	0													99.0	106.0	104.0					10																	115947675		2203	4299	6502	SO:0001583	missense	56165			AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000369280.1:c.85G>C	10.37:g.115947675G>C	ENSP00000358286:p.Glu29Gln		A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Missense_Mutation	SNP	pfam_Tudor,pfam_Znf_MYND,smart_Tudor,pfscan_Tudor,pfscan_Znf_MYND	p.E29Q	ENST00000369280.1	37	c.85		10	.	.	.	.	.	.	.	.	.	.	G	17.63	3.436146	0.62955	.	.	ENSG00000095627	ENST00000369282;ENST00000251864;ENST00000369281;ENST00000369280	T;T;T;T	0.58652	0.32;0.32;0.32;0.32	5.58	3.7	0.42460	.	0.193522	0.36555	N	0.002534	T	0.59404	0.2191	L	0.32530	0.975	0.80722	D	1	D;D;D;D	0.65815	0.991;0.991;0.995;0.995	P;P;D;D	0.64144	0.837;0.837;0.922;0.922	T	0.61426	-0.7065	10	0.87932	D	0	-16.0067	6.9461	0.24520	0.0916:0.1772:0.7312:0.0	.	29;29;29;29	Q9BXT4;B7WPM2;Q9BXT4-3;Q9BXT4-2	TDRD1_HUMAN;.;.;.	Q	29	ENSP00000358288:E29Q;ENSP00000251864:E29Q;ENSP00000358287:E29Q;ENSP00000358286:E29Q	ENSP00000251864:E29Q	E	+	1	0	TDRD1	115937665	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	2.716000	0.47219	1.345000	0.45676	0.563000	0.77884	GAG	TDRD1	-	NULL		0.393	TDRD1-001	KNOWN	basic	protein_coding	TDRD1	HGNC	protein_coding	OTTHUMT00000050457.2	G			115947675	+1	no_errors	ENST00000251864	ensembl	human	known	70_37	missense	SNP	1.000	C
TECTA	7007	genome.wustl.edu	37	11	121031101	121031101	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr11:121031101G>A	ENST00000392793.1	+	15	5218	c.4947G>A	c.(4945-4947)caG>caA	p.Q1649Q	TECTA_ENST00000264037.2_Silent_p.Q1649Q			O75443	TECTA_HUMAN	tectorin alpha	1649	VWFD 4. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		TGCTGGCCCAGAGCTGGAAAA	0.542																																																	0													124.0	120.0	121.0					11																	121031101		2203	4299	6502	SO:0001819	synonymous_variant	7007			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.4947G>A	11.37:g.121031101G>A				Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_ZP_dom,pfam_Nidogen_extracell_dom,pfam_TIL_dom,superfamily_TIL_dom,smart_Nidogen_extracell_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_ZP_dom,pfscan_ZP_dom	p.Q1649	ENST00000392793.1	37	c.4947	CCDS8434.1	11																																																																																			TECTA	-	NULL		0.542	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TECTA	HGNC	protein_coding	OTTHUMT00000313850.1	G	NM_005422		121031101	+1	no_errors	ENST00000264037	ensembl	human	known	70_37	silent	SNP	1.000	A
TENM1	10178	genome.wustl.edu	37	X	123615768	123615768	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chrX:123615768C>T	ENST00000371130.3	-	21	3805	c.3742G>A	c.(3742-3744)Gaa>Aaa	p.E1248K	TENM1_ENST00000461429.1_5'UTR|TENM1_ENST00000422452.2_Missense_Mutation_p.E1255K	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1248					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TAGAGTGATTCAGACACAGGG	0.418																																																	0													128.0	112.0	117.0					X																	123615768		2203	4300	6503	SO:0001583	missense	10178			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.3742G>A	X.37:g.123615768C>T	ENSP00000360171:p.Glu1248Lys		B2RTR5|Q5JZ17	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD	p.E1255K	ENST00000371130.3	37	c.3763	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	C	34	5.318289	0.95682	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.90197	-2.63;-2.63	5.16	5.16	0.70880	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.92586	0.7645	L	0.34521	1.04	0.80722	D	1	D;D;D	0.67145	0.996;0.993;0.972	D;P;P	0.70227	0.968;0.787;0.632	D	0.93834	0.7130	10	0.87932	D	0	.	17.774	0.88502	0.0:1.0:0.0:0.0	.	1254;1255;1248	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	K	1248;1255	ENSP00000360171:E1248K;ENSP00000403954:E1255K	ENSP00000360171:E1248K	E	-	1	0	ODZ1	123443449	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	6.087000	0.71362	2.128000	0.65567	0.600000	0.82982	GAA	TENM1	-	NULL		0.418	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM1	HGNC	protein_coding	OTTHUMT00000058985.1	C	NM_014253		123615768	-1	no_errors	ENST00000422452	ensembl	human	known	70_37	missense	SNP	1.000	T
TEX14	56155	genome.wustl.edu	37	17	56661914	56661914	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:56661914C>A	ENST00000240361.8	-	19	3221	c.3136G>T	c.(3136-3138)Gaa>Taa	p.E1046*	TEX14_ENST00000349033.5_Nonsense_Mutation_p.E1040*|TEX14_ENST00000389934.3_Nonsense_Mutation_p.E1040*			Q8IWB6	TEX14_HUMAN	testis expressed 14	1046					attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)			breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TGGAAGGCTTCACTATGCTCT	0.428																																																	0													204.0	172.0	183.0					17																	56661914		2203	4300	6503	SO:0001587	stop_gained	56155			AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.3136G>T	17.37:g.56661914C>A	ENSP00000240361:p.Glu1046*		A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Nonsense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_cat_dom	p.E1046*	ENST00000240361.8	37	c.3136	CCDS56042.1	17	.	.	.	.	.	.	.	.	.	.	C	36	5.907649	0.97093	.	.	ENSG00000121101	ENST00000240361;ENST00000389934;ENST00000349033	.	.	.	4.62	3.64	0.41730	.	0.532293	0.18520	N	0.138788	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-6.5902	11.0412	0.47831	0.0:0.8114:0.1886:0.0	.	.	.	.	X	1046;1040;1040	.	ENSP00000240361:E1046X	E	-	1	0	TEX14	54016913	0.181000	0.23161	0.858000	0.33744	0.359000	0.29487	1.363000	0.34159	1.053000	0.40415	0.455000	0.32223	GAA	TEX14	-	NULL		0.428	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TEX14	HGNC	protein_coding	OTTHUMT00000445446.1	C			56661914	-1	no_errors	ENST00000240361	ensembl	human	known	70_37	nonsense	SNP	0.479	A
TEX14	56155	genome.wustl.edu	37	17	56679877	56679877	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:56679877C>T	ENST00000240361.8	-	12	1514	c.1429G>A	c.(1429-1431)Gat>Aat	p.D477N	TEX14_ENST00000349033.5_Missense_Mutation_p.D471N|TEX14_ENST00000389934.3_Missense_Mutation_p.D471N			Q8IWB6	TEX14_HUMAN	testis expressed 14	477	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)			breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AGCCTGACATCAGCTTCTAAA	0.408																																																	0													101.0	93.0	96.0					17																	56679877		2203	4300	6503	SO:0001583	missense	56155			AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.1429G>A	17.37:g.56679877C>T	ENSP00000240361:p.Asp477Asn		A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_cat_dom	p.D477N	ENST00000240361.8	37	c.1429	CCDS56042.1	17	.	.	.	.	.	.	.	.	.	.	C	26.2	4.711998	0.89112	.	.	ENSG00000121101	ENST00000240361;ENST00000389934;ENST00000349033	D;D;D	0.82255	-1.59;-1.59;-1.59	5.64	5.64	0.86602	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.168320	0.41605	D	0.000851	D	0.90597	0.7052	M	0.73598	2.24	0.44048	D	0.996785	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.80764	0.993;0.994;0.994	D	0.90200	0.4256	10	0.51188	T	0.08	-19.5586	16.78	0.85561	0.0:1.0:0.0:0.0	.	477;471;471	Q8IWB6;Q8IWB6-3;Q8IWB6-2	TEX14_HUMAN;.;.	N	477;471;471	ENSP00000240361:D477N;ENSP00000374584:D471N;ENSP00000268910:D471N	ENSP00000240361:D477N	D	-	1	0	TEX14	54034876	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	4.947000	0.63583	2.816000	0.96949	0.563000	0.77884	GAT	TEX14	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.408	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TEX14	HGNC	protein_coding	OTTHUMT00000445446.1	C			56679877	-1	no_errors	ENST00000240361	ensembl	human	known	70_37	missense	SNP	1.000	T
TFCP2	7024	genome.wustl.edu	37	12	51503033	51503033	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr12:51503033G>T	ENST00000257915.5	-	6	1046	c.588C>A	c.(586-588)ttC>ttA	p.F196L	TFCP2_ENST00000549867.1_Missense_Mutation_p.F196L|TFCP2_ENST00000307660.4_Intron|TFCP2_ENST00000548115.1_Intron	NM_001173452.1|NM_005653.4	NP_001166923.1|NP_005644.2	Q12800	TFCP2_HUMAN	transcription factor CP2	196	DNA-binding.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)	23						TCCTCATAGTGAACTCTGTGC	0.423																																																	0													138.0	127.0	131.0					12																	51503033		2203	4300	6503	SO:0001583	missense	7024			U03494	CCDS8808.1, CCDS55827.1	12q13	2004-01-05				ENSG00000135457			11748	protein-coding gene	gene with protein product		189889				8157699	Standard	NM_005653		Approved	CP2, LSF, LBP-1C, TFCP2C	uc001rxw.3	Q12800	OTTHUMG00000169621	ENST00000257915.5:c.588C>A	12.37:g.51503033G>T	ENSP00000257915:p.Phe196Leu		A8K5E9|Q12801|Q9UD75|Q9UD77	Missense_Mutation	SNP	pfam_CP2,superfamily_SAM/pointed	p.F196L	ENST00000257915.5	37	c.588	CCDS8808.1	12	.	.	.	.	.	.	.	.	.	.	G	23.8	4.454542	0.84209	.	.	ENSG00000135457	ENST00000257915;ENST00000549867;ENST00000548108	T;T;T	0.47528	0.84;0.84;0.84	5.61	2.73	0.32206	CP2 transcription factor (1);	0.000000	0.85682	D	0.000000	T	0.71065	0.3296	M	0.91561	3.22	0.80722	D	1	P;D;D	0.65815	0.823;0.995;0.968	P;D;D	0.74674	0.686;0.984;0.928	T	0.73414	-0.3990	10	0.87932	D	0	-14.9154	9.8296	0.40932	0.2282:0.0:0.7718:0.0	.	196;196;196	F8VX55;Q12800;Q12800-4	.;TFCP2_HUMAN;.	L	196;196;98	ENSP00000257915:F196L;ENSP00000449742:F196L;ENSP00000449280:F98L	ENSP00000257915:F196L	F	-	3	2	TFCP2	49789300	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	0.936000	0.28938	0.385000	0.24970	0.655000	0.94253	TTC	TFCP2	-	pfam_CP2		0.423	TFCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFCP2	HGNC	protein_coding	OTTHUMT00000405119.1	G	NM_005653		51503033	-1	no_errors	ENST00000257915	ensembl	human	known	70_37	missense	SNP	1.000	T
TFPI2	7980	genome.wustl.edu	37	7	93519512	93519512	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr7:93519512C>T	ENST00000222543.5	-	2	520	c.208G>A	c.(208-210)Gag>Aag	p.E70K	AC002076.10_ENST00000435257.1_RNA|TFPI2_ENST00000545378.1_Missense_Mutation_p.E70K|GNGT1_ENST00000455502.1_Intron	NM_001271003.1|NM_001271004.1|NM_006528.3	NP_001257932.1|NP_001257933.1|NP_006519.1	P48307	TFPI2_HUMAN	tissue factor pathway inhibitor 2	70	BPTI/Kunitz inhibitor 1. {ECO:0000255|PROSITE-ProRule:PRU00031}.				blood coagulation (GO:0007596)	nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(1)|large_intestine(5)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	all_cancers(62;4.45e-10)|all_epithelial(64;2.92e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)			GCGTTGCCCTCGCAGCCCCCG	0.612																																																	0													36.0	39.0	38.0					7																	93519512		2203	4300	6503	SO:0001583	missense	7980			L27624	CCDS5632.1	7q	2008-07-18			ENSG00000105825	ENSG00000105825			11761	protein-coding gene	gene with protein product		600033				7896752, 8945635	Standard	NM_006528		Approved	PP5, TFPI-2, REF1	uc003umy.2	P48307	OTTHUMG00000022963	ENST00000222543.5:c.208G>A	7.37:g.93519512C>T	ENSP00000222543:p.Glu70Lys		Q66ME8|Q8NAK6|Q9UC86	Missense_Mutation	SNP	pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,pirsf_Prot_inhib_I2_TFPI,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.E70K	ENST00000222543.5	37	c.208	CCDS5632.1	7	.	.	.	.	.	.	.	.	.	.	C	9.794	1.178662	0.21787	.	.	ENSG00000105825	ENST00000222543;ENST00000545378	T;T	0.56776	0.44;0.44	5.07	-4.44	0.03557	Proteinase inhibitor I2, Kunitz metazoa (6);Proteinase inhibitor I2, Kunitz, conserved site (1);	1.247540	0.04985	N	0.466269	T	0.23492	0.0568	L	0.29908	0.895	0.20873	N	0.999834	P;B;P;B	0.43314	0.694;0.005;0.803;0.005	B;B;B;B	0.26770	0.073;0.009;0.064;0.009	T	0.29305	-1.0016	10	0.05833	T	0.94	.	3.3856	0.07270	0.2546:0.2497:0.3719:0.1238	.	41;59;70;70	A4ZVU7;Q8NAK6;F5H3J8;P48307	.;.;.;TFPI2_HUMAN	K	70	ENSP00000222543:E70K;ENSP00000438861:E70K	ENSP00000222543:E70K	E	-	1	0	TFPI2	93357448	0.001000	0.12720	0.127000	0.21898	0.640000	0.38277	-0.769000	0.04710	-0.886000	0.03966	0.313000	0.20887	GAG	TFPI2	-	pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,pirsf_Prot_inhib_I2_TFPI,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m		0.612	TFPI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFPI2	HGNC	protein_coding	OTTHUMT00000254720.2	C	NM_006528		93519512	-1	no_errors	ENST00000222543	ensembl	human	known	70_37	missense	SNP	0.089	T
THAP7	80764	genome.wustl.edu	37	22	21354544	21354544	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr22:21354544C>T	ENST00000215742.4	-	4	729	c.555G>A	c.(553-555)caG>caA	p.Q185Q	THAP7-AS1_ENST00000436079.1_RNA|THAP7-AS1_ENST00000452284.1_RNA|THAP7-AS1_ENST00000429962.1_RNA|THAP7_ENST00000399133.2_Silent_p.Q185Q	NM_030573.2	NP_085050.2	Q9BT49	THAP7_HUMAN	THAP domain containing 7	185					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nuclear speck (GO:0016607)	C2H2 zinc finger domain binding (GO:0070742)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)			cervix(1)|lung(2)|prostate(3)|skin(1)|stomach(1)	8	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CTTCATCTGCCTGGGCACCCA	0.672																																																	0													6.0	7.0	7.0					22																	21354544		2147	4198	6345	SO:0001819	synonymous_variant	80764			BC004346	CCDS13787.1	22q11.2	2013-01-25			ENSG00000184436	ENSG00000184436		"""THAP (C2CH-type zinc finger) domain containing"""	23190	protein-coding gene	gene with protein product		609518				12575992	Standard	NM_030573		Approved	MGC10963	uc002ztr.1	Q9BT49	OTTHUMG00000150879	ENST00000215742.4:c.555G>A	22.37:g.21354544C>T			B2RD97|D3DX40	Silent	SNP	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.Q185	ENST00000215742.4	37	c.555	CCDS13787.1	22																																																																																			THAP7	-	NULL		0.672	THAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP7	HGNC	protein_coding	OTTHUMT00000320405.1	C	NM_030573		21354544	-1	no_errors	ENST00000215742	ensembl	human	known	70_37	silent	SNP	0.994	T
TMEM145	284339	genome.wustl.edu	37	19	42820703	42820703	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:42820703G>A	ENST00000301204.3	+	9	758	c.717G>A	c.(715-717)gtG>gtA	p.V239V	TMEM145_ENST00000598766.1_Silent_p.V263V	NM_173633.2	NP_775904.2	Q8NBT3	TM145_HUMAN	transmembrane protein 145	239					G-protein coupled receptor signaling pathway (GO:0007186)|response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	27		Prostate(69;0.00682)				ACGAGAGTGTGAAGATCTTGG	0.577																																																	0													139.0	123.0	129.0					19																	42820703		2203	4300	6503	SO:0001819	synonymous_variant	284339			AK075286	CCDS12603.1	19q13.2	2008-02-05				ENSG00000167619			26912	protein-coding gene	gene with protein product							Standard	NM_173633		Approved	FLJ90805	uc002otk.1	Q8NBT3		ENST00000301204.3:c.717G>A	19.37:g.42820703G>A				Silent	SNP	pfam_Rhodopsin-like_GPCR_TM_domain	p.V239	ENST00000301204.3	37	c.717	CCDS12603.1	19																																																																																			TMEM145	-	pfam_Rhodopsin-like_GPCR_TM_domain		0.577	TMEM145-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM145	HGNC	protein_coding	OTTHUMT00000463737.1	G	NM_173633		42820703	+1	no_errors	ENST00000301204	ensembl	human	known	70_37	silent	SNP	1.000	A
TMEM246	84302	genome.wustl.edu	37	9	104238925	104238925	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr9:104238925C>T	ENST00000374851.1	-	4	1597	c.450G>A	c.(448-450)gtG>gtA	p.V150V	TMEM246_ENST00000374847.1_Silent_p.V150V|RP11-490D19.6_ENST00000425734.1_RNA|RP11-490D19.6_ENST00000431507.1_RNA|RP11-490D19.6_ENST00000424154.1_RNA|RP11-490D19.6_ENST00000450109.1_RNA|TMEM246_ENST00000374848.3_Silent_p.V150V			Q9BRR3	TM246_HUMAN	transmembrane protein 246	150						integral component of membrane (GO:0016021)											CAAAATGGCTCACACTACGCT	0.552																																																	0													102.0	88.0	93.0					9																	104238925		2203	4300	6503	SO:0001819	synonymous_variant	84302			BC006115	CCDS6757.1	9q31.1	2012-04-02	2012-04-02	2012-04-02	ENSG00000165152	ENSG00000165152			28180	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 125"""	C9orf125		12477932	Standard	NM_032342		Approved	MGC12992	uc004bbm.3	Q9BRR3	OTTHUMG00000020381	ENST00000374851.1:c.450G>A	9.37:g.104238925C>T			Q49AQ4	Silent	SNP	NULL	p.V150	ENST00000374851.1	37	c.450	CCDS6757.1	9																																																																																			TMEM246	-	NULL		0.552	TMEM246-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TMEM246	HGNC	protein_coding	OTTHUMT00000053444.1	C	NM_032342		104238925	-1	no_errors	ENST00000374847	ensembl	human	known	70_37	silent	SNP	0.992	T
TMEM42	131616	genome.wustl.edu	37	3	44905835	44905835	+	Splice_Site	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr3:44905835G>A	ENST00000302392.4	+	2	395	c.339G>A	c.(337-339)tcG>tcA	p.S113S	MIR564_ENST00000385049.1_RNA	NM_144638.1	NP_653239.1	Q69YG0	TMM42_HUMAN	transmembrane protein 42	113						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	8				BRCA - Breast invasive adenocarcinoma(193;0.00839)|KIRC - Kidney renal clear cell carcinoma(197;0.0461)|Kidney(197;0.0576)		TCCTCAGCTCGGTGAGTAGCC	0.498																																																	0													124.0	112.0	116.0					3																	44905835		2203	4300	6503	SO:0001630	splice_region_variant	131616			AL834253	CCDS2722.1	3p21.31	2005-01-19			ENSG00000169964	ENSG00000169964			28444	protein-coding gene	gene with protein product						12477932	Standard	NM_144638		Approved	MGC29956	uc003cnz.3	Q69YG0	OTTHUMG00000133092	ENST00000302392.4:c.339+1G>A	3.37:g.44905835G>A			Q8WUQ6	Silent	SNP	NULL	p.S113	ENST00000302392.4	37	c.339	CCDS2722.1	3																																																																																			TMEM42	-	NULL		0.498	TMEM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM42	HGNC	protein_coding	OTTHUMT00000256750.2	G	NM_144638	Silent	44905835	+1	no_errors	ENST00000302392	ensembl	human	known	70_37	silent	SNP	1.000	A
