#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
A1CF	29974	genome.wustl.edu	37	10	52601652	52601652	+	Missense_Mutation	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr10:52601652G>C	ENST00000373993.1	-	3	379	c.335C>G	c.(334-336)gCa>gGa	p.A112G	A1CF_ENST00000373997.3_Missense_Mutation_p.A112G|A1CF_ENST00000282641.2_Missense_Mutation_p.A112G|A1CF_ENST00000374001.2_Missense_Mutation_p.A112G|A1CF_ENST00000395489.2_Missense_Mutation_p.A105G|A1CF_ENST00000373995.3_Missense_Mutation_p.A120G|A1CF_ENST00000395495.1_Missense_Mutation_p.A112G			Q9NQ94	A1CF_HUMAN	APOBEC1 complementation factor	112	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cytidine to uridine editing (GO:0016554)|gene expression (GO:0010467)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|protein stabilization (GO:0050821)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			NS(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(14)|prostate(2)|skin(3)	29						TTGCTTGATTGCATTCTTGGC	0.313																																																	0													164.0	152.0	156.0					10																	52601652		2201	4299	6500	SO:0001583	missense	29974			AF271790	CCDS7241.1, CCDS7242.1, CCDS7243.1, CCDS73133.1	10q21.1	2013-02-12			ENSG00000148584	ENSG00000148584		"""RNA binding motif (RRM) containing"""	24086	protein-coding gene	gene with protein product						11815617, 11072063	Standard	NM_014576		Approved	ACF, ASP, ACF64, ACF65, APOBEC1CF	uc001jjj.3	Q9NQ94	OTTHUMG00000018240	ENST00000373993.1:c.335C>G	10.37:g.52601652G>C	ENSP00000363105:p.Ala112Gly		A1L4F2|A8K7G7|B7ZM14|Q5SZQ0|Q9NQ93|Q9NQX8|Q9NQX9|Q9NXC9|Q9NZD3	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	p.A112G	ENST00000373993.1	37	c.335	CCDS7242.1	10	.	.	.	.	.	.	.	.	.	.	G	28.8	4.949815	0.92660	.	.	ENSG00000148584	ENST00000374001;ENST00000373993;ENST00000373997;ENST00000373995;ENST00000282641;ENST00000395495;ENST00000395488;ENST00000395489;ENST00000414883	T;T;T;T;T;T;T;T	0.37915	1.17;1.17;1.17;1.17;1.17;1.17;1.17;1.17	5.76	5.76	0.90799	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.73969	0.3655	H	0.96748	3.875	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.992;0.996;0.996;0.992	T	0.82843	-0.0257	10	0.87932	D	0	-6.4962	17.4703	0.87645	0.0:0.0:1.0:0.0	.	105;112;112;120	F8W9F8;Q9NQ94;Q9NQ94-2;Q9NQ94-4	.;A1CF_HUMAN;.;.	G	112;112;112;120;112;112;95;105;112	ENSP00000363113:A112G;ENSP00000363105:A112G;ENSP00000363109:A112G;ENSP00000363107:A120G;ENSP00000282641:A112G;ENSP00000378873:A112G;ENSP00000378868:A105G;ENSP00000397953:A112G	ENSP00000282641:A112G	A	-	2	0	A1CF	52271658	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	9.767000	0.98960	2.733000	0.93635	0.467000	0.42956	GCA	A1CF	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac		0.313	A1CF-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	A1CF	HGNC	protein_coding	OTTHUMT00000048086.2	G	NM_014576		52601652	-1	no_errors	ENST00000282641	ensembl	human	known	70_37	missense	SNP	1.000	C
ACTC1	70	genome.wustl.edu	37	15	35086922	35086922	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr15:35086922G>A	ENST00000290378.4	-	2	743	c.88C>T	c.(88-90)Cgc>Tgc	p.R30C	ACTC1_ENST00000557860.1_5'Flank|RP11-814P5.1_ENST00000503496.1_RNA	NM_005159.4	NP_005150.1	P68032	ACTC_HUMAN	actin, alpha, cardiac muscle 1	30					actin filament-based movement (GO:0030048)|actin-myosin filament sliding (GO:0033275)|actomyosin structure organization (GO:0031032)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|heart contraction (GO:0060047)|muscle filament sliding (GO:0030049)|negative regulation of apoptotic process (GO:0043066)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|skeletal muscle thin filament assembly (GO:0030240)	actin filament (GO:0005884)|actomyosin, actin portion (GO:0042643)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|I band (GO:0031674)|membrane (GO:0016020)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|myosin binding (GO:0017022)			central_nervous_system(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	31		all_lung(180;2.3e-08)		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		AAGACAGCGCGGGGCGCGTCA	0.682																																																	0													35.0	39.0	38.0					15																	35086922		2198	4293	6491	SO:0001583	missense	70			BC009978	CCDS10041.1	15q14	2014-09-17	2006-08-24	2006-08-24	ENSG00000159251	ENSG00000159251			143	protein-coding gene	gene with protein product		102540	"""actin, alpha, cardiac muscle"""	ACTC		1639426	Standard	NM_005159		Approved	CMD1R	uc001ziu.1	P68032	OTTHUMG00000129675	ENST00000290378.4:c.88C>T	15.37:g.35086922G>A	ENSP00000290378:p.Arg30Cys		P04270	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.R30C	ENST00000290378.4	37	c.88	CCDS10041.1	15	.	.	.	.	.	.	.	.	.	.	G	16.60	3.169695	0.57584	.	.	ENSG00000159251	ENST00000290378;ENST00000544062	D	0.95137	-3.62	4.21	3.25	0.37280	.	0.000000	0.49916	U	0.000123	D	0.97573	0.9205	H	0.95645	3.7	0.80722	D	1	D	0.55385	0.971	D	0.63113	0.911	D	0.97677	1.0170	10	0.87932	D	0	.	11.6901	0.51510	0.0:0.0:0.5951:0.4049	.	30	P68032	ACTC_HUMAN	C	30	ENSP00000290378:R30C	ENSP00000290378:R30C	R	-	1	0	ACTC1	32874214	1.000000	0.71417	0.982000	0.44146	0.870000	0.49936	2.927000	0.48900	0.826000	0.34661	0.561000	0.74099	CGC	ACTC1	-	pfam_Actin-like,smart_Actin-like,prints_Actin-like		0.682	ACTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTC1	HGNC	protein_coding	OTTHUMT00000251876.3	G	NM_005159		35086922	-1	no_errors	ENST00000290378	ensembl	human	known	70_37	missense	SNP	0.997	A
ADAMTS5	11096	genome.wustl.edu	37	21	28338227	28338227	+	Missense_Mutation	SNP	G	G	A	rs551411133		TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr21:28338227G>A	ENST00000284987.5	-	1	605	c.484C>T	c.(484-486)Cgc>Tgc	p.R162C		NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	162					defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						AGGGTGTAGCGCGCGTGCTTG	0.647																																					Esophageal Squamous(53;683 1080 10100 14424 45938)												0													25.0	26.0	26.0					21																	28338227		2202	4295	6497	SO:0001583	missense	11096			AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.484C>T	21.37:g.28338227G>A	ENSP00000284987:p.Arg162Cys		Q52LV4|Q9UKP2	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Pept_M12B_ADAM-TS5,prints_Peptidase_M12B_ADAM-TS	p.R162C	ENST00000284987.5	37	c.484	CCDS13579.1	21	.	.	.	.	.	.	.	.	.	.	G	25.3	4.628930	0.87560	.	.	ENSG00000154736	ENST00000284987	T	0.06608	3.28	4.57	4.57	0.56435	Peptidase M12B, propeptide (1);	0.000000	0.85682	D	0.000000	T	0.11367	0.0277	N	0.08118	0	0.80722	D	1	D	0.89917	1.0	D	0.69824	0.966	T	0.44528	-0.9322	10	0.87932	D	0	.	17.5536	0.87884	0.0:0.0:1.0:0.0	.	162	Q9UNA0	ATS5_HUMAN	C	162	ENSP00000284987:R162C	ENSP00000284987:R162C	R	-	1	0	ADAMTS5	27260098	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	7.226000	0.78060	2.344000	0.79699	0.561000	0.74099	CGC	ADAMTS5	-	pfam_Peptidase_M12B_N,prints_Pept_M12B_ADAM-TS5		0.647	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS5	HGNC	protein_coding	OTTHUMT00000171648.1	G			28338227	-1	no_errors	ENST00000284987	ensembl	human	known	70_37	missense	SNP	1.000	A
ADCY1	107	genome.wustl.edu	37	7	45697411	45697411	+	Missense_Mutation	SNP	C	C	T	rs536487311		TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr7:45697411C>T	ENST00000297323.7	+	6	1256	c.1234C>T	c.(1234-1236)Cgc>Tgc	p.R412C	ADCY1_ENST00000432715.1_Missense_Mutation_p.R187C	NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	412					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CCTGGGCTTGCGCAAGTGGCA	0.612													C|||	1	0.000199681	0.0	0.0	5008	,	,		18206	0.0		0.0	False		,,,				2504	0.001																0													125.0	92.0	103.0					7																	45697411		2203	4300	6503	SO:0001583	missense	107			L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.1234C>T	7.37:g.45697411C>T	ENSP00000297323:p.Arg412Cys		A4D2L8|Q75MI1	Missense_Mutation	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.R412C	ENST00000297323.7	37	c.1234	CCDS34631.1	7	.	.	.	.	.	.	.	.	.	.	C	20.6	4.023242	0.75275	.	.	ENSG00000164742	ENST00000432715;ENST00000297323;ENST00000545300	D;D	0.82433	-1.61;-1.61	4.44	4.44	0.53790	Adenylyl cyclase class-3/4/guanylyl cyclase, conserved site (1);Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	D	0.87450	0.6180	M	0.79693	2.465	0.80722	D	1	D;D	0.62365	0.991;0.99	P;P	0.51895	0.48;0.683	D	0.88579	0.3135	10	0.49607	T	0.09	.	14.9371	0.70964	0.0:1.0:0.0:0.0	.	412;187	Q08828;C9J1J0	ADCY1_HUMAN;.	C	187;412;412	ENSP00000392721:R187C;ENSP00000297323:R412C	ENSP00000297323:R412C	R	+	1	0	ADCY1	45663936	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.352000	0.59404	2.446000	0.82766	0.655000	0.94253	CGC	ADCY1	-	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase		0.612	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY1	HGNC	protein_coding	OTTHUMT00000340055.2	C	NM_021116		45697411	+1	no_errors	ENST00000297323	ensembl	human	known	70_37	missense	SNP	1.000	T
ADCY10	55811	genome.wustl.edu	37	1	167778974	167778974	+	Missense_Mutation	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:167778974G>C	ENST00000367851.4	-	33	4958	c.4774C>G	c.(4774-4776)Cag>Gag	p.Q1592E	ADCY10_ENST00000367848.1_Missense_Mutation_p.Q1500E|ADCY10_ENST00000545172.1_Missense_Mutation_p.Q1439E	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	1592					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						TGAAGATCCTGAATGTTTACC	0.373																																																	0													145.0	137.0	140.0					1																	167778974		2203	4300	6503	SO:0001583	missense	55811			AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.4774C>G	1.37:g.167778974G>C	ENSP00000356825:p.Gln1592Glu		B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Missense_Mutation	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,pirsf_Adenylate_cylcase_typ10,pfscan_A/G_cyclase	p.Q1592E	ENST00000367851.4	37	c.4774	CCDS1265.1	1	.	.	.	.	.	.	.	.	.	.	G	12.88	2.071806	0.36566	.	.	ENSG00000143199	ENST00000545172;ENST00000367851;ENST00000367848	T;T;T	0.29655	1.56;1.56;1.56	5.44	-0.364	0.12553	.	1.288270	0.05253	N	0.514351	T	0.10423	0.0255	L	0.57536	1.79	0.23336	N	0.99789	B;B	0.15141	0.012;0.007	B;B	0.16289	0.015;0.006	T	0.29912	-0.9996	9	0.33940	T	0.23	-0.6107	2.4744	0.04572	0.0918:0.2812:0.3082:0.3188	.	1500;1592	Q96PN6-2;Q96PN6	.;ADCYA_HUMAN	E	1439;1592;1500	ENSP00000441992:Q1439E;ENSP00000356825:Q1592E;ENSP00000356822:Q1500E	ENSP00000356822:Q1500E	Q	-	1	0	ADCY10	166045598	0.009000	0.17119	0.001000	0.08648	0.271000	0.26615	0.227000	0.17795	0.224000	0.20940	0.591000	0.81541	CAG	ADCY10	-	pirsf_Adenylate_cylcase_typ10		0.373	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY10	HGNC	protein_coding	OTTHUMT00000083663.1	G	NM_018417		167778974	-1	no_errors	ENST00000367851	ensembl	human	known	70_37	missense	SNP	0.000	C
AKIP1	56672	genome.wustl.edu	37	11	8934001	8934001	+	Splice_Site	SNP	G	G	C	rs537025239		TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr11:8934001G>C	ENST00000309377.4	+	3	314	c.224G>C	c.(223-225)aGa>aCa	p.R75T	AKIP1_ENST00000396648.2_Intron|AKIP1_ENST00000525005.1_Splice_Site_p.R75T|AKIP1_ENST00000534147.1_Splice_Site_p.R75T|AKIP1_ENST00000529876.1_Intron|ST5_ENST00000534127.1_5'Flank|AKIP1_ENST00000534506.1_Intron|AKIP1_ENST00000309357.4_Splice_Site_p.R75T|AKIP1_ENST00000299576.5_Intron	NM_020642.3	NP_065693.2	Q9NQ31	AKIP1_HUMAN	A kinase (PRKA) interacting protein 1	75					substrate adhesion-dependent cell spreading (GO:0034446)	nucleus (GO:0005634)				kidney(1)|large_intestine(2)|lung(2)	5						TTCAAATAGAGAGAAGAGAGA	0.423																																																	0													115.0	103.0	107.0					11																	8934001		2201	4296	6497	SO:0001630	splice_region_variant	56672			AF512007	CCDS7793.1, CCDS55743.1, CCDS55744.1	11p15.3	2011-04-18	2011-04-18	2011-04-18	ENSG00000166452	ENSG00000166452			1170	protein-coding gene	gene with protein product		609191	"""chromosome 11 open reading frame 17"""	C11orf17		20562110, 18178962, 15630084	Standard	NM_020642		Approved	BCA3	uc001mgx.3	Q9NQ31	OTTHUMG00000165653	ENST00000309377.4:c.223-1G>C	11.37:g.8934001G>C			Q8NBS2|Q8TAC6|Q8TAD3|Q8TAE0	Missense_Mutation	SNP	NULL	p.R75T	ENST00000309377.4	37	c.224	CCDS7793.1	11	.	.	.	.	.	.	.	.	.	.	G	15.01	2.706169	0.48412	.	.	ENSG00000166452	ENST00000309377;ENST00000309357;ENST00000525005;ENST00000524577;ENST00000534147	T;T;T;T;T	0.38077	1.21;1.3;1.16;1.19;1.21	4.92	4.01	0.46588	.	0.210963	0.39615	N	0.001320	T	0.51295	0.1666	M	0.72479	2.2	0.32814	D	0.501857	D;P;D	0.76494	0.999;0.745;0.989	P;B;P	0.62298	0.9;0.354;0.836	T	0.62604	-0.6819	10	0.39692	T	0.17	-5.1761	9.1922	0.37207	0.0984:0.0:0.9016:0.0	.	75;75;75	B4DGE2;Q9NQ31-2;Q9NQ31	.;.;AKIP1_HUMAN	T	75	ENSP00000310459:R75T;ENSP00000310644:R75T;ENSP00000433510:R75T;ENSP00000434785:R75T;ENSP00000431331:R75T	ENSP00000310644:R75T	R	+	2	0	AKIP1	8890577	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.648000	0.37271	1.434000	0.47414	0.563000	0.77884	AGA	AKIP1	-	NULL		0.423	AKIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AKIP1	HGNC	protein_coding	OTTHUMT00000385615.1	G	NM_020642	Missense_Mutation	8934001	+1	no_errors	ENST00000309377	ensembl	human	known	70_37	missense	SNP	1.000	C
ALOX12P2	245	genome.wustl.edu	37	17	6797690	6797690	+	RNA	SNP	G	G	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr17:6797690G>T	ENST00000574727.1	+	0	549									arachidonate 12-lipoxygenase pseudogene 2											endometrium(1)	1						TCCTGATGGTGAAGCTGCGCA	0.607																																																	0																																												245			AF020774		17p13.1	2014-03-18			ENSG00000262943	ENSG00000262943			432	pseudogene	pseudogene						9691181	Standard	NR_002710		Approved		uc002gdv.3		OTTHUMG00000177324		17.37:g.6797690G>T				RNA	SNP	-	NULL	ENST00000574727.1	37	NULL		17																																																																																			ALOX12P2	-	-		0.607	ALOX12P2-003	KNOWN	basic	processed_transcript	ALOX12P2	HGNC	pseudogene	OTTHUMT00000436284.1	G			6797690	+1	no_errors	ENST00000570835	ensembl	human	known	70_37	rna	SNP	1.000	T
ANKRD13D	338692	genome.wustl.edu	37	11	67059210	67059210	+	Missense_Mutation	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr11:67059210G>C	ENST00000447274.2	+	5	1448	c.273G>C	c.(271-273)aaG>aaC	p.K91N	ANKRD13D_ENST00000511455.2_Missense_Mutation_p.K178N|ANKRD13D_ENST00000514166.1_Missense_Mutation_p.K91N|ANKRD13D_ENST00000308440.6_Missense_Mutation_p.K91N			Q6ZTN6	AN13D_HUMAN	ankyrin repeat domain 13 family, member D	91						endosome (GO:0005768)|plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			TCATCTTCAAGGGCCAGGGTG	0.612																																																	0													55.0	51.0	52.0					11																	67059210		2200	4295	6495	SO:0001583	missense	338692			AK027313	CCDS31616.1, CCDS31616.2	11q13.2	2013-01-11		2005-08-09	ENSG00000172932	ENSG00000172932		"""Ankyrin repeat domain containing"""	27880	protein-coding gene	gene with protein product		615126					Standard	NM_207354		Approved		uc001okd.2	Q6ZTN6	OTTHUMG00000162929	ENST00000447274.2:c.273G>C	11.37:g.67059210G>C	ENSP00000402616:p.Lys91Asn		D6RCN6|Q0VAK0|Q0VGC3|Q6ZVD0|Q86SU1	Missense_Mutation	SNP	pfam_ANKRD13,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ubiquitin-int_motif,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Ubiquitin-int_motif	p.K178N	ENST00000447274.2	37	c.534		11	.	.	.	.	.	.	.	.	.	.	G	17.67	3.446909	0.63178	.	.	ENSG00000172932	ENST00000447274;ENST00000511455;ENST00000308440;ENST00000514166	T;T;T;T	0.48522	0.81;0.81;0.81;0.81	3.75	3.75	0.43078	.	0.234051	0.33092	N	0.005284	T	0.50939	0.1645	L	0.41124	1.26	0.51012	D	0.999905	D;B	0.55385	0.971;0.389	P;B	0.61658	0.892;0.16	T	0.38735	-0.9647	10	0.25751	T	0.34	-21.5801	9.3779	0.38295	0.106:0.0:0.894:0.0	.	178;91	Q6ZTN6-3;Q6ZTN6	.;AN13D_HUMAN	N	91;178;91;91	ENSP00000402616:K91N;ENSP00000427130:K178N;ENSP00000310874:K91N;ENSP00000444404:K91N	ENSP00000310874:K91N	K	+	3	2	ANKRD13D	66815786	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.840000	0.39230	2.118000	0.64928	0.561000	0.74099	AAG	ANKRD13D	-	pfam_ANKRD13		0.612	ANKRD13D-001	KNOWN	basic	protein_coding	ANKRD13D	HGNC	protein_coding	OTTHUMT00000371067.2	G	NM_207354		67059210	+1	no_errors	ENST00000511455	ensembl	human	known	70_37	missense	SNP	1.000	C
APOBEC3B	9582	genome.wustl.edu	37	22	39385582	39385582	+	Silent	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr22:39385582G>C	ENST00000333467.3	+	5	735	c.690G>C	c.(688-690)ctG>ctC	p.L230L	APOBEC3B_ENST00000402182.3_Silent_p.L230L|APOBEC3B-AS1_ENST00000513758.2_RNA|APOBEC3B_ENST00000407298.3_Silent_p.L230L	NM_001270411.1|NM_004900.4	NP_001257340.1|NP_004891	Q9UH17	ABC3B_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B	230					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|negative regulation of transposition (GO:0010529)	nucleus (GO:0005634)	deoxycytidine deaminase activity (GO:0047844)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	13	Melanoma(58;0.04)					CCTGGGTCCTGATGGACCAGC	0.552																																																	0													68.0	58.0	62.0					22																	39385582		2198	4279	6477	SO:0001819	synonymous_variant	9582			AK024854	CCDS13982.1, CCDS58807.1	22q13.1-q13.2	2008-05-15			ENSG00000179750	ENSG00000179750		"""Apolipoprotein B mRNA editing enzymes"""	17352	protein-coding gene	gene with protein product	"""phorbolin 3"""	607110				11863358, 10469298	Standard	NM_004900		Approved	PHRBNL, FLJ21201	uc003awo.2	Q9UH17	OTTHUMG00000151085	ENST00000333467.3:c.690G>C	22.37:g.39385582G>C			B0QYD2|O95618|Q20WL1|Q5IFJ4|Q7Z2N3|Q7Z6D6|Q9UE74	Silent	SNP	pfam_APOBEC_N,pfam_APOBEC_C,superfamily_Cytidine_deaminase-like	p.L230	ENST00000333467.3	37	c.690	CCDS13982.1	22																																																																																			APOBEC3B	-	pfam_APOBEC_N		0.552	APOBEC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOBEC3B	HGNC	protein_coding	OTTHUMT00000321233.1	G	NM_004900		39385582	+1	no_errors	ENST00000333467	ensembl	human	known	70_37	silent	SNP	0.000	C
ARHGAP11A	9824	genome.wustl.edu	37	15	32928987	32928987	+	Missense_Mutation	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr15:32928987G>C	ENST00000361627.3	+	12	2735	c.2013G>C	c.(2011-2013)gaG>gaC	p.E671D	ARHGAP11A_ENST00000565905.1_Missense_Mutation_p.E482D|ARHGAP11A_ENST00000543522.1_Missense_Mutation_p.E482D	NM_014783.3	NP_055598.1	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A	671					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		GTTTTTCAGAGAGGGACTTTT	0.323																																					Colon(45;757 1134 30003 36652)												0													23.0	25.0	24.0					15																	32928987		2160	4271	6431	SO:0001583	missense	9824			D87717	CCDS10028.1, CCDS58349.1, CCDS66730.1	15q13.3	2006-09-19			ENSG00000198826	ENSG00000198826		"""Rho GTPase activating proteins"""	15783	protein-coding gene	gene with protein product	"""GAP (1-12)"""	610589				11829490	Standard	NM_199357		Approved	KIAA0013	uc001zgy.1	Q6P4F7	OTTHUMG00000129289	ENST00000361627.3:c.2013G>C	15.37:g.32928987G>C	ENSP00000355090:p.Glu671Asp		B4DZN9|Q6PI96|Q9Y3S6	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.E671D	ENST00000361627.3	37	c.2013	CCDS10028.1	15	.	.	.	.	.	.	.	.	.	.	.	2.923	-0.222745	0.06061	.	.	ENSG00000198826	ENST00000361627;ENST00000543522	T	0.10382	2.88	4.91	1.08	0.20341	.	0.098647	0.44483	D	0.000444	T	0.09686	0.0238	M	0.65498	2.005	0.09310	N	0.999995	P	0.43094	0.799	B	0.35931	0.214	T	0.21449	-1.0245	10	0.72032	D	0.01	.	4.992	0.14218	0.4866:0.0:0.3732:0.1403	.	671	Q6P4F7	RHGBA_HUMAN	D	671;482	ENSP00000355090:E671D	ENSP00000355090:E671D	E	+	3	2	ARHGAP11A	30716279	0.082000	0.21442	0.304000	0.25085	0.042000	0.13812	0.339000	0.19875	0.318000	0.23185	-0.312000	0.09012	GAG	ARHGAP11A	-	NULL		0.323	ARHGAP11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP11A	HGNC	protein_coding	OTTHUMT00000251417.1	G	NM_014783		32928987	+1	no_errors	ENST00000361627	ensembl	human	known	70_37	missense	SNP	0.161	C
ARMC9	80210	genome.wustl.edu	37	2	232100031	232100031	+	Silent	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr2:232100031C>T	ENST00000349938.4	+	8	911	c.717C>T	c.(715-717)caC>caT	p.H239H	ARMC9_ENST00000483477.1_3'UTR	NM_001271466.1|NM_025139.4	NP_001258395.1|NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9	239						extracellular vesicular exosome (GO:0070062)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		CCGACTACCACAATCTCATTG	0.493																																																	0													96.0	91.0	93.0					2																	232100031		2203	4300	6503	SO:0001819	synonymous_variant	80210			BC004514	CCDS2484.1, CCDS74666.1	2q37.1	2013-02-14			ENSG00000135931	ENSG00000135931		"""Armadillo repeat containing"""	20730	protein-coding gene	gene with protein product						11347906	Standard	NM_025139		Approved	FLJ12584, KIAA1868, ARM, KU-MEL-1	uc031rrs.1	Q7Z3E5	OTTHUMG00000133229	ENST00000349938.4:c.717C>T	2.37:g.232100031C>T			Q53TI3|Q6P162|Q7L594|Q86WG2|Q96JF9|Q9H9R8	Silent	SNP	superfamily_ARM-type_fold,smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.H239	ENST00000349938.4	37	c.717	CCDS2484.1	2																																																																																			ARMC9	-	NULL		0.493	ARMC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC9	HGNC	protein_coding	OTTHUMT00000256966.3	C	NM_025139		232100031	+1	no_errors	ENST00000349938	ensembl	human	known	70_37	silent	SNP	1.000	T
ASTN1	460	genome.wustl.edu	37	1	176934347	176934347	+	Missense_Mutation	SNP	C	C	T	rs370485432		TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:176934347C>T	ENST00000367654.3	-	9	1785	c.1574G>A	c.(1573-1575)cGa>cAa	p.R525Q	ASTN1_ENST00000424564.2_Missense_Mutation_p.R517Q|ASTN1_ENST00000367657.3_Missense_Mutation_p.R517Q|ASTN1_ENST00000361833.2_Missense_Mutation_p.R517Q|ASTN1_ENST00000281881.3_5'UTR	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	525					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						GTCAAAGCCTCGCTGAAATAT	0.418																																																	0								C	GLN/ARG,GLN/ARG	0,4406		0,0,2203	126.0	128.0	128.0		1550,1550	5.1	1.0	1		128	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	ASTN1	NM_004319.1,NM_207108.1	43,43	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging,possibly-damaging	517/1295,517/1217	176934347	2,13004	2203	4300	6503	SO:0001583	missense	460			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.1574G>A	1.37:g.176934347C>T	ENSP00000356626:p.Arg525Gln		A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_EG-like_dom,smart_MACPF,pfscan_Fibronectin_type3	p.R525Q	ENST00000367654.3	37	c.1574		1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.810675	0.90707	0.0	2.33E-4	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;D;T	0.87256	2.22;2.63;-2.23;2.22	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.79604	0.4474	L	0.27053	0.805	0.53688	D	0.99997	P;P;P	0.46327	0.876;0.876;0.876	B;B;B	0.34652	0.187;0.187;0.132	D	0.84012	0.0349	10	0.87932	D	0	-12.5265	18.4965	0.90866	0.0:1.0:0.0:0.0	.	525;517;517	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	Q	517;517;525;517;517	ENSP00000356629:R517Q;ENSP00000354536:R517Q;ENSP00000356626:R525Q;ENSP00000395041:R517Q	ENSP00000354536:R517Q	R	-	2	0	ASTN1	175200970	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.299000	0.65716	2.517000	0.84864	0.555000	0.69702	CGA	ASTN1	-	NULL		0.418	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	HGNC	protein_coding		C	NM_004319		176934347	-1	no_errors	ENST00000367654	ensembl	human	known	70_37	missense	SNP	1.000	T
ASUN	55726	genome.wustl.edu	37	12	27068991	27068991	+	Missense_Mutation	SNP	C	C	G			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr12:27068991C>G	ENST00000261191.7	-	11	1728	c.1192G>C	c.(1192-1194)Gat>Cat	p.D398H	ASUN_ENST00000539625.1_Missense_Mutation_p.D297H	NM_018164.2	NP_060634.2	Q9NVM9	ASUN_HUMAN	asunder spermatogenesis regulator	398					centrosome localization (GO:0051642)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|protein localization to nuclear envelope (GO:0090435)|regulation of fertilization (GO:0080154)|regulation of mitotic cell cycle (GO:0007346)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|nucleus (GO:0005634)											GAAGGTGGATCTTCTAGAATG	0.378																																																	0													84.0	78.0	80.0					12																	27068991		2203	4300	6503	SO:0001583	missense	55726			AK001222	CCDS8708.1	12p12.3	2013-05-08	2013-05-08	2011-12-09	ENSG00000064102	ENSG00000064102			20174	protein-coding gene	gene with protein product	"""spermatogenesis associated 30"""	615079	"""chromosome 12 open reading frame 11"", ""asunder, spermatogenesis regulator homolog (Drosphila)"""	C12orf11		12414650, 19357193, 23097494	Standard	NM_018164		Approved	FLJ10637, NET48, Mat89Bb, SPATA30	uc001rhk.4	Q9NVM9	OTTHUMG00000169193	ENST00000261191.7:c.1192G>C	12.37:g.27068991C>G	ENSP00000261191:p.Asp398His		B4DNK1|Q86WE2|Q96HM2|Q9BTX2|Q9NTB6|Q9NVM5	Missense_Mutation	SNP	pfam_Cell_cycle_regulator_Mat89Bb	p.D398H	ENST00000261191.7	37	c.1192	CCDS8708.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.1|29.1	4.976271|4.976271	0.92982|0.92982	.|.	.|.	ENSG00000064102|ENSG00000064102	ENST00000538155;ENST00000261191;ENST00000539625;ENST00000335745|ENST00000542392	T;T;T|.	0.50001|.	0.76;0.76;0.76|.	5.85|5.85	5.85|5.85	0.93711|0.93711	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78052|0.78052	0.4223|0.4223	M|M	0.73962|0.73962	2.25|2.25	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.999;0.997|.	T|T	0.75150|0.75150	-0.3419|-0.3419	10|5	0.87932|.	D|.	0|.	-30.309|-30.309	20.5471|20.5471	0.99284|0.99284	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	398;297|.	Q9NVM9;B4DNK1|.	M89BB_HUMAN;.|.	H|T	102;398;297;42|111	ENSP00000445645:D102H;ENSP00000261191:D398H;ENSP00000443724:D297H|.	ENSP00000261191:D398H|.	D|R	-|-	1|2	0|0	C12orf11|C12orf11	26960258|26960258	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.758000|7.758000	0.85224|0.85224	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GAT|AGA	ASUN	-	pfam_Cell_cycle_regulator_Mat89Bb		0.378	ASUN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASUN	HGNC	protein_coding	OTTHUMT00000402819.1	C	NM_018164		27068991	-1	no_errors	ENST00000261191	ensembl	human	known	70_37	missense	SNP	1.000	G
BAI3	577	genome.wustl.edu	37	6	70070940	70070940	+	Missense_Mutation	SNP	C	C	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr6:70070940C>A	ENST00000370598.1	+	29	4596	c.3775C>A	c.(3775-3777)Ccc>Acc	p.P1259T	BAI3_ENST00000546190.1_Missense_Mutation_p.P223T|BAI3_ENST00000238918.8_Missense_Mutation_p.P465T	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1259					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				TTTGCACATGCCCATGAGTAT	0.413																																																	0													91.0	82.0	85.0					6																	70070940		2203	4299	6502	SO:0001583	missense	577			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.3775C>A	6.37:g.70070940C>A	ENSP00000359630:p.Pro1259Thr		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.P1259T	ENST00000370598.1	37	c.3775	CCDS4968.1	6	.	.	.	.	.	.	.	.	.	.	C	16.15	3.041888	0.55003	.	.	ENSG00000135298	ENST00000370598;ENST00000238918;ENST00000546190	T;T;T	0.43294	2.11;2.72;0.95	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.29223	0.0727	L	0.40543	1.245	0.58432	D	0.999996	P;B	0.37061	0.58;0.3	B;B	0.37601	0.254;0.098	T	0.09662	-1.0664	10	0.49607	T	0.09	.	19.9199	0.97084	0.0:1.0:0.0:0.0	.	465;1259	B7Z356;O60242	.;BAI3_HUMAN	T	1259;465;223	ENSP00000359630:P1259T;ENSP00000238918:P465T;ENSP00000441821:P223T	ENSP00000238918:P465T	P	+	1	0	BAI3	70127661	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	4.595000	0.61048	2.781000	0.95711	0.591000	0.81541	CCC	BAI3	-	NULL		0.413	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1	C			70070940	+1	no_errors	ENST00000370598	ensembl	human	known	70_37	missense	SNP	1.000	A
BTK	695	genome.wustl.edu	37	X	100608249	100608249	+	Missense_Mutation	SNP	A	A	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chrX:100608249A>T	ENST00000308731.7	-	18	2004	c.1841T>A	c.(1840-1842)cTa>cAa	p.L614Q	BTK_ENST00000372880.1_Missense_Mutation_p.L438Q	NM_000061.2	NP_000052.1	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	614	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adaptive immune response (GO:0002250)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|Fc-epsilon receptor signaling pathway (GO:0038095)|histamine secretion by mast cell (GO:0002553)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell cytokine production (GO:0002721)|response to organic substance (GO:0010033)|response to reactive oxygen species (GO:0000302)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein tyrosine kinase activity (GO:0004713)			breast(4)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(25)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						GTAGAGACGTAGGCCTTGGGC	0.433									Agammaglobulinemia, X-linked																																								0													233.0	209.0	217.0					X																	100608249		2203	4300	6503	SO:0001583	missense	695	Familial Cancer Database	Bruton Type Agammaglobulinemia	AK057105	CCDS14482.1, CCDS76002.1, CCDS76003.1	Xq21.33-q22	2014-09-17			ENSG00000010671	ENSG00000010671	2.7.10.1	"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1133	protein-coding gene	gene with protein product		300300		AGMX1, IMD1		8380905	Standard	NM_000061		Approved	ATK, XLA, PSCTK1	uc004ehg.2	Q06187	OTTHUMG00000022022	ENST00000308731.7:c.1841T>A	X.37:g.100608249A>T	ENSP00000308176:p.Leu614Gln		B2RAW1|Q32ML5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_Znf_Btk_motif,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,prints_SH2,prints_Znf_Btk_motif	p.L614Q	ENST00000308731.7	37	c.1841	CCDS14482.1	X	.	.	.	.	.	.	.	.	.	.	A	14.28	2.489227	0.44249	.	.	ENSG00000010671	ENST00000372880;ENST00000372855;ENST00000372859;ENST00000372860;ENST00000308731	D;D	0.82167	-1.58;-1.58	5.23	5.23	0.72850	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.329046	0.29486	N	0.012011	T	0.71039	0.3293	N	0.11284	0.12	0.36347	D	0.859862	B;B;B;B	0.27765	0.047;0.032;0.181;0.188	B;B;B;B	0.33042	0.023;0.019;0.157;0.029	T	0.72984	-0.4125	10	0.30854	T	0.27	.	14.0357	0.64642	1.0:0.0:0.0:0.0	.	438;285;189;614	Q5JY90;Q3MS96;Q572P5;Q06187	.;.;.;BTK_HUMAN	Q	438;163;94;189;614	ENSP00000361971:L438Q;ENSP00000308176:L614Q	ENSP00000308176:L614Q	L	-	2	0	BTK	100494905	0.977000	0.34250	0.996000	0.52242	0.830000	0.47004	2.580000	0.46068	1.840000	0.53500	0.486000	0.48141	CTA	BTK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.433	BTK-006	KNOWN	basic|appris_principal|CCDS	protein_coding	BTK	HGNC	protein_coding	OTTHUMT00000057532.2	A	NM_000061		100608249	-1	no_errors	ENST00000308731	ensembl	human	known	70_37	missense	SNP	0.842	T
C10orf10	11067	genome.wustl.edu	37	10	45473403	45473403	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr10:45473403C>T	ENST00000298295.3	-	2	293	c.76G>A	c.(76-78)Ggt>Agt	p.G26S	RASSF4_ENST00000374417.2_Intron|RASSF4_ENST00000472561.1_Intron|RASSF4_ENST00000340258.5_Intron|RASSF4_ENST00000334940.6_Intron|C10orf10_ENST00000496638.1_Intron	NM_007021.3	NP_008952.1	Q9NTK1	DEPP_HUMAN	chromosome 10 open reading frame 10	26						mitochondrion (GO:0005739)				lung(1)	1						TGTCCAGGACCCCCAAGCAGC	0.627																																																	0													47.0	51.0	50.0					10																	45473403		2202	4295	6497	SO:0001583	missense	11067			AB022718	CCDS7210.1	10q11.21	2014-07-31			ENSG00000165507	ENSG00000165507			23355	protein-coding gene	gene with protein product	"""decidual protein induced by progesterone"", ""fasting induced"", ""fat-specific expressed gene"""	611309				24530860, 19937567, 16123073	Standard	NM_007021		Approved	DEPP, FIG, Fseg	uc001jbr.4	Q9NTK1	OTTHUMG00000018063	ENST00000298295.3:c.76G>A	10.37:g.45473403C>T	ENSP00000298295:p.Gly26Ser		B2R6A1|O94997|Q5T735|Q76MX8	Missense_Mutation	SNP	NULL	p.G26S	ENST00000298295.3	37	c.76	CCDS7210.1	10	.	.	.	.	.	.	.	.	.	.	C	8.935	0.964408	0.18583	.	.	ENSG00000165507	ENST00000298295;ENST00000432283;ENST00000448778	T;T	0.42131	0.98;0.98	5.39	2.24	0.28232	.	0.548954	0.15700	N	0.248988	T	0.27731	0.0682	N	0.17082	0.46	0.09310	N	1	P	0.40431	0.717	P	0.44990	0.466	T	0.06373	-1.0830	10	0.45353	T	0.12	-10.3363	3.759	0.08596	0.1693:0.5754:0.164:0.0913	.	26	Q9NTK1	DEPP_HUMAN	S	26	ENSP00000298295:G26S;ENSP00000414494:G26S	ENSP00000298295:G26S	G	-	1	0	C10orf10	44793409	0.000000	0.05858	0.002000	0.10522	0.266000	0.26442	0.035000	0.13797	1.249000	0.43950	0.561000	0.74099	GGT	C10orf10	-	NULL		0.627	C10orf10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf10	HGNC	protein_coding	OTTHUMT00000047758.1	C	NM_007021		45473403	-1	no_errors	ENST00000298295	ensembl	human	known	70_37	missense	SNP	0.000	T
