#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ABCA2	20	genome.wustl.edu	37	9	139908007	139908007	+	Missense_Mutation	SNP	G	G	A			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr9:139908007G>A	ENST00000371605.3	-	28	4600	c.4453C>T	c.(4453-4455)Ccc>Tcc	p.P1485S	ABCA2_ENST00000341511.6_Missense_Mutation_p.P1486S|ABCA2_ENST00000265662.5_Missense_Mutation_p.P1486S			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	1485					ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		ACCAGCGGGGGCAGATCACCT	0.672																																																	0													39.0	49.0	45.0					9																	139908007		2009	4139	6148	SO:0001583	missense	20			U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.4453C>T	9.37:g.139908007G>A	ENSP00000360666:p.Pro1485Ser		A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.P1486S	ENST00000371605.3	37	c.4456		9	.	.	.	.	.	.	.	.	.	.	G	21.1	4.104877	0.77096	.	.	ENSG00000107331	ENST00000265662;ENST00000371605;ENST00000355090;ENST00000341511	D;D;D	0.94280	-3.39;-3.39;-3.39	4.86	4.86	0.63082	.	0.131238	0.52532	N	0.000074	D	0.96503	0.8859	M	0.76727	2.345	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.981	D	0.97181	0.9851	10	0.87932	D	0	.	17.9576	0.89074	0.0:0.0:1.0:0.0	.	1485;1516	Q9BZC7;E7ETC3	ABCA2_HUMAN;.	S	1486;1485;1516;1486	ENSP00000265662:P1486S;ENSP00000360666:P1485S;ENSP00000344155:P1486S	ENSP00000265662:P1486S	P	-	1	0	ABCA2	139027828	1.000000	0.71417	0.996000	0.52242	0.096000	0.18686	6.949000	0.75971	2.235000	0.73313	0.484000	0.47621	CCC	ABCA2	-	NULL		0.672	ABCA2-202	KNOWN	basic	protein_coding	ABCA2	HGNC	protein_coding		G	NM_001606		139908007	-1	no_errors	ENST00000265662	ensembl	human	known	70_37	missense	SNP	1.000	A
ABCB4	5244	genome.wustl.edu	37	7	87082375	87082375	+	Missense_Mutation	SNP	C	C	T			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr7:87082375C>T	ENST00000265723.4	-	6	532	c.421G>A	c.(421-423)Gca>Aca	p.A141T	ABCB4_ENST00000453593.1_Missense_Mutation_p.A141T|ABCB4_ENST00000358400.3_Missense_Mutation_p.A141T|ABCB4_ENST00000359206.3_Missense_Mutation_p.A141T|ABCB4_ENST00000545634.1_Missense_Mutation_p.A141T	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	141	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	CGACCAGCTGCCAAAGTCCAA	0.398																																																	0													92.0	86.0	88.0					7																	87082375		2203	4300	6503	SO:0001583	missense	5244			M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.421G>A	7.37:g.87082375C>T	ENSP00000265723:p.Ala141Thr		A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,pfam_Zeta_toxin_domain,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.A141T	ENST00000265723.4	37	c.421	CCDS5606.1	7	.	.	.	.	.	.	.	.	.	.	C	15.11	2.735646	0.49045	.	.	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634	T;T;T;T;T	0.80909	-1.43;-1.43;-1.43;-1.43;-1.43	5.76	5.76	0.90799	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.292660	0.38959	N	0.001516	T	0.69682	0.3138	N	0.17082	0.46	0.50313	D	0.999868	P;B;B;B	0.43909	0.821;0.112;0.246;0.29	B;B;B;B	0.39840	0.311;0.052;0.121;0.192	T	0.67768	-0.5585	10	0.18710	T	0.47	-15.3262	19.9693	0.97278	0.0:1.0:0.0:0.0	.	141;141;141;141	Q6PJ81;A4D1D5;P21439-2;P21439	.;.;.;MDR3_HUMAN	T	141	ENSP00000352135:A141T;ENSP00000351172:A141T;ENSP00000265723:A141T;ENSP00000392983:A141T;ENSP00000437465:A141T	ENSP00000265723:A141T	A	-	1	0	ABCB4	86920311	0.913000	0.31002	1.000000	0.80357	0.991000	0.79684	1.879000	0.39618	2.725000	0.93324	0.591000	0.81541	GCA	ABCB4	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1		0.398	ABCB4-002	KNOWN	basic|CCDS	protein_coding	ABCB4	HGNC	protein_coding	OTTHUMT00000336083.1	C	NM_000443		87082375	-1	no_errors	ENST00000265723	ensembl	human	known	70_37	missense	SNP	1.000	T
AK5	26289	genome.wustl.edu	37	1	77763549	77763549	+	Silent	SNP	T	T	C			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr1:77763549T>C	ENST00000354567.2	+	5	879	c.616T>C	c.(616-618)Ttg>Ctg	p.L206L	AK5_ENST00000317704.4_3'UTR|AK5_ENST00000344720.5_Silent_p.L180L	NM_174858.2	NP_777283.1	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5	206	Adenylate kinase 1.				ADP biosynthetic process (GO:0006172)|ATP metabolic process (GO:0046034)|dADP biosynthetic process (GO:0006173)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|pyrimidine ribonucleotide biosynthetic process (GO:0009220)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule organizing center (GO:0005815)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside kinase activity (GO:0019206)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|prostate(1)|skin(2)|stomach(1)	40						AAAGCAAAAATTGATGCAAAT	0.348																																																	0													91.0	94.0	93.0					1																	77763549		2203	4300	6503	SO:0001819	synonymous_variant	26289			AF062595	CCDS675.1, CCDS676.1	1p31	2008-02-05			ENSG00000154027	ENSG00000154027		"""Adenylate kinases"""	365	protein-coding gene	gene with protein product		608009				10215863	Standard	NM_012093		Approved		uc001dhn.3	Q9Y6K8	OTTHUMG00000009796	ENST00000354567.2:c.616T>C	1.37:g.77763549T>C			Q5U622|Q6FH66|Q7Z4T5|Q86YS0|Q8N464|Q96EC9	Silent	SNP	pfam_Adenylate_kin,pfam_Dpy-30_motif,superfamily_cAMP_dep_PK_reg_su_I/II_a/b,prints_Adenylate_kin,tigrfam_Adenylate_kin1	p.L206	ENST00000354567.2	37	c.616	CCDS675.1	1																																																																																			AK5	-	pfam_Adenylate_kin		0.348	AK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AK5	HGNC	protein_coding	OTTHUMT00000026993.4	T	NM_174858		77763549	+1	no_errors	ENST00000354567	ensembl	human	known	70_37	silent	SNP	0.999	C
ANGPT1	284	genome.wustl.edu	37	8	108297059	108297060	+	Frame_Shift_Ins	INS	-	-	GA	rs201186487		TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr8:108297059_108297060insGA	ENST00000520734.1	-	6	740_741	c.455_456insTC	c.(454-456)tccfs	p.S152fs	ANGPT1_ENST00000518386.1_Intron|ANGPT1_ENST00000520052.1_Frame_Shift_Ins_p.S151fs			Q15389	ANGP1_HUMAN	angiopoietin 1	352					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell-substrate adhesion (GO:0031589)|glomerulus vasculature development (GO:0072012)|hemopoiesis (GO:0030097)|heparin biosynthetic process (GO:0030210)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of vascular permeability (GO:0043116)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|protein localization to cell surface (GO:0034394)|regulation of satellite cell proliferation (GO:0014842)|sprouting angiogenesis (GO:0002040)|Tie signaling pathway (GO:0048014)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(13)|ovary(4)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	43	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			AATATTCACCGGAGGGATTTCC	0.386																																																	0																																										SO:0001589	frameshift_variant	284			D13628	CCDS6306.1, CCDS56551.1	8q23.1	2013-02-06			ENSG00000154188	ENSG00000154188		"""Fibrinogen C domain containing"""	484	protein-coding gene	gene with protein product		601667				9545648	Standard	NM_001146		Approved	KIAA0003, Ang1	uc003ymn.3	Q15389	OTTHUMG00000164812	ENST00000520734.1:c.454_455dupTC	8.37:g.108297060_108297061dupGA	ENSP00000430750:p.Ser152fs		Q5HYA0	Frame_Shift_Ins	INS	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.G353fs	ENST00000520734.1	37	c.1056_1055		8																																																																																			ANGPT1	-	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C		0.386	ANGPT1-002	PUTATIVE	alternative_5_UTR|basic	protein_coding	ANGPT1	HGNC	protein_coding	OTTHUMT00000380428.2	-	NM_001146, NM_139290		108297060	-1	no_errors	ENST00000517746	ensembl	human	known	70_37	frame_shift_ins	INS	0.742:0.996	GA
ANO7	50636	genome.wustl.edu	37	2	242149950	242149950	+	Missense_Mutation	SNP	T	T	A	rs534689646		TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr2:242149950T>A	ENST00000274979.8	+	15	1791	c.1688T>A	c.(1687-1689)aTc>aAc	p.I563N	ANO7_ENST00000402430.3_Missense_Mutation_p.I562N	NM_001001891.3	NP_001001891.2	Q6IWH7	ANO7_HUMAN	anoctamin 7	563					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(14)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	32						CTCTCCAAGATCTATGTATCC	0.647																																																	0													108.0	92.0	97.0					2																	242149950		2203	4300	6503	SO:0001583	missense	50636			AY617079	CCDS33423.1, CCDS46563.1	2q37.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000146205	ENSG00000146205		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	31677	protein-coding gene	gene with protein product		605096	"""transmembrane protein 16G"""	PCANAP5, TMEM16G		14981236, 15375614, 24692353	Standard	NM_001001891		Approved	NGEP, PCANAP5L, IPCA-5	uc002wax.2	Q6IWH7	OTTHUMG00000151702	ENST00000274979.8:c.1688T>A	2.37:g.242149950T>A	ENSP00000274979:p.Ile563Asn		Q6IWH6	Missense_Mutation	SNP	pfam_Anoctamin	p.I563N	ENST00000274979.8	37	c.1688	CCDS33423.1	2	.	.	.	.	.	.	.	.	.	.	T	20.4	3.984776	0.74474	.	.	ENSG00000146205	ENST00000274979;ENST00000402430	T;T	0.66995	-0.24;-0.24	3.34	3.34	0.38264	.	2.468800	0.02314	U	0.072346	T	0.81735	0.4885	M	0.80847	2.515	0.39296	D	0.96481	D	0.55172	0.97	P	0.57960	0.83	T	0.68247	-0.5459	10	0.72032	D	0.01	.	10.9906	0.47547	0.0:0.0:0.0:1.0	.	563	Q6IWH7	ANO7_HUMAN	N	563;562	ENSP00000274979:I563N;ENSP00000385418:I562N	ENSP00000274979:I563N	I	+	2	0	ANO7	241798623	0.900000	0.30661	0.055000	0.19348	0.293000	0.27360	4.002000	0.57053	1.289000	0.44618	0.260000	0.18958	ATC	ANO7	-	pfam_Anoctamin		0.647	ANO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO7	HGNC	protein_coding	OTTHUMT00000323509.1	T	NM_001001891		242149950	+1	no_errors	ENST00000274979	ensembl	human	known	70_37	missense	SNP	0.992	A
ARL5B	221079	genome.wustl.edu	37	10	18961578	18961578	+	Missense_Mutation	SNP	G	G	T			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr10:18961578G>T	ENST00000377275.3	+	4	516	c.283G>T	c.(283-285)Gac>Tac	p.D95Y		NM_178815.3	NP_848930.1	Q96KC2	ARL5B_HUMAN	ADP-ribosylation factor-like 5B	95					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			lung(1)|ovary(1)	2						TGATAGCATTGACAGGGAACG	0.299																																																	0													98.0	103.0	101.0					10																	18961578		2203	4294	6497	SO:0001583	missense	221079			AF494061	CCDS7131.1	10p13	2014-05-09	2005-11-03	2005-11-03	ENSG00000165997	ENSG00000165997		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	23052	protein-coding gene	gene with protein product		608909	"""ADP-ribosylation factor-like 8"""	ARL8		12853149	Standard	XM_005252400		Approved		uc001iqd.1	Q96KC2	OTTHUMG00000017765	ENST00000377275.3:c.283G>T	10.37:g.18961578G>T	ENSP00000366487:p.Asp95Tyr			Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_MIRO-like,pfam_Gtr1_RagA,pfam_Gprotein_alpha_su,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.D95Y	ENST00000377275.3	37	c.283	CCDS7131.1	10	.	.	.	.	.	.	.	.	.	.	G	23.3	4.395113	0.83011	.	.	ENSG00000165997	ENST00000377275	D	0.85013	-1.93	5.91	5.01	0.66863	Small GTP-binding protein domain (1);	0.042723	0.85682	D	0.000000	D	0.96262	0.8781	H	0.99820	4.81	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98065	1.0395	10	0.87932	D	0	-20.9561	14.9978	0.71446	0.0683:0.0:0.9317:0.0	.	95	Q96KC2	ARL5B_HUMAN	Y	95	ENSP00000366487:D95Y	ENSP00000366487:D95Y	D	+	1	0	ARL5B	19001584	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.387000	0.73191	1.507000	0.48752	0.579000	0.79373	GAC	ARL5B	-	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_MIRO-like,pfam_Gtr1_RagA,pfam_Gprotein_alpha_su,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,prints_Small_GTPase_ARF/SAR,tigrfam_Small_GTP-bd_dom		0.299	ARL5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL5B	HGNC	protein_coding	OTTHUMT00000047078.1	G	NM_178815		18961578	+1	no_errors	ENST00000377275	ensembl	human	known	70_37	missense	SNP	1.000	T
ATP6V0A1	535	genome.wustl.edu	37	17	40618526	40618526	+	Splice_Site	SNP	G	G	C			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr17:40618526G>C	ENST00000343619.4	+	3	319		c.e3+1		ATP6V0A1_ENST00000393829.2_Splice_Site|ATP6V0A1_ENST00000585525.1_Splice_Site|ATP6V0A1_ENST00000537728.1_Splice_Site|ATP6V0A1_ENST00000264649.6_Splice_Site|ATP6V0A1_ENST00000544137.1_Intron|ATP6V0A1_ENST00000546249.1_Splice_Site	NM_001130021.1	NP_001123493.1	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1						ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|urinary_tract(3)	26		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		CGAAAGCTTCGTATGTGCACT	0.313																																																	0													171.0	167.0	168.0					17																	40618526		2203	4300	6503	SO:0001630	splice_region_variant	535			U73006	CCDS11426.1, CCDS45683.1, CCDS45684.1	17q21	2010-04-21	2006-01-20	2002-05-10	ENSG00000033627	ENSG00000033627		"""ATPases / V-type"""	865	protein-coding gene	gene with protein product		192130	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1A (110/116kD)"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 1"", ""ATPase, H+ transporting, lysosomal V0 subunit A1"""	VPP1, ATP6N1, ATP6N1A		7774924	Standard	NM_001130020		Approved	a1, Vph1, Stv1	uc002hzs.3	Q93050		ENST00000343619.4:c.196+1G>C	17.37:g.40618526G>C			B7Z3B7|Q8N5G7|Q9NSX0	Splice_Site	SNP	-	e2+1	ENST00000343619.4	37	c.196+1	CCDS45684.1	17	.	.	.	.	.	.	.	.	.	.	G	20.3	3.962184	0.74016	.	.	ENSG00000033627	ENST00000343619;ENST00000546249;ENST00000393829;ENST00000264649;ENST00000537728	.	.	.	5.8	3.75	0.43078	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9262	0.70881	0.0:0.0:0.7383:0.2617	.	.	.	.	.	-1	.	.	.	+	.	.	ATP6V0A1	37872052	1.000000	0.71417	0.999000	0.59377	0.956000	0.61745	9.206000	0.95056	0.749000	0.32854	0.561000	0.74099	.	ATP6V0A1	-	-		0.313	ATP6V0A1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATP6V0A1	HGNC	protein_coding	OTTHUMT00000450364.1	G	NM_001130020	Intron	40618526	+1	no_errors	ENST00000264649	ensembl	human	known	70_37	splice_site	SNP	1.000	C
B3GNTL1	146712	genome.wustl.edu	37	17	80972328	80972328	+	Splice_Site	SNP	A	A	T			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr17:80972328A>T	ENST00000320865.3	-	5	422		c.e5+1		B3GNTL1_ENST00000576599.1_Splice_Site|B3GNTL1_ENST00000571954.1_Splice_Site	NM_001009905.1	NP_001009905.1	Q67FW5	B3GNL_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1								transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	8	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)			GCCAGTACTTACGCTCGACGG	0.478																																																	0													116.0	92.0	100.0					17																	80972328		2203	4300	6503	SO:0001630	splice_region_variant	146712			AY634364	CCDS32778.1	17q25.3	2013-02-22	2004-01-13	2004-01-14	ENSG00000175711	ENSG00000175711		"""Glycosyltransferase family 2 domain containing"""	21727	protein-coding gene	gene with protein product		615337					Standard	NM_001009905		Approved	B3GNT8	uc002kgg.1	Q67FW5	OTTHUMG00000177788	ENST00000320865.3:c.408+1T>A	17.37:g.80972328A>T			Q6GV30|Q8WUT3	Splice_Site	SNP	-	e5+2	ENST00000320865.3	37	c.408+2	CCDS32778.1	17	.	.	.	.	.	.	.	.	.	.	a	11.33	1.607175	0.28623	.	.	ENSG00000175711	ENST00000320865	.	.	.	4.15	4.15	0.48705	.	.	.	.	.	.	.	.	.	.	.	0.51012	D	0.999909	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.8082	0.40805	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	B3GNTL1	78565617	0.991000	0.36638	0.039000	0.18376	0.007000	0.05969	3.765000	0.55272	1.899000	0.54978	0.362000	0.22060	.	B3GNTL1	-	-		0.478	B3GNTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNTL1	HGNC	protein_coding	OTTHUMT00000438949.1	A	NM_001009905	Intron	80972328	-1	no_errors	ENST00000320865	ensembl	human	known	70_37	splice_site	SNP	0.093	T
BACH2	60468	genome.wustl.edu	37	6	90647929	90647929	+	Silent	SNP	C	C	T			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr6:90647929C>T	ENST00000257749.4	-	8	2684	c.1977G>A	c.(1975-1977)gcG>gcA	p.A659A	BACH2_ENST00000343122.3_Silent_p.A659A|BACH2_ENST00000537989.1_Silent_p.A659A	NM_021813.2	NP_068585.1	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 2	659	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	45		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		AGCGCTGGGCCGCGATGCGGT	0.463																																																	0													94.0	95.0	95.0					6																	90647929		2203	4300	6503	SO:0001819	synonymous_variant	60468			AL121787	CCDS5026.1	6q15	2013-01-10			ENSG00000112182	ENSG00000112182		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	14078	protein-coding gene	gene with protein product		605394				10949928, 12829606	Standard	NM_001170794		Approved	BTBD25	uc003pnw.3	Q9BYV9	OTTHUMG00000015216	ENST00000257749.4:c.1977G>A	6.37:g.90647929C>T			E1P518|Q59H70|Q5T793|Q9NTS5	Silent	SNP	pfam_BTB_POZ,pfam_bZIP,superfamily_BTB/POZ_fold,superfamily_Euk_TF_DNA-bd,smart_BTB/POZ-like,smart_bZIP,pfscan_BTB/POZ-like,pfscan_bZIP	p.A659	ENST00000257749.4	37	c.1977	CCDS5026.1	6																																																																																			BACH2	-	pfam_bZIP,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP		0.463	BACH2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	BACH2	HGNC	protein_coding	OTTHUMT00000041522.2	C	NM_021813		90647929	-1	no_errors	ENST00000257749	ensembl	human	known	70_37	silent	SNP	0.024	T
C11orf48	79081	genome.wustl.edu	37	11	62432618	62432618	+	Intron	SNP	G	G	A			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr11:62432618G>A	ENST00000431002.2	-	3	2350				C11orf48_ENST00000525675.1_Silent_p.I8I|C11orf48_ENST00000524958.1_Silent_p.I8I|C11orf48_ENST00000354588.3_Intron|METTL12_ENST00000532971.1_5'Flank|RP11-831H9.11_ENST00000528405.1_Silent_p.I8I|C11orf48_ENST00000532208.1_Intron|SNORA57_ENST00000383870.1_RNA			Q9BQE6	CK048_HUMAN	chromosome 11 open reading frame 48											endometrium(1)|lung(5)|urinary_tract(1)	7						GGGGCCGGTTGATCTTTCCCC	0.647																																																	0																																										SO:0001627	intron_variant	79081			BC001434	CCDS8028.1	11q12.3	2014-02-12			ENSG00000162194	ENSG00000162194			28351	protein-coding gene	gene with protein product						12477932	Standard	NM_024099		Approved	MGC2477	uc001nuf.3	Q9BQE6	OTTHUMG00000167588	ENST00000431002.2:c.617-173C>T	11.37:g.62432618G>A			Q96NA4	Silent	SNP	NULL	p.I8	ENST00000431002.2	37	c.24		11																																																																																			C11orf48	-	NULL		0.647	C11orf48-004	KNOWN	basic	protein_coding	C11orf48	HGNC	protein_coding	OTTHUMT00000395233.1	G	NM_024099		62432618	-1	no_errors	ENST00000524958	ensembl	human	putative	70_37	silent	SNP	1.000	A