TMOD1	7111	genome.wustl.edu	37	9	100326399	100326399	+	Silent	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr9:100326399G>C	ENST00000259365.4	+	6	780	c.567G>C	c.(565-567)cgG>cgC	p.R189R	TMOD1_ENST00000375175.1_Silent_p.R62R|TMOD1_ENST00000395211.2_Silent_p.R189R	NM_003275.3	NP_003266.1	P28289	TMOD1_HUMAN	tropomodulin 1	189					adult locomotory behavior (GO:0008344)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)	cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|membrane (GO:0016020)|myofibril (GO:0030016)				breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(2)|urinary_tract(1)	11		Acute lymphoblastic leukemia(62;0.154)		STAD - Stomach adenocarcinoma(157;0.105)		CGCTGGAACGGATAAAGAACA	0.468																																																	0													119.0	96.0	104.0					9																	100326399		2203	4300	6503	SO:0001819	synonymous_variant	7111				CCDS6726.1	9q22	2008-07-21		2003-03-21	ENSG00000136842	ENSG00000136842			11871	protein-coding gene	gene with protein product		190930		D9S57E, TMOD		1370827, 8661028	Standard	NM_003275		Approved	ETMOD	uc004axl.2	P28289	OTTHUMG00000020325	ENST00000259365.4:c.567G>C	9.37:g.100326399G>C			B2RB77|Q5T7W3|Q9BUF1	Silent	SNP	pfam_Tropomodulin	p.R189	ENST00000259365.4	37	c.567	CCDS6726.1	9																																																																																			TMOD1	-	NULL		0.468	TMOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMOD1	HGNC	protein_coding	OTTHUMT00000053320.2	G	NM_003275		100326399	+1	no_errors	ENST00000259365	ensembl	human	known	70_37	silent	SNP	0.985	C
TNFRSF6B	8771	genome.wustl.edu	37	20	62328684	62328684	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr20:62328684C>T	ENST00000369996.1	+	2	528	c.428C>T	c.(427-429)aCc>aTc	p.T143I	RTEL1-TNFRSF6B_ENST00000482936.1_3'UTR|ARFRP1_ENST00000485858.1_5'Flank	NM_003823.3	NP_003814.1	O95407	TNF6B_HUMAN	tumor necrosis factor receptor superfamily, member 6b, decoy	143					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	extracellular space (GO:0005615)	receptor activity (GO:0004872)			central_nervous_system(1)|lung(2)|skin(1)	4	all_cancers(38;4.66e-12)|all_epithelial(29;2.56e-13)|Lung NSC(23;1.06e-08)|all_lung(23;3.34e-08)		Epithelial(9;1.78e-08)|all cancers(9;7.89e-08)|OV - Ovarian serous cystadenocarcinoma(5;0.00504)			GCTGCAGGCACCCCCAGCCAG	0.677																																																	0													27.0	27.0	27.0					20																	62328684		2181	4285	6466	SO:0001583	missense	8771			AF104419	CCDS13532.1	20q13.33	2012-06-27						"""Tumor necrosis factor receptor superfamily"""	11921	protein-coding gene	gene with protein product		603361				9872321, 10318773	Standard	NM_003823		Approved	DcR3, DCR3, TR6, M68	uc002yfz.3	O95407	OTTHUMG00000143724	ENST00000369996.1:c.428C>T	20.37:g.62328684C>T	ENSP00000359013:p.Thr143Ile			Missense_Mutation	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg	p.T143I	ENST00000369996.1	37	c.428	CCDS13532.1	20	.	.	.	.	.	.	.	.	.	.	C	16.27	3.076143	0.55646	.	.	ENSG00000243509	ENST00000370006;ENST00000369996	D	0.95103	-3.61	4.2	3.2	0.36748	TNFR/CD27/30/40/95 cysteine-rich region (1);	.	.	.	.	D	0.95092	0.8410	M	0.68952	2.095	0.23309	N	0.997931	D	0.69078	0.997	P	0.57101	0.813	D	0.88227	0.2901	9	0.72032	D	0.01	-27.1048	7.8644	0.29528	0.183:0.6396:0.1774:0.0	.	143	O95407	TNF6B_HUMAN	I	143	ENSP00000359013:T143I	ENSP00000359010:T143I	T	+	2	0	TNFRSF6B	61799128	0.000000	0.05858	0.685000	0.30070	0.016000	0.09150	0.526000	0.22971	0.695000	0.31675	0.561000	0.74099	ACC	TNFRSF6B	-	smart_TNFR/NGFR_Cys_rich_reg		0.677	TNFRSF6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF6B	HGNC	protein_coding	OTTHUMT00000080182.1	C			62328684	+1	no_errors	ENST00000369996	ensembl	human	known	70_37	missense	SNP	0.980	T
TNN	63923	genome.wustl.edu	37	1	175086232	175086232	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:175086232G>A	ENST00000239462.4	+	10	2390	c.2277G>A	c.(2275-2277)caG>caA	p.Q759Q		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	759	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GGAAGGAGCAGAGTAGCACTG	0.647																																																	0													94.0	87.0	89.0					1																	175086232		2203	4300	6503	SO:0001819	synonymous_variant	63923			AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.2277G>A	1.37:g.175086232G>A			B9EGP3|Q5R360	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_Fibronectin_type3	p.Q759	ENST00000239462.4	37	c.2277	CCDS30943.1	1																																																																																			TNN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.647	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNN	HGNC	protein_coding	OTTHUMT00000084422.1	G	XM_040527		175086232	+1	no_errors	ENST00000239462	ensembl	human	known	70_37	silent	SNP	0.637	A
TOPBP1	11073	genome.wustl.edu	37	3	133327481	133327481	+	Missense_Mutation	SNP	C	C	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr3:133327481C>A	ENST00000260810.5	-	27	4454	c.4323G>T	c.(4321-4323)ttG>ttT	p.L1441F		NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	1441	BRCT 8. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						TCAGTTTATTCAAGTCAGAAA	0.388								Other conserved DNA damage response genes																													Ovarian(21;193 658 4424 15423 17362)												0													97.0	88.0	91.0					3																	133327481		1825	4100	5925	SO:0001583	missense	11073			AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.4323G>T	3.37:g.133327481C>A	ENSP00000260810:p.Leu1441Phe		B7Z7W8|Q7LGC1|Q9UEB9	Missense_Mutation	SNP	pfam_BRCT_dom,superfamily_BRCT_dom,superfamily_Secretoglobin,smart_BRCT_dom,pfscan_BRCT_dom	p.L1441F	ENST00000260810.5	37	c.4323	CCDS46919.1	3	.	.	.	.	.	.	.	.	.	.	C	3.519	-0.098210	0.07010	.	.	ENSG00000163781	ENST00000260810	T	0.11495	2.77	5.43	-10.9	0.00192	.	0.274589	0.47852	N	0.000205	T	0.01156	0.0038	N	0.00275	-1.725	0.22873	N	0.998627	B	0.02656	0.0	B	0.01281	0.0	T	0.27536	-1.0071	10	0.02654	T	1	.	5.7254	0.18010	0.1646:0.1725:0.4983:0.1646	.	1441	Q92547	TOPB1_HUMAN	F	1441	ENSP00000260810:L1441F	ENSP00000260810:L1441F	L	-	3	2	TOPBP1	134810171	0.845000	0.29573	0.224000	0.23877	0.970000	0.65996	-0.031000	0.12287	-2.409000	0.00572	-0.976000	0.02587	TTG	TOPBP1	-	superfamily_BRCT_dom		0.388	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOPBP1	HGNC	protein_coding	OTTHUMT00000357254.1	C	NM_007027		133327481	-1	no_errors	ENST00000260810	ensembl	human	known	70_37	missense	SNP	0.732	A
TOPBP1	11073	genome.wustl.edu	37	3	133347213	133347213	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr3:133347213C>T	ENST00000260810.5	-	16	2928	c.2797G>A	c.(2797-2799)Gat>Aat	p.D933N		NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	933	BRCT 6. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						TACCTGTAATCTGCTCCTAGA	0.383								Other conserved DNA damage response genes																													Ovarian(21;193 658 4424 15423 17362)												0													97.0	93.0	95.0					3																	133347213		1886	4116	6002	SO:0001583	missense	11073			AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.2797G>A	3.37:g.133347213C>T	ENSP00000260810:p.Asp933Asn		B7Z7W8|Q7LGC1|Q9UEB9	Missense_Mutation	SNP	pfam_BRCT_dom,superfamily_BRCT_dom,superfamily_Secretoglobin,smart_BRCT_dom,pfscan_BRCT_dom	p.D933N	ENST00000260810.5	37	c.2797	CCDS46919.1	3	.	.	.	.	.	.	.	.	.	.	C	35	5.422583	0.96111	.	.	ENSG00000163781	ENST00000260810	T	0.79352	-1.26	5.62	5.62	0.85841	BRCT (4);	0.317751	0.41712	D	0.000832	D	0.84795	0.5551	M	0.61703	1.905	0.50039	D	0.999842	D	0.58620	0.983	P	0.57679	0.825	D	0.83499	0.0074	10	0.42905	T	0.14	.	19.6406	0.95755	0.0:1.0:0.0:0.0	.	933	Q92547	TOPB1_HUMAN	N	933	ENSP00000260810:D933N	ENSP00000260810:D933N	D	-	1	0	TOPBP1	134829903	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	7.210000	0.77924	2.794000	0.96219	0.650000	0.86243	GAT	TOPBP1	-	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom		0.383	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOPBP1	HGNC	protein_coding	OTTHUMT00000357254.1	C	NM_007027		133347213	-1	no_errors	ENST00000260810	ensembl	human	known	70_37	missense	SNP	1.000	T
TRAPPC11	60684	genome.wustl.edu	37	4	184626182	184626182	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr4:184626182C>T	ENST00000334690.6	+	27	3216	c.3014C>T	c.(3013-3015)cCg>cTg	p.P1005L	RNU6-1053P_ENST00000515930.1_RNA|TRAPPC11_ENST00000357207.4_Missense_Mutation_p.P1005L|TRAPPC11_ENST00000512476.1_Missense_Mutation_p.P611L	NM_021942.5	NP_068761.4	Q7Z392	TPC11_HUMAN	trafficking protein particle complex 11	1005					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)											ATCACTCTGCCGCACGTGATT	0.383																																																	0													171.0	158.0	162.0					4																	184626182		2203	4300	6503	SO:0001583	missense	60684				CCDS34112.1, CCDS47166.1	4q35.1	2011-12-12	2011-12-12	2011-12-12	ENSG00000168538	ENSG00000168538		"""Trafficking protein particle complex"""	25751	protein-coding gene	gene with protein product	"""gryzun homolog (Drosophila)"", ""foie gras homolog (zebrafish)"""	614138	"""chromosome 4 open reading frame 41"""	C4orf41		19942856, 21525244	Standard	NM_021942		Approved	FLJ12716, gry, foigr	uc003ivx.3	Q7Z392	OTTHUMG00000160673	ENST00000334690.6:c.3014C>T	4.37:g.184626182C>T	ENSP00000335371:p.Pro1005Leu		A4QPB8|B2RCD6|Q5U5I7|Q6FI73|Q86T25|Q9H0L1|Q9H5K9|Q9H8Q1|Q9H9I7	Missense_Mutation	SNP	pfam_Foie-gras_1,pfam_DUF1683_C	p.P1005L	ENST00000334690.6	37	c.3014	CCDS34112.1	4	.	.	.	.	.	.	.	.	.	.	C	27.5	4.833448	0.91036	.	.	ENSG00000168538	ENST00000334690;ENST00000357207;ENST00000512476	.	.	.	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.79341	0.4429	M	0.76574	2.34	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	T	0.80248	-0.1461	9	0.46703	T	0.11	.	18.1806	0.89776	0.0:1.0:0.0:0.0	.	736;611;1005;1005	B3KR79;D6RHE5;Q7Z392;Q7Z392-3	.;.;TPC11_HUMAN;.	L	1005;1005;611	.	ENSP00000335371:P1005L	P	+	2	0	C4orf41	184863176	1.000000	0.71417	0.986000	0.45419	0.831000	0.47069	7.326000	0.79133	2.295000	0.77249	0.563000	0.77884	CCG	TRAPPC11	-	pfam_DUF1683_C		0.383	TRAPPC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAPPC11	HGNC	protein_coding	OTTHUMT00000361654.2	C	NM_021942		184626182	+1	no_errors	ENST00000334690	ensembl	human	known	70_37	missense	SNP	1.000	T
TTC28	23331	genome.wustl.edu	37	22	28389396	28389396	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr22:28389396G>A	ENST00000397906.2	-	18	5496	c.5355C>T	c.(5353-5355)ctC>ctT	p.L1785L	TTC28-AS1_ENST00000454741.1_RNA|TTC28-AS1_ENST00000452612.1_RNA|TTC28-AS1_ENST00000430525.1_RNA|TTC28-AS1_ENST00000433317.1_RNA|TTC28-AS1_ENST00000434221.1_RNA|TTC28-AS1_ENST00000417497.1_RNA|TTC28-AS1_ENST00000453632.1_RNA|TTC28-AS1_ENST00000435348.1_RNA|TTC28-AS1_ENST00000424161.1_RNA|TTC28-AS1_ENST00000428584.1_RNA|TTC28-AS1_ENST00000430853.1_RNA	NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	1785					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						CCACAGCGGTGAGGAGGGCCT	0.662																																																	0													51.0	53.0	52.0					22																	28389396		692	1591	2283	SO:0001819	synonymous_variant	23331			AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.5355C>T	22.37:g.28389396G>A			K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Silent	SNP	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L1785	ENST00000397906.2	37	c.5355	CCDS46678.1	22																																																																																			TTC28	-	NULL		0.662	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	TTC28	HGNC	protein_coding	OTTHUMT00000320930.2	G	XM_929318		28389396	-1	no_errors	ENST00000397906	ensembl	human	novel	70_37	silent	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179486627	179486627	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:179486627C>A	ENST00000591111.1	-	194	40323	c.40099G>T	c.(40099-40101)Gaa>Taa	p.E13367*	TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000604956.1_RNA|TTN_ENST00000359218.5_Nonsense_Mutation_p.E6068*|TTN_ENST00000460472.2_Nonsense_Mutation_p.E5943*|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Nonsense_Mutation_p.E6135*|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Nonsense_Mutation_p.E15008*|TTN_ENST00000342992.6_Nonsense_Mutation_p.E12440*|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589487.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13367	Ig-like 89.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TATTCAGCTTCATCATCCAGT	0.398																																																	0													145.0	134.0	138.0					2																	179486627		1942	4138	6080	SO:0001587	stop_gained	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.40099G>T	2.37:g.179486627C>A	ENSP00000465570:p.Glu13367*		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E12440*	ENST00000591111.1	37	c.37318		2	.	.	.	.	.	.	.	.	.	.	C	58	31.455376	0.99979	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	5.8	5.8	0.92144	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.0499	0.97621	0.0:1.0:0.0:0.0	.	.	.	.	X	12440;5943;6135;6068;5943	.	ENSP00000340554:E6135X	E	-	1	0	TTN	179194872	1.000000	0.71417	1.000000	0.80357	0.749000	0.42624	7.767000	0.85331	2.734000	0.93682	0.650000	0.86243	GAA	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.398	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	C	NM_133378		179486627	-1	no_errors	ENST00000342992	ensembl	human	known	70_37	nonsense	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179501396	179501396	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:179501396C>T	ENST00000591111.1	-	175	36359	c.36135G>A	c.(36133-36135)gtG>gtA	p.V12045V	TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Silent_p.V4746V|TTN_ENST00000460472.2_Silent_p.V4621V|TTN_ENST00000342175.6_Silent_p.V4813V|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Silent_p.V13686V|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Silent_p.V11118V|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000418062.1_RNA|TTN-AS1_ENST00000589487.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12045	Ig-like 80.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGATTTCTTTCACAAACTTCA	0.463																																																	0													82.0	80.0	81.0					2																	179501396		1921	4143	6064	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.36135G>A	2.37:g.179501396C>T			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.V11118	ENST00000591111.1	37	c.33354		2																																																																																			TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,pfscan_Ig-like		0.463	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	C	NM_133378		179501396	-1	no_errors	ENST00000342992	ensembl	human	known	70_37	silent	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179659263	179659263	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:179659263C>T	ENST00000591111.1	-	8	1485	c.1261G>A	c.(1261-1263)Gac>Aac	p.D421N	TTN_ENST00000359218.5_Missense_Mutation_p.D421N|TTN_ENST00000460472.2_Missense_Mutation_p.D421N|TTN_ENST00000342175.6_Missense_Mutation_p.D421N|TTN_ENST00000589042.1_Missense_Mutation_p.D421N|TTN_ENST00000342992.6_Missense_Mutation_p.D421N|TTN_ENST00000360870.5_Missense_Mutation_p.D421N			Q8WZ42	TITIN_HUMAN	titin	0	Ala-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCACTTTTGTCAGCATCTTGT	0.433																																																	0													120.0	112.0	115.0					2																	179659263		2203	4300	6503	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.1261G>A	2.37:g.179659263C>T	ENSP00000465570:p.Asp421Asn		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.D421N	ENST00000591111.1	37	c.1261		2	.	.	.	.	.	.	.	.	.	.	C	17.24	3.340532	0.60963	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870;ENST00000436599	T;T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94;0.94	5.99	5.99	0.97316	Titin Z (1);	.	.	.	.	T	0.42653	0.1212	N	0.19112	0.55	0.27727	N	0.944924	B;B;B;B;P	0.43477	0.117;0.117;0.117;0.117;0.808	B;B;B;B;P	0.46825	0.159;0.159;0.268;0.268;0.528	T	0.43988	-0.9357	9	0.87932	D	0	.	20.0881	0.97803	0.0:1.0:0.0:0.0	.	421;421;421;421;421	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	N	421;421;421;421;421;421;17	ENSP00000343764:D421N;ENSP00000434586:D421N;ENSP00000340554:D421N;ENSP00000352154:D421N;ENSP00000354117:D421N;ENSP00000405517:D17N	ENSP00000340554:D421N	D	-	1	0	TTN	179367508	1.000000	0.71417	0.977000	0.42913	0.995000	0.86356	4.314000	0.59166	2.840000	0.97914	0.655000	0.94253	GAC	TTN	-	pfam_Titin_Z		0.433	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	C	NM_133378		179659263	-1	no_errors	ENST00000342992	ensembl	human	known	70_37	missense	SNP	1.000	T