C20orf62	140834	genome.wustl.edu	37	20	43090637	43090637	+	Missense_Mutation	SNP	C	C	T	rs569712213	byFrequency	TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr20:43090637C>T	ENST00000372910.3	-	2	465	c.401G>A	c.(400-402)cGc>cAc	p.R134H	C20orf62_ENST00000306731.4_Intron			Q4KN68	CT062_HUMAN	chromosome 20 open reading frame 62	134										lung(1)	1						ctgattcaggcgctgggctct	0.532													C|||	3	0.000599042	0.0	0.0	5008	,	,		18007	0.003		0.0	False		,,,				2504	0.0																0																																										SO:0001583	missense	140834				CCDS74729.1	20q13.12	2014-08-13			ENSG00000168746	ENSG00000168746			16195	protein-coding gene	gene with protein product							Standard	NM_001287807		Approved	dJ1013A22.3	uc002xmb.3	Q4KN68	OTTHUMG00000130221	ENST00000372910.3:c.401G>A	20.37:g.43090637C>T	ENSP00000362001:p.Arg134His		A2A2S9|Q5QPC4	Missense_Mutation	SNP	NULL	p.R134H	ENST00000372910.3	37	c.401		20	.	.	.	.	.	.	.	.	.	.	C	9.927	1.213751	0.22289	.	.	ENSG00000168746	ENST00000372910	D	0.89123	-2.47	2.9	-2.63	0.06133	.	.	.	.	.	T	0.81564	0.4849	.	.	.	.	.	.	B	0.09022	0.002	B	0.04013	0.001	T	0.69584	-0.5106	7	0.87932	D	0	.	7.5396	0.27731	0.0:0.3624:0.0:0.6376	.	134	Q4KN68	CT062_HUMAN	H	134	ENSP00000362001:R134H	ENSP00000362001:R134H	R	-	2	0	C20orf62	42524051	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.819000	0.04462	-0.623000	0.05618	-0.291000	0.09656	CGC	C20orf62	-	NULL		0.532	C20orf62-002	PUTATIVE	basic|appris_candidate_longest	protein_coding	C20orf62	HGNC	protein_coding	OTTHUMT00000252541.1	C			43090637	-1	no_errors	ENST00000372910	ensembl	human	putative	70_37	missense	SNP	0.000	T
C21orf62	56245	genome.wustl.edu	37	21	34160945	34160945	+	IGR	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr21:34160945C>T	ENST00000536776.1	-	0	3889				C21orf49_ENST00000453404.1_Intron|C21orf49_ENST00000382378.1_Missense_Mutation_p.S22L|C21orf49_ENST00000382377.3_Intron|C21orf49_ENST00000382375.4_Missense_Mutation_p.S22L|C21orf49_ENST00000477513.1_Intron	NM_001162495.2|NM_001162496.2|NM_019596.5	NP_001155967.2|NP_001155968.2|NP_062542.5	Q9NYP8	CU062_HUMAN	chromosome 21 open reading frame 62											endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	6		Myeloproliferative disorder(46;0.0255)				ACAACCTCATCATCTACCACC	0.423																																																	0																																										SO:0001628	intergenic_variant	54067			AF231922	CCDS42919.1, CCDS42919.2	21q22.1	2011-02-24			ENSG00000205929	ENSG00000205929			1305	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 120"""	C21orf120			Standard	NM_001162495		Approved	B37, PRED81	uc011adu.2	Q9NYP8	OTTHUMG00000163477		21.37:g.34160945C>T			A8K4L8	Missense_Mutation	SNP	NULL	p.S22L	ENST00000536776.1	37	c.65	CCDS42919.2	21	.	.	.	.	.	.	.	.	.	.	C	7.882	0.730514	0.15507	.	.	ENSG00000205930	ENST00000382375;ENST00000382378	.	.	.	2.09	1.18	0.20946	.	.	.	.	.	T	0.38532	0.1044	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.37549	-0.9701	5	0.87932	D	0	.	4.5825	0.12266	0.0:0.8084:0.0:0.1916	.	.	.	.	L	22	.	ENSP00000371812:S22L	S	+	2	0	C21orf49	33082816	0.002000	0.14202	0.002000	0.10522	0.006000	0.05464	0.577000	0.23758	0.477000	0.27464	0.551000	0.68910	TCA	C21orf49	-	NULL		0.423	C21orf62-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C21orf49	HGNC	protein_coding	OTTHUMT00000139598.5	C	NM_019596		34160945	+1	no_errors	ENST00000382375	ensembl	human	known	70_37	missense	SNP	0.002	T
CACNA1S	779	genome.wustl.edu	37	1	201061236	201061236	+	Silent	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:201061236G>A	ENST00000362061.3	-	4	631	c.405C>T	c.(403-405)ttC>ttT	p.F135F	CACNA1S_ENST00000367338.3_Silent_p.F135F	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	135					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GAATCACGGTGAAGACCCTAG	0.577																																																	0													76.0	75.0	75.0					1																	201061236		2203	4300	6503	SO:0001819	synonymous_variant	779			L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.405C>T	1.37:g.201061236G>A			A4IF51|B1ALM2|Q12896|Q13934	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_VDCC_L_a1ssu	p.F135	ENST00000362061.3	37	c.405	CCDS1407.1	1																																																																																			CACNA1S	-	pfam_Ion_trans_dom,prints_VDCC_L_a1su		0.577	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1S	HGNC	protein_coding	OTTHUMT00000087049.1	G	NM_000069		201061236	-1	no_errors	ENST00000362061	ensembl	human	known	70_37	silent	SNP	1.000	A
CADM4	199731	genome.wustl.edu	37	19	44131041	44131041	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr19:44131041G>A	ENST00000222374.2	-	4	442	c.394C>T	c.(394-396)Cgg>Tgg	p.R132W	CADM4_ENST00000593506.1_5'Flank	NM_145296.1	NP_660339.1	Q8NFZ8	CADM4_HUMAN	cell adhesion molecule 4	132	Ig-like C2-type 1.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)|lung(4)|prostate(1)|skin(2)	12		Prostate(69;0.0199)				GCCTGCTCCCGGACCTCCACC	0.662																																																	0													27.0	30.0	29.0					19																	44131041		2202	4300	6502	SO:0001583	missense	199731			AF363368	CCDS12627.1	19q13.32	2013-01-29	2007-02-07	2007-02-07		ENSG00000105767		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30825	protein-coding gene	gene with protein product	"""nectin-like 4"""	609744	"""immunoglobulin superfamily, member 4C"""	IGSF4C		11536053	Standard	NM_145296		Approved	TSLL2, Necl-4, SynCAM4	uc002oxc.1	Q8NFZ8		ENST00000222374.2:c.394C>T	19.37:g.44131041G>A	ENSP00000222374:p.Arg132Trp		B2R7L5|Q9Y4A4	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_CD80_C2-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Neurexin-like,pfscan_Ig-like	p.R132W	ENST00000222374.2	37	c.394	CCDS12627.1	19	.	.	.	.	.	.	.	.	.	.	G	20.9	4.058646	0.76074	.	.	ENSG00000105767	ENST00000222374	T	0.76060	-0.99	5.62	3.39	0.38822	Immunoglobulin subtype (1);CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.209202	0.38548	N	0.001645	T	0.59985	0.2234	L	0.34521	1.04	0.35601	D	0.807888	B	0.14012	0.009	B	0.10450	0.005	T	0.63391	-0.6648	10	0.59425	D	0.04	.	6.2267	0.20711	0.0876:0.0:0.6225:0.2899	.	132	Q8NFZ8	CADM4_HUMAN	W	132	ENSP00000222374:R132W	ENSP00000222374:R132W	R	-	1	2	CADM4	48822881	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.207000	0.58480	1.383000	0.46405	-0.218000	0.12543	CGG	CADM4	-	pfam_CD80_C2-set,smart_Ig_sub,pfscan_Ig-like		0.662	CADM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CADM4	HGNC	protein_coding	OTTHUMT00000463352.1	G	NM_145296		44131041	-1	no_errors	ENST00000222374	ensembl	human	known	70_37	missense	SNP	1.000	A
CAMKK2	10645	genome.wustl.edu	37	12	121693424	121693424	+	Missense_Mutation	SNP	G	G	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr12:121693424G>T	ENST00000324774.5	-	9	1664	c.836C>A	c.(835-837)cCc>cAc	p.P279H	CAMKK2_ENST00000535524.1_Intron|CAMKK2_ENST00000402834.4_Missense_Mutation_p.P279H|CAMKK2_ENST00000538733.1_Missense_Mutation_p.P279H|CAMKK2_ENST00000337174.3_Missense_Mutation_p.P279H|CAMKK2_ENST00000404169.3_Missense_Mutation_p.P279H|CAMKK2_ENST00000545538.1_Missense_Mutation_p.P66H|CAMKK2_ENST00000347034.2_Missense_Mutation_p.P279H|CAMKK2_ENST00000446440.2_Missense_Mutation_p.P279H|CAMKK2_ENST00000392474.2_Missense_Mutation_p.P279H|CAMKK2_ENST00000412367.2_Missense_Mutation_p.P279H|CAMKK2_ENST00000392473.2_Missense_Mutation_p.P279H	NM_006549.3	NP_006540.3	Q96RR4	KKCC2_HUMAN	calcium/calmodulin-dependent protein kinase kinase 2, beta	279	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium-mediated signaling (GO:0019722)|MAPK cascade (GO:0000165)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	17	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TTTGAGGGTGGGCACTTCCAT	0.582																																																	0													77.0	72.0	74.0					12																	121693424		2203	4300	6503	SO:0001583	missense	10645			AF101264	CCDS9216.1, CCDS9217.1, CCDS9218.1, CCDS9219.1, CCDS44999.1, CCDS53837.1, CCDS58283.1	12q24.2	2002-08-13				ENSG00000110931			1470	protein-coding gene	gene with protein product		615002				9662074	Standard	NM_172226		Approved	CAMKK, KIAA0787, CAMKKB, MGC15254	uc001tzu.3	Q96RR4		ENST00000324774.5:c.836C>A	12.37:g.121693424G>T	ENSP00000312741:p.Pro279His		A8K7Q7|O94883|Q8IUG2|Q8IUG3|Q8N3I4|Q8WY03|Q8WY04|Q8WY05|Q8WY06|Q96RP1|Q96RP2|Q96RR3|Q9BWE9|Q9UER3|Q9UES2|Q9Y5N2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.P279H	ENST00000324774.5	37	c.836	CCDS9216.1	12	.	.	.	.	.	.	.	.	.	.	G	22.5	4.297844	0.81025	.	.	ENSG00000110931	ENST00000392474;ENST00000347034;ENST00000538733;ENST00000337174;ENST00000324774;ENST00000545538;ENST00000412367;ENST00000404169;ENST00000360452;ENST00000446440;ENST00000392473	T;T;T;T;T;T;T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13	5.11	5.11	0.69529	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.72455	0.3462	L	0.37466	1.105	0.80722	D	1	D;D;D;D;P;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.76;1.0;1.0;1.0	D;D;D;D;P;D;D;D	0.97110	0.987;0.993;0.998;0.995;0.563;0.999;1.0;0.998	T	0.75789	-0.3194	10	0.87932	D	0	-12.938	17.5254	0.87799	0.0:0.0:1.0:0.0	.	279;279;279;66;279;279;279;279	Q96RR4-6;Q96RR4-2;Q96RR4-7;F5GZ00;Q96RR4-5;Q96RR4-4;Q96RR4;Q96RR4-3	.;.;.;.;.;.;KKCC2_HUMAN;.	H	279;279;279;279;279;66;279;279;262;279;279	ENSP00000376266:P279H;ENSP00000321230:P279H;ENSP00000445944:P279H;ENSP00000336634:P279H;ENSP00000312741:P279H;ENSP00000441352:P66H;ENSP00000388368:P279H;ENSP00000384600:P279H;ENSP00000388273:P279H;ENSP00000376265:P279H	ENSP00000312741:P279H	P	-	2	0	CAMKK2	120177807	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	9.091000	0.94151	2.368000	0.80403	0.655000	0.94253	CCC	CAMKK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.582	CAMKK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMKK2	HGNC	protein_coding	OTTHUMT00000402563.1	G	NM_172226		121693424	-1	no_errors	ENST00000324774	ensembl	human	known	70_37	missense	SNP	1.000	T
TMED5	50999	genome.wustl.edu	37	1	93646208	93646208	+	5'UTR	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:93646208C>T	ENST00000370282.3	-	0	77				CCDC18_ENST00000557479.1_Missense_Mutation_p.R41W|TMED5_ENST00000370280.1_5'Flank|CCDC18_ENST00000401026.3_5'UTR|CCDC18_ENST00000334652.5_5'UTR|TMED5_ENST00000479918.1_5'Flank|CCDC18_ENST00000343253.7_Intron|CCDC18_ENST00000338949.4_5'UTR	NM_016040.4	NP_057124.3	Q9Y3A6	TMED5_HUMAN	transmembrane emp24 protein transport domain containing 5						Golgi ribbon formation (GO:0090161)|protein transport (GO:0015031)	cis-Golgi network (GO:0005801)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	6		all_lung(203;0.0223)|Lung NSC(277;0.071)|Melanoma(281;0.147)|Glioma(108;0.188)		all cancers(265;0.00108)|GBM - Glioblastoma multiforme(16;0.00407)|Epithelial(280;0.0797)		CCCGCGCCTTCGGCGGCGCCT	0.721																																																	0													13.0	15.0	14.0					1																	93646208		1778	3983	5761	SO:0001623	5_prime_UTR_variant	343099			BC070051	CCDS743.1, CCDS53342.1	1p22.1	2013-09-19			ENSG00000117500	ENSG00000117500			24251	protein-coding gene	gene with protein product						10810093	Standard	NM_016040		Approved	CGI-100	uc001dpn.3	Q9Y3A6	OTTHUMG00000010162	ENST00000370282.3:c.-409G>A	1.37:g.93646208C>T			B1AKT4|B2R703|D3DT38|Q96AX8	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.R41W	ENST00000370282.3	37	c.121	CCDS743.1	1	.	.	.	.	.	.	.	.	.	.	C	14.75	2.627853	0.46944	.	.	ENSG00000122483	ENST00000557479	.	.	.	4.77	-9.55	0.00569	.	.	.	.	.	T	0.10208	0.0250	.	.	.	0.20196	N	0.999924	B	0.02656	0.0	B	0.01281	0.0	T	0.31110	-0.9955	7	0.54805	T	0.06	.	9.2507	0.37554	0.0:0.1419:0.2862:0.5719	.	41	G3V388	.	W	41	.	ENSP00000383808:R41W	R	+	1	2	CCDC18	93418796	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.397000	0.01051	-2.374000	0.00599	-0.291000	0.09656	CGG	CCDC18	-	NULL		0.721	TMED5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC18	HGNC	protein_coding	OTTHUMT00000028076.3	C	NM_016040		93646208	+1	no_errors	ENST00000557479	ensembl	human	known	70_37	missense	SNP	0.000	T
CAMSAP2	23271	genome.wustl.edu	37	1	200817339	200817339	+	Missense_Mutation	SNP	A	A	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:200817339A>T	ENST00000236925.4	+	12	1524	c.1475A>T	c.(1474-1476)gAg>gTg	p.E492V	CAMSAP2_ENST00000413307.2_Missense_Mutation_p.E465V|CAMSAP2_ENST00000358823.2_Missense_Mutation_p.E481V			Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein family, member 2	492					microtubule cytoskeleton organization (GO:0000226)|regulation of organelle organization (GO:0033043)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)	microtubule minus-end binding (GO:0051011)										AATGGAGAAGAGGAAGCAGAG	0.348																																																	0													87.0	92.0	90.0					1																	200817339		2203	4300	6503	SO:0001583	missense	23271			AB029001	CCDS1404.1, CCDS72998.1, CCDS72999.1	1q32	2011-08-18	2011-08-18	2011-08-18	ENSG00000118200	ENSG00000118200			29188	protein-coding gene	gene with protein product		613775	"""calmodulin regulated spectrin-associated protein 1-like 1"""	CAMSAP1L1		15897902, 19508979	Standard	XM_005245040		Approved	KIAA1078	uc001gvk.3	Q08AD1	OTTHUMG00000035740	ENST00000236925.4:c.1475A>T	1.37:g.200817339A>T	ENSP00000236925:p.Glu492Val		B1APG6|Q08AD2|Q6PGN8|Q96FB3|Q9UG20|Q9UPS4	Missense_Mutation	SNP	pfam_CKK_domain,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_PRC_barrell-like,superfamily_CH-domain	p.E492V	ENST00000236925.4	37	c.1475		1	.	.	.	.	.	.	.	.	.	.	A	10.98	1.504809	0.26949	.	.	ENSG00000118200	ENST00000358823;ENST00000413307;ENST00000236925	T;T;T	0.15139	2.46;2.45;2.46	5.62	3.26	0.37387	.	0.342996	0.33959	N	0.004381	T	0.10852	0.0265	L	0.36672	1.1	0.35560	D	0.804568	P;B;B	0.37276	0.589;0.007;0.01	B;B;B	0.30316	0.114;0.012;0.02	T	0.29150	-1.0021	10	0.26408	T	0.33	-12.6215	9.0195	0.36191	0.8536:0.0:0.1464:0.0	.	465;492;481	Q08AD1-2;Q08AD1;Q08AD1-3	.;CAMP2_HUMAN;.	V	481;465;492	ENSP00000351684:E481V;ENSP00000416800:E465V;ENSP00000236925:E492V	ENSP00000236925:E492V	E	+	2	0	CAMSAP1L1	199083962	1.000000	0.71417	0.930000	0.37139	0.996000	0.88848	4.726000	0.61986	0.381000	0.24851	0.533000	0.62120	GAG	CAMSAP2	-	NULL		0.348	CAMSAP2-001	KNOWN	basic|appris_candidate_longest	protein_coding	CAMSAP2	HGNC	protein_coding	OTTHUMT00000086956.2	A	NM_203459		200817339	+1	no_errors	ENST00000236925	ensembl	human	known	70_37	missense	SNP	1.000	T
CCNYL2	414194	genome.wustl.edu	37	10	42950057	42950057	+	RNA	SNP	C	C	T	rs553494151	byFrequency	TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr10:42950057C>T	ENST00000483242.3	-	0	623					NR_103829.1		Q5T2Q4	CCYL2_HUMAN	cyclin Y-like 2						regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)					breast(2)|endometrium(1)|lung(3)|ovary(1)	7						GAAGACCAGCCGGCTTATTTA	0.582													c|||	2	0.000399361	0.0	0.0014	5008	,	,		15850	0.0		0.001	False		,,,				2504	0.0																0																																												414194			BC039000		10q11.21	2007-02-09	2007-02-09	2007-02-09	ENSG00000182632	ENSG00000182632			23495	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 21"""	C10orf21			Standard	NR_103829		Approved	bA178A10.2		Q5T2Q4	OTTHUMG00000018009		10.37:g.42950057C>T				RNA	SNP	-	NULL	ENST00000483242.3	37	NULL		10																																																																																			CCNYL2	-	-		0.582	CCNYL2-002	KNOWN	basic	processed_transcript	CCNYL2	HGNC	pseudogene	OTTHUMT00000047670.5	C	XM_936368		42950057	-1	no_errors	ENST00000472090	ensembl	human	known	70_37	rna	SNP	0.937	T
CEACAM1	634	genome.wustl.edu	37	19	43031407	43031407	+	Silent	SNP	C	C	G	rs79326931	byFrequency	TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr19:43031407C>G	ENST00000161559.6	-	2	344	c.210G>C	c.(208-210)ggG>ggC	p.G70G	CEACAM1_ENST00000358394.3_Silent_p.G70G|CEACAM1_ENST00000308072.4_Silent_p.G30G|LIPE-AS1_ENST00000594688.1_RNA|CEACAM1_ENST00000351134.3_Silent_p.G70G|CEACAM1_ENST00000352591.5_Silent_p.G70G|CEACAM1_ENST00000599389.1_Silent_p.G70G|CEACAM1_ENST00000403444.3_Silent_p.G70G|CEACAM1_ENST00000403461.1_Silent_p.G70G|LIPE-AS1_ENST00000594624.2_RNA|LIPE-AS1_ENST00000457234.2_RNA	NM_001712.4	NP_001703.2	P13688	CEAM1_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)	70	Ig-like V-type.				angiogenesis (GO:0001525)|cell migration (GO:0016477)|homophilic cell adhesion (GO:0007156)|integrin-mediated signaling pathway (GO:0007229)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	17		Prostate(69;0.00682)		GBM - Glioblastoma multiforme(486;0.00148)	Arcitumomab(DB00113)	CCACTCTTTCCCCTTTGTACC	0.498																																																	0													235.0	189.0	205.0					19																	43031407		2203	4300	6503	SO:0001819	synonymous_variant	634			M72238	CCDS12609.1, CCDS46089.1, CCDS54272.1, CCDS54273.1, CCDS54274.1	19q13.2	2014-05-16			ENSG00000079385	ENSG00000079385		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1814	protein-coding gene	gene with protein product		109770		BGP		2457922, 2025273	Standard	NM_001712		Approved	BGP1, CD66a	uc002otv.3	P13688	OTTHUMG00000151078	ENST00000161559.6:c.210G>C	19.37:g.43031407C>G			A6NE38|A8MY49|O60430|Q069I7|Q13854|Q13857|Q13858|Q13859|Q13860|Q15600|Q15601|Q16170|Q5UB49|Q7KYP5|Q96CA7|Q9UQV9	Silent	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.G70	ENST00000161559.6	37	c.210	CCDS12609.1	19																																																																																			CEACAM1	-	pfam_Ig_V-set,smart_Ig_sub		0.498	CEACAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEACAM1	HGNC	protein_coding	OTTHUMT00000321190.2	C	NM_001712		43031407	-1	no_errors	ENST00000161559	ensembl	human	known	70_37	silent	SNP	0.004	G
CHRFAM7A	89832	genome.wustl.edu	37	15	30665323	30665323	+	Silent	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr15:30665323G>A	ENST00000299847.2	-	6	639	c.186C>T	c.(184-186)atC>atT	p.I62I	CHRFAM7A_ENST00000567722.1_5'UTR|CHRFAM7A_ENST00000397827.3_5'UTR|CHRFAM7A_ENST00000401522.3_5'UTR	NM_139320.1	NP_647536.1	Q494W8	CRFM7_HUMAN	CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion	62						integral component of membrane (GO:0016021)	extracellular ligand-gated ion channel activity (GO:0005230)			large_intestine(3)|lung(1)|skin(2)	6		all_lung(180;3.42e-11)|Breast(32;0.000153)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		AGCGTACATCGATGTAGCAGG	0.498																																																	0																																										SO:0001819	synonymous_variant	89832			AF029838	CCDS32184.1, CCDS42008.1	15q13.2	2013-04-24	2006-02-01		ENSG00000166664	ENSG00000166664			15781	protein-coding gene	gene with protein product		609756				11829490	Standard	NM_139320		Approved	D-10, CHRNA7-DR1	uc001zdt.1	Q494W8	OTTHUMG00000175645	ENST00000299847.2:c.186C>T	15.37:g.30665323G>A			A8KAB9	Silent	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	p.I62	ENST00000299847.2	37	c.186	CCDS32184.1	15																																																																																			CHRFAM7A	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel		0.498	CHRFAM7A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRFAM7A	HGNC	protein_coding	OTTHUMT00000430700.1	G	NM_148911		30665323	-1	no_errors	ENST00000299847	ensembl	human	known	70_37	silent	SNP	0.864	A
CHRM3	1131	genome.wustl.edu	37	1	240071991	240071991	+	Missense_Mutation	SNP	G	G	A	rs145638222		TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:240071991G>A	ENST00000255380.4	+	5	2019	c.1240G>A	c.(1240-1242)Gtg>Atg	p.V414M		NM_000740.2	NP_000731.1	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	414					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of insulin secretion (GO:0050796)|regulation of vascular smooth muscle contraction (GO:0003056)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|smooth muscle contraction (GO:0006939)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)|receptor activity (GO:0004872)			breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(19)|ovary(4)|prostate(1)|skin(12)|upper_aerodigestive_tract(1)	51	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Fesoterodine(DB06702)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methacholine(DB06709)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tramadol(DB00193)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	CCAGAAGAGCGTGGACGATGG	0.557													G|||	1	0.000199681	0.0	0.0014	5008	,	,		20521	0.0		0.0	False		,,,				2504	0.0																0								G	MET/VAL	0,4406		0,0,2203	46.0	44.0	44.0		1240	-9.9	0.0	1	dbSNP_134	44	1,8599	1.2+/-3.3	0,1,4299	yes	missense	CHRM3	NM_000740.2	21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	414/591	240071991	1,13005	2203	4300	6503	SO:0001583	missense	1131			U29589	CCDS1616.1	1q43	2012-09-20			ENSG00000133019	ENSG00000133019		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1952	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 3"""	118494					Standard	XM_005273032		Approved		uc001hyp.3	P20309	OTTHUMG00000039649	ENST00000255380.4:c.1240G>A	1.37:g.240071991G>A	ENSP00000255380:p.Val414Met		Q0VAJ8|Q4QRI3|Q5VXY2|Q9HB60	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Musac_M3_rcpt,prints_Musac_rcpt,prints_GPCR_Rhodpsn	p.V414M	ENST00000255380.4	37	c.1240	CCDS1616.1	1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	3.641	-0.073528	0.07184	0.0	1.16E-4	ENSG00000133019	ENST00000255380	T	0.59502	0.26	5.97	-9.85	0.00476	GPCR, rhodopsin-like superfamily (1);	0.939929	0.09064	N	0.853823	T	0.37156	0.0993	L	0.38175	1.15	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.25433	-1.0132	10	0.46703	T	0.11	-6.8869	7.049	0.25063	0.2219:0.1713:0.5224:0.0844	.	414	P20309	ACM3_HUMAN	M	414	ENSP00000255380:V414M	ENSP00000255380:V414M	V	+	1	0	CHRM3	238138614	0.000000	0.05858	0.003000	0.11579	0.630000	0.37929	-1.440000	0.02412	-1.752000	0.01325	-0.140000	0.14226	GTG	CHRM3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.557	CHRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM3	HGNC	protein_coding	OTTHUMT00000095644.2	G	NM_000740		240071991	+1	no_errors	ENST00000255380	ensembl	human	known	70_37	missense	SNP	0.000	A
CIC	23152	genome.wustl.edu	37	19	42796784	42796784	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr19:42796784C>T	ENST00000575354.2	+	14	3282	c.3242C>T	c.(3241-3243)cCg>cTg	p.P1081L	CIC_ENST00000572681.2_Missense_Mutation_p.P1989L|CIC_ENST00000160740.3_Missense_Mutation_p.P1080L	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	1081	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				CCCCAGCTGCCGCCTGCCTGT	0.647			"""Mis, F, S"""		oligodendroglioma																																			Rec	yes		19	19q13.2	23152	capicua homolog		O	0													40.0	47.0	45.0					19																	42796784		2203	4300	6503	SO:0001583	missense	23152			AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.3242C>T	19.37:g.42796784C>T	ENSP00000458663:p.Pro1081Leu		Q7LGI1|Q9UEG5|Q9Y6T1	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.P1081L	ENST00000575354.2	37	c.3242	CCDS12601.1	19	.	.	.	.	.	.	.	.	.	.	C	15.05	2.718496	0.48622	.	.	ENSG00000079432	ENST00000160740	.	.	.	5.05	5.05	0.67936	.	.	.	.	.	T	0.33030	0.0849	N	0.08118	0	0.48901	D	0.999723	D	0.60575	0.988	P	0.45449	0.481	T	0.35943	-0.9768	8	0.87932	D	0	-9.7746	13.7669	0.63002	0.0:1.0:0.0:0.0	.	1081	Q96RK0	CIC_HUMAN	L	1081	.	ENSP00000160740:P1081L	P	+	2	0	CIC	47488624	1.000000	0.71417	1.000000	0.80357	0.633000	0.38033	4.996000	0.63914	2.639000	0.89480	0.491000	0.48974	CCG	CIC	-	NULL		0.647	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CIC	HGNC	protein_coding	OTTHUMT00000438532.2	C			42796784	+1	no_errors	ENST00000160740	ensembl	human	known	70_37	missense	SNP	1.000	T
CLSPN	63967	genome.wustl.edu	37	1	36230312	36230312	+	Nonsense_Mutation	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:36230312G>C	ENST00000318121.3	-	3	194	c.137C>G	c.(136-138)tCa>tGa	p.S46*	CLSPN_ENST00000520551.1_Nonsense_Mutation_p.S46*|CLSPN_ENST00000373220.3_Nonsense_Mutation_p.S46*|CLSPN_ENST00000251195.5_Nonsense_Mutation_p.S46*	NM_022111.3	NP_071394.2	Q9HAW4	CLSPN_HUMAN	claspin	46					activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|mitotic DNA replication checkpoint (GO:0033314)|peptidyl-serine phosphorylation (GO:0018105)	nucleoplasm (GO:0005654)	anaphase-promoting complex binding (GO:0010997)|DNA binding (GO:0003677)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CTCTTCATCTGAATCTGGAGG	0.333																																																	0													40.0	39.0	39.0					1																	36230312		2197	4296	6493	SO:0001587	stop_gained	63967			AF297866	CCDS396.1, CCDS53297.1	1p34.3	2010-06-24	2010-06-24		ENSG00000092853	ENSG00000092853			19715	protein-coding gene	gene with protein product		605434	"""claspin homolog (Xenopus laevis)"""			11090622, 12766152	Standard	NM_022111		Approved		uc001bzi.3	Q9HAW4	OTTHUMG00000004168	ENST00000318121.3:c.137C>G	1.37:g.36230312G>C	ENSP00000312995:p.Ser46*		A6NFL4|Q1RMC6|Q2KHM3|Q5VYG0|Q6P6H5|Q8IWI1	Nonsense_Mutation	SNP	NULL	p.S46*	ENST00000318121.3	37	c.137	CCDS396.1	1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.025717	0.93518	.	.	ENSG00000092853	ENST00000251195;ENST00000318121;ENST00000373220;ENST00000520551;ENST00000544356	.	.	.	6.03	6.03	0.97812	.	0.250206	0.33290	N	0.005063	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-8.8225	18.3299	0.90264	0.0:0.0:1.0:0.0	.	.	.	.	X	46	.	ENSP00000251195:S46X	S	-	2	0	CLSPN	36002899	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	6.180000	0.71981	2.861000	0.98227	0.655000	0.94253	TCA	CLSPN	-	NULL		0.333	CLSPN-005	KNOWN	basic|appris_principal|CCDS	protein_coding	CLSPN	HGNC	protein_coding	OTTHUMT00000377857.1	G	NM_022111		36230312	-1	no_errors	ENST00000318121	ensembl	human	known	70_37	nonsense	SNP	1.000	C
GPSM2	29899	genome.wustl.edu	37	1	109472616	109472616	+	3'UTR	SNP	A	A	G			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:109472616A>G	ENST00000406462.2	+	0	2882				GPSM2_ENST00000264126.3_3'UTR|CLCC1_ENST00000369968.2_3'UTR|CLCC1_ENST00000369969.2_3'UTR|CLCC1_ENST00000369976.1_3'UTR|AKNAD1_ENST00000357393.4_Intron|CLCC1_ENST00000482889.1_5'UTR|CLCC1_ENST00000369971.2_3'UTR|CLCC1_ENST00000415331.1_3'UTR|CLCC1_ENST00000356970.2_3'UTR			P81274	GPSM2_HUMAN	G-protein signaling modulator 2						establishment of mitotic spindle orientation (GO:0000132)|G-protein coupled receptor signaling pathway (GO:0007186)|lung epithelial cell differentiation (GO:0060487)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase regulator activity (GO:0030695)|identical protein binding (GO:0042802)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)	14		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0353)|Lung(183;0.0984)|COAD - Colon adenocarcinoma(174;0.129)|Epithelial(280;0.175)|all cancers(265;0.209)		ACAATCTATTACTTTTTTCCT	0.284																																																	0																																										SO:0001624	3_prime_UTR_variant	23155			AY136740	CCDS792.2	1p13.3	2013-10-11	2010-06-24		ENSG00000121957	ENSG00000121957		"""Tetratricopeptide (TTC) repeat domain containing"""	29501	protein-coding gene	gene with protein product		609245	"""G-protein signalling modulator 2 (AGS3-like, C. elegans)"", ""deafness, autosomal recessive 82"""	DFNB82		11832491, 8973305, 19888295, 20602914, 21348867	Standard	NM_013296		Approved	LGN, Pins	uc010ovc.2	P81274	OTTHUMG00000011730	ENST00000406462.2:c.*54A>G	1.37:g.109472616A>G			Q5T1N8|Q6IBL7|Q8N0Z5	RNA	SNP	-	NULL	ENST00000406462.2	37	NULL	CCDS792.2	1																																																																																			CLCC1	-	-		0.284	GPSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCC1	HGNC	protein_coding	OTTHUMT00000032400.3	A	NM_013296		109472616	-1	no_errors	ENST00000473062	ensembl	human	known	70_37	rna	SNP	0.000	G
CNTNAP3B	728577	genome.wustl.edu	37	9	43875988	43875988	+	Splice_Site	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr9:43875988G>C	ENST00000377564.3	+	14	2473		c.e14-1			NM_001201380.1	NP_001188309.1	Q96NU0	CNT3B_HUMAN	contactin associated protein-like 3B						cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|lung(3)|pancreas(1)|prostate(3)	10						TTGTCTTTCAGATGGAACCCC	0.453																																																	0																																										SO:0001630	splice_region_variant	728577			BX538190	CCDS75836.1	9p12	2007-12-14			ENSG00000154529	ENSG00000154529			32035	protein-coding gene	gene with protein product						15820314	Standard	XM_006716853		Approved		uc004abr.1	Q96NU0	OTTHUMG00000013174	ENST00000377564.3:c.2081-1G>C	9.37:g.43875988G>C			B1B0V7|B1B0V8|B1B0V9|B1B0W0|B1B0X8|B1B162|Q4VXF0|Q9H7W3	Splice_Site	SNP	-	e14-1	ENST00000377564.3	37	c.2081-1	CCDS55312.1	9	.	.	.	.	.	.	.	.	.	.	.	11.77	1.738809	0.30774	.	.	ENSG00000154529	ENST00000377564;ENST00000341990;ENST00000377561	.	.	.	2.5	2.5	0.30297	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.0794	0.53662	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CNTNAP3B	43815984	1.000000	0.71417	1.000000	0.80357	0.415000	0.31203	8.494000	0.90477	1.433000	0.47394	0.121000	0.15741	.	CNTNAP3B	-	-		0.453	CNTNAP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP3B	HGNC	protein_coding	OTTHUMT00000036930.3	G		Intron	43875988	+1	no_errors	ENST00000377564	ensembl	human	known	70_37	splice_site	SNP	1.000	C
COL11A1	1301	genome.wustl.edu	37	1	103364276	103364276	+	Silent	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:103364276C>T	ENST00000370096.3	-	56	4506	c.4194G>A	c.(4192-4194)caG>caA	p.Q1398Q	COL11A1_ENST00000358392.2_Silent_p.Q1410Q|COL11A1_ENST00000512756.1_Silent_p.Q1282Q|COL11A1_ENST00000353414.4_Silent_p.Q1359Q	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1398	Collagen-like 6.|Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CTGCAGGTCCCTGAGGACCGA	0.478																																																	0													44.0	47.0	46.0					1																	103364276		2203	4300	6503	SO:0001819	synonymous_variant	1301			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.4194G>A	1.37:g.103364276C>T			B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Silent	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C,smart_Laminin_G,smart_Fib_collagen_C	p.Q1410	ENST00000370096.3	37	c.4230	CCDS778.1	1																																																																																			COL11A1	-	pfam_Collagen		0.478	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COL11A1	HGNC	protein_coding	OTTHUMT00000029997.1	C	NM_080630		103364276	-1	no_errors	ENST00000358392	ensembl	human	known	70_37	silent	SNP	0.999	T