RNF212B	100507650	genome.wustl.edu	37	14	23733863	23733863	+	Missense_Mutation	SNP	C	C	T			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr14:23733863C>T	ENST00000399910.1	+	12	870	c.617C>T	c.(616-618)cCc>cTc	p.P206L	C14orf164_ENST00000430154.2_Missense_Mutation_p.P206L|C14orf164_ENST00000399905.1_Intron|C14orf164_ENST00000492355.1_3'UTR			A8MTL3	R212B_HUMAN		206							zinc ion binding (GO:0008270)										AGGAGAACTCCCAGAGACTCT	0.403																																																	0																																										SO:0001583	missense	100507650																														ENST00000399910.1:c.617C>T	14.37:g.23733863C>T	ENSP00000382794:p.Pro206Leu			Missense_Mutation	SNP	NULL	p.P206L	ENST00000399910.1	37	c.617		14	.	.	.	.	.	.	.	.	.	.	C	15.36	2.810045	0.50421	.	.	ENSG00000215277	ENST00000399910;ENST00000430154;ENST00000470456	.	.	.	5.99	5.99	0.97316	.	0.527164	0.15457	U	0.261357	T	0.58424	0.2121	L	0.29908	0.895	0.51233	D	0.999917	.	.	.	.	.	.	T	0.52704	-0.8540	7	0.37606	T	0.19	-7.5869	15.9778	0.80083	0.0:1.0:0.0:0.0	.	.	.	.	L	206;206;70	.	ENSP00000382794:P206L	P	+	2	0	C14orf164	22803703	1.000000	0.71417	1.000000	0.80357	0.243000	0.25628	3.536000	0.53582	2.840000	0.97914	0.655000	0.94253	CCC	C14orf164	-	NULL		0.403	C14orf164-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	C14orf164	HGNC	protein_coding	OTTHUMT00000313900.1	C			23733863	+1	no_errors	ENST00000430154	ensembl	human	known	70_37	missense	SNP	1.000	T
CAPN8	388743	genome.wustl.edu	37	1	223842102	223842102	+	Splice_Site	SNP	C	C	G			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr1:223842102C>G	ENST00000366873.2	-	2	314		c.e2-1		CAPN8_ENST00000366872.5_Splice_Site			A6NHC0	CAN8_HUMAN	calpain 8						digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|endometrium(2)|prostate(1)	4						GACACAACTCCTGAAAGTAAT	0.498																																																	0													86.0	76.0	79.0					1																	223842102		692	1591	2283	SO:0001630	splice_region_variant	388743				CCDS73038.1	1q41	2013-01-10	2007-02-21		ENSG00000203697	ENSG00000203697		"""EF-hand domain containing"""	1485	protein-coding gene	gene with protein product			"""calpain 8 (nCL-2)"""			7690035, 8889549	Standard	NM_001143962		Approved	nCL-2	uc009xee.2	A6NHC0	OTTHUMG00000037378	ENST00000366873.2:c.238-1G>C	1.37:g.223842102C>G			B2RXL2	Splice_Site	SNP	-	e2-1	ENST00000366873.2	37	c.238-1		1	.	.	.	.	.	.	.	.	.	.	C	10.20	1.284778	0.23392	.	.	ENSG00000203697	ENST00000366872;ENST00000419193;ENST00000366873	.	.	.	4.93	4.93	0.64822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2198	0.73303	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CAPN8	221908725	1.000000	0.71417	0.943000	0.38184	0.347000	0.29111	5.143000	0.64826	2.442000	0.82660	0.561000	0.74099	.	CAPN8	-	-		0.498	CAPN8-001	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	CAPN8	HGNC	protein_coding	OTTHUMT00000171394.3	C	NM_001143962	Intron	223842102	-1	no_errors	ENST00000366872	ensembl	human	known	70_37	splice_site	SNP	1.000	G
CDPF1	150383	genome.wustl.edu	37	22	46641057	46641057	+	Missense_Mutation	SNP	G	G	A			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr22:46641057G>A	ENST00000314567.3	-	4	727	c.304C>T	c.(304-306)Cgg>Tgg	p.R102W	CDPF1_ENST00000404583.1_Missense_Mutation_p.R97W|CDPF1_ENST00000404744.1_3'UTR|CDPF1_ENST00000475605.1_5'UTR	NM_207327.4	NP_997210.3	Q6NVV7	CDPF1_HUMAN	cysteine-rich, DPF motif domain containing 1	102																	AAGTCTTGCCGAATTTCCTGA	0.522																																																	0													87.0	84.0	85.0					22																	46641057		2203	4300	6503	SO:0001583	missense	150383				CCDS33670.1	22q13.31	2012-07-18	2012-07-18	2012-07-18	ENSG00000205643	ENSG00000205643			33710	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 40"""	C22orf40			Standard	NM_207327		Approved	LOC150383	uc003bhe.3	Q6NVV7	OTTHUMG00000030672	ENST00000314567.3:c.304C>T	22.37:g.46641057G>A	ENSP00000325301:p.Arg102Trp		A6NCA1|A9IU12|A9IU16|Q3ZCR8	Missense_Mutation	SNP	pfam_Cys-rich_DPF,prints_Cys-rich_DPF	p.R102W	ENST00000314567.3	37	c.304	CCDS33670.1	22	.	.	.	.	.	.	.	.	.	.	G	24.1	4.497288	0.85069	.	.	ENSG00000205643	ENST00000404583;ENST00000314567	T;T	0.44083	0.93;0.93	5.56	4.52	0.55395	Cysteine-rich domain, DPF-motif (1);	0.713584	0.14159	N	0.337481	T	0.56470	0.1987	L	0.50333	1.59	0.80722	D	1	D;D	0.76494	0.999;0.996	P;P	0.60609	0.877;0.736	T	0.57177	-0.7856	10	0.72032	D	0.01	.	14.7684	0.69657	0.0:0.0:0.8546:0.1454	.	102;97	Q6NVV7;F6RAJ7	CV040_HUMAN;.	W	97;102	ENSP00000384451:R97W;ENSP00000325301:R102W	ENSP00000325301:R102W	R	-	1	2	C22orf40	45019721	0.870000	0.30015	0.866000	0.34008	0.995000	0.86356	3.405000	0.52630	1.290000	0.44636	0.650000	0.86243	CGG	CDPF1	-	pfam_Cys-rich_DPF		0.522	CDPF1-001	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	CDPF1	HGNC	protein_coding	OTTHUMT00000075560.4	G	NM_207327		46641057	-1	no_errors	ENST00000314567	ensembl	human	novel	70_37	missense	SNP	0.681	A
COL6A5	256076	genome.wustl.edu	37	3	130095298	130095298	+	Missense_Mutation	SNP	C	C	A			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr3:130095298C>A	ENST00000432398.2	+	3	780	c.286C>A	c.(286-288)Cac>Aac	p.H96N	COL6A5_ENST00000265379.6_Missense_Mutation_p.H96N	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	96	Nonhelical region.|VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						CATGCTGAACCACCTCAAGAA	0.517																																																	0													79.0	69.0	72.0					3																	130095298		692	1591	2283	SO:0001583	missense	256076			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.286C>A	3.37:g.130095298C>A	ENSP00000390895:p.His96Asn		A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.H96N	ENST00000432398.2	37	c.286		3	.	.	.	.	.	.	.	.	.	.	C	8.370	0.835203	0.16820	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	D;D	0.82433	-1.61;-1.61	5.14	2.23	0.28157	.	.	.	.	.	D	0.88112	0.6349	M	0.78049	2.395	0.22050	N	0.999393	D	0.71674	0.998	D	0.70487	0.969	T	0.75682	-0.3233	9	0.30078	T	0.28	.	6.5929	0.22656	0.1471:0.6917:0.0:0.1612	.	96	A8TX70-2	.	N	96	ENSP00000390895:H96N;ENSP00000265379:H96N	ENSP00000265379:H96N	H	+	1	0	COL6A5	131577988	0.968000	0.33430	1.000000	0.80357	0.042000	0.13812	1.008000	0.29872	0.615000	0.30124	0.557000	0.71058	CAC	COL6A5	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.517	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		C	NM_153264		130095298	+1	no_errors	ENST00000265379	ensembl	human	known	70_37	missense	SNP	0.999	A
CTDSPL2	51496	genome.wustl.edu	37	15	44783040	44783040	+	Silent	SNP	A	A	G			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr15:44783040A>G	ENST00000260327.4	+	5	1097	c.534A>G	c.(532-534)caA>caG	p.Q178Q	CTDSPL2_ENST00000558966.1_Silent_p.Q178Q|CTDSPL2_ENST00000396780.1_Intron|CTDSPL2_ENST00000558373.1_Intron	NM_016396.2	NP_057480.2	Q05D32	CTSL2_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2	178							phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(2)	13		all_cancers(109;4.36e-14)|all_epithelial(112;9.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;1.02e-20)|GBM - Glioblastoma multiforme(94;1.49e-06)|COAD - Colon adenocarcinoma(120;0.0857)|Colorectal(105;0.0905)		TAGTAAAACAACTTGATATGG	0.393																																																	0													120.0	111.0	114.0					15																	44783040		2198	4298	6496	SO:0001819	synonymous_variant	51496			AF161478	CCDS10110.1	15q15.3-q21.1	2010-06-21			ENSG00000137770	ENSG00000137770		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	26936	protein-coding gene	gene with protein product							Standard	NM_016396		Approved	HSPC129, FLJ10523	uc001ztr.3	Q05D32	OTTHUMG00000131159	ENST00000260327.4:c.534A>G	15.37:g.44783040A>G			Q3ZTU1|Q6AI06|Q8IYI9|Q9NVT2|Q9NZX8|Q9P030	Silent	SNP	pfam_NIF,superfamily_HAD-like_dom,smart_NIF,pfscan_NIF,tigrfam_Dullard_phosphatase	p.Q178	ENST00000260327.4	37	c.534	CCDS10110.1	15																																																																																			CTDSPL2	-	NULL		0.393	CTDSPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTDSPL2	HGNC	protein_coding	OTTHUMT00000253851.1	A	NM_016396		44783040	+1	no_errors	ENST00000260327	ensembl	human	known	70_37	silent	SNP	1.000	G
CYP2A13	1553	genome.wustl.edu	37	19	41601815	41601815	+	Missense_Mutation	SNP	G	G	A	rs267605496		TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr19:41601815G>A	ENST00000330436.3	+	9	1454	c.1454G>A	c.(1453-1455)cGa>cAa	p.R485Q		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	485					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.R485Q(1)		breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	ACGATCCCACGAAACTACACC	0.627																																																	1	Substitution - Missense(1)	skin(1)											134.0	120.0	125.0					19																	41601815		2203	4300	6503	SO:0001583	missense	1553			U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.1454G>A	19.37:g.41601815G>A	ENSP00000332679:p.Arg485Gln		Q53YR8|Q6R569|Q6R570|Q9H2X2	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2A-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV	p.R485Q	ENST00000330436.3	37	c.1454	CCDS12571.1	19	.	.	.	.	.	.	.	.	.	.	G	12.87	2.068208	0.36470	.	.	ENSG00000197838	ENST00000330436	T	0.68181	-0.31	3.97	-7.93	0.01156	.	0.305062	0.31531	U	0.007492	T	0.34366	0.0895	N	0.03016	-0.435	0.09310	N	1	B	0.18310	0.027	B	0.12837	0.008	T	0.29640	-1.0005	10	0.56958	D	0.05	.	13.9469	0.64091	0.0832:0.3916:0.5252:0.0	.	485	Q16696	CP2AD_HUMAN	Q	485	ENSP00000332679:R485Q	ENSP00000332679:R485Q	R	+	2	0	CYP2A13	46293655	0.000000	0.05858	0.014000	0.15608	0.592000	0.36648	-1.542000	0.02196	-0.648000	0.05437	-0.645000	0.03944	CGA	CYP2A13	-	pfam_Cyt_P450,superfamily_Cyt_P450		0.627	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2A13	HGNC	protein_coding	OTTHUMT00000463505.1	G	NM_000766		41601815	+1	no_errors	ENST00000330436	ensembl	human	known	70_37	missense	SNP	0.000	A
DMD	1756	genome.wustl.edu	37	X	32398677	32398677	+	Missense_Mutation	SNP	C	C	T			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chrX:32398677C>T	ENST00000357033.4	-	34	5001	c.4795G>A	c.(4795-4797)Gca>Aca	p.A1599T	DMD_ENST00000378677.2_Missense_Mutation_p.A1595T	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1599	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CCTTCAACTGCTGATCTCTTT	0.393																																																	0													152.0	133.0	140.0					X																	32398677		2202	4300	6502	SO:0001583	missense	1756			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.4795G>A	X.37:g.32398677C>T	ENSP00000354923:p.Ala1599Thr		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.A1599T	ENST00000357033.4	37	c.4795	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	c	11.63	1.696992	0.30142	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.34859	1.34;1.34	5.21	5.21	0.72293	.	0.000000	0.33272	U	0.005095	T	0.39937	0.1097	N	0.21142	0.635	0.80722	D	1	B;D;B;D;D	0.61697	0.221;0.967;0.262;0.99;0.99	B;P;B;P;P	0.62885	0.084;0.622;0.137;0.908;0.908	T	0.10730	-1.0617	10	0.02654	T	1	.	17.8733	0.88817	0.0:1.0:0.0:0.0	.	1591;1599;1595;258;255	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;DMD_HUMAN;.;.;.	T	1591;258;255;1595;1599;1599;1476	ENSP00000367948:A1595T;ENSP00000354923:A1599T	ENSP00000354923:A1599T	A	-	1	0	DMD	32308598	0.739000	0.28196	1.000000	0.80357	0.855000	0.48748	1.405000	0.34635	2.153000	0.67306	0.534000	0.68092	GCA	DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin		0.393	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	C	NM_004006		32398677	-1	no_errors	ENST00000357033	ensembl	human	known	70_37	missense	SNP	0.953	T
DNAH3	55567	genome.wustl.edu	37	16	21145629	21145629	+	Missense_Mutation	SNP	G	G	T			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr16:21145629G>T	ENST00000261383.3	-	7	1032	c.1033C>A	c.(1033-1035)Cac>Aac	p.H345N	DNAH3_ENST00000415178.1_Missense_Mutation_p.H345N	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	345	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TTCACCGTGTGCAGATGCTCC	0.532																																																	0													113.0	105.0	107.0					16																	21145629		2201	4300	6501	SO:0001583	missense	55567			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.1033C>A	16.37:g.21145629G>T	ENSP00000261383:p.His345Asn		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Prefoldin,smart_AAA+_ATPase	p.H345N	ENST00000261383.3	37	c.1033	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	G	10.24	1.296165	0.23650	.	.	ENSG00000158486	ENST00000261383;ENST00000415178;ENST00000396036	T;T	0.22336	1.96;2.12	5.85	-0.00454	0.14021	.	0.203493	0.41001	D	0.000979	T	0.12561	0.0305	L	0.33485	1.01	0.23095	N	0.998302	B;B	0.34264	0.0;0.446	B;B	0.33750	0.001;0.169	T	0.26258	-1.0108	10	0.22109	T	0.4	.	8.1269	0.31003	0.6299:0.0:0.3701:0.0	.	345;316	Q8TD57;Q8TD57-2	DYH3_HUMAN;.	N	345;345;316	ENSP00000261383:H345N;ENSP00000394245:H345N	ENSP00000261383:H345N	H	-	1	0	DNAH3	21053130	1.000000	0.71417	0.911000	0.35937	0.777000	0.43975	2.238000	0.43070	0.116000	0.18110	-0.137000	0.14449	CAC	DNAH3	-	NULL		0.532	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	G	NM_017539		21145629	-1	no_errors	ENST00000261383	ensembl	human	known	70_37	missense	SNP	0.929	T
AC024132.1	0	genome.wustl.edu	37	4	27209653	27209654	+	lincRNA	DEL	GT	GT	-			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	GT	GT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr4:27209653_27209654delGT	ENST00000382007.1	-	0	1981_1982																											TAAAGACTGAgtgtgtgtgtgt	0.446																																																	0										37,127,2860		0,0,37,4,119,1352						-3.5	0.0		dbSNP_119	46	8,184,4818		1,0,6,9,166,2323	no	intergenic				1,0,43,13,285,3675	A1A1,A1A2,A1R,A2A2,A2R,RR		3.8323,5.4233,4.4312				45,311,7678						0																															4.37:g.27209663_27209664delGT				RNA	DEL	-	NULL	ENST00000382007.1	37	NULL		4																																																																																			AC024132.1	-	-		0.446	AC024132.1-001	KNOWN	basic	lincRNA	ENSG00000205830	Clone_based_vega_gene	lincRNA	OTTHUMT00000319578.1	GT			27209654	-1	no_errors	ENST00000382007	ensembl	human	known	70_37	rna	DEL	0.000:0.000	-
HERC2P4	100289574	genome.wustl.edu	37	16	32141827	32141827	+	IGR	SNP	A	A	G	rs149005115		TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr16:32141827A>G								RP11-1166P10.6 (45721 upstream) : HERC2P4 (39477 downstream)																							ATCTCAGGCCATCTGCAGAGA	0.428																																																	0																																										SO:0001628	intergenic_variant	0																															16.37:g.32141827A>G				RNA	SNP	-	NULL		37	NULL		16																																																																																			RP11-1166P10.9	-	-	0	0.428					ENSG00000260544	Clone_based_vega_gene			A			32141827	+1	no_errors	ENST00000568083	ensembl	human	known	70_37	rna	SNP	0.110	G
FAM132A	388581	genome.wustl.edu	37	1	1177985	1177985	+	Silent	SNP	C	C	T			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr1:1177985C>T	ENST00000330388.2	-	8	883	c.852G>A	c.(850-852)ggG>ggA	p.G284G		NM_001014980.2	NP_001014980.1	Q5T7M4	ADIPL_HUMAN	family with sequence similarity 132, member A	284	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				negative regulation of gluconeogenesis (GO:0045721)|negative regulation of inflammatory response (GO:0050728)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of glucose import (GO:0046324)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)			haematopoietic_and_lymphoid_tissue(1)|lung(1)	2	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.22e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		TGAGGACGGCCCCGGAGCCAT	0.687																																																	0													52.0	43.0	46.0					1																	1177985		2168	4270	6438	SO:0001819	synonymous_variant	388581			BC089443	CCDS30554.1	1p36.33	2012-03-26	2007-03-27	2007-03-27	ENSG00000184163	ENSG00000184163			32308	protein-coding gene	gene with protein product	"""adipolin"", ""adipose-derived insulin-sensitizing factor"""		"""C1q domain containing 2"""	C1QDC2		21849507	Standard	NM_001014980		Approved	MGC105127, C1QTNF12, CTRP12	uc001adl.2	Q5T7M4	OTTHUMG00000001412	ENST00000330388.2:c.852G>A	1.37:g.1177985C>T			Q5EBL5	Silent	SNP	superfamily_Tumour_necrosis_fac-like	p.G284	ENST00000330388.2	37	c.852	CCDS30554.1	1																																																																																			FAM132A	-	superfamily_Tumour_necrosis_fac-like		0.687	FAM132A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM132A	HGNC	protein_coding	OTTHUMT00000004080.4	C	XM_371208		1177985	-1	no_errors	ENST00000330388	ensembl	human	known	70_37	silent	SNP	0.979	T
FAM73B	84895	genome.wustl.edu	37	9	131822885	131822885	+	Missense_Mutation	SNP	G	G	C			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr9:131822885G>C	ENST00000358369.4	+	8	1076	c.850G>C	c.(850-852)Gag>Cag	p.E284Q	FAM73B_ENST00000277475.5_Nonstop_Mutation_p.*324S|FAM73B_ENST00000406926.2_Missense_Mutation_p.E284Q	NM_032809.2	NP_116198.2	Q7L4E1	FA73B_HUMAN	family with sequence similarity 73, member B	284					bone development (GO:0060348)	integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(1)	13						GGCGGACGATGAGGACAGCCT	0.657																																																	0													27.0	25.0	26.0					9																	131822885		2203	4296	6499	SO:0001583	missense	84895			AK074127	CCDS6917.1	9q34.13	2008-02-05	2005-08-11	2005-08-11	ENSG00000148343	ENSG00000148343			23621	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 54"""	C9orf54			Standard	NM_032809		Approved	FLJ14596, FLJ00199	uc004bxa.3	Q7L4E1	OTTHUMG00000020770	ENST00000358369.4:c.850G>C	9.37:g.131822885G>C	ENSP00000351138:p.Glu284Gln		Q8NBM3|Q8TEJ6|Q969E6	Missense_Mutation	SNP	pfam_DUF2217	p.E284Q	ENST00000358369.4	37	c.850	CCDS6917.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.40|12.40	1.927486|1.927486	0.34002|0.34002	.|.	.|.	ENSG00000148343|ENSG00000148343	ENST00000358369;ENST00000406926|ENST00000277475	T;T|.	0.23754|.	1.89;1.89|.	5.14|5.14	5.14|5.14	0.70334|0.70334	.|.	0.103596|.	0.64402|.	D|.	0.000004|.	T|.	0.56673|.	0.2001|.	L|L	0.57536|0.57536	1.79|1.79	0.09310|0.09310	N|N	1|1	D;B|.	0.54964|.	0.969;0.408|.	P;B|.	0.56916|.	0.809;0.428|.	T|.	0.51317|.	-0.8721|.	10|.	0.21014|.	T|.	0.42|.	-14.9242|-14.9242	15.7813|15.7813	0.78264|0.78264	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	348;284|.	B4DZP8;Q7L4E1|.	.;FA73B_HUMAN|.	Q|S	284|324	ENSP00000351138:E284Q;ENSP00000384662:E284Q|.	ENSP00000351138:E284Q|.	E|X	+|+	1|2	0|2	FAM73B|FAM73B	130862706|130862706	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.799000|0.799000	0.45148|0.45148	8.575000|8.575000	0.90766|0.90766	2.407000|2.407000	0.81776|0.81776	0.561000|0.561000	0.74099|0.74099	GAG|TGA	FAM73B	-	pfam_DUF2217		0.657	FAM73B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM73B	HGNC	protein_coding	OTTHUMT00000054542.7	G	NM_032809		131822885	+1	no_errors	ENST00000358369	ensembl	human	known	70_37	missense	SNP	1.000	C