UBAP2L	9898	genome.wustl.edu	37	1	154226534	154226534	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:154226534C>T	ENST00000361546.2	+	14	1865	c.1823C>T	c.(1822-1824)tCa>tTa	p.S608L	AL590431.1_ENST00000517008.1_RNA|UBAP2L_ENST00000271877.7_Missense_Mutation_p.S619L|UBAP2L_ENST00000428931.1_Missense_Mutation_p.S608L|UBAP2L_ENST00000343815.6_Missense_Mutation_p.S608L			Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like	608					binding of sperm to zona pellucida (GO:0007339)		poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|prostate(1)|urinary_tract(2)	50	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TCCATCTCTTCATCACCCCAA	0.468																																																	0													63.0	59.0	60.0					1																	154226534		2203	4300	6503	SO:0001583	missense	9898			BC003170	CCDS1063.1, CCDS44229.1, CCDS72925.1	1q21.3	2008-02-05			ENSG00000143569	ENSG00000143569			29877	protein-coding gene	gene with protein product						8590280, 11230159	Standard	NM_014847		Approved	NICE-4, KIAA0144	uc001fep.4	Q14157	OTTHUMG00000035983	ENST00000361546.2:c.1823C>T	1.37:g.154226534C>T	ENSP00000355343:p.Ser608Leu		B4E0U8|Q5VU75|Q5VU76|Q9BTU3|Q9UGL2|Q9UGL3|Q9UGL4|Q9UGL5	Missense_Mutation	SNP	pfam_DUF3697_Uba2,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.S608L	ENST00000361546.2	37	c.1823	CCDS1063.1	1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.686428	0.88639	.	.	ENSG00000143569	ENST00000343815;ENST00000428931;ENST00000456955;ENST00000433006;ENST00000271877;ENST00000361546	T;T;T;T	0.13538	2.58;2.59;2.58;2.59	5.05	5.05	0.67936	.	0.222123	0.39909	N	0.001223	T	0.21801	0.0525	L	0.40543	1.245	0.58432	D	0.999991	D;D;D;D;D	0.61080	0.967;0.989;0.981;0.981;0.967	P;D;D;D;P	0.75020	0.879;0.985;0.943;0.943;0.879	T	0.00975	-1.1494	10	0.72032	D	0.01	-4.9926	17.5691	0.87930	0.0:1.0:0.0:0.0	.	522;619;601;608;608	B4DZJ6;F8W726;Q14157-4;Q14157-1;Q14157	.;.;.;.;UBP2L_HUMAN	L	608;608;104;104;619;608	ENSP00000345308:S608L;ENSP00000389445:S608L;ENSP00000271877:S619L;ENSP00000355343:S608L	ENSP00000271877:S619L	S	+	2	0	UBAP2L	152493158	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.164000	0.71885	2.623000	0.88846	0.655000	0.94253	TCA	UBAP2L	-	NULL		0.468	UBAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBAP2L	HGNC	protein_coding	OTTHUMT00000087673.1	C	NM_014847		154226534	+1	no_errors	ENST00000361546	ensembl	human	known	70_37	missense	SNP	1.000	T
UBAP2L	9898	genome.wustl.edu	37	1	154241393	154241393	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:154241393C>T	ENST00000361546.2	+	25	3173	c.3131C>T	c.(3130-3132)tCt>tTt	p.S1044F	UBAP2L_ENST00000484819.1_3'UTR|UBAP2L_ENST00000271877.7_Missense_Mutation_p.S1054F|UBAP2L_ENST00000428931.1_Missense_Mutation_p.S1044F			Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like	1044					binding of sperm to zona pellucida (GO:0007339)		poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|prostate(1)|urinary_tract(2)	50	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CAGCCGCATTCTCAGATCCTT	0.567																																																	0													127.0	116.0	120.0					1																	154241393		2203	4300	6503	SO:0001583	missense	9898			BC003170	CCDS1063.1, CCDS44229.1, CCDS72925.1	1q21.3	2008-02-05			ENSG00000143569	ENSG00000143569			29877	protein-coding gene	gene with protein product						8590280, 11230159	Standard	NM_014847		Approved	NICE-4, KIAA0144	uc001fep.4	Q14157	OTTHUMG00000035983	ENST00000361546.2:c.3131C>T	1.37:g.154241393C>T	ENSP00000355343:p.Ser1044Phe		B4E0U8|Q5VU75|Q5VU76|Q9BTU3|Q9UGL2|Q9UGL3|Q9UGL4|Q9UGL5	Missense_Mutation	SNP	pfam_DUF3697_Uba2,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.S1044F	ENST00000361546.2	37	c.3131	CCDS1063.1	1	.	.	.	.	.	.	.	.	.	.	C	19.20	3.781357	0.70222	.	.	ENSG00000143569	ENST00000428931;ENST00000456955;ENST00000433006;ENST00000271877;ENST00000361546	T;T;T	0.51071	0.72;0.72;0.72	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.63570	0.2522	M	0.68317	2.08	0.80722	D	1	D;D;D;D	0.89917	0.997;0.99;0.994;1.0	D;D;D;D	0.85130	0.994;0.974;0.983;0.997	T	0.65582	-0.6133	10	0.87932	D	0	-5.3586	18.4626	0.90745	0.0:1.0:0.0:0.0	.	1054;540;1044;1044	F8W726;C9JD99;Q14157-3;Q14157	.;.;.;UBP2L_HUMAN	F	1044;540;540;1054;1044	ENSP00000389445:S1044F;ENSP00000271877:S1054F;ENSP00000355343:S1044F	ENSP00000271877:S1054F	S	+	2	0	UBAP2L	152508017	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.427000	0.80284	2.711000	0.92665	0.467000	0.42956	TCT	UBAP2L	-	NULL		0.567	UBAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBAP2L	HGNC	protein_coding	OTTHUMT00000087673.1	C	NM_014847		154241393	+1	no_errors	ENST00000361546	ensembl	human	known	70_37	missense	SNP	1.000	T
UGCG	7357	genome.wustl.edu	37	9	114676973	114676973	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr9:114676973G>T	ENST00000374279.3	+	2	637	c.187G>T	c.(187-189)Gat>Tat	p.D63Y	UGCG_ENST00000495085.1_3'UTR	NM_003358.1	NP_003349.1	Q16739	CEGT_HUMAN	UDP-glucose ceramide glucosyltransferase	63					epidermis development (GO:0008544)|glucosylceramide biosynthetic process (GO:0006679)|glycosphingolipid biosynthetic process (GO:0006688)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ceramide glucosyltransferase activity (GO:0008120)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|ovary(1)|urinary_tract(1)	12				OV - Ovarian serous cystadenocarcinoma(323;0.0433)	Miglustat(DB00419)	GAAAGGGGTAGATCCTAACTT	0.378																																																	0													111.0	111.0	111.0					9																	114676973		2203	4300	6503	SO:0001583	missense	7357			D50840	CCDS6782.1	9q31	2014-03-13			ENSG00000148154	ENSG00000148154	2.4.1.80	"""Glycosyltransferase family 2 domain containing"""	12524	protein-coding gene	gene with protein product	"""glucosylceramide synthase"", ""ceramide glucosyltransferase"""	602874				8643456, 9605861	Standard	NM_003358		Approved	GCS	uc004bft.3	Q16739	OTTHUMG00000020498	ENST00000374279.3:c.187G>T	9.37:g.114676973G>T	ENSP00000363397:p.Asp63Tyr		Q5T258	Missense_Mutation	SNP	pfam_Glyco_trans_2	p.D63Y	ENST00000374279.3	37	c.187	CCDS6782.1	9	.	.	.	.	.	.	.	.	.	.	G	21.1	4.091120	0.76756	.	.	ENSG00000148154	ENST00000374279	T	0.60040	0.22	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.81564	0.4849	M	0.89478	3.035	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.83914	0.0297	10	0.87932	D	0	.	20.2279	0.98344	0.0:0.0:1.0:0.0	.	63	Q16739	CEGT_HUMAN	Y	63	ENSP00000363397:D63Y	ENSP00000363397:D63Y	D	+	1	0	UGCG	113716794	1.000000	0.71417	0.694000	0.30210	0.426000	0.31534	9.476000	0.97823	2.778000	0.95560	0.655000	0.94253	GAT	UGCG	-	NULL		0.378	UGCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGCG	HGNC	protein_coding	OTTHUMT00000053661.1	G	NM_003358		114676973	+1	no_errors	ENST00000374279	ensembl	human	known	70_37	missense	SNP	1.000	T
UNC80	285175	genome.wustl.edu	37	2	210804363	210804363	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr2:210804363C>T	ENST00000439458.1	+	42	6515	c.6435C>T	c.(6433-6435)ttC>ttT	p.F2145F	UNC80_ENST00000272845.6_Silent_p.F2140F	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	2145					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						TTTCACTCTTCAGTGATCCTC	0.413																																																	0													101.0	88.0	92.0					2																	210804363		692	1591	2283	SO:0001819	synonymous_variant	285175			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.6435C>T	2.37:g.210804363C>T			B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Silent	SNP	NULL	p.F2145	ENST00000439458.1	37	c.6435	CCDS46504.1	2																																																																																			UNC80	-	NULL		0.413	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	HGNC	protein_coding		C	NM_182587		210804363	+1	no_errors	ENST00000439458	ensembl	human	known	70_37	silent	SNP	1.000	T
UNKL	64718	genome.wustl.edu	37	16	1463963	1463963	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr16:1463963G>A	ENST00000389221.4	-	2	170	c.171C>T	c.(169-171)ttC>ttT	p.F57F	UNKL_ENST00000301712.5_Silent_p.F57F|LA16c-312E8.2_ENST00000568554.1_RNA|UNKL_ENST00000397462.1_Silent_p.F57F|UNKL_ENST00000508903.2_Silent_p.F57F|UNKL_ENST00000503648.1_5'UTR	NM_001193388.1	NP_001180317	Q9H9P5	UNKL_HUMAN	unkempt family zinc finger-like	57					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Hepatocellular(780;0.0893)				GCTGGTTGAGGAAGTGCCAGT	0.627											OREG0023546	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													18.0	16.0	17.0					16																	1463963		2109	4146	6255	SO:0001819	synonymous_variant	64718			BC011924	CCDS32359.1, CCDS53980.1, CCDS61787.1	16p13.3	2014-03-10	2013-10-17		ENSG00000059145	ENSG00000059145		"""Zinc fingers, CCCH-type domain containing"""	14184	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 28"", ""unkempt homolog (Drosophila)-like"""	C16orf28		20148946	Standard	NM_001193389		Approved	ZC3HDC5L, ZC3H5L, FLJ23360	uc031qup.1	Q9H9P5	OTTHUMG00000128553	ENST00000389221.4:c.171C>T	16.37:g.1463963G>A		596	B0QYN6|B1GXI8|Q96EV1|Q96RZ1|Q9BWL5|Q9H5K0|Q9UJJ8	Missense_Mutation	SNP	NULL	p.S42F	ENST00000389221.4	37	c.125	CCDS53981.1	16																																																																																			UNKL	-	NULL		0.627	UNKL-201	KNOWN	basic|CCDS	protein_coding	UNKL	HGNC	protein_coding		G	NM_001037125		1463963	-1	no_errors	ENST00000382757	ensembl	human	known	70_37	missense	SNP	1.000	A
UPF2	26019	genome.wustl.edu	37	10	11997477	11997477	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr10:11997477G>A	ENST00000356352.2	-	13	3077	c.2604C>T	c.(2602-2604)cgC>cgT	p.R868R	UPF2_ENST00000397053.2_Silent_p.R868R|UPF2_ENST00000357604.5_Silent_p.R868R			Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog (yeast)	868	MIF4G 3.|Sufficient for interaction with EIF4A1 and EIF1.|Sufficient for interaction with UPF3A and UPF3B.				gene expression (GO:0010467)|liver development (GO:0001889)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(14)|lung(17)|ovary(2)|skin(3)|urinary_tract(2)	56		Renal(717;0.228)				CACTGCTGATGCGCCTCTGAT	0.353																																																	0													62.0	61.0	61.0					10																	11997477		2203	4300	6503	SO:0001819	synonymous_variant	26019			AB037829	CCDS7086.1	10p14-p13	2011-06-21			ENSG00000151461	ENSG00000151461			17854	protein-coding gene	gene with protein product	"""smg-3 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	605529				11073994, 11113196	Standard	NM_080599		Approved	RENT2, DKFZP434D222, KIAA1408, smg-3	uc001ilb.3	Q9HAU5	OTTHUMG00000017678	ENST00000356352.2:c.2604C>T	10.37:g.11997477G>A			A6NLJ5|D3DRS0|Q14BM1|Q5W0J4|Q8N8U1|Q9H1J2|Q9NWL1|Q9P2D9|Q9Y4M9	Silent	SNP	pfam_MIF4G-like_typ-3,pfam_Up-fram_suppressor-2,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	p.R868	ENST00000356352.2	37	c.2604	CCDS7086.1	10																																																																																			UPF2	-	pfam_MIF4G-like_typ-3,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3		0.353	UPF2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UPF2	HGNC	protein_coding	OTTHUMT00000046783.1	G			11997477	-1	no_errors	ENST00000356352	ensembl	human	known	70_37	silent	SNP	1.000	A
USP24	23358	genome.wustl.edu	37	1	55539505	55539505	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:55539505G>A	ENST00000294383.6	-	64	7521	c.7522C>T	c.(7522-7524)Caa>Taa	p.Q2508*	USP24_ENST00000407756.1_Nonsense_Mutation_p.Q2348*|USP24_ENST00000484447.1_5'UTR	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	2508					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						ACTTACTTTTGAGCAAGAGTG	0.408																																																	0													62.0	54.0	56.0					1																	55539505		1876	4104	5980	SO:0001587	stop_gained	23358			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.7522C>T	1.37:g.55539505G>A	ENSP00000294383:p.Gln2508*		Q6ZSY2|Q8N2Y4|Q9NXD1	Nonsense_Mutation	SNP	pfam_Peptidase_C19,superfamily_UBA-like,superfamily_ARM-type_fold,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Peptidase_C19	p.Q2508*	ENST00000294383.6	37	c.7522	CCDS44154.2	1	.	.	.	.	.	.	.	.	.	.	G	48	14.511991	0.99799	.	.	ENSG00000162402	ENST00000294383;ENST00000407756	.	.	.	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	.	19.0783	0.93171	0.0:0.0:1.0:0.0	.	.	.	.	X	2508;2348	.	ENSP00000294383:Q2508X	Q	-	1	0	USP24	55312093	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.709000	0.91379	2.731000	0.93534	0.650000	0.86243	CAA	USP24	-	superfamily_ARM-type_fold		0.408	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	USP24	HGNC	protein_coding	OTTHUMT00000022275.2	G			55539505	-1	no_errors	ENST00000294383	ensembl	human	known	70_37	nonsense	SNP	1.000	A
USP8	9101	genome.wustl.edu	37	15	50776513	50776513	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr15:50776513G>A	ENST00000396444.3	+	12	2183	c.1845G>A	c.(1843-1845)agG>agA	p.R615R	USP8_ENST00000307179.4_Silent_p.R615R|USP8_ENST00000425032.3_Intron|USP8_ENST00000433963.1_Silent_p.R615R	NM_001128610.1|NM_005154.3	NP_001122082.1|NP_005145.3	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	615					cell proliferation (GO:0008283)|endosome organization (GO:0007032)|mitotic cytokinesis (GO:0000281)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|Ras protein signal transduction (GO:0007265)|ubiquitin-dependent protein catabolic process (GO:0006511)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|midbody (GO:0030496)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		GAATTCTAAGGACAGGAACTT	0.308																																																	0													61.0	65.0	64.0					15																	50776513		2196	4289	6485	SO:0001819	synonymous_variant	9101			D29956	CCDS10137.1, CCDS61632.1	15q21.1	2014-03-03	2005-08-08		ENSG00000138592	ENSG00000138592		"""Ubiquitin-specific peptidases"""	12631	protein-coding gene	gene with protein product		603158	"""ubiquitin specific protease 8"""			12838346, 9582025, 24482476	Standard	NM_005154		Approved	HumORF8, KIAA0055, UBPY, SPG59	uc001zyl.4	P40818	OTTHUMG00000131645	ENST00000396444.3:c.1845G>A	15.37:g.50776513G>A			B4DKA8|Q2TB31|Q7Z3U2|Q86VA0|Q8IWI7	Silent	SNP	pfam_Peptidase_C19,pfam_DUF1873,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,superfamily_WW_Rsp5_WWP,pfscan_Rhodanese-like_dom,pfscan_Peptidase_C19	p.R615	ENST00000396444.3	37	c.1845	CCDS10137.1	15																																																																																			USP8	-	NULL		0.308	USP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP8	HGNC	protein_coding	OTTHUMT00000254541.1	G	NM_005154		50776513	+1	no_errors	ENST00000307179	ensembl	human	known	70_37	silent	SNP	0.999	A
VMP1	81671	genome.wustl.edu	37	17	57915573	57915573	+	Intron	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr17:57915573G>A	ENST00000262291.4	+	11	1284				VMP1_ENST00000536180.1_Intron|VMP1_ENST00000545362.1_Intron|VMP1_ENST00000588617.1_3'UTR|VMP1_ENST00000537567.1_Intron|VMP1_ENST00000539763.1_Intron	NM_030938.3	NP_112200.2	Q96GC9	VMP1_HUMAN	vacuole membrane protein 1						autophagy (GO:0006914)|cell junction assembly (GO:0034329)|embryo implantation (GO:0007566)|regulation of autophagy (GO:0010506)|single organismal cell-cell adhesion (GO:0016337)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|pre-autophagosomal structure (GO:0000407)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|skin(2)	16						GAGTCCAGGTGGTAAGTACAT	0.393																																																	0																																										SO:0001627	intron_variant	81671				CCDS11619.1	17q23.1	2014-05-20	2011-03-02	2011-03-02	ENSG00000062716	ENSG00000062716			29559	protein-coding gene	gene with protein product	"""ectopic P-granules autophagy protein 3 homolog (C. elegans)"", ""transport and golgi organization 5 homolog (Drosophila)"""	611753	"""transmembrane protein 49"""	TMEM49		11230166, 11785947	Standard	NM_030938		Approved	EPG3, TANGO5	uc002ixu.4	Q96GC9	OTTHUMG00000179882	ENST00000262291.4:c.975-83G>A	17.37:g.57915573G>A			B4DVV9|Q9H0P4|Q9P089	RNA	SNP	-	NULL	ENST00000262291.4	37	NULL	CCDS11619.1	17																																																																																			VMP1	-	-		0.393	VMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VMP1	HGNC	protein_coding	OTTHUMT00000448793.1	G	NM_030938		57915573	+1	no_errors	ENST00000588617	ensembl	human	known	70_37	rna	SNP	0.995	A