COL14A1	7373	genome.wustl.edu	37	8	121262997	121262997	+	Missense_Mutation	SNP	T	T	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr8:121262997T>C	ENST00000297848.3	+	22	3014	c.2744T>C	c.(2743-2745)gTg>gCg	p.V915A	COL14A1_ENST00000309791.4_Missense_Mutation_p.V915A|COL14A1_ENST00000247781.3_Missense_Mutation_p.V820A|COL14A1_ENST00000432943.2_3'UTR	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			ACAGGCATGGTGAAAACATGT	0.493																																																	0													68.0	60.0	63.0					8																	121262997		2203	4300	6503	SO:0001583	missense	7373				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.2744T>C	8.37:g.121262997T>C	ENSP00000297848:p.Val915Ala			Missense_Mutation	SNP	pfam_VWF_A,pfam_Fibronectin_type3,pfam_Collagen,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.V915A	ENST00000297848.3	37	c.2744	CCDS34938.1	8	.	.	.	.	.	.	.	.	.	.	T	0.087	-1.173106	0.01646	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781;ENST00000434620	D;D;D;T	0.87029	-2.09;-2.12;-2.2;0.65	5.73	4.58	0.56647	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.123875	0.53938	D	0.000050	T	0.54271	0.1848	N	0.00514	-1.41	0.80722	D	1	B;B	0.09022	0.002;0.0	B;B	0.09377	0.004;0.001	T	0.61312	-0.7088	10	0.02654	T	1	.	3.6761	0.08292	0.0:0.1526:0.2174:0.63	.	915;915	Q05707-2;Q05707	.;COEA1_HUMAN	A	915;915;820;728	ENSP00000311809:V915A;ENSP00000297848:V915A;ENSP00000247781:V820A;ENSP00000409461:V728A	ENSP00000247781:V820A	V	+	2	0	COL14A1	121332178	1.000000	0.71417	1.000000	0.80357	0.198000	0.23893	2.675000	0.46875	2.324000	0.78689	0.533000	0.62120	GTG	COL14A1	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3		0.493	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL14A1	HGNC	protein_coding	OTTHUMT00000313657.2	T	NM_021110		121262997	+1	no_errors	ENST00000297848	ensembl	human	known	70_37	missense	SNP	1.000	C
COL1A2	1278	genome.wustl.edu	37	7	94037505	94037505	+	Missense_Mutation	SNP	G	G	A	rs72656380		TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr7:94037505G>A	ENST00000297268.6	+	14	1121	c.650G>A	c.(649-651)gGg>gAg	p.G217E		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	217					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	GGAGCCCGTGGGCTTCCTGGT	0.413										HNSCC(75;0.22)																																							0			GRCh37	CM011294	COL1A2	M	rs72656380						94.0	98.0	97.0					7																	94037505		2203	4300	6503	SO:0001583	missense	1278			Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.650G>A	7.37:g.94037505G>A	ENSP00000297268:p.Gly217Glu		P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_Fibrinogen_a/b/g_C,smart_Fib_collagen_C	p.G217E	ENST00000297268.6	37	c.650	CCDS34682.1	7	.	.	.	.	.	.	.	.	.	.	G	22.1	4.243105	0.79912	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.99176	-5.52	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	D	0.99548	0.9838	H	0.94771	3.58	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98372	1.0554	10	0.87932	D	0	.	20.5471	0.99284	0.0:0.0:1.0:0.0	.	217	P08123	CO1A2_HUMAN	E	217;218	ENSP00000297268:G217E	ENSP00000297268:G217E	G	+	2	0	COL1A2	93875441	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	GGG	COL1A2	-	NULL		0.413	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL1A2	HGNC	protein_coding	OTTHUMT00000309045.2	G	NM_000089		94037505	+1	no_errors	ENST00000297268	ensembl	human	known	70_37	missense	SNP	1.000	A
CPXM1	56265	genome.wustl.edu	37	20	2777278	2777278	+	Nonsense_Mutation	SNP	C	C	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr20:2777278C>A	ENST00000380605.2	-	8	1004	c.940G>T	c.(940-942)Gag>Tag	p.E314*		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	314					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						GGGCATTGCTCTTGTACCTGC	0.547																																																	0													173.0	157.0	163.0					20																	2777278		2203	4300	6503	SO:0001587	stop_gained	56265			AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.940G>T	20.37:g.2777278C>A	ENSP00000369979:p.Glu314*		Q6P4G8|Q6UW65|Q9NUB5	Nonsense_Mutation	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom,prints_Peptidase_M14	p.E314*	ENST00000380605.2	37	c.940	CCDS13033.1	20	.	.	.	.	.	.	.	.	.	.	C	29.5	5.010223	0.93346	.	.	ENSG00000088882	ENST00000380605;ENST00000421947	.	.	.	5.43	5.43	0.79202	.	0.097074	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-27.0231	16.7686	0.85531	0.0:1.0:0.0:0.0	.	.	.	.	X	314;10	.	ENSP00000369979:E314X	E	-	1	0	CPXM1	2725278	0.978000	0.34361	0.975000	0.42487	0.521000	0.34408	2.537000	0.45702	2.825000	0.97269	0.655000	0.94253	GAG	CPXM1	-	pfam_Peptidase_M14		0.547	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPXM1	HGNC	protein_coding	OTTHUMT00000077643.2	C	NM_019609		2777278	-1	no_errors	ENST00000380605	ensembl	human	known	70_37	nonsense	SNP	0.997	A
CYP11B1	1584	genome.wustl.edu	37	8	143957227	143957227	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr8:143957227C>T	ENST00000292427.4	-	6	1054	c.1022G>A	c.(1021-1023)cGc>cAc	p.R341H	CYP11B1_ENST00000377675.3_Missense_Mutation_p.R412H|CYP11B1_ENST00000517471.1_Missense_Mutation_p.R341H	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	341					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	GCTCTCCTGGCGCAGGGCCTG	0.642									Familial Hyperaldosteronism type I																																								0													76.0	78.0	78.0					8																	143957227		2203	4300	6503	SO:0001583	missense	1584	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.1022G>A	8.37:g.143957227C>T	ENSP00000292427:p.Arg341His		Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_mitochondrial,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B,prints_Cyt_P450	p.R341H	ENST00000292427.4	37	c.1022	CCDS6392.1	8	.	.	.	.	.	.	.	.	.	.	.	22.8	4.338374	0.81911	.	.	ENSG00000160882	ENST00000292427;ENST00000517471;ENST00000377675	T;T;T	0.72615	-0.67;2.36;-0.67	4.42	4.42	0.53409	.	0.126247	0.31963	N	0.006789	T	0.73583	0.3605	L	0.41961	1.31	0.51012	D	0.999904	P;P;P;B;D	0.60575	0.948;0.772;0.772;0.296;0.988	P;P;P;B;P	0.57846	0.597;0.458;0.458;0.098;0.828	T	0.70063	-0.4975	10	0.23302	T	0.38	.	14.8598	0.70372	0.0:1.0:0.0:0.0	.	412;341;341;341;57	Q4VAR0;Q8TDD0;Q4VAQ9;P15538;Q8N9P8	.;.;.;C11B1_HUMAN;.	H	341;341;412	ENSP00000292427:R341H;ENSP00000428043:R341H;ENSP00000366903:R412H	ENSP00000292427:R341H	R	-	2	0	CYP11B1	143954229	0.021000	0.18746	0.994000	0.49952	0.811000	0.45836	2.466000	0.45084	2.169000	0.68431	0.555000	0.69702	CGC	CYP11B1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I		0.642	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11B1	HGNC	protein_coding	OTTHUMT00000379475.2	C			143957227	-1	no_errors	ENST00000292427	ensembl	human	known	70_37	missense	SNP	1.000	T
CYP2B7P	1556	genome.wustl.edu	37	19	41455326	41455326	+	RNA	SNP	A	A	G			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr19:41455326A>G	ENST00000597260.1	+	0	1098				CYP2B7P1_ENST00000599198.1_RNA																							AGATTATTGaaaattataata	0.468																																																	0																																												1556																															19.37:g.41455326A>G				RNA	SNP	-	NULL	ENST00000597260.1	37	NULL		19																																																																																			CYP2B7P1	-	-		0.468	AC092071.1-001	KNOWN	basic	sense_intronic	CYP2B7P1	HGNC	sense_intronic	OTTHUMT00000463563.1	A			41455326	+1	no_errors	ENST00000599198	ensembl	human	known	70_37	rna	SNP	0.010	G
DBN1	1627	genome.wustl.edu	37	5	176887655	176887655	+	Missense_Mutation	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr5:176887655G>C	ENST00000309007.5	-	9	1040	c.821C>G	c.(820-822)tCg>tGg	p.S274W	DBN1_ENST00000292385.5_Missense_Mutation_p.S276W|DBN1_ENST00000393565.1_Missense_Mutation_p.S274W|DBN1_ENST00000393563.4_Missense_Mutation_p.S6W|DBN1_ENST00000512501.1_Missense_Mutation_p.S6W	NM_004395.3	NP_004386	Q16643	DREB_HUMAN	drebrin 1	274					actin filament organization (GO:0007015)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|maintenance of protein location in cell (GO:0032507)|neural precursor cell proliferation (GO:0061351)|regulation of dendrite development (GO:0050773)|regulation of neuronal synaptic plasticity (GO:0048168)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|gap junction (GO:0005921)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|profilin binding (GO:0005522)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(12)|ovary(1)|skin(2)	25	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTCCACCTCCGACTCTGACTT	0.602																																																	0													154.0	123.0	134.0					5																	176887655		2203	4300	6503	SO:0001583	missense	1627				CCDS4420.1, CCDS4421.1	5q35.3	2008-02-05			ENSG00000113758	ENSG00000113758			2695	protein-coding gene	gene with protein product		126660		D0S117E		8216329	Standard	NM_004395		Approved		uc003mgy.2	Q16643	OTTHUMG00000130856	ENST00000309007.5:c.821C>G	5.37:g.176887655G>C	ENSP00000308532:p.Ser274Trp		A8MV58|B2RBG0|Q9UFZ5	Missense_Mutation	SNP	pfam_Actin-bd_cofilin/tropomyosin,smart_Actin-bd_cofilin/tropomyosin	p.S276W	ENST00000309007.5	37	c.827	CCDS4420.1	5	.	.	.	.	.	.	.	.	.	.	G	17.68	3.450596	0.63290	.	.	ENSG00000113758	ENST00000309007;ENST00000292385;ENST00000393565;ENST00000512501;ENST00000393563;ENST00000477391	T;T;T;T;T	0.56103	0.8;0.8;1.43;0.48;0.73	5.07	5.07	0.68467	.	0.391208	0.25854	N	0.027875	T	0.67896	0.2942	L	0.59436	1.845	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;1.0;0.999;1.0	T	0.70572	-0.4835	10	0.87932	D	0	-9.2116	13.0419	0.58904	0.0:0.1623:0.8377:0.0	.	224;274;274;276	B3KSQ7;A8MV58;Q16643;Q16643-2	.;.;DREB_HUMAN;.	W	274;276;274;6;6;273	ENSP00000308532:S274W;ENSP00000292385:S276W;ENSP00000377195:S274W;ENSP00000423208:S6W;ENSP00000377193:S6W	ENSP00000292385:S276W	S	-	2	0	DBN1	176820261	1.000000	0.71417	0.461000	0.27105	0.883000	0.51084	4.202000	0.58446	2.368000	0.80403	0.561000	0.74099	TCG	DBN1	-	NULL		0.602	DBN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DBN1	HGNC	protein_coding	OTTHUMT00000253429.2	G	NM_080881		176887655	-1	no_errors	ENST00000292385	ensembl	human	known	70_37	missense	SNP	0.751	C
DCAF12L2	340578	genome.wustl.edu	37	X	125298663	125298663	+	Silent	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chrX:125298663G>A	ENST00000360028.2	-	1	1271	c.1245C>T	c.(1243-1245)gaC>gaT	p.D415D	DCAF12L2_ENST00000538699.1_Silent_p.D415D			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	415										NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						TCACCCAGACGTCATCTTGGT	0.617																																																	0													102.0	104.0	104.0					X																	125298663		2203	4300	6503	SO:0001819	synonymous_variant	340578			AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.1245C>T	X.37:g.125298663G>A			B2RN42	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D415	ENST00000360028.2	37	c.1245	CCDS43991.1	X																																																																																			DCAF12L2	-	NULL		0.617	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF12L2	HGNC	protein_coding	OTTHUMT00000058181.1	G	NM_001013628		125298663	-1	no_errors	ENST00000360028	ensembl	human	known	70_37	silent	SNP	0.163	A
DDX49	54555	genome.wustl.edu	37	19	19035769	19035769	+	Silent	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr19:19035769C>T	ENST00000247003.4	+	9	1075	c.1008C>T	c.(1006-1008)gtC>gtT	p.V336V	DDX49_ENST00000438170.2_Missense_Mutation_p.S239L|AC002985.3_ENST00000596918.1_Intron|DDX49_ENST00000599156.1_3'UTR	NM_019070.4	NP_061943.2	Q9Y6V7	DDX49_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 49	336	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.						ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	18			Epithelial(12;0.0289)			TCCACCGAGTCGGCCGGACGG	0.657																																																	0													49.0	45.0	47.0					19																	19035769		2203	4300	6503	SO:0001819	synonymous_variant	54555				CCDS12390.1	19p12	2008-02-05				ENSG00000105671		"""DEAD-boxes"""	18684	protein-coding gene	gene with protein product							Standard	NM_019070		Approved	FLJ10432	uc002nkq.2	Q9Y6V7		ENST00000247003.4:c.1008C>T	19.37:g.19035769C>T			E7ENA0|Q53FJ1|Q9BVQ8	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S239L	ENST00000247003.4	37	c.716	CCDS12390.1	19	.	.	.	.	.	.	.	.	.	.	C	0.177	-1.065868	0.01934	.	.	ENSG00000105671	ENST00000438170	T	0.08458	3.09	4.77	-9.54	0.00572	.	.	.	.	.	T	0.07818	0.0196	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.28776	-1.0033	6	0.87932	D	0	-27.9248	6.3086	0.21153	0.0656:0.1623:0.2719:0.5002	.	.	.	.	L	239	ENSP00000395377:S239L	ENSP00000395377:S239L	S	+	2	0	DDX49	18896769	0.000000	0.05858	0.020000	0.16555	0.027000	0.11550	-3.581000	0.00424	-3.558000	0.00141	-2.069000	0.00389	TCG	DDX49	-	smart_Helicase_C,pfscan_Helicase_C		0.657	DDX49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX49	HGNC	protein_coding	OTTHUMT00000464593.1	C	NM_019070		19035769	+1	no_errors	ENST00000438170	ensembl	human	known	70_37	missense	SNP	0.002	T
DDX60	55601	genome.wustl.edu	37	4	169167643	169167643	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr4:169167643G>A	ENST00000393743.3	-	30	4381	c.4090C>T	c.(4090-4092)Ctc>Ttc	p.L1364F		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	1364	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		GTTATGCTGAGAGGGAAGTGT	0.488																																																	0													95.0	93.0	94.0					4																	169167643		2203	4300	6503	SO:0001583	missense	55601			AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.4090C>T	4.37:g.169167643G>A	ENSP00000377344:p.Leu1364Phe		Q6PK35|Q9NVE3	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L1364F	ENST00000393743.3	37	c.4090	CCDS34097.1	4	.	.	.	.	.	.	.	.	.	.	G	2.715	-0.267923	0.05754	.	.	ENSG00000137628	ENST00000393743	T	0.24538	1.85	5.83	-4.52	0.03472	Helicase, C-terminal (1);	0.564132	0.16039	N	0.232487	T	0.21881	0.0527	M	0.83384	2.64	0.09310	N	1	P	0.34934	0.476	B	0.31101	0.124	T	0.08391	-1.0724	10	0.59425	D	0.04	.	3.1114	0.06360	0.5008:0.0966:0.2188:0.1837	.	1364	Q8IY21	DDX60_HUMAN	F	1364	ENSP00000377344:L1364F	ENSP00000377344:L1364F	L	-	1	0	DDX60	169404218	0.007000	0.16637	0.000000	0.03702	0.202000	0.24057	-0.199000	0.09491	-1.135000	0.02895	0.563000	0.77884	CTC	DDX60	-	pfscan_Helicase_C		0.488	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX60	HGNC	protein_coding	OTTHUMT00000364622.1	G	NM_017631		169167643	-1	no_errors	ENST00000393743	ensembl	human	known	70_37	missense	SNP	0.001	A
DENND2D	79961	genome.wustl.edu	37	1	111731372	111731372	+	Missense_Mutation	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:111731372G>C	ENST00000357640.4	-	10	1280	c.1051C>G	c.(1051-1053)Cag>Gag	p.Q351E	DENND2D_ENST00000369752.5_Missense_Mutation_p.Q348E	NM_024901.3	NP_079177.2	Q9H6A0	DEN2D_HUMAN	DENN/MADD domain containing 2D	351					positive regulation of Rab GTPase activity (GO:0032851)	cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(1)|kidney(7)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	25		all_cancers(81;0.00198)|all_epithelial(167;0.000686)|all_lung(203;0.00318)|Lung NSC(277;0.00499)		Lung(183;0.0162)|Colorectal(144;0.069)|all cancers(265;0.0757)|LUSC - Lung squamous cell carcinoma(189;0.0845)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.14)		ATGTCATCCTGAAGCTTCGGT	0.488																																																	0													201.0	196.0	198.0					1																	111731372		2203	4300	6503	SO:0001583	missense	79961				CCDS831.1, CCDS60219.1	1p13.3	2014-02-12	2005-08-17		ENSG00000162777	ENSG00000162777		"""DENN/MADD domain containing"""	26192	protein-coding gene	gene with protein product		615111				12477932	Standard	NM_024901		Approved	FLJ22457, RP5-1180E21.2	uc001eal.2	Q9H6A0	OTTHUMG00000012356	ENST00000357640.4:c.1051C>G	1.37:g.111731372G>C	ENSP00000350266:p.Gln351Glu		Q5T5V6|Q9BSU0	Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.Q351E	ENST00000357640.4	37	c.1051	CCDS831.1	1	.	.	.	.	.	.	.	.	.	.	G	17.56	3.419999	0.62622	.	.	ENSG00000162777	ENST00000357640;ENST00000369752	T;T	0.15139	2.45;2.45	5.2	5.2	0.72013	.	0.060296	0.64402	D	0.000002	T	0.21921	0.0528	M	0.72118	2.19	0.35021	D	0.757828	D;D	0.57257	0.979;0.979	P;P	0.51487	0.671;0.625	T	0.02326	-1.1176	10	0.45353	T	0.12	-18.4575	16.5792	0.84710	0.0:0.0:1.0:0.0	.	348;351	Q9H6A0-2;Q9H6A0	.;DEN2D_HUMAN	E	351;348	ENSP00000350266:Q351E;ENSP00000358767:Q348E	ENSP00000350266:Q351E	Q	-	1	0	DENND2D	111532895	1.000000	0.71417	1.000000	0.80357	0.705000	0.40729	5.242000	0.65389	2.586000	0.87340	0.655000	0.94253	CAG	DENND2D	-	NULL		0.488	DENND2D-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DENND2D	HGNC	protein_coding	OTTHUMT00000034456.1	G	NM_024901		111731372	-1	no_errors	ENST00000357640	ensembl	human	known	70_37	missense	SNP	1.000	C
DIDO1	11083	genome.wustl.edu	37	20	61512828	61512828	+	Missense_Mutation	SNP	C	C	G			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr20:61512828C>G	ENST00000266070.4	-	16	4805	c.4480G>C	c.(4480-4482)Gag>Cag	p.E1494Q	DIDO1_ENST00000395343.1_Missense_Mutation_p.E1494Q	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1494					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					TCTTGCTCCTCCAGCTGTCTC	0.617																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)												0													95.0	93.0	94.0					20																	61512828		2203	4300	6503	SO:0001583	missense	11083			AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.4480G>C	20.37:g.61512828C>G	ENSP00000266070:p.Glu1494Gln		A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_SPOC_C,pfam_Znf_PHD-finger,superfamily_TFIIS_cen_dom,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_TFS2M,pfscan_Znf_PHD-finger	p.E1494Q	ENST00000266070.4	37	c.4480	CCDS33506.1	20	.	.	.	.	.	.	.	.	.	.	C	27.1	4.799491	0.90538	.	.	ENSG00000101191	ENST00000266070;ENST00000395343	T;T	0.10477	2.87;2.87	5.8	5.8	0.92144	.	0.000000	0.43416	D	0.000569	T	0.31358	0.0794	M	0.65320	2	0.80722	D	1	D	0.76494	0.999	D	0.66716	0.946	T	0.00168	-1.1963	10	0.33940	T	0.23	-48.9073	20.063	0.97692	0.0:1.0:0.0:0.0	.	1494	Q9BTC0	DIDO1_HUMAN	Q	1494	ENSP00000266070:E1494Q;ENSP00000378752:E1494Q	ENSP00000266070:E1494Q	E	-	1	0	DIDO1	60983273	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.789000	0.69029	2.735000	0.93741	0.655000	0.94253	GAG	DIDO1	-	NULL		0.617	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIDO1	HGNC	protein_coding	OTTHUMT00000080091.2	C	NM_080796		61512828	-1	no_errors	ENST00000266070	ensembl	human	known	70_37	missense	SNP	1.000	G
DKK4	27121	genome.wustl.edu	37	8	42231857	42231857	+	Silent	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr8:42231857G>A	ENST00000220812.2	-	4	622	c.436C>T	c.(436-438)Ctg>Ttg	p.L146L		NM_014420.2	NP_055235.1	Q9UBT3	DKK4_HUMAN	dickkopf WNT signaling pathway inhibitor 4	146	DKK-type Cys-2.				multicellular organismal development (GO:0007275)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)				NS(1)|endometrium(1)|large_intestine(7)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	14	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;2.58e-12)|Lung NSC(13;4.24e-11)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.1)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;3.48e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00523)|Lung(22;0.00597)|LUSC - Lung squamous cell carcinoma(45;0.024)			AAAGTTCTCAGACAACTTTCT	0.468																																																	0													79.0	77.0	78.0					8																	42231857		2203	4300	6503	SO:0001819	synonymous_variant	27121			AF177397	CCDS6130.1	8p11.2-p11.1	2013-05-15	2013-05-15		ENSG00000104371	ENSG00000104371			2894	protein-coding gene	gene with protein product		605417	"""dickkopf (Xenopus laevis) homolog 4"", ""dickkopf homolog 4 (Xenopus laevis)"""			10570958, 11701963	Standard	NM_014420		Approved		uc003xpb.3	Q9UBT3	OTTHUMG00000164167	ENST00000220812.2:c.436C>T	8.37:g.42231857G>A			Q3KNX0|Q9Y4C3	Silent	SNP	pfam_Dickkopf_N,pfam_Prokineticin_domain	p.L146	ENST00000220812.2	37	c.436	CCDS6130.1	8																																																																																			DKK4	-	pfam_Prokineticin_domain		0.468	DKK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DKK4	HGNC	protein_coding	OTTHUMT00000377563.1	G			42231857	-1	no_errors	ENST00000220812	ensembl	human	known	70_37	silent	SNP	1.000	A
DNAH3	55567	genome.wustl.edu	37	16	20994204	20994204	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr16:20994204C>T	ENST00000261383.3	-	49	7697	c.7698G>A	c.(7696-7698)atG>atA	p.M2566I	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2566	AAA 4. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CTATTGGACTCATGGCTAATG	0.527																																																	0													100.0	97.0	98.0					16																	20994204		2201	4300	6501	SO:0001583	missense	55567			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.7698G>A	16.37:g.20994204C>T	ENSP00000261383:p.Met2566Ile		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Prefoldin,smart_AAA+_ATPase	p.M2566I	ENST00000261383.3	37	c.7698	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	C	28.8	4.954138	0.92726	.	.	ENSG00000158486	ENST00000261383	T	0.39997	1.05	5.83	5.83	0.93111	Dynein heavy chain, P-loop containing D4 domain (1);	0.048426	0.85682	D	0.000000	T	0.69214	0.3086	M	0.92367	3.3	0.80722	D	1	D	0.63046	0.992	P	0.54544	0.755	T	0.77008	-0.2747	10	0.72032	D	0.01	.	20.1381	0.98040	0.0:1.0:0.0:0.0	.	2566	Q8TD57	DYH3_HUMAN	I	2566	ENSP00000261383:M2566I	ENSP00000261383:M2566I	M	-	3	0	DNAH3	20901705	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.801000	0.55545	2.769000	0.95229	0.655000	0.94253	ATG	DNAH3	-	NULL		0.527	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	C	NM_017539		20994204	-1	no_errors	ENST00000261383	ensembl	human	known	70_37	missense	SNP	1.000	T
DNAH8	1769	genome.wustl.edu	37	6	38830105	38830105	+	Missense_Mutation	SNP	C	C	G			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr6:38830105C>G	ENST00000359357.3	+	42	5784	c.5530C>G	c.(5530-5532)Ccc>Gcc	p.P1844A	DNAH8_ENST00000441566.1_Missense_Mutation_p.P1844A|DNAH8_ENST00000449981.2_Missense_Mutation_p.P2061A			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	1844	AAA 1. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GGGAGGTGCTCCCGCAGGACC	0.463																																																	0													128.0	122.0	124.0					6																	38830105		2203	4300	6503	SO:0001583	missense	1769			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.5530C>G	6.37:g.38830105C>G	ENSP00000352312:p.Pro1844Ala		O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.P1844A	ENST00000359357.3	37	c.5530		6	.	.	.	.	.	.	.	.	.	.	C	29.1	4.980034	0.92982	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.15139	2.45;2.45;2.45	6.04	6.04	0.98038	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.52058	0.1711	H	0.94698	3.57	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.64373	-0.6423	10	0.87932	D	0	.	20.5948	0.99439	0.0:1.0:0.0:0.0	.	1844	Q96JB1	DYH8_HUMAN	A	2049;2049;1844;1844	ENSP00000333363:P2049A;ENSP00000352312:P1844A;ENSP00000402294:P1844A	ENSP00000333363:P2049A	P	+	1	0	DNAH8	38938083	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	5.851000	0.69481	2.873000	0.98535	0.563000	0.77884	CCC	DNAH8	-	smart_AAA+_ATPase		0.463	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	HGNC	protein_coding	OTTHUMT00000043574.1	C	NM_001206927		38830105	+1	no_errors	ENST00000359357	ensembl	human	known	70_37	missense	SNP	1.000	G
DNM3	26052	genome.wustl.edu	37	1	172348158	172348158	+	Splice_Site	SNP	G	G	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:172348158G>T	ENST00000355305.5	+	18	2069	c.1912G>T	c.(1912-1914)Gct>Tct	p.A638S	DNM3_ENST00000367731.1_Splice_Site_p.A628S|DNM3_ENST00000358155.4_Splice_Site_p.A632S			Q9UQ16	DYN3_HUMAN	dynamin 3	638					endocytosis (GO:0006897)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|synapse assembly (GO:0007416)	dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(16)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						CTTCTTTTAGGCTGAAAATGA	0.383																																																	0													65.0	66.0	65.0					1																	172348158		1944	4175	6119	SO:0001630	splice_region_variant	26052			AL136712	CCDS44276.1, CCDS60356.1	1q24.1	2013-01-10			ENSG00000197959	ENSG00000197959		"""Pleckstrin homology (PH) domain containing"""	29125	protein-coding gene	gene with protein product	"""Dyna III"""	611445				10048485	Standard	NM_015569		Approved	KIAA0820	uc001gie.4	Q9UQ16	OTTHUMG00000034913	ENST00000355305.5:c.1912-1G>T	1.37:g.172348158G>T			A9Z1Y1|O14982|O95555|Q1MTM8|Q5W129|Q6P2G1|Q9H0P3|Q9H548|Q9NQ68|Q9NQN6	Missense_Mutation	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,pfam_Pleckstrin_homology,smart_Dynamin_GTPase,smart_Pleckstrin_homology,smart_GED,pfscan_Pleckstrin_homology,prints_Dynamin	p.A632S	ENST00000355305.5	37	c.1894		1	.	.	.	.	.	.	.	.	.	.	G	5.400	0.259029	0.10239	.	.	ENSG00000197959	ENST00000359070;ENST00000358155;ENST00000355305;ENST00000367731;ENST00000485254	D;D;D;T	0.92699	-3.09;-3.05;-3.05;-0.82	5.49	0.507	0.16967	.	0.520042	0.17717	N	0.164381	T	0.72003	0.3407	N	0.20807	0.61	0.80722	D	1	B;B	0.18166	0.005;0.026	B;B	0.19391	0.025;0.015	T	0.58284	-0.7663	9	.	.	.	.	9.1863	0.37172	0.4794:0.0:0.5206:0.0	.	628;632	Q9UQ16-2;Q9UQ16-3	.;.	S	642;632;638;628;1	ENSP00000350876:A632S;ENSP00000347457:A638S;ENSP00000356705:A628S;ENSP00000429165:A1S	.	A	+	1	0	DNM3	170614781	1.000000	0.71417	0.982000	0.44146	0.686000	0.39977	0.571000	0.23669	0.084000	0.17077	-0.378000	0.06908	GCT	DNM3	-	NULL		0.383	DNM3-003	NOVEL	not_organism_supported|basic	protein_coding	DNM3	HGNC	protein_coding	OTTHUMT00000084531.1	G	NM_015569	Missense_Mutation	172348158	+1	no_errors	ENST00000358155	ensembl	human	known	70_37	missense	SNP	1.000	T
DOCK9	23348	genome.wustl.edu	37	13	99481710	99481710	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr13:99481710C>T	ENST00000376460.1	-	43	4827	c.4747G>A	c.(4747-4749)Gcc>Acc	p.A1583T	DOCK9-AS1_ENST00000439367.1_RNA|DOCK9_ENST00000339416.2_Missense_Mutation_p.A1584T|DOCK9_ENST00000448493.2_3'UTR	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	1584					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TTCATCTGGGCGGTGGCCATT	0.547																																																	0													85.0	83.0	83.0					13																	99481710		2098	4230	6328	SO:0001583	missense	23348			AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.4747G>A	13.37:g.99481710C>T	ENSP00000365643:p.Ala1583Thr		B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Missense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.A1584T	ENST00000376460.1	37	c.4750	CCDS45062.1	13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.373236|5.373236	0.95923|0.95923	.|.	.|.	ENSG00000088387|ENSG00000088387	ENST00000376460;ENST00000357329;ENST00000376455;ENST00000400235;ENST00000428223;ENST00000400220;ENST00000339416;ENST00000376453;ENST00000340449|ENST00000400228	T;T;T|.	0.69175|.	2.3;2.39;-0.38|.	5.77|5.77	5.77|5.77	0.91146|0.91146	.|.	0.052677|.	0.85682|.	D|.	0.000000|.	D|D	0.84624|0.84624	0.5513|0.5513	M|M	0.87547|0.87547	2.89|2.89	0.80722|0.80722	D|D	1|1	D;D;D;D;D;P;D;D|.	0.63880|.	0.991;0.962;0.967;0.984;0.993;0.782;0.967;0.98|.	P;P;P;P;P;B;P;P|.	0.59761|.	0.691;0.734;0.631;0.651;0.863;0.261;0.631;0.796|.	D|D	0.85147|0.85147	0.0984|0.0984	10|5	0.87932|.	D|.	0|.	.|.	20.3627|20.3627	0.98863|0.98863	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1584;303;227;1583;227;1584;276;226|.	A8MWZ5;B7Z6H5;B7Z2J2;Q9BZ29-5;Q5JUD8;Q9BZ29;B7Z6G9;F5H1Q4|.	.;.;.;.;.;DOCK9_HUMAN;.;.|.	T|H	1583;1584;1576;1584;1583;514;1584;226;227|170	ENSP00000365643:A1583T;ENSP00000341086:A1584T;ENSP00000344702:A227T|.	ENSP00000341086:A1584T|.	A|R	-|-	1|2	0|0	DOCK9|DOCK9	98279711|98279711	1.000000|1.000000	0.71417|0.71417	0.977000|0.977000	0.42913|0.42913	0.996000|0.996000	0.88848|0.88848	5.667000|5.667000	0.68067|0.68067	2.885000|2.885000	0.99019|0.99019	0.655000|0.655000	0.94253|0.94253	GCC|CGC	DOCK9	-	NULL		0.547	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK9	HGNC	protein_coding	OTTHUMT00000045566.1	C	NM_015296		99481710	-1	no_errors	ENST00000339416	ensembl	human	known	70_37	missense	SNP	0.998	T
DPP6	1804	genome.wustl.edu	37	7	154519587	154519587	+	Missense_Mutation	SNP	G	G	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr7:154519587G>T	ENST00000377770.3	+	8	1014	c.873G>T	c.(871-873)tgG>tgT	p.W291C	DPP6_ENST00000404039.1_Missense_Mutation_p.W227C|DPP6_ENST00000427557.1_Missense_Mutation_p.W184C|DPP6_ENST00000332007.3_Missense_Mutation_p.W229C			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	291					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			TCAGTGACTGGCTGTATGAAG	0.438																																					NSCLC(125;1384 1783 2490 7422 34254)												0													118.0	114.0	115.0					7																	154519587		1989	4177	6166	SO:0001583	missense	1804			M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.873G>T	7.37:g.154519587G>T	ENSP00000367001:p.Trp291Cys			Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9,pfam_PD40	p.W291C	ENST00000377770.3	37	c.873		7	.	.	.	.	.	.	.	.	.	.	G	17.86	3.492289	0.64074	.	.	ENSG00000130226	ENST00000404039;ENST00000377770;ENST00000332007;ENST00000427557	T;T;T;T	0.55413	0.52;0.52;0.52;0.52	5.22	5.22	0.72569	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.82185	0.4982	H	0.96208	3.785	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.996;0.998;0.998	D	0.88252	0.2917	10	0.87932	D	0	-12.4876	18.7854	0.91952	0.0:0.0:1.0:0.0	.	184;229;291;227	E9PDL2;P42658-2;P42658;E9PF59	.;.;DPP6_HUMAN;.	C	227;291;229;184	ENSP00000385578:W227C;ENSP00000367001:W291C;ENSP00000328226:W229C;ENSP00000397303:W184C	ENSP00000328226:W229C	W	+	3	0	DPP6	154150520	1.000000	0.71417	1.000000	0.80357	0.487000	0.33371	9.468000	0.97676	2.432000	0.82394	0.579000	0.79373	TGG	DPP6	-	pfam_Peptidase_S9B		0.438	DPP6-003	KNOWN	basic|appris_principal	protein_coding	DPP6	HGNC	protein_coding	OTTHUMT00000322932.1	G	NM_130797		154519587	+1	no_errors	ENST00000377770	ensembl	human	known	70_37	missense	SNP	1.000	T
DROSHA	29102	genome.wustl.edu	37	5	31526312	31526313	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	CT	CT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr5:31526312_31526313delCT	ENST00000511367.2	-	4	971_972	c.727_728delAG	c.(727-729)aggfs	p.R243fs	DROSHA_ENST00000513349.1_Frame_Shift_Del_p.R243fs|DROSHA_ENST00000504361.1_5'Flank|DROSHA_ENST00000442743.1_Frame_Shift_Del_p.R243fs|DROSHA_ENST00000344624.3_Frame_Shift_Del_p.R243fs	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	243	Arg-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						GGACCGATGCCTCTCACCTCGC	0.574																																																	0																																										SO:0001589	frameshift_variant	29102			AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.727_728delAG	5.37:g.31526314_31526315delCT	ENSP00000425979:p.Arg243fs		E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Frame_Shift_Del	DEL	pfam_RNase_III_dom,pfam_Ds-RNA-bd,superfamily_RNase_III_dom,smart_RNase_III_dom,smart_Ds-RNA-bd,pfscan_Ds-RNA-bd,pfscan_RNase_III_dom	p.R243fs	ENST00000511367.2	37	c.728_727	CCDS47195.1	5																																																																																			DROSHA	-	NULL		0.574	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DROSHA	HGNC	protein_coding	OTTHUMT00000366561.3	CT	NM_013235		31526313	-1	no_errors	ENST00000344624	ensembl	human	known	70_37	frame_shift_del	DEL	1.000:0.998	-