FFAR3	2865	genome.wustl.edu	37	19	35849932	35849932	+	Missense_Mutation	SNP	C	C	G			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr19:35849932C>G	ENST00000327809.4	+	2	341	c.140C>G	c.(139-141)cCg>cGg	p.P47R	FFAR3_ENST00000594310.1_Missense_Mutation_p.P47R	NM_005304.3	NP_005295.1	O14843	FFAR3_HUMAN	free fatty acid receptor 3	47					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to fatty acid (GO:0071398)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|mucosal immune response (GO:0002385)|negative regulation of blood pressure (GO:0045776)|positive regulation of acute inflammatory response to non-antigenic stimulus (GO:0002879)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production involved in immune response (GO:0002720)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|regulation of hormone biosynthetic process (GO:0046885)|regulation of norepinephrine secretion (GO:0014061)|regulation of peptide hormone secretion (GO:0090276)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)			endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|stomach(1)	17	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;1.29e-19)|OV - Ovarian serous cystadenocarcinoma(14;4.63e-18)|all cancers(14;5.19e-17)|LUSC - Lung squamous cell carcinoma(66;0.0221)			CAGCGCCGCCCGGTGGCCGTG	0.647																																					Esophageal Squamous(185;1742 2042 21963 24215 27871)												0													169.0	156.0	160.0					19																	35849932		2199	4295	6494	SO:0001583	missense	2865			AF024688	CCDS12459.1	19q13.1	2012-08-08	2006-02-15	2006-02-15	ENSG00000185897	ENSG00000185897		"""GPCR / Class A : Fatty acid receptors"""	4499	protein-coding gene	gene with protein product		603821	"""G protein-coupled receptor 41"""	GPR41		9344866, 22493486	Standard	NM_005304		Approved	FFA3R	uc002nzd.3	O14843	OTTHUMG00000172514	ENST00000327809.4:c.140C>G	19.37:g.35849932C>G	ENSP00000328230:p.Pro47Arg		B2RWM8|Q14CM7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_GPR40-rel_recept	p.P47R	ENST00000327809.4	37	c.140	CCDS12459.1	19	.	.	.	.	.	.	.	.	.	.	C	19.73	3.882807	0.72410	.	.	ENSG00000185897	ENST00000327809	T	0.63580	-0.05	4.99	4.99	0.66335	GPCR, rhodopsin-like superfamily (1);	0.278177	0.34750	U	0.003711	T	0.67739	0.2925	L	0.46157	1.445	0.22880	N	0.998613	D	0.89917	1.0	D	0.85130	0.997	T	0.57112	-0.7867	10	0.14252	T	0.57	-23.4484	9.2359	0.37466	0.0:0.904:0.0:0.096	.	47	O14843	FFAR3_HUMAN	R	47	ENSP00000328230:P47R	ENSP00000328230:P47R	P	+	2	0	FFAR3	40541772	0.008000	0.16893	0.994000	0.49952	0.936000	0.57629	2.091000	0.41691	2.597000	0.87782	0.455000	0.32223	CCG	FFAR3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.647	FFAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FFAR3	HGNC	protein_coding	OTTHUMT00000418873.2	C	NM_005304		35849932	+1	no_errors	ENST00000327809	ensembl	human	known	70_37	missense	SNP	0.395	G
FCGBP	8857	genome.wustl.edu	37	19	40424127	40424127	+	Missense_Mutation	SNP	G	G	C			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr19:40424127G>C	ENST00000221347.6	-	4	2083	c.2076C>G	c.(2074-2076)gaC>gaG	p.D692E		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	692						extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			AGGGCCTGGGGTCCAGGGTGT	0.652																																																	0													144.0	133.0	137.0					19																	40424127		2203	4300	6503	SO:0001583	missense	8857			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.2076C>G	19.37:g.40424127G>C	ENSP00000221347:p.Asp692Glu		O95784	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_VWF_C,smart_VWC_out	p.D692E	ENST00000221347.6	37	c.2076	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	G	13.72	2.321977	0.41096	.	.	ENSG00000090920	ENST00000221347	T	0.77358	-1.09	5.43	0.936	0.19488	Uncharacterised domain, cysteine-rich (2);	0.804464	0.09573	N	0.783889	T	0.71821	0.3385	M	0.62723	1.935	0.23936	N	0.996416	P	0.37370	0.592	B	0.40329	0.326	T	0.58329	-0.7655	10	0.29301	T	0.29	.	3.3389	0.07111	0.4015:0.0:0.4238:0.1748	.	692	Q9Y6R7	FCGBP_HUMAN	E	692	ENSP00000221347:D692E	ENSP00000221347:D692E	D	-	3	2	FCGBP	45115967	0.092000	0.21681	0.947000	0.38551	0.047000	0.14425	0.045000	0.14013	0.267000	0.21916	0.650000	0.86243	GAC	FCGBP	-	pfam_Unchr_dom_Cys-rich,smart_Unchr_dom_Cys-rich		0.652	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	G	NM_003890		40424127	-1	no_errors	ENST00000221347	ensembl	human	known	70_37	missense	SNP	0.999	C
FLNA	2316	genome.wustl.edu	37	X	153589834	153589834	+	Missense_Mutation	SNP	G	G	A			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chrX:153589834G>A	ENST00000369850.3	-	21	3285	c.3049C>T	c.(3049-3051)Ccc>Tcc	p.P1017S	FLNA_ENST00000360319.4_Missense_Mutation_p.P1017S|FLNA_ENST00000422373.1_Missense_Mutation_p.P1017S|FLNA_ENST00000344736.4_Missense_Mutation_p.P1017S	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	1017					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					ACCTTGCAGGGCACCGCTGCA	0.612																																																	0													74.0	76.0	76.0					X																	153589834		2131	4206	6337	SO:0001583	missense	2316			X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.3049C>T	X.37:g.153589834G>A	ENSP00000358866:p.Pro1017Ser		E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.P1017S	ENST00000369850.3	37	c.3049	CCDS48194.1	X	.	.	.	.	.	.	.	.	.	.	G	13.82	2.350410	0.41599	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.91894	-2.93;-2.93;-2.93;-2.93	5.51	5.51	0.81932	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.072322	0.56097	D	0.000037	D	0.93086	0.7799	M	0.84846	2.72	0.80722	D	1	B;B	0.25850	0.136;0.018	B;B	0.24006	0.049;0.05	D	0.91698	0.5371	10	0.72032	D	0.01	.	18.5078	0.90904	0.0:0.0:1.0:0.0	.	1017;1017	P21333-2;P21333	.;FLNA_HUMAN	S	1017;990;1017;1017;1017	ENSP00000353467:P1017S;ENSP00000416926:P1017S;ENSP00000358866:P1017S;ENSP00000358863:P1017S	ENSP00000358863:P1017S	P	-	1	0	FLNA	153243028	1.000000	0.71417	0.998000	0.56505	0.482000	0.33219	3.047000	0.49854	2.313000	0.78055	0.523000	0.50628	CCC	FLNA	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like		0.612	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNA	HGNC	protein_coding	OTTHUMT00000058942.3	G			153589834	-1	no_errors	ENST00000369850	ensembl	human	known	70_37	missense	SNP	1.000	A
FREM3	166752	genome.wustl.edu	37	4	144498997	144498997	+	Missense_Mutation	SNP	C	C	A			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr4:144498997C>A	ENST00000329798.5	-	8	6186	c.6187G>T	c.(6187-6189)Gat>Tat	p.D2063Y		NM_001168235.1	NP_001161707.1	P0C091	FREM3_HUMAN	FRAS1 related extracellular matrix 3	2063	Calx-beta 3.				cell adhesion (GO:0007155)|cell communication (GO:0007154)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|prostate(1)	8						CCAACATAATCTGTTCCAGCT	0.483																																																	0													25.0	23.0	24.0					4																	144498997		692	1591	2283	SO:0001583	missense	166752			BX091796	CCDS54808.1	4q31.21	2011-06-09			ENSG00000183090	ENSG00000183090			25172	protein-coding gene	gene with protein product		608946				15345741	Standard	NM_001168235		Approved		uc021xsj.1	P0C091	OTTHUMG00000161577	ENST00000329798.5:c.6187G>T	4.37:g.144498997C>A	ENSP00000332886:p.Asp2063Tyr			Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.D2063Y	ENST00000329798.5	37	c.6187	CCDS54808.1	4	.	.	.	.	.	.	.	.	.	.	C	17.69	3.451045	0.63290	.	.	ENSG00000183090	ENST00000329798	T	0.62364	0.03	4.23	4.23	0.50019	.	0.000000	0.64402	D	0.000001	D	0.83317	0.5228	M	0.93241	3.395	0.80722	D	1	.	.	.	.	.	.	D	0.88464	0.3057	8	0.87932	D	0	-9.8764	15.5353	0.75998	0.0:1.0:0.0:0.0	.	.	.	.	Y	2063	ENSP00000332886:D2063Y	ENSP00000332886:D2063Y	D	-	1	0	FREM3	144718447	1.000000	0.71417	0.082000	0.20525	0.637000	0.38172	5.562000	0.67346	2.159000	0.67721	0.655000	0.94253	GAT	FREM3	-	pfam_Calx_beta,smart_Calx_beta		0.483	FREM3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	FREM3	HGNC	protein_coding	OTTHUMT00000365391.1	C	XM_094074		144498997	-1	no_errors	ENST00000329798	ensembl	human	putative	70_37	missense	SNP	1.000	A
FRG2B	441581	genome.wustl.edu	37	10	135438753	135438753	+	Silent	SNP	G	G	A	rs375000694		TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr10:135438753G>A	ENST00000425520.1	-	4	739	c.687C>T	c.(685-687)acC>acT	p.T229T	FRG2B_ENST00000443774.1_Silent_p.T230T	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	229						nucleus (GO:0005634)				endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		AAGCTGCCTGGGTGGCCATGG	0.597																																																	0													3.0	4.0	4.0					10																	135438753		1467	3364	4831	SO:0001819	synonymous_variant	441581			AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.687C>T	10.37:g.135438753G>A			Q5VSQ1	Silent	SNP	NULL	p.T230	ENST00000425520.1	37	c.690	CCDS44502.1	10																																																																																			FRG2B	-	NULL		0.597	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FRG2B	HGNC	protein_coding	OTTHUMT00000467780.1	G	NM_001080998		135438753	-1	no_errors	ENST00000443774	ensembl	human	known	70_37	silent	SNP	0.707	A
GRAMD1B	57476	genome.wustl.edu	37	11	123477438	123477438	+	Missense_Mutation	SNP	C	C	T			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr11:123477438C>T	ENST00000529750.1	+	10	1343	c.1016C>T	c.(1015-1017)tCa>tTa	p.S339L	GRAMD1B_ENST00000322282.7_Missense_Mutation_p.S339L|GRAMD1B_ENST00000450171.2_5'Flank|GRAMD1B_ENST00000456860.2_Missense_Mutation_p.S346L	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	339						integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		AACTCCCCTTCACTGGACTTC	0.542																																																	0													64.0	66.0	66.0					11																	123477438		1995	4154	6149	SO:0001583	missense	57476			AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.1016C>T	11.37:g.123477438C>T	ENSP00000436500:p.Ser339Leu		Q6UW85|Q9ULL9	Missense_Mutation	SNP	pfam_GRAM,smart_GRAM	p.S339L	ENST00000529750.1	37	c.1016	CCDS53720.1	11	.	.	.	.	.	.	.	.	.	.	C	22.7	4.321801	0.81580	.	.	ENSG00000023171	ENST00000539133;ENST00000456860;ENST00000322282;ENST00000529750;ENST00000529432;ENST00000534764	T;T;T;T;T	0.37058	1.62;1.63;1.62;1.62;1.22	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.42698	0.1214	L	0.47716	1.5	0.80722	D	1	P;P;P;B	0.40970	0.552;0.734;0.666;0.415	B;P;B;B	0.45310	0.146;0.476;0.162;0.206	T	0.25012	-1.0144	10	0.44086	T	0.13	.	18.8443	0.92198	0.0:1.0:0.0:0.0	.	299;346;339;346	B7Z4N9;F5H572;Q3KR37;E7EPH8	.;.;GRM1B_HUMAN;.	L	346;346;339;339;299;335	ENSP00000402457:S346L;ENSP00000325628:S339L;ENSP00000436500:S339L;ENSP00000432987:S299L;ENSP00000434214:S335L	ENSP00000325628:S339L	S	+	2	0	GRAMD1B	122982648	1.000000	0.71417	0.720000	0.30636	0.850000	0.48378	7.755000	0.85180	2.437000	0.82529	0.462000	0.41574	TCA	GRAMD1B	-	NULL		0.542	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRAMD1B	HGNC	protein_coding	OTTHUMT00000387404.2	C	XM_370660		123477438	+1	no_errors	ENST00000322282	ensembl	human	known	70_37	missense	SNP	0.998	T
GXYLT1	283464	genome.wustl.edu	37	12	42512938	42512938	+	Missense_Mutation	SNP	T	T	A	rs200822565		TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr12:42512938T>A	ENST00000398675.3	-	3	582	c.350A>T	c.(349-351)cAt>cTt	p.H117L	GXYLT1_ENST00000280876.6_Missense_Mutation_p.H86L	NM_001099650.1|NM_173601.1	NP_001093120.1|NP_775872.1	Q4G148	GXLT1_HUMAN	glucoside xylosyltransferase 1	117					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|O-glycan processing (GO:0016266)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	UDP-xylosyltransferase activity (GO:0035252)	p.H117L(1)|p.H86L(1)		kidney(2)|large_intestine(4)|liver(3)|lung(8)	17						TACAGCTAGATGCATTTTCTC	0.348																																																	2	Substitution - Missense(2)	liver(2)											98.0	89.0	91.0					12																	42512938		1891	4131	6022	SO:0001583	missense	283464			BC015597	CCDS41771.1, CCDS41772.1	12q12	2013-10-11	2009-11-17	2009-11-17	ENSG00000151233	ENSG00000151233		"""Glycosyltransferase family 8 domain containing"""	27482	protein-coding gene	gene with protein product		613321	"""glycosyltransferase 8 domain containing 3"""	GLT8D3		19940119	Standard	NM_001099650		Approved	FLJ43151	uc001rms.4	Q4G148	OTTHUMG00000169379	ENST00000398675.3:c.350A>T	12.37:g.42512938T>A	ENSP00000381666:p.His117Leu		B3KWJ2|Q8IXV1|Q96BH4	Missense_Mutation	SNP	pfam_Glyco_trans_8	p.H117L	ENST00000398675.3	37	c.350	CCDS41772.1	12	.	.	.	.	.	.	.	.	.	.	T	28.5	4.926250	0.92319	.	.	ENSG00000151233	ENST00000398675;ENST00000280876	T;T	0.25749	1.78;1.78	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.52191	0.1719	M	0.86805	2.84	0.80722	D	1	P;D	0.56035	0.937;0.974	P;P	0.57620	0.805;0.824	T	0.61579	-0.7034	10	0.72032	D	0.01	8.6287	15.6136	0.76748	0.0:0.0:0.0:1.0	.	86;117	Q4G148-2;Q4G148	.;GXLT1_HUMAN	L	117;86	ENSP00000381666:H117L;ENSP00000280876:H86L	ENSP00000280876:H86L	H	-	2	0	GXYLT1	40799205	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.428000	0.80296	2.097000	0.63578	0.482000	0.46254	CAT	GXYLT1	-	NULL		0.348	GXYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GXYLT1	HGNC	protein_coding	OTTHUMT00000403778.1	T	XM_290597		42512938	-1	no_errors	ENST00000398675	ensembl	human	known	70_37	missense	SNP	1.000	A
IGFN1	91156	genome.wustl.edu	37	1	201184859	201184859	+	Missense_Mutation	SNP	C	C	T			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr1:201184859C>T	ENST00000335211.4	+	15	9318	c.9188C>T	c.(9187-9189)aCg>aTg	p.T3063M	IGFN1_ENST00000295591.8_Missense_Mutation_p.T223M|IGFN1_ENST00000451870.2_Intron	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	606						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GATGGCTACACGCGGCTGTGC	0.662																																																	0													41.0	37.0	38.0					1																	201184859		2203	4300	6503	SO:0001583	missense	91156			AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.9188C>T	1.37:g.201184859C>T	ENSP00000334714:p.Thr3063Met		F8WAI1|Q9NT72	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.T3063M	ENST00000335211.4	37	c.9188	CCDS53455.1	1	.	.	.	.	.	.	.	.	.	.	C	17.75	3.465445	0.63513	.	.	ENSG00000163395	ENST00000335211;ENST00000295591	T;T	0.43688	0.94;0.94	4.83	4.83	0.62350	.	0.292105	0.31290	N	0.007920	T	0.66317	0.2777	M	0.80982	2.52	0.24636	N	0.993596	D	0.89917	1.0	D	0.81914	0.995	T	0.62220	-0.6900	9	.	.	.	.	16.1224	0.81369	0.0:1.0:0.0:0.0	.	3063	F8WAI1	.	M	3063;223	ENSP00000334714:T3063M;ENSP00000295591:T223M	.	T	+	2	0	IGFN1	199451482	0.998000	0.40836	0.023000	0.16930	0.001000	0.01503	4.125000	0.57931	2.234000	0.73211	0.561000	0.74099	ACG	IGFN1	-	pfam_Ig_I-set,smart_Ig_sub		0.662	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFN1	HGNC	protein_coding		C	NM_178275		201184859	+1	no_errors	ENST00000335211	ensembl	human	known	70_37	missense	SNP	0.460	T
IL26	55801	genome.wustl.edu	37	12	68619364	68619364	+	Splice_Site	SNP	A	A	G			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr12:68619364A>G	ENST00000229134.4	-	1	236		c.e1+1		IFNG-AS1_ENST00000536914.1_RNA	NM_018402.1	NP_060872.1	Q9NPH9	IL26_HUMAN	interleukin 26						cell-cell signaling (GO:0007267)|negative regulation of epithelial cell proliferation (GO:0050680)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(1)	12			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000515)		CCTAATACTTACTGGAATCGT	0.388																																																	0													208.0	191.0	196.0					12																	68619364		2203	4300	6503	SO:0001630	splice_region_variant	55801			AJ251549	CCDS8981.1	12q15	2008-08-04			ENSG00000111536	ENSG00000111536		"""Interleukins and interleukin receptors"""	17119	protein-coding gene	gene with protein product		605679				10729163, 11528524	Standard	NM_018402		Approved	AK155, IL-26	uc001stx.1	Q9NPH9	OTTHUMG00000169114	ENST00000229134.4:c.171+1T>C	12.37:g.68619364A>G				Splice_Site	SNP	-	e1+2	ENST00000229134.4	37	c.171+2	CCDS8981.1	12	.	.	.	.	.	.	.	.	.	.	A	16.64	3.178340	0.57692	.	.	ENSG00000111536	ENST00000229134	.	.	.	4.63	4.63	0.57726	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.731	0.51737	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	IL26	66905631	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.979000	0.63806	1.862000	0.54008	0.379000	0.24179	.	IL26	-	-		0.388	IL26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL26	HGNC	protein_coding	OTTHUMT00000402302.1	A	NM_018402	Intron	68619364	-1	no_errors	ENST00000229134	ensembl	human	known	70_37	splice_site	SNP	1.000	G
IRAK2	3656	genome.wustl.edu	37	3	10219598	10219598	+	Silent	SNP	G	G	A	rs572521578	byFrequency	TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr3:10219598G>A	ENST00000256458.4	+	2	261	c.171G>A	c.(169-171)acG>acA	p.T57T		NM_001570.3	NP_001561.3	O43187	IRAK2_HUMAN	interleukin-1 receptor-associated kinase 2	57	Death.				activation of MAPK activity (GO:0000187)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein phosphorylation (GO:0006468)|regulation of cytokine-mediated signaling pathway (GO:0001959)|response to interleukin-1 (GO:0070555)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)			breast(4)|large_intestine(8)|lung(11)|prostate(1)|stomach(1)	25						TGAGCATCACGCGGGAGCTGC	0.637													G|||	2	0.000399361	0.0	0.0029	5008	,	,		15740	0.0		0.0	False		,,,				2504	0.0																0													70.0	64.0	66.0					3																	10219598		2203	4300	6503	SO:0001819	synonymous_variant	3656			AF026273	CCDS33697.1	3p25.2	2008-08-18			ENSG00000134070	ENSG00000134070			6113	protein-coding gene	gene with protein product		603304				9374458	Standard	XR_245126		Approved		uc003bve.1	O43187	OTTHUMG00000155358	ENST00000256458.4:c.171G>A	3.37:g.10219598G>A			B4DQZ6|Q08AG6|Q5K546	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death,superfamily_Kinase-like_dom,superfamily_DEATH-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.T57	ENST00000256458.4	37	c.171	CCDS33697.1	3																																																																																			IRAK2	-	pfam_Death,superfamily_DEATH-like		0.637	IRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRAK2	HGNC	protein_coding	OTTHUMT00000339623.1	G			10219598	+1	no_errors	ENST00000256458	ensembl	human	known	70_37	silent	SNP	0.036	A