VPS72	6944	genome.wustl.edu	37	1	151149160	151149160	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:151149160G>A	ENST00000354473.4	-	6	1124	c.1088C>T	c.(1087-1089)tCt>tTt	p.S363F	TMOD4_ENST00000601585.1_5'Flank|VPS72_ENST00000496809.1_5'Flank|TMOD4_ENST00000416280.2_5'Flank			Q15906	VPS72_HUMAN	vacuolar protein sorting 72 homolog (S. cerevisiae)	352					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	14	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			TCGGGGCCCAGAGCCAGGGAG	0.577																																					Pancreas(109;1131 2287 3209 24201)												0													72.0	86.0	81.0					1																	151149160		2203	4300	6503	SO:0001583	missense	6944			D43642	CCDS989.1, CCDS59201.1	1q21	2008-02-05	2006-12-19	2005-09-08	ENSG00000163159	ENSG00000163159			11644	protein-coding gene	gene with protein product		600607	"""transcription factor-like 1"", ""vacuolar protein sorting 72 (yeast)"""	TCFL1		7702631	Standard	NM_001271087		Approved	YL-1, YL1, Swc2	uc001exe.2	Q15906	OTTHUMG00000012345	ENST00000354473.4:c.1088C>T	1.37:g.151149160G>A	ENSP00000346464:p.Ser363Phe		A6NLK9|A6PW55|Q53GJ2|Q5U0R4	Missense_Mutation	SNP	pfam_YL1,pfam_YL1_C	p.S352F	ENST00000354473.4	37	c.1055	CCDS59201.1	1	.	.	.	.	.	.	.	.	.	.	.	15.68	2.904912	0.52333	.	.	ENSG00000163159	ENST00000368892;ENST00000354473	.	.	.	5.27	5.27	0.74061	.	0.323197	0.28742	N	0.014289	T	0.27063	0.0663	N	0.08118	0	0.38718	D	0.953384	B	0.25169	0.119	B	0.23018	0.043	T	0.24190	-1.0167	9	0.72032	D	0.01	-12.6668	16.8449	0.85978	0.0:0.0:1.0:0.0	.	352	Q15906	VPS72_HUMAN	F	352;363	.	ENSP00000346464:S363F	S	-	2	0	VPS72	149415784	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.646000	0.83445	2.758000	0.94735	0.561000	0.74099	TCT	VPS72	-	NULL		0.577	VPS72-002	NOVEL	mRNA_start_NF|basic|exp_conf|CCDS	protein_coding	VPS72	HGNC	protein_coding	OTTHUMT00000034394.3	G	NM_005997		151149160	-1	no_errors	ENST00000368892	ensembl	human	known	70_37	missense	SNP	0.997	A
WDR62	284403	genome.wustl.edu	37	19	36593869	36593869	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:36593869C>T	ENST00000270301.7	+	28	3340	c.3340C>T	c.(3340-3342)Ccc>Tcc	p.P1114S	WDR62_ENST00000401500.2_Missense_Mutation_p.P1119S			O43379	WDR62_HUMAN	WD repeat domain 62	1114					cerebral cortex development (GO:0021987)|neurogenesis (GO:0022008)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle pole (GO:0000922)				cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(15)|prostate(4)|stomach(2)|urinary_tract(3)	43	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			TACCTTCCCTCCCCGGGCAAC	0.632																																																	0													49.0	50.0	50.0					19																	36593869		2203	4300	6503	SO:0001583	missense	284403			BX647726	CCDS33001.1, CCDS46059.1	19q13.12	2013-01-09	2005-05-09	2005-05-09	ENSG00000075702	ENSG00000075702		"""WD repeat domain containing"""	24502	protein-coding gene	gene with protein product		613583	"""chromosome 19 open reading frame 14"", ""microcephaly, primary autosomal recessive 2"""	C19orf14, MCPH2		19910486, 20729831, 20890278, 21496009	Standard	NM_001083961		Approved	DKFZP434J046, FLJ33298	uc002odd.2	O43379	OTTHUMG00000048139	ENST00000270301.7:c.3340C>T	19.37:g.36593869C>T	ENSP00000270301:p.Pro1114Ser		Q63HP9|Q659D7|Q8NBF7|Q96AD9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P1119S	ENST00000270301.7	37	c.3355	CCDS33001.1	19	.	.	.	.	.	.	.	.	.	.	C	0.488	-0.876767	0.02550	.	.	ENSG00000075702	ENST00000401500;ENST00000270301	T;T	0.51325	0.8;0.71	5.08	-2.65	0.06095	.	0.608775	0.15578	N	0.255087	T	0.27241	0.0668	L	0.41824	1.3	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.002	T	0.31194	-0.9952	10	0.08179	T	0.78	-5.2476	5.3087	0.15817	0.0:0.4241:0.1399:0.436	.	1119;1114	O43379-4;O43379	.;WDR62_HUMAN	S	1119;1114	ENSP00000384792:P1119S;ENSP00000270301:P1114S	ENSP00000270301:P1114S	P	+	1	0	WDR62	41285709	0.000000	0.05858	0.021000	0.16686	0.003000	0.03518	-0.512000	0.06313	-0.527000	0.06374	-0.143000	0.13931	CCC	WDR62	-	NULL		0.632	WDR62-006	NOVEL	basic|appris_candidate|CCDS	protein_coding	WDR62	HGNC	protein_coding	OTTHUMT00000457436.1	C	NM_015671		36593869	+1	no_errors	ENST00000401500	ensembl	human	known	70_37	missense	SNP	0.004	T
NELFA	7469	genome.wustl.edu	37	4	1987870	1987870	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr4:1987870C>T	ENST00000411638.2	-	6	821	c.806G>A	c.(805-807)cGa>cAa	p.R269Q	NELFA_ENST00000382882.3_Missense_Mutation_p.R280Q|MIR943_ENST00000401286.1_RNA|NELFA_ENST00000542778.1_Missense_Mutation_p.R134Q	NM_005663.4	NP_005654.3	Q9H3P2	NELFA_HUMAN	negative elongation factor complex member A	269					gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)										CTTCGCCTCTCGGCCAGCGCC	0.677																																																	0													39.0	33.0	35.0					4																	1987870		2165	4220	6385	SO:0001583	missense	7469			AF101434	CCDS3358.2	4p16.3	2013-01-31	2013-01-31	2013-01-31	ENSG00000185049	ENSG00000185049			12768	protein-coding gene	gene with protein product		606026	"""Wolf-Hirschhorn syndrome candidate 2"""	WHSC2		10409432	Standard	NM_005663		Approved	NELF-A	uc003gem.3	Q9H3P2	OTTHUMG00000089967	ENST00000411638.2:c.806G>A	4.37:g.1987870C>T	ENSP00000399165:p.Arg269Gln		A2A2T1|O95392	Missense_Mutation	SNP	NULL	p.R280Q	ENST00000411638.2	37	c.839		4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.7|24.7	4.563327|4.563327	0.86335|0.86335	.|.	.|.	ENSG00000185049|ENSG00000185049	ENST00000453740|ENST00000382882;ENST00000416258;ENST00000542778;ENST00000411638;ENST00000431323;ENST00000455762	.|T;T;T;T;T;T	.|0.54675	.|0.56;0.56;0.56;0.56;0.56;0.56	5.42|5.42	4.58|4.58	0.56647|0.56647	.|.	.|0.055113	.|0.64402	.|N	.|0.000001	T|T	0.45337|0.45337	0.1337|0.1337	M|M	0.62723|0.62723	1.935|1.935	0.58432|0.58432	D|D	0.999999|0.999999	.|B	.|0.33494	.|0.414	.|B	.|0.20767	.|0.031	T|T	0.37798|0.37798	-0.9690|-0.9690	5|10	.|0.21014	.|T	.|0.42	-12.5738|-12.5738	14.0137|14.0137	0.64513|0.64513	0.0:0.9265:0.0:0.0735|0.0:0.9265:0.0:0.0735	.|.	.|269	.|Q9H3P2	.|NELFA_HUMAN	K|Q	170|280;273;134;269;285;199	.|ENSP00000372335:R280Q;ENSP00000387647:R273Q;ENSP00000445757:R134Q;ENSP00000399165:R269Q;ENSP00000395761:R285Q;ENSP00000410154:R199Q	.|ENSP00000372335:R280Q	E|R	-|-	1|2	0|0	WHSC2|WHSC2	1957668|1957668	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.693000|0.693000	0.40251|0.40251	7.697000|7.697000	0.84279|0.84279	1.275000|1.275000	0.44379|0.44379	0.462000|0.462000	0.41574|0.41574	GAG|CGA	WHSC2	-	NULL		0.677	NELFA-015	NOVEL	basic|appris_principal	protein_coding	WHSC2	HGNC	protein_coding	OTTHUMT00000473007.1	C	NM_005663		1987870	-1	no_errors	ENST00000382882	ensembl	human	known	70_37	missense	SNP	1.000	T
WNK1	65125	genome.wustl.edu	37	12	992678	992678	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr12:992678G>A	ENST00000315939.6	+	16	4250	c.3607G>A	c.(3607-3609)Gat>Aat	p.D1203N	WNK1_ENST00000530271.2_Missense_Mutation_p.D1701N|WNK1_ENST00000535572.1_Missense_Mutation_p.D956N|WNK1_ENST00000537687.1_Missense_Mutation_p.D1463N|WNK1_ENST00000340908.4_Missense_Mutation_p.D796N	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	1203					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			ACCAGAGGGTGATCAGGGATT	0.418																																					Colon(19;451 567 6672 12618 28860)												0													147.0	158.0	154.0					12																	992678		2203	4300	6503	SO:0001583	missense	65125			AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.3607G>A	12.37:g.992678G>A	ENSP00000313059:p.Asp1203Asn		A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D1701N	ENST00000315939.6	37	c.5101	CCDS8506.1	12	.	.	.	.	.	.	.	.	.	.	G	21.5	4.161285	0.78226	.	.	ENSG00000060237	ENST00000535572;ENST00000315939;ENST00000537687;ENST00000252477;ENST00000530271;ENST00000340908;ENST00000534872	T;T;T;T;T;T	0.31769	1.48;1.48;1.48;1.48;1.48;1.48	5.6	5.6	0.85130	.	0.173869	0.40144	N	0.001168	T	0.28928	0.0718	N	0.19112	0.55	0.36715	D	0.880871	B;P;P	0.39480	0.449;0.675;0.546	B;B;B	0.41988	0.265;0.372;0.205	T	0.30179	-0.9987	10	0.87932	D	0	-8.7264	19.6155	0.95632	0.0:0.0:1.0:0.0	.	956;956;1203	Q9H4A3-2;F5GWT4;Q9H4A3	.;.;WNK1_HUMAN	N	956;1203;1463;376;1701;796;103	ENSP00000441972:D956N;ENSP00000313059:D1203N;ENSP00000444465:D1463N;ENSP00000433548:D1701N;ENSP00000341292:D796N;ENSP00000446253:D103N	ENSP00000252477:D376N	D	+	1	0	WNK1	862939	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.463000	0.73530	2.621000	0.88768	0.585000	0.79938	GAT	WNK1	-	NULL		0.418	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK1	HGNC	protein_coding	OTTHUMT00000206683.1	G	NM_018979		992678	+1	no_errors	ENST00000530271	ensembl	human	known	70_37	missense	SNP	1.000	A
YES1	7525	genome.wustl.edu	37	18	724573	724573	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr18:724573G>A	ENST00000584307.1	-	12	1653	c.1483C>T	c.(1483-1485)Cag>Tag	p.Q495*	YES1_ENST00000314574.4_Nonsense_Mutation_p.Q495*|YES1_ENST00000577961.1_Nonsense_Mutation_p.Q500*			P07947	YES_HUMAN	YES proto-oncogene 1, Src family tyrosine kinase	495	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|cellular protein modification process (GO:0006464)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glucose transport (GO:0015758)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|regulation of vascular permeability (GO:0043114)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.Q495*(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(1)	17					Dasatinib(DB01254)	GGACAGCCCTGAGGGCACGGC	0.418																																																	1	Substitution - Nonsense(1)	ovary(1)											92.0	94.0	93.0					18																	724573		2203	4300	6503	SO:0001587	stop_gained	7525			M15990	CCDS11824.1	18p11.31-p11.21	2014-06-26	2014-06-26		ENSG00000176105	ENSG00000176105		"""SH2 domain containing"""	12841	protein-coding gene	gene with protein product		164880	"""v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1"""			2983418	Standard	NM_005433		Approved	Yes, c-yes, HsT441	uc002kky.3	P07947	OTTHUMG00000131472	ENST00000584307.1:c.1483C>T	18.37:g.724573G>A	ENSP00000462468:p.Gln495*		A6NLB3|D3DUH1	Nonsense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.Q495*	ENST00000584307.1	37	c.1483	CCDS11824.1	18	.	.	.	.	.	.	.	.	.	.	G	37	6.288145	0.97444	.	.	ENSG00000176105	ENST00000359834;ENST00000314574	.	.	.	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	18.5435	0.91038	0.0:0.0:1.0:0.0	.	.	.	.	X	495	.	ENSP00000324740:Q495X	Q	-	1	0	YES1	714573	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.510000	0.98004	2.468000	0.83385	0.591000	0.81541	CAG	YES1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.418	YES1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	YES1	HGNC	protein_coding	OTTHUMT00000440827.2	G	NM_005433		724573	-1	no_errors	ENST00000314574	ensembl	human	known	70_37	nonsense	SNP	1.000	A
YIPF2	78992	genome.wustl.edu	37	19	11038333	11038333	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:11038333C>G	ENST00000586748.1	-	4	424	c.252G>C	c.(250-252)caG>caC	p.Q84H	C19orf52_ENST00000270502.6_5'Flank|YIPF2_ENST00000253031.2_Missense_Mutation_p.Q84H|YIPF2_ENST00000590329.1_Missense_Mutation_p.Q84H			Q9BWQ6	YIPF2_HUMAN	Yip1 domain family, member 2	84						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				cervix(1)|endometrium(1)|lung(3)|ovary(2)	7						CAAAGAAGCTCTGATAGTAGC	0.617																																																	0													97.0	86.0	89.0					19																	11038333		2203	4300	6503	SO:0001583	missense	78992			BC013014	CCDS12251.1	19p13.2	2008-02-05				ENSG00000130733		"""Yip1 domain family"""	28476	protein-coding gene	gene with protein product						12477932	Standard	NM_024029		Approved	MGC3262, FinGER2	uc002mqc.3	Q9BWQ6		ENST00000586748.1:c.252G>C	19.37:g.11038333C>G	ENSP00000466055:p.Gln84His			Missense_Mutation	SNP	pfam_Yip1	p.Q84H	ENST00000586748.1	37	c.252	CCDS12251.1	19	.	.	.	.	.	.	.	.	.	.	C	21.2	4.106950	0.77096	.	.	ENSG00000130733	ENST00000253031	.	.	.	4.89	2.74	0.32292	.	0.000000	0.85682	D	0.000000	T	0.70561	0.3238	M	0.75615	2.305	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.69807	-0.5045	9	0.87932	D	0	-13.0963	6.6941	0.23189	0.0:0.6856:0.1495:0.1649	.	84	Q9BWQ6	YIPF2_HUMAN	H	84	.	ENSP00000253031:Q84H	Q	-	3	2	YIPF2	10899333	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.206000	0.42779	0.656000	0.30886	-0.150000	0.13652	CAG	YIPF2	-	NULL		0.617	YIPF2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	YIPF2	HGNC	protein_coding	OTTHUMT00000453045.1	C	NM_024029		11038333	-1	no_errors	ENST00000253031	ensembl	human	known	70_37	missense	SNP	0.997	G
YTHDC2	64848	genome.wustl.edu	37	5	112929060	112929060	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr5:112929060G>C	ENST00000161863.4	+	29	4486	c.4273G>C	c.(4273-4275)Gaa>Caa	p.E1425Q		NM_022828.3	NP_073739.3	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	1425					ATP catabolic process (GO:0006200)|positive regulation by host of viral genome replication (GO:0044829)|response to interleukin-1 (GO:0070555)|response to tumor necrosis factor (GO:0034612)	endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA polymerase binding (GO:0070063)|RNA-dependent ATPase activity (GO:0008186)			NS(2)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(13)|lung(10)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		TCCCTTGGGAGAAAAAAACAC	0.358																																																	0													96.0	90.0	92.0					5																	112929060		2202	4300	6502	SO:0001583	missense	64848			AK000915	CCDS4113.1	5q22.3	2008-02-05			ENSG00000047188	ENSG00000047188			24721	protein-coding gene	gene with protein product						12477932	Standard	NM_022828		Approved	FLJ2194, FLJ10053, DKFZp564A186	uc003kqn.3	Q9H6S0	OTTHUMG00000128837	ENST00000161863.4:c.4273G>C	5.37:g.112929060G>C	ENSP00000161863:p.Glu1425Gln		B2RP66	Missense_Mutation	SNP	pfam_YTH_domain,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_DUF1605,pfam_R3H_ss-bd,superfamily_Ankyrin_rpt-contain_dom,smart_R3H_ss-bd,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_R3H_ss-bd,pfscan_YTH_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E1425Q	ENST00000161863.4	37	c.4273	CCDS4113.1	5	.	.	.	.	.	.	.	.	.	.	G	14.96	2.690903	0.48097	.	.	ENSG00000047188	ENST00000161863;ENST00000511372	T	0.02631	4.22	5.98	5.98	0.97165	.	0.314453	0.34531	N	0.003892	T	0.02380	0.0073	L	0.29908	0.895	0.80722	D	1	P	0.37466	0.596	B	0.26864	0.074	T	0.54938	-0.8218	10	0.62326	D	0.03	.	10.0269	0.42076	0.0693:0.0:0.7924:0.1383	.	1425	Q9H6S0	YTDC2_HUMAN	Q	1425;1335	ENSP00000161863:E1425Q	ENSP00000161863:E1425Q	E	+	1	0	YTHDC2	112956959	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.411000	0.52672	2.839000	0.97877	0.650000	0.86243	GAA	YTHDC2	-	NULL		0.358	YTHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YTHDC2	HGNC	protein_coding	OTTHUMT00000250776.2	G	NM_022828		112929060	+1	no_errors	ENST00000161863	ensembl	human	known	70_37	missense	SNP	1.000	C
ZBTB40	9923	genome.wustl.edu	37	1	22817988	22817988	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:22817988C>G	ENST00000375647.4	+	3	1000	c.793C>G	c.(793-795)Cta>Gta	p.L265V	ZBTB40_ENST00000404138.1_Missense_Mutation_p.L265V|ZBTB40_ENST00000374651.4_Missense_Mutation_p.L265V	NM_014870.3	NP_055685.3	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	265					bone mineralization (GO:0030282)|cellular response to DNA damage stimulus (GO:0006974)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(4)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		TTTAAAAAAACTAGAAATGTG	0.378																																																	0													78.0	83.0	81.0					1																	22817988		2203	4300	6503	SO:0001583	missense	9923			AB007947	CCDS224.1	1p36	2013-01-08			ENSG00000184677	ENSG00000184677		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	29045	protein-coding gene	gene with protein product		612106					Standard	NM_014870		Approved	KIAA0478, ZNF923	uc001bfu.2	Q9NUA8	OTTHUMG00000002897	ENST00000375647.4:c.793C>G	1.37:g.22817988C>G	ENSP00000364798:p.Leu265Val		O75066|Q5TFU5|Q8N1R1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.L265V	ENST00000375647.4	37	c.793	CCDS224.1	1	.	.	.	.	.	.	.	.	.	.	C	16.24	3.067454	0.55539	.	.	ENSG00000184677	ENST00000404138;ENST00000374649;ENST00000375647;ENST00000400239;ENST00000374651	D;D;D;D	0.83335	-1.71;-1.71;-1.71;-1.71	5.57	3.69	0.42338	.	0.000000	0.42821	D	0.000643	D	0.88355	0.6414	M	0.64997	1.995	0.35472	D	0.79744	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.987	D	0.91577	0.5276	10	0.87932	D	0	-8.0602	11.2996	0.49298	0.0:0.8483:0.0:0.1517	.	265;265	F8WAI8;Q9NUA8	.;ZBT40_HUMAN	V	265;219;265;265;265	ENSP00000384527:L265V;ENSP00000364798:L265V;ENSP00000383098:L265V;ENSP00000363782:L265V	ENSP00000363780:L219V	L	+	1	2	ZBTB40	22690575	1.000000	0.71417	0.993000	0.49108	0.957000	0.61999	1.759000	0.38420	1.356000	0.45884	0.585000	0.79938	CTA	ZBTB40	-	NULL		0.378	ZBTB40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB40	HGNC	protein_coding	OTTHUMT00000008094.1	C	NM_014870		22817988	+1	no_errors	ENST00000375647	ensembl	human	known	70_37	missense	SNP	1.000	G
ZBTB46	140685	genome.wustl.edu	37	20	62421190	62421190	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr20:62421190G>A	ENST00000245663.4	-	2	1071	c.921C>T	c.(919-921)ttC>ttT	p.F307F	ZBTB46_ENST00000480766.1_5'UTR|ZBTB46_ENST00000302995.2_Silent_p.F307F|ZBTB46_ENST00000395104.1_Silent_p.F307F	NM_025224.3	NP_079500.2	Q86UZ6	ZBT46_HUMAN	zinc finger and BTB domain containing 46	307					negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of monocyte differentiation (GO:0045656)|positive regulation of dendritic cell differentiation (GO:2001200)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)					CTCGGCTGCTGAACGGCCACC	0.647																																																	0													64.0	70.0	68.0					20																	62421190		2203	4299	6502	SO:0001819	synonymous_variant	140685			AK131482	CCDS13538.1	20q13.33	2013-01-08	2006-09-19	2006-09-19	ENSG00000130584	ENSG00000130584		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16094	protein-coding gene	gene with protein product	"""BTB-ZF protein expressed in effector lymphocytes"""	614639	"""BTB (POZ) domain containing 4"""	ZNF340, BTBD4			Standard	NM_025224		Approved	FLJ13502, RINZF, BZEL	uc002ygv.2	Q86UZ6	OTTHUMG00000033001	ENST00000245663.4:c.921C>T	20.37:g.62421190G>A			E1P5K9|Q5JWJ3|Q6GMV4|Q9BQK3|Q9H3Z8|Q9H3Z9	Silent	SNP	pfam_BTB_POZ,pfam_DUF3342,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.F307	ENST00000245663.4	37	c.921	CCDS13538.1	20																																																																																			ZBTB46	-	NULL		0.647	ZBTB46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB46	HGNC	protein_coding	OTTHUMT00000080232.2	G	NM_025224		62421190	-1	no_errors	ENST00000245663	ensembl	human	known	70_37	silent	SNP	0.999	A