EDARADD	128178	genome.wustl.edu	37	1	236577572	236577572	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:236577572C>T	ENST00000334232.4	+	3	300	c.133C>T	c.(133-135)Ccc>Tcc	p.P45S	EDARADD_ENST00000359362.5_Missense_Mutation_p.P35S	NM_145861.2	NP_665860.2	Q8WWZ3	EDAD_HUMAN	EDAR-associated death domain	45					cell differentiation (GO:0030154)|hair follicle development (GO:0001942)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)|trachea gland development (GO:0061153)	cytoplasm (GO:0005737)				endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|stomach(1)	12	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.0232)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			AGACAAATATCCCATTCAAGA	0.323																																																	0													99.0	103.0	102.0					1																	236577572		2203	4299	6502	SO:0001583	missense	128178			AY028914	CCDS1610.1, CCDS31065.1	1q42.3	2013-05-22			ENSG00000186197	ENSG00000186197			14341	protein-coding gene	gene with protein product		606603				11780064	Standard	NM_145861		Approved		uc001hxu.1	Q8WWZ3	OTTHUMG00000039954	ENST00000334232.4:c.133C>T	1.37:g.236577572C>T	ENSP00000335076:p.Pro45Ser		A2VCK5|A8K7B5|B1AL54|B9ZVW5|Q5VYJ7	Missense_Mutation	SNP	pfam_Death,superfamily_DEATH-like	p.P45S	ENST00000334232.4	37	c.133	CCDS1610.1	1	.	.	.	.	.	.	.	.	.	.	C	17.27	3.348016	0.61183	.	.	ENSG00000186197	ENST00000439430;ENST00000334232;ENST00000359362	T;T;D	0.83335	-0.34;-1.15;-1.71	4.72	3.79	0.43588	.	0.000000	0.48767	U	0.000163	D	0.82614	0.5075	M	0.71581	2.175	0.40232	D	0.977857	P;D	0.56287	0.58;0.975	B;P	0.45712	0.196;0.491	D	0.84495	0.0613	10	0.87932	D	0	-13.2909	10.6161	0.45451	0.0:0.8052:0.1948:0.0	.	35;45	A8K7B5;Q8WWZ3	.;EDAD_HUMAN	S	23;45;35	ENSP00000405815:P23S;ENSP00000335076:P45S;ENSP00000352320:P35S	ENSP00000335076:P45S	P	+	1	0	EDARADD	234644195	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	2.295000	0.43576	1.188000	0.43014	0.563000	0.77884	CCC	EDARADD	-	NULL		0.323	EDARADD-001	KNOWN	basic|CCDS	protein_coding	EDARADD	HGNC	protein_coding	OTTHUMT00000096368.1	C	NM_145861		236577572	+1	no_errors	ENST00000334232	ensembl	human	known	70_37	missense	SNP	1.000	T
ENHO	375704	genome.wustl.edu	37	9	34521603	34521603	+	Missense_Mutation	SNP	A	A	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr9:34521603A>T	ENST00000399775.2	-	2	516	c.91T>A	c.(91-93)Tgc>Agc	p.C31S	RP11-296L22.8_ENST00000439960.1_RNA	NM_198573.2	NP_940975.2	Q6UWT2	ENHO_HUMAN	energy homeostasis associated	31						extracellular region (GO:0005576)				endometrium(1)|lung(1)	2						CAGGCCCAGCAGAGGATGACC	0.642																																																	0													44.0	62.0	56.0					9																	34521603		2182	4282	6464	SO:0001583	missense	375704			BC022101	CCDS43795.1	9p13.3	2008-12-10	2008-12-10	2008-12-10	ENSG00000168913	ENSG00000168913			24838	protein-coding gene	gene with protein product	"""adropin"""		"""chromosome 9 open reading frame 165"""	C9orf165		12975309, 19041763	Standard	NM_198573		Approved	UNQ470	uc003zun.1	Q6UWT2	OTTHUMG00000159589	ENST00000399775.2:c.91T>A	9.37:g.34521603A>T	ENSP00000382675:p.Cys31Ser		Q8N666	Missense_Mutation	SNP	NULL	p.C31S	ENST00000399775.2	37	c.91	CCDS43795.1	9	.	.	.	.	.	.	.	.	.	.	A	15.73	2.919671	0.52653	.	.	ENSG00000168913	ENST00000399775;ENST00000303992	.	.	.	5.12	3.9	0.45041	.	0.164513	0.29451	N	0.012114	T	0.29716	0.0742	.	.	.	0.25098	N	0.990806	B	0.15930	0.015	B	0.08055	0.003	T	0.22173	-1.0224	8	0.87932	D	0	.	7.5125	0.27581	0.8088:0.0:0.0:0.1912	.	31	Q6UWT2	ENHO_HUMAN	S	31	.	ENSP00000305955:C31S	C	-	1	0	ENHO	34511603	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.087000	0.57671	1.929000	0.55896	0.454000	0.30748	TGC	ENHO	-	NULL		0.642	ENHO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENHO	HGNC	protein_coding	OTTHUMT00000356348.1	A	NM_198573		34521603	-1	no_errors	ENST00000399775	ensembl	human	known	70_37	missense	SNP	1.000	T
ENPP3	5169	genome.wustl.edu	37	6	131962640	131962640	+	Missense_Mutation	SNP	G	G	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr6:131962640G>T	ENST00000414305.1	+	3	452	c.124G>T	c.(124-126)Ggg>Tgg	p.G42W	ENPP3_ENST00000357639.3_Missense_Mutation_p.G42W|ENPP3_ENST00000427148.2_Missense_Mutation_p.G8W|ENPP3_ENST00000358229.5_Missense_Mutation_p.G42W|ENPP3_ENST00000543135.1_Missense_Mutation_p.G8W|ENPP3_ENST00000470930.1_3'UTR|RNU4-18P_ENST00000516751.1_RNA			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3	42					immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		ATTAGGCCTGGGGCTTGGACT	0.358																																																	0													93.0	94.0	93.0					6																	131962640		2203	4300	6503	SO:0001583	missense	5169			AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.124G>T	6.37:g.131962640G>T	ENSP00000406261:p.Gly42Trp		Q5JTL3	Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,pfam_Somatomedin_B_dom,pfam_DNA/RNA_non-sp_Endonuclease,superfamily_Alkaline_phosphatase_core,smart_Somatomedin_B_dom,smart_DNA/RNA_non-sp_Endonuclease,smart_Extracellular_endonuc_su_A,pfscan_Somatomedin_B_dom	p.G42W	ENST00000414305.1	37	c.124	CCDS5148.1	6	.	.	.	.	.	.	.	.	.	.	G	15.58	2.876202	0.51801	.	.	ENSG00000154269	ENST00000414305;ENST00000357639;ENST00000543135;ENST00000427148;ENST00000358229	T;T;T;T;T	0.75477	-0.84;-0.84;-0.82;-0.94;-0.91	5.74	3.96	0.45880	.	0.222162	0.31347	N	0.007818	T	0.70046	0.3179	M	0.65498	2.005	0.36472	D	0.867349	D	0.63046	0.992	P	0.54499	0.754	T	0.74359	-0.3691	10	0.87932	D	0	-2.9619	7.976	0.30155	0.085:0.1608:0.7542:0.0	.	42	O14638	ENPP3_HUMAN	W	42;42;8;8;42	ENSP00000406261:G42W;ENSP00000350265:G42W;ENSP00000440810:G8W;ENSP00000399269:G8W;ENSP00000350964:G42W	ENSP00000350265:G42W	G	+	1	0	ENPP3	132004333	1.000000	0.71417	0.832000	0.32986	0.593000	0.36681	2.515000	0.45512	0.765000	0.33221	0.655000	0.94253	GGG	ENPP3	-	NULL		0.358	ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP3	HGNC	protein_coding	OTTHUMT00000043627.2	G			131962640	+1	no_errors	ENST00000357639	ensembl	human	known	70_37	missense	SNP	0.992	T
AC140481.2	0	genome.wustl.edu	37	2	131334526	131334526	+	Silent	SNP	C	C	G			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr2:131334526C>G	ENST00000409982.1	+	3	651	c.480C>G	c.(478-480)gcC>gcG	p.A160A	AC140481.2_ENST00000409793.1_Intron																							CCAGCCAAGCCTGAGGTGTCG	0.577																																																	0																																										SO:0001819	synonymous_variant	0																														ENST00000409982.1:c.480C>G	2.37:g.131334526C>G				Silent	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	p.A160	ENST00000409982.1	37	c.480		2																																																																																			AC140481.2	-	NULL		0.577	AC140481.2-003	PUTATIVE	basic|appris_candidate_longest	protein_coding	ENSG00000183292	Clone_based_vega_gene	protein_coding	OTTHUMT00000333364.2	C			131334526	+1	no_errors	ENST00000409982	ensembl	human	putative	70_37	silent	SNP	0.016	G
SLC9A3	6550	genome.wustl.edu	37	5	472823	472823	+	IGR	SNP	G	G	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr5:472823G>T	ENST00000264938.3	-	0	2584				CTD-2228K2.7_ENST00000606319.1_RNA|CTD-2228K2.5_ENST00000510604.1_Missense_Mutation_p.F76L|CTD-2228K2.7_ENST00000607286.1_RNA|CTD-2228K2.5_ENST00000510714.1_5'UTR|CTD-2228K2.5_ENST00000342584.3_Missense_Mutation_p.F76L	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3						ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)			NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			CGAGGGCCTGGAAACGGCGCT	0.662																																																	0																																										SO:0001628	intergenic_variant	0				CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315		5.37:g.472823G>T			B7ZKR2|E9PF67|Q3MIW3	Missense_Mutation	SNP	NULL	p.F76L	ENST00000264938.3	37	c.228	CCDS3855.1	5	.	.	.	.	.	.	.	.	.	.	g	9.764	1.170887	0.21621	.	.	ENSG00000188242	ENST00000342584;ENST00000510604	.	.	.	2.25	-0.888	0.10583	.	.	.	.	.	T	0.45175	0.1329	.	.	.	.	.	.	.	.	.	.	.	.	T	0.54794	-0.8240	4	0.87932	D	0	.	6.193	0.20534	0.4378:0.0:0.5622:0.0	.	.	.	.	L	76	.	ENSP00000345223:F76L	F	-	3	2	CTD-2228K2.5	525823	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.086000	0.11233	-0.104000	0.12154	-0.511000	0.04467	TTC	CTD-2228K2.5	-	NULL		0.662	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000188242	Clone_based_vega_gene	protein_coding	OTTHUMT00000206677.2	G	NM_004174		472823	-1	no_errors	ENST00000342584	ensembl	human	putative	70_37	missense	SNP	0.001	T
ZNF433	163059	genome.wustl.edu	37	19	12137825	12137825	+	Intron	SNP	C	C	G			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr19:12137825C>G	ENST00000344980.6	-	1	174				CTD-2006C1.2_ENST00000476474.1_RNA|CTD-2006C1.10_ENST00000547473.1_Intron|RNA5SP465_ENST00000391195.1_RNA|ZNF433_ENST00000419886.2_Intron|CTD-2006C1.2_ENST00000406892.2_RNA	NM_001080411.1	NP_001073880.1	Q8N7K0	ZN433_HUMAN	zinc finger protein 433						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(1)|prostate(1)|skin(1)	14						ttaataagatcaaaatttggg	0.363																																																	0																																										SO:0001627	intron_variant	0			AK098300	CCDS45983.1	19p13.13	2013-01-08			ENSG00000197647	ENSG00000197647		"""Zinc fingers, C2H2-type"", ""-"""	20811	protein-coding gene	gene with protein product							Standard	NM_001080411		Approved	FLJ40981	uc002msy.1	Q8N7K0	OTTHUMG00000156427	ENST00000344980.6:c.3+8526G>C	19.37:g.12137825C>G			Q86VX3	RNA	SNP	-	NULL	ENST00000344980.6	37	NULL	CCDS45983.1	19	.	.	.	.	.	.	.	.	.	.	c	12.27	1.887475	0.33348	.	.	ENSG00000219665	ENST00000406892	.	.	.	.	.	.	.	.	.	.	.	T	0.54255	0.1847	.	.	.	0.32864	D	0.508282	.	.	.	.	.	.	T	0.63695	-0.6579	3	0.87932	D	0	.	.	.	.	.	.	.	.	M	107	.	ENSP00000384993:I107M	I	+	3	3	CTD-2006C1.2	11998825	0.500000	0.26091	0.628000	0.29241	0.627000	0.37826	0.116000	0.15561	0.119000	0.18210	0.121000	0.15741	ATC	CTD-2006C1.2	-	-		0.363	ZNF433-005	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000219665	Clone_based_vega_gene	protein_coding	OTTHUMT00000403716.1	C	NM_152602		12137825	+1	no_errors	ENST00000406892	ensembl	human	known	70_37	rna	SNP	0.660	G
RP11-353N4.5	0	genome.wustl.edu	37	1	149651005	149651008	+	lincRNA	DEL	TTTG	TTTG	-	rs142919803|rs373013964	byFrequency	TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	TTTG	TTTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:149651005_149651008delTTTG	ENST00000608683.1	-	0	378																											TTTAATTTCCTTTGTTTGAATGAA	0.279														549	0.109625	0.0454	0.1542	5008	,	,		17911	0.0476		0.1849	False		,,,				2504	0.1513																0																																												0																															1.37:g.149651009_149651012delTTTG				RNA	DEL	-	NULL	ENST00000608683.1	37	NULL		1																																																																																			RP11-277L2.2	-	-		0.279	RP11-353N4.5-006	KNOWN	basic	lincRNA	ENSG00000232151	Clone_based_vega_gene	lincRNA	OTTHUMT00000472690.1	TTTG			149651008	+1	no_errors	ENST00000445225	ensembl	human	known	70_37	rna	DEL	0.378:0.380:0.381:0.380	-
GLTPP1	645312	genome.wustl.edu	37	11	18210800	18210800	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr11:18210800G>A	ENST00000527671.1	-	1	242	c.118C>T	c.(118-120)Cgc>Tgc	p.R40C																	lung(6)	6						GGAGCAGAGCGGCTCAAAGTA	0.552																																																	0																																										SO:0001583	missense	0																														ENST00000527671.1:c.118C>T	11.37:g.18210800G>A	ENSP00000436221:p.Arg40Cys			Missense_Mutation	SNP	NULL	p.R40C	ENST00000527671.1	37	c.118		11	.	.	.	.	.	.	.	.	.	.	g	6.386	0.439420	0.12104	.	.	ENSG00000255470	ENST00000527671	.	.	.	1.77	0.378	0.16204	.	.	.	.	.	T	0.45276	0.1334	.	.	.	.	.	.	.	.	.	.	.	.	T	0.54029	-0.8354	4	0.87932	D	0	.	5.2357	0.15445	0.2948:0.0:0.7052:0.0	.	.	.	.	C	40	.	ENSP00000436221:R40C	R	-	1	0	RP11-113D6.6	18167376	1.000000	0.71417	0.451000	0.26982	0.449000	0.32228	5.402000	0.66332	0.100000	0.17581	0.454000	0.30748	CGC	RP11-113D6.6	-	NULL		0.552	RP11-113D6.6-001	NOVEL	basic|appris_principal	protein_coding	ENSG00000255470	Clone_based_vega_gene	protein_coding	OTTHUMT00000389787.1	G			18210800	-1	no_errors	ENST00000527671	ensembl	human	novel	70_37	missense	SNP	1.000	A
HEXA	3073	genome.wustl.edu	37	15	72638463	72638463	+	Intron	SNP	C	C	G			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr15:72638463C>G	ENST00000268097.5	-	12	1925				HEXA_ENST00000567159.1_Intron|RP11-106M3.2_ENST00000379915.4_RNA|HEXA_ENST00000566304.1_Intron|RP11-106M3.3_ENST00000570175.1_RNA|HEXA_ENST00000457859.2_Intron	NM_000520.4	NP_000511.2	P06865	HEXA_HUMAN	hexosaminidase A (alpha polypeptide)						carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-N-acetylhexosaminidase activity (GO:0004563)|protein heterodimerization activity (GO:0046982)			breast(2)|cervix(1)|endometrium(3)|kidney(3)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	24						CCTGCTCTCTCTCAGGCCTGA	0.547																																																	0																																										SO:0001627	intron_variant	0			M13520	CCDS10243.1	15q24.1	2012-10-02			ENSG00000213614	ENSG00000213614	3.2.1.52		4878	protein-coding gene	gene with protein product	"""Tay Sachs disease"", ""GM2 gangliosidosis"""	606869				2952641, 3013851	Standard	NM_000520		Approved		uc002aun.4	P06865	OTTHUMG00000133445	ENST00000268097.5:c.1421+112G>C	15.37:g.72638463C>G			B4DKE7|E7ENH7|Q53HS8|Q6AI32	RNA	SNP	-	NULL	ENST00000268097.5	37	NULL	CCDS10243.1	15																																																																																			RP11-106M3.3	-	-		0.547	HEXA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000261460	Clone_based_vega_gene	protein_coding	OTTHUMT00000257317.2	C	NM_000520		72638463	+1	no_errors	ENST00000570175	ensembl	human	known	70_37	rna	SNP	0.007	G
MAGEA5	4104	genome.wustl.edu	37	X	151283808	151283808	+	RNA	SNP	A	A	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chrX:151283808A>T	ENST00000509345.2	-	0	528																											GGGATGGCGGAGGCTCCCTGA	0.622																																																	0													70.0	67.0	68.0					X																	151283808		2203	4300	6503			0																															X.37:g.151283808A>T				RNA	SNP	-	NULL	ENST00000509345.2	37	NULL		X																																																																																			RP11-1007I13.4	-	-		0.622	RP11-1007I13.4-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000266560	Clone_based_vega_gene	processed_transcript	OTTHUMT00000445981.1	A			151283808	-1	no_errors	ENST00000509345	ensembl	human	known	70_37	rna	SNP	0.000	T
ESRRB	2103	genome.wustl.edu	37	14	76957920	76957920	+	Silent	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr14:76957920C>T	ENST00000509242.1	+	7	1016	c.918C>T	c.(916-918)atC>atT	p.I306I	ESRRB_ENST00000556177.1_Silent_p.I306I|ESRRB_ENST00000261532.7_Silent_p.I306I|ESRRB_ENST00000380887.2_Silent_p.I306I	NM_004452.3	NP_004443.3	O95718	ERR2_HUMAN	estrogen-related receptor beta	306					gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|trophectodermal cell proliferation (GO:0001834)|trophectodermal cellular morphogenesis (GO:0001831)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding (GO:0043565)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(4)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(234;0.0213)		AGGACTACATCATGGATGAGG	0.602																																																	0													60.0	47.0	51.0					14																	76957920		2201	4299	6500	SO:0001819	synonymous_variant	2103			X51417	CCDS9850.1, CCDS9850.2	14q24.3	2013-01-16				ENSG00000119715		"""Nuclear hormone receptors"""	3473	protein-coding gene	gene with protein product		602167	"""deafness, autosomal recessive 35"""	ESRL2, DFNB35		3267207, 9344655, 18179891	Standard	NM_004452		Approved	ERR2, ERRbeta, NR3B2, ERRb	uc001xsr.3	O95718		ENST00000509242.1:c.918C>T	14.37:g.76957920C>T			A2VDJ2|B6ZGU4|Q5F0P7|Q5F0P8|Q9HCB4	Silent	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.I306	ENST00000509242.1	37	c.918	CCDS9850.2	14																																																																																			ESRRB	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core		0.602	ESRRB-003	KNOWN	basic|CCDS	protein_coding	ESRRB	HGNC	protein_coding	OTTHUMT00000360663.1	C			76957920	+1	no_errors	ENST00000380887	ensembl	human	known	70_37	silent	SNP	1.000	T
EYS	346007	genome.wustl.edu	37	6	66005999	66005999	+	Missense_Mutation	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr6:66005999G>C	ENST00000370621.3	-	12	2306	c.1780C>G	c.(1780-1782)Ctt>Gtt	p.L594V	EYS_ENST00000503581.1_Missense_Mutation_p.L594V|EYS_ENST00000370616.2_Missense_Mutation_p.L594V			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	594	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						ATGTAACTAAGAGAACAGCTG	0.348																																																	0													95.0	71.0	79.0					6																	66005999		692	1590	2282	SO:0001583	missense	346007				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.1780C>G	6.37:g.66005999G>C	ENSP00000359655:p.Leu594Val		A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.L594V	ENST00000370621.3	37	c.1780		6	.	.	.	.	.	.	.	.	.	.	.	2.084	-0.410106	0.04799	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	T;T;T	0.19938	2.11;2.11;2.11	4.89	2.06	0.26882	.	.	.	.	.	T	0.04092	0.0114	N	0.08118	0	0.09310	N	1	P	0.45957	0.869	P	0.45276	0.475	T	0.24548	-1.0157	9	0.37606	T	0.19	.	5.7216	0.17990	0.1786:0.1599:0.6615:0.0	.	594	Q5T1H1-1	.	V	594	ENSP00000424243:L594V;ENSP00000359655:L594V;ENSP00000359650:L594V	ENSP00000359650:L594V	L	-	1	0	EYS	66062720	0.007000	0.16637	0.000000	0.03702	0.232000	0.25224	0.939000	0.28978	0.118000	0.18165	0.591000	0.81541	CTT	EYS	-	smart_EG-like_dom,smart_EGF-like_Ca-bd,pfscan_EG-like_dom		0.348	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	G	XM_294050		66005999	-1	no_errors	ENST00000370616	ensembl	human	known	70_37	missense	SNP	0.002	C
FAM178A	55719	genome.wustl.edu	37	10	102684122	102684122	+	Missense_Mutation	SNP	A	A	G			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr10:102684122A>G	ENST00000238961.4	+	5	1906	c.1364A>G	c.(1363-1365)aAc>aGc	p.N455S	FAM178A_ENST00000370269.3_Missense_Mutation_p.N455S|FAM178A_ENST00000370271.3_Missense_Mutation_p.N455S	NM_018121.3	NP_060591.3	Q8IX21	F178A_HUMAN	family with sequence similarity 178, member A	455						chromatin (GO:0000785)|extracellular space (GO:0005615)|nucleus (GO:0005634)											AAAGCTAGCAACCTTCAGAAA	0.428																																																	0													85.0	99.0	94.0					10																	102684122		2203	4300	6503	SO:0001583	missense	55719			AF460991	CCDS7500.1, CCDS44470.1, CCDS65918.1	10q24.31	2008-07-18	2008-07-18	2008-07-18	ENSG00000119906	ENSG00000119906			17814	protein-coding gene	gene with protein product		610348	"""chromosome 10 open reading frame 6"""	C10orf6		12459258	Standard	NM_018121		Approved	FLJ10512, FLJ25012	uc001krs.3	Q8IX21	OTTHUMG00000018919	ENST00000238961.4:c.1364A>G	10.37:g.102684122A>G	ENSP00000238961:p.Asn455Ser		A8K950|B1AL17|Q5W0L8|Q6GMU6|Q9NPE8	Missense_Mutation	SNP	NULL	p.N455S	ENST00000238961.4	37	c.1364	CCDS7500.1	10	.	.	.	.	.	.	.	.	.	.	A	7.141	0.581900	0.13749	.	.	ENSG00000119906	ENST00000370271;ENST00000238961;ENST00000370269	T;T;T	0.49139	0.79;1.46;1.45	5.95	-4.94	0.03057	.	0.340721	0.25723	N	0.028724	T	0.23926	0.0579	N	0.24115	0.695	0.29396	N	0.862257	B;B;B;B	0.16603	0.006;0.0;0.0;0.018	B;B;B;B	0.14578	0.005;0.001;0.001;0.011	T	0.37337	-0.9710	10	0.09084	T	0.74	-0.7891	11.2088	0.48786	0.1949:0.1406:0.6646:0.0	.	104;455;455;455	Q96LW0;Q8IX21;B1AL17;B1AL16	.;F178A_HUMAN;.;.	S	455	ENSP00000359294:N455S;ENSP00000238961:N455S;ENSP00000359292:N455S	ENSP00000238961:N455S	N	+	2	0	FAM178A	102674112	0.524000	0.26282	0.955000	0.39395	0.709000	0.40893	-0.400000	0.07241	-0.782000	0.04541	-0.256000	0.11100	AAC	FAM178A	-	NULL		0.428	FAM178A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM178A	HGNC	protein_coding	OTTHUMT00000049897.3	A			102684122	+1	no_errors	ENST00000370269	ensembl	human	known	70_37	missense	SNP	0.956	G
BRINP3	339479	genome.wustl.edu	37	1	190066940	190066940	+	3'UTR	SNP	A	A	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:190066940A>T	ENST00000367462.3	-	0	2740				BRINP3_ENST00000534846.1_3'UTR	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3						cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											GACTGGTGTCAGTATTTATGT	0.318																																																	0																																										SO:0001624	3_prime_UTR_variant	339479			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.*208T>A	1.37:g.190066940A>T			B3KVP1|B7Z260|O95726|Q2M330	RNA	SNP	-	NULL	ENST00000367462.3	37	NULL	CCDS1373.1	1																																																																																			FAM5C	-	-		0.318	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM5C	HGNC	protein_coding	OTTHUMT00000086278.1	A	NM_199051		190066940	-1	no_errors	ENST00000484105	ensembl	human	known	70_37	rna	SNP	1.000	T
FAM9B	171483	genome.wustl.edu	37	X	8995967	8995967	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chrX:8995967C>T	ENST00000327220.5	-	7	798	c.434G>A	c.(433-435)aGa>aAa	p.R145K	FAM9B_ENST00000428477.1_Missense_Mutation_p.R145K|FAM9B_ENST00000362066.3_Missense_Mutation_p.R185K			Q8IZU0	FAM9B_HUMAN	family with sequence similarity 9, member B	145						nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|urinary_tract(1)	11		Hepatocellular(5;0.219)				CCTAACACTTCTATATTGTTG	0.313																																																	0													215.0	181.0	193.0					X																	8995967		2203	4300	6503	SO:0001583	missense	171483				CCDS14132.1	Xp22.31	2014-02-17			ENSG00000177138	ENSG00000177138			18404	protein-coding gene	gene with protein product	"""testis expressed 39B"""	300478				12213195, 21085121, 21998597, 22936694	Standard	XM_005274456		Approved	TEX39B	uc011mhu.2	Q8IZU0	OTTHUMG00000021114	ENST00000327220.5:c.434G>A	X.37:g.8995967C>T	ENSP00000318716:p.Arg145Lys		Q0IJ68|Q8N7Z8	Missense_Mutation	SNP	pfam_Cor1/Xlr/Xmr	p.R145K	ENST00000327220.5	37	c.434	CCDS14132.1	X	.	.	.	.	.	.	.	.	.	.	C	12.02	1.811830	0.32053	.	.	ENSG00000177138	ENST00000362066;ENST00000327220;ENST00000428477	.	.	.	1.31	-2.62	0.06152	.	.	.	.	.	T	0.34861	0.0912	L	0.43923	1.385	0.09310	N	1	P;P	0.42961	0.795;0.795	P;P	0.52267	0.694;0.694	T	0.30650	-0.9971	8	0.59425	D	0.04	.	2.3591	0.04303	0.3223:0.3533:0.3244:0.0	.	145;185	Q8IZU0;Q8N7Z8	FAM9B_HUMAN;.	K	185;145;145	.	ENSP00000318716:R145K	R	-	2	0	FAM9B	8955967	0.901000	0.30685	0.003000	0.11579	0.017000	0.09413	0.446000	0.21694	-0.474000	0.06862	0.292000	0.19580	AGA	FAM9B	-	pfam_Cor1/Xlr/Xmr		0.313	FAM9B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM9B	HGNC	protein_coding	OTTHUMT00000055702.2	C	NM_205849		8995967	-1	no_errors	ENST00000327220	ensembl	human	known	70_37	missense	SNP	0.002	T
FBF1	85302	genome.wustl.edu	37	17	73910890	73910890	+	Missense_Mutation	SNP	C	C	T	rs577460839	byFrequency	TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr17:73910890C>T	ENST00000586717.1	-	24	2983	c.2710G>A	c.(2710-2712)Gag>Aag	p.E904K	FBF1_ENST00000319129.5_Missense_Mutation_p.E903K|FBF1_ENST00000389570.4_Missense_Mutation_p.E904K|RP11-552F3.12_ENST00000587556.1_5'Flank			Q8TES7	FBF1_HUMAN	Fas (TNFRSF6) binding factor 1	904					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	4						CGCTCGGCCTCGCGCTCGGCC	0.701																																																	0													13.0	18.0	16.0					17																	73910890		2078	4185	6263	SO:0001583	missense	85302			AK074045	CCDS45779.1	17q25.3	2011-04-21			ENSG00000188878	ENSG00000188878			24674	protein-coding gene	gene with protein product	"""albatross"""					11347906	Standard	NM_001080542		Approved	FLJ00103, FBF-1, KIAA1863, ALB	uc002jqc.3	Q8TES7		ENST00000586717.1:c.2710G>A	17.37:g.73910890C>T	ENSP00000465132:p.Glu904Lys		B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	superfamily_HRDC-like	p.E904K	ENST00000586717.1	37	c.2710		17	.	.	.	.	.	.	.	.	.	.	C	16.87	3.241810	0.58995	.	.	ENSG00000188878	ENST00000389570;ENST00000319129;ENST00000427433	T;T	0.20881	2.04;2.04	5.58	3.55	0.40652	.	.	.	.	.	T	0.42314	0.1197	L	0.56769	1.78	0.41833	D	0.990085	D;D	0.89917	0.972;1.0	P;D	0.85130	0.552;0.997	T	0.24048	-1.0171	9	0.42905	T	0.14	-8.0856	15.7176	0.77681	0.0:0.7212:0.2788:0.0	.	918;903	Q8TES7-6;A6NLR5	.;.	K	904;903;917	ENSP00000374221:E904K;ENSP00000324292:E903K	ENSP00000324292:E903K	E	-	1	0	FBF1	71422485	0.994000	0.37717	0.004000	0.12327	0.017000	0.09413	3.438000	0.52871	0.681000	0.31386	-0.219000	0.12488	GAG	FBF1	-	NULL		0.701	FBF1-001	KNOWN	basic|appris_candidate	protein_coding	FBF1	HGNC	protein_coding	OTTHUMT00000448945.2	C	NM_001080542		73910890	-1	no_errors	ENST00000389570	ensembl	human	known	70_37	missense	SNP	0.922	T
FBLN5	10516	genome.wustl.edu	37	14	92361324	92361324	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr14:92361324C>T	ENST00000342058.4	-	5	1065	c.472G>A	c.(472-474)Gga>Aga	p.G158R	FBLN5_ENST00000556154.1_Missense_Mutation_p.G163R|FBLN5_ENST00000267620.10_Missense_Mutation_p.G199R	NM_006329.3	NP_006320.2	Q9UBX5	FBLN5_HUMAN	fibulin 5	158	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell-matrix adhesion (GO:0007160)|elastic fiber assembly (GO:0048251)|extracellular matrix organization (GO:0030198)|protein localization to cell surface (GO:0034394)|regulation of cell growth (GO:0001558)|regulation of removal of superoxide radicals (GO:2000121)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	28		all_cancers(154;0.0722)				AGCCAATATCCGTCGGTGCAG	0.537																																																	0													108.0	87.0	94.0					14																	92361324		2203	4300	6503	SO:0001583	missense	10516			AJ133490	CCDS9898.1	14q31	2014-09-17				ENSG00000140092		"""Fibulins"""	3602	protein-coding gene	gene with protein product		604580				10640802	Standard	NM_006329		Approved	EVEC, UP50, DANCE, ARMD3	uc001xzx.4	Q9UBX5		ENST00000342058.4:c.472G>A	14.37:g.92361324C>T	ENSP00000345008:p.Gly158Arg		O75966|Q6IAL4|Q6UWA3	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,superfamily_TIL_dom,smart_EGF-like_Ca-bd,smart_EG-like_dom,pfscan_EG-like_dom	p.G158R	ENST00000342058.4	37	c.472	CCDS9898.1	14	.	.	.	.	.	.	.	.	.	.	C	20.6	4.023421	0.75390	.	.	ENSG00000140092	ENST00000267620;ENST00000342058;ENST00000556154	D;D;D	0.92752	-3.1;-3.08;-3.1	5.26	5.26	0.73747	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.97561	0.9201	H	0.96518	3.835	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.98794	1.0737	10	0.87932	D	0	.	18.891	0.92403	0.0:1.0:0.0:0.0	.	199;163;158	G3XA98;G3V4U0;Q9UBX5	.;.;FBLN5_HUMAN	R	199;158;163	ENSP00000267620:G199R;ENSP00000345008:G158R;ENSP00000451982:G163R	ENSP00000267620:G255R	G	-	1	0	FBLN5	91431077	1.000000	0.71417	0.093000	0.20910	0.229000	0.25112	7.395000	0.79876	2.465000	0.83290	0.655000	0.94253	GGA	FBLN5	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EG-like_dom,pfscan_EG-like_dom		0.537	FBLN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBLN5	HGNC	protein_coding	OTTHUMT00000411787.1	C			92361324	-1	no_errors	ENST00000342058	ensembl	human	known	70_37	missense	SNP	1.000	T
FKTN	2218	genome.wustl.edu	37	9	108337407	108337407	+	Silent	SNP	T	T	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr9:108337407T>C	ENST00000223528.2	+	2	218	c.94T>C	c.(94-96)Tta>Cta	p.L32L	FKTN_ENST00000490134.1_3'UTR|FKTN_ENST00000448551.2_Silent_p.L32L|FKTN_ENST00000357998.5_Silent_p.L32L|FKTN_ENST00000602661.1_Silent_p.L32L|FKTN_ENST00000540160.1_Silent_p.L32L	NM_006731.2	NP_006722.2	O75072	FKTN_HUMAN	fukutin	32					muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|negative regulation of JNK cascade (GO:0046329)|nervous system development (GO:0007399)|regulation of protein glycosylation (GO:0060049)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	transferase activity (GO:0016740)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	25						CAAGCACTATTTATCAACAAA	0.323																																																	0													115.0	107.0	110.0					9																	108337407		2202	4300	6502	SO:0001819	synonymous_variant	2218				CCDS6766.1	9q31-q33	2014-09-17	2007-11-21	2007-11-21	ENSG00000106692	ENSG00000106692			3622	protein-coding gene	gene with protein product		607440	"""Fukuyama type congenital muscular dystrophy (fukutin)"""	FCMD		8275093, 17036286, 17044012	Standard	NM_001079802		Approved	LGMD2M	uc004bcs.3	O75072	OTTHUMG00000020425	ENST00000223528.2:c.94T>C	9.37:g.108337407T>C			B4DUX9|J3KP13|Q3MIJ1|Q96TE1|Q9P295	Silent	SNP	pfam_LicD,superfamily_Hedgehog_sig/DD-Pept_Zn-bd_dom	p.L32	ENST00000223528.2	37	c.94	CCDS6766.1	9																																																																																			FKTN	-	NULL		0.323	FKTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKTN	HGNC	protein_coding	OTTHUMT00000053505.1	T	NM_006731		108337407	+1	no_errors	ENST00000223528	ensembl	human	known	70_37	silent	SNP	1.000	C
FLG	2312	genome.wustl.edu	37	1	152278983	152278983	+	Missense_Mutation	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:152278983G>C	ENST00000368799.1	-	3	8414	c.8379C>G	c.(8377-8379)agC>agG	p.S2793R	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2793	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTCCTCCTCTGCTTGACCCCG	0.592									Ichthyosis																																								0													269.0	367.0	334.0					1																	152278983		2192	4296	6488	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.8379C>G	1.37:g.152278983G>C	ENSP00000357789:p.Ser2793Arg		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.S2793R	ENST00000368799.1	37	c.8379	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	G	5.862	0.343226	0.11069	.	.	ENSG00000143631	ENST00000368799;ENST00000368796	T	0.03745	3.82	4.2	0.631	0.17699	.	.	.	.	.	T	0.01029	0.0034	L	0.37850	1.14	0.09310	N	1	B	0.18863	0.031	B	0.14578	0.011	T	0.47100	-0.9143	9	0.72032	D	0.01	-0.3483	3.0168	0.06063	0.3065:0.2311:0.4624:0.0	.	2793	P20930	FILA_HUMAN	R	2793;55	ENSP00000357789:S2793R	ENSP00000357786:S55R	S	-	3	2	FLG	150545607	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.340000	0.19892	0.352000	0.24053	-0.675000	0.03792	AGC	FLG	-	NULL		0.592	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	G	NM_002016		152278983	-1	no_errors	ENST00000368799	ensembl	human	known	70_37	missense	SNP	0.000	C
FLNA	2316	genome.wustl.edu	37	X	153579990	153579990	+	Missense_Mutation	SNP	G	G	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chrX:153579990G>T	ENST00000369850.3	-	43	7218	c.6982C>A	c.(6982-6984)Ccg>Acg	p.P2328T	FLNA_ENST00000498491.1_5'Flank|FLNA_ENST00000344736.4_Missense_Mutation_p.P2288T|FLNA_ENST00000360319.4_Missense_Mutation_p.P2320T|FLNA_ENST00000369856.3_Missense_Mutation_p.P461T|FLNA_ENST00000422373.1_Missense_Mutation_p.P2320T	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	2328					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TCGCCAGACGGAGAAGCCACA	0.617																																																	0													38.0	44.0	42.0					X																	153579990		2109	4226	6335	SO:0001583	missense	2316			X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.6982C>A	X.37:g.153579990G>T	ENSP00000358866:p.Pro2328Thr		E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.P2328T	ENST00000369850.3	37	c.6982	CCDS48194.1	X	.	.	.	.	.	.	.	.	.	.	G	10.18	1.280679	0.23392	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000369856;ENST00000344736;ENST00000444578	D;D;D;D;D;D	0.92048	-2.96;-2.96;-2.96;-2.96;-2.96;-2.96	5.42	5.42	0.78866	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.071540	0.56097	D	0.000037	D	0.85986	0.5825	N	0.25789	0.76	0.44366	D	0.997268	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.06405	0.0;0.002;0.001;0.001	T	0.81409	-0.0946	10	0.36615	T	0.2	.	12.076	0.53644	0.0:0.0:0.6995:0.3005	.	461;2320;2328;2328	E9PHF0;P21333-2;P21333;E9KL45	.;.;FLNA_HUMAN;.	T	2320;1996;2320;2328;461;2288;268	ENSP00000353467:P2320T;ENSP00000416926:P2320T;ENSP00000358866:P2328T;ENSP00000358872:P461T;ENSP00000358863:P2288T;ENSP00000397824:P268T	ENSP00000358863:P2288T	P	-	1	0	FLNA	153233184	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	3.765000	0.55272	2.280000	0.76307	0.523000	0.50628	CCG	FLNA	-	superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like		0.617	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNA	HGNC	protein_coding	OTTHUMT00000058942.3	G			153579990	-1	no_errors	ENST00000369850	ensembl	human	known	70_37	missense	SNP	1.000	T