KHK	3795	genome.wustl.edu	37	2	27322557	27322557	+	Missense_Mutation	SNP	G	G	C			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr2:27322557G>C	ENST00000260599.6	+	8	1349	c.836G>C	c.(835-837)aGa>aCa	p.R279T	KHK_ENST00000260598.5_Missense_Mutation_p.R279T|KHK_ENST00000490823.1_3'UTR|CGREF1_ENST00000402550.1_3'UTR|CGREF1_ENST00000452318.2_3'UTR	NM_000221.2	NP_000212.1	P50053	KHK_HUMAN	ketohexokinase (fructokinase)	279					carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose catabolic process (GO:0006001)|regulation of glycogen metabolic process (GO:0070873)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ketohexokinase activity (GO:0004454)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAAGCACTGAGATTCGGGTGC	0.617																																																	0													77.0	63.0	68.0					2																	27322557		2203	4300	6503	SO:0001583	missense	3795				CCDS1734.1, CCDS1735.1	2p23.3-p23.2	2008-02-05			ENSG00000138030	ENSG00000138030	2.7.1.3		6315	protein-coding gene	gene with protein product		614058				7833921	Standard	NM_000221		Approved		uc002rim.2	P50053	OTTHUMG00000097077	ENST00000260599.6:c.836G>C	2.37:g.27322557G>C	ENSP00000260599:p.Arg279Thr		Q6IBK2|Q99532|Q9BRJ3|Q9UMN1	Missense_Mutation	SNP	pfam_PfkB	p.R279T	ENST00000260599.6	37	c.836	CCDS1734.1	2	.	.	.	.	.	.	.	.	.	.	G	3.921	-0.018102	0.07681	.	.	ENSG00000138030	ENST00000260599;ENST00000260598	T;T	0.78924	-1.22;-1.22	4.91	0.788	0.18601	Carbohydrate/purine kinase (1);	0.157984	0.53938	N	0.000057	T	0.53206	0.1782	N	0.10809	0.05	0.80722	D	1	B;B;B;B	0.12630	0.002;0.006;0.0;0.006	B;B;B;B	0.12837	0.004;0.008;0.003;0.008	T	0.29458	-1.0011	10	0.11794	T	0.64	-8.9101	9.4549	0.38750	0.0902:0.568:0.3418:0.0	.	279;279;279;279	Q53G56;Q6IBK2;P50053-2;P50053	.;.;.;KHK_HUMAN	T	279	ENSP00000260599:R279T;ENSP00000260598:R279T	ENSP00000260598:R279T	R	+	2	0	KHK	27176061	1.000000	0.71417	0.337000	0.25536	0.158000	0.22134	4.129000	0.57957	0.262000	0.21774	-0.314000	0.08810	AGA	KHK	-	pfam_PfkB		0.617	KHK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KHK	HGNC	protein_coding	OTTHUMT00000214196.1	G			27322557	+1	no_errors	ENST00000260598	ensembl	human	known	70_37	missense	SNP	0.931	C
KIAA0101	9768	genome.wustl.edu	37	15	64669055	64669055	+	Silent	SNP	G	G	T			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr15:64669055G>T	ENST00000300035.4	-	3	315	c.177C>A	c.(175-177)ccC>ccA	p.P59P	KIAA0101_ENST00000558008.1_Silent_p.P59P|KIAA0101_ENST00000559519.1_Silent_p.P32P|KIAA0101_ENST00000380258.2_Intron	NM_014736.4	NP_055551.1	Q15004	PAF15_HUMAN	KIAA0101	59					cellular response to DNA damage stimulus (GO:0006974)|centrosome organization (GO:0051297)|DNA replication (GO:0006260)|regulation of cell cycle (GO:0051726)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	chromatin binding (GO:0003682)			central_nervous_system(1)|lung(1)|upper_aerodigestive_tract(1)	3						TTTGCCACTTGGGAGTTGGGC	0.408																																																	0													50.0	51.0	51.0					15																	64669055		2203	4300	6503	SO:0001819	synonymous_variant	9768			D14657	CCDS10193.1, CCDS32269.1	15q22	2006-06-22			ENSG00000166803	ENSG00000166803			28961	protein-coding gene	gene with protein product		610696				11313979, 16288740	Standard	NM_001029989		Approved	NS5ATP9, OEATC-1, p15(PAF)	uc002ank.3	Q15004	OTTHUMG00000133017	ENST00000300035.4:c.177C>A	15.37:g.64669055G>T			A6NNU5|A8K3Y3|G9G694|G9G696	Missense_Mutation	SNP	NULL	p.P60Q	ENST00000300035.4	37	c.179	CCDS10193.1	15																																																																																			KIAA0101	-	NULL		0.408	KIAA0101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0101	HGNC	protein_coding	OTTHUMT00000256603.1	G	NM_014736		64669055	-1	no_errors	ENST00000560234	ensembl	human	putative	70_37	missense	SNP	0.990	T
KIAA1683	80726	genome.wustl.edu	37	19	18378102	18378102	+	Missense_Mutation	SNP	C	C	T			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr19:18378102C>T	ENST00000600328.3	-	3	441	c.248G>A	c.(247-249)cGg>cAg	p.R83Q	KIAA1683_ENST00000392413.4_Missense_Mutation_p.R83Q|KIAA1683_ENST00000600359.3_Missense_Mutation_p.R37Q			Q9H0B3	K1683_HUMAN	KIAA1683	83						mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						GACCACAGCCCGGAGGCGTGG	0.657																																																	0													68.0	70.0	69.0					19																	18378102		2203	4300	6503	SO:0001583	missense	80726			AB051470	CCDS32958.1, CCDS46017.1, CCDS46018.1	19p13.1	2008-02-05				ENSG00000130518			29350	protein-coding gene	gene with protein product						11214970, 11230166	Standard	NM_025249		Approved		uc010ebn.2	Q9H0B3		ENST00000600328.3:c.248G>A	19.37:g.18378102C>T	ENSP00000470780:p.Arg83Gln		B4DYH2|E9PDE0|E9PH54|Q2KHR5|Q8N4G8|Q96M14|Q9C0I0	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.R83Q	ENST00000600328.3	37	c.248	CCDS32958.1	19	.	.	.	.	.	.	.	.	.	.	C	20.5	3.995107	0.74703	.	.	ENSG00000130518	ENST00000392413;ENST00000359737;ENST00000427634;ENST00000358422;ENST00000411671	T;T;T	0.05717	3.45;3.47;3.4	2.99	1.95	0.26073	.	.	.	.	.	T	0.12518	0.0304	L	0.36672	1.1	0.09310	N	1	D;D	0.89917	1.0;0.99	D;P	0.76071	0.987;0.47	T	0.18209	-1.0344	9	0.48119	T	0.1	-34.4264	5.2166	0.15346	0.0:0.8369:0.0:0.1631	.	83;83	E9PDE0;Q9H0B3	.;K1683_HUMAN	Q	83;83;37;82;83	ENSP00000376213:R83Q;ENSP00000352774:R83Q;ENSP00000404501:R37Q	ENSP00000351198:R82Q	R	-	2	0	KIAA1683	18239102	0.110000	0.22057	0.151000	0.22473	0.434000	0.31775	1.170000	0.31883	1.699000	0.51192	0.313000	0.20887	CGG	KIAA1683	-	NULL		0.657	KIAA1683-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1683	HGNC	protein_coding	OTTHUMT00000466312.3	C			18378102	-1	no_errors	ENST00000392413	ensembl	human	known	70_37	missense	SNP	0.305	T
KRTAP26-1	388818	genome.wustl.edu	37	21	31691800	31691800	+	Missense_Mutation	SNP	G	G	A			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr21:31691800G>A	ENST00000360542.3	-	1	807	c.554C>T	c.(553-555)cCt>cTt	p.P185L		NM_203405.1	NP_981950.1	Q6PEX3	KR261_HUMAN	keratin associated protein 26-1	185						intermediate filament (GO:0005882)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16						AGGCCCCAGAGGTCTGAGGCT	0.547																																																	0													167.0	173.0	171.0					21																	31691800		2203	4300	6503	SO:0001583	missense	388818			AB096936	CCDS13588.1	21q22.11	2007-11-23			ENSG00000197683	ENSG00000197683		"""Keratin associated proteins"""	33760	protein-coding gene	gene with protein product							Standard	NM_203405		Approved		uc002ynw.3	Q6PEX3	OTTHUMG00000057766	ENST00000360542.3:c.554C>T	21.37:g.31691800G>A	ENSP00000353742:p.Pro185Leu		B0RZD3	Missense_Mutation	SNP	pfam_PMG	p.P185L	ENST00000360542.3	37	c.554	CCDS13588.1	21	.	.	.	.	.	.	.	.	.	.	G	21.4	4.144769	0.77888	.	.	ENSG00000197683	ENST00000360542	T	0.03441	3.93	5.06	5.06	0.68205	.	0.237850	0.33253	N	0.005108	T	0.17619	0.0423	M	0.73598	2.24	0.47584	D	0.99946	D	0.89917	1.0	D	0.97110	1.0	T	0.00022	-1.2341	10	0.87932	D	0	-15.6583	14.6444	0.68751	0.0:0.0:1.0:0.0	.	185	Q6PEX3	KR261_HUMAN	L	185	ENSP00000353742:P185L	ENSP00000353742:P185L	P	-	2	0	KRTAP26-1	30613671	0.988000	0.35896	0.994000	0.49952	0.811000	0.45836	1.747000	0.38298	2.708000	0.92522	0.650000	0.86243	CCT	KRTAP26-1	-	pfam_PMG		0.547	KRTAP26-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP26-1	HGNC	protein_coding	OTTHUMT00000128218.1	G	NM_203405		31691800	-1	no_errors	ENST00000360542	ensembl	human	known	70_37	missense	SNP	0.999	A
LCORL	254251	genome.wustl.edu	37	4	17885634	17885634	+	Silent	SNP	T	T	A			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr4:17885634T>A	ENST00000382226.5	-	7	1626	c.1518A>T	c.(1516-1518)ggA>ggT	p.G506G	LCORL_ENST00000539056.1_Intron|LCORL_ENST00000326877.4_Intron|LCORL_ENST00000382224.1_Silent_p.G422G	NM_001166139.1	NP_001159611.1	Q8N3X6	LCORL_HUMAN	ligand dependent nuclear receptor corepressor-like	506					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)			kidney(1)|large_intestine(1)|lung(1)|prostate(1)	4						TTCGATCTAATCCATCTTCAG	0.403																																																	0													93.0	71.0	78.0					4																	17885634		692	1590	2282	SO:0001819	synonymous_variant	254251				CCDS3425.1, CCDS54749.1	4p15.32	2006-06-14			ENSG00000178177	ENSG00000178177			30776	protein-coding gene	gene with protein product		611799				12560079	Standard	NM_153686		Approved	MLR1, FLJ30696	uc021xmr.1	Q8N3X6	OTTHUMG00000128538	ENST00000382226.5:c.1518A>T	4.37:g.17885634T>A			Q96NK1	Silent	SNP	pfam_HTH_Psq,superfamily_Homeodomain-like,pfscan_HTH_Psq	p.G506	ENST00000382226.5	37	c.1518	CCDS54749.1	4																																																																																			LCORL	-	NULL		0.403	LCORL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LCORL	HGNC	protein_coding		T	NM_153686		17885634	-1	no_errors	ENST00000382226	ensembl	human	known	70_37	silent	SNP	0.979	A
LIPE	3991	genome.wustl.edu	37	19	42911508	42911508	+	Missense_Mutation	SNP	C	C	G			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr19:42911508C>G	ENST00000244289.4	-	6	2231	c.1955G>C	c.(1954-1956)gGc>gCc	p.G652A	LIPE-AS1_ENST00000594624.2_RNA|LIPE_ENST00000602000.1_5'Flank|LIPE-AS1_ENST00000599276.1_RNA|LIPE-AS1_ENST00000597203.1_RNA|LIPE-AS1_ENST00000593491.2_RNA	NM_005357.2	NP_005348.2	Q05469	LIPS_HUMAN	lipase, hormone-sensitive	652					cholesterol metabolic process (GO:0008203)|diacylglycerol catabolic process (GO:0046340)|lipid catabolic process (GO:0016042)|long-chain fatty acid catabolic process (GO:0042758)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	hormone-sensitive lipase activity (GO:0033878)|triglyceride lipase activity (GO:0004806)			breast(2)|endometrium(4)|kidney(7)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		Prostate(69;0.00682)				AAAGCCACCGCCGTGGAAGTG	0.662																																																	0													26.0	27.0	27.0					19																	42911508		2202	4297	6499	SO:0001583	missense	3991			L11706	CCDS12607.1	19q13.1-q13.2	2014-03-14			ENSG00000079435	ENSG00000079435	3.1.1.3		6621	protein-coding gene	gene with protein product		151750				8506334	Standard	NM_005357		Approved	HSL	uc002otr.3	Q05469	OTTHUMG00000182814	ENST00000244289.4:c.1955G>C	19.37:g.42911508C>G	ENSP00000244289:p.Gly652Ala		Q3LRT2|Q6NSL7	Missense_Mutation	SNP	pfam_HSL_N,pfam_AB_hydrolase_3,pfam_Steryl_acetyl_hydrolase	p.G652A	ENST00000244289.4	37	c.1955	CCDS12607.1	19	.	.	.	.	.	.	.	.	.	.	C	18.71	3.682035	0.68042	.	.	ENSG00000079435	ENST00000244289	T	0.61510	0.1	4.07	4.07	0.47477	Alpha/beta hydrolase fold-3 (1);	0.145744	0.44285	D	0.000469	D	0.85788	0.5778	H	0.99312	4.51	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	D	0.91931	0.5555	10	0.87932	D	0	-4.0111	15.5513	0.76155	0.0:1.0:0.0:0.0	.	652	Q05469	LIPS_HUMAN	A	652	ENSP00000244289:G652A	ENSP00000244289:G652A	G	-	2	0	LIPE	47603348	0.996000	0.38824	0.914000	0.36105	0.866000	0.49608	3.886000	0.56190	2.301000	0.77427	0.561000	0.74099	GGC	LIPE	-	pfam_AB_hydrolase_3,pfam_Steryl_acetyl_hydrolase		0.662	LIPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPE	HGNC	protein_coding	OTTHUMT00000463861.1	C	NM_005357		42911508	-1	no_errors	ENST00000244289	ensembl	human	known	70_37	missense	SNP	0.994	G
FAM230B	642633	genome.wustl.edu	37	22	21538436	21538436	+	RNA	SNP	A	A	G	rs201160694		TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr22:21538436A>G	ENST00000451257.1	+	0	1422									family with sequence similarity 230, member B (non-protein coding)																		GCCAACGAGGACGCCGCCCAG	0.731																																																	0																																												642633			BC039313, AK128837		22q11.21	2014-01-24	2014-01-06		ENSG00000215498	ENSG00000215498			32943	non-coding RNA	RNA, long non-coding			"""family with sequence similarity 230, member B"""				Standard	NR_108107		Approved	FLJ46366			OTTHUMG00000150782		22.37:g.21538436A>G				RNA	SNP	-	NULL	ENST00000451257.1	37	NULL		22																																																																																			KB-1183D5.11	-	-		0.731	FAM230B-002	KNOWN	basic	lincRNA	LOC642633	Clone_based_vega_gene	processed_transcript	OTTHUMT00000320063.1	A	NR_108107		21538436	+1	no_errors	ENST00000451257	ensembl	human	known	70_37	rna	SNP	0.017	G
LINC00839	84856	genome.wustl.edu	37	10	42971108	42971108	+	lincRNA	SNP	T	T	C			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr10:42971108T>C	ENST00000429940.2	+	0	118					NR_026827.1				long intergenic non-protein coding RNA 839																		TGCTCCGCCGTGGGCAGGAGG	0.667																																																	0																																												84856					10q11.21	2012-12-20			ENSG00000185904	ENSG00000185904		"""Long non-coding RNAs"""	28269	protein-coding gene	gene with protein product						12477932	Standard	NR_026827		Approved		uc001izy.3		OTTHUMG00000018010		10.37:g.42971108T>C				RNA	SNP	-	NULL	ENST00000429940.2	37	NULL		10																																																																																			RP11-178A10.1	-	-		0.667	LINC00839-001	KNOWN	basic	lincRNA	LOC84856	Clone_based_vega_gene	lincRNA	OTTHUMT00000047672.2	T	NR_026827		42971108	+1	no_errors	ENST00000332123	ensembl	human	known	70_37	rna	SNP	0.017	C
LRRC16A	55604	genome.wustl.edu	37	6	25479389	25479389	+	Intron	SNP	C	C	G			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr6:25479389C>G	ENST00000329474.6	+	12	1242				LRRC16A_ENST00000377969.3_Missense_Mutation_p.L149V	NM_001173977.1|NM_017640.5	NP_001167448.1|NP_060110.4	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A						actin filament organization (GO:0007015)|barbed-end actin filament uncapping (GO:0051638)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|lamellipodium assembly (GO:0030032)|negative regulation of barbed-end actin filament capping (GO:2000813)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of lamellipodium organization (GO:1902745)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|ruffle organization (GO:0031529)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|lamellipodium (GO:0030027)|nucleus (GO:0005634)	protein complex binding (GO:0032403)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	50						ccagacttaccttgtggtttg	0.448																																																	0													339.0	323.0	328.0					6																	25479389		876	1991	2867	SO:0001627	intron_variant	55604			AK000055	CCDS54973.1	6p22.1	2010-09-10	2008-02-12	2008-02-12	ENSG00000079691	ENSG00000079691			21581	protein-coding gene	gene with protein product	"""capping protein, Arp2/3, and Myosin-I Linker homolog 1 (Dictyostelium)"""	609593	"""leucine rich repeat containing 16"""	LRRC16		19846667	Standard	NM_017640		Approved	dJ501N12.1, FLJ20048, CARMIL, CARMIL1	uc011djw.2	Q5VZK9	OTTHUMG00000014393	ENST00000329474.6:c.875-3096C>G	6.37:g.25479389C>G			B8X1J0|Q6ZUH5|Q6ZW07|Q9NXU7	Missense_Mutation	SNP	NULL	p.L149V	ENST00000329474.6	37	c.445	CCDS54973.1	6	.	.	.	.	.	.	.	.	.	.	C	8.040	0.763612	0.15914	.	.	ENSG00000079691	ENST00000377969	.	.	.	1.41	0.448	0.16614	.	.	.	.	.	T	0.11024	0.0269	.	.	.	0.09310	N	1	B	0.20988	0.05	B	0.15052	0.012	T	0.24584	-1.0156	7	0.59425	D	0.04	.	3.1163	0.06376	0.0:0.6889:0.0:0.3111	.	149	Q5VZK9-4	.	V	149	.	ENSP00000367206:L149V	L	+	1	0	LRRC16A	25587368	0.000000	0.05858	0.002000	0.10522	0.192000	0.23643	0.166000	0.16583	0.737000	0.32582	0.400000	0.26472	CTT	LRRC16A	-	NULL		0.448	LRRC16A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRC16A	HGNC	protein_coding	OTTHUMT00000040045.2	C	NM_017640		25479389	+1	no_errors	ENST00000377969	ensembl	human	known	70_37	missense	SNP	0.003	G
LSP1	4046	genome.wustl.edu	37	11	1902741	1902741	+	Missense_Mutation	SNP	C	C	T			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr11:1902741C>T	ENST00000311604.3	+	3	446	c.271C>T	c.(271-273)Cgg>Tgg	p.R91W	LSP1_ENST00000485341.1_3'UTR|LSP1_ENST00000381775.1_Missense_Mutation_p.R219W|LSP1_ENST00000406638.2_Missense_Mutation_p.R29W|LSP1_ENST00000405957.2_Missense_Mutation_p.R29W	NM_002339.2	NP_002330.1	P33241	LSP1_HUMAN	lymphocyte-specific protein 1	91					cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemotaxis (GO:0006935)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|signal transducer activity (GO:0004871)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|Lung(200;0.0729)|LUSC - Lung squamous cell carcinoma(625;0.0856)		GCCAGAGCAGCGGCAGCAGCA	0.692																																																	0													19.0	21.0	20.0					11																	1902741		2182	4274	6456	SO:0001583	missense	4046			M33552	CCDS31334.1, CCDS31335.1, CCDS58110.1	11p15.5	2008-02-05			ENSG00000130592	ENSG00000130592			6707	protein-coding gene	gene with protein product		153432				2174784	Standard	NM_001242932		Approved	WP34	uc001luj.3	P33241	OTTHUMG00000012252	ENST00000311604.3:c.271C>T	11.37:g.1902741C>T	ENSP00000308383:p.Arg91Trp		B3KPP1|B3KRR6|E9PBV6|E9PFP3|Q16096|Q53H48|Q6FHM3|Q9BUY8	Missense_Mutation	SNP	pfam_Caldesmon_LSP,prints_Lymphspecific	p.R91W	ENST00000311604.3	37	c.271	CCDS31334.1	11	.	.	.	.	.	.	.	.	.	.	.	21.1	4.092788	0.76756	.	.	ENSG00000130592	ENST00000311604;ENST00000421485;ENST00000446808;ENST00000381775;ENST00000405957;ENST00000451814;ENST00000457279;ENST00000429923;ENST00000406638;ENST00000418975;ENST00000417766;ENST00000432093	T;T;T;T;T;T;T;T;T;T;T;T	0.59638	1.16;0.9;1.06;1.15;1.23;0.85;1.21;0.95;1.23;0.25;1.26;1.26	3.4	1.29	0.21616	.	0.899723	0.08983	N	0.865549	T	0.67951	0.2948	L	0.56769	1.78	0.22468	N	0.99907	D;D	0.89917	1.0;0.999	D;P	0.67548	0.952;0.791	T	0.53507	-0.8429	10	0.87932	D	0	-11.8726	7.06	0.25121	0.17:0.7246:0.0:0.1054	.	219;91	E9PFP3;P33241	.;LSP1_HUMAN	W	91;29;29;219;29;29;82;74;29;109;29;29	ENSP00000308383:R91W;ENSP00000411191:R29W;ENSP00000402543:R29W;ENSP00000371194:R219W;ENSP00000383932:R29W;ENSP00000414106:R29W;ENSP00000400346:R82W;ENSP00000400999:R74W;ENSP00000384022:R29W;ENSP00000403460:R109W;ENSP00000416363:R29W;ENSP00000412405:R29W	ENSP00000308383:R91W	R	+	1	2	LSP1	1859317	0.000000	0.05858	0.049000	0.19019	0.573000	0.36030	0.456000	0.21859	0.784000	0.33661	0.394000	0.25966	CGG	LSP1	-	prints_Lymphspecific		0.692	LSP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	LSP1	HGNC	protein_coding	OTTHUMT00000034045.3	C	NM_002339		1902741	+1	no_errors	ENST00000311604	ensembl	human	known	70_37	missense	SNP	0.473	T