ZC3H3	23144	genome.wustl.edu	37	8	144623587	144623587	+	Missense_Mutation	SNP	T	T	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr8:144623587T>A	ENST00000262577.5	-	1	36	c.5A>T	c.(4-6)gAg>gTg	p.E2V	7SK_ENST00000517300.1_RNA|RP11-661A12.5_ENST00000530600.1_RNA	NM_015117.2	NP_055932.2	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	2					mRNA polyadenylation (GO:0006378)|poly(A)+ mRNA export from nucleus (GO:0016973)|regulation of mRNA export from nucleus (GO:0010793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			CTCCTTTTCCTCCATCTCCCG	0.716																																																	0													39.0	45.0	43.0					8																	144623587		2203	4297	6500	SO:0001583	missense	23144			D63484	CCDS6402.1	8q24.3	2012-07-05	2005-06-02	2005-06-02	ENSG00000014164	ENSG00000014164		"""Zinc fingers, CCCH-type domain containing"""	28972	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 3"""	ZC3HDC3		8590280	Standard	NM_015117		Approved	KIAA0150	uc003yyd.2	Q8IXZ2	OTTHUMG00000165127	ENST00000262577.5:c.5A>T	8.37:g.144623587T>A	ENSP00000262577:p.Glu2Val		Q14163|Q8N4E2|Q9BUS4	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.E2V	ENST00000262577.5	37	c.5	CCDS6402.1	8	.	.	.	.	.	.	.	.	.	.	T	27.0	4.787416	0.90367	.	.	ENSG00000014164	ENST00000262577	T	0.04083	3.71	3.65	3.65	0.41850	.	0.000000	0.52532	D	0.000064	T	0.11110	0.0271	L	0.46157	1.445	0.42390	D	0.992525	D	0.58268	0.982	P	0.56700	0.804	T	0.02498	-1.1150	10	0.66056	D	0.02	-28.0714	11.8971	0.52661	0.0:0.0:0.0:1.0	.	2	Q8IXZ2	ZC3H3_HUMAN	V	2	ENSP00000262577:E2V	ENSP00000262577:E2V	E	-	2	0	ZC3H3	144694730	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	1.708000	0.37899	1.647000	0.50633	0.413000	0.27773	GAG	ZC3H3	-	NULL		0.716	ZC3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H3	HGNC	protein_coding	OTTHUMT00000382011.2	T	NM_015117		144623587	-1	no_errors	ENST00000262577	ensembl	human	known	70_37	missense	SNP	1.000	A
ZCCHC12	170261	genome.wustl.edu	37	X	117959558	117959558	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chrX:117959558G>A	ENST00000310164.2	+	4	858	c.351G>A	c.(349-351)atG>atA	p.M117I		NM_173798.2	NP_776159.1	Q6PEW1	ZCH12_HUMAN	zinc finger, CCHC domain containing 12	117					BMP signaling pathway (GO:0030509)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	22						tgcgagccatgaaattggtgt	0.512																																																	0													174.0	170.0	171.0					X																	117959558		2203	4300	6503	SO:0001583	missense	170261			AK122676	CCDS14574.1	Xq24	2013-10-11			ENSG00000174460	ENSG00000174460		"""Zinc fingers, CCHC domain containing"", ""Paraneoplastic Ma antigens"""	27273	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 7A"""	300701				21739307, 19578717	Standard	NM_173798		Approved	FLJ16123, SIZN, SIZN1, PNMA7A	uc004equ.3	Q6PEW1	OTTHUMG00000022261	ENST00000310164.2:c.351G>A	X.37:g.117959558G>A	ENSP00000308921:p.Met117Ile		B3KV48|Q6PID5|Q8N1C1	Missense_Mutation	SNP	superfamily_Znf_CCHC	p.M117I	ENST00000310164.2	37	c.351	CCDS14574.1	X	.	.	.	.	.	.	.	.	.	.	G	16.25	3.069959	0.55539	.	.	ENSG00000174460	ENST00000310164	T	0.09073	3.02	3.09	3.09	0.35607	.	0.000000	0.44097	D	0.000493	T	0.25158	0.0611	M	0.80028	2.48	0.28950	N	0.890467	P	0.52577	0.954	D	0.66351	0.943	T	0.01587	-1.1318	10	0.72032	D	0.01	-27.0226	8.7855	0.34818	0.0:0.0:1.0:0.0	.	117	Q6PEW1	ZCH12_HUMAN	I	117	ENSP00000308921:M117I	ENSP00000308921:M117I	M	+	3	0	ZCCHC12	117843586	1.000000	0.71417	0.989000	0.46669	0.978000	0.69477	3.765000	0.55272	1.801000	0.52704	0.594000	0.82650	ATG	ZCCHC12	-	NULL		0.512	ZCCHC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC12	HGNC	protein_coding	OTTHUMT00000058014.1	G	NM_173798		117959558	+1	no_errors	ENST00000310164	ensembl	human	known	70_37	missense	SNP	0.990	A
ZDHHC14	79683	genome.wustl.edu	37	6	157803287	157803287	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr6:157803287C>G	ENST00000359775.5	+	1	1123	c.234C>G	c.(232-234)ttC>ttG	p.F78L	ZDHHC14_ENST00000414563.2_Missense_Mutation_p.F78L			Q8IZN3	ZDH14_HUMAN	zinc finger, DHHC-type containing 14	78					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)	17		Breast(66;0.00586)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.9e-17)|BRCA - Breast invasive adenocarcinoma(81;5.8e-05)		GCGGACTCTTCTTCGCCTTCG	0.607																																																	0													45.0	51.0	49.0					6																	157803287		2203	4296	6499	SO:0001583	missense	79683			AF542388	CCDS5252.1, CCDS47510.1	6q25.3	2008-05-02			ENSG00000175048	ENSG00000175048		"""Zinc fingers, DHHC-type"""	20341	protein-coding gene	gene with protein product							Standard	NM_024630		Approved	FLJ20984, NEW1CP	uc003qqt.3	Q8IZN3	OTTHUMG00000015896	ENST00000359775.5:c.234C>G	6.37:g.157803287C>G	ENSP00000352821:p.Phe78Leu		A6NDB7|Q5JS07|Q5JS08|Q6PHS4|Q8IZN2|Q9H7F1	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.F78L	ENST00000359775.5	37	c.234	CCDS5252.1	6	.	.	.	.	.	.	.	.	.	.	C	35	5.536233	0.96460	.	.	ENSG00000175048	ENST00000359775;ENST00000414563;ENST00000538483	T;T	0.54866	0.56;0.55	4.53	4.53	0.55603	.	0.000000	0.85682	U	0.000000	T	0.66277	0.2773	M	0.82923	2.615	0.80722	D	1	P;D	0.58268	0.751;0.982	P;P	0.60068	0.562;0.868	T	0.74677	-0.3585	10	0.72032	D	0.01	-13.0933	17.2836	0.87135	0.0:1.0:0.0:0.0	.	78;78	Q8IZN3;Q8IZN3-2	ZDH14_HUMAN;.	L	78;78;82	ENSP00000352821:F78L;ENSP00000410713:F78L	ENSP00000352821:F78L	F	+	3	2	ZDHHC14	157723275	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.721000	0.61951	1.690000	0.51089	0.460000	0.39030	TTC	ZDHHC14	-	NULL		0.607	ZDHHC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC14	HGNC	protein_coding	OTTHUMT00000042841.2	C	NM_153746		157803287	+1	no_errors	ENST00000359775	ensembl	human	known	70_37	missense	SNP	1.000	G
ZDHHC8	29801	genome.wustl.edu	37	22	20127384	20127384	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr22:20127384G>A	ENST00000334554.7	+	4	667	c.526G>A	c.(526-528)Gag>Aag	p.E176K	ZDHHC8_ENST00000320602.7_Intron|ZDHHC8_ENST00000405930.3_Missense_Mutation_p.E176K|ZDHHC8_ENST00000468112.1_Intron	NM_013373.3	NP_037505.1	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC-type containing 8	176					locomotory behavior (GO:0007626)|protein palmitoylation (GO:0018345)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	20	Colorectal(54;0.0993)					GAACCACGCTGAGGGGCTGGG	0.602																																																	0													64.0	55.0	58.0					22																	20127384		2203	4300	6503	SO:0001583	missense	29801			AB033118	CCDS13776.1, CCDS54502.1	22q11.21	2009-10-06		2003-02-28	ENSG00000099904	ENSG00000099904		"""Zinc fingers, DHHC-type"""	18474	protein-coding gene	gene with protein product		608784				10574462, 15184899	Standard	NM_013373		Approved	ZNF378, KIAA1292	uc002zrr.2	Q9ULC8	OTTHUMG00000150499	ENST00000334554.7:c.526G>A	22.37:g.20127384G>A	ENSP00000334490:p.Glu176Lys		Q2TGE9|Q6ICL1|Q6ZNF5|Q7Z6L9	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,superfamily_Plexin-like_fold,pfscan_Znf_DHHC_palmitoyltrfase	p.E176K	ENST00000334554.7	37	c.526	CCDS13776.1	22	.	.	.	.	.	.	.	.	.	.	G	17.28	3.350480	0.61183	.	.	ENSG00000099904	ENST00000436518;ENST00000334554;ENST00000405930	T;T;T	0.24151	1.87;1.87;1.87	3.59	3.59	0.41128	.	0.154597	0.42821	D	0.000658	T	0.24392	0.0591	L	0.42686	1.345	0.80722	D	1	P;B	0.36789	0.57;0.242	B;B	0.37198	0.219;0.243	T	0.08597	-1.0714	10	0.34782	T	0.22	.	16.101	0.81172	0.0:0.0:1.0:0.0	.	176;176	Q9ULC8-3;Q9ULC8	.;ZDHC8_HUMAN	K	165;176;176	ENSP00000412807:E165K;ENSP00000334490:E176K;ENSP00000384716:E176K	ENSP00000334490:E176K	E	+	1	0	ZDHHC8	18507384	1.000000	0.71417	0.830000	0.32933	0.683000	0.39861	9.296000	0.96104	1.946000	0.56461	0.462000	0.41574	GAG	ZDHHC8	-	NULL		0.602	ZDHHC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC8	HGNC	protein_coding	OTTHUMT00000318564.1	G	NM_013373		20127384	+1	no_errors	ENST00000405930	ensembl	human	known	70_37	missense	SNP	0.997	A
ZFX	7543	genome.wustl.edu	37	X	24197540	24197540	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chrX:24197540C>T	ENST00000379177.1	+	6	726	c.299C>T	c.(298-300)tCa>tTa	p.S100L	ZFX_ENST00000338565.3_Missense_Mutation_p.S100L|ZFX_ENST00000539115.1_Intron|ZFX_ENST00000304543.5_Missense_Mutation_p.S100L|ZFX_ENST00000540034.1_Missense_Mutation_p.S139L|ZFX_ENST00000379188.3_Missense_Mutation_p.S100L|ZFX_ENST00000459724.1_Intron	NM_001178085.1|NM_003410.3	NP_001171556.1|NP_003401.2	P17010	ZFX_HUMAN	zinc finger protein, X-linked	100					death (GO:0016265)|fertilization (GO:0009566)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|parental behavior (GO:0060746)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)			cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|prostate(1)	24						GTGCTGGACTCAGATGTAACT	0.428																																					Esophageal Squamous(20;306 562 7346 32868 37983)												0													292.0	229.0	250.0					X																	24197540		2203	4300	6503	SO:0001583	missense	7543				CCDS14211.1, CCDS55390.1	Xp22.1-p21.3	2013-01-08			ENSG00000005889	ENSG00000005889		"""Zinc fingers, C2H2-type"""	12869	protein-coding gene	gene with protein product		314980					Standard	NM_003410		Approved	ZNF926	uc022bua.1	P17010	OTTHUMG00000021264	ENST00000379177.1:c.299C>T	X.37:g.24197540C>T	ENSP00000368475:p.Ser100Leu		B9EG97|O43668|Q8WYJ8	Missense_Mutation	SNP	pfam_Transcrp_activ_Zfx/Zfy-dom,pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S139L	ENST00000379177.1	37	c.416	CCDS14211.1	X	.	.	.	.	.	.	.	.	.	.	C	13.59	2.283177	0.40394	.	.	ENSG00000005889	ENST00000428571;ENST00000379188;ENST00000536464;ENST00000379177;ENST00000304543;ENST00000540034;ENST00000338565	T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97;0.97	6.17	6.17	0.99709	Transcriptional activator, Zfx / Zfy domain (1);	0.486739	0.18944	N	0.126846	T	0.37237	0.0996	L	0.33485	1.01	0.80722	D	1	B;B;B;B	0.24043	0.001;0.027;0.096;0.004	B;B;B;B	0.28385	0.006;0.023;0.089;0.01	T	0.09684	-1.0663	10	0.36615	T	0.2	-8.8885	15.872	0.79127	0.0:0.8685:0.1315:0.0	.	139;100;100;104	B9EG97;F5H6Z8;P17010;Q59EB9	.;.;ZFX_HUMAN;.	L	100;100;100;100;100;139;100	ENSP00000411637:S100L;ENSP00000368486:S100L;ENSP00000368475:S100L;ENSP00000304985:S100L;ENSP00000441382:S139L;ENSP00000343384:S100L	ENSP00000304985:S100L	S	+	2	0	ZFX	24107461	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.650000	0.37292	2.618000	0.88619	0.600000	0.82982	TCA	ZFX	-	pfam_Transcrp_activ_Zfx/Zfy-dom		0.428	ZFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFX	HGNC	protein_coding	OTTHUMT00000056084.1	C	NM_003410		24197540	+1	no_errors	ENST00000540034	ensembl	human	known	70_37	missense	SNP	1.000	T
ZFYVE28	57732	genome.wustl.edu	37	4	2343313	2343313	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr4:2343313G>A	ENST00000290974.2	-	3	549	c.210C>T	c.(208-210)atC>atT	p.I70I	ZFYVE28_ENST00000509171.1_Silent_p.I23I|ZFYVE28_ENST00000511071.1_Silent_p.I70I|ZFYVE28_ENST00000505421.1_5'Flank|ZFYVE28_ENST00000503000.1_Silent_p.I70I|ZFYVE28_ENST00000515312.1_5'UTR|ZFYVE28_ENST00000515169.1_5'UTR	NM_020972.2	NP_066023.2	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	70					negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	31						ACTCATCCATGATCTGGTTAA	0.567																																																	0													74.0	65.0	68.0					4																	2343313		2203	4300	6503	SO:0001819	synonymous_variant	57732			AK126692	CCDS33942.1, CCDS54708.1, CCDS54709.1, CCDS54710.1, CCDS54711.1, CCDS54712.1	4p16.3	2008-05-02			ENSG00000159733	ENSG00000159733		"""Zinc fingers, FYVE domain containing"""	29334	protein-coding gene	gene with protein product		614176				10997877	Standard	NM_020972		Approved	KIAA1643	uc003gex.2	Q9HCC9	OTTHUMG00000160292	ENST00000290974.2:c.210C>T	4.37:g.2343313G>A			B2RP83|B3KX50|B7Z1Q7|B7Z2G9|B7Z2M2|B7ZB19|E9PB54|E9PB64|E9PG77|Q7Z6J3	Silent	SNP	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.I70	ENST00000290974.2	37	c.210	CCDS33942.1	4																																																																																			ZFYVE28	-	NULL		0.567	ZFYVE28-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFYVE28	HGNC	protein_coding	OTTHUMT00000360078.1	G	XM_035371		2343313	-1	no_errors	ENST00000290974	ensembl	human	known	70_37	silent	SNP	1.000	A
ZNF133	7692	genome.wustl.edu	37	20	18297585	18297585	+	3'UTR	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr20:18297585C>T	ENST00000316358.4	+	0	2187				ZNF133_ENST00000377671.3_3'UTR|RP4-568F9.3_ENST00000436848.1_RNA|ZNF133_ENST00000538547.1_3'UTR|ZNF133_ENST00000396026.3_3'UTR|ZNF133_ENST00000462170.1_3'UTR|ZNF133_ENST00000401790.1_3'UTR|ZNF133_ENST00000535822.1_3'UTR	NM_001282998.1|NM_001282999.1|NM_001283000.1|NM_001283001.1|NM_001283008.1	NP_001269927.1|NP_001269928.1|NP_001269929.1|NP_001269930.1|NP_001269937.1	P52736	ZN133_HUMAN	zinc finger protein 133						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	26						ACTAAGTCTTCTCCATGTTTT	0.393																																																	0																																										SO:0001624	3_prime_UTR_variant	7692			AK123005	CCDS13134.1, CCDS63234.1, CCDS63235.1, CCDS74703.1, CCDS74704.1	20p11.23	2013-01-08	2006-06-13		ENSG00000125846	ENSG00000125846		"""Zinc fingers, C2H2-type"", ""-"""	12917	protein-coding gene	gene with protein product		604075	"""zinc finger protein 150 (pHZ-66)"", ""zinc finger protein 133 (clone pHZ-13)"""	ZNF150		7557990, 7649249	Standard	XM_005260819		Approved	pHZ-13, pHZ-66	uc010gcs.3	P52736	OTTHUMG00000031965	ENST00000316358.4:c.*125C>T	20.37:g.18297585C>T			A8K5S4|B4DHU7|B4DIB8|B7ZAS1|F5H289|J3KQ11|J3KQJ0|Q53XU1|Q5JXV8|Q9BUV2|Q9H443	RNA	SNP	-	NULL	ENST00000316358.4	37	NULL		20																																																																																			ZNF133	-	-		0.393	ZNF133-002	KNOWN	basic|appris_candidate	protein_coding	ZNF133	HGNC	protein_coding	OTTHUMT00000127616.1	C	NM_003434		18297585	+1	no_errors	ENST00000462170	ensembl	human	known	70_37	rna	SNP	0.080	T
ZNF263	10127	genome.wustl.edu	37	16	3335110	3335110	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr16:3335110C>T	ENST00000219069.5	+	2	1315	c.439C>T	c.(439-441)Ctg>Ttg	p.L147L	ZNF263_ENST00000573578.1_Intron|ZNF263_ENST00000538765.1_Intron|ZNF263_ENST00000574253.1_Intron	NM_005741.4	NP_005732.2	O14978	ZN263_HUMAN	zinc finger protein 263	147					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(4)|urinary_tract(3)	20						GCCTTTGCCTCTGGAAACAGC	0.592																																																	0													76.0	68.0	71.0					16																	3335110		2197	4300	6497	SO:0001819	synonymous_variant	10127			AC004232	CCDS10499.1	16p13.3	2013-01-09			ENSG00000006194	ENSG00000006194		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13056	protein-coding gene	gene with protein product		604191				9256059	Standard	NM_005741		Approved	FPM315, ZKSCAN12, ZSCAN44	uc002cuq.3	O14978	OTTHUMG00000129323	ENST00000219069.5:c.439C>T	16.37:g.3335110C>T			B2R634|O43387|Q96H95	Silent	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.L147	ENST00000219069.5	37	c.439	CCDS10499.1	16																																																																																			ZNF263	-	smart_Tscrpt_reg_SCAN		0.592	ZNF263-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF263	HGNC	protein_coding	OTTHUMT00000251463.2	C			3335110	+1	no_errors	ENST00000219069	ensembl	human	known	70_37	silent	SNP	1.000	T
ZNF28	7576	genome.wustl.edu	37	19	53303790	53303790	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:53303790C>T	ENST00000457749.2	-	4	1427	c.1308G>A	c.(1306-1308)gaG>gaA	p.E436E	ZNF28_ENST00000360272.4_Silent_p.E383E|ZNF28_ENST00000414252.2_Silent_p.E383E|ZNF28_ENST00000438150.2_Silent_p.E383E	NM_006969.3	NP_008900.3	P17035	ZNF28_HUMAN	zinc finger protein 28	436					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(10)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		TGTAAGGCTTCTCTCCAGTGT	0.373																																																	0													112.0	118.0	116.0					19																	53303790		2203	4300	6503	SO:0001819	synonymous_variant	7576			X52355	CCDS33093.1, CCDS33093.2	19q13.41	2013-01-08	2006-05-10		ENSG00000198538	ENSG00000198538		"""Zinc fingers, C2H2-type"", ""-"""	13073	protein-coding gene	gene with protein product			"""zinc finger protein 28 (KOX 24)"""				Standard	NR_036599		Approved	KOX24, DKFZp781D0275	uc002qad.3	P17035	OTTHUMG00000154564	ENST00000457749.2:c.1308G>A	19.37:g.53303790C>T			A8KAK9|B4E3G0|B9EIK7|Q5H9V1|Q5HYM9|Q6ZML9|Q6ZN56	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E436	ENST00000457749.2	37	c.1308	CCDS33093.2	19																																																																																			ZNF28	-	pfscan_Znf_C2H2		0.373	ZNF28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF28	HGNC	protein_coding	OTTHUMT00000336038.2	C	NM_006969		53303790	-1	no_errors	ENST00000457749	ensembl	human	known	70_37	silent	SNP	1.000	T