FLT1	2321	genome.wustl.edu	37	13	28942801	28942801	+	Intron	SNP	C	C	G			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr13:28942801C>G	ENST00000282397.4	-	15	2368				FLT1_ENST00000541932.1_Splice_Site	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1						blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	gTATACAGTTCTAGGTACACA	0.373																																																	0													546.0	523.0	530.0					13																	28942801		692	1591	2283	SO:0001627	intron_variant	2321			AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.2117-10979G>C	13.37:g.28942801C>G			A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Splice_Site	SNP	-	e15-1	ENST00000282397.4	37	c.2117-1	CCDS9330.1	13	.	.	.	.	.	.	.	.	.	.	C	3.095	-0.185972	0.06340	.	.	ENSG00000102755	ENST00000541932	.	.	.	1.1	0.132	0.14762	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.8765	0.13658	0.0:0.6057:0.3943:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FLT1	27840801	0.084000	0.21492	0.005000	0.12908	0.067000	0.16453	0.211000	0.17474	0.018000	0.15052	0.460000	0.39030	.	FLT1	-	-		0.373	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLT1	HGNC	protein_coding	OTTHUMT00000044322.1	C			28942801	-1	no_errors	ENST00000541932	ensembl	human	known	70_37	splice_site	SNP	0.006	G
FOXD4	2298	genome.wustl.edu	37	9	117854	117854	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr9:117854G>A	ENST00000382500.2	-	1	563	c.266C>T	c.(265-267)cCg>cTg	p.P89L		NM_207305.4	NP_997188.2	Q12950	FOXD4_HUMAN	forkhead box D4	89					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|large_intestine(2)|lung(3)|prostate(1)|skin(3)	14	all_lung(41;0.218)	all_cancers(5;0.0395)|Acute lymphoblastic leukemia(5;1.91e-07)|all_hematologic(5;1.95e-06)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		AGACCTTGGCGGTGCCCTGAA	0.701																																																	0													32.0	55.0	47.0					9																	117854		2176	4273	6449	SO:0001583	missense	2298			U13223	CCDS34975.1	9p24.3	2014-09-17			ENSG00000170122	ENSG00000170122		"""Forkhead boxes"""	3805	protein-coding gene	gene with protein product		601092		FKHL9		7957066, 8825632, 12234674	Standard	NM_207305		Approved	FREAC5, FOXD4a	uc003zfz.4	Q12950	OTTHUMG00000021015	ENST00000382500.2:c.266C>T	9.37:g.117854G>A	ENSP00000371940:p.Pro89Leu		B2RN05|B9EGL7|Q5VVK1|Q8WXT6	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.P89L	ENST00000382500.2	37	c.266	CCDS34975.1	9	.	.	.	.	.	.	.	.	.	.	.	9.976	1.226874	0.22542	.	.	ENSG00000170122	ENST00000382500	D	0.95171	-3.63	2.24	2.24	0.28232	.	1.362120	0.06167	U	0.676965	D	0.87724	0.6249	N	0.24115	0.695	0.09310	N	1	B	0.28971	0.229	B	0.15870	0.014	T	0.79827	-0.1639	10	0.56958	D	0.05	.	3.6941	0.08357	0.1575:0.2634:0.5791:0.0	.	89	Q12950	FOXD4_HUMAN	L	89	ENSP00000371940:P89L	ENSP00000371940:P89L	P	-	2	0	FOXD4	107854	.	.	0.005000	0.12908	0.067000	0.16453	.	.	1.253000	0.44018	0.291000	0.19559	CCG	FOXD4	-	NULL		0.701	FOXD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXD4	HGNC	protein_coding	OTTHUMT00000055433.1	G	NM_207305		117854	-1	no_errors	ENST00000382500	ensembl	human	known	70_37	missense	SNP	0.000	A
FRG2B	441581	genome.wustl.edu	37	10	135438753	135438753	+	Silent	SNP	G	G	A	rs375000694		TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr10:135438753G>A	ENST00000425520.1	-	4	739	c.687C>T	c.(685-687)acC>acT	p.T229T	FRG2B_ENST00000443774.1_Silent_p.T230T	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	229						nucleus (GO:0005634)				endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		AAGCTGCCTGGGTGGCCATGG	0.597																																																	0													3.0	4.0	4.0					10																	135438753		1467	3364	4831	SO:0001819	synonymous_variant	441581			AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.687C>T	10.37:g.135438753G>A			Q5VSQ1	Silent	SNP	NULL	p.T230	ENST00000425520.1	37	c.690	CCDS44502.1	10																																																																																			FRG2B	-	NULL		0.597	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FRG2B	HGNC	protein_coding	OTTHUMT00000467780.1	G	NM_001080998		135438753	-1	no_errors	ENST00000443774	ensembl	human	known	70_37	silent	SNP	0.707	A
FSBP	100861412	genome.wustl.edu	37	8	95448953	95448953	+	Silent	SNP	G	G	A	rs199864950		TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr8:95448953G>A	ENST00000481490.2	-	1	217	c.144C>T	c.(142-144)atC>atT	p.I48I	RAD54B_ENST00000297592.5_Intron|RAD54B_ENST00000336148.5_Intron	NM_001256141.1	NP_001243070.1	O95073	FSBP_HUMAN	fibrinogen silencer binding protein	48					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)											TAACTGCTATGATATCCCAAC	0.393																																																	0																																										SO:0001819	synonymous_variant	100861412				CCDS59106.1	8q22.1	2012-08-13			ENSG00000265817	ENSG00000265817			43653	protein-coding gene	gene with protein product						20531236	Standard	NM_001256141		Approved		uc003ygm.3	O95073	OTTHUMG00000178341	ENST00000481490.2:c.144C>T	8.37:g.95448953G>A			Q8N4S5	Silent	SNP	NULL	p.I48	ENST00000481490.2	37	c.144	CCDS59106.1	8																																																																																			FSBP	-	NULL		0.393	FSBP-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	FSBP	HGNC	protein_coding	OTTHUMT00000441631.1	G	NM_001256141		95448953	-1	no_errors	ENST00000481490	ensembl	human	known	70_37	silent	SNP	1.000	A
GABRA5	2558	genome.wustl.edu	37	15	27193366	27193366	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr15:27193366G>A	ENST00000335625.5	+	11	2263	c.1375G>A	c.(1375-1377)Gcc>Acc	p.A459T	GABRA5_ENST00000355395.5_Missense_Mutation_p.A459T|GABRA5_ENST00000400081.3_Missense_Mutation_p.A459T	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5	459					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.A459T(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	AAAAGGAGCCGCCTCTCCAAA	0.483																																																	1	Substitution - Missense(1)	endometrium(1)											15.0	16.0	16.0					15																	27193366		1775	3933	5708	SO:0001583	missense	2558				CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.1375G>A	15.37:g.27193366G>A	ENSP00000335592:p.Ala459Thr		A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa5_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.A459T	ENST00000335625.5	37	c.1375	CCDS45194.1	15	.	.	.	.	.	.	.	.	.	.	G	1.622	-0.521227	0.04171	.	.	ENSG00000186297	ENST00000335625;ENST00000355395;ENST00000400081	T;T;T	0.70869	-0.52;-0.52;-0.52	5.06	-1.98	0.07480	.	0.625964	0.15791	N	0.244425	T	0.39809	0.1092	N	0.04880	-0.145	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.36768	-0.9734	10	0.02654	T	1	.	10.8797	0.46931	0.8007:0.0:0.1993:0.0	.	459	P31644	GBRA5_HUMAN	T	459	ENSP00000335592:A459T;ENSP00000347557:A459T;ENSP00000382953:A459T	ENSP00000335592:A459T	A	+	1	0	GABRA5	24776112	0.030000	0.19436	0.065000	0.19835	0.718000	0.41266	0.749000	0.26320	-0.158000	0.11040	0.655000	0.94253	GCC	GABRA5	-	prints_GABBAa5_rcpt		0.483	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA5	HGNC	protein_coding	OTTHUMT00000415234.1	G			27193366	+1	no_errors	ENST00000335625	ensembl	human	known	70_37	missense	SNP	0.001	A
GGNBP2	79893	genome.wustl.edu	37	17	34935768	34935768	+	Missense_Mutation	SNP	C	C	G			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr17:34935768C>G	ENST00000304718.4	+	8	1255	c.939C>G	c.(937-939)atC>atG	p.I313M		NM_024835.3	NP_079111.1	Q9H3C7	GGNB2_HUMAN	gametogenetin binding protein 2	313					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)	38		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		TGCATCGAATCTGGCAGAAGC	0.428																																																	0													185.0	186.0	186.0					17																	34935768		2203	4300	6503	SO:0001583	missense	79893			AF126964	CCDS11314.1	17q21.1	2014-05-06	2007-08-20	2007-08-20	ENSG00000005955	ENSG00000278311			19357	protein-coding gene	gene with protein product		612275	"""zinc finger protein 403"""	ZNF403		11728448	Standard	NM_024835		Approved	ZFP403, LZK1, FLJ22561, FLJ21230, DIF-3, DIF3	uc002hnb.3	Q9H3C7	OTTHUMG00000188440	ENST00000304718.4:c.939C>G	17.37:g.34935768C>G	ENSP00000307617:p.Ile313Met		B2RPK7|Q96T90|Q9GZR8|Q9H767	Missense_Mutation	SNP	NULL	p.I313M	ENST00000304718.4	37	c.939	CCDS11314.1	17	.	.	.	.	.	.	.	.	.	.	C	21.2	4.118686	0.77323	.	.	ENSG00000005955	ENST00000304718	.	.	.	5.55	4.58	0.56647	.	0.000000	0.85682	D	0.000000	T	0.68109	0.2965	L	0.50333	1.59	0.80722	D	1	D;D;D	0.67145	0.996;0.996;0.996	D;D;P	0.65010	0.931;0.931;0.906	T	0.70799	-0.4774	9	0.87932	D	0	-8.7751	13.8193	0.63311	0.0:0.9267:0.0:0.0733	.	313;313;313	A8K3S2;Q9H3C7;Q9H3C7-3	.;GGNB2_HUMAN;.	M	313	.	ENSP00000307617:I313M	I	+	3	3	GGNBP2	32009881	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.785000	0.47782	2.615000	0.88500	0.460000	0.39030	ATC	GGNBP2	-	NULL		0.428	GGNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGNBP2	HGNC	protein_coding	OTTHUMT00000256684.2	C	NM_024835		34935768	+1	no_errors	ENST00000304718	ensembl	human	known	70_37	missense	SNP	1.000	G
GK2	2712	genome.wustl.edu	37	4	80328008	80328008	+	Silent	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr4:80328008G>A	ENST00000358842.3	-	1	1364	c.1347C>T	c.(1345-1347)ccC>ccT	p.P449P		NM_033214.2	NP_149991.2	Q01415	GALK2_HUMAN	glycerol kinase 2	0					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)			autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	39						CAGGCATAAAGGGTTTTATTA	0.463																																																	0													94.0	94.0	94.0					4																	80328008		2203	4300	6503	SO:0001819	synonymous_variant	2712			BC029820	CCDS3585.1	4q13	2008-02-05	2002-10-03	2002-10-04	ENSG00000196475	ENSG00000196475		"""Glycerol kinases"""	4291	protein-coding gene	gene with protein product		600148	"""glycerol kinase pseudogene 2"""	GKP2		7987308	Standard	NM_033214		Approved	GKTA	uc003hlu.3	Q14410	OTTHUMG00000130199	ENST00000358842.3:c.1347C>T	4.37:g.80328008G>A			Q7Z4Q4	Silent	SNP	pfam_Carb_kinase_FGGY_N,pfam_Carb_kinase_FGGY_C,tigrfam_Glycerol_kin	p.P449	ENST00000358842.3	37	c.1347	CCDS3585.1	4																																																																																			GK2	-	pfam_Carb_kinase_FGGY_C,tigrfam_Glycerol_kin		0.463	GK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GK2	HGNC	protein_coding	OTTHUMT00000252517.2	G	NM_033214		80328008	-1	no_errors	ENST00000358842	ensembl	human	known	70_37	silent	SNP	0.010	A
GOLGA4	2803	genome.wustl.edu	37	3	37360697	37360697	+	Intron	DEL	T	T	-			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr3:37360697delT	ENST00000361924.2	+	12	1919				GOLGA4_ENST00000356847.4_Intron|GOLGA4_ENST00000444882.1_Intron|GOLGA4_ENST00000435830.2_3'UTR	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4						Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						TAAGTGACTATTTTTTTTTTT	0.413																																																	0									,	167,169,3930		0,0,167,0,169,1797	56.0	62.0	60.0		,	-10.2	0.0	3		62	255,299,7700		0,0,255,0,299,3573	no	intron,intron	GOLGA4	NM_002078.4,NM_001172713.1	,	0,0,422,0,468,5370	A1A1,A1A2,A1R,A2A2,A2R,RR		6.7119,7.8762,7.1086	,	,	37360697	422,468,11630	2203	4300	6503	SO:0001627	intron_variant	2803			U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.1545+12T>-	3.37:g.37360697delT			F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	RNA	DEL	-	NULL	ENST00000361924.2	37	NULL	CCDS2666.1	3																																																																																			GOLGA4	-	-		0.413	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGA4	HGNC	protein_coding	OTTHUMT00000253339.2	T	NM_002078		37360697	+1	no_errors	ENST00000435830	ensembl	human	known	70_37	rna	DEL	0.005	-
GOLGA4	2803	genome.wustl.edu	37	3	37365514	37365514	+	Missense_Mutation	SNP	C	C	G			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr3:37365514C>G	ENST00000361924.2	+	14	2511	c.2137C>G	c.(2137-2139)Caa>Gaa	p.Q713E	GOLGA4_ENST00000356847.4_Missense_Mutation_p.Q735E|GOLGA4_ENST00000444882.1_Intron	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	713	Glu-rich.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						TCTGAAAGATCAAACAGATAA	0.373																																																	0													39.0	40.0	40.0					3																	37365514		2199	4287	6486	SO:0001583	missense	2803			U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.2137C>G	3.37:g.37365514C>G	ENSP00000354486:p.Gln713Glu		F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Missense_Mutation	SNP	pfam_GRIP,superfamily_GRIP,superfamily_tRNA-bd_arm,superfamily_t-SNARE,superfamily_Prefoldin,smart_GRIP,pfscan_GRIP	p.Q713E	ENST00000361924.2	37	c.2137	CCDS2666.1	3	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.223070	0.00283	.	.	ENSG00000144674	ENST00000361924;ENST00000356847;ENST00000429018;ENST00000437131	T;T;T	0.20069	2.1;2.11;2.11	5.22	2.02	0.26589	.	0.741063	0.11117	N	0.597878	T	0.09905	0.0243	N	0.12746	0.255	0.09310	N	1	B;B;B;B	0.09022	0.0;0.001;0.001;0.002	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.30707	-0.9969	10	0.02654	T	1	.	10.4055	0.44254	0.1672:0.2708:0.562:0.0	.	713;713;735;713	Q13439-3;Q13439-4;F8W8Q7;Q13439	.;.;.;GOGA4_HUMAN	E	713;735;274;584	ENSP00000354486:Q713E;ENSP00000349305:Q735E;ENSP00000405842:Q584E	ENSP00000349305:Q735E	Q	+	1	0	GOLGA4	37340518	0.964000	0.33143	0.055000	0.19348	0.322000	0.28314	1.227000	0.32576	0.665000	0.31066	-0.211000	0.12701	CAA	GOLGA4	-	NULL		0.373	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGA4	HGNC	protein_coding	OTTHUMT00000253339.2	C	NM_002078		37365514	+1	no_errors	ENST00000361924	ensembl	human	known	70_37	missense	SNP	0.067	G
GNAI2	2771	genome.wustl.edu	37	3	50296396	50296396	+	3'UTR	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr3:50296396G>C	ENST00000313601.6	+	0	2073				GNAI2_ENST00000491100.1_3'UTR|GNAI2_ENST00000536647.1_3'UTR|GNAI2_ENST00000266027.5_3'UTR|U73166.2_ENST00000439898.1_lincRNA	NM_002070.2	NP_002061.1	P04899	GNAI2_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2						activation of MAPKK activity (GO:0000186)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of synaptic transmission (GO:0050805)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|regulation of calcium ion transport (GO:0051924)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|membrane raft (GO:0045121)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|liver(2)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000288)|KIRC - Kidney renal clear cell carcinoma(197;0.00571)|Kidney(197;0.00651)		GTCAGATCCTGACCAGCAAGC	0.463																																																	0																																										SO:0001624	3_prime_UTR_variant	2771			X04828	CCDS2813.1, CCDS54587.1, CCDS63642.1, CCDS63644.1	3p21.31	2010-08-27			ENSG00000114353	ENSG00000114353			4385	protein-coding gene	gene with protein product	"""GTP-binding regulatory protein Gi alpha-2 chain"""	139360		GNAI2B		3100330, 1733849	Standard	NM_001166425		Approved	GIP	uc003cyq.1	P04899	OTTHUMG00000156940	ENST00000313601.6:c.*621G>C	3.37:g.50296396G>C			B3KTZ0|B4DYA0|B4E2X5|Q6B6N3|Q8IZ71	RNA	SNP	-	NULL	ENST00000313601.6	37	NULL	CCDS2813.1	3	.	.	.	.	.	.	.	.	.	.	G	10.22	1.289256	0.23478	.	.	ENSG00000114353	ENST00000540560	.	.	.	4.54	2.69	0.31865	.	.	.	.	.	T	0.60483	0.2272	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60752	-0.7201	5	0.87932	D	0	.	5.4908	0.16774	0.1006:0.0:0.7024:0.1971	.	.	.	.	H	347	.	ENSP00000439958:D347H	D	+	1	0	GNAI2	50271400	0.988000	0.35896	1.000000	0.80357	0.886000	0.51366	0.502000	0.22594	0.802000	0.34089	0.655000	0.94253	GAC	GNAI2	-	-		0.463	GNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNAI2	HGNC	protein_coding	OTTHUMT00000346688.1	G	NM_002070		50296396	+1	no_errors	ENST00000491100	ensembl	human	known	70_37	rna	SNP	1.000	C
GOLGA8DP	100132979	genome.wustl.edu	37	15	22709181	22709181	+	RNA	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr15:22709181C>T	ENST00000314246.8	-	0	1215				RN7SL545P_ENST00000495815.2_RNA			Q0D2H9	GOG8D_HUMAN	golgin A8 family, member D, pseudogene							Golgi apparatus (GO:0005794)											GTTCCTTCCTCAGGTGCTGCA	0.572																																																	0																																												100132979					15q11.2	2014-04-10	2011-04-15	2010-02-12	ENSG00000185182	ENSG00000185182			32376	pseudogene	pseudogene			"""golgi autoantigen, golgin subfamily a, 8D"""	GOLGA8D		12477932	Standard	NR_027407		Approved		uc010axw.2	Q0D2H9	OTTHUMG00000171882		15.37:g.22709181C>T				RNA	SNP	-	NULL	ENST00000314246.8	37	NULL		15																																																																																			GOLGA8DP	-	-		0.572	GOLGA8DP-002	KNOWN	basic	processed_transcript	GOLGA8DP	HGNC	pseudogene	OTTHUMT00000415613.1	C	NR_027407		22709181	-1	no_errors	ENST00000314246	ensembl	human	known	70_37	rna	SNP	0.062	T
GPC5	2262	genome.wustl.edu	37	13	92345909	92345909	+	Missense_Mutation	SNP	C	C	T	rs150834424	byFrequency	TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr13:92345909C>T	ENST00000377067.3	+	3	1166	c.794C>T	c.(793-795)gCg>gTg	p.A265V		NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	265					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				CAAGGCCTGGCGCTCACTAAG	0.547													C|||	8	0.00159744	0.0045	0.0014	5008	,	,		19659	0.0		0.0	False		,,,				2504	0.001																0								C	VAL/ALA	11,4395	17.9+/-39.9	0,11,2192	82.0	74.0	77.0		794	1.7	0.4	13	dbSNP_134	77	0,8600		0,0,4300	yes	missense	GPC5	NM_004466.4	64	0,11,6492	TT,TC,CC		0.0,0.2497,0.0846	benign	265/573	92345909	11,12995	2203	4300	6503	SO:0001583	missense	2262			AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.794C>T	13.37:g.92345909C>T	ENSP00000366267:p.Ala265Val		B2R726|O60436|Q9BX27	Missense_Mutation	SNP	pfam_Glypican	p.A265V	ENST00000377067.3	37	c.794	CCDS9468.1	13	.	.	.	.	.	.	.	.	.	.	C	0.177	-1.066286	0.01934	0.002497	0.0	ENSG00000179399	ENST00000377067	T	0.49432	0.78	5.45	1.67	0.24075	Glypican, conserved site (1);	0.199841	0.52532	D	0.000080	T	0.33059	0.0850	L	0.43152	1.355	0.09310	N	1	B	0.24258	0.1	B	0.22753	0.041	T	0.17289	-1.0374	10	0.23891	T	0.37	-5.9162	6.1403	0.20257	0.0:0.5288:0.1215:0.3497	.	265	P78333	GPC5_HUMAN	V	265	ENSP00000366267:A265V	ENSP00000366267:A265V	A	+	2	0	GPC5	91143910	0.043000	0.20138	0.374000	0.26016	0.169000	0.22640	0.568000	0.23623	-0.004000	0.14419	0.585000	0.79938	GCG	GPC5	-	pfam_Glypican		0.547	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC5	HGNC	protein_coding	OTTHUMT00000045454.1	C	NM_004466		92345909	+1	no_errors	ENST00000377067	ensembl	human	known	70_37	missense	SNP	0.251	T
GRIN2A	2903	genome.wustl.edu	37	16	9857127	9857127	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr16:9857127G>A	ENST00000396573.2	-	14	4583	c.4274C>T	c.(4273-4275)tCg>tTg	p.S1425L	GRIN2A_ENST00000330684.3_Missense_Mutation_p.S1425L|GRIN2A_ENST00000404927.2_3'UTR|GRIN2A_ENST00000396575.2_Missense_Mutation_p.S1425L|GRIN2A_ENST00000562109.1_3'UTR|GRIN2A_ENST00000535259.1_3'UTR	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	1425			S -> L (found in a cutaneous malignant melanoma sample; somatic mutation). {ECO:0000269|PubMed:21499247}.		directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.S1425L(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	AACATGCTCCGAAATATACAC	0.473																																																	1	Substitution - Missense(1)	skin(1)											79.0	72.0	74.0					16																	9857127		2197	4300	6497	SO:0001583	missense	2903				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.4274C>T	16.37:g.9857127G>A	ENSP00000379818:p.Ser1425Leu		O00669|Q17RZ6	Missense_Mutation	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.S1425L	ENST00000396573.2	37	c.4274	CCDS10539.1	16	.	.	.	.	.	.	.	.	.	.	G	12.31	1.900828	0.33535	.	.	ENSG00000183454	ENST00000396573;ENST00000330684;ENST00000396575	T;T;T	0.11604	2.76;2.76;2.76	5.79	4.83	0.62350	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.334636	0.32593	N	0.005891	T	0.11707	0.0285	L	0.60455	1.87	0.80722	D	1	P	0.40794	0.729	B	0.31869	0.137	T	0.06391	-1.0829	9	.	.	.	.	15.2816	0.73790	0.0:0.0:0.8589:0.1411	.	1425	Q12879	NMDE1_HUMAN	L	1425	ENSP00000379818:S1425L;ENSP00000332549:S1425L;ENSP00000379820:S1425L	.	S	-	2	0	GRIN2A	9764628	1.000000	0.71417	0.315000	0.25238	0.931000	0.56810	5.852000	0.69488	1.425000	0.47237	0.655000	0.94253	TCG	GRIN2A	-	pfam_NMDAR2_C		0.473	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2A	HGNC	protein_coding	OTTHUMT00000251930.3	G			9857127	-1	no_errors	ENST00000330684	ensembl	human	known	70_37	missense	SNP	0.911	A
GRM8	2918	genome.wustl.edu	37	7	126249508	126249508	+	Missense_Mutation	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr7:126249508G>C	ENST00000339582.2	-	8	2210	c.1402C>G	c.(1402-1404)Cct>Gct	p.P468A	GRM8_ENST00000358373.3_Missense_Mutation_p.P468A|GRM8_ENST00000480995.1_Intron|GRM8_ENST00000405249.1_Silent_p.L491L|GRM8_ENST00000444921.2_Missense_Mutation_p.P468A			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	468					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				TAACGTCCAGGAGCATCTCCG	0.388										HNSCC(24;0.065)																																							0													158.0	136.0	143.0					7																	126249508		2203	4300	6503	SO:0001583	missense	2918				CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.1402C>G	7.37:g.126249508G>C	ENSP00000344173:p.Pro468Ala		A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_8,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_4	p.P468A	ENST00000339582.2	37	c.1402	CCDS5794.1	7	.	.	.	.	.	.	.	.	.	.	G	19.38	3.816561	0.70912	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373	D;D;D	0.82893	-1.66;-1.66;-1.66	5.45	5.45	0.79879	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.91818	0.7411	M	0.82193	2.58	0.80722	D	1	D;B	0.89917	1.0;0.052	D;B	0.85130	0.997;0.066	D	0.92050	0.5647	10	0.52906	T	0.07	.	18.2877	0.90119	0.0:0.0:1.0:0.0	.	468;468	O00222-2;O00222	.;GRM8_HUMAN	A	468	ENSP00000344173:P468A;ENSP00000409790:P468A;ENSP00000351142:P468A	ENSP00000344173:P468A	P	-	1	0	GRM8	126036744	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.835000	0.99442	2.535000	0.85469	0.563000	0.77884	CCT	GRM8	-	pfam_ANF_lig-bd_rcpt		0.388	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM8	HGNC	protein_coding	OTTHUMT00000059209.4	G			126249508	-1	no_errors	ENST00000339582	ensembl	human	known	70_37	missense	SNP	1.000	C
GSTT1	2952	genome.wustl.edu	37	22	24381725	24381725	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr22:24381725C>T	ENST00000248935.5	-	2	227	c.175G>A	c.(175-177)Gac>Aac	p.D59N	GSTT1_ENST00000439996.2_Intron	NM_000853.2	NP_000844.2	P30711	GSTT1_HUMAN		59	GST N-terminal.				glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione peroxidase activity (GO:0004602)|glutathione transferase activity (GO:0004364)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|ovary(1)|prostate(1)|skin(1)	6					Carboplatin(DB00958)|Cisplatin(DB00515)|Etoposide(DB00773)|Glutathione(DB00143)|Oxaliplatin(DB00526)	AAGTCCCCGTCCTTCAAGGCT	0.562									Myelodysplasia and Acute Myeloid Leukemia (AML), Familial																																								0													100.0	85.0	90.0					22																	24381725		1707	3612	5319	SO:0001583	missense	2952	Familial Cancer Database	incl.: Familial Myelodysplastic syndrome (late-onset), Familial AML, Familial Monocytic Leukemia, Familial Monosomy 7 and AML																												ENST00000248935.5:c.175G>A	22.37:g.24381725C>T	ENSP00000248935:p.Asp59Asn		O00226|Q5TZY2|Q6IC69|Q969K8|Q96IY3	Missense_Mutation	SNP	pfam_Glutathione_S-Trfase_N,pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold	p.D59N	ENST00000248935.5	37	c.175	CCDS13822.1	22	.	.	.	.	.	.	.	.	.	.	.	21.5	4.152555	0.78001	.	.	ENSG00000184674	ENST00000248935;ENST00000447865	T;T	0.09163	3.01;3.01	4.84	4.84	0.62591	Glutathione S-transferase, N-terminal (2);Thioredoxin-like fold (2);	0.000000	0.85682	U	0.000000	T	0.40196	0.1107	M	0.90705	3.14	0.80722	D	1	D	0.76494	0.999	D	0.71656	0.974	T	0.49799	-0.8901	10	0.72032	D	0.01	-17.8244	15.879	0.79189	0.0:1.0:0.0:0.0	.	59	P30711	GSTT1_HUMAN	N	59	ENSP00000248935:D59N;ENSP00000397362:D59N	ENSP00000248935:D59N	D	-	1	0	GSTT1	22711725	1.000000	0.71417	0.997000	0.53966	0.243000	0.25628	6.492000	0.73654	2.438000	0.82558	0.650000	0.86243	GAC	GSTT1	-	pfam_Glutathione_S-Trfase_N,superfamily_Thioredoxin-like_fold		0.562	GSTT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTT1	HGNC	protein_coding	OTTHUMT00000320184.2	C			24381725	-1	no_errors	ENST00000248935	ensembl	human	known	70_37	missense	SNP	1.000	T
GTF3C5	9328	genome.wustl.edu	37	9	135919210	135919210	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr9:135919210G>A	ENST00000372097.5	+	3	792	c.469G>A	c.(469-471)Gag>Aag	p.E157K	GTF3C5_ENST00000342018.8_Missense_Mutation_p.E157K|GTF3C5_ENST00000372099.6_Missense_Mutation_p.E148K|GTF3C5_ENST00000372108.5_Missense_Mutation_p.E157K|GTF3C5_ENST00000372095.5_Missense_Mutation_p.E32K|GTF3C5_ENST00000485692.1_3'UTR	NM_012087.3	NP_036219.2	Q9Y5Q8	TF3C5_HUMAN	general transcription factor IIIC, polypeptide 5, 63kDa	157					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)	21				OV - Ovarian serous cystadenocarcinoma(145;4.01e-06)|Epithelial(140;4e-05)		GCCCGAGAAGGAGGCCTTTTT	0.587																																																	0													100.0	95.0	97.0					9																	135919210		2203	4300	6503	SO:0001583	missense	9328			AF133124	CCDS6958.1, CCDS48050.1, CCDS75927.1	9q34.13	2010-03-23	2002-08-29		ENSG00000148308	ENSG00000148308		"""General transcription factors"""	4668	protein-coding gene	gene with protein product	"""transcription factor IIIC, 63 kD"""	604890	"""general transcription factor IIIC, polypeptide 5 (63kD)"""			10373544	Standard	NM_012087		Approved	TFiiiC2-63, TFIIIC63, TFIIICepsilon	uc004ccj.4	Q9Y5Q8	OTTHUMG00000020856	ENST00000372097.5:c.469G>A	9.37:g.135919210G>A	ENSP00000361169:p.Glu157Lys		A6NI44|A6NJB9|Q5T7U2|Q5T7U3|Q8N2U7|Q8N857|Q96GD9|Q9H4P2	Missense_Mutation	SNP	pfam_TF_IIIC_su-5	p.E157K	ENST00000372097.5	37	c.469	CCDS6958.1	9	.	.	.	.	.	.	.	.	.	.	G	16.42	3.118652	0.56505	.	.	ENSG00000148308	ENST00000372097;ENST00000440319;ENST00000372099;ENST00000372095;ENST00000372089;ENST00000372108;ENST00000342018;ENST00000439697	T;T;T;T	0.48522	0.83;0.81;0.82;0.86	4.98	4.06	0.47325	.	0.052541	0.85682	D	0.000000	T	0.37265	0.0997	L	0.38175	1.15	0.44862	D	0.997878	P;B;P	0.41978	0.767;0.236;0.465	B;B;B	0.42245	0.288;0.122;0.381	T	0.13150	-1.0520	10	0.06757	T	0.87	0.0369	14.2611	0.66085	0.0:0.1501:0.8499:0.0	.	32;157;157	B7Z1V3;Q9Y5Q8-3;Q9Y5Q8	.;.;TF3C5_HUMAN	K	157;110;148;32;7;157;157;32	ENSP00000361169:E157K;ENSP00000361171:E148K;ENSP00000361180:E157K;ENSP00000339530:E157K	ENSP00000339530:E157K	E	+	1	0	GTF3C5	134909031	1.000000	0.71417	0.994000	0.49952	0.986000	0.74619	4.185000	0.58330	1.031000	0.39867	0.563000	0.77884	GAG	GTF3C5	-	pfam_TF_IIIC_su-5		0.587	GTF3C5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C5	HGNC	protein_coding	OTTHUMT00000054826.1	G	NM_001122823		135919210	+1	no_errors	ENST00000372108	ensembl	human	known	70_37	missense	SNP	1.000	A
HIST2H2AC	8338	genome.wustl.edu	37	1	149858613	149858613	+	Missense_Mutation	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:149858613G>C	ENST00000331380.2	+	1	89	c.89G>C	c.(88-90)cGa>cCa	p.R30P	HIST2H2BE_ENST00000369155.2_5'Flank|BOLA1_ENST00000369153.2_5'Flank	NM_003517.2	NP_003508.1	Q16777	H2A2C_HUMAN	histone cluster 2, H2ac	30						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|ovary(1)|skin(1)	20	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			CCGGTAGGGCGAGTGCACCGC	0.672																																																	0													60.0	67.0	64.0					1																	149858613		2202	4298	6500	SO:0001583	missense	8338			AY131973	CCDS937.1	1q21.2	2011-01-27	2006-10-11	2003-02-21	ENSG00000184260	ENSG00000184260		"""Histones / Replication-dependent"""	4738	protein-coding gene	gene with protein product		602797	"""H2A histone family, member Q"", ""histone 2, H2ac"""	H2A, H2AFQ		1469070, 9439656, 12408966	Standard	NM_003517		Approved	H2A/q	uc001etd.3	Q16777	OTTHUMG00000035825	ENST00000331380.2:c.89G>C	1.37:g.149858613G>C	ENSP00000332194:p.Arg30Pro		Q6DRA7|Q8IUE5	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.R30P	ENST00000331380.2	37	c.89	CCDS937.1	1	.	.	.	.	.	.	.	.	.	.	G	18.77	3.694144	0.68386	.	.	ENSG00000184260	ENST00000331380	D	0.85339	-1.97	5.81	5.81	0.92471	Histone-fold (2);Histone core (1);Histone H2A (2);	0.000000	0.42964	D	0.000638	D	0.96815	0.8960	H	0.99948	5.02	0.58432	D	0.999991	D	0.89917	1.0	D	0.97110	1.0	D	0.98688	1.0695	10	0.87932	D	0	.	18.6409	0.91396	0.0:0.0:1.0:0.0	.	30	Q16777	H2A2C_HUMAN	P	30	ENSP00000332194:R30P	ENSP00000332194:R30P	R	+	2	0	HIST2H2AC	148125237	1.000000	0.71417	0.081000	0.20488	0.963000	0.63663	7.466000	0.80914	2.745000	0.94114	0.655000	0.94253	CGA	HIST2H2AC	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A		0.672	HIST2H2AC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST2H2AC	HGNC	protein_coding	OTTHUMT00000087128.1	G	NM_003517		149858613	+1	no_errors	ENST00000331380	ensembl	human	known	70_37	missense	SNP	1.000	C
HPS6	79803	genome.wustl.edu	37	10	103827104	103827104	+	Missense_Mutation	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr10:103827104G>C	ENST00000299238.5	+	1	1958	c.1873G>C	c.(1873-1875)Gag>Cag	p.E625Q		NM_024747.5	NP_079023.2	Q86YV9	HPS6_HUMAN	Hermansky-Pudlak syndrome 6	625					blood coagulation (GO:0007596)|melanocyte differentiation (GO:0030318)|organelle organization (GO:0006996)|protein localization to membrane (GO:0072657)	BLOC-2 complex (GO:0031084)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|Rab GTPase binding (GO:0017137)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|prostate(1)	11		Colorectal(252;0.122)		Epithelial(162;5.93e-08)|all cancers(201;1.03e-06)		TCTGGAGCTAGAGCTGCTCTT	0.667									Hermansky-Pudlak syndrome																																								0													46.0	46.0	46.0					10																	103827104		2203	4300	6503	SO:0001583	missense	79803	Familial Cancer Database	HPS, HPS1-8	BC009258	CCDS7527.1	10q24.32	2014-06-18			ENSG00000166189	ENSG00000166189			18817	protein-coding gene	gene with protein product		607522				12548288	Standard	NM_024747		Approved	FLJ22501	uc001kuj.3	Q86YV9	OTTHUMG00000018945	ENST00000299238.5:c.1873G>C	10.37:g.103827104G>C	ENSP00000299238:p.Glu625Gln		Q5VV69|Q9H685	Missense_Mutation	SNP	pirsf_BLOC-2_complex_Hps6_subunit	p.E625Q	ENST00000299238.5	37	c.1873	CCDS7527.1	10	.	.	.	.	.	.	.	.	.	.	G	18.81	3.703868	0.68501	.	.	ENSG00000166189	ENST00000299238	T	0.80824	-1.42	5.12	5.12	0.69794	.	0.111999	0.64402	D	0.000013	D	0.85035	0.5605	L	0.55481	1.735	0.50813	D	0.999894	D	0.55800	0.973	P	0.55161	0.77	D	0.85335	0.1092	10	0.51188	T	0.08	-5.8629	18.7368	0.91757	0.0:0.0:1.0:0.0	.	625	Q86YV9	HPS6_HUMAN	Q	625	ENSP00000299238:E625Q	ENSP00000299238:E625Q	E	+	1	0	HPS6	103817094	1.000000	0.71417	0.956000	0.39512	0.937000	0.57800	9.471000	0.97696	2.669000	0.90835	0.561000	0.74099	GAG	HPS6	-	pirsf_BLOC-2_complex_Hps6_subunit		0.667	HPS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPS6	HGNC	protein_coding	OTTHUMT00000050018.2	G	NM_024747		103827104	+1	no_errors	ENST00000299238	ensembl	human	known	70_37	missense	SNP	1.000	C