MASP2	10747	genome.wustl.edu	37	1	11106635	11106635	+	Silent	SNP	G	G	A			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr1:11106635G>A	ENST00000400897.3	-	3	405	c.390C>T	c.(388-390)ttC>ttT	p.F130F	MASP2_ENST00000400898.3_Silent_p.F130F	NM_006610.3	NP_006601.2	O00187	MASP2_HUMAN	mannan-binding lectin serine peptidase 2	130	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|complement component C4b binding (GO:0001855)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			biliary_tract(1)|endometrium(2)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.071)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.12e-07)|COAD - Colon adenocarcinoma(227;7.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)		AGAAGGCCTCGAACCCCGTGA	0.622																																					GBM(35;611 746 20780 22741 36496)												0													52.0	46.0	48.0					1																	11106635		2203	4300	6503	SO:0001819	synonymous_variant	10747			X98400	CCDS123.1, CCDS124.1	1p36.3-p36.2	2014-09-17	2005-08-17		ENSG00000009724	ENSG00000009724			6902	protein-coding gene	gene with protein product		605102	"""mannan-binding lectin serine protease 2"", ""mannan-binding lectin serine peptidase 1 pseudogene 1"", ""mannan-binding lectin serine protease 1 pseudogene 1"""	MASP1P1		9087411, 9777418	Standard	NM_006610		Approved		uc001aru.3	O00187	OTTHUMG00000002121	ENST00000400897.3:c.390C>T	1.37:g.11106635G>A			A8K458|A8MWJ2|O75754|Q5TEQ5|Q5TER0|Q96QG4|Q9BZH0|Q9H498|Q9H499|Q9UBP3|Q9UC48|Q9ULC7|Q9UMV3|Q9Y270	Silent	SNP	pfam_Peptidase_S1_S6,pfam_CUB,pfam_Sushi_SCR_CCP,pfam_EGF-like_Ca-bd,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_EGF-like_Ca-bd,smart_EG-like_dom,smart_Sushi_SCR_CCP,smart_Peptidase_S1_S6,pfscan_CUB,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.F130	ENST00000400897.3	37	c.390	CCDS123.1	1																																																																																			MASP2	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB		0.622	MASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MASP2	HGNC	protein_coding	OTTHUMT00000006072.1	G	NM_006610		11106635	-1	no_errors	ENST00000400897	ensembl	human	known	70_37	silent	SNP	0.999	A
MAST3	23031	genome.wustl.edu	37	19	18234034	18234034	+	Missense_Mutation	SNP	C	C	T			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr19:18234034C>T	ENST00000262811.6	+	6	320	c.320C>T	c.(319-321)tCa>tTa	p.S107L	MAST3_ENST00000608648.1_3'UTR	NM_015016.1	NP_055831.1	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase 3	107	Poly-Ser.						ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(6)|ovary(4)|pancreas(1)|stomach(1)	31						CAGTCAAGCTCATCCTCCCGG	0.612																																																	0													52.0	53.0	53.0					19																	18234034		2129	4237	6366	SO:0001583	missense	23031			AB011133	CCDS46014.1	19p13	2008-02-05				ENSG00000099308			19036	protein-coding gene	gene with protein product		612258					Standard	NM_015016		Approved	KIAA0561	uc002nhz.4	O60307		ENST00000262811.6:c.320C>T	19.37:g.18234034C>T	ENSP00000262811:p.Ser107Leu		Q7LDZ8|Q9UPI0	Missense_Mutation	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_cat_dom	p.S107L	ENST00000262811.6	37	c.320	CCDS46014.1	19	.	.	.	.	.	.	.	.	.	.	C	21.5	4.157108	0.78114	.	.	ENSG00000099308	ENST00000262811	T	0.34472	1.36	4.93	4.93	0.64822	Microtubule-associated serine/threonine-protein kinase, domain (1);	.	.	.	.	T	0.50394	0.1613	M	0.72479	2.2	0.47511	D	0.999442	B	0.27910	0.193	B	0.41135	0.348	T	0.55309	-0.8161	9	0.66056	D	0.02	-10.2619	17.4786	0.87667	0.0:1.0:0.0:0.0	.	107	O60307	MAST3_HUMAN	L	107	ENSP00000262811:S107L	ENSP00000262811:S107L	S	+	2	0	MAST3	18095034	1.000000	0.71417	0.996000	0.52242	0.915000	0.54546	5.619000	0.67729	2.453000	0.82957	0.555000	0.69702	TCA	MAST3	-	pfam_MA_Ser/Thr_Kinase_dom		0.612	MAST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST3	HGNC	protein_coding	OTTHUMT00000466526.2	C	XM_038150		18234034	+1	no_errors	ENST00000262811	ensembl	human	known	70_37	missense	SNP	1.000	T
MSH2	4436	genome.wustl.edu	37	2	47639566	47639566	+	Missense_Mutation	SNP	G	G	T			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr2:47639566G>T	ENST00000233146.2	+	4	882	c.659G>T	c.(658-660)gGa>gTa	p.G220V	MSH2_ENST00000543555.1_Missense_Mutation_p.G154V|MSH2_ENST00000406134.1_Missense_Mutation_p.G220V	NM_000251.2	NP_000242.1	P43246	MSH2_HUMAN	mutS homolog 2	220					ATP catabolic process (GO:0006200)|B cell differentiation (GO:0030183)|B cell mediated immunity (GO:0019724)|cell cycle arrest (GO:0007050)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|intra-S DNA damage checkpoint (GO:0031573)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|isotype switching (GO:0045190)|maintenance of DNA repeat elements (GO:0043570)|male gonad development (GO:0008584)|meiotic gene conversion (GO:0006311)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reciprocal meiotic recombination (GO:0045128)|oxidative phosphorylation (GO:0006119)|positive regulation of helicase activity (GO:0051096)|postreplication repair (GO:0006301)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSalpha complex (GO:0032301)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|guanine/thymine mispair binding (GO:0032137)|heteroduplex DNA loop binding (GO:0000404)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|Y-form DNA binding (GO:0000403)	p.0?(2)|p.?(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(5)|large_intestine(50)|lung(18)|ovary(5)|prostate(2)|skin(3)|small_intestine(1)|stomach(2)|urinary_tract(1)	112		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			ATTCAAAGAGGAGGAATTCTG	0.313			"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian"""	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p22-p21	4436	mutS homolog 2 (E. coli)		E	3	Whole gene deletion(2)|Unknown(1)	haematopoietic_and_lymphoid_tissue(3)											46.0	47.0	47.0					2																	47639566		2203	4300	6503	SO:0001583	missense	4436	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U03911	CCDS1834.1, CCDS58709.1	2p21	2014-09-17	2013-09-12		ENSG00000095002	ENSG00000095002			7325	protein-coding gene	gene with protein product		609309	"""mutS (E. coli) homolog 2 (colon cancer, nonpolyposis type 1)"", ""mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)"""	COCA1		8484120, 9843200	Standard	NM_000251		Approved	HNPCC, HNPCC1	uc002rvy.2	P43246	OTTHUMG00000128861	ENST00000233146.2:c.659G>T	2.37:g.47639566G>T	ENSP00000233146:p.Gly220Val		B4E2Z2|O75488	Missense_Mutation	SNP	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mismatch_repair_MutS_connt,pfam_DNA_mismatch_repair_MutS-lik_N,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,superfamily_DNA_mismatch_repair_MutS_connt,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C,pirsf_DNA_mismatch_repair_MSH2	p.G220V	ENST00000233146.2	37	c.659	CCDS1834.1	2	.	.	.	.	.	.	.	.	.	.	G	12.56	1.973215	0.34848	.	.	ENSG00000095002	ENST00000233146;ENST00000543555;ENST00000406134;ENST00000419559;ENST00000432737;ENST00000453755;ENST00000448533;ENST00000394792;ENST00000413880	D;D;D	0.87103	-2.21;-2.21;-2.21	5.3	3.42	0.39159	DNA mismatch repair protein MutS, connector (1);	0.189182	0.47093	D	0.000252	D	0.88355	0.6414	L	0.48877	1.53	0.80722	D	1	P;B;B;P	0.50528	0.936;0.187;0.379;0.814	P;B;B;P	0.53035	0.673;0.185;0.241;0.716	D	0.88172	0.2865	10	0.62326	D	0.03	-3.6239	15.5397	0.76031	0.0:0.247:0.753:0.0	.	154;220;220;220	B4E2Z2;E7EQQ1;E9PHA6;P43246	.;.;.;MSH2_HUMAN	V	220;154;220;220;220;220;220;220;56	ENSP00000233146:G220V;ENSP00000442697:G154V;ENSP00000384199:G220V	ENSP00000233146:G220V	G	+	2	0	MSH2	47493070	1.000000	0.71417	1.000000	0.80357	0.422000	0.31414	6.331000	0.72929	0.585000	0.29608	0.558000	0.71614	GGA	MSH2	-	pfam_DNA_mismatch_repair_MutS_connt,superfamily_DNA_mismatch_repair_MutS_connt,pirsf_DNA_mismatch_repair_MSH2		0.313	MSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSH2	HGNC	protein_coding	OTTHUMT00000250805.3	G			47639566	+1	no_errors	ENST00000233146	ensembl	human	known	70_37	missense	SNP	1.000	T
NOP14	8602	genome.wustl.edu	37	4	2949269	2949269	+	Missense_Mutation	SNP	T	T	A			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr4:2949269T>A	ENST00000314262.6	-	10	1531	c.1483A>T	c.(1483-1485)Att>Ttt	p.I495F	NOP14_ENST00000502735.1_Missense_Mutation_p.I495F|NOP14-AS1_ENST00000505731.1_RNA|NOP14-AS1_ENST00000503709.1_RNA|NOP14-AS1_ENST00000515194.1_RNA|NOP14-AS1_ENST00000507702.1_RNA|NOP14_ENST00000398071.4_Missense_Mutation_p.I495F|NOP14_ENST00000416614.2_Missense_Mutation_p.I495F	NM_003703.1	NP_003694.1	P78316	NOP14_HUMAN	NOP14 nucleolar protein	495					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|membrane (GO:0016020)|mitochondrion (GO:0005739)|Noc4p-Nop14p complex (GO:0030692)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			NS(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	30						AACTTATCAATGACTGTGAGG	0.398																																																	0													136.0	125.0	129.0					4																	2949269		2203	4300	6503	SO:0001583	missense	8602			AB000467	CCDS33945.1	4p16.3	2012-12-10	2012-12-10	2008-10-13	ENSG00000087269	ENSG00000087269			16821	protein-coding gene	gene with protein product	"""NOP14 homolog (S. cerevisiae)"""	611526	"""chromosome 4 open reading frame 9"", ""nucleolar protein 14"", ""nucleolar protein 14 homolog (yeast)"", ""NOP14 nucleolar protein homolog (yeast)"""	C4orf9, NOL14		9734812, 11694595	Standard	XR_241655		Approved	RES4-25, UTP2	uc003ggj.1	P78316	OTTHUMG00000159911	ENST00000314262.6:c.1483A>T	4.37:g.2949269T>A	ENSP00000315674:p.Ile495Phe		D3DVR6|Q7LGI5|Q7Z6K0|Q8TBR6	Missense_Mutation	SNP	pfam_Nop14	p.I495F	ENST00000314262.6	37	c.1483	CCDS33945.1	4	.	.	.	.	.	.	.	.	.	.	T	10.58	1.390999	0.25118	.	.	ENSG00000087269	ENST00000416614;ENST00000314262;ENST00000502735;ENST00000398071;ENST00000546137	T;T;T;T	0.31247	1.5;1.5;1.5;1.5	5.46	3.07	0.35406	.	0.316592	0.34338	N	0.004048	T	0.44561	0.1299	L	0.52573	1.65	0.34356	D	0.690435	D;D;D	0.71674	0.998;0.984;0.987	D;P;P	0.71184	0.972;0.865;0.899	T	0.57860	-0.7738	10	0.87932	D	0	-17.4688	9.0234	0.36213	0.0:0.1512:0.0:0.8488	.	288;495;495	Q96GC8;E9PFK5;P78316	.;.;NOP14_HUMAN	F	495;495;495;495;394	ENSP00000405068:I495F;ENSP00000315674:I495F;ENSP00000427415:I495F;ENSP00000381146:I495F	ENSP00000315674:I495F	I	-	1	0	NOP14	2919067	0.956000	0.32656	0.010000	0.14722	0.519000	0.34347	1.643000	0.37217	0.913000	0.36797	0.533000	0.62120	ATT	NOP14	-	pfam_Nop14		0.398	NOP14-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	NOP14	HGNC	protein_coding	OTTHUMT00000358135.2	T	NM_003703		2949269	-1	no_errors	ENST00000416614	ensembl	human	known	70_37	missense	SNP	0.348	A
NPY5R	4889	genome.wustl.edu	37	4	164271435	164271435	+	Missense_Mutation	SNP	G	G	C			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr4:164271435G>C	ENST00000515560.1	+	4	1532	c.10G>C	c.(10-12)Gag>Cag	p.E4Q	NPY5R_ENST00000506953.1_Missense_Mutation_p.E4Q|NPY5R_ENST00000338566.3_Missense_Mutation_p.E4Q			Q15761	NPY5R_HUMAN	neuropeptide Y receptor Y5	4					cardiac left ventricle morphogenesis (GO:0003214)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of ovulation cycle rhythm (GO:0060112)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of smooth muscle cell proliferation (GO:0048661)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)			NS(2)|biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(4)|lung(26)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_hematologic(180;0.166)	Prostate(90;0.109)				TATGGATTTAGAGCTCGACGA	0.363																																					Melanoma(139;1287 1774 9781 19750 25599)												0													54.0	56.0	56.0					4																	164271435		2203	4300	6503	SO:0001583	missense	4889			BC042416	CCDS3804.1	4q31-q32	2012-08-08				ENSG00000164129		"""GPCR / Class A : Neuropeptide receptors : Y"""	7958	protein-coding gene	gene with protein product		602001				8700207, 9417917	Standard	NM_006174		Approved	NPYR5	uc003iqn.3	Q15761		ENST00000515560.1:c.10G>C	4.37:g.164271435G>C	ENSP00000423917:p.Glu4Gln		Q6GTR7|Q92916	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_NPY5_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.E4Q	ENST00000515560.1	37	c.10	CCDS3804.1	4	.	.	.	.	.	.	.	.	.	.	G	12.28	1.891196	0.33442	.	.	ENSG00000164129	ENST00000338566;ENST00000515560;ENST00000506953	T;T;T	0.72051	-0.62;-0.62;-0.62	5.35	4.5	0.54988	.	0.717759	0.11794	N	0.528842	T	0.60222	0.2252	L	0.27053	0.805	0.24009	N	0.996184	B	0.13594	0.008	B	0.13407	0.009	T	0.51888	-0.8648	10	0.42905	T	0.14	.	13.4623	0.61233	0.0769:0.0:0.9231:0.0	.	4	Q15761	NPY5R_HUMAN	Q	4	ENSP00000339377:E4Q;ENSP00000423917:E4Q;ENSP00000423474:E4Q	ENSP00000339377:E4Q	E	+	1	0	NPY5R	164490885	1.000000	0.71417	0.275000	0.24674	0.888000	0.51559	3.268000	0.51585	1.364000	0.46038	0.655000	0.94253	GAG	NPY5R	-	NULL		0.363	NPY5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPY5R	HGNC	protein_coding	OTTHUMT00000364633.1	G	NM_006174		164271435	+1	no_errors	ENST00000338566	ensembl	human	known	70_37	missense	SNP	0.942	C
OR51B4	79339	genome.wustl.edu	37	11	5322698	5322698	+	Missense_Mutation	SNP	A	A	G			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr11:5322698A>G	ENST00000380224.1	-	1	528	c.479T>C	c.(478-480)cTc>cCc	p.L160P	HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron	NM_033179.2	NP_149419.2	Q9Y5P0	O51B4_HUMAN	olfactory receptor, family 51, subfamily B, member 4	160					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	20		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTAGCAGTAGAGTGAAAGAAT	0.443																																																	0													131.0	118.0	123.0					11																	5322698		2201	4297	6498	SO:0001583	missense	79339			BC069094	CCDS7757.1	11p15.4	2012-08-09			ENSG00000183251	ENSG00000183251		"""GPCR / Class A : Olfactory receptors"""	14708	protein-coding gene	gene with protein product							Standard	NM_033179		Approved		uc010qza.2	Q9Y5P0	OTTHUMG00000066665	ENST00000380224.1:c.479T>C	11.37:g.5322698A>G	ENSP00000369573:p.Leu160Pro		A7MAV5|Q6NTD7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L160P	ENST00000380224.1	37	c.479	CCDS7757.1	11	.	.	.	.	.	.	.	.	.	.	A	10.48	1.360739	0.24598	.	.	ENSG00000183251	ENST00000380224	T	0.00130	8.69	4.93	4.93	0.64822	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48767	D	0.000179	T	0.00666	0.0022	H	0.96080	3.765	0.24012	N	0.996179	D	0.89917	1.0	D	0.97110	1.0	T	0.23797	-1.0178	10	0.87932	D	0	.	8.2547	0.31748	0.9111:0.0:0.0889:0.0	.	160	Q9Y5P0	O51B4_HUMAN	P	160	ENSP00000369573:L160P	ENSP00000369573:L160P	L	-	2	0	OR51B4	5279274	0.061000	0.20836	0.104000	0.21259	0.023000	0.10783	2.086000	0.41643	2.083000	0.62718	0.533000	0.62120	CTC	OR51B4	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.443	OR51B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51B4	HGNC	protein_coding	OTTHUMT00000142956.2	A	NM_033179		5322698	-1	no_errors	ENST00000380224	ensembl	human	known	70_37	missense	SNP	0.071	G
OR5D14	219436	genome.wustl.edu	37	11	55563486	55563486	+	Missense_Mutation	SNP	T	T	C			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr11:55563486T>C	ENST00000335605.1	+	1	455	c.455T>C	c.(454-456)cTc>cCc	p.L152P		NM_001004735.1	NP_001004735.1	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D, member 14	152						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(30)|ovary(2)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	48		all_epithelial(135;0.196)				GGGTCATATCTCTGGGGCATG	0.498																																																	0													134.0	128.0	130.0					11																	55563486		2200	4296	6496	SO:0001583	missense	219436			AB065779	CCDS31508.1	11q11	2012-08-09			ENSG00000186113	ENSG00000186113		"""GPCR / Class A : Olfactory receptors"""	15281	protein-coding gene	gene with protein product							Standard	NM_001004735		Approved		uc010rim.2	Q8NGL3	OTTHUMG00000166809	ENST00000335605.1:c.455T>C	11.37:g.55563486T>C	ENSP00000334456:p.Leu152Pro		Q6IF69|Q6IFD4|Q96RB5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L152P	ENST00000335605.1	37	c.455	CCDS31508.1	11	.	.	.	.	.	.	.	.	.	.	t	2.731	-0.264380	0.05754	.	.	ENSG00000186113	ENST00000335605	T	0.45276	0.9	5.08	3.92	0.45320	GPCR, rhodopsin-like superfamily (1);	0.595915	0.13966	N	0.350519	T	0.53302	0.1788	M	0.92367	3.3	0.18873	N	0.999989	B	0.15719	0.014	B	0.24394	0.053	T	0.54873	-0.8228	10	0.87932	D	0	-10.5069	8.1775	0.31292	0.0:0.1687:0.0:0.8313	.	152	Q8NGL3	OR5DE_HUMAN	P	152	ENSP00000334456:L152P	ENSP00000334456:L152P	L	+	2	0	OR5D14	55320062	0.000000	0.05858	0.063000	0.19743	0.009000	0.06853	-0.380000	0.07427	0.750000	0.32877	0.523000	0.50628	CTC	OR5D14	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.498	OR5D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D14	HGNC	protein_coding	OTTHUMT00000391513.1	T	NM_001004735		55563486	+1	no_errors	ENST00000335605	ensembl	human	known	70_37	missense	SNP	0.020	C
OR5D16	390144	genome.wustl.edu	37	11	55606424	55606424	+	Missense_Mutation	SNP	A	A	C			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr11:55606424A>C	ENST00000378396.1	+	1	197	c.197A>C	c.(196-198)aAc>aCc	p.N66T		NM_001005496.1	NP_001005496.1	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D, member 16	66						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(4)|lung(26)|ovary(5)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_epithelial(135;0.208)				TTTTTCCTCAACCACCTCTCC	0.428																																																	0													186.0	183.0	184.0					11																	55606424		2201	4296	6497	SO:0001583	missense	390144			AB065783	CCDS31512.1	11q11	2012-08-09			ENSG00000205029	ENSG00000205029		"""GPCR / Class A : Olfactory receptors"""	15283	protein-coding gene	gene with protein product							Standard	NM_001005496		Approved		uc010rio.2	Q8NGK9	OTTHUMG00000154233	ENST00000378396.1:c.197A>C	11.37:g.55606424A>C	ENSP00000367649:p.Asn66Thr		Q6IF65|Q96RB4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.N66T	ENST00000378396.1	37	c.197	CCDS31512.1	11	.	.	.	.	.	.	.	.	.	.	.	12.13	1.846719	0.32606	.	.	ENSG00000205029	ENST00000378396	T	0.01963	4.53	4.05	2.11	0.27256	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01124	0.0037	N	0.02315	-0.6	0.21675	N	0.999593	B	0.06786	0.001	B	0.06405	0.002	T	0.47959	-0.9076	9	0.66056	D	0.02	-27.8965	3.8686	0.09027	0.092:0.1615:0.58:0.1665	.	66	Q8NGK9	OR5DG_HUMAN	T	66	ENSP00000367649:N66T	ENSP00000367649:N66T	N	+	2	0	OR5D16	55363000	0.000000	0.05858	0.928000	0.36995	0.973000	0.67179	0.304000	0.19228	0.321000	0.23259	-0.317000	0.08691	AAC	OR5D16	-	pfam_GPCR_Rhodpsn,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.428	OR5D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D16	HGNC	protein_coding	OTTHUMT00000334506.1	A	NM_001005496		55606424	+1	no_errors	ENST00000378396	ensembl	human	known	70_37	missense	SNP	0.992	C