ZNF292	23036	genome.wustl.edu	37	6	87966072	87966072	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr6:87966072G>C	ENST00000369577.3	+	8	2768	c.2725G>C	c.(2725-2727)Gag>Cag	p.E909Q	ZNF292_ENST00000339907.4_Missense_Mutation_p.E904Q	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	909						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		TTCTGCCTCTGAGCTCAGGCA	0.423																																																	0													73.0	69.0	71.0					6																	87966072		1924	4127	6051	SO:0001583	missense	23036			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.2725G>C	6.37:g.87966072G>C	ENSP00000358590:p.Glu909Gln		Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E909Q	ENST00000369577.3	37	c.2725	CCDS47457.1	6	.	.	.	.	.	.	.	.	.	.	G	4.609	0.113244	0.08831	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.07327	3.2;3.21	5.77	4.89	0.63831	.	0.751962	0.13465	N	0.385839	T	0.02267	0.0070	N	0.19112	0.55	0.09310	N	1	B	0.27068	0.167	B	0.28011	0.085	T	0.42498	-0.9448	10	0.27785	T	0.31	.	10.9329	0.47228	0.1413:0.0:0.8587:0.0	.	909	O60281	ZN292_HUMAN	Q	909;904	ENSP00000358590:E909Q;ENSP00000342847:E904Q	ENSP00000342847:E904Q	E	+	1	0	ZNF292	88022791	0.003000	0.15002	0.924000	0.36721	0.884000	0.51177	1.188000	0.32102	2.729000	0.93468	0.591000	0.81541	GAG	ZNF292	-	NULL		0.423	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF292	HGNC	protein_coding	OTTHUMT00000376192.2	G	NM_015021		87966072	+1	no_errors	ENST00000369577	ensembl	human	known	70_37	missense	SNP	0.012	C
ZNF292	23036	genome.wustl.edu	37	6	87966431	87966431	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr6:87966431G>C	ENST00000369577.3	+	8	3127	c.3084G>C	c.(3082-3084)ttG>ttC	p.L1028F	ZNF292_ENST00000339907.4_Missense_Mutation_p.L1023F	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	1028						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		TGAACAACTTGATGACCTTTT	0.328																																																	0													60.0	57.0	58.0					6																	87966431		1839	4084	5923	SO:0001583	missense	23036			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.3084G>C	6.37:g.87966431G>C	ENSP00000358590:p.Leu1028Phe		Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L1028F	ENST00000369577.3	37	c.3084	CCDS47457.1	6	.	.	.	.	.	.	.	.	.	.	G	15.62	2.887366	0.52014	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.11712	2.75;2.76	5.55	2.53	0.30540	.	0.559497	0.18587	N	0.136821	T	0.06645	0.0170	L	0.46157	1.445	0.34535	D	0.709657	D	0.57899	0.981	P	0.52758	0.708	T	0.20472	-1.0274	10	0.72032	D	0.01	.	2.9466	0.05848	0.2949:0.0:0.3773:0.3279	.	1028	O60281	ZN292_HUMAN	F	1028;1023	ENSP00000358590:L1028F;ENSP00000342847:L1023F	ENSP00000342847:L1023F	L	+	3	2	ZNF292	88023150	0.821000	0.29204	0.992000	0.48379	0.987000	0.75469	-0.029000	0.12329	0.611000	0.30052	0.591000	0.81541	TTG	ZNF292	-	NULL		0.328	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF292	HGNC	protein_coding	OTTHUMT00000376192.2	G	NM_015021		87966431	+1	no_errors	ENST00000369577	ensembl	human	known	70_37	missense	SNP	0.991	C
ZNF32	7580	genome.wustl.edu	37	10	44139651	44139651	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr10:44139651C>T	ENST00000395797.1	-	3	857	c.669G>A	c.(667-669)agG>agA	p.R223R	ZNF32_ENST00000374433.2_Silent_p.R223R|ZNF32-AS3_ENST00000458063.1_RNA|ZNF32-AS2_ENST00000418966.1_RNA|ZNF32-AS1_ENST00000453284.1_RNA|ZNF32_ENST00000485351.1_5'Flank	NM_001005368.1	NP_001005368.1	P17041	ZNF32_HUMAN	zinc finger protein 32	223					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|ovary(1)|pancreas(1)|urinary_tract(1)	14		all_neural(218;0.0182)|Ovarian(717;0.0443)|Renal(717;0.157)		Lung(62;0.179)		GGAAACTCTTCCTGCACTGGG	0.498																																																	0													105.0	103.0	104.0					10																	44139651		2203	4300	6503	SO:0001819	synonymous_variant	7580			U69645	CCDS7206.1	10q22-q25	2013-01-08	2006-05-11		ENSG00000169740	ENSG00000169740		"""Zinc fingers, C2H2-type"""	13095	protein-coding gene	gene with protein product		194539	"""zinc finger protein 32 (KOX 30)"""				Standard	XM_005271822		Approved	KOX30	uc001jbc.3	P17041	OTTHUMG00000018043	ENST00000395797.1:c.669G>A	10.37:g.44139651C>T			Q92951	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R223	ENST00000395797.1	37	c.669	CCDS7206.1	10																																																																																			ZNF32	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.498	ZNF32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF32	HGNC	protein_coding	OTTHUMT00000047723.1	C	NM_006973		44139651	-1	no_errors	ENST00000374433	ensembl	human	known	70_37	silent	SNP	1.000	T
ZNF365	22891	genome.wustl.edu	37	10	64135973	64135973	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr10:64135973G>A	ENST00000395254.3	+	2	301	c.21G>A	c.(19-21)gaG>gaA	p.E7E	ZNF365_ENST00000395255.3_Silent_p.E7E|ZNF365_ENST00000410046.3_Silent_p.E7E|ZNF365_ENST00000466727.1_Intron	NM_014951.2	NP_055766.2	Q70YC4	TALAN_HUMAN	zinc finger protein 365	0										breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	Prostate(12;0.0297)|all_hematologic(501;0.228)					AGGCTTTTGAGGAAAGCAGAT	0.468																																																	0													76.0	81.0	80.0					10																	64135973		2203	4300	6503	SO:0001819	synonymous_variant	22891			AB020651	CCDS7264.1, CCDS7265.1, CCDS31209.1, CCDS41531.1	10q21.2	2008-10-28			ENSG00000138311	ENSG00000138311		"""Zinc fingers, C2H2-type"""	18194	protein-coding gene	gene with protein product	"""Talanin"""	607818				10048485, 12740763	Standard	NM_199450		Approved	KIAA0844, UAN	uc001jmc.2	Q70YC4	OTTHUMG00000018302	ENST00000395254.3:c.21G>A	10.37:g.64135973G>A				Silent	SNP	NULL	p.E7	ENST00000395254.3	37	c.21	CCDS31209.1	10																																																																																			ZNF365	-	NULL		0.468	ZNF365-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF365	HGNC	protein_coding	OTTHUMT00000048238.2	G	NM_014951		64135973	+1	no_errors	ENST00000410046	ensembl	human	known	70_37	silent	SNP	1.000	A
ZNF366	167465	genome.wustl.edu	37	5	71756459	71756459	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr5:71756459G>C	ENST00000318442.5	-	2	1355	c.865C>G	c.(865-867)Ctc>Gtc	p.L289V		NM_152625.1	NP_689838.1	Q8N895	ZN366_HUMAN	zinc finger protein 366	289					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|estrogen receptor binding (GO:0030331)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	35		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		TGCTTGAAGAGCTTCCCGCAG	0.632																																																	0													115.0	103.0	107.0					5																	71756459		2203	4300	6503	SO:0001583	missense	167465			AK097115	CCDS4015.1	5q13.1	2013-01-08			ENSG00000178175	ENSG00000178175		"""Zinc fingers, C2H2-type"""	18316	protein-coding gene	gene with protein product		610159					Standard	NM_152625		Approved	FLJ39796	uc003kce.1	Q8N895	OTTHUMG00000100965	ENST00000318442.5:c.865C>G	5.37:g.71756459G>C	ENSP00000313158:p.Leu289Val		Q5HYI9|Q7RTV4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L289V	ENST00000318442.5	37	c.865	CCDS4015.1	5	.	.	.	.	.	.	.	.	.	.	G	22.8	4.342776	0.82022	.	.	ENSG00000178175	ENST00000318442	T	0.75367	-0.93	5.79	5.79	0.91817	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000018	T	0.74680	0.3748	N	0.05012	-0.13	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.77135	-0.2699	10	0.33940	T	0.23	-48.7211	20.0407	0.97588	0.0:0.0:1.0:0.0	.	289	Q8N895	ZN366_HUMAN	V	289	ENSP00000313158:L289V	ENSP00000313158:L289V	L	-	1	0	ZNF366	71792215	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.869000	0.99810	2.746000	0.94184	0.561000	0.74099	CTC	ZNF366	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.632	ZNF366-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF366	HGNC	protein_coding	OTTHUMT00000218574.3	G			71756459	-1	no_errors	ENST00000318442	ensembl	human	known	70_37	missense	SNP	1.000	C
ZNF396	252884	genome.wustl.edu	37	18	32954014	32954014	+	Silent	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr18:32954014C>T	ENST00000589332.1	-	2	374	c.243G>A	c.(241-243)ctG>ctA	p.L81L	ZNF396_ENST00000586687.1_Silent_p.L81L|ZNF396_ENST00000306346.1_Silent_p.L81L			Q96N95	ZN396_HUMAN	zinc finger protein 396	81	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)	7						CTTCCGGCCTCAGCCAGAGAT	0.597																																																	0													67.0	68.0	68.0					18																	32954014		2203	4300	6503	SO:0001819	synonymous_variant	252884			AK055775	CCDS11913.1	18p12	2013-01-09			ENSG00000186496	ENSG00000186496		"""-"", ""Zinc fingers, C2H2-type"""	18824	protein-coding gene	gene with protein product		609600					Standard	NM_145756		Approved	ZSCAN14, FLJ31213	uc010xcf.1	Q96N95	OTTHUMG00000132562	ENST00000589332.1:c.243G>A	18.37:g.32954014C>T			A1L3V0|Q8NF98|Q8TD80	Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.L81	ENST00000589332.1	37	c.243		18																																																																																			ZNF396	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN		0.597	ZNF396-002	KNOWN	basic|appris_principal	protein_coding	ZNF396	HGNC	protein_coding	OTTHUMT00000255766.1	C	NM_145756		32954014	-1	no_errors	ENST00000589332	ensembl	human	known	70_37	silent	SNP	0.999	T
ZNF436	80818	genome.wustl.edu	37	1	23688685	23688685	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:23688685C>T	ENST00000314011.4	-	4	1326	c.1190G>A	c.(1189-1191)cGa>cAa	p.R397Q	ZNF436_ENST00000374608.3_Missense_Mutation_p.R397Q	NM_001077195.1	NP_001070663.1	Q9C0F3	ZN436_HUMAN	zinc finger protein 436	397					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;5.97e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000977)|KIRC - Kidney renal clear cell carcinoma(1967;0.00336)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		ACCAAAGCTTCGCCAACACTC	0.483																																																	0													98.0	101.0	100.0					1																	23688685		2203	4300	6503	SO:0001583	missense	80818			AB051497	CCDS233.1	1p36	2013-01-08			ENSG00000125945	ENSG00000125945		"""Zinc fingers, C2H2-type"", ""-"""	20814	protein-coding gene	gene with protein product		611703				11214970	Standard	NM_001077195		Approved	KIAA1710, Zfp46	uc001bgt.3	Q9C0F3	OTTHUMG00000003232	ENST00000314011.4:c.1190G>A	1.37:g.23688685C>T	ENSP00000313582:p.Arg397Gln		Q658I9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R397Q	ENST00000314011.4	37	c.1190	CCDS233.1	1	.	.	.	.	.	.	.	.	.	.	C	17.51	3.406930	0.62399	.	.	ENSG00000125945	ENST00000314011;ENST00000374608	T;T	0.07567	3.18;3.18	5.61	5.61	0.85477	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.47852	D	0.000209	T	0.06554	0.0168	L	0.31120	0.905	0.35354	D	0.787657	P	0.34800	0.469	B	0.27796	0.083	T	0.16276	-1.0408	10	0.72032	D	0.01	-13.1307	10.8753	0.46906	0.0:0.9149:0.0:0.0851	.	397	Q9C0F3	ZN436_HUMAN	Q	397	ENSP00000313582:R397Q;ENSP00000363736:R397Q	ENSP00000313582:R397Q	R	-	2	0	ZNF436	23561272	0.996000	0.38824	1.000000	0.80357	0.999000	0.98932	3.212000	0.51145	2.826000	0.97356	0.655000	0.94253	CGA	ZNF436	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.483	ZNF436-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF436	HGNC	protein_coding	OTTHUMT00000008908.1	C	NM_030634		23688685	-1	no_errors	ENST00000314011	ensembl	human	known	70_37	missense	SNP	1.000	T
ZNF462	58499	genome.wustl.edu	37	9	109691272	109691272	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr9:109691272G>A	ENST00000277225.5	+	3	5368	c.5079G>A	c.(5077-5079)aaG>aaA	p.K1693K	ZNF462_ENST00000457913.1_Silent_p.K1693K|ZNF462_ENST00000441147.2_Silent_p.K538K			Q96JM2	ZN462_HUMAN	zinc finger protein 462	1693					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						CAGAAGGCAAGAACAACCTCT	0.562																																																	0													120.0	104.0	109.0					9																	109691272		2203	4300	6503	SO:0001819	synonymous_variant	58499			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.5079G>A	9.37:g.109691272G>A			Q5T0T4|Q8N408	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K1693	ENST00000277225.5	37	c.5079	CCDS35096.1	9																																																																																			ZNF462	-	NULL		0.562	ZNF462-001	KNOWN	basic|CCDS	protein_coding	ZNF462	HGNC	protein_coding	OTTHUMT00000053532.2	G	NM_021224		109691272	+1	no_errors	ENST00000457913	ensembl	human	known	70_37	silent	SNP	1.000	A
ZNF467	168544	genome.wustl.edu	37	7	149461892	149461892	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr7:149461892C>T	ENST00000302017.3	-	5	2112	c.1699G>A	c.(1699-1701)Gaa>Aaa	p.E567K	ZNF467_ENST00000484747.1_Intron	NM_207336.1	NP_997219.1	Q7Z7K2	ZN467_HUMAN	zinc finger protein 467	567					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|urinary_tract(1)	13	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TGGGCGGCTTCGCCGTGAATG	0.716																																																	0													17.0	20.0	19.0					7																	149461892		2090	4233	6323	SO:0001583	missense	168544			BC029296	CCDS5899.1	7q36.1	2013-01-08			ENSG00000181444	ENSG00000181444		"""Zinc fingers, C2H2-type"""	23154	protein-coding gene	gene with protein product		614040				12426389	Standard	NM_207336		Approved	EZI, Zfp467	uc003wgd.2	Q7Z7K2	OTTHUMG00000157883	ENST00000302017.3:c.1699G>A	7.37:g.149461892C>T	ENSP00000304769:p.Glu567Lys			Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E567K	ENST00000302017.3	37	c.1699	CCDS5899.1	7	.	.	.	.	.	.	.	.	.	.	C	9.364	1.068820	0.20147	.	.	ENSG00000181444	ENST00000302017	T	0.07688	3.17	3.97	3.06	0.35304	.	0.648009	0.11830	U	0.525272	T	0.06325	0.0163	N	0.24115	0.695	0.09310	N	1	B	0.32731	0.382	B	0.23018	0.043	T	0.30031	-0.9992	10	0.66056	D	0.02	0.0406	12.1134	0.53852	0.0:0.8251:0.1749:0.0	.	567	Q7Z7K2	ZN467_HUMAN	K	567	ENSP00000304769:E567K	ENSP00000304769:E567K	E	-	1	0	ZNF467	149092825	0.000000	0.05858	0.015000	0.15790	0.064000	0.16182	0.952000	0.29149	0.860000	0.35481	0.462000	0.41574	GAA	ZNF467	-	NULL		0.716	ZNF467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF467	HGNC	protein_coding	OTTHUMT00000349833.1	C	NM_207336		149461892	-1	no_errors	ENST00000302017	ensembl	human	known	70_37	missense	SNP	0.021	T
ZNF506	440515	genome.wustl.edu	37	19	19905766	19905766	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:19905766C>G	ENST00000540806.2	-	4	1018	c.930G>C	c.(928-930)gaG>gaC	p.E310D	CTC-559E9.6_ENST00000589657.1_RNA|CTC-559E9.6_ENST00000591884.1_RNA|ZNF506_ENST00000450683.2_Missense_Mutation_p.E278D|CTC-559E9.4_ENST00000590274.1_lincRNA|ZNF506_ENST00000587461.1_Intron|ZNF506_ENST00000443905.2_Missense_Mutation_p.E310D			Q5JVG8	ZN506_HUMAN	zinc finger protein 506	310					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(7)|lung(3)|skin(1)|stomach(1)	14						TGTAGGGTTTCTCTCCAGTAT	0.368																																																	0													53.0	58.0	56.0					19																	19905766		2196	4298	6494	SO:0001583	missense	440515			AK095575	CCDS42531.1, CCDS46027.1	19p13.11	2013-01-08				ENSG00000081665		"""Zinc fingers, C2H2-type"", ""-"""	23780	protein-coding gene	gene with protein product							Standard	NM_001099269		Approved	DKFZp761G1812	uc010eci.2	Q5JVG8		ENST00000540806.2:c.930G>C	19.37:g.19905766C>G	ENSP00000440625:p.Glu310Asp		B3KTH6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E310D	ENST00000540806.2	37	c.930	CCDS42531.1	19	.	.	.	.	.	.	.	.	.	.	-	14.62	2.589078	0.46110	.	.	ENSG00000081665	ENST00000443905;ENST00000540806;ENST00000450683	T;T;T	0.26810	1.71;1.71;1.71	0.974	0.974	0.19715	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.40119	0.1104	L	0.58810	1.83	0.35240	D	0.777754	B;D	0.57257	0.157;0.979	B;D	0.69479	0.132;0.964	T	0.49390	-0.8945	9	0.59425	D	0.04	.	7.3873	0.26891	0.0:1.0:0.0:0.0	.	310;278	Q5JVG8;Q5JVG8-2	ZN506_HUMAN;.	D	310;310;278	ENSP00000393835:E310D;ENSP00000440625:E310D;ENSP00000408892:E278D	ENSP00000393835:E310D	E	-	3	2	ZNF506	19766766	0.994000	0.37717	0.567000	0.28434	0.528000	0.34623	1.258000	0.32944	0.423000	0.26033	0.423000	0.28283	GAG	ZNF506	-	pfscan_Znf_C2H2		0.368	ZNF506-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	ZNF506	HGNC	protein_coding	OTTHUMT00000460794.1	C	XM_036218		19905766	-1	no_errors	ENST00000443905	ensembl	human	known	70_37	missense	SNP	1.000	G