HYOU1	10525	genome.wustl.edu	37	11	118922230	118922230	+	Missense_Mutation	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr11:118922230G>C	ENST00000404233.3	-	13	1570	c.1446C>G	c.(1444-1446)atC>atG	p.I482M	HYOU1_ENST00000543287.1_Missense_Mutation_p.I395M|HYOU1_ENST00000529972.1_Missense_Mutation_p.I482M|HYOU1_ENST00000525859.1_Missense_Mutation_p.I482M	NM_001130991.1|NM_006389.3	NP_001124463.1|NP_006380.1	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1	482					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|response to ischemia (GO:0002931)|response to stress (GO:0006950)	endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(10)|prostate(1)|skin(2)	33	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		GGTTAAAGGTGATGACTTTGC	0.562																																																	0													219.0	182.0	194.0					11																	118922230		2200	4295	6495	SO:0001583	missense	10525			U65785	CCDS8408.1	11q23.1-q23.3	2011-09-02			ENSG00000149428	ENSG00000149428		"""Heat shock proteins / HSP70"""	16931	protein-coding gene	gene with protein product	"""glucose-regulated protein 170"""	601746				9020069, 10037731	Standard	XM_005271390		Approved	ORP150, HSP12A, Grp170	uc001pux.3	Q9Y4L1	OTTHUMG00000166354	ENST00000404233.3:c.1446C>G	11.37:g.118922230G>C	ENSP00000384144:p.Ile482Met		A8C1Z0|B7Z909|Q2I204|Q53H25	Missense_Mutation	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.I482M	ENST00000404233.3	37	c.1446	CCDS8408.1	11	.	.	.	.	.	.	.	.	.	.	G	13.62	2.291815	0.40594	.	.	ENSG00000149428	ENST00000404233;ENST00000353883;ENST00000529972;ENST00000536103;ENST00000535579;ENST00000525859;ENST00000544701;ENST00000543287;ENST00000530473	T;T;T;T;T	0.01059	5.39;5.39;5.39;5.39;5.39	5.26	3.23	0.37069	.	0.000000	0.85682	D	0.000000	T	0.02380	0.0073	L	0.53729	1.69	0.58432	D	0.999996	P;P;P;P	0.44776	0.843;0.711;0.587;0.587	P;P;B;B	0.48815	0.591;0.482;0.383;0.383	T	0.65228	-0.6219	10	0.34782	T	0.22	-25.0627	10.7583	0.46249	0.0774:0.0:0.7873:0.1353	.	473;526;482;482	B3KXH0;B7Z2N4;Q9Y4L1;A8C1Z0	.;.;HYOU1_HUMAN;.	M	482;473;482;482;331;482;525;395;482	ENSP00000384144:I482M;ENSP00000437313:I482M;ENSP00000433397:I482M;ENSP00000442727:I395M;ENSP00000431874:I482M	ENSP00000278752:I473M	I	-	3	3	HYOU1	118427440	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.488000	0.53229	1.430000	0.47334	-0.182000	0.12963	ATC	HYOU1	-	pfam_Hsp_70_fam		0.562	HYOU1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	HYOU1	HGNC	protein_coding	OTTHUMT00000389353.1	G	NM_006389		118922230	-1	no_errors	ENST00000404233	ensembl	human	known	70_37	missense	SNP	1.000	C
IGF2BP1	10642	genome.wustl.edu	37	17	47123357	47123357	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr17:47123357C>T	ENST00000290341.3	+	13	1835	c.1501C>T	c.(1501-1503)Cgg>Tgg	p.R501W	IGF2BP1_ENST00000431824.2_Missense_Mutation_p.R362W	NM_006546.3	NP_006537.3	Q9NZI8	IF2B1_HUMAN	insulin-like growth factor 2 mRNA binding protein 1	501	KH 4. {ECO:0000255|PROSITE- ProRule:PRU00117}.|Necessary for interaction with ELAVL4 and binding to TAU mRNA. {ECO:0000250}.				CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of mRNA stability involved in response to stress (GO:0010610)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						AGCAGCTGGCCGGGTCATTGG	0.547																																					Esophageal Squamous(198;1041 2123 8248 37119 38268)												0													54.0	52.0	53.0					17																	47123357		2203	4300	6503	SO:0001583	missense	10642			AF198254	CCDS11543.1, CCDS54138.1	17q21.32	2013-02-12			ENSG00000159217	ENSG00000159217		"""RNA binding motif (RRM) containing"""	28866	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 1"""	608288				9891060, 11992722	Standard	NM_001160423		Approved	IMP-1	uc002iom.3	Q9NZI8	OTTHUMG00000161173	ENST00000290341.3:c.1501C>T	17.37:g.47123357C>T	ENSP00000290341:p.Arg501Trp		C9JT33	Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_RRM_dom,smart_RRM_dom,smart_KH_dom,pfscan_KH_dom_type_1,pfscan_RRM_dom	p.R501W	ENST00000290341.3	37	c.1501	CCDS11543.1	17	.	.	.	.	.	.	.	.	.	.	C	21.9	4.212537	0.79240	.	.	ENSG00000159217	ENST00000290341;ENST00000431824	T;T	0.35048	1.33;1.33	5.5	2.19	0.27852	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.106432	0.64402	D	0.000007	T	0.64011	0.2560	M	0.88570	2.965	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.993;0.998	T	0.73033	-0.4110	10	0.72032	D	0.01	-28.999	14.0421	0.64681	0.4867:0.5133:0.0:0.0	.	362;501	C9JT33;Q9NZI8	.;IF2B1_HUMAN	W	501;362	ENSP00000290341:R501W;ENSP00000389135:R362W	ENSP00000290341:R501W	R	+	1	2	IGF2BP1	44478356	0.968000	0.33430	1.000000	0.80357	0.997000	0.91878	0.287000	0.18920	0.838000	0.34948	0.655000	0.94253	CGG	IGF2BP1	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1		0.547	IGF2BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2BP1	HGNC	protein_coding	OTTHUMT00000364046.1	C	NM_006546		47123357	+1	no_errors	ENST00000290341	ensembl	human	known	70_37	missense	SNP	1.000	T
IL1R2	7850	genome.wustl.edu	37	2	102644707	102644707	+	Nonsense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr2:102644707G>A	ENST00000332549.3	+	9	1279	c.1050G>A	c.(1048-1050)tgG>tgA	p.W350*	IL1R2_ENST00000485335.1_3'UTR|IL1R2_ENST00000393414.2_Nonsense_Mutation_p.W350*	NM_004633.3	NP_004624.1	P27930	IL1R2_HUMAN	interleukin 1 receptor, type II	350					cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)			breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)	28						CGTTCTCCTGGGGCATTGTGC	0.522																																					Pancreas(106;189 1628 2302 5133 12295)												0													109.0	101.0	104.0					2																	102644707		2203	4300	6503	SO:0001587	stop_gained	7850			X59770	CCDS2054.1, CCDS58719.1	2q12	2013-01-11			ENSG00000115590	ENSG00000115590		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5994	protein-coding gene	gene with protein product		147811		IL1RB		10191101, 1833184	Standard	NM_004633		Approved	CD121b	uc002tbm.3	P27930	OTTHUMG00000130695	ENST00000332549.3:c.1050G>A	2.37:g.102644707G>A	ENSP00000330959:p.Trp350*		D3DVJ5|Q6LCE6|Q9UE68	Nonsense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like,prints_Interleukin-1_rcpt_II,prints_IL1_rcpt_I/II	p.W350*	ENST00000332549.3	37	c.1050	CCDS2054.1	2	.	.	.	.	.	.	.	.	.	.	G	23.9	4.465584	0.84425	.	.	ENSG00000115590	ENST00000332549;ENST00000393414	.	.	.	5.88	5.0	0.66597	.	0.685983	0.14231	N	0.332705	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	12.4979	0.55940	0.0:0.0:0.8332:0.1668	.	.	.	.	X	350	.	ENSP00000330959:W350X	W	+	3	0	IL1R2	102011139	1.000000	0.71417	0.934000	0.37439	0.068000	0.16541	5.319000	0.65835	1.467000	0.48044	0.655000	0.94253	TGG	IL1R2	-	prints_Interleukin-1_rcpt_II		0.522	IL1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1R2	HGNC	protein_coding	OTTHUMT00000253191.1	G	NM_004633		102644707	+1	no_errors	ENST00000332549	ensembl	human	known	70_37	nonsense	SNP	0.968	A
IRX2	153572	genome.wustl.edu	37	5	2749785	2749785	+	Silent	SNP	C	C	T	rs61742405	byFrequency	TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr5:2749785C>T	ENST00000382611.6	-	2	614	c.366G>A	c.(364-366)acG>acA	p.T122T	C5orf38_ENST00000334000.3_5'Flank|C5orf38_ENST00000515640.1_5'Flank|C5orf38_ENST00000397835.4_5'Flank|C5orf38_ENST00000457752.2_5'Flank|IRX2_ENST00000302057.5_Silent_p.T122T|C5orf38_ENST00000505778.1_5'Flank|IRX2_ENST00000502957.1_5'UTR	NM_001134222.1	NP_001127694.1	Q9BZI1	IRX2_HUMAN	iroquois homeobox 2	122					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.T122T(2)		breast(1)|central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|prostate(1)|skin(2)	26				GBM - Glioblastoma multiforme(108;0.204)		TGGCGTCCCGCGTGGCGTTCT	0.652																																																	2	Substitution - coding silent(2)	lung(2)											126.0	99.0	108.0					5																	2749785		2203	4300	6503	SO:0001819	synonymous_variant	153572			AF319967	CCDS3868.1	5p15.33	2011-06-20	2007-07-13		ENSG00000170561	ENSG00000170561		"""Homeoboxes / TALE class"""	14359	protein-coding gene	gene with protein product		606198				11435706	Standard	NM_033267		Approved		uc003jdb.3	Q9BZI1	OTTHUMG00000090377	ENST00000382611.6:c.366G>A	5.37:g.2749785C>T			Q68A19|Q7Z2I7	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,smart_Iroquois_homeo,pfscan_Homeodomain	p.T122	ENST00000382611.6	37	c.366	CCDS3868.1	5																																																																																			IRX2	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain		0.652	IRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRX2	HGNC	protein_coding	OTTHUMT00000206749.2	C			2749785	-1	no_errors	ENST00000302057	ensembl	human	known	70_37	silent	SNP	0.996	T
ISY1	57461	genome.wustl.edu	37	3	128849395	128849395	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr3:128849395C>T	ENST00000393295.3	-	10	1065	c.748G>A	c.(748-750)Gag>Aag	p.E250K	ISY1_ENST00000471497.1_5'UTR|ISY1-RAB43_ENST00000418265.1_Missense_Mutation_p.E250K|ISY1_ENST00000273541.8_Missense_Mutation_p.E272K|ISY1_ENST00000393292.3_Missense_Mutation_p.R251K	NM_001199469.1|NM_020701.3	NP_001186398.1|NP_065752.1	Q9ULR0	ISY1_HUMAN	ISY1 splicing factor homolog (S. cerevisiae)	250					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(1)|lung(10)|prostate(1)|skin(1)	15						GGTCCTACCTCTTGCTGCGAG	0.557																																																	0													106.0	105.0	105.0					3																	128849395		1997	4172	6169	SO:0001583	missense	57461				CCDS43149.1, CCDS56277.1	3q21.3	2008-11-25			ENSG00000240682	ENSG00000240682			29201	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 33"""	612764				16103217	Standard	NM_020701		Approved	KIAA1160, fSAP33		Q9ULR0	OTTHUMG00000137365	ENST00000393295.3:c.748G>A	3.37:g.128849395C>T	ENSP00000376973:p.Glu250Lys		Q96IL2|Q9BT05	Missense_Mutation	SNP	pfam_Isy1	p.E272K	ENST00000393295.3	37	c.814	CCDS43149.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	31|31	5.082628|5.082628	0.94050|0.94050	.|.	.|.	ENSG00000240682|ENSG00000240682	ENST00000418265;ENST00000393295;ENST00000273541|ENST00000496163;ENST00000393292	T|.	0.35605|.	1.3|.	5.59|5.59	5.59|5.59	0.84812|0.84812	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74359|0.74359	0.3706|0.3706	M|M	0.90425|0.90425	3.115|3.115	0.27161|0.27161	N|N	0.961159|0.961159	D;D;D|.	0.71674|.	0.995;0.996;0.998|.	D;D;D|.	0.71184|.	0.948;0.96;0.972|.	T|T	0.71712|0.71712	-0.4510|-0.4510	10|5	0.72032|.	D|.	0.01|.	.|.	15.0882|15.0882	0.72170|0.72170	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	272;250;250|.	Q9ULR0-2;Q9ULR0;Q9ULR0-1|.	.;ISY1_HUMAN;.|.	K|K	250;250;272|147;251	ENSP00000273541:E272K|.	ENSP00000273541:E272K|.	E|R	-|-	1|2	0|0	ISY1|ISY1	130332085|130332085	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.792000|0.792000	0.44763|0.44763	6.265000|6.265000	0.72534|0.72534	2.629000|2.629000	0.89072|0.89072	0.484000|0.484000	0.47621|0.47621	GAG|AGA	ISY1	-	pfam_Isy1		0.557	ISY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISY1	HGNC	protein_coding	OTTHUMT00000267856.1	C	NM_020701		128849395	-1	no_errors	ENST00000273541	ensembl	human	known	70_37	missense	SNP	1.000	T
JPH3	57338	genome.wustl.edu	37	16	87724057	87724057	+	Silent	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr16:87724057C>T	ENST00000284262.2	+	4	2333	c.2091C>T	c.(2089-2091)ttC>ttT	p.F697F	JPH3_ENST00000563609.1_3'UTR	NM_020655.2	NP_065706.2	Q8WXH2	JPH3_HUMAN	junctophilin 3	697					calcium ion transport into cytosol (GO:0060402)|exploration behavior (GO:0035640)|learning (GO:0007612)|locomotion (GO:0040011)|memory (GO:0007613)|neuromuscular process controlling balance (GO:0050885)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)	calcium-release channel activity (GO:0015278)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(80;0.0287)		ACTTGACCTTCTCCCCGCCCC	0.672																																																	0													15.0	13.0	14.0					16																	87724057		2179	4283	6462	SO:0001819	synonymous_variant	57338			AB042636	CCDS10962.1	16q24.3	2008-02-05	2002-11-13		ENSG00000154118	ENSG00000154118			14203	protein-coding gene	gene with protein product		605268	"""trinucleotide repeat containing 22"""	TNRC22		10949023, 10891348	Standard	NM_020655		Approved	JP-3, CAGL237, HDL2, JP3	uc002fkd.4	Q8WXH2	OTTHUMG00000137656	ENST00000284262.2:c.2091C>T	16.37:g.87724057C>T			D3DUN2|Q8N471|Q9HDC3|Q9HDC4	Silent	SNP	pirsf_Junctophilin,pfam_MORN,smart_MORN	p.F697	ENST00000284262.2	37	c.2091	CCDS10962.1	16																																																																																			JPH3	-	pirsf_Junctophilin		0.672	JPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JPH3	HGNC	protein_coding	OTTHUMT00000269108.2	C			87724057	+1	no_errors	ENST00000284262	ensembl	human	known	70_37	silent	SNP	1.000	T
KCNB2	9312	genome.wustl.edu	37	8	73480146	73480146	+	Silent	SNP	G	G	A	rs566076958		TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr8:73480146G>A	ENST00000523207.1	+	2	765	c.177G>A	c.(175-177)acG>acA	p.T59T		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	59					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	TGCCCAGGACGCGCCTGGGGA	0.537													G|||	1	0.000199681	0.0	0.0	5008	,	,		16275	0.0		0.001	False		,,,				2504	0.0																0													66.0	68.0	67.0					8																	73480146		2203	4300	6503	SO:0001819	synonymous_variant	9312			U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.177G>A	8.37:g.73480146G>A			Q7Z7D0|Q9BXD3	Silent	SNP	pfam_K_chnl_volt-dep_Kv2,pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv2.2,prints_K_chnl_volt-dep_Kv2,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv8	p.T59	ENST00000523207.1	37	c.177	CCDS6209.1	8																																																																																			KCNB2	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl_volt-dep_Kv9		0.537	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNB2	HGNC	protein_coding	OTTHUMT00000378998.1	G	NM_004770		73480146	+1	no_errors	ENST00000523207	ensembl	human	known	70_37	silent	SNP	0.028	A
KIAA1958	158405	genome.wustl.edu	37	9	115380203	115380203	+	Intron	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr9:115380203C>T	ENST00000337530.6	+	3	1467				KIAA1958_ENST00000374244.3_Silent_p.I408I|KIAA1958_ENST00000536272.1_Silent_p.I408I	NM_133465.2	NP_597722.1	Q8N8K9	K1958_HUMAN	KIAA1958											endometrium(1)|large_intestine(9)|lung(10)|prostate(2)|skin(3)	25						AGAAAACCATCCGGAGCACGC	0.517																																																	0																																										SO:0001627	intron_variant	158405			AB075838	CCDS35108.1, CCDS69642.1	9q33.1	2009-09-22			ENSG00000165185	ENSG00000165185			23427	protein-coding gene	gene with protein product							Standard	NM_001287038		Approved	FLJ39294	uc004bgf.1	Q8N8K9	OTTHUMG00000020508	ENST00000337530.6:c.1172-27727C>T	9.37:g.115380203C>T			B7ZKW6|Q2M336|Q5T252|Q8TF43|Q96N02	Silent	SNP	pfam_DUF3504,superfamily_Integrase_Lambda-type_N	p.I408	ENST00000337530.6	37	c.1224	CCDS35108.1	9																																																																																			KIAA1958	-	NULL		0.517	KIAA1958-001	KNOWN	basic|CCDS	protein_coding	KIAA1958	HGNC	protein_coding	OTTHUMT00000053690.1	C	NM_133465		115380203	+1	no_errors	ENST00000536272	ensembl	human	known	70_37	silent	SNP	1.000	T
KIFC1	3833	genome.wustl.edu	37	6	33366154	33366154	+	Silent	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr6:33366154C>T	ENST00000428849.2	+	3	690	c.240C>T	c.(238-240)ggC>ggT	p.G80G		NM_002263.3	NP_002254.2	Q9BW19	KIFC1_HUMAN	kinesin family member C1	80					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|spindle assembly (GO:0051225)	endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|minus-end-directed microtubule motor activity (GO:0008569)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	13						AGACACAAGGCCAGACCACAG	0.473																																																	0													89.0	86.0	87.0					6																	33366154		2203	4300	6503	SO:0001819	synonymous_variant	3833			D14678	CCDS34430.1	6p21.32	2014-05-15	2003-01-09	2003-01-10	ENSG00000237649	ENSG00000237649		"""Kinesins"""	6389	protein-coding gene	gene with protein product		603763	"""kinesin-like 2"""	KNSL2		8276466	Standard	NM_002263		Approved	HSET	uc003oef.4	Q9BW19	OTTHUMG00000031209	ENST00000428849.2:c.240C>T	6.37:g.33366154C>T			O60887|Q14834|Q4KMP0|Q5SU09|Q6GMS7|Q6P4A5|Q9UQP7	Silent	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.G80	ENST00000428849.2	37	c.240	CCDS34430.1	6																																																																																			KIFC1	-	NULL		0.473	KIFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIFC1	HGNC	protein_coding	OTTHUMT00000076417.1	C	NM_002263		33366154	+1	no_errors	ENST00000428849	ensembl	human	known	70_37	silent	SNP	0.209	T
KIF25	3834	genome.wustl.edu	37	6	168418689	168418689	+	5'UTR	SNP	C	C	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr6:168418689C>A	ENST00000443060.2	+	0	266				KIF25_ENST00000351261.3_5'UTR|KIF25_ENST00000354419.2_5'UTR|KIF25_ENST00000515361.1_3'UTR			Q9UIL4	KIF25_HUMAN	kinesin family member 25						ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of autophagy (GO:0010507)|organelle organization (GO:0006996)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		TCCTGGCCACCCTCTGATTGA	0.368																																																	0																																										SO:0001623	5_prime_UTR_variant	3834			AB012722	CCDS5305.1, CCDS43530.1	6q27	2008-02-05	2003-01-09	2003-01-10	ENSG00000125337	ENSG00000125337		"""Kinesins"""	6390	protein-coding gene	gene with protein product		603815	"""kinesin-like 3"""	KNSL3		9925910	Standard	NM_030615		Approved		uc003qwk.1	Q9UIL4	OTTHUMG00000016035	ENST00000443060.2:c.-126C>A	6.37:g.168418689C>A			O94775|Q5SZU9	RNA	SNP	-	NULL	ENST00000443060.2	37	NULL	CCDS5305.1	6																																																																																			KIF25	-	-		0.368	KIF25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KIF25	HGNC	protein_coding	OTTHUMT00000362509.1	C			168418689	+1	no_errors	ENST00000515361	ensembl	human	known	70_37	rna	SNP	0.006	A
KLHDC4	54758	genome.wustl.edu	37	16	87764168	87764168	+	Nonsense_Mutation	SNP	C	C	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr16:87764168C>A	ENST00000270583.5	-	6	647	c.589G>T	c.(589-591)Gaa>Taa	p.E197*	KLHDC4_ENST00000353170.5_Nonsense_Mutation_p.E140*|KLHDC4_ENST00000347925.5_Intron|KLHDC4_ENST00000566349.1_5'UTR	NM_017566.3	NP_060036.2	Q8TBB5	KLDC4_HUMAN	kelch domain containing 4	197										breast(2)|endometrium(3)|lung(10)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(2)	21				BRCA - Breast invasive adenocarcinoma(80;0.0283)		CGTGTACTTTCATGGAAGCCA	0.433																																																	0													140.0	121.0	127.0					16																	87764168		2198	4300	6498	SO:0001587	stop_gained	54758			AK001742	CCDS10963.1, CCDS54050.1, CCDS54051.1	16q24	2008-02-05			ENSG00000104731	ENSG00000104731			25272	protein-coding gene	gene with protein product							Standard	NM_001184854		Approved	DKFZp434G0522	uc002fki.3	Q8TBB5	OTTHUMG00000137657	ENST00000270583.5:c.589G>T	16.37:g.87764168C>A	ENSP00000270583:p.Glu197*		D3DUN3|D3DUN4|D3DUN5|Q96F29|Q9BVN3	Nonsense_Mutation	SNP	pfam_Kelch_2,pfam_Kelch_1	p.E197*	ENST00000270583.5	37	c.589	CCDS10963.1	16	.	.	.	.	.	.	.	.	.	.	C	37	6.117246	0.97296	.	.	ENSG00000104731	ENST00000270583;ENST00000316853;ENST00000353170	.	.	.	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-3.8145	14.9275	0.70890	0.0:1.0:0.0:0.0	.	.	.	.	X	197;16;140	.	ENSP00000270583:E197X	E	-	1	0	KLHDC4	86321669	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	4.688000	0.61715	2.193000	0.70182	0.655000	0.94253	GAA	KLHDC4	-	pfam_Kelch_1		0.433	KLHDC4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KLHDC4	HGNC	protein_coding	OTTHUMT00000269109.2	C	NM_017566		87764168	-1	no_errors	ENST00000270583	ensembl	human	known	70_37	nonsense	SNP	1.000	A
L3MBTL2	83746	genome.wustl.edu	37	22	41605844	41605844	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr22:41605844G>A	ENST00000216237.5	+	2	327	c.169G>A	c.(169-171)Gag>Aag	p.E57K	L3MBTL2_ENST00000489136.1_3'UTR|RP4-756G23.5_ENST00000451176.1_RNA|RP4-756G23.5_ENST00000441316.1_RNA	NM_031488.4	NP_113676.2	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2 (Drosophila)	57					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.E57K(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						AGCAGAAAATGAGGATCGGGA	0.557																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											142.0	138.0	139.0					22																	41605844		2203	4300	6503	SO:0001583	missense	83746			AJ305226	CCDS14011.1	22q13.31-q13.33	2008-06-11			ENSG00000100395	ENSG00000100395			18594	protein-coding gene	gene with protein product		611865				11682070	Standard	NM_031488		Approved	H-l(3)mbt-l, DKFZP761I141, dJ756G23.3	uc003azo.3	Q969R5	OTTHUMG00000150942	ENST00000216237.5:c.169G>A	22.37:g.41605844G>A	ENSP00000216237:p.Glu57Lys		Q8TEN1|Q96SC4|Q9BQI2|Q9UGS4	Missense_Mutation	SNP	pfam_Mbt,smart_Mbt,pfscan_Mbt,pfscan_Znf_FCS	p.E57K	ENST00000216237.5	37	c.169	CCDS14011.1	22	.	.	.	.	.	.	.	.	.	.	G	18.15	3.558972	0.65538	.	.	ENSG00000100395	ENST00000216237;ENST00000449635	T	0.20332	2.08	5.36	4.32	0.51571	.	0.520111	0.20332	N	0.094412	T	0.14442	0.0349	N	0.24115	0.695	0.26030	N	0.981756	B	0.29037	0.231	B	0.21917	0.037	T	0.11060	-1.0603	10	0.22706	T	0.39	.	15.1449	0.72643	0.0:0.0:0.8576:0.1424	.	57	Q969R5	LMBL2_HUMAN	K	57;49	ENSP00000216237:E57K	ENSP00000216237:E57K	E	+	1	0	L3MBTL2	39935790	1.000000	0.71417	0.890000	0.34922	0.980000	0.70556	6.323000	0.72891	1.206000	0.43276	0.650000	0.86243	GAG	L3MBTL2	-	NULL		0.557	L3MBTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	L3MBTL2	HGNC	protein_coding	OTTHUMT00000320613.1	G	NM_031488		41605844	+1	no_errors	ENST00000216237	ensembl	human	known	70_37	missense	SNP	0.670	A
LCLAT1	253558	genome.wustl.edu	37	2	30828927	30828927	+	Intron	SNP	T	T	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr2:30828927T>C	ENST00000309052.4	+	7	951				LCLAT1_ENST00000540623.1_Intron|LCLAT1_ENST00000379509.3_Intron|LCLAT1_ENST00000359433.1_Missense_Mutation_p.L263P|LCLAT1_ENST00000491680.2_Intron|LCLAT1_ENST00000319406.4_Missense_Mutation_p.L263P	NM_182551.3	NP_872357.2	Q6UWP7	LCLT1_HUMAN	lysocardiolipin acyltransferase 1						cardiolipin acyl-chain remodeling (GO:0035965)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|multicellular organismal development (GO:0007275)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)	19						caaggagaactacaaatcact	0.458																																																	0																																										SO:0001627	intron_variant	253558			AK095284	CCDS1772.1, CCDS42670.1	2p23.1	2008-12-15	2008-12-15	2008-12-15	ENSG00000172954	ENSG00000172954			26756	protein-coding gene	gene with protein product		614241	"""lysocardiolipin acyltransferase"""	LYCAT		18931347, 15152008, 16620771, 17675553	Standard	NM_001002257		Approved	FLJ37965, ALCAT1, AGPAT8	uc002rnl.3	Q6UWP7	OTTHUMG00000099349	ENST00000309052.4:c.743-34056T>C	2.37:g.30828927T>C			A6H8Z7|Q8N1Q7	Missense_Mutation	SNP	pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase	p.L263P	ENST00000309052.4	37	c.788	CCDS1772.1	2	.	.	.	.	.	.	.	.	.	.	T	7.347	0.622017	0.14193	.	.	ENSG00000172954	ENST00000319406;ENST00000359433	T;T	0.54866	0.55;0.55	0.0465	0.0465	0.14256	.	.	.	.	.	T	0.33818	0.0876	.	.	.	0.23820	N	0.996754	B	0.17465	0.022	B	0.08055	0.003	T	0.18272	-1.0342	7	0.33940	T	0.23	.	.	.	.	.	263	Q6UWP7-2	.	P	263	ENSP00000368826:L263P;ENSP00000352406:L263P	ENSP00000368826:L263P	L	+	2	0	LCLAT1	30682431	0.579000	0.26725	0.464000	0.27143	0.466000	0.32739	0.147000	0.16202	0.115000	0.18071	0.113000	0.15668	CTA	LCLAT1	-	NULL		0.458	LCLAT1-001	KNOWN	basic|CCDS	protein_coding	LCLAT1	HGNC	protein_coding	OTTHUMT00000216780.1	T	NM_182551		30828927	+1	no_errors	ENST00000319406	ensembl	human	known	70_37	missense	SNP	0.497	C
LINC00657	647979	genome.wustl.edu	37	20	34638258	34638258	+	lincRNA	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr20:34638258G>A	ENST00000565493.1	-	0	624					NR_027451.1				long intergenic non-protein coding RNA 657																		ACCGCCCGATGGCCGCTAACC	0.577																																																	0																																												647979			AI619767, AK090641, BC011592		20q11.23	2012-10-12			ENSG00000260032	ENSG00000260032		"""Long non-coding RNAs"""	44311	non-coding RNA	RNA, long non-coding							Standard	NR_027451		Approved		uc002xet.3		OTTHUMG00000175580		20.37:g.34638258G>A				RNA	SNP	-	NULL	ENST00000565493.1	37	NULL		20																																																																																			LINC00657	-	-		0.577	LINC00657-001	KNOWN	basic	lincRNA	LINC00657	HGNC	lincRNA	OTTHUMT00000430538.1	G	NR_027451		34638258	-1	no_errors	ENST00000565493	ensembl	human	known	70_37	rna	SNP	0.000	A
LINC00969	440993	genome.wustl.edu	37	3	195412514	195412515	+	lincRNA	INS	-	-	C	rs140203535	byFrequency	TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr3:195412514_195412515insC	ENST00000445430.1	+	0	3711_3712									long intergenic non-protein coding RNA 969																		tcatttacagtcccctgttgcg	0.376													|||unknown(NO_COVERAGE)	1724	0.344249	0.2526	0.3689	5008	,	,		33784	0.3889		0.3797	False		,,,				2504	0.3681																0																																												440993			AK128346		3q29	2013-06-07			ENSG00000242086	ENSG00000242086		"""Long non-coding RNAs"""	48729	non-coding RNA	RNA, long non-coding							Standard	XR_427455		Approved				OTTHUMG00000155834		3.37:g.195412518_195412518dupC				RNA	INS	-	NULL	ENST00000445430.1	37	NULL		3																																																																																			AC069513.3	-	-		0.376	LINC00969-038	KNOWN	basic	lincRNA	LOC440993	Clone_based_vega_gene	lincRNA	OTTHUMT00000341951.1	-			195412515	+1	no_errors	ENST00000414625	ensembl	human	known	70_37	rna	INS	0.000:0.000	C
LRCH3	84859	genome.wustl.edu	37	3	197547201	197547201	+	Silent	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr3:197547201G>A	ENST00000425562.2	+	4	540	c.540G>A	c.(538-540)gtG>gtA	p.V180V	LRCH3_ENST00000438796.2_Silent_p.V180V|LRCH3_ENST00000414675.2_Silent_p.V180V|LRCH3_ENST00000441090.2_Intron|LRCH3_ENST00000334859.4_Silent_p.V180V			Q96II8	LRCH3_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 3	180						cytoplasm (GO:0005737)|extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)		AATAGGATGTGAGCTGCAATG	0.353																																																	0													98.0	97.0	97.0					3																	197547201		2203	4300	6503	SO:0001819	synonymous_variant	84859			AL137527	CCDS3330.1	3q29	2006-04-12			ENSG00000186001	ENSG00000186001			28637	protein-coding gene	gene with protein product						12477932	Standard	NM_032773		Approved	MGC4126	uc003fyj.1	Q96II8	OTTHUMG00000155378	ENST00000425562.2:c.540G>A	3.37:g.197547201G>A			B4E0T7|Q96FP9|Q9NT52	Missense_Mutation	SNP	NULL	p.E90K	ENST00000425562.2	37	c.268		3																																																																																			LRCH3	-	NULL		0.353	LRCH3-006	KNOWN	basic	protein_coding	LRCH3	HGNC	protein_coding	OTTHUMT00000339965.1	G	NM_032773		197547201	+1	no_errors	ENST00000443727	ensembl	human	known	70_37	missense	SNP	0.997	A
LRCH3	84859	genome.wustl.edu	37	3	197547211	197547211	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr3:197547211G>A	ENST00000425562.2	+	4	550	c.550G>A	c.(550-552)Gaa>Aaa	p.E184K	LRCH3_ENST00000438796.2_Missense_Mutation_p.E184K|LRCH3_ENST00000493726.1_3'UTR|LRCH3_ENST00000414675.2_Missense_Mutation_p.E184K|LRCH3_ENST00000441090.2_Intron|LRCH3_ENST00000334859.4_Missense_Mutation_p.E184K			Q96II8	LRCH3_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 3	184						cytoplasm (GO:0005737)|extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)		GAGCTGCAATGAAATTCAAAC	0.338																																																	0													103.0	103.0	103.0					3																	197547211		2203	4300	6503	SO:0001583	missense	84859			AL137527	CCDS3330.1	3q29	2006-04-12			ENSG00000186001	ENSG00000186001			28637	protein-coding gene	gene with protein product						12477932	Standard	NM_032773		Approved	MGC4126	uc003fyj.1	Q96II8	OTTHUMG00000155378	ENST00000425562.2:c.550G>A	3.37:g.197547211G>A	ENSP00000393579:p.Glu184Lys		B4E0T7|Q96FP9|Q9NT52	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_CH-domain,superfamily_CH-domain,smart_Leu-rich_rpt_typical-subtyp,smart_CH-domain,pfscan_CH-domain	p.E184K	ENST00000425562.2	37	c.550		3	.	.	.	.	.	.	.	.	.	.	G	34	5.378307	0.95945	.	.	ENSG00000186001	ENST00000438796;ENST00000414675;ENST00000334859;ENST00000425562	T;T;T;T	0.56444	0.46;0.46;0.46;0.46	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.59622	0.2207	N	0.13235	0.315	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.991	D;D;D	0.91635	0.992;0.999;0.966	T	0.67070	-0.5763	10	0.87932	D	0	-18.6597	19.2799	0.94048	0.0:0.0:1.0:0.0	.	184;184;184	B4E0T7;Q96II8-2;Q96II8-3	.;.;.	K	184	ENSP00000399751:E184K;ENSP00000394965:E184K;ENSP00000334375:E184K;ENSP00000393579:E184K	ENSP00000334375:E184K	E	+	1	0	LRCH3	199031608	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.179000	0.94861	2.644000	0.89710	0.555000	0.69702	GAA	LRCH3	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp		0.338	LRCH3-006	KNOWN	basic	protein_coding	LRCH3	HGNC	protein_coding	OTTHUMT00000339965.1	G	NM_032773		197547211	+1	no_errors	ENST00000438796	ensembl	human	known	70_37	missense	SNP	1.000	A
LRP12	29967	genome.wustl.edu	37	8	105502654	105502654	+	3'UTR	SNP	C	C	G			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr8:105502654C>G	ENST00000276654.5	-	0	2935				LRP12_ENST00000518375.1_5'UTR|LRP12_ENST00000424843.2_3'UTR	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12						endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			TGAAAACAATCAGAAACAAAT	0.303																																																	0																																										SO:0001624	3_prime_UTR_variant	29967			AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.*247G>C	8.37:g.105502654C>G			A8K137|B4DRQ2	RNA	SNP	-	NULL	ENST00000276654.5	37	NULL	CCDS6303.1	8																																																																																			LRP12	-	-		0.303	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRP12	HGNC	protein_coding	OTTHUMT00000380821.1	C	NM_013437		105502654	-1	no_errors	ENST00000518375	ensembl	human	putative	70_37	rna	SNP	0.980	G
LRP1B	53353	genome.wustl.edu	37	2	141625833	141625833	+	Splice_Site	DEL	C	C	-			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr2:141625833delC	ENST00000389484.3	-	26	5141		c.e26-1			NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B						protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GAAAAGAATTCTaaaaaaaaa	0.343										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0													25.0	26.0	26.0					2																	141625833		2201	4295	6496	SO:0001630	splice_region_variant	53353			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.4170-1G>-	2.37:g.141625833delC			Q8WY29|Q8WY30|Q8WY31	Splice_Site	DEL	-	e26-1	ENST00000389484.3	37	c.4170-1	CCDS2182.1	2																																																																																			LRP1B	-	-		0.343	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	C	NM_018557	Intron	141625833	-1	no_errors	ENST00000389484	ensembl	human	known	70_37	splice_site_del	DEL	1.000	-
LTBP4	8425	genome.wustl.edu	37	19	41112348	41112348	+	Missense_Mutation	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr19:41112348G>C	ENST00000308370.7	+	9	1108	c.1108G>C	c.(1108-1110)Ggc>Cgc	p.G370R	LTBP4_ENST00000602240.1_3'UTR|LTBP4_ENST00000545697.1_5'UTR|LTBP4_ENST00000204005.9_Missense_Mutation_p.G333R|LTBP4_ENST00000396819.3_Missense_Mutation_p.G303R|RN7SL758P_ENST00000580450.1_RNA	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	370	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CTGCCAGCACGGCGAGTGTGC	0.652																																																	0													7.0	10.0	9.0					19																	41112348		2080	4177	6257	SO:0001583	missense	8425			Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.1108G>C	19.37:g.41112348G>C	ENSP00000311905:p.Gly370Arg		O00508|O75412|O75413	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_TB_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.G370R	ENST00000308370.7	37	c.1108		19	.	.	.	.	.	.	.	.	.	.	G	27.6	4.849237	0.91277	.	.	ENSG00000090006	ENST00000204005;ENST00000308370;ENST00000396819	D;D;D	0.96073	-3.9;-3.9;-3.9	3.95	3.95	0.45737	Matrix fibril-associated (1);EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.36893	U	0.002355	D	0.97365	0.9138	M	0.79475	2.455	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98083	1.0405	10	0.87932	D	0	.	14.9058	0.70718	0.0:0.0:1.0:0.0	.	303;370;333	E7EUU1;Q8N2S1;E7ENG9	.;LTBP4_HUMAN;.	R	333;370;303	ENSP00000204005:G333R;ENSP00000311905:G370R;ENSP00000380031:G303R	ENSP00000204005:G333R	G	+	1	0	LTBP4	45804188	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	6.956000	0.76013	2.037000	0.60232	0.305000	0.20034	GGC	LTBP4	-	pfam_EGF-like_Ca-bd,superfamily_TB_dom,smart_EGF-like_Ca-bd,smart_EG-like_dom,pfscan_EG-like_dom		0.652	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	LTBP4	HGNC	protein_coding		G	NM_003573		41112348	+1	no_errors	ENST00000308370	ensembl	human	known	70_37	missense	SNP	1.000	C