OR5D16	390144	genome.wustl.edu	37	11	55607128	55607128	+	Missense_Mutation	SNP	G	G	A			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr11:55607128G>A	ENST00000378396.1	+	1	901	c.901G>A	c.(901-903)Gat>Aat	p.D301N		NM_001005496.1	NP_001005496.1	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D, member 16	301						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(4)|lung(26)|ovary(5)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_epithelial(135;0.208)				AGATGTTAAGGATGCAATCCG	0.338																																																	0													37.0	38.0	37.0					11																	55607128		2201	4296	6497	SO:0001583	missense	390144			AB065783	CCDS31512.1	11q11	2012-08-09			ENSG00000205029	ENSG00000205029		"""GPCR / Class A : Olfactory receptors"""	15283	protein-coding gene	gene with protein product							Standard	NM_001005496		Approved		uc010rio.2	Q8NGK9	OTTHUMG00000154233	ENST00000378396.1:c.901G>A	11.37:g.55607128G>A	ENSP00000367649:p.Asp301Asn		Q6IF65|Q96RB4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.D301N	ENST00000378396.1	37	c.901	CCDS31512.1	11	.	.	.	.	.	.	.	.	.	.	.	4.427	0.078962	0.08533	.	.	ENSG00000205029	ENST00000378396	T	0.35973	1.28	4.43	1.47	0.22746	.	.	.	.	.	T	0.16128	0.0388	N	0.10782	0.045	0.09310	N	1	B	0.12013	0.005	B	0.19666	0.026	T	0.33624	-0.9861	9	0.09084	T	0.74	-7.3807	6.1267	0.20184	0.4176:0.0:0.5824:0.0	.	301	Q8NGK9	OR5DG_HUMAN	N	301	ENSP00000367649:D301N	ENSP00000367649:D301N	D	+	1	0	OR5D16	55363704	0.000000	0.05858	0.001000	0.08648	0.017000	0.09413	0.498000	0.22530	0.448000	0.26722	0.537000	0.68136	GAT	OR5D16	-	NULL		0.338	OR5D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D16	HGNC	protein_coding	OTTHUMT00000334506.1	G	NM_001005496		55607128	+1	no_errors	ENST00000378396	ensembl	human	known	70_37	missense	SNP	0.001	A
NTM	50863	genome.wustl.edu	37	11	132205130	132205130	+	3'UTR	SNP	A	A	T			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr11:132205130A>T	ENST00000374786.1	+	0	1604				NTM_ENST00000425719.2_3'UTR|NTM_ENST00000374791.3_3'UTR|NTM_ENST00000474900.1_3'UTR	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin						cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						AACCAATCAGATATATACAAA	0.443																																																	0																																										SO:0001624	3_prime_UTR_variant	50863			AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.*90A>T	11.37:g.132205130A>T			A0MTT2|Q6UXJ3|Q86VJ9	RNA	SNP	-	NULL	ENST00000374786.1	37	NULL	CCDS8491.1	11																																																																																			NTM	-	-		0.443	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTM	HGNC	protein_coding	OTTHUMT00000141937.1	A	NM_016522		132205130	+1	no_errors	ENST00000474900	ensembl	human	known	70_37	rna	SNP	0.000	T
PAPLN	89932	genome.wustl.edu	37	14	73719422	73719422	+	Missense_Mutation	SNP	C	C	T	rs556246074		TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr14:73719422C>T	ENST00000554301.1	+	10	1196	c.1033C>T	c.(1033-1035)Cgc>Tgc	p.R345C	PAPLN_ENST00000340738.5_Missense_Mutation_p.R318C|PAPLN_ENST00000555445.1_Missense_Mutation_p.R345C|PAPLN_ENST00000381166.3_Missense_Mutation_p.R345C|PAPLN_ENST00000427855.1_Missense_Mutation_p.R345C			O95428	PPN_HUMAN	papilin, proteoglycan-like sulfated glycoprotein	345	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.					basement membrane (GO:0005604)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase inhibitor activity (GO:0004867)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(3)	42				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		CATGTGCCAGCGCCAGCCACG	0.662													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17891	0.0		0.0	False		,,,				2504	0.0																0													78.0	79.0	79.0					14																	73719422		2203	4300	6503	SO:0001583	missense	89932			BC042057	CCDS32114.1	14q24.2	2013-01-11				ENSG00000100767		"""Immunoglobulin superfamily / I-set domain containing"""	19262	protein-coding gene	gene with protein product						11076767, 19734141	Standard	NM_173462		Approved	MGC50452	uc001xnw.4	O95428		ENST00000554301.1:c.1033C>T	14.37:g.73719422C>T	ENSP00000451803:p.Arg345Cys		B4DES8|B4DGE6|Q659F2|Q6UXJ4|Q6ZNM1|Q6ZUJ0|Q7Z681|Q8IVU0	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_Prot_inh_Kunz-m,pfam_PLAC,superfamily_Prot_inh_Kunz-m,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Prot_inh_Kunz-m,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Prot_inh_Kunz-m,pfscan_Ig-like,prints_Peptidase_M12B_ADAM-TS,prints_Prot_inh_Kunz-m	p.R345C	ENST00000554301.1	37	c.1033		14	.	.	.	.	.	.	.	.	.	.	C	14.31	2.497667	0.44455	.	.	ENSG00000100767	ENST00000340738;ENST00000427855;ENST00000381166;ENST00000554301;ENST00000555445	T;T;T;T;T	0.61158	0.13;0.13;0.13;0.13;0.13	5.22	4.32	0.51571	.	.	.	.	.	T	0.57169	0.2035	L	0.36672	1.1	0.28758	N	0.901086	D;D;D	0.71674	0.998;0.998;0.994	P;P;P	0.54372	0.635;0.75;0.711	T	0.52518	-0.8565	9	0.54805	T	0.06	.	8.304	0.32032	0.308:0.4563:0.2357:0.0	.	345;345;318	O95428-5;O95428;O95428-6	.;PPN_HUMAN;.	C	318;345;345;345;345	ENSP00000345395:R318C;ENSP00000403403:R345C;ENSP00000370558:R345C;ENSP00000451803:R345C;ENSP00000451729:R345C	ENSP00000216658:R345C	R	+	1	0	PAPLN	72789175	0.961000	0.32948	0.760000	0.31359	0.285000	0.27093	2.812000	0.47994	1.152000	0.42452	0.462000	0.41574	CGC	PAPLN	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.662	PAPLN-002	KNOWN	basic|appris_principal	protein_coding	PAPLN	HGNC	protein_coding	OTTHUMT00000413182.1	C	NM_173462		73719422	+1	no_errors	ENST00000427855	ensembl	human	known	70_37	missense	SNP	0.496	T
PASD1	139135	genome.wustl.edu	37	X	150840915	150840915	+	Silent	SNP	G	G	A			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chrX:150840915G>A	ENST00000370357.4	+	14	1943	c.1698G>A	c.(1696-1698)caG>caA	p.Q566Q		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	566						nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					agaagcagcagctgcaagagc	0.547																																																	0													104.0	79.0	87.0					X																	150840915		2203	4300	6503	SO:0001819	synonymous_variant	139135			AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.1698G>A	X.37:g.150840915G>A			Q3MNE0|Q69HD7|Q8N7X9	Silent	SNP	smart_PAS,pfscan_PAS	p.Q566	ENST00000370357.4	37	c.1698	CCDS35431.1	X																																																																																			PASD1	-	NULL		0.547	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PASD1	HGNC	protein_coding	OTTHUMT00000060879.2	G	NM_173493		150840915	+1	no_errors	ENST00000370357	ensembl	human	known	70_37	silent	SNP	0.000	A
PASD1	139135	genome.wustl.edu	37	X	150840924	150840924	+	Silent	SNP	G	G	A			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chrX:150840924G>A	ENST00000370357.4	+	14	1952	c.1707G>A	c.(1705-1707)gaG>gaA	p.E569E		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	569						nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					agctgcaagagcagccactga	0.542																																																	0													113.0	85.0	94.0					X																	150840924		2203	4300	6503	SO:0001819	synonymous_variant	139135			AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.1707G>A	X.37:g.150840924G>A			Q3MNE0|Q69HD7|Q8N7X9	Silent	SNP	smart_PAS,pfscan_PAS	p.E569	ENST00000370357.4	37	c.1707	CCDS35431.1	X																																																																																			PASD1	-	NULL		0.542	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PASD1	HGNC	protein_coding	OTTHUMT00000060879.2	G	NM_173493		150840924	+1	no_errors	ENST00000370357	ensembl	human	known	70_37	silent	SNP	0.002	A
PCDHA8	56140	genome.wustl.edu	37	5	140222840	140222840	+	Missense_Mutation	SNP	A	A	C			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr5:140222840A>C	ENST00000531613.1	+	1	1934	c.1934A>C	c.(1933-1935)cAc>cCc	p.H645P	PCDHA5_ENST00000529619.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA8_ENST00000378123.3_Missense_Mutation_p.H645P|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	645	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTCCGCGCCACCGTCTGCTG	0.662																																																	0													101.0	100.0	100.0					5																	140222840		2197	4267	6464	SO:0001583	missense	56140			AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.1934A>C	5.37:g.140222840A>C	ENSP00000434655:p.His645Pro		B9EGT7|O75281	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.H645P	ENST00000531613.1	37	c.1934	CCDS54919.1	5	.	.	.	.	.	.	.	.	.	.	A	13.83	2.354120	0.41700	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.52526	0.66;0.66	2.93	2.93	0.34026	Cadherin (4);Cadherin-like (1);	0.591505	0.13034	U	0.419082	T	0.56455	0.1986	M	0.72624	2.21	0.31160	N	0.704448	D;P	0.54772	0.968;0.931	P;P	0.54026	0.74;0.622	T	0.61192	-0.7112	10	0.87932	D	0	.	7.3267	0.26560	0.8041:0.0:0.0:0.1958	.	645;645	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	P	645	ENSP00000434655:H645P;ENSP00000367363:H645P	ENSP00000367363:H645P	H	+	2	0	PCDHA8	140203024	0.976000	0.34144	0.925000	0.36789	0.247000	0.25773	3.643000	0.54374	1.329000	0.45376	0.260000	0.18958	CAC	PCDHA8	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.662	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA8	HGNC	protein_coding	OTTHUMT00000372830.2	A	NM_018911		140222840	+1	no_errors	ENST00000531613	ensembl	human	known	70_37	missense	SNP	0.971	C
PDE1B	5153	genome.wustl.edu	37	12	54968932	54968932	+	Missense_Mutation	SNP	G	G	A			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr12:54968932G>A	ENST00000243052.3	+	11	1551	c.1115G>A	c.(1114-1116)aGc>aAc	p.S372N	PDE1B_ENST00000394277.3_3'UTR|PDE1B_ENST00000538346.1_Missense_Mutation_p.S331N|PDE1B_ENST00000550620.1_Missense_Mutation_p.S352N	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent	372	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	GCTGACATCAGCCACCCAACC	0.562																																																	0													137.0	121.0	127.0					12																	54968932		2203	4300	6503	SO:0001583	missense	5153			U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.1115G>A	12.37:g.54968932G>A	ENSP00000243052:p.Ser372Asn		Q92825|Q96KP3	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_PDEase_N,smart_HD/PDEase_dom,prints_PDEase	p.S372N	ENST00000243052.3	37	c.1115	CCDS8882.1	12	.	.	.	.	.	.	.	.	.	.	G	32	5.130482	0.94473	.	.	ENSG00000123360	ENST00000243052;ENST00000538346;ENST00000550620	D;D;D	0.89552	-2.53;-2.53;-2.53	5.25	5.25	0.73442	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	D	0.92315	0.7562	M	0.84326	2.69	0.80722	D	1	B;P	0.39551	0.264;0.678	B;P	0.47015	0.263;0.534	D	0.93014	0.6434	10	0.62326	D	0.03	.	16.7112	0.85386	0.0:0.0:1.0:0.0	.	352;372	Q01064-2;Q01064	.;PDE1B_HUMAN	N	372;331;352	ENSP00000243052:S372N;ENSP00000442559:S331N;ENSP00000448519:S352N	ENSP00000243052:S372N	S	+	2	0	PDE1B	53255199	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.699000	0.98703	2.618000	0.88619	0.561000	0.74099	AGC	PDE1B	-	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase		0.562	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE1B	HGNC	protein_coding	OTTHUMT00000406203.1	G			54968932	+1	no_errors	ENST00000243052	ensembl	human	known	70_37	missense	SNP	1.000	A
PRR12	57479	genome.wustl.edu	37	19	50119035	50119035	+	Missense_Mutation	SNP	G	G	T			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr19:50119035G>T	ENST00000418929.2	+	9	5068	c.5056G>T	c.(5056-5058)Gct>Tct	p.A1686S		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	865							DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		CCCCGTATCTGCTGGGGGTAG	0.592																																																	0													32.0	37.0	35.0					19																	50119035		1900	4128	6028	SO:0001583	missense	57479			AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.5056G>T	19.37:g.50119035G>T	ENSP00000394510:p.Ala1686Ser		E9PB06|Q8N4J6	Missense_Mutation	SNP	NULL	p.A1686S	ENST00000418929.2	37	c.5056	CCDS46143.1	19	.	.	.	.	.	.	.	.	.	.	G	8.158	0.788962	0.16258	.	.	ENSG00000126464	ENST00000418929;ENST00000246798;ENST00000314734	.	.	.	4.68	-0.294	0.12831	.	0.748080	0.11398	N	0.568115	T	0.10551	0.0258	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.35400	-0.9790	9	0.06236	T	0.91	-0.5979	6.0533	0.19796	0.0906:0.0:0.4325:0.4769	.	1686	Q9ULL5-3	.	S	1686;866;866	.	ENSP00000246798:A866S	A	+	1	0	PRR12	54810847	0.001000	0.12720	0.007000	0.13788	0.670000	0.39368	0.147000	0.16202	0.202000	0.20498	-0.268000	0.10319	GCT	PRR12	-	NULL		0.592	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PRR12	HGNC	protein_coding	OTTHUMT00000465915.1	G	NM_020719		50119035	+1	no_errors	ENST00000418929	ensembl	human	novel	70_37	missense	SNP	0.003	T
RAD51AP1	10635	genome.wustl.edu	37	12	4657294	4657294	+	Missense_Mutation	SNP	T	T	C	rs367934651		TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr12:4657294T>C	ENST00000544927.1	+	5	366	c.356T>C	c.(355-357)aTg>aCg	p.M119T	RAD51AP1_ENST00000543041.1_Start_Codon_SNP_p.M1T|RAD51AP1_ENST00000321524.7_Missense_Mutation_p.M136T|RAD51AP1_ENST00000352618.4_Missense_Mutation_p.M119T|RAD51AP1_ENST00000228843.9_Missense_Mutation_p.M136T					RAD51 associated protein 1											breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(1)	13			Colorectal(7;0.00306)|COAD - Colon adenocarcinoma(12;0.0389)			ATAGAAACAATGAATAAGTCT	0.274																																																	0													76.0	86.0	82.0					12																	4657294		2201	4298	6499	SO:0001583	missense	10635			AF006259	CCDS8529.1, CCDS44805.1	12p13.2-p13.1	2004-09-16			ENSG00000111247	ENSG00000111247			16956	protein-coding gene	gene with protein product		603070				9396801	Standard	NM_001130862		Approved	PIR51	uc001qmw.3	Q96B01	OTTHUMG00000168125	ENST00000544927.1:c.356T>C	12.37:g.4657294T>C	ENSP00000446296:p.Met119Thr			Missense_Mutation	SNP	NULL	p.M136T	ENST00000544927.1	37	c.407		12	.	.	.	.	.	.	.	.	.	.	T	12.84	2.057735	0.36277	.	.	ENSG00000111247	ENST00000321524;ENST00000543041;ENST00000228843;ENST00000352618;ENST00000544927	T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54	4.86	-0.184	0.13280	.	0.942214	0.09037	N	0.857909	T	0.09949	0.0244	N	0.04203	-0.255	0.80722	D	1	B;B;B;B	0.32467	0.372;0.003;0.003;0.002	B;B;B;B	0.26864	0.074;0.002;0.002;0.001	T	0.33420	-0.9869	10	0.09338	T	0.73	3.7565	3.8955	0.09138	0.0:0.3127:0.1901:0.4971	.	1;136;136;119	B4DUS5;Q96B01;A8K313;Q96B01-2	.;R51A1_HUMAN;.;.	T	136;1;136;119;119	ENSP00000323750:M136T;ENSP00000439960:M1T;ENSP00000228843:M136T;ENSP00000309479:M119T;ENSP00000446296:M119T	ENSP00000228843:M136T	M	+	2	0	RAD51AP1	4527555	0.000000	0.05858	0.000000	0.03702	0.622000	0.37654	-0.101000	0.10973	-0.175000	0.10725	0.482000	0.46254	ATG	RAD51AP1	-	NULL		0.274	RAD51AP1-012	PUTATIVE	basic|exp_conf	protein_coding	RAD51AP1	HGNC	protein_coding	OTTHUMT00000399208.1	T	NM_006479		4657294	+1	no_errors	ENST00000228843	ensembl	human	known	70_37	missense	SNP	0.000	C
SAA2	6289	genome.wustl.edu	37	11	18267518	18267518	+	Missense_Mutation	SNP	G	G	A			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr11:18267518G>A	ENST00000526900.1	-	3	352	c.169C>T	c.(169-171)Cgg>Tgg	p.R57W	SAA2_ENST00000528349.1_Missense_Mutation_p.R57W|SAA2_ENST00000529528.1_Missense_Mutation_p.R57W|SAA2_ENST00000530400.1_Missense_Mutation_p.R57W|RNA5SP333_ENST00000363466.1_RNA|SAA2-SAA4_ENST00000524555.1_RNA|SAA2_ENST00000414546.2_Missense_Mutation_p.R57W|SAA2_ENST00000256733.4_Missense_Mutation_p.R57W			P0DJI9	SAA2_HUMAN	serum amyloid A2	57					acute-phase response (GO:0006953)	extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)				central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(1)	6						TAGTTCCCCCGAGCATGGAAG	0.557																																																	0													74.0	69.0	71.0					11																	18267518		2199	4290	6489	SO:0001583	missense	6289			M26152	CCDS7833.1, CCDS44548.1	11p15.1-p14	2008-07-21			ENSG00000134339	ENSG00000134339			10514	protein-coding gene	gene with protein product		104751				7686132	Standard	NM_030754		Approved			P0DJI9	OTTHUMG00000166484	ENST00000526900.1:c.169C>T	11.37:g.18267518G>A	ENSP00000436126:p.Arg57Trp		G3XAK9|P02735|P02736|P02737|Q16730|Q16834|Q16835|Q16879|Q3KRB3|Q6FG67|Q96QN0|Q9UCK9|Q9UCL0	Missense_Mutation	SNP	pfam_Serum_amyloid_A,smart_Serum_amyloid_A,pirsf_Serum_amyloid_A,prints_Serum_amyloid_A	p.R57W	ENST00000526900.1	37	c.169	CCDS7833.1	11	.	.	.	.	.	.	.	.	.	.	G	10.75	1.439006	0.25900	.	.	ENSG00000134339	ENST00000414546;ENST00000530400;ENST00000528349;ENST00000256733;ENST00000529528;ENST00000526900	T;T;T;T;T;T	0.13307	2.6;2.6;2.6;2.6;2.6;2.6	5.09	3.19	0.36642	.	0.000000	0.64402	D	0.000001	T	0.38026	0.1025	.	.	.	0.40252	D	0.978085	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.24548	-1.0157	9	0.62326	D	0.03	.	14.4934	0.67667	0.0:0.0:0.7344:0.2656	.	57;57	G3XAK9;E9PR14	.;.	W	57	ENSP00000416716:R57W;ENSP00000432370:R57W;ENSP00000435659:R57W;ENSP00000256733:R57W;ENSP00000437162:R57W;ENSP00000436126:R57W	ENSP00000256733:R57W	R	-	1	2	SAA2	18224094	1.000000	0.71417	0.987000	0.45799	0.258000	0.26162	3.248000	0.51430	0.267000	0.21916	-0.824000	0.03097	CGG	SAA2	-	pfam_Serum_amyloid_A,smart_Serum_amyloid_A,pirsf_Serum_amyloid_A,prints_Serum_amyloid_A		0.557	SAA2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SAA2	HGNC	protein_coding	OTTHUMT00000389983.1	G	NM_030754		18267518	-1	no_errors	ENST00000256733	ensembl	human	known	70_37	missense	SNP	0.987	A