ZNF532	55205	genome.wustl.edu	37	18	56606737	56606737	+	Silent	SNP	T	T	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr18:56606737T>C	ENST00000336078.4	+	6	3365	c.2589T>C	c.(2587-2589)ggT>ggC	p.G863G	ZNF532_ENST00000591083.1_Silent_p.G863G|ZNF532_ENST00000591808.1_Silent_p.G863G|ZNF532_ENST00000591230.1_Silent_p.G863G|ZNF532_ENST00000589288.1_Silent_p.G863G	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	863					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						ACATTCAAGGTTCTCACTGTG	0.453																																																	0													193.0	166.0	175.0					18																	56606737		2203	4297	6500	SO:0001819	synonymous_variant	55205			AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.2589T>C	18.37:g.56606737T>C			Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G863	ENST00000336078.4	37	c.2589	CCDS11969.1	18																																																																																			ZNF532	-	smart_Znf_C2H2-like		0.453	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF532	HGNC	protein_coding	OTTHUMT00000256130.1	T	NM_018181		56606737	+1	no_errors	ENST00000336078	ensembl	human	known	70_37	silent	SNP	0.958	C
ZNF532	55205	genome.wustl.edu	37	18	56606770	56606770	+	Silent	SNP	T	T	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr18:56606770T>C	ENST00000336078.4	+	6	3398	c.2622T>C	c.(2620-2622)atT>atC	p.I874I	ZNF532_ENST00000591083.1_Silent_p.I874I|ZNF532_ENST00000591808.1_Silent_p.I874I|ZNF532_ENST00000591230.1_Silent_p.I874I|ZNF532_ENST00000589288.1_Silent_p.I874I	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	874					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						AGTGTCCTATTTGTCCAATGG	0.458																																																	0													162.0	138.0	146.0					18																	56606770		2203	4300	6503	SO:0001819	synonymous_variant	55205			AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.2622T>C	18.37:g.56606770T>C			Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.I874	ENST00000336078.4	37	c.2622	CCDS11969.1	18																																																																																			ZNF532	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.458	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF532	HGNC	protein_coding	OTTHUMT00000256130.1	T	NM_018181		56606770	+1	no_errors	ENST00000336078	ensembl	human	known	70_37	silent	SNP	1.000	C
ZNF564	163050	genome.wustl.edu	37	19	12637494	12637494	+	Silent	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:12637494G>C	ENST00000339282.7	-	4	1624	c.1428C>G	c.(1426-1428)ccC>ccG	p.P476P	ZNF709_ENST00000428311.1_Intron|CTD-2192J16.20_ENST00000593682.1_3'UTR	NM_144976.3	NP_659413.1	Q8TBZ8	ZN564_HUMAN	zinc finger protein 564	476					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P476P(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18						TACATTCATAGGGTTTTTCTC	0.383																																																	1	Substitution - coding silent(1)	lung(1)											121.0	127.0	125.0					19																	12637494		2195	4299	6494	SO:0001819	synonymous_variant	163050			BC028367	CCDS42505.1	19p13.2	2013-09-19			ENSG00000249709	ENSG00000249709		"""Zinc fingers, C2H2-type"", ""-"""	31106	protein-coding gene	gene with protein product							Standard	NM_144976		Approved	MGC26914		Q8TBZ8	OTTHUMG00000156418	ENST00000339282.7:c.1428C>G	19.37:g.12637494G>C			B9EGT4|Q6P1K6	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P476	ENST00000339282.7	37	c.1428	CCDS42505.1	19																																																																																			ZNF564	-	pfscan_Znf_C2H2		0.383	ZNF564-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF564	HGNC	protein_coding	OTTHUMT00000344120.2	G	NM_144976		12637494	-1	no_errors	ENST00000339282	ensembl	human	known	70_37	silent	SNP	0.016	C
ZNF564	163050	genome.wustl.edu	37	19	12637736	12637736	+	Missense_Mutation	SNP	G	G	C			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:12637736G>C	ENST00000339282.7	-	4	1382	c.1186C>G	c.(1186-1188)Cag>Gag	p.Q396E	ZNF709_ENST00000428311.1_Intron|CTD-2192J16.21_ENST00000601420.1_RNA|CTD-2192J16.20_ENST00000593682.1_3'UTR	NM_144976.3	NP_659413.1	Q8TBZ8	ZN564_HUMAN	zinc finger protein 564	396					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18						CCACATACCTGACATTTATAA	0.443																																																	0													140.0	144.0	142.0					19																	12637736		2203	4300	6503	SO:0001583	missense	163050			BC028367	CCDS42505.1	19p13.2	2013-09-19			ENSG00000249709	ENSG00000249709		"""Zinc fingers, C2H2-type"", ""-"""	31106	protein-coding gene	gene with protein product							Standard	NM_144976		Approved	MGC26914		Q8TBZ8	OTTHUMG00000156418	ENST00000339282.7:c.1186C>G	19.37:g.12637736G>C	ENSP00000340004:p.Gln396Glu		B9EGT4|Q6P1K6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q396E	ENST00000339282.7	37	c.1186	CCDS42505.1	19	.	.	.	.	.	.	.	.	.	.	G	7.564	0.665365	0.14710	.	.	ENSG00000249709	ENST00000339282	T	0.07114	3.22	1.56	-1.01	0.10169	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02688	0.0081	N	0.02181	-0.65	0.23144	N	0.998225	B	0.11235	0.004	B	0.20577	0.03	T	0.41840	-0.9486	9	0.54805	T	0.06	.	1.4539	0.02381	0.1687:0.1495:0.4358:0.2461	.	396	Q8TBZ8	ZN564_HUMAN	E	396	ENSP00000340004:Q396E	ENSP00000340004:Q396E	Q	-	1	0	ZNF564	12498736	0.004000	0.15560	0.002000	0.10522	0.157000	0.22087	-1.194000	0.03046	-0.326000	0.08564	-0.294000	0.09567	CAG	ZNF564	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.443	ZNF564-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF564	HGNC	protein_coding	OTTHUMT00000344120.2	G	NM_144976		12637736	-1	no_errors	ENST00000339282	ensembl	human	known	70_37	missense	SNP	0.013	C
ZNF564	163050	genome.wustl.edu	37	19	12638687	12638687	+	Missense_Mutation	SNP	G	G	C	rs555349242		TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:12638687G>C	ENST00000339282.7	-	4	431	c.235C>G	c.(235-237)Caa>Gaa	p.Q79E	ZNF709_ENST00000428311.1_Intron|CTD-2192J16.21_ENST00000601420.1_RNA|CTD-2192J16.20_ENST00000593682.1_3'UTR	NM_144976.3	NP_659413.1	Q8TBZ8	ZN564_HUMAN	zinc finger protein 564	79	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18						TCTCCACATTGATCATATTCT	0.328													G|||	1	0.000199681	0.0	0.0	5008	,	,		19853	0.0		0.0	False		,,,				2504	0.001																0													73.0	73.0	73.0					19																	12638687		1965	4165	6130	SO:0001583	missense	163050			BC028367	CCDS42505.1	19p13.2	2013-09-19			ENSG00000249709	ENSG00000249709		"""Zinc fingers, C2H2-type"", ""-"""	31106	protein-coding gene	gene with protein product							Standard	NM_144976		Approved	MGC26914		Q8TBZ8	OTTHUMG00000156418	ENST00000339282.7:c.235C>G	19.37:g.12638687G>C	ENSP00000340004:p.Gln79Glu		B9EGT4|Q6P1K6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q79E	ENST00000339282.7	37	c.235	CCDS42505.1	19	.	.	.	.	.	.	.	.	.	.	G	5.603	0.296055	0.10622	.	.	ENSG00000249709	ENST00000339282	T	0.07114	3.22	1.37	0.242	0.15498	Krueppel-associated box (1);	.	.	.	.	T	0.06962	0.0177	L	0.54863	1.705	0.09310	N	1	B	0.24823	0.112	B	0.22152	0.038	T	0.44283	-0.9338	9	0.13853	T	0.58	.	3.9499	0.09364	0.0:0.2254:0.3205:0.4541	.	79	Q8TBZ8	ZN564_HUMAN	E	79	ENSP00000340004:Q79E	ENSP00000340004:Q79E	Q	-	1	0	ZNF564	12499687	.	.	0.001000	0.08648	0.009000	0.06853	.	.	0.126000	0.18424	0.643000	0.83706	CAA	ZNF564	-	pfscan_Krueppel-associated_box		0.328	ZNF564-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF564	HGNC	protein_coding	OTTHUMT00000344120.2	G	NM_144976		12638687	-1	no_errors	ENST00000339282	ensembl	human	known	70_37	missense	SNP	0.001	C
ZNF570	148268	genome.wustl.edu	37	19	37961245	37961245	+	5'UTR	SNP	G	G	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:37961245G>T	ENST00000330173.1	+	0	518				ZNF570_ENST00000388801.3_Intron|ZNF569_ENST00000316950.6_5'Flank|ZNF570_ENST00000586475.1_Nonsense_Mutation_p.E53*|ZNF569_ENST00000591073.1_5'Flank	NM_144694.1	NP_653295.1	Q96NI8	ZN570_HUMAN	zinc finger protein 570						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(1)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GAAGAGCCAGGAGGAAGAAAG	0.448																																																	0													167.0	158.0	161.0					19																	37961245		2203	4300	6503	SO:0001623	5_prime_UTR_variant	148268			AK055353	CCDS12504.1, CCDS74355.1	19q13.12	2013-09-20			ENSG00000171827	ENSG00000171827		"""Zinc fingers, C2H2-type"", ""-"""	26416	protein-coding gene	gene with protein product							Standard	XM_005258567		Approved	FLJ30791	uc002ogk.1	Q96NI8	OTTHUMG00000048176	ENST00000330173.1:c.-12G>T	19.37:g.37961245G>T			A1L472|B4DMP1	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E53*	ENST00000330173.1	37	c.157	CCDS12504.1	19																																																																																			ZNF570	-	NULL		0.448	ZNF570-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF570	HGNC	protein_coding	OTTHUMT00000109600.1	G	NM_144694		37961245	+1	no_errors	ENST00000586475	ensembl	human	putative	70_37	nonsense	SNP	0.000	T
ZNF570	148268	genome.wustl.edu	37	19	37961255	37961255	+	5'UTR	SNP	G	G	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:37961255G>T	ENST00000330173.1	+	0	528				ZNF570_ENST00000388801.3_Intron|ZNF569_ENST00000316950.6_5'Flank|ZNF570_ENST00000586475.1_Missense_Mutation_p.R56I|ZNF569_ENST00000591073.1_5'Flank	NM_144694.1	NP_653295.1	Q96NI8	ZN570_HUMAN	zinc finger protein 570						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(1)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GAGGAAGAAAGAATGGCTGTT	0.438																																																	0													169.0	162.0	165.0					19																	37961255		2203	4300	6503	SO:0001623	5_prime_UTR_variant	148268			AK055353	CCDS12504.1, CCDS74355.1	19q13.12	2013-09-20			ENSG00000171827	ENSG00000171827		"""Zinc fingers, C2H2-type"", ""-"""	26416	protein-coding gene	gene with protein product							Standard	XM_005258567		Approved	FLJ30791	uc002ogk.1	Q96NI8	OTTHUMG00000048176	ENST00000330173.1:c.-2G>T	19.37:g.37961255G>T			A1L472|B4DMP1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R56I	ENST00000330173.1	37	c.167	CCDS12504.1	19																																																																																			ZNF570	-	NULL		0.438	ZNF570-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF570	HGNC	protein_coding	OTTHUMT00000109600.1	G	NM_144694		37961255	+1	no_errors	ENST00000586475	ensembl	human	putative	70_37	missense	SNP	0.763	T
ZNF714	148206	genome.wustl.edu	37	19	21299966	21299966	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:21299966C>T	ENST00000596143.1	+	5	821	c.496C>T	c.(496-498)Cat>Tat	p.H166Y	ZNF714_ENST00000291770.7_3'UTR|ZNF714_ENST00000601416.1_3'UTR|ZNF714_ENST00000596053.1_Intron	NM_182515.3	NP_872321	Q96N38	ZN714_HUMAN	zinc finger protein 714	166					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|urinary_tract(2)	18						TAAAAGAATTCATATTAGAGA	0.348																																																	0													52.0	58.0	56.0					19																	21299966		2175	4278	6453	SO:0001583	missense	148206			AK056006	CCDS54239.1	19p12	2013-01-08				ENSG00000160352		"""Zinc fingers, C2H2-type"""	27124	protein-coding gene	gene with protein product						12477932	Standard	NM_182515		Approved		uc002npo.4	Q96N38		ENST00000596143.1:c.496C>T	19.37:g.21299966C>T	ENSP00000472368:p.His166Tyr		Q49AI1|Q86W65|Q8ND40	Missense_Mutation	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H166Y	ENST00000596143.1	37	c.496	CCDS54239.1	19	.	.	.	.	.	.	.	.	.	.	.	13.69	2.313338	0.40996	.	.	ENSG00000160352	ENST00000343332;ENST00000291770	.	.	.	0.889	0.889	0.19212	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.61874	0.2382	L	0.52126	1.63	0.34396	D	0.69468	D;D;D	0.76494	0.999;0.997;0.994	D;D;D	0.85130	0.997;0.97;0.977	T	0.67074	-0.5762	8	0.52906	T	0.07	.	8.5827	0.33640	0.0:1.0:0.0:0.0	.	167;166;167	Q96N38-2;A6NEM4;Q96N38	.;.;ZN714_HUMAN	Y	166	.	ENSP00000291770:H166Y	H	+	1	0	ZNF714	21091806	0.716000	0.27956	0.072000	0.20136	0.071000	0.16799	3.299000	0.51826	0.300000	0.22699	0.306000	0.20318	CAT	ZNF714	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.348	ZNF714-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF714	HGNC	protein_coding	OTTHUMT00000463930.1	C	NM_182515		21299966	+1	no_errors	ENST00000596143	ensembl	human	known	70_37	missense	SNP	1.000	T
ZNF570	148268	genome.wustl.edu	37	19	37975793	37975793	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:37975793C>G	ENST00000330173.1	+	5	1798	c.1269C>G	c.(1267-1269)ttC>ttG	p.F423L	ZNF570_ENST00000388801.3_Missense_Mutation_p.F220L|ZNF570_ENST00000586475.1_Missense_Mutation_p.F479L	NM_144694.1	NP_653295.1	Q96NI8	ZN570_HUMAN	zinc finger protein 570	423					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(1)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GGAAAGCATTCAGCCAGATTG	0.428																																																	0													107.0	107.0	107.0					19																	37975793		2203	4300	6503	SO:0001583	missense	148268			AK055353	CCDS12504.1, CCDS74355.1	19q13.12	2013-09-20			ENSG00000171827	ENSG00000171827		"""Zinc fingers, C2H2-type"", ""-"""	26416	protein-coding gene	gene with protein product							Standard	XM_005258567		Approved	FLJ30791	uc002ogk.1	Q96NI8	OTTHUMG00000048176	ENST00000330173.1:c.1269C>G	19.37:g.37975793C>G	ENSP00000331540:p.Phe423Leu		A1L472|B4DMP1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F423L	ENST00000330173.1	37	c.1269	CCDS12504.1	19	.	.	.	.	.	.	.	.	.	.	C	16.01	3.001437	0.54254	.	.	ENSG00000171827	ENST00000330173;ENST00000388801	T;T	0.46063	0.88;0.88	4.25	-2.1	0.07210	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.44688	D	0.000428	T	0.64023	0.2561	M	0.90483	3.12	0.34323	D	0.686781	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.71600	-0.4544	10	0.87932	D	0	.	9.8414	0.41002	0.0:0.359:0.0:0.641	.	220;423	B4DMP1;Q96NI8	.;ZN570_HUMAN	L	423;220	ENSP00000331540:F423L;ENSP00000373453:F220L	ENSP00000331540:F423L	F	+	3	2	ZNF570	42667633	0.013000	0.17824	0.991000	0.47740	0.988000	0.76386	0.226000	0.17776	-0.333000	0.08476	-0.251000	0.11542	TTC	ZNF570	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.428	ZNF570-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF570	HGNC	protein_coding	OTTHUMT00000109600.1	C	NM_144694		37975793	+1	no_errors	ENST00000330173	ensembl	human	known	70_37	missense	SNP	0.989	G
ZNF727	442319	genome.wustl.edu	37	7	63538904	63538904	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr7:63538904C>T	ENST00000550760.3	+	4	1656	c.1477C>T	c.(1477-1479)Cag>Tag	p.Q493*	RP11-3N2.13_ENST00000445978.1_RNA	NM_001159522.1	NP_001152994.1	A8MUV8	ZN727_HUMAN	zinc finger protein 727	493					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|skin(1)|stomach(1)|urinary_tract(1)	8						AGGTGGTTCTCAGACCTTACT	0.393																																																	0													41.0	38.0	39.0					7																	63538904		692	1591	2283	SO:0001587	stop_gained	442319					7q11.21	2014-09-09	2014-09-09	2014-09-09	ENSG00000214652	ENSG00000214652		"""Zinc fingers, C2H2-type"", ""-"""	22785	pseudogene	pseudogene			"""zinc finger protein 727, pseudogene"""	ZNF727P			Standard	NM_001159522		Approved		uc011kdm.2	A8MUV8	OTTHUMG00000156536	ENST00000550760.3:c.1477C>T	7.37:g.63538904C>T	ENSP00000447987:p.Gln493*			Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q493*	ENST00000550760.3	37	c.1477	CCDS55113.1	7	.	.	.	.	.	.	.	.	.	.	C	15.51	2.855940	0.51376	.	.	ENSG00000257482	ENST00000550760	.	.	.	0.988	0.988	0.19796	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.3718	0.07224	0.0:0.6901:0.0:0.3099	.	.	.	.	X	493	.	.	Q	+	1	0	ZNF727	63176339	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.580000	0.23803	0.430000	0.26230	0.430000	0.28490	CAG	ZNF727	-	NULL		0.393	ZNF727-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF727	HGNC	protein_coding		C	NM_001159522		63538904	+1	no_errors	ENST00000550760	ensembl	human	known	70_37	nonsense	SNP	0.000	T
ZNF878	729747	genome.wustl.edu	37	19	12155702	12155702	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:12155702C>T	ENST00000547628.1	-	4	651	c.514G>A	c.(514-516)Gaa>Aaa	p.E172K	CTD-2006C1.2_ENST00000476474.1_RNA|CTD-2006C1.2_ENST00000591898.1_RNA|CTD-2006C1.10_ENST00000547473.1_Intron|CTD-2006C1.2_ENST00000591838.1_RNA|ZNF878_ENST00000602107.1_Missense_Mutation_p.E219K	NM_001080404.2	NP_001073873.2	C9JN71	ZN878_HUMAN	zinc finger protein 878	172					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|kidney(1)|lung(4)|urinary_tract(1)	8						TGCTTACATTCATAGGGTTTT	0.413																																																	0													150.0	164.0	159.0					19																	12155702		2101	4252	6353	SO:0001583	missense	729747				CCDS45984.1, CCDS45984.2	19p13.2	2013-01-08				ENSG00000257446		"""Zinc fingers, C2H2-type"", ""-"""	37246	protein-coding gene	gene with protein product							Standard	NM_001080404		Approved		uc021upl.1	C9JN71		ENST00000547628.1:c.514G>A	19.37:g.12155702C>T	ENSP00000447931:p.Glu172Lys			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E219K	ENST00000547628.1	37	c.655	CCDS45984.2	19	.	.	.	.	.	.	.	.	.	.	C	1.495	-0.553650	0.03996	.	.	ENSG00000257446;ENSG00000232371	ENST00000547628;ENST00000440730	T	0.06608	3.28	1.19	1.19	0.21007	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01454	0.0047	N	0.00566	-1.37	0.09310	N	1	B	0.18166	0.026	B	0.12837	0.008	T	0.47420	-0.9119	9	0.16420	T	0.52	.	2.0162	0.03498	0.3169:0.4672:0.0:0.2159	.	172	C9JN71	ZN878_HUMAN	K	172;219	ENSP00000447931:E172K	ENSP00000447931:E172K	E	-	1	0	AC022415.4;ZNF878	12016702	0.000000	0.05858	0.041000	0.18516	0.261000	0.26267	-1.566000	0.02148	0.619000	0.30197	0.186000	0.17326	GAA	ZNF878	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.413	ZNF878-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF878	HGNC	protein_coding	OTTHUMT00000403723.1	C	NM_001080404		12155702	-1	no_errors	ENST00000602107	ensembl	human	known	70_37	missense	SNP	0.131	T