MAGEE1	57692	genome.wustl.edu	37	X	75648437	75648437	+	Silent	SNP	T	T	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chrX:75648437T>C	ENST00000361470.2	+	1	392	c.114T>C	c.(112-114)gcT>gcC	p.A38A		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	38						dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						GTCTCCCCGCTGATGTGCCAG	0.682																																																	0													22.0	19.0	20.0					X																	75648437		2145	4204	6349	SO:0001819	synonymous_variant	57692			AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.114T>C	X.37:g.75648437T>C			Q5JXC7|Q86TG0|Q8TD92|Q9H216	Silent	SNP	pfam_MAGE,pfscan_MAGE	p.A38	ENST00000361470.2	37	c.114	CCDS14433.1	X																																																																																			MAGEE1	-	NULL		0.682	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEE1	HGNC	protein_coding	OTTHUMT00000057298.1	T	NM_020932		75648437	+1	no_errors	ENST00000361470	ensembl	human	known	70_37	silent	SNP	0.003	C
MAS1L	116511	genome.wustl.edu	37	6	29454693	29454693	+	Silent	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr6:29454693G>C	ENST00000377127.3	-	1	1045	c.987C>G	c.(985-987)ctC>ctG	p.L329L		NM_052967.1	NP_443199.1	P35410	MAS1L_HUMAN	MAS1 proto-oncogene like, G protein-coupled receptor	329					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(7)|pancreas(1)|prostate(2)|skin(2)	28						GAATCACTCTGAGAGATTCCT	0.473																																					NSCLC(153;755 1987 3859 11251 32945)												0													114.0	119.0	117.0					6																	29454693		2203	4300	6503	SO:0001819	synonymous_variant	116511			S78653	CCDS4661.1	6p22.1	2014-06-26	2014-06-26		ENSG00000204687	ENSG00000204687		"""GPCR / Class A : Orphans"""	13961	protein-coding gene	gene with protein product		607235	"""MAS1 oncogene-like"""				Standard	NM_052967		Approved	MAS-L, MRG, dJ994E9.2	uc011dlq.2	P35410	OTTHUMG00000031089	ENST00000377127.3:c.987C>G	6.37:g.29454693G>C			Q5SUN5	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.L329	ENST00000377127.3	37	c.987	CCDS4661.1	6																																																																																			MAS1L	-	NULL		0.473	MAS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAS1L	HGNC	protein_coding	OTTHUMT00000076126.2	G	NM_052967		29454693	-1	no_errors	ENST00000377127	ensembl	human	known	70_37	silent	SNP	0.001	C
MLLT3	4300	genome.wustl.edu	37	9	20414346	20414346	+	Silent	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr9:20414346G>A	ENST00000380338.4	-	5	784	c.498C>T	c.(496-498)agC>agT	p.S166S	MLLT3_ENST00000429426.2_Silent_p.S163S|MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000475957.1_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	166	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S166S(4)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctactgctgctgctgc	0.527			T	MLL	ALL																																			Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	4	Substitution - coding silent(4)	urinary_tract(2)|lung(1)|prostate(1)											8.0	15.0	13.0					9																	20414346		1434	3114	4548	SO:0001819	synonymous_variant	4300			L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.498C>T	9.37:g.20414346G>A			B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	pfam_YEATS,pfscan_YEATS	p.S166	ENST00000380338.4	37	c.498	CCDS6494.1	9																																																																																			MLLT3	-	NULL		0.527	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLLT3	HGNC	protein_coding	OTTHUMT00000051872.1	G	NM_004529		20414346	-1	no_errors	ENST00000380338	ensembl	human	known	70_37	silent	SNP	0.975	A
MLLT4	4301	genome.wustl.edu	37	6	168352292	168352292	+	Missense_Mutation	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr6:168352292G>C	ENST00000447894.2	+	29	4237	c.4237G>C	c.(4237-4239)Gaa>Caa	p.E1413Q	MLLT4_ENST00000400822.3_Missense_Mutation_p.E1412Q|MLLT4_ENST00000351017.4_Missense_Mutation_p.E1420Q|MLLT4_ENST00000344191.4_Missense_Mutation_p.E1413Q|MLLT4_ENST00000392108.3_Missense_Mutation_p.E1413Q|MLLT4_ENST00000392112.1_Missense_Mutation_p.E1396Q|MLLT4_ENST00000366806.2_Missense_Mutation_p.E1413Q			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	1413					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		GAGAAAGAGAGAAGAACATCA	0.602			T	MLL	AL																																			Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	0													89.0	86.0	87.0					6																	168352292		2203	4300	6503	SO:0001583	missense	4301			AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.4237G>C	6.37:g.168352292G>C	ENSP00000404595:p.Glu1413Gln		O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Missense_Mutation	SNP	pfam_Ras-assoc,pfam_Dil_domain,pfam_PDZ,pfam_FHA_dom,superfamily_PDZ,superfamily_SMAD_FHA_domain,smart_Ras-assoc,smart_FHA_dom,smart_PDZ,pfscan_Dilute,pfscan_PDZ,pfscan_Ras-assoc	p.E1413Q	ENST00000447894.2	37	c.4237		6	.	.	.	.	.	.	.	.	.	.	G	13.83	2.354904	0.41700	.	.	ENSG00000130396	ENST00000344191;ENST00000351017;ENST00000392108;ENST00000366806;ENST00000392112;ENST00000341575;ENST00000400822;ENST00000447894	T;T;T;T;T;T;T	0.04809	3.77;3.66;3.76;3.76;3.55;3.66;3.66	5.52	3.75	0.43078	.	0.000000	0.85682	D	0.000000	T	0.09905	0.0243	M	0.72479	2.2	0.49389	D	0.999784	D;D;D;D	0.89917	0.999;1.0;0.999;0.999	D;D;D;D	0.91635	0.993;0.999;0.995;0.995	T	0.03503	-1.1030	10	0.34782	T	0.22	-0.0041	11.9041	0.52701	0.1403:0.0:0.8597:0.0	.	1413;1412;1413;1397	P55196;P55196-5;P55196-6;P55196-2	AFAD_HUMAN;.;.;.	Q	1413;1420;1413;1413;1396;1413;1412;1413	ENSP00000341118:E1413Q;ENSP00000252692:E1420Q;ENSP00000375956:E1413Q;ENSP00000355771:E1413Q;ENSP00000375960:E1396Q;ENSP00000383623:E1412Q;ENSP00000404595:E1413Q	ENSP00000345834:E1413Q	E	+	1	0	MLLT4	168095141	1.000000	0.71417	0.008000	0.14137	0.001000	0.01503	8.734000	0.91543	0.705000	0.31890	-0.136000	0.14681	GAA	MLLT4	-	NULL		0.602	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	MLLT4	HGNC	protein_coding	OTTHUMT00000372077.1	G	NM_005936		168352292	+1	no_errors	ENST00000366806	ensembl	human	known	70_37	missense	SNP	0.979	C
MUC2	4583	genome.wustl.edu	37	11	1086013	1086013	+	Silent	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr11:1086013G>A	ENST00000441003.2	+	22	2880	c.2853G>A	c.(2851-2853)acG>acA	p.T951T	MUC2_ENST00000359061.5_Silent_p.T951T	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	951	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CCTACACCACGCGGGAGGTGG	0.617																																																	0													47.0	54.0	52.0					11																	1086013		2143	4228	6371	SO:0001819	synonymous_variant	4583			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.2853G>A	11.37:g.1086013G>A			Q14878	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.T951	ENST00000441003.2	37	c.2853		11																																																																																			MUC2	-	pfam_VWF_type-D,smart_VWF_type-D		0.617	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	HGNC	protein_coding	OTTHUMT00000345894.2	G	NM_002457		1086013	+1	no_errors	ENST00000441003	ensembl	human	known	70_37	silent	SNP	0.000	A
MUC4	4585	genome.wustl.edu	37	3	195508307	195508307	+	Missense_Mutation	SNP	T	T	C	rs200780098	byFrequency	TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr3:195508307T>C	ENST00000463781.3	-	2	10603	c.10144A>G	c.(10144-10146)Att>Gtt	p.I3382V	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.I3382V|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCCGAGGAAATGTCGGTGACA	0.577																																																	0													39.0	33.0	35.0					3																	195508307		686	1584	2270	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10144A>G	3.37:g.195508307T>C	ENSP00000417498:p.Ile3382Val		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.I3382V	ENST00000463781.3	37	c.10144	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	N	1.063	-0.672271	0.03403	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33865	1.46;1.39	1.18	-2.35	0.06684	.	.	.	.	.	T	0.14098	0.0341	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.15925	-1.0420	8	.	.	.	.	3.6586	0.08230	0.3126:0.498:0.0:0.1893	rs433791	3254	E7ESK3	.	V	3382	ENSP00000417498:I3382V;ENSP00000420243:I3382V	.	I	-	1	0	MUC4	196993086	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-4.250000	0.00266	-2.348000	0.00619	-1.896000	0.00531	ATT	MUC4	-	NULL		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	T	NM_018406		195508307	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	missense	SNP	0.001	C
MYB	4602	genome.wustl.edu	37	6	135518263	135518263	+	Intron	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr6:135518263G>C	ENST00000367814.4	+	9	1389				MYB_ENST00000527615.1_Intron|MYB_ENST00000531845.1_Intron|MYB_ENST00000528774.1_Missense_Mutation_p.L453F|MYB_ENST00000442647.2_Intron|MYB-AS1_ENST00000455534.1_RNA|MYB_ENST00000341911.5_Missense_Mutation_p.L456F|MYB_ENST00000534044.1_Intron|MYB_ENST00000525369.1_Intron|MYB_ENST00000534121.1_Missense_Mutation_p.L440F|MYB_ENST00000533624.1_Intron|MYB_ENST00000316528.8_Intron	NM_001161659.1|NM_005375.2	NP_001155131.1|NP_005366.2	P10242	MYB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog						B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|chromatin remodeling (GO:0006338)|embryonic digestive tract development (GO:0048566)|G1/S transition of mitotic cell cycle (GO:0000082)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of T-helper cell differentiation (GO:0045624)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|thymus development (GO:0048538)	nuclear matrix (GO:0016363)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(4)|endometrium(1)|kidney(2)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		AACGTATGTTGAGTGAGAGTT	0.532			T	NFIB	adenoid cystic carcinoma																																			Dom	yes		6	6q22-23	4602	v-myb myeloblastosis viral oncogene homolog		E	0													150.0	134.0	139.0					6																	135518263		1568	3582	5150	SO:0001627	intron_variant	4602				CCDS5174.1, CCDS47481.1, CCDS47482.1, CCDS55058.1, CCDS55059.1, CCDS55060.1, CCDS55061.1, CCDS55062.1	6q22-q23	2013-07-09	2013-07-09		ENSG00000118513	ENSG00000118513			7545	protein-coding gene	gene with protein product		189990				17599807	Standard	NM_001130172		Approved	c-myb	uc003qfh.3	P10242	OTTHUMG00000015629	ENST00000367814.4:c.1203+1123G>C	6.37:g.135518263G>C			E9PI07|E9PLZ5|E9PNA4|E9PNL6|E9PRS2|P78391|P78392|P78525|P78526|Q14023|Q14024|Q708E4|Q708E7|Q9UE83	Missense_Mutation	SNP	pfam_C-myb_C,pfam_SANT/Myb,pfam_Tscrpt_reg_Wos2-domain,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.L456F	ENST00000367814.4	37	c.1368	CCDS5174.1	6	.	.	.	.	.	.	.	.	.	.	G	4.431	0.079810	0.08533	.	.	ENSG00000118513	ENST00000341911;ENST00000528774;ENST00000534121	T;T;T	0.12774	2.67;2.67;2.65	5.79	4.91	0.64330	.	0.358411	0.26275	N	0.025313	T	0.10852	0.0265	L	0.39898	1.24	0.80722	D	1	D;D;D	0.63046	0.966;0.961;0.992	P;P;P	0.57101	0.691;0.708;0.813	T	0.09487	-1.0672	10	0.09843	T	0.71	-2.5913	13.4561	0.61199	0.1266:0.0:0.8734:0.0	.	453;440;456	E9PNL6;E9PNA4;P10242-4	.;.;.	F	456;453;440	ENSP00000339992:L456F;ENSP00000434723:L453F;ENSP00000432851:L440F	ENSP00000339992:L456F	L	+	3	2	MYB	135559956	1.000000	0.71417	0.928000	0.36995	0.125000	0.20455	2.433000	0.44793	2.746000	0.94184	0.655000	0.94253	TTG	MYB	-	NULL		0.532	MYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYB	HGNC	protein_coding	OTTHUMT00000042347.4	G			135518263	+1	no_errors	ENST00000341911	ensembl	human	known	70_37	missense	SNP	0.992	C
MYO15A	51168	genome.wustl.edu	37	17	18022172	18022172	+	Missense_Mutation	SNP	G	G	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr17:18022172G>T	ENST00000205890.5	+	2	396	c.58G>T	c.(58-60)Gca>Tca	p.A20S		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	20					inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					ggggaagaaggcaccggagcc	0.612																																																	0													55.0	76.0	69.0					17																	18022172		1989	4148	6137	SO:0001583	missense	51168			AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.58G>T	17.37:g.18022172G>T	ENSP00000205890:p.Ala20Ser		B4DFC7	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_SH3_2,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_SH3_domain,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,prints_Myosin_head_motor_dom	p.A20S	ENST00000205890.5	37	c.58	CCDS42271.1	17	.	.	.	.	.	.	.	.	.	.	G	13.19	2.164184	0.38217	.	.	ENSG00000091536	ENST00000205890	D	0.89552	-2.53	5.37	4.37	0.52481	.	.	.	.	.	T	0.79009	0.4374	L	0.27053	0.805	0.50632	D	0.99988	P	0.44734	0.842	B	0.33521	0.165	T	0.81250	-0.1018	9	0.59425	D	0.04	.	10.5718	0.45204	0.0751:0.1348:0.7902:0.0	.	20	Q9UKN7	MYO15_HUMAN	S	20	ENSP00000205890:A20S	ENSP00000205890:A20S	A	+	1	0	MYO15A	17962897	1.000000	0.71417	0.985000	0.45067	0.524000	0.34500	3.636000	0.54317	2.524000	0.85096	0.561000	0.74099	GCA	MYO15A	-	NULL		0.612	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO15A	HGNC	protein_coding	OTTHUMT00000132048.1	G	NM_016239		18022172	+1	no_errors	ENST00000205890	ensembl	human	known	70_37	missense	SNP	0.683	T
MYO7B	4648	genome.wustl.edu	37	2	128379604	128379604	+	Silent	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr2:128379604C>T	ENST00000409816.2	+	26	3527	c.3495C>T	c.(3493-3495)ttC>ttT	p.F1165F	MYO7B_ENST00000428314.1_Silent_p.F1165F|MYO7B_ENST00000389524.4_Silent_p.F1165F|MYO7B_ENST00000409090.1_Silent_p.F18F			Q6PIF6	MYO7B_HUMAN	myosin VIIB	1165	MyTH4 1. {ECO:0000255|PROSITE- ProRule:PRU00359}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		ACGGCCCCTTCTGTGCCGAGC	0.652																																																	0													25.0	25.0	25.0					2																	128379604		1752	3692	5444	SO:0001819	synonymous_variant	4648				CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.3495C>T	2.37:g.128379604C>T			Q14786|Q8TEE1	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,pfam_SH3_2,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.F1165	ENST00000409816.2	37	c.3495	CCDS46405.1	2																																																																																			MYO7B	-	pfam_MyTH4_dom,smart_MyTH4_dom,pfscan_MyTH4_dom		0.652	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYO7B	HGNC	protein_coding	OTTHUMT00000331124.3	C	XM_291001		128379604	+1	no_errors	ENST00000389524	ensembl	human	known	70_37	silent	SNP	1.000	T
NDST3	9348	genome.wustl.edu	37	4	119158287	119158287	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr4:119158287C>T	ENST00000296499.5	+	10	2433	c.2030C>T	c.(2029-2031)gCc>gTc	p.A677V	NDST3_ENST00000433996.2_3'UTR	NM_004784.2	NP_004775.1	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3	677	Heparan sulfate N-sulfotransferase 3.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	54						TCAGAGGAAGCCCCTAAAAGA	0.438																																																	0													80.0	78.0	79.0					4																	119158287		2203	4300	6503	SO:0001583	missense	9348			AF074924	CCDS3708.1	4q26	2008-08-04			ENSG00000164100	ENSG00000164100		"""Sulfotransferases, membrane-bound"""	7682	protein-coding gene	gene with protein product		603950				9915799	Standard	NM_004784		Approved	HSST3	uc003ibx.3	O95803	OTTHUMG00000132959	ENST00000296499.5:c.2030C>T	4.37:g.119158287C>T	ENSP00000296499:p.Ala677Val		B4DI67|Q4W5C1|Q4W5D0|Q6UWC5|Q9UP21	Missense_Mutation	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom	p.A677V	ENST00000296499.5	37	c.2030	CCDS3708.1	4	.	.	.	.	.	.	.	.	.	.	C	14.41	2.528544	0.44969	.	.	ENSG00000164100	ENST00000296499	T	0.57273	0.41	6.03	6.03	0.97812	Sulfotransferase domain (1);	0.112160	0.64402	D	0.000011	T	0.33147	0.0853	N	0.16201	0.385	0.80722	D	1	B	0.29627	0.252	B	0.26693	0.072	T	0.19386	-1.0307	10	0.11794	T	0.64	.	13.7229	0.62740	0.0:0.9301:0.0:0.0699	.	677	O95803	NDST3_HUMAN	V	677	ENSP00000296499:A677V	ENSP00000296499:A677V	A	+	2	0	NDST3	119377735	0.998000	0.40836	1.000000	0.80357	0.999000	0.98932	3.650000	0.54424	2.854000	0.98071	0.655000	0.94253	GCC	NDST3	-	pfam_Sulfotransferase_dom		0.438	NDST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST3	HGNC	protein_coding	OTTHUMT00000256517.4	C	NM_004784		119158287	+1	no_errors	ENST00000296499	ensembl	human	known	70_37	missense	SNP	1.000	T
NLRP1	22861	genome.wustl.edu	37	17	5403371	5403371	+	IGR	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr17:5403371C>T	ENST00000262467.5	-	0	5131					NM_001033053.2	NP_001028225.1	Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				CCTCCAGCTTCGCCTGCTGCG	0.687																																																	0																																										SO:0001628	intergenic_variant	22861			AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000			17.37:g.5403371C>T			E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	RNA	SNP	-	NULL	ENST00000262467.5	37	NULL	CCDS32537.1	17																																																																																			NLRP1	-	-		0.687	NLRP1-001	KNOWN	basic|CCDS	protein_coding	NLRP1	HGNC	protein_coding	OTTHUMT00000439513.1	C	NM_033004		5403371	-1	no_errors	ENST00000568641	ensembl	human	known	70_37	rna	SNP	0.000	T
NRXN3	9369	genome.wustl.edu	37	14	79270053	79270053	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr14:79270053G>A	ENST00000554719.1	+	6	1507	c.1016G>A	c.(1015-1017)cGc>cAc	p.R339H	NRXN3_ENST00000335750.5_Missense_Mutation_p.R339H	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	116					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		GTGTCCTTCCGCTTCATGTCC	0.567																																																	0													203.0	147.0	166.0					14																	79270053		2203	4300	6503	SO:0001583	missense	9369			AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.1016G>A	14.37:g.79270053G>A	ENSP00000451648:p.Arg339His		A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Laminin_G	p.R710H	ENST00000554719.1	37	c.2129	CCDS9870.1	14	.	.	.	.	.	.	.	.	.	.	G	33	5.250422	0.95305	.	.	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000554719;ENST00000335750	T;T	0.79749	-1.3;-1.3	5.91	5.91	0.95273	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);	0.000000	0.85682	D	0.000000	D	0.90331	0.6975	.	.	.	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	D	0.89235	0.3580	8	.	.	.	.	20.2985	0.98592	0.0:0.0:1.0:0.0	.	712;339	Q9Y4C0;Q9Y4C0-3	NRX3A_HUMAN;.	H	712;710;339;339	ENSP00000451648:R339H;ENSP00000338349:R339H	.	R	+	2	0	NRXN3	78339806	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.793000	0.96121	0.655000	0.94253	CGC	NRXN3	-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.567	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRXN3	HGNC	protein_coding	OTTHUMT00000413787.1	G	NM_001105250		79270053	+1	no_errors	ENST00000554738	ensembl	human	known	70_37	missense	SNP	1.000	A
OPN1MW	2652	genome.wustl.edu	37	X	153459060	153459060	+	Missense_Mutation	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chrX:153459060G>C	ENST00000369935.5	+	5	966	c.906G>C	c.(904-906)ttG>ttC	p.L302F		NM_000513.2	NP_000504.1	P04001	OPSG_HUMAN	opsin 1 (cone pigments), medium-wave-sensitive	302					G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction, visible light (GO:0007603)|positive regulation of cytokinesis (GO:0032467)|protein-chromophore linkage (GO:0018298)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			endometrium(1)|lung(1)	2	all_cancers(53;1.83e-16)|all_epithelial(53;2.73e-10)|all_lung(58;6.39e-07)|Lung NSC(58;8.37e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TCCACCCTTTGATGGCTGCCC	0.542																																																	0													73.0	79.0	78.0					X																	153459060		1401	3776	5177	SO:0001583	missense	2652			K03494	CCDS14743.1	Xq28	2013-01-08	2008-04-16		ENSG00000147380	ENSG00000268221		"""GPCR / Class A : Opsin receptors"""	4206	protein-coding gene	gene with protein product	"""cone dystrophy 5 (X-linked)"""	300821	"""color blindness, deutan"", ""green cone photoreceptor pigment"""	GCP, CBBM, CBD			Standard	NM_000513		Approved	OPN1MW1, COD5	uc004fkb.3	P04001	OTTHUMG00000022652	ENST00000369935.5:c.906G>C	X.37:g.153459060G>C	ENSP00000358951:p.Leu302Phe			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfscan_GPCR_Rhodpsn_7TM,prints_Opsin_red/grn,prints_GPCR_Rhodpsn,prints_Opsin	p.L302F	ENST00000369935.5	37	c.906	CCDS14743.1	X	.	.	.	.	.	.	.	.	.	.	G	10.76	1.441320	0.25900	.	.	ENSG00000147380	ENST00000369935	T	0.38887	1.11	3.15	2.21	0.28008	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	T	0.59142	0.2172	M	0.83223	2.63	0.46586	D	0.999119	D	0.60575	0.988	D	0.67548	0.952	T	0.56884	-0.7905	10	0.66056	D	0.02	.	5.474	0.16686	0.0:0.184:0.4163:0.3997	.	302	P04001	OPSG_HUMAN	F	302	ENSP00000358951:L302F	ENSP00000358951:L302F	L	+	3	2	OPN1MW	153112254	0.001000	0.12720	0.893000	0.35052	0.150000	0.21749	0.775000	0.26689	0.267000	0.21916	0.171000	0.16805	TTG	OPN1MW	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfscan_GPCR_Rhodpsn_7TM,prints_Opsin_red/grn,prints_Opsin		0.542	OPN1MW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPN1MW	HGNC	protein_coding	OTTHUMT00000058771.3	G	NM_000513		153459060	+1	no_errors	ENST00000369935	ensembl	human	known	70_37	missense	SNP	0.995	C
OR10K2	391107	genome.wustl.edu	37	1	158389870	158389870	+	Nonsense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:158389870G>A	ENST00000314902.2	-	1	786	c.787C>T	c.(787-789)Cag>Tag	p.Q263*		NM_001004476.1	NP_001004476.1	Q6IF99	O10K2_HUMAN	olfactory receptor, family 10, subfamily K, member 2	263						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(19)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_hematologic(112;0.0378)					TAGTTGGACTGAGGCCTTAAG	0.408																																																	0													115.0	113.0	113.0					1																	158389870		2203	4300	6503	SO:0001587	stop_gained	391107			AB065642	CCDS30896.1	1q23.1	2012-08-09			ENSG00000180708	ENSG00000180708		"""GPCR / Class A : Olfactory receptors"""	14826	protein-coding gene	gene with protein product							Standard	NM_001004476		Approved		uc010pii.2	Q6IF99	OTTHUMG00000019638	ENST00000314902.2:c.787C>T	1.37:g.158389870G>A	ENSP00000324251:p.Gln263*			Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Q263*	ENST00000314902.2	37	c.787	CCDS30896.1	1	.	.	.	.	.	.	.	.	.	.	g	3.746	-0.052569	0.07362	.	.	ENSG00000180708	ENST00000314902	.	.	.	4.23	-1.27	0.09347	.	0.146527	0.30879	N	0.008689	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.365	0.32380	0.0:0.0773:0.2714:0.6513	.	.	.	.	X	263	.	ENSP00000324251:Q263X	Q	-	1	0	OR10K2	156656494	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.872000	0.04219	-0.324000	0.08589	-1.515000	0.00940	CAG	OR10K2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.408	OR10K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10K2	HGNC	protein_coding	OTTHUMT00000051854.1	G	NM_001004476		158389870	-1	no_errors	ENST00000314902	ensembl	human	known	70_37	nonsense	SNP	0.000	A
OR10S1	219873	genome.wustl.edu	37	11	123848062	123848062	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr11:123848062C>T	ENST00000531945.1	-	1	426	c.337G>A	c.(337-339)Gta>Ata	p.V113I		NM_001004474.1	NP_001004474.1	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S, member 1	113						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	36		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TAAAGCTGTACGGCACAGCCC	0.537																																																	0													97.0	75.0	82.0					11																	123848062		2202	4299	6501	SO:0001583	missense	219873			BK004509	CCDS31701.1	11q24.1	2012-08-09			ENSG00000196248	ENSG00000196248		"""GPCR / Class A : Olfactory receptors"""	14807	protein-coding gene	gene with protein product							Standard	NM_001004474		Approved		uc001pzm.1	Q8NGN2	OTTHUMG00000165963	ENST00000531945.1:c.337G>A	11.37:g.123848062C>T	ENSP00000431914:p.Val113Ile		B9EH43|Q6IEV3|Q96R78	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V113I	ENST00000531945.1	37	c.337	CCDS31701.1	11	.	.	.	.	.	.	.	.	.	.	C	8.614	0.889724	0.17540	.	.	ENSG00000196248	ENST00000531945	T	0.02974	4.09	4.74	-5.02	0.02982	GPCR, rhodopsin-like superfamily (1);	1.043970	0.07721	N	0.943597	T	0.01092	0.0036	N	0.02266	-0.62	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.47522	-0.9111	10	0.33940	T	0.23	-0.1205	2.7527	0.05285	0.1006:0.2512:0.1984:0.4497	.	113	Q8NGN2	O10S1_HUMAN	I	113	ENSP00000431914:V113I	ENSP00000431914:V113I	V	-	1	0	OR10S1	123353272	0.000000	0.05858	0.000000	0.03702	0.691000	0.40173	-2.589000	0.00900	-0.919000	0.03803	0.573000	0.79308	GTA	OR10S1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.537	OR10S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10S1	HGNC	protein_coding	OTTHUMT00000387265.2	C	NM_001004474		123848062	-1	no_errors	ENST00000531945	ensembl	human	known	70_37	missense	SNP	0.000	T
OR1N2	138882	genome.wustl.edu	37	9	125315488	125315488	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr9:125315488G>A	ENST00000373688.2	+	1	98	c.40G>A	c.(40-42)Ggg>Agg	p.G14R		NM_001004457.1	NP_001004457.1	Q8NGR9	OR1N2_HUMAN	olfactory receptor, family 1, subfamily N, member 2	14						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(3)	26						CGAACTACAAGGGATGGGAAA	0.453																																																	0													99.0	98.0	98.0					9																	125315488		2203	4300	6503	SO:0001583	missense	138882				CCDS35123.1	9q33.2	2013-09-20			ENSG00000171501	ENSG00000171501		"""GPCR / Class A : Olfactory receptors"""	15111	protein-coding gene	gene with protein product							Standard	NM_001004457		Approved		uc011lyx.2	Q8NGR9	OTTHUMG00000020607	ENST00000373688.2:c.40G>A	9.37:g.125315488G>A	ENSP00000362792:p.Gly14Arg		A3KFM2|B2RNY4|Q6IF17|Q96RA3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G14R	ENST00000373688.2	37	c.40	CCDS35123.1	9	.	.	.	.	.	.	.	.	.	.	G	0.036	-1.304469	0.01353	.	.	ENSG00000171501	ENST00000373688	T	0.00382	7.62	3.71	0.426	0.16479	.	1.391580	0.05579	U	0.572573	T	0.00210	0.0006	N	0.14661	0.345	0.25616	N	0.986451	B	0.06786	0.001	B	0.04013	0.001	T	0.21042	-1.0257	10	0.25751	T	0.34	.	6.4881	0.22099	0.6196:0.0:0.3804:0.0	.	14	Q8NGR9	OR1N2_HUMAN	R	14	ENSP00000362792:G14R	ENSP00000362792:G14R	G	+	1	0	OR1N2	124355309	0.000000	0.05858	0.685000	0.30070	0.558000	0.35554	0.014000	0.13333	-0.018000	0.14079	0.644000	0.83932	GGG	OR1N2	-	NULL		0.453	OR1N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1N2	HGNC	protein_coding	OTTHUMT00000053937.2	G			125315488	+1	no_errors	ENST00000373688	ensembl	human	known	70_37	missense	SNP	0.944	A
OR52W1	120787	genome.wustl.edu	37	11	6221355	6221355	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr11:6221355G>A	ENST00000311352.2	+	1	980	c.902G>A	c.(901-903)cGc>cAc	p.R301H	RP11-290F24.6_ENST00000600308.1_lincRNA	NM_001005178.1	NP_001005178.1	Q6IF63	O52W1_HUMAN	olfactory receptor, family 52, subfamily W, member 1	301						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)	11		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;2.13e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TATGGGGCCCGCACCAAGCAG	0.532																																																	0													144.0	156.0	152.0					11																	6221355		2201	4296	6497	SO:0001583	missense	120787			AB065511	CCDS31407.1	11p15.4	2012-08-09		2004-03-10	ENSG00000175485	ENSG00000175485		"""GPCR / Class A : Olfactory receptors"""	15239	protein-coding gene	gene with protein product				OR52W1P			Standard	NM_001005178		Approved		uc010qzz.2	Q6IF63	OTTHUMG00000165378	ENST00000311352.2:c.902G>A	11.37:g.6221355G>A	ENSP00000309673:p.Arg301His		Q8NH78	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	p.R301H	ENST00000311352.2	37	c.902	CCDS31407.1	11	.	.	.	.	.	.	.	.	.	.	G	13.84	2.357516	0.41801	.	.	ENSG00000175485	ENST00000311352	T	0.41065	1.01	4.59	3.65	0.41850	.	0.000000	0.39274	N	0.001402	T	0.72574	0.3477	H	0.97465	4.01	0.31171	N	0.703213	D	0.89917	1.0	D	0.71656	0.974	T	0.78326	-0.2247	10	0.87932	D	0	.	8.9852	0.35990	0.1728:0.0:0.8272:0.0	.	301	Q6IF63	O52W1_HUMAN	H	301	ENSP00000309673:R301H	ENSP00000309673:R301H	R	+	2	0	OR52W1	6177931	0.003000	0.15002	0.924000	0.36721	0.899000	0.52679	0.962000	0.29280	1.237000	0.43756	0.563000	0.77884	CGC	OR52W1	-	prints_Olfact_rcpt		0.532	OR52W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52W1	HGNC	protein_coding	OTTHUMT00000383758.1	G	NM_001005178		6221355	+1	no_errors	ENST00000311352	ensembl	human	known	70_37	missense	SNP	0.749	A
OTOG	340990	genome.wustl.edu	37	11	17617633	17617633	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr11:17617633C>T	ENST00000399391.2	+	28	3493	c.3493C>T	c.(3493-3495)Cga>Tga	p.R1165*	OTOG_ENST00000399397.1_Nonsense_Mutation_p.R1092*|OTOG_ENST00000342528.2_Nonsense_Mutation_p.R180*	NM_001277269.1	NP_001264198.1	Q6ZRI0	OTOG_HUMAN	otogelin	1165	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				adult locomotory behavior (GO:0008344)|L-arabinose metabolic process (GO:0046373)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	alpha-L-arabinofuranosidase activity (GO:0046556)|structural molecule activity (GO:0005198)			breast(3)|central_nervous_system(1)|lung(1)|skin(1)	6						GAATCCTCTCCGAGAACCATT	0.577																																																	0																																										SO:0001587	stop_gained	340990			AK128214	CCDS59225.1	11p14.3	2014-07-17			ENSG00000188162	ENSG00000188162			8516	protein-coding gene	gene with protein product		604487				9405633	Standard	NM_001277269		Approved	mlemp, OTGN, FLJ46346	uc031pzc.1	Q6ZRI0	OTTHUMG00000149905	ENST00000399391.2:c.3493C>T	11.37:g.17617633C>T	ENSP00000382323:p.Arg1165*		A8MTX6|A8MUJ0|B7WPC4	Nonsense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_AbfB,pfam_TIL_dom,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom	p.R1165*	ENST00000399391.2	37	c.3493	CCDS59225.1	11	.	.	.	.	.	.	.	.	.	.	C	44	10.872638	0.99481	.	.	ENSG00000188162	ENST00000399391;ENST00000399397;ENST00000342528	.	.	.	5.41	4.46	0.54185	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.0695	0.59053	0.3525:0.6475:0.0:0.0	.	.	.	.	X	1165;1092;180	.	ENSP00000341666:R180X	R	+	1	2	OTOG	17574209	0.996000	0.38824	1.000000	0.80357	0.986000	0.74619	3.261000	0.51530	2.529000	0.85273	0.650000	0.86243	CGA	OTOG	-	NULL		0.577	OTOG-201	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOG	HGNC	protein_coding		C			17617633	+1	no_errors	ENST00000399391	ensembl	human	known	70_37	nonsense	SNP	1.000	T
OR9Q2	219957	genome.wustl.edu	37	11	57958484	57958484	+	Missense_Mutation	SNP	C	C	G			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr11:57958484C>G	ENST00000311591.3	+	1	579	c.522C>G	c.(520-522)atC>atG	p.I174M		NM_001005283.2	NP_001005283.1	Q8NGE9	OR9Q2_HUMAN	olfactory receptor, family 9, subfamily Q, member 2	174						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I174M(1)		breast(2)|central_nervous_system(2)|endometrium(1)|large_intestine(3)|lung(24)|ovary(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41		Breast(21;0.0589)				ACAATGAGATCAACTTCATTT	0.473																																																	1	Substitution - Missense(1)	breast(1)											118.0	110.0	113.0					11																	57958484		2201	4296	6497	SO:0001583	missense	219957			AB065859	CCDS31544.1	11q12.1	2012-08-09		2004-03-10	ENSG00000186513	ENSG00000186513		"""GPCR / Class A : Olfactory receptors"""	15328	protein-coding gene	gene with protein product				OR9Q2P			Standard	NM_001005283		Approved		uc010rka.2	Q8NGE9	OTTHUMG00000167414	ENST00000311591.3:c.522C>G	11.37:g.57958484C>G	ENSP00000308714:p.Ile174Met			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I174M	ENST00000311591.3	37	c.522	CCDS31544.1	11	.	.	.	.	.	.	.	.	.	.	C	13.30	2.197283	0.38806	.	.	ENSG00000186513	ENST00000311591	T	0.00220	8.52	5.08	-1.12	0.09808	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48767	D	0.000168	T	0.00580	0.0019	M	0.93197	3.39	0.09310	N	0.999997	D	0.69078	0.997	D	0.72625	0.978	T	0.37865	-0.9687	10	0.87932	D	0	-30.4592	7.2926	0.26374	0.0:0.3847:0.117:0.4984	.	174	Q8NGE9	OR9Q2_HUMAN	M	174	ENSP00000308714:I174M	ENSP00000308714:I174M	I	+	3	3	OR9Q2	57715060	0.000000	0.05858	0.245000	0.24217	0.838000	0.47535	-1.244000	0.02902	-0.071000	0.12886	0.655000	0.94253	ATC	OR9Q2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.473	OR9Q2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR9Q2	HGNC	protein_coding	OTTHUMT00000394540.1	C	NM_001005283		57958484	+1	no_errors	ENST00000311591	ensembl	human	known	70_37	missense	SNP	0.002	G