SAA1	6288	genome.wustl.edu	37	11	18290819	18290819	+	Missense_Mutation	SNP	C	C	T			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr11:18290819C>T	ENST00000405158.2	+	3	353	c.169C>T	c.(169-171)Cgg>Tgg	p.R57W	RNA5SP334_ENST00000364825.1_RNA|SAA1_ENST00000532858.1_Missense_Mutation_p.R57W|SAA1_ENST00000356524.4_Missense_Mutation_p.R57W	NM_000331.4	NP_000322	P0DJI8	SAA1_HUMAN	serum amyloid A1	57					acute-phase response (GO:0006953)|innate immune response (GO:0045087)|lymphocyte chemotaxis (GO:0048247)|macrophage chemotaxis (GO:0048246)|negative regulation of inflammatory response (GO:0050728)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of interleukin-1 secretion (GO:0050716)|regulation of protein secretion (GO:0050708)	endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)	G-protein coupled receptor binding (GO:0001664)|heparin binding (GO:0008201)			endometrium(1)|large_intestine(3)|lung(2)|stomach(3)	9					Human Serum Albumin(DB00062)|Serum albumin iodonated(DB00064)	CTTCCATGCTCGGGGGAACTA	0.557																																																	0													26.0	26.0	26.0					11																	18290819		2197	4271	6468	SO:0001583	missense	6288			M10906	CCDS7835.1	11p15.1	2014-01-30			ENSG00000173432	ENSG00000173432		"""Endogenous ligands"""	10513	protein-coding gene	gene with protein product		104750		SAA		2595451, 9305847	Standard	NM_199161		Approved	PIG4, TP53I4	uc021qeo.1	P0DJI8	OTTHUMG00000166147	ENST00000405158.2:c.169C>T	11.37:g.18290819C>T	ENSP00000384906:p.Arg57Trp		P02735|P02736|P02737|Q16730|Q16834|Q16835|Q16879|Q3KRB3|Q6FG67|Q96QN0|Q9UCK9|Q9UCL0	Missense_Mutation	SNP	pfam_Serum_amyloid_A,smart_Serum_amyloid_A,pirsf_Serum_amyloid_A,prints_Serum_amyloid_A	p.R57W	ENST00000405158.2	37	c.169	CCDS7835.1	11	.	.	.	.	.	.	.	.	.	.	C	12.45	1.940860	0.34283	.	.	ENSG00000173432	ENST00000356524;ENST00000532858;ENST00000405158	T;T;T	0.13307	2.6;2.6;2.6	3.23	2.31	0.28768	.	0.000000	0.64402	D	0.000001	T	0.40347	0.1113	M	0.90082	3.085	0.39115	D	0.961548	D;P	0.89917	1.0;0.696	D;B	0.91635	0.999;0.344	T	0.48581	-0.9023	10	0.62326	D	0.03	.	9.8917	0.41294	0.203:0.797:0.0:0.0	.	57;57	D3DQX7;P02735	.;SAA_HUMAN	W	57	ENSP00000348918:R57W;ENSP00000436866:R57W;ENSP00000384906:R57W	ENSP00000348918:R57W	R	+	1	2	SAA1	18247395	0.986000	0.35501	0.989000	0.46669	0.408000	0.30992	0.917000	0.28665	0.930000	0.37217	-0.437000	0.05841	CGG	SAA1	-	pfam_Serum_amyloid_A,smart_Serum_amyloid_A,pirsf_Serum_amyloid_A,prints_Serum_amyloid_A		0.557	SAA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SAA1	HGNC	protein_coding	OTTHUMT00000395864.1	C	NM_199161		18290819	+1	no_errors	ENST00000356524	ensembl	human	known	70_37	missense	SNP	0.999	T
SAGE1	55511	genome.wustl.edu	37	X	134994496	134994496	+	Missense_Mutation	SNP	C	C	G	rs200895409		TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chrX:134994496C>G	ENST00000370709.3	+	18	2538	c.2538C>G	c.(2536-2538)ttC>ttG	p.F846L	SAGE1_ENST00000537770.1_Missense_Mutation_p.F470L|SAGE1_ENST00000535938.1_Missense_Mutation_p.F846L|SAGE1_ENST00000324447.3_Missense_Mutation_p.F846L			Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	846						nucleus (GO:0005634)				breast(5)|endometrium(5)|large_intestine(10)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	55	Acute lymphoblastic leukemia(192;0.000127)					AAAGAATTTTCATTTTGCTTG	0.318																																																	0													77.0	76.0	76.0					X																	134994496		2201	4299	6500	SO:0001583	missense	55511			AJ278111	CCDS14652.1	Xq26	2009-03-25			ENSG00000181433	ENSG00000181433			30369	protein-coding gene	gene with protein product	"""cancer/testis antigen 14"""	300359				10919659	Standard	NM_018666		Approved	SAGE, CT14	uc004ezh.3	Q9NXZ1	OTTHUMG00000022496	ENST00000370709.3:c.2538C>G	X.37:g.134994496C>G	ENSP00000359743:p.Phe846Leu		Q5JNW0	Missense_Mutation	SNP	NULL	p.F846L	ENST00000370709.3	37	c.2538	CCDS14652.1	X	.	.	.	.	.	.	.	.	.	.	C	11.38	1.622517	0.28889	.	.	ENSG00000181433	ENST00000324447;ENST00000535938;ENST00000537770;ENST00000370709	T;T;T;T	0.41400	1.0;1.0;1.02;1.0	2.31	2.31	0.28768	.	0.191967	0.45126	N	0.000399	T	0.52435	0.1734	L	0.53671	1.685	0.31443	N	0.671768	D;P	0.56035	0.974;0.859	D;B	0.67725	0.953;0.37	T	0.56589	-0.7954	10	0.56958	D	0.05	.	8.1043	0.30877	0.0:0.8572:0.0:0.1428	.	470;846	F5H2Z8;Q9NXZ1	.;SAGE1_HUMAN	L	846;846;470;846	ENSP00000323191:F846L;ENSP00000445959:F846L;ENSP00000438276:F470L;ENSP00000359743:F846L	ENSP00000323191:F846L	F	+	3	2	SAGE1	134822162	0.144000	0.22641	0.055000	0.19348	0.396000	0.30629	0.319000	0.19522	1.145000	0.42336	0.179000	0.17066	TTC	SAGE1	-	NULL		0.318	SAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAGE1	HGNC	protein_coding	OTTHUMT00000058448.1	C	NM_018666		134994496	+1	no_errors	ENST00000324447	ensembl	human	known	70_37	missense	SNP	0.818	G
SEC22B	9554	genome.wustl.edu	37	1	145116147	145116148	+	RNA	INS	-	-	A	rs56026824|rs113058116	byFrequency	TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr1:145116147_145116148insA	ENST00000453618.1	+	0	1233_1234							O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											AGTAGATTGTTATTTCGTTTTT	0.416													A|A|AA|insertion	2465	0.492212	0.497	0.4914	5008	,	,		69600	0.4891		0.4891	False		,,,				2504	0.4928																0																																												9554			AF047442		1q21.1	2012-04-20	2010-03-12	2006-04-25	ENSG00000223380				10700	protein-coding gene	gene with protein product		604029	"""SEC22, vesicle trafficking protein (S. cerevisiae)-like 1"", ""SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)"", ""SEC22 vesicle trafficking protein homolog B (S. cerevisiae)"""	SEC22L1		9094723, 16354670	Standard	NM_004892		Approved	sec22b, ERS-24	uc031poa.1	O75396	OTTHUMG00000013745		1.37:g.145116148_145116148dupA			A8K1G0	RNA	INS	-	NULL	ENST00000453618.1	37	NULL		1																																																																																			SEC22B	-	-		0.416	SEC22B-001	KNOWN	basic	processed_transcript	SEC22B	HGNC	processed_transcript	OTTHUMT00000038523.5	-	NM_004892		145116148	+1	no_errors	ENST00000453618	ensembl	human	known	70_37	rna	INS	0.382:0.029	A
SNAPC4	6621	genome.wustl.edu	37	9	139272788	139272788	+	Missense_Mutation	SNP	G	G	A			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr9:139272788G>A	ENST00000298532.2	-	21	3859	c.3491C>T	c.(3490-3492)cCt>cTt	p.P1164L		NM_003086.2	NP_003077.2			small nuclear RNA activating complex, polypeptide 4, 190kDa											biliary_tract(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	33		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		CGCTTCTGCAGGACTTTGGGA	0.632																																																	0													22.0	25.0	24.0					9																	139272788		2195	4296	6491	SO:0001583	missense	6621			AF032387	CCDS6998.1	9q34.3	2008-07-21	2002-08-29		ENSG00000165684	ENSG00000165684			11137	protein-coding gene	gene with protein product		602777	"""small nuclear RNA activating complex, polypeptide 4, 190kD"""			9418884	Standard	XM_005266096		Approved	SNAP190, PTFalpha, FLJ13451	uc004chh.3	Q5SXM2	OTTHUMG00000020929	ENST00000298532.2:c.3491C>T	9.37:g.139272788G>A	ENSP00000298532:p.Pro1164Leu			Missense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.P1164L	ENST00000298532.2	37	c.3491	CCDS6998.1	9	.	.	.	.	.	.	.	.	.	.	g	6.990	0.552766	0.13374	.	.	ENSG00000165684	ENST00000298532	T	0.23950	1.88	3.18	2.15	0.27550	.	2.239790	0.03085	U	0.158944	T	0.20292	0.0488	L	0.36672	1.1	0.09310	N	1	P	0.39480	0.675	B	0.30943	0.122	T	0.27297	-1.0078	10	0.34782	T	0.22	.	9.7967	0.40740	0.0:0.0:0.6847:0.3152	.	1164	Q5SXM2	SNPC4_HUMAN	L	1164	ENSP00000298532:P1164L	ENSP00000298532:P1164L	P	-	2	0	SNAPC4	138392609	0.033000	0.19621	0.002000	0.10522	0.053000	0.15095	1.376000	0.34306	1.630000	0.50440	0.556000	0.70494	CCT	SNAPC4	-	NULL		0.632	SNAPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAPC4	HGNC	protein_coding	OTTHUMT00000055071.1	G	NM_003086		139272788	-1	no_errors	ENST00000298532	ensembl	human	known	70_37	missense	SNP	0.000	A
STAR	6770	genome.wustl.edu	37	8	38003905	38003905	+	Missense_Mutation	SNP	C	C	G			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr8:38003905C>G	ENST00000276449.4	-	4	813	c.367G>C	c.(367-369)Gag>Cag	p.E123Q	RP11-90P5.2_ENST00000520598.1_RNA	NM_000349.2	NP_000340.2	P49675	STAR_HUMAN	steroidogenic acute regulatory protein	123	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				bile acid biosynthetic process (GO:0006699)|biphenyl metabolic process (GO:0018879)|brain development (GO:0007420)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to alkaloid (GO:0071312)|cellular response to antibiotic (GO:0071236)|cellular response to cadmium ion (GO:0071276)|cellular response to cAMP (GO:0071320)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth hormone stimulus (GO:0071378)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-alpha (GO:0035457)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to luteinizing hormone stimulus (GO:0071373)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cholesterol metabolic process (GO:0008203)|circadian sleep/wake cycle, REM sleep (GO:0042747)|dibenzo-p-dioxin metabolic process (GO:0018894)|diterpenoid metabolic process (GO:0016101)|estrogen biosynthetic process (GO:0006703)|fractalkine metabolic process (GO:0050756)|glucocorticoid metabolic process (GO:0008211)|insecticide metabolic process (GO:0017143)|intracellular cholesterol transport (GO:0032367)|male gonad development (GO:0008584)|negative regulation of neuron apoptotic process (GO:0043524)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|positive regulation of gene expression (GO:0010628)|positive regulation of neurogenesis (GO:0050769)|progesterone biosynthetic process (GO:0006701)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of steroid biosynthetic process (GO:0050810)|response to activity (GO:0014823)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to fungicide (GO:0060992)|response to herbicide (GO:0009635)|response to hydrogen peroxide (GO:0042542)|response to ionizing radiation (GO:0010212)|response to lead ion (GO:0010288)|response to leptin (GO:0044321)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	cytosol (GO:0005829)|mitochondrial crista (GO:0030061)|mitochondrial intermembrane space (GO:0005758)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	cholesterol binding (GO:0015485)			breast(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	11	Colorectal(12;0.000442)	all_lung(54;0.0151)|Lung NSC(58;0.0295)		READ - Rectum adenocarcinoma(644;0.188)		ACCACGACCTCCAGCCGGAAC	0.547																																																	0													86.0	81.0	83.0					8																	38003905		2203	4300	6503	SO:0001583	missense	6770			BC010550	CCDS6102.1	8p11.2	2011-09-13	2007-05-15		ENSG00000147465	ENSG00000147465		"""StAR-related lipid transfer (START) domain containing"""	11359	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 1"""	600617	"""steroidogenic acute regulator"""			7761400	Standard	NM_000349		Approved	StAR, STARD1	uc003xkv.1	P49675	OTTHUMG00000164058	ENST00000276449.4:c.367G>C	8.37:g.38003905C>G	ENSP00000276449:p.Glu123Gln		Q16396	Missense_Mutation	SNP	pfam_START_lipid-bd,smart_START_lipid-bd,pfscan_START_lipid-bd,prints_StAR	p.E123Q	ENST00000276449.4	37	c.367	CCDS6102.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.90|18.90	3.720788|3.720788	0.68959|0.68959	.|.	.|.	ENSG00000147465|ENSG00000147465	ENST00000276449;ENST00000522753;ENST00000521236|ENST00000522050	T;T|.	0.79141|.	-1.24;-1.24|.	5.72|5.72	5.72|5.72	0.89469|0.89469	Lipid-binding START (3);START-like domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.76948|0.76948	0.4059|0.4059	M|M	0.73319|0.73319	2.225|2.225	0.80722|0.80722	D|D	1|1	P;P|.	0.46327|.	0.798;0.876|.	P;P|.	0.48677|.	0.586;0.586|.	T|T	0.75033|0.75033	-0.3460|-0.3460	10|5	0.72032|.	D|.	0.01|.	-34.3036|-34.3036	19.8968|19.8968	0.96969|0.96969	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	85;123|.	E7ETA9;P49675|.	.;STAR_HUMAN|.	Q|C	123;85;41|101	ENSP00000276449:E123Q;ENSP00000430030:E41Q|.	ENSP00000276449:E123Q|.	E|W	-|-	1|3	0|0	STAR|STAR	38123062|38123062	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.859000|0.859000	0.49053|0.49053	7.487000|7.487000	0.81328|0.81328	2.691000|2.691000	0.91804|0.91804	0.655000|0.655000	0.94253|0.94253	GAG|TGG	STAR	-	pfam_START_lipid-bd,smart_START_lipid-bd,pfscan_START_lipid-bd		0.547	STAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAR	HGNC	protein_coding	OTTHUMT00000376990.2	C	NM_000349		38003905	-1	no_errors	ENST00000276449	ensembl	human	known	70_37	missense	SNP	1.000	G
STAT1	6772	genome.wustl.edu	37	2	191841666	191841666	+	Silent	SNP	G	G	A			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr2:191841666G>A	ENST00000361099.3	-	22	2346	c.1959C>T	c.(1957-1959)gtC>gtT	p.V653V	STAT1_ENST00000540176.1_3'UTR|STAT1_ENST00000409465.1_Silent_p.V653V|STAT1_ENST00000392323.2_Silent_p.V655V|STAT1_ENST00000392322.3_Silent_p.V653V	NM_007315.3	NP_009330.1	P42224	STAT1_HUMAN	signal transducer and activator of transcription 1, 91kDa	653	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				apoptotic process (GO:0006915)|blood circulation (GO:0008015)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of macrophage fusion (GO:0034240)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|renal tubule development (GO:0061326)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|tumor necrosis factor receptor binding (GO:0005164)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)			CAGCAGCCATGACTTTGTAAT	0.413																																																	0													116.0	109.0	111.0					2																	191841666		2203	4300	6503	SO:0001819	synonymous_variant	6772				CCDS2309.1, CCDS42793.1	2q32.2-q32.3	2014-09-17	2002-08-29		ENSG00000115415	ENSG00000115415		"""SH2 domain containing"""	11362	protein-coding gene	gene with protein product	"""transcription factor ISGF-3 components p91/p84"""	600555	"""signal transducer and activator of transcription 1, 91kD"""			7885841	Standard	NM_139266		Approved	STAT91, ISGF-3	uc002usj.2	P42224	OTTHUMG00000132699	ENST00000361099.3:c.1959C>T	2.37:g.191841666G>A			A8K989|B2RCA0|D2KFR8|D3DPI7|Q53S88|Q53XW4|Q68D00|Q9UDL5	Silent	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_STAT1_TAZ2-bd_C,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,pfscan_SH2	p.V653	ENST00000361099.3	37	c.1959	CCDS2309.1	2																																																																																			STAT1	-	pfscan_SH2		0.413	STAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAT1	HGNC	protein_coding	OTTHUMT00000255997.3	G	NM_007315		191841666	-1	no_errors	ENST00000361099	ensembl	human	known	70_37	silent	SNP	1.000	A
TAF15	8148	genome.wustl.edu	37	17	34169419	34169419	+	Missense_Mutation	SNP	G	G	T			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr17:34169419G>T	ENST00000588240.1	+	12	1077	c.962G>T	c.(961-963)aGa>aTa	p.R321I	TAF15_ENST00000311979.3_Missense_Mutation_p.R318I|TAF15_ENST00000592237.1_Missense_Mutation_p.R230I	NM_003487.3|NM_139215.2	NP_003478.1|NP_631961.1	Q16514	TAF12_HUMAN	TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa	0					chromatin organization (GO:0006325)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of RNA biosynthetic process (GO:2001141)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)		TAF15/NR4A3(33)	lung(1)|ovary(1)|skin(2)|stomach(1)	5		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		GCCACTAGAAGACCTGAATTC	0.443			T	"""TEC, CHN1, ZNF384"""	"""extraskeletal myxoid chondrosarcomas, ALL"""																																			Dom	yes		17	17q11.1-q11.2	8148	"""TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa"""		"""L, M"""	0													102.0	98.0	99.0					17																	34169419		2203	4300	6503	SO:0001583	missense	8148			U51334	CCDS32623.1, CCDS59279.1	17q11.1-q11.2	2013-02-12	2002-08-29	2001-12-07		ENSG00000270647		"""RNA binding motif (RRM) containing"""	11547	protein-coding gene	gene with protein product		601574	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, N, 68kD (RNA-binding protein 56)"""	TAF2N		8954779, 9795213	Standard	NM_003487		Approved	hTAFII68, RBP56, Npl3	uc002hkd.4	Q92804		ENST00000588240.1:c.962G>T	17.37:g.34169419G>T	ENSP00000466950:p.Arg321Ile		D3DPM5|Q15775|Q5T077	Missense_Mutation	SNP	pfam_RRM_dom,pfam_Znf_RanBP2,smart_RRM_dom,smart_Znf_RanBP2,pfscan_Znf_RanBP2,pfscan_RRM_dom	p.R321I	ENST00000588240.1	37	c.962	CCDS32623.1	17	.	.	.	.	.	.	.	.	.	.	G	28.7	4.940796	0.92526	.	.	ENSG00000172660	ENST00000311979;ENST00000536077	.	.	.	5.17	5.17	0.71159	Nucleotide-binding, alpha-beta plait (1);	.	.	.	.	T	0.69342	0.3100	L	0.45137	1.4	0.80722	D	1	D;D	0.65815	0.992;0.995	D;D	0.75020	0.967;0.985	T	0.71728	-0.4505	8	0.66056	D	0.02	-15.1297	16.1613	0.81712	0.0:0.0:1.0:0.0	.	321;318	Q92804;Q92804-2	RBP56_HUMAN;.	I	321;124	.	ENSP00000309558:R321I	R	+	2	0	TAF15	31193532	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.009000	0.93606	2.402000	0.81655	0.563000	0.77884	AGA	TAF15	-	NULL		0.443	TAF15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TAF15	HGNC	protein_coding	OTTHUMT00000449134.1	G	NM_139215		34169419	+1	no_errors	ENST00000588240	ensembl	human	known	70_37	missense	SNP	1.000	T
TBL3	10607	genome.wustl.edu	37	16	2027624	2027624	+	Missense_Mutation	SNP	G	G	C	rs532426427		TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr16:2027624G>C	ENST00000568546.1	+	17	1980	c.1852G>C	c.(1852-1854)Gac>Cac	p.D618H		NM_006453.2	NP_006444.2	Q12788	TBL3_HUMAN	transducin (beta)-like 3	618					G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|intracellular signal transduction (GO:0035556)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)|receptor signaling protein activity (GO:0005057)			breast(1)|endometrium(2)|kidney(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	18						CCGGCTGGACGACCACGCCCT	0.647																																					Melanoma(118;616 1651 35077 38081 48633)												0													36.0	33.0	34.0					16																	2027624		2171	4261	6432	SO:0001583	missense	10607			U02609	CCDS10453.1	16p13.3	2013-01-10			ENSG00000183751	ENSG00000183751		"""WD repeat domain containing"""	11587	protein-coding gene	gene with protein product		605915				8307582	Standard	NM_006453		Approved	SAZD, UTP13	uc002cnu.1	Q12788	OTTHUMG00000128710	ENST00000568546.1:c.1852G>C	16.37:g.2027624G>C	ENSP00000454836:p.Asp618His		Q59GD6|Q8IVB7|Q96A78	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_SSU_processome_Utp13,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.D618H	ENST00000568546.1	37	c.1852	CCDS10453.1	16	.	.	.	.	.	.	.	.	.	.	G	14.43	2.533451	0.45073	.	.	ENSG00000183751	ENST00000332704	.	.	.	5.54	4.58	0.56647	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.136463	0.64402	D	0.000004	T	0.69780	0.3149	M	0.64260	1.97	0.43874	D	0.996487	P;D	0.65815	0.942;0.995	P;D	0.65010	0.879;0.931	T	0.70439	-0.4871	9	0.51188	T	0.08	-32.8977	12.8808	0.58015	0.0783:0.0:0.9217:0.0	.	380;618	A0JLS5;Q12788	.;TBL3_HUMAN	H	618	.	ENSP00000331815:D618H	D	+	1	0	TBL3	1967625	1.000000	0.71417	0.125000	0.21846	0.193000	0.23685	3.153000	0.50685	2.601000	0.87937	0.561000	0.74099	GAC	TBL3	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.647	TBL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBL3	HGNC	protein_coding	OTTHUMT00000250615.3	G	NM_006453		2027624	+1	no_errors	ENST00000568546	ensembl	human	known	70_37	missense	SNP	0.696	C