ZNF761	388561	genome.wustl.edu	37	19	53958209	53958209	+	RNA	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr19:53958209G>A	ENST00000454407.1	+	0	901							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		GCATCTGCCTGAAATGCACAT	0.383																																																	0													107.0	108.0	107.0					19																	53958209		2203	4300	6503			388561			AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		19.37:g.53958209G>A			Q6ZNB9	RNA	SNP	-	NULL	ENST00000454407.1	37	NULL		19																																																																																			ZNF761	-	-		0.383	ZNF761-203	KNOWN	basic	processed_transcript	ZNF761	HGNC	processed_transcript		G	NM_001008401		53958209	+1	no_errors	ENST00000334095	ensembl	human	known	70_37	rna	SNP	0.036	A
ZNRF3	84133	genome.wustl.edu	37	22	29446272	29446272	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr22:29446272G>A	ENST00000544604.2	+	8	2278	c.2103G>A	c.(2101-2103)tgG>tgA	p.W701*	ZNRF3_ENST00000406323.3_Nonsense_Mutation_p.W601*|ZNRF3_ENST00000402174.1_Nonsense_Mutation_p.W601*|ZNRF3_ENST00000332811.4_Nonsense_Mutation_p.W601*	NM_001206998.1	NP_001193927.1	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3	701					canonical Wnt signaling pathway (GO:0060070)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|protein ubiquitination (GO:0016567)|stem cell proliferation (GO:0072089)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	integral component of plasma membrane (GO:0005887)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(4)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	28						GGAGGACCTGGAAGGGGGGCC	0.692																																																	0													15.0	17.0	16.0					22																	29446272		1925	4103	6028	SO:0001587	stop_gained	84133			AB051436	CCDS42999.1, CCDS56225.1	22q12.1	2013-01-09			ENSG00000183579	ENSG00000183579		"""RING-type (C3HC4) zinc fingers"""	18126	protein-coding gene	gene with protein product		612062				10574461	Standard	NM_032173		Approved	KIAA1133, BK747E2.3, FLJ22057, RNF203	uc003aeg.3	Q9ULT6	OTTHUMG00000151009	ENST00000544604.2:c.2103G>A	22.37:g.29446272G>A	ENSP00000443824:p.Trp701*		B3KU18|Q6ICH1|Q6NTF8|Q8WU18	Nonsense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.W701*	ENST00000544604.2	37	c.2103	CCDS56225.1	22	.	.	.	.	.	.	.	.	.	.	G	38	6.685869	0.97764	.	.	ENSG00000183579	ENST00000544604;ENST00000332811;ENST00000462485;ENST00000402174;ENST00000406323	.	.	.	5.01	5.01	0.66863	.	0.455403	0.23698	N	0.045445	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-10.2538	10.8865	0.46971	0.0861:0.0:0.9139:0.0	.	.	.	.	X	701;601;408;601;601	.	ENSP00000328614:W601X	W	+	3	0	ZNRF3	27776272	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	4.106000	0.57804	2.317000	0.78254	0.655000	0.94253	TGG	ZNRF3	-	NULL		0.692	ZNRF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNRF3	HGNC	protein_coding	OTTHUMT00000320943.2	G	XM_290972		29446272	+1	no_errors	ENST00000544604	ensembl	human	known	70_37	nonsense	SNP	1.000	A
ZP2	7783	genome.wustl.edu	37	16	21215375	21215375	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr16:21215375G>T	ENST00000574002.1	-	10	1430	c.948C>A	c.(946-948)ttC>ttA	p.F316L	AF001550.7_ENST00000572747.1_RNA|ZP2_ENST00000574091.1_Missense_Mutation_p.F316L|ZP2_ENST00000219593.4_Missense_Mutation_p.F316L			Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 (sperm receptor)	316					binding of sperm to zona pellucida (GO:0007339)|intracellular protein transport (GO:0006886)|multicellular organism reproduction (GO:0032504)|prevention of polyspermy (GO:0060468)|signal transduction (GO:0007165)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|coreceptor activity (GO:0015026)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(16)|ovary(1)|prostate(1)|stomach(1)	41				GBM - Glioblastoma multiforme(48;0.0573)		GAGTTTTGCTGAAATGCAATT	0.423																																																	0													190.0	164.0	172.0					16																	21215375		2200	4300	6500	SO:0001583	missense	7783			M90366	CCDS10596.1, CCDS73843.1	16p12	2014-07-04			ENSG00000103310	ENSG00000103310		"""Zona pellucida glycoproteins"""	13188	protein-coding gene	gene with protein product		182888				8385033	Standard	XM_005255562		Approved	ZPA	uc002dii.2	Q05996	OTTHUMG00000090681	ENST00000574002.1:c.948C>A	16.37:g.21215375G>T	ENSP00000460971:p.Phe316Leu		B2R7J2|Q4VAN9|Q4VAP0|Q4VAP1	Missense_Mutation	SNP	pfam_ZP_dom,smart_ZP_dom,pfscan_ZP_dom,prints_ZP_dom	p.F316L	ENST00000574002.1	37	c.948	CCDS10596.1	16	.	.	.	.	.	.	.	.	.	.	G	19.96	3.923787	0.73213	.	.	ENSG00000103310	ENST00000219593	T	0.76448	-1.02	5.97	5.97	0.96955	.	0.260506	0.34484	N	0.003934	D	0.86916	0.6048	M	0.80183	2.485	0.36470	D	0.86718	D;P;P	0.89917	1.0;0.881;0.881	D;P;P	0.91635	0.999;0.471;0.471	D	0.88407	0.3019	10	0.40728	T	0.16	-18.0346	10.7782	0.46363	0.1441:0.0:0.8559:0.0	.	316;316;316	B4DEV1;Q4VAP1;Q05996	.;.;ZP2_HUMAN	L	316	ENSP00000219593:F316L	ENSP00000219593:F316L	F	-	3	2	ZP2	21122876	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	2.842000	0.48230	2.819000	0.97034	0.655000	0.94253	TTC	ZP2	-	NULL		0.423	ZP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZP2	HGNC	protein_coding	OTTHUMT00000207365.2	G			21215375	-1	no_errors	ENST00000219593	ensembl	human	known	70_37	missense	SNP	1.000	T
ZP2	7783	genome.wustl.edu	37	16	21215708	21215708	+	Silent	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr16:21215708G>A	ENST00000574002.1	-	9	1193	c.711C>T	c.(709-711)ctC>ctT	p.L237L	AF001550.7_ENST00000572747.1_RNA|ZP2_ENST00000574091.1_Silent_p.L237L|ZP2_ENST00000219593.4_Silent_p.L237L			Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 (sperm receptor)	237					binding of sperm to zona pellucida (GO:0007339)|intracellular protein transport (GO:0006886)|multicellular organism reproduction (GO:0032504)|prevention of polyspermy (GO:0060468)|signal transduction (GO:0007165)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|coreceptor activity (GO:0015026)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(16)|ovary(1)|prostate(1)|stomach(1)	41				GBM - Glioblastoma multiforme(48;0.0573)		ACACCATGTAGAGATGACTGT	0.403																																																	0													95.0	94.0	94.0					16																	21215708		2200	4300	6500	SO:0001819	synonymous_variant	7783			M90366	CCDS10596.1, CCDS73843.1	16p12	2014-07-04			ENSG00000103310	ENSG00000103310		"""Zona pellucida glycoproteins"""	13188	protein-coding gene	gene with protein product		182888				8385033	Standard	XM_005255562		Approved	ZPA	uc002dii.2	Q05996	OTTHUMG00000090681	ENST00000574002.1:c.711C>T	16.37:g.21215708G>A			B2R7J2|Q4VAN9|Q4VAP0|Q4VAP1	Silent	SNP	pfam_ZP_dom,smart_ZP_dom,pfscan_ZP_dom,prints_ZP_dom	p.L237	ENST00000574002.1	37	c.711	CCDS10596.1	16																																																																																			ZP2	-	NULL		0.403	ZP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZP2	HGNC	protein_coding	OTTHUMT00000207365.2	G			21215708	-1	no_errors	ENST00000219593	ensembl	human	known	70_37	silent	SNP	0.970	A
ZRSR2	8233	genome.wustl.edu	37	X	15818015	15818015	+	Missense_Mutation	SNP	G	G	A			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chrX:15818015G>A	ENST00000307771.7	+	3	166	c.142G>A	c.(142-144)Gag>Aag	p.E48K	ZRSR2_ENST00000380308.3_Missense_Mutation_p.E48K|ZRSR2_ENST00000468028.1_3'UTR	NM_005089.3	NP_005080.1	Q15696	U2AFM_HUMAN	zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2	48	Poly-Glu.				mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	U12-type spliceosomal complex (GO:0005689)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|pre-mRNA 3'-splice site binding (GO:0030628)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(38)|kidney(1)|large_intestine(2)|ovary(2)	48	Hepatocellular(33;0.183)					GAAGGAGGAAGAGGAGGACAC	0.343			"""F, S, Mis"""		"""MDS, CLL"""																																NSCLC(197;1631 3042 5741 31152)			Rec	yes		X	Xp22.1	8233	"""zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2"""		L	0													96.0	83.0	87.0					X																	15818015		2203	4300	6503	SO:0001583	missense	8233			BC050451	CCDS14172.1	Xp22.1	2014-09-17	2006-09-26	2006-09-26	ENSG00000169249	ENSG00000169249		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	23019	protein-coding gene	gene with protein product		300028	"""U2(RNU2) small nuclear RNA auxiliary factor 1-like 2"", ""U2 small nuclear RNA auxiliary factor 1-like 2"""	U2AF1L2		8586425, 9237760, 15146077	Standard	NM_005089		Approved	U2AF1-RS2, URP	uc004cxg.4	Q15696	OTTHUMG00000021184	ENST00000307771.7:c.142G>A	X.37:g.15818015G>A	ENSP00000303015:p.Glu48Lys		Q14D69	Missense_Mutation	SNP	pfam_Znf_CCCH,pfam_RRM_dom,smart_Znf_CCCH,smart_RRM_dom_euk,pfscan_RRM_dom,prints_U2_small	p.E48K	ENST00000307771.7	37	c.142	CCDS14172.1	X	.	.	.	.	.	.	.	.	.	.	G	13.04	2.119528	0.37436	.	.	ENSG00000169249	ENST00000307771;ENST00000380308	D;T	0.84873	-1.91;1.81	4.96	4.96	0.65561	.	0.098930	0.64402	D	0.000002	D	0.91630	0.7355	M	0.80982	2.52	0.42276	D	0.992071	D	0.63880	0.993	D	0.70935	0.971	D	0.92534	0.6036	10	0.62326	D	0.03	.	12.9043	0.58143	0.0:0.0:1.0:0.0	.	48	Q15696	U2AFM_HUMAN	K	48	ENSP00000303015:E48K;ENSP00000369664:E48K	ENSP00000303015:E48K	E	+	1	0	ZRSR2	15727936	0.997000	0.39634	0.929000	0.37066	0.776000	0.43924	3.067000	0.50010	2.192000	0.70111	0.600000	0.82982	GAG	ZRSR2	-	NULL		0.343	ZRSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZRSR2	HGNC	protein_coding	OTTHUMT00000055889.1	G	NM_005089		15818015	+1	no_errors	ENST00000307771	ensembl	human	known	70_37	missense	SNP	0.975	A
ZSCAN12	9753	genome.wustl.edu	37	6	28366095	28366095	+	Missense_Mutation	SNP	G	G	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr6:28366095G>T	ENST00000361028.1	-	2	233	c.88C>A	c.(88-90)Cag>Aag	p.Q30K	ZSCAN12_ENST00000396827.3_Missense_Mutation_p.Q30K			O43309	ZSC12_HUMAN	zinc finger and SCAN domain containing 12	30					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|urinary_tract(1)	6						TCCCAATCCTGTCTGGTGGTA	0.493																																																	0													297.0	256.0	268.0					6																	28366095		692	1591	2283	SO:0001583	missense	9753			AB007886		6p21	2013-01-08	2007-02-20	2007-02-20	ENSG00000158691	ENSG00000158691		"""-"", ""Zinc fingers, C2H2-type"""	13172	protein-coding gene	gene with protein product		603978	"""zinc finger protein 305"", ""zinc finger protein 96"""	ZNF305, ZNF96		9244436	Standard	NM_001163391		Approved	KIAA0426, ZNF29K1, ZFP96, dJ29K1.2	uc011dlh.2	O43309	OTTHUMG00000014522	ENST00000361028.1:c.88C>A	6.37:g.28366095G>T	ENSP00000354305:p.Gln30Lys		O43724	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.Q30K	ENST00000361028.1	37	c.88		6	.	.	.	.	.	.	.	.	.	.	G	12.55	1.970310	0.34754	.	.	ENSG00000158691	ENST00000361028;ENST00000396827	T;T	0.07444	3.19;3.19	3.11	2.2	0.27929	.	0.376691	0.15959	N	0.236372	T	0.01222	0.0040	N	0.08118	0	0.09310	N	1	B;B	0.11235	0.004;0.004	B;B	0.04013	0.001;0.001	T	0.47873	-0.9083	10	0.34782	T	0.22	.	7.2619	0.26207	0.0:0.0:0.7098:0.2901	.	30;30	A8K187;O43309	.;ZSC12_HUMAN	K	30	ENSP00000354305:Q30K;ENSP00000380039:Q30K	ENSP00000354305:Q30K	Q	-	1	0	ZSCAN12	28474074	0.004000	0.15560	0.032000	0.17829	0.312000	0.27988	0.453000	0.21811	0.586000	0.29626	0.603000	0.83216	CAG	ZSCAN12	-	NULL		0.493	ZSCAN12-001	KNOWN	basic|appris_principal	protein_coding	ZSCAN12	HGNC	protein_coding	OTTHUMT00000040190.1	G	NM_014724		28366095	-1	no_errors	ENST00000361028	ensembl	human	known	70_37	missense	SNP	0.046	T
ZSCAN23	222696	genome.wustl.edu	37	6	28403360	28403360	+	Missense_Mutation	SNP	C	C	T			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr6:28403360C>T	ENST00000289788.4	-	3	578	c.433G>A	c.(433-435)Gaa>Aaa	p.E145K	ZSCAN23_ENST00000486481.1_5'UTR	NM_001012455.1	NP_001012458.1	Q3MJ62	ZSC23_HUMAN	zinc finger and SCAN domain containing 23	145					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|prostate(1)|stomach(2)	4						ACAAACTCTTCCTGTTCATGA	0.498																																																	0													70.0	57.0	61.0					6																	28403360		692	1591	2283	SO:0001583	missense	222696			AK092117	CCDS47393.1	6p21.33	2013-01-08	2007-02-20	2007-02-20	ENSG00000187987	ENSG00000187987		"""-"", ""Zinc fingers, C2H2-type"""	21193	protein-coding gene	gene with protein product			"""zinc finger protein 453"", ""zinc finger protein 390"""	ZNF453, ZNF390			Standard	NM_001012455		Approved	dJ29K1.3.1	uc003nli.4	Q3MJ62	OTTHUMG00000016346	ENST00000289788.4:c.433G>A	6.37:g.28403360C>T	ENSP00000289788:p.Glu145Lys		Q96KV9	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E145K	ENST00000289788.4	37	c.433	CCDS47393.1	6	.	.	.	.	.	.	.	.	.	.	C	13.47	2.246248	0.39697	.	.	ENSG00000187987	ENST00000289788	T	0.05996	3.36	3.75	2.88	0.33553	Transcription regulator SCAN (1);	0.607232	0.13682	N	0.370100	T	0.01254	0.0041	N	0.19112	0.55	0.24505	N	0.994237	B	0.06786	0.001	B	0.04013	0.001	T	0.47573	-0.9107	10	0.22706	T	0.39	.	7.3316	0.26586	0.0:0.8809:0.0:0.1191	.	145	Q3MJ62	ZSC23_HUMAN	K	145	ENSP00000289788:E145K	ENSP00000289788:E145K	E	-	1	0	ZSCAN23	28511339	0.001000	0.12720	0.028000	0.17463	0.045000	0.14185	0.375000	0.20518	1.142000	0.42291	0.557000	0.71058	GAA	ZSCAN23	-	smart_Tscrpt_reg_SCAN		0.498	ZSCAN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN23	HGNC	protein_coding	OTTHUMT00000043751.2	C	XM_167147		28403360	-1	no_errors	ENST00000289788	ensembl	human	known	70_37	missense	SNP	0.832	T
ZYG11A	440590	genome.wustl.edu	37	1	53322948	53322948	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:53322948C>G	ENST00000371528.1	+	3	683	c.535C>G	c.(535-537)Cag>Gag	p.Q179E	ZYG11A_ENST00000371532.1_Intron	NM_001004339.2	NP_001004339.2	Q6WRX3	ZY11A_HUMAN	zyg-11 family member A, cell cycle regulator	179										breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	10						GTTCTTTAGTCAGCTCACTGG	0.403																																																	0													93.0	72.0	79.0					1																	53322948		692	1591	2283	SO:0001583	missense	440590				CCDS44148.1	1p32.3	2013-01-17	2012-12-10		ENSG00000203995	ENSG00000203995		"""ZYG11 cell cycle regulator family"""	32058	protein-coding gene	gene with protein product			"""zyg-11 homolog A (C. elegans)"""				Standard	NM_001004339		Approved	ZYG11	uc001cuk.2	Q6WRX3	OTTHUMG00000008923	ENST00000371528.1:c.535C>G	1.37:g.53322948C>G	ENSP00000360583:p.Gln179Glu		A6NCK5	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.Q179E	ENST00000371528.1	37	c.535	CCDS44148.1	1	.	.	.	.	.	.	.	.	.	.	C	10.67	1.414638	0.25465	.	.	ENSG00000203995	ENST00000371528	T	0.06933	3.24	5.62	5.62	0.85841	.	0.542802	0.20024	N	0.100849	T	0.09642	0.0237	L	0.59436	1.845	0.24495	N	0.994282	B	0.25206	0.12	B	0.25884	0.064	T	0.41822	-0.9487	10	0.05436	T	0.98	-3.7609	14.5098	0.67776	0.1466:0.8534:0.0:0.0	.	179	Q6WRX3	ZY11A_HUMAN	E	179	ENSP00000360583:Q179E	ENSP00000360583:Q179E	Q	+	1	0	ZYG11A	53095536	0.993000	0.37304	1.000000	0.80357	0.829000	0.46940	1.204000	0.32296	2.645000	0.89757	0.650000	0.86243	CAG	ZYG11A	-	NULL		0.403	ZYG11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZYG11A	HGNC	protein_coding	OTTHUMT00000024856.3	C	NM_001004339		53322948	+1	no_errors	ENST00000371528	ensembl	human	known	70_37	missense	SNP	1.000	G
ZYG11A	440590	genome.wustl.edu	37	1	53323185	53323185	+	Missense_Mutation	SNP	C	C	G			TCGA-IR-A3LI-01A-11D-A20U-09	TCGA-IR-A3LI-10A-01D-A20U-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0f741066-3dc3-42b9-8287-28b5e5aade9a	5c21b027-1850-4ea4-92e7-8a7e863b86b8	g.chr1:53323185C>G	ENST00000371528.1	+	3	920	c.772C>G	c.(772-774)Ctg>Gtg	p.L258V	ZYG11A_ENST00000371532.1_Intron	NM_001004339.2	NP_001004339.2	Q6WRX3	ZY11A_HUMAN	zyg-11 family member A, cell cycle regulator	258										breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	10						ACTTAAATGTCTGCTTCACCT	0.408																																																	0													110.0	87.0	94.0					1																	53323185		692	1591	2283	SO:0001583	missense	440590				CCDS44148.1	1p32.3	2013-01-17	2012-12-10		ENSG00000203995	ENSG00000203995		"""ZYG11 cell cycle regulator family"""	32058	protein-coding gene	gene with protein product			"""zyg-11 homolog A (C. elegans)"""				Standard	NM_001004339		Approved	ZYG11	uc001cuk.2	Q6WRX3	OTTHUMG00000008923	ENST00000371528.1:c.772C>G	1.37:g.53323185C>G	ENSP00000360583:p.Leu258Val		A6NCK5	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.L258V	ENST00000371528.1	37	c.772	CCDS44148.1	1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.042590	0.55003	.	.	ENSG00000203995	ENST00000371528	T	0.05081	3.5	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000001	T	0.27900	0.0687	M	0.78049	2.395	0.47308	D	0.999386	D	0.64830	0.994	D	0.69654	0.965	T	0.00883	-1.1528	10	0.87932	D	0	-7.1135	19.4128	0.94681	0.0:1.0:0.0:0.0	.	258	Q6WRX3	ZY11A_HUMAN	V	258	ENSP00000360583:L258V	ENSP00000360583:L258V	L	+	1	2	ZYG11A	53095773	0.994000	0.37717	1.000000	0.80357	0.707000	0.40811	2.011000	0.40922	2.581000	0.87130	0.563000	0.77884	CTG	ZYG11A	-	NULL		0.408	ZYG11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZYG11A	HGNC	protein_coding	OTTHUMT00000024856.3	C	NM_001004339		53323185	+1	no_errors	ENST00000371528	ensembl	human	known	70_37	missense	SNP	0.990	G