TBRG1	84897	genome.wustl.edu	37	11	124496383	124496383	+	Missense_Mutation	SNP	T	T	C			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr11:124496383T>C	ENST00000441174.3	+	4	673	c.469T>C	c.(469-471)Tgc>Cgc	p.C157R	TBRG1_ENST00000375005.4_Intron|TBRG1_ENST00000438907.2_Intron	NM_032811.2	NP_116200.2	Q3YBR2	TBRG1_HUMAN	transforming growth factor beta regulator 1	157	Lys-rich.				cell cycle arrest (GO:0007050)|DNA replication (GO:0006260)|negative regulation of cell proliferation (GO:0008285)|nucleolus to nucleoplasm transport (GO:0032066)|protein stabilization (GO:0050821)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				kidney(1)|prostate(1)	2	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0218)		GAAGAAAACATGCAAGAAAAA	0.527																																																	0													75.0	75.0	75.0					11																	124496383		692	1591	2283	SO:0001583	missense	84897			AK074140	CCDS8448.2	11q24.2	2008-02-05			ENSG00000154144	ENSG00000154144			29551	protein-coding gene	gene with protein product	"""nuclear interactor of ARF and MDM2"""	610614				7654366, 17110379	Standard	NM_032811		Approved	FLJ14621, TB-5, NIAM	uc001qak.4	Q3YBR2	OTTHUMG00000153024	ENST00000441174.3:c.469T>C	11.37:g.124496383T>C	ENSP00000409016:p.Cys157Arg		Q53GJ5|Q66ZJ6|Q69YS7|Q8TCS4|Q8TEI4|Q96SV0	Missense_Mutation	SNP	pfam_FYrich_N,pfam_FYrich_C,smart_FYrich_N,smart_FYrich_C	p.C157R	ENST00000441174.3	37	c.469	CCDS8448.2	11	.	.	.	.	.	.	.	.	.	.	T	10.78	1.447810	0.26074	.	.	ENSG00000154144	ENST00000441174	T	0.79554	-1.28	5.69	4.54	0.55810	.	0.183046	0.48767	D	0.000161	T	0.63861	0.2547	N	0.14661	0.345	0.80722	D	1	B	0.16166	0.016	B	0.15484	0.013	T	0.54964	-0.8214	10	0.20519	T	0.43	-1.9269	10.3141	0.43725	0.1476:0.0:0.0:0.8524	.	157	Q3YBR2	TBRG1_HUMAN	R	157	ENSP00000409016:C157R	ENSP00000409016:C157R	C	+	1	0	TBRG1	124001593	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.162000	0.50755	0.958000	0.37956	0.533000	0.62120	TGC	TBRG1	-	NULL		0.527	TBRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBRG1	HGNC	protein_coding	OTTHUMT00000329057.2	T	NM_032811		124496383	+1	no_errors	ENST00000441174	ensembl	human	known	70_37	missense	SNP	1.000	C
TEKT5	146279	genome.wustl.edu	37	16	10721427	10721427	+	3'UTR	SNP	G	G	A	rs368826321		TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr16:10721427G>A	ENST00000283025.2	-	0	1542				TEKT5_ENST00000574923.1_5'UTR	NM_144674.1	NP_653275.1	Q96M29	TEKT5_HUMAN	tektin 5							cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)	34						GGAATGAGGCGCCAGGGCGGT	0.527																																																	0								G		0,4394		0,0,2197	47.0	49.0	48.0			-0.5	0.0	16		48	2,8596	2.2+/-6.3	0,2,4297	no	utr-3	TEKT5	NM_144674.1		0,2,6494	AA,AG,GG		0.0233,0.0,0.0154			10721427	2,12990	2197	4299	6496	SO:0001624	3_prime_UTR_variant	146279				CCDS10542.1	16p13.13	2014-01-21			ENSG00000153060	ENSG00000153060			26554	protein-coding gene	gene with protein product							Standard	NM_144674		Approved	FLJ32871, CT149	uc002czz.1	Q96M29	OTTHUMG00000129750	ENST00000283025.2:c.*13C>T	16.37:g.10721427G>A			A1L3Z3	RNA	SNP	-	NULL	ENST00000283025.2	37	NULL	CCDS10542.1	16																																																																																			TEKT5	-	-		0.527	TEKT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEKT5	HGNC	protein_coding	OTTHUMT00000251963.1	G	NM_144674		10721427	-1	no_errors	ENST00000574923	ensembl	human	known	70_37	rna	SNP	0.001	A
TG	7038	genome.wustl.edu	37	8	133885442	133885442	+	Missense_Mutation	SNP	T	T	C			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr8:133885442T>C	ENST00000220616.4	+	5	654	c.614T>C	c.(613-615)tTt>tCt	p.F205S	TG_ENST00000377869.1_Missense_Mutation_p.F205S	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	205	Thyroglobulin type-1 3. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		ATGATGATTTTTGATCTGGTC	0.562																																																	0													141.0	106.0	118.0					8																	133885442		2203	4300	6503	SO:0001583	missense	7038			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.614T>C	8.37:g.133885442T>C	ENSP00000220616:p.Phe205Ser		O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_CarbesteraseB,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	p.F205S	ENST00000220616.4	37	c.614	CCDS34944.1	8	.	.	.	.	.	.	.	.	.	.	T	24.1	4.492944	0.84962	.	.	ENSG00000042832	ENST00000377869;ENST00000220616;ENST00000535932	T;T	0.69040	-0.37;-0.36	5.7	5.7	0.88788	Thyroglobulin type-1 (2);	0.000000	0.64402	D	0.000003	T	0.78419	0.4280	L	0.60455	1.87	0.25975	N	0.982456	D	0.89917	1.0	D	0.69307	0.963	T	0.73275	-0.4034	10	0.87932	D	0	.	15.1511	0.72700	0.0:0.0:0.0:1.0	.	205	P01266	THYG_HUMAN	S	205	ENSP00000367100:F205S;ENSP00000220616:F205S	ENSP00000220616:F205S	F	+	2	0	TG	133954624	1.000000	0.71417	0.753000	0.31225	0.993000	0.82548	7.184000	0.77705	2.189000	0.69895	0.459000	0.35465	TTT	TG	-	superfamily_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1		0.562	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	HGNC	protein_coding	OTTHUMT00000379606.1	T	NM_003235		133885442	+1	no_errors	ENST00000220616	ensembl	human	known	70_37	missense	SNP	0.414	C
TMEM175	84286	genome.wustl.edu	37	4	947120	947120	+	Missense_Mutation	SNP	T	T	G			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr4:947120T>G	ENST00000264771.4	+	8	790	c.605T>G	c.(604-606)tTc>tGc	p.F202C	TMEM175_ENST00000515740.1_Missense_Mutation_p.F86C|TMEM175_ENST00000508204.1_Missense_Mutation_p.F120C|TMEM175_ENST00000504180.1_3'UTR	NM_032326.2	NP_115702.1	Q9BSA9	TM175_HUMAN	transmembrane protein 175	202						integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				NS(1)|endometrium(1)|large_intestine(2)|lung(6)|pancreas(1)|upper_aerodigestive_tract(3)	14			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GCGGCCATCTTCTCTCTCTTC	0.642																																																	0													125.0	110.0	115.0					4																	947120		2203	4300	6503	SO:0001583	missense	84286			BC005158	CCDS3341.1, CCDS75087.1, CCDS75088.1	4p16.3	2008-02-05			ENSG00000127419	ENSG00000127419			28709	protein-coding gene	gene with protein product						12477932	Standard	XM_005272301		Approved	MGC4618	uc003gbq.3	Q9BSA9	OTTHUMG00000118996	ENST00000264771.4:c.605T>G	4.37:g.947120T>G	ENSP00000264771:p.Phe202Cys		D3DVN4|Q8ND13	Missense_Mutation	SNP	pfam_DUF1211_TMEM175	p.F202C	ENST00000264771.4	37	c.605	CCDS3341.1	4	.	.	.	.	.	.	.	.	.	.	t	15.12	2.739846	0.49045	.	.	ENSG00000127419	ENST00000264771;ENST00000515492;ENST00000359768;ENST00000509508;ENST00000515740;ENST00000508204;ENST00000510493	T;T;T	0.51574	1.28;1.26;0.7	4.6	4.6	0.57074	.	0.000000	0.85682	D	0.000000	T	0.64125	0.2570	M	0.66939	2.045	0.54753	D	0.999982	D;D;D	0.89917	0.998;1.0;1.0	P;D;D	0.85130	0.804;0.997;0.963	T	0.66814	-0.5828	10	0.66056	D	0.02	-15.9538	10.3981	0.44214	0.0:0.0:0.0:1.0	.	120;202;120	D6RBE5;Q9BSA9;B3KR27	.;TM175_HUMAN;.	C	202;120;120;108;86;120;120	ENSP00000264771:F202C;ENSP00000427039:F86C;ENSP00000423669:F120C	ENSP00000264771:F202C	F	+	2	0	TMEM175	937120	1.000000	0.71417	0.955000	0.39395	0.059000	0.15707	2.929000	0.48916	1.705000	0.51264	0.468000	0.43344	TTC	TMEM175	-	NULL		0.642	TMEM175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM175	HGNC	protein_coding	OTTHUMT00000239193.2	T	NM_032326		947120	+1	no_errors	ENST00000264771	ensembl	human	known	70_37	missense	SNP	1.000	G
TRPM2	7226	genome.wustl.edu	37	21	45826479	45826479	+	Missense_Mutation	SNP	G	G	A	rs376205676		TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr21:45826479G>A	ENST00000397928.1	+	19	3238	c.2793G>A	c.(2791-2793)atG>atA	p.M931I	TRPM2_ENST00000498430.1_3'UTR|TRPM2_ENST00000300481.9_Missense_Mutation_p.M911I|TRPM2_ENST00000397932.2_Missense_Mutation_p.M931I|TRPM2_ENST00000300482.5_Missense_Mutation_p.M931I	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	931					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						TCCTGCAGATGAAGGACGTCT	0.632																																																	0													36.0	34.0	35.0					21																	45826479		2190	4284	6474	SO:0001583	missense	7226			AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.2793G>A	21.37:g.45826479G>A	ENSP00000381023:p.Met931Ile		D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	pfam_Ion_trans_dom,superfamily_NUDIX_hydrolase_dom-like	p.M931I	ENST00000397928.1	37	c.2793	CCDS13710.1	21	.	.	.	.	.	.	.	.	.	.	g	14.62	2.590007	0.46214	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932	T;T;T;T	0.71579	-0.58;-0.58;-0.58;-0.58	4.12	4.12	0.48240	Ion transport (1);	0.103719	0.64402	D	0.000005	T	0.66790	0.2825	L	0.43923	1.385	0.51767	D	0.999936	P;B;P	0.45768	0.866;0.117;0.783	B;B;B	0.42771	0.397;0.113;0.397	T	0.73260	-0.4039	10	0.62326	D	0.03	-28.1579	16.8189	0.85740	0.0:0.0:1.0:0.0	.	931;717;931	E9PGK7;Q5KTC1;O94759	.;.;TRPM2_HUMAN	I	931;931;911;931	ENSP00000300482:M931I;ENSP00000381023:M931I;ENSP00000300481:M911I;ENSP00000381026:M931I	ENSP00000300481:M911I	M	+	3	0	TRPM2	44650907	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	6.428000	0.73383	2.028000	0.59812	0.536000	0.68110	ATG	TRPM2	-	pfam_Ion_trans_dom		0.632	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM2	HGNC	protein_coding	OTTHUMT00000098086.1	G	NM_003307		45826479	+1	no_errors	ENST00000300482	ensembl	human	known	70_37	missense	SNP	1.000	A
TSHZ2	128553	genome.wustl.edu	37	20	51870650	51870650	+	Missense_Mutation	SNP	G	G	A			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr20:51870650G>A	ENST00000371497.5	+	2	1540	c.653G>A	c.(652-654)cGa>cAa	p.R218Q	RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_Missense_Mutation_p.R215Q|TSHZ2_ENST00000603338.2_Missense_Mutation_p.R215Q	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	218					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			TTCCGATGCCGACAGTGCAGC	0.557																																																	0													59.0	54.0	56.0					20																	51870650		2203	4300	6503	SO:0001583	missense	128553			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.653G>A	20.37:g.51870650G>A	ENSP00000360552:p.Arg218Gln		B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Znf_C2H2	p.R218Q	ENST00000371497.5	37	c.653	CCDS33490.1	20	.	.	.	.	.	.	.	.	.	.	G	19.76	3.888011	0.72524	.	.	ENSG00000182463	ENST00000371497;ENST00000329613	T;T	0.14640	2.5;2.49	5.2	5.2	0.72013	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.056478	0.64402	D	0.000002	T	0.22898	0.0553	L	0.29908	0.895	0.44685	D	0.997673	D	0.63880	0.993	P	0.56216	0.794	T	0.00775	-1.1571	10	0.56958	D	0.05	-11.3381	19.0899	0.93223	0.0:0.0:1.0:0.0	.	218	Q9NRE2	TSH2_HUMAN	Q	218;215	ENSP00000360552:R218Q;ENSP00000333114:R215Q	ENSP00000333114:R215Q	R	+	2	0	TSHZ2	51304057	1.000000	0.71417	0.602000	0.28890	0.403000	0.30841	7.145000	0.77365	2.579000	0.87056	0.643000	0.83706	CGA	TSHZ2	-	smart_Znf_C2H2-like		0.557	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ2	HGNC	protein_coding	OTTHUMT00000080398.6	G	NM_173485		51870650	+1	no_errors	ENST00000371497	ensembl	human	known	70_37	missense	SNP	0.998	A
TTF2	8458	genome.wustl.edu	37	1	117617918	117617918	+	Missense_Mutation	SNP	G	G	A			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr1:117617918G>A	ENST00000369466.4	+	5	756	c.712G>A	c.(712-714)Gag>Aag	p.E238K		NM_003594.3	NP_003585.3	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase II	238					ATP catabolic process (GO:0006200)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(24)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	50	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		ATCTTCTCAGGAGAAATCAAG	0.423																																																	0													149.0	162.0	157.0					1																	117617918		2203	4300	6503	SO:0001583	missense	8458			AF073771	CCDS892.1	1p13.1	2014-02-18			ENSG00000116830	ENSG00000116830			12398	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 6"""	604718				9748214	Standard	NM_003594		Approved	HuF2, ZGRF6	uc001egy.3	Q9UNY4	OTTHUMG00000012030	ENST00000369466.4:c.712G>A	1.37:g.117617918G>A	ENSP00000358478:p.Glu238Lys		A8K4Q2|O75921|Q5T2K7|Q5VVU8|Q8N6I8	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_Znf_GRF,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E238K	ENST00000369466.4	37	c.712	CCDS892.1	1	.	.	.	.	.	.	.	.	.	.	G	7.134	0.580403	0.13686	.	.	ENSG00000116830	ENST00000369466	D	0.87103	-2.21	5.87	0.74	0.18330	.	1.066300	0.07416	N	0.893160	T	0.61073	0.2318	L	0.47716	1.5	0.09310	N	1	B;B	0.20052	0.011;0.041	B;B	0.20955	0.003;0.032	T	0.51442	-0.8705	10	0.06625	T	0.88	-6.9518	5.4196	0.16394	0.2439:0.3042:0.4519:0.0	.	238;238	Q9UNY4;Q9UNY4-2	TTF2_HUMAN;.	K	238	ENSP00000358478:E238K	ENSP00000358478:E238K	E	+	1	0	TTF2	117419441	0.005000	0.15991	0.000000	0.03702	0.016000	0.09150	0.600000	0.24104	0.309000	0.22966	0.655000	0.94253	GAG	TTF2	-	NULL		0.423	TTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTF2	HGNC	protein_coding	OTTHUMT00000033277.3	G			117617918	+1	no_errors	ENST00000369466	ensembl	human	known	70_37	missense	SNP	0.000	A
TTN	7273	genome.wustl.edu	37	2	179463400	179463400	+	Intron	SNP	C	C	T	rs369216122	byFrequency	TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr2:179463400C>T	ENST00000591111.1	-	242	52264				TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000589042.1_Intron|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCCAGTATACGTTAGTATTC	0.438																																																	0								C	,,,	1,3663		0,1,1831	60.0	59.0	59.0		,,,	-3.2	0.0	2		59	0,8172		0,0,4086	no	intron,intron,intron,intron	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	,,,	0,1,5917	TT,TC,CC		0.0,0.0273,0.0084	,,,	,,,	179463400	1,11835	1832	4086	5918	SO:0001627	intron_variant	100506866			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.52040-19G>A	2.37:g.179463400C>T			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	RNA	SNP	-	NULL	ENST00000591111.1	37	NULL		2																																																																																			TTN-AS1	-	-		0.438	TTN-019	PUTATIVE	basic	protein_coding	TTN-AS1	HGNC	protein_coding	OTTHUMT00000460310.1	C	NM_133378		179463400	+1	no_errors	ENST00000419746	ensembl	human	known	70_37	rna	SNP	0.000	T
XKR4	114786	genome.wustl.edu	37	8	56436066	56436066	+	Silent	SNP	C	C	A			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr8:56436066C>A	ENST00000327381.6	+	3	1333	c.1233C>A	c.(1231-1233)atC>atA	p.I411I	RP11-628E19.2_ENST00000522918.1_RNA	NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	411						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			ACTGGTGCATCATGACCTTCT	0.488																																																	0													311.0	255.0	274.0					8																	56436066		2203	4300	6503	SO:0001819	synonymous_variant	114786			AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.1233C>A	8.37:g.56436066C>A			Q96PZ8	Silent	SNP	pfam_Transport_prot_XK	p.I411	ENST00000327381.6	37	c.1233	CCDS34893.1	8																																																																																			XKR4	-	pfam_Transport_prot_XK		0.488	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR4	HGNC	protein_coding	OTTHUMT00000378129.2	C	NM_052898		56436066	+1	no_errors	ENST00000327381	ensembl	human	known	70_37	silent	SNP	1.000	A
ZC3H11A	9877	genome.wustl.edu	37	1	203798606	203798606	+	Missense_Mutation	SNP	C	C	T			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr1:203798606C>T	ENST00000545588.1	+	5	4153	c.326C>T	c.(325-327)cCa>cTa	p.P109L	ZC3H11A_ENST00000332127.4_Missense_Mutation_p.P109L|ZC3H11A_ENST00000367210.1_Missense_Mutation_p.P109L|ZC3H11A_ENST00000367214.1_Missense_Mutation_p.P109L|ZC3H11A_ENST00000367212.3_Missense_Mutation_p.P109L	NM_001271675.1	NP_001258604.1	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A	109					poly(A)+ mRNA export from nucleus (GO:0016973)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			CCTGAGTCACCAGAAGAGGAA	0.448																																																	0													69.0	70.0	70.0					1																	203798606		2203	4300	6503	SO:0001583	missense	9877				CCDS30978.1	1q32.1	2012-07-05	2005-06-02	2005-06-02	ENSG00000058673	ENSG00000058673		"""Zinc fingers, CCCH-type domain containing"""	29093	protein-coding gene	gene with protein product		613513	"""zinc finger CCCH-type domain containing 11A"""	ZC3HDC11A		9734811	Standard	NM_014827		Approved	KIAA0663	uc001hac.3	O75152	OTTHUMG00000035909	ENST00000545588.1:c.326C>T	1.37:g.203798606C>T	ENSP00000438527:p.Pro109Leu		Q6AHY4|Q6AHY9|Q6AW79|Q6AWA1|Q6PJK4|Q86XZ7	Missense_Mutation	SNP	smart_Znf_CCCH	p.P109L	ENST00000545588.1	37	c.326	CCDS30978.1	1	.	.	.	.	.	.	.	.	.	.	C	17.01	3.279258	0.59758	.	.	ENSG00000058673	ENST00000453771;ENST00000367214;ENST00000537080;ENST00000367212;ENST00000332127;ENST00000545588;ENST00000367210	T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84	5.87	3.92	0.45320	.	0.771616	0.12481	N	0.465198	T	0.31231	0.0790	N	0.08118	0	0.41089	D	0.985582	P	0.40834	0.73	B	0.38842	0.283	T	0.14420	-1.0473	10	0.51188	T	0.08	-24.5351	14.3041	0.66373	0.2631:0.7369:0.0:0.0	.	109	O75152	ZC11A_HUMAN	L	109;109;55;109;109;109;109	ENSP00000356183:P109L;ENSP00000356181:P109L;ENSP00000333253:P109L;ENSP00000438527:P109L;ENSP00000356179:P109L	ENSP00000333253:P109L	P	+	2	0	ZC3H11A	202065229	0.369000	0.25039	0.998000	0.56505	0.998000	0.95712	0.562000	0.23531	0.854000	0.35336	0.655000	0.94253	CCA	ZC3H11A	-	NULL		0.448	ZC3H11A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H11A	HGNC	protein_coding	OTTHUMT00000087471.3	C	NM_014827		203798606	+1	no_errors	ENST00000332127	ensembl	human	known	70_37	missense	SNP	0.995	T
ZNF767P	79970	genome.wustl.edu	37	7	149318527	149318527	+	RNA	SNP	C	C	T			TCGA-JX-A3Q8-01A-11D-A21Q-09	TCGA-JX-A3Q8-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8492e084-f9e1-4bad-9143-ab05dca4dc2d	4fe4de09-aaf1-4b8b-8708-e41c19c23cac	g.chr7:149318527C>T	ENST00000463567.1	-	0	309					NR_027788.1		Q75MW2	ZN767_HUMAN												central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(1)	5	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00434)			GCTGTCTTCTCGCAATCAGCC	0.607																																																	0													81.0	76.0	78.0					7																	149318527		2203	4300	6503			79970																															7.37:g.149318527C>T			D3DWG6|Q86WY4|Q9H9J3	RNA	SNP	-	NULL	ENST00000463567.1	37	NULL		7																																																																																			ZNF767	-	-		0.607	ZNF767-001	KNOWN	basic	processed_transcript	ZNF767	HGNC	pseudogene	OTTHUMT00000352753.2	C			149318527	-1	no_errors	ENST00000463567	ensembl	human	known	70_37	rna	SNP	0.899	T