OR5A2	219981	genome.wustl.edu	37	11	59189567	59189567	+	Missense_Mutation	SNP	T	T	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr11:59189567T>A	ENST00000302040.4	-	1	882	c.860A>T	c.(859-861)aAt>aTt	p.N287I		NM_001001954.1	NP_001001954.1	Q8NGI9	OR5A2_HUMAN	olfactory receptor, family 5, subfamily A, member 2	287						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|liver(1)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	21						GATGATGGGATTCACCACGGG	0.468																																																	0													82.0	78.0	80.0					11																	59189567		2201	4295	6496	SO:0001583	missense	219981			AB065805	CCDS31560.1	11q12.1	2012-08-09			ENSG00000172324	ENSG00000172324		"""GPCR / Class A : Olfactory receptors"""	15249	protein-coding gene	gene with protein product							Standard	NM_001001954		Approved		uc010rkt.2	Q8NGI9	OTTHUMG00000167419	ENST00000302040.4:c.860A>T	11.37:g.59189567T>A	ENSP00000303834:p.Asn287Ile		B9EH21|Q6IFF4|Q96RB0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.N287I	ENST00000302040.4	37	c.860	CCDS31560.1	11	.	.	.	.	.	.	.	.	.	.	T	22.2	4.263340	0.80358	.	.	ENSG00000172324	ENST00000302040	T	0.59638	0.25	5.57	5.57	0.84162	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37136	U	0.002234	T	0.70640	0.3247	L	0.51422	1.61	0.40260	D	0.978162	D	0.89917	1.0	D	0.91635	0.999	T	0.74275	-0.3718	10	0.87932	D	0	.	13.9746	0.64265	0.0:0.0:0.0:1.0	.	287	Q8NGI9	OR5A2_HUMAN	I	287	ENSP00000303834:N287I	ENSP00000303834:N287I	N	-	2	0	OR5A2	58946143	1.000000	0.71417	0.640000	0.29408	0.695000	0.40330	6.142000	0.71750	2.253000	0.74438	0.533000	0.62120	AAT	OR5A2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn		0.468	OR5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5A2	HGNC	protein_coding	OTTHUMT00000394552.1	T	NM_001001954		59189567	-1	no_errors	ENST00000302040	ensembl	human	known	70_37	missense	SNP	0.998	A
PADI4	23569	genome.wustl.edu	37	1	17672565	17672565	+	Silent	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:17672565G>C	ENST00000375448.4	+	9	1004	c.978G>C	c.(976-978)ctG>ctC	p.L326L	AC004824.2_ENST00000602074.1_Intron	NM_012387.2	NP_036519.2	Q9UM07	PADI4_HUMAN	peptidyl arginine deiminase, type IV	326					cellular protein modification process (GO:0006464)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|histone citrullination (GO:0036414)|histone H3-R26 citrullination (GO:0036413)|innate immune response (GO:0045087)|nucleosome assembly (GO:0006334)|protein citrullination (GO:0018101)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	arginine deiminase activity (GO:0016990)|calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(2)|urinary_tract(3)	26		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000338)|Lung NSC(340;0.00042)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00537)|BRCA - Breast invasive adenocarcinoma(304;8.54e-06)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(64;0.000223)|KIRC - Kidney renal clear cell carcinoma(64;0.00313)|STAD - Stomach adenocarcinoma(196;0.00707)|READ - Rectum adenocarcinoma(331;0.0689)|Lung(427;0.199)	L-Citrulline(DB00155)	TGACTACTCTGGCCATGAAAG	0.512																																																	0													91.0	79.0	83.0					1																	17672565		2203	4300	6503	SO:0001819	synonymous_variant	23569			AB017919	CCDS180.1	1p36.13	2014-06-06	2003-02-12		ENSG00000159339	ENSG00000159339	3.5.3.15	"""Peptidyl arginine deiminases"""	18368	protein-coding gene	gene with protein product		605347	"""peptidyl arginine deiminase, type V"""	PADI5		10488123	Standard	NM_012387		Approved	PAD, PDI5, PDI4	uc001baj.2	Q9UM07	OTTHUMG00000002371	ENST00000375448.4:c.978G>C	1.37:g.17672565G>C			A8K392|B2RBW0|Q5VTZ8|Q70SX4	Silent	SNP	pfam_PAD_C,pfam_Prot_Arg_deaminase_cen_dom,pfam_PAD_N,superfamily_Prot_Arg_deaminase_cen_dom,superfamily_Cupredoxin,pirsf_Protein-arginine_deiminase_sub	p.L326	ENST00000375448.4	37	c.978	CCDS180.1	1																																																																																			PADI4	-	pfam_PAD_C,pirsf_Protein-arginine_deiminase_sub		0.512	PADI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PADI4	HGNC	protein_coding	OTTHUMT00000006799.1	G	NM_012387		17672565	+1	no_errors	ENST00000375448	ensembl	human	known	70_37	silent	SNP	1.000	C
PAPPA	5069	genome.wustl.edu	37	9	119094720	119094720	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr9:119094720G>A	ENST00000328252.3	+	12	3739	c.3370G>A	c.(3370-3372)Gat>Aat	p.D1124N	PAPPA_ENST00000534838.1_Missense_Mutation_p.D162N	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	1124					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						GCAGCTGCTTGATACCAAAGA	0.507																																																	0													158.0	130.0	139.0					9																	119094720		2203	4300	6503	SO:0001583	missense	5069				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.3370G>A	9.37:g.119094720G>A	ENSP00000330658:p.Asp1124Asn		B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_Notch_dom,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Complement_control_module,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.D1124N	ENST00000328252.3	37	c.3370	CCDS6813.1	9	.	.	.	.	.	.	.	.	.	.	G	36	5.792255	0.96945	.	.	ENSG00000182752	ENST00000328252;ENST00000534838	T;T	0.08008	4.13;3.14	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.36276	0.0961	M	0.84326	2.69	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.04294	-1.0962	10	0.87932	D	0	-20.8523	20.6439	0.99570	0.0:0.0:1.0:0.0	.	162;1124	F5GZ19;Q13219	.;PAPP1_HUMAN	N	1124;162	ENSP00000330658:D1124N;ENSP00000441461:D162N	ENSP00000330658:D1124N	D	+	1	0	PAPPA	118134541	1.000000	0.71417	0.981000	0.43875	0.963000	0.63663	9.358000	0.97109	2.884000	0.98904	0.655000	0.94253	GAT	PAPPA	-	NULL		0.507	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA	HGNC	protein_coding	OTTHUMT00000055546.1	G	NM_002581		119094720	+1	no_errors	ENST00000328252	ensembl	human	known	70_37	missense	SNP	1.000	A
PARPBP	55010	genome.wustl.edu	37	12	102517807	102517807	+	Silent	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr12:102517807G>A	ENST00000358383.5	+	2	186	c.141G>A	c.(139-141)gaG>gaA	p.E47E	PARPBP_ENST00000392911.2_5'UTR|PARPBP_ENST00000543784.1_Silent_p.E47E|PARPBP_ENST00000378128.3_Silent_p.E47E|PARPBP_ENST00000327680.2_5'UTR|PARPBP_ENST00000537257.1_Silent_p.E47E|PARPBP_ENST00000535811.1_3'UTR|PARPBP_ENST00000541394.1_Silent_p.E47E			Q9NWS1	PARI_HUMAN	PARP1 binding protein	47					DNA repair (GO:0006281)|negative regulation of double-strand break repair via homologous recombination (GO:2000042)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|lung(8)|urinary_tract(2)	11						CTATGGCGGAGAACAACAAAC	0.363																																																	0																																										SO:0001819	synonymous_variant	55010			AK000648	CCDS9090.1, CCDS9090.2	12q23.2	2013-03-14	2012-01-24	2012-01-24		ENSG00000185480			26074	protein-coding gene	gene with protein product	"""PARP-1 binding protein"""	613687	"""chromosome 12 open reading frame 48"""	C12orf48		20931645	Standard	NM_017915		Approved	FLJ20641, PARI	uc001tjf.3	Q9NWS1		ENST00000358383.5:c.141G>A	12.37:g.102517807G>A			B4E0Y0|Q05C00|Q499L8|Q4FZA0|Q4KMW7|Q6NSC6|Q6PJA1|Q86W36	Silent	SNP	NULL	p.E47	ENST00000358383.5	37	c.141	CCDS9090.2	12																																																																																			PARPBP	-	NULL		0.363	PARPBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARPBP	HGNC	protein_coding	OTTHUMT00000397030.2	G	NM_017915		102517807	+1	no_errors	ENST00000358383	ensembl	human	known	70_37	silent	SNP	1.000	A
PCDH10	57575	genome.wustl.edu	37	4	134071436	134071436	+	Missense_Mutation	SNP	A	A	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr4:134071436A>C	ENST00000264360.5	+	1	967	c.141A>C	c.(139-141)aaA>aaC	p.K47N	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	47	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		ACATTACAAAACTTTCGGCTC	0.517																																																	0													111.0	110.0	110.0					4																	134071436		2203	4300	6503	SO:0001583	missense	57575			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.141A>C	4.37:g.134071436A>C	ENSP00000264360:p.Lys47Asn		Q4W5F6|Q96SF0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.K47N	ENST00000264360.5	37	c.141	CCDS34063.1	4	.	.	.	.	.	.	.	.	.	.	A	16.43	3.122431	0.56613	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.28255	1.62	4.77	4.77	0.60923	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	0.000000	0.48286	D	0.000187	T	0.48978	0.1530	L	0.49256	1.55	0.80722	D	1	D;B	0.89917	1.0;0.417	D;B	0.87578	0.998;0.345	T	0.46830	-0.9163	10	0.51188	T	0.08	.	14.1058	0.65088	1.0:0.0:0.0:0.0	.	47;47	Q9P2E7;Q96SF0	PCD10_HUMAN;.	N	47	ENSP00000264360:K47N	ENSP00000264360:K47N	K	+	3	2	PCDH10	134290886	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.666000	0.54540	1.992000	0.58205	0.454000	0.30748	AAA	PCDH10	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin		0.517	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PCDH10	HGNC	protein_coding	OTTHUMT00000364457.2	A	NM_032961		134071436	+1	no_errors	ENST00000264360	ensembl	human	known	70_37	missense	SNP	1.000	C
PCDH17	27253	genome.wustl.edu	37	13	58299233	58299233	+	Missense_Mutation	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr13:58299233G>C	ENST00000377918.3	+	4	3311	c.3285G>C	c.(3283-3285)caG>caC	p.Q1095H		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	1095					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		CTTCCGATCAGATGGCAAGGG	0.542																																					Melanoma(72;952 1291 1619 12849 33676)												0													143.0	140.0	141.0					13																	58299233		2203	4300	6503	SO:0001583	missense	27253			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.3285G>C	13.37:g.58299233G>C	ENSP00000367151:p.Gln1095His		A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q1095H	ENST00000377918.3	37	c.3285	CCDS31986.1	13	.	.	.	.	.	.	.	.	.	.	G	7.412	0.634885	0.14322	.	.	ENSG00000118946	ENST00000377918	T	0.53857	0.6	5.96	5.96	0.96718	.	0.059165	0.64402	D	0.000001	T	0.35970	0.0950	N	0.08118	0	0.30818	N	0.738096	P	0.42785	0.79	B	0.38500	0.275	T	0.21793	-1.0235	9	.	.	.	.	20.4008	0.98991	0.0:0.0:1.0:0.0	.	1095	O14917	PCD17_HUMAN	H	1095	ENSP00000367151:Q1095H	.	Q	+	3	2	PCDH17	57197234	1.000000	0.71417	0.999000	0.59377	0.802000	0.45316	3.287000	0.51732	2.826000	0.97356	0.655000	0.94253	CAG	PCDH17	-	NULL		0.542	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH17	HGNC	protein_coding	OTTHUMT00000045139.1	G	NM_001040429		58299233	+1	no_errors	ENST00000377918	ensembl	human	known	70_37	missense	SNP	1.000	C
PEAK1	79834	genome.wustl.edu	37	15	77474169	77474169	+	Missense_Mutation	SNP	C	C	G			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr15:77474169C>G	ENST00000560626.2	-	4	575	c.100G>C	c.(100-102)Gag>Cag	p.E34Q	PEAK1_ENST00000312493.4_Missense_Mutation_p.E34Q|PEAK1_ENST00000558305.1_Missense_Mutation_p.E34Q			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	34					cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										GGTGCCTTCTCAGGGTCTGGG	0.468																																																	0													150.0	144.0	146.0					15																	77474169		1892	4100	5992	SO:0001583	missense	79834				CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.100G>C	15.37:g.77474169C>G	ENSP00000452796:p.Glu34Gln		Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.E34Q	ENST00000560626.2	37	c.100	CCDS42062.1	15	.	.	.	.	.	.	.	.	.	.	C	14.97	2.694688	0.48202	.	.	ENSG00000173517	ENST00000312493	T	0.69435	-0.4	6.07	6.07	0.98685	.	0.207024	0.18670	U	0.134468	T	0.54287	0.1849	N	0.22421	0.69	0.36492	D	0.868486	P	0.36183	0.542	B	0.36845	0.234	T	0.60332	-0.7284	10	0.35671	T	0.21	-9.4514	13.793	0.63152	0.0:0.9304:0.0:0.0696	.	34	Q9H792	PEAK1_HUMAN	Q	34	ENSP00000309230:E34Q	ENSP00000309230:E34Q	E	-	1	0	AC087465.1	75261224	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.697000	0.68295	2.890000	0.99128	0.650000	0.86243	GAG	PEAK1	-	NULL		0.468	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PEAK1	Uniprot_genename	protein_coding	OTTHUMT00000419483.3	C			77474169	-1	no_errors	ENST00000312493	ensembl	human	known	70_37	missense	SNP	1.000	G
PER2	8864	genome.wustl.edu	37	2	239180028	239180028	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr2:239180028G>A	ENST00000254657.3	-	6	976	c.697C>T	c.(697-699)Cct>Tct	p.P233S	PER2_ENST00000355768.2_Missense_Mutation_p.P233S|PER2_ENST00000440245.1_Missense_Mutation_p.P233S|PER2_ENST00000254658.3_Missense_Mutation_p.P233S	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	233	PAS 1. {ECO:0000255|PROSITE- ProRule:PRU00140}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		ACATCGTGAGGCGCCAGGAAC	0.527																																																	0													135.0	117.0	123.0					2																	239180028		2203	4300	6503	SO:0001583	missense	8864			AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.697C>T	2.37:g.239180028G>A	ENSP00000254657:p.Pro233Ser		A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Missense_Mutation	SNP	pfam_Period_circadian-like_C,pfam_PAS_fold_3,pfam_PAS_fold,smart_PAS,pfscan_PAS	p.P233S	ENST00000254657.3	37	c.697	CCDS2528.1	2	.	.	.	.	.	.	.	.	.	.	G	25.5	4.641164	0.87859	.	.	ENSG00000132326	ENST00000254657;ENST00000254658;ENST00000440245;ENST00000355768	T;T;T;T	0.55588	2.1;0.51;1.29;0.51	5.06	5.06	0.68205	PAS (1);	0.000000	0.85682	D	0.000000	T	0.75627	0.3875	M	0.85197	2.74	0.80722	D	1	D;B;D;D	0.89917	0.99;0.449;0.995;1.0	D;B;D;D	0.97110	0.916;0.283;0.972;1.0	T	0.80120	-0.1515	10	0.87932	D	0	-26.4136	16.328	0.82994	0.0:0.0:1.0:0.0	.	233;233;233;233	F5GYD5;B4DH14;O15055-2;O15055	.;.;.;PER2_HUMAN	S	233	ENSP00000254657:P233S;ENSP00000254658:P233S;ENSP00000397516:P233S;ENSP00000348013:P233S	ENSP00000254657:P233S	P	-	1	0	PER2	238844767	1.000000	0.71417	0.951000	0.38953	0.875000	0.50365	9.503000	0.97984	2.525000	0.85131	0.655000	0.94253	CCT	PER2	-	smart_PAS		0.527	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PER2	HGNC	protein_coding	OTTHUMT00000257167.1	G	NM_022817		239180028	-1	no_errors	ENST00000254657	ensembl	human	known	70_37	missense	SNP	1.000	A
PEX14	5195	genome.wustl.edu	37	1	10678417	10678417	+	Silent	SNP	C	C	T	rs367754543		TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:10678417C>T	ENST00000356607.4	+	5	407	c.327C>T	c.(325-327)taC>taT	p.Y109Y	RN7SL614P_ENST00000461850.2_RNA|PEX14_ENST00000538836.1_Silent_p.Y45Y	NM_004565.2	NP_004556.1	O75381	PEX14_HUMAN	peroxisomal biogenesis factor 14	109					microtubule anchoring (GO:0034453)|negative regulation of protein binding (GO:0032091)|negative regulation of protein homotetramerization (GO:1901094)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peroxisome organization (GO:0007031)|peroxisome transport along microtubule (GO:0036250)|protein complex assembly (GO:0006461)|protein homooligomerization (GO:0051260)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, substrate release (GO:0044721)|protein import into peroxisome matrix, translocation (GO:0016561)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|protein N-terminus binding (GO:0047485)|receptor binding (GO:0005102)|transcription corepressor activity (GO:0003714)			breast(3)|endometrium(1)|large_intestine(3)|lung(5)|prostate(1)	13	Ovarian(185;0.203)	all_lung(284;6.02e-06)|Lung NSC(185;9.62e-06)|Renal(390;0.000147)|Breast(348;0.000932)|Colorectal(325;0.00215)|Hepatocellular(190;0.00913)|Ovarian(437;0.023)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0292)|Colorectal(212;9.13e-08)|COAD - Colon adenocarcinoma(227;2.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000482)|Kidney(185;0.00174)|KIRC - Kidney renal clear cell carcinoma(229;0.00457)|STAD - Stomach adenocarcinoma(132;0.0249)|READ - Rectum adenocarcinoma(331;0.0419)		GGCGAGATTACGGCGCCCTGG	0.632																																																	0								C		0,4406		0,0,2203	83.0	72.0	76.0		327	-4.2	0.3	1		76	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	PEX14	NM_004565.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		109/378	10678417	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5195			AF045186	CCDS30582.1	1p36.22	2008-05-14			ENSG00000142655	ENSG00000142655			8856	protein-coding gene	gene with protein product		601791				9653144	Standard	NM_004565		Approved		uc001arn.3	O75381	OTTHUMG00000001908	ENST00000356607.4:c.327C>T	1.37:g.10678417C>T			B2R7N1|B3KML6|B7Z1N2|Q8WX51	Silent	SNP	pfam_Pex14_N	p.Y109	ENST00000356607.4	37	c.327	CCDS30582.1	1																																																																																			PEX14	-	pfam_Pex14_N		0.632	PEX14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX14	HGNC	protein_coding	OTTHUMT00000005414.1	C			10678417	+1	no_errors	ENST00000356607	ensembl	human	known	70_37	silent	SNP	0.961	T
JADE3	9767	genome.wustl.edu	37	X	46918303	46918303	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chrX:46918303G>A	ENST00000218343.4	+	11	2594	c.2296G>A	c.(2296-2298)Ggc>Agc	p.G766S	PHF16_ENST00000397189.1_Missense_Mutation_p.G766S	NM_014735.3	NP_055550.1														NS(2)|endometrium(8)|kidney(4)|large_intestine(5)|lung(12)|upper_aerodigestive_tract(2)	33						GGAAAATGATGGCTATTGCCC	0.478																																																	0													48.0	42.0	44.0					X																	46918303		2203	4300	6503	SO:0001583	missense	9767																														ENST00000218343.4:c.2296G>A	X.37:g.46918303G>A	ENSP00000218343:p.Gly766Ser			Missense_Mutation	SNP	pfam_Enhancer_polycomb-like_N,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.G766S	ENST00000218343.4	37	c.2296	CCDS14271.1	X	.	.	.	.	.	.	.	.	.	.	G	23.9	4.467451	0.84533	.	.	ENSG00000102221	ENST00000397189;ENST00000218343	T;T	0.66995	-0.24;-0.24	5.49	5.49	0.81192	.	0.000000	0.64402	D	0.000004	T	0.75737	0.3890	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.78703	-0.2101	10	0.87932	D	0	.	18.4761	0.90793	0.0:0.0:1.0:0.0	.	766	Q92613	JADE3_HUMAN	S	766	ENSP00000380373:G766S;ENSP00000218343:G766S	ENSP00000218343:G766S	G	+	1	0	PHF16	46803247	1.000000	0.71417	0.985000	0.45067	0.976000	0.68499	9.121000	0.94375	2.304000	0.77564	0.594000	0.82650	GGC	PHF16	-	NULL		0.478	PHF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF16	HGNC	protein_coding	OTTHUMT00000056376.1	G			46918303	+1	no_errors	ENST00000218343	ensembl	human	known	70_37	missense	SNP	1.000	A
PHF8	23133	genome.wustl.edu	37	X	54040926	54040926	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chrX:54040926C>T	ENST00000357988.5	-	7	1133	c.775G>A	c.(775-777)Gaa>Aaa	p.E259K	PHF8_ENST00000338154.6_Missense_Mutation_p.E223K|PHF8_ENST00000338946.6_Missense_Mutation_p.E223K|PHF8_ENST00000322659.8_Missense_Mutation_p.E223K	NM_001184896.1	NP_001171825.1	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	259	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				brain development (GO:0007420)|G1/S transition of mitotic cell cycle (GO:0000082)|histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of chromatin silencing at rDNA (GO:0061188)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	40						AAGACACATTCCTCTGGCCAC	0.478																																																	0													154.0	99.0	117.0					X																	54040926		2203	4300	6503	SO:0001583	missense	23133			AB029034	CCDS14355.1, CCDS55418.1, CCDS55419.1, CCDS55420.1	Xp11.22	2013-01-28			ENSG00000172943	ENSG00000172943		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	20672	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1F"""	300560				10470851, 20023638, 20644565	Standard	NM_015107		Approved	ZNF422, KIAA1111, JHDM1F	uc004dsu.3	Q9UPP1	OTTHUMG00000021622	ENST00000357988.5:c.775G>A	X.37:g.54040926C>T	ENSP00000350676:p.Glu259Lys		B3KMV4|B7Z911|Q5H9U5|Q5JPR9|Q5JPS0|Q5JPS2|Q5JPS3|Q5VUJ4|Q7Z6D4|Q9HAH2	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_JmjC_dom,pfscan_JmjC_dom,pfscan_Znf_PHD-finger	p.E259K	ENST00000357988.5	37	c.775	CCDS55420.1	X	.	.	.	.	.	.	.	.	.	.	C	19.55	3.849178	0.71603	.	.	ENSG00000172943	ENST00000357988;ENST00000338154;ENST00000338946;ENST00000396277;ENST00000322659	T;T;T;T	0.70869	-0.52;-0.52;-0.52;-0.52	5.24	5.24	0.73138	Transcription factor jumonji/aspartyl beta-hydroxylase (2);	0.159958	0.53938	D	0.000045	T	0.55065	0.1897	L	0.31845	0.965	0.50813	D	0.999895	P;P;P	0.47910	0.842;0.902;0.786	B;B;B	0.34180	0.086;0.177;0.104	T	0.61322	-0.7086	10	0.48119	T	0.1	-4.8374	12.4762	0.55814	0.0:0.8352:0.1648:0.0	.	223;259;259	B7Z911;Q9UPP1-3;Q9UPP1	.;.;PHF8_HUMAN	K	259;223;223;253;223	ENSP00000350676:E259K;ENSP00000338868:E223K;ENSP00000340051:E223K;ENSP00000319473:E223K	ENSP00000319473:E223K	E	-	1	0	PHF8	54057651	1.000000	0.71417	0.995000	0.50966	0.988000	0.76386	5.977000	0.70492	2.182000	0.69389	0.494000	0.49563	GAA	PHF8	-	smart_JmjC_dom,pfscan_JmjC_dom		0.478	PHF8-001	KNOWN	basic|CCDS	protein_coding	PHF8	HGNC	protein_coding	OTTHUMT00000056784.2	C	NM_015107		54040926	-1	no_errors	ENST00000357988	ensembl	human	known	70_37	missense	SNP	1.000	T
PHIP	55023	genome.wustl.edu	37	6	79655921	79655921	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr6:79655921G>A	ENST00000275034.4	-	38	4594	c.4427C>T	c.(4426-4428)tCt>tTt	p.S1476F	PHIP_ENST00000479165.1_5'UTR	NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	1476					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		AGAGAATGCAGAGGTAGAGCT	0.398																																																	0													213.0	201.0	205.0					6																	79655921		2203	4300	6503	SO:0001583	missense	55023			AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.4427C>T	6.37:g.79655921G>A	ENSP00000275034:p.Ser1476Phe		A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_Quinonprotein_ADH-like,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.S1476F	ENST00000275034.4	37	c.4427	CCDS4987.1	6	.	.	.	.	.	.	.	.	.	.	G	14.24	2.475034	0.43942	.	.	ENSG00000146247	ENST00000275034;ENST00000355098	T	0.44083	0.93	5.87	5.87	0.94306	.	0.074701	0.56097	D	0.000021	T	0.37732	0.1014	L	0.27053	0.805	0.54753	D	0.999986	D;D	0.61080	0.989;0.989	P;P	0.56916	0.809;0.809	T	0.03684	-1.1013	9	.	.	.	-18.219	19.2028	0.93717	0.0:0.0:1.0:0.0	.	1476;1476	A7J992;Q8WWQ0	.;PHIP_HUMAN	F	1476;202	ENSP00000275034:S1476F	.	S	-	2	0	PHIP	79712640	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	6.757000	0.74924	2.785000	0.95823	0.591000	0.81541	TCT	PHIP	-	NULL		0.398	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHIP	HGNC	protein_coding	OTTHUMT00000041297.2	G			79655921	-1	no_errors	ENST00000275034	ensembl	human	known	70_37	missense	SNP	1.000	A
PLEKHG4	25894	genome.wustl.edu	37	16	67313990	67313990	+	Missense_Mutation	SNP	C	C	G			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr16:67313990C>G	ENST00000360461.5	+	1	2578	c.43C>G	c.(43-45)Cag>Gag	p.Q15E	PLEKHG4_ENST00000450733.1_Missense_Mutation_p.Q15E|PLEKHG4_ENST00000427155.2_Missense_Mutation_p.Q15E|PLEKHG4_ENST00000379344.3_Missense_Mutation_p.Q15E	NM_001129727.1|NM_015432.3	NP_001123199.1|NP_056247.1	Q58EX7	PKHG4_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4	15							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)		CCCAGACTCTCAGGGCCATGC	0.617																																																	0													57.0	61.0	59.0					16																	67313990		2198	4300	6498	SO:0001583	missense	25894			AK024475	CCDS32466.1, CCDS45512.1	16q22.1	2013-01-11						"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24501	protein-coding gene	gene with protein product	"""puratrophin-1"""	609526	"""spinocerebellar ataxia 4"""	SCA4		16491300, 16001362	Standard	NM_015432		Approved	DKFZP434I216, ARHGEF44	uc010cef.3	Q58EX7		ENST00000360461.5:c.43C>G	16.37:g.67313990C>G	ENSP00000353646:p.Gln15Glu		Q4G0J8|Q4H485|Q56A69|Q9H7K4|Q9UFW0	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_CRAL-TRIO_dom,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.Q15E	ENST00000360461.5	37	c.43	CCDS32466.1	16	.	.	.	.	.	.	.	.	.	.	C	18.77	3.693797	0.68386	.	.	ENSG00000196155	ENST00000360461;ENST00000427155;ENST00000379344;ENST00000450733;ENST00000393966	T;T;T;T	0.14766	2.72;2.72;2.72;2.48	4.22	3.21	0.36854	.	.	.	.	.	T	0.15176	0.0366	M	0.62723	1.935	0.09310	N	1	B;B	0.28636	0.218;0.139	B;B	0.24701	0.04;0.055	T	0.07868	-1.0750	9	0.49607	T	0.09	.	9.2813	0.37731	0.2133:0.7867:0.0:0.0	.	15;15	Q58EX7-2;Q58EX7	.;PKHG4_HUMAN	E	15	ENSP00000353646:Q15E;ENSP00000401118:Q15E;ENSP00000368649:Q15E;ENSP00000398030:Q15E	ENSP00000353646:Q15E	Q	+	1	0	PLEKHG4	65871491	0.041000	0.20044	0.212000	0.23672	0.989000	0.77384	3.121000	0.50438	2.183000	0.69458	0.655000	0.94253	CAG	PLEKHG4	-	NULL		0.617	PLEKHG4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHG4	HGNC	protein_coding	OTTHUMT00000421395.2	C	NM_015432		67313990	+1	no_errors	ENST00000360461	ensembl	human	known	70_37	missense	SNP	0.041	G
POU4F2	5458	genome.wustl.edu	37	4	147560396	147560396	+	Missense_Mutation	SNP	G	G	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr4:147560396G>T	ENST00000281321.3	+	1	352	c.104G>T	c.(103-105)gGc>gTc	p.G35V	AC093887.1_ENST00000584185.1_RNA	NM_004575.2	NP_004566.2	Q12837	PO4F2_HUMAN	POU class 4 homeobox 2	35					axon extension (GO:0048675)|axon guidance (GO:0007411)|intracellular estrogen receptor signaling pathway (GO:0030520)|MAPK cascade (GO:0000165)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)					ACCTCGCCGGGCTCCTCGGCT	0.726																																																	0													10.0	11.0	10.0					4																	147560396		2148	4213	6361	SO:0001583	missense	5458			U06233	CCDS34074.1	4q31.22	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9219	protein-coding gene	gene with protein product		113725	"""POU domain, class 4, transcription factor 2"", ""POU domain class 4, transcription factor 2"""	BRN3B		8332509	Standard	NM_004575		Approved	Brn-3b	uc003ikv.3	Q12837		ENST00000281321.3:c.104G>T	4.37:g.147560396G>T	ENSP00000281321:p.Gly35Val		B1PJR6|B2RC84|Q13883|Q14987	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,pfscan_Homeodomain,pfscan_POU_specific,prints_POU	p.G35V	ENST00000281321.3	37	c.104	CCDS34074.1	4	.	.	.	.	.	.	.	.	.	.	G	14.23	2.472744	0.43942	.	.	ENSG00000151615	ENST00000281321	D	0.82893	-1.66	4.49	4.49	0.54785	.	0.715314	0.13098	N	0.414012	T	0.66858	0.2832	N	0.08118	0	0.50039	D	0.999847	B	0.12630	0.006	B	0.14023	0.01	T	0.62905	-0.6755	10	0.44086	T	0.13	.	8.5258	0.33304	0.1064:0.0:0.8936:0.0	.	35	Q12837	PO4F2_HUMAN	V	35	ENSP00000281321:G35V	ENSP00000281321:G35V	G	+	2	0	POU4F2	147779846	1.000000	0.71417	0.992000	0.48379	0.795000	0.44927	2.245000	0.43133	2.045000	0.60652	0.561000	0.74099	GGC	POU4F2	-	NULL		0.726	POU4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU4F2	HGNC	protein_coding	OTTHUMT00000367020.1	G	NM_004575		147560396	+1	no_errors	ENST00000281321	ensembl	human	known	70_37	missense	SNP	0.994	T
PPIP5K2	23262	genome.wustl.edu	37	5	102491616	102491616	+	Silent	SNP	T	T	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr5:102491616T>C	ENST00000358359.3	+	14	1916	c.1407T>C	c.(1405-1407)taT>taC	p.Y469Y	PPIP5K2_ENST00000321521.9_Silent_p.Y469Y|PPIP5K2_ENST00000513500.1_3'UTR|PPIP5K2_ENST00000414217.1_Silent_p.Y469Y	NM_001276277.1	NP_001263206.1	O43314	VIP2_HUMAN	diphosphoinositol pentakisphosphate kinase 2	469					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TTTTCAGGTATGGTCATTTTT	0.343																																																	0													191.0	188.0	189.0					5																	102491616		2203	4300	6503	SO:0001819	synonymous_variant	23262			AB007893	CCDS34207.1, CCDS64212.1, CCDS75283.1	5q21.1	2014-05-06	2010-01-26	2010-01-26	ENSG00000145725	ENSG00000145725	2.7.4.24		29035	protein-coding gene	gene with protein product		611648	"""histidine acid phosphatase domain containing 1"""	HISPPD1		9455477, 17690096, 18981179	Standard	NM_001276277		Approved	KIAA0433, VIP2	uc003koe.4	O43314	OTTHUMG00000181461	ENST00000358359.3:c.1407T>C	5.37:g.102491616T>C			A1NI53|A6NGS8|Q8TB50	Silent	SNP	pfam_His_Pase_superF_clade-2	p.Y469	ENST00000358359.3	37	c.1407		5																																																																																			PPIP5K2	-	pfam_His_Pase_superF_clade-2		0.343	PPIP5K2-003	KNOWN	basic	protein_coding	PPIP5K2	HGNC	protein_coding	OTTHUMT00000370487.1	T	NM_015216		102491616	+1	no_errors	ENST00000358359	ensembl	human	known	70_37	silent	SNP	1.000	C
PRDM15	63977	genome.wustl.edu	37	21	43256674	43256674	+	Missense_Mutation	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr21:43256674G>C	ENST00000269844.3	-	16	2294	c.2184C>G	c.(2182-2184)atC>atG	p.I728M	PRDM15_ENST00000422911.1_Missense_Mutation_p.I399M|PRDM15_ENST00000447207.2_Missense_Mutation_p.I362M|PRDM15_ENST00000398548.1_Missense_Mutation_p.I399M|PRDM15_ENST00000538201.1_Missense_Mutation_p.I362M	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	728					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						CGAGCTGTTTGATGAGCTTGC	0.547																																																	0													193.0	177.0	182.0					21																	43256674		2203	4300	6503	SO:0001583	missense	63977			AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.2184C>G	21.37:g.43256674G>C	ENSP00000269844:p.Ile728Met		E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.I728M	ENST00000269844.3	37	c.2184	CCDS13676.1	21	.	.	.	.	.	.	.	.	.	.	G	11.30	1.598021	0.28445	.	.	ENSG00000141956	ENST00000422911;ENST00000398548;ENST00000538201;ENST00000447207;ENST00000269844;ENST00000380489	T;T;T;T;T	0.08546	3.14;3.13;3.14;3.12;3.08	4.88	0.735	0.18300	.	.	.	.	.	T	0.04770	0.0129	N	0.24115	0.695	0.09310	N	1	P;B;B	0.45283	0.855;0.055;0.306	B;B;B	0.35859	0.212;0.04;0.084	T	0.36986	-0.9725	9	0.51188	T	0.08	-6.7367	6.305	0.21133	0.0774:0.4611:0.3355:0.126	.	728;399;399	P57071;E9PDJ6;E9PF37	PRD15_HUMAN;.;.	M	399;399;362;362;728;362	ENSP00000408592:I399M;ENSP00000381556:I399M;ENSP00000444044:I362M;ENSP00000390245:I362M;ENSP00000269844:I728M	ENSP00000269844:I728M	I	-	3	3	PRDM15	42129743	0.000000	0.05858	0.000000	0.03702	0.991000	0.79684	-0.808000	0.04515	-0.165000	0.10908	0.655000	0.94253	ATC	PRDM15	-	NULL		0.547	PRDM15-201	KNOWN	basic|CCDS	protein_coding	PRDM15	HGNC	protein_coding		G	NM_022115		43256674	-1	no_errors	ENST00000269844	ensembl	human	known	70_37	missense	SNP	0.000	C
PRDM9	56979	genome.wustl.edu	37	5	23521142	23521142	+	Missense_Mutation	SNP	A	A	G			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr5:23521142A>G	ENST00000296682.3	+	6	544	c.362A>G	c.(361-363)aAg>aGg	p.K121R		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	121					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						GGAATGCCCAAGGCGTCATTC	0.393										HNSCC(3;0.000094)																																							0													77.0	73.0	74.0					5																	23521142		1874	4106	5980	SO:0001583	missense	56979			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.362A>G	5.37:g.23521142A>G	ENSP00000296682:p.Lys121Arg		B4DX22|Q27Q50	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_SSXRD_motif,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.K121R	ENST00000296682.3	37	c.362	CCDS43307.1	5	.	.	.	.	.	.	.	.	.	.	A	0.015	-1.555063	0.00918	.	.	ENSG00000164256	ENST00000296682	T	0.09630	2.96	3.12	-2.18	0.07037	.	.	.	.	.	T	0.03783	0.0107	N	0.11698	0.16	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.43621	-0.9380	9	0.02654	T	1	-0.8349	4.0841	0.09939	0.4082:0.1805:0.4113:0.0	.	121	Q9NQV7	PRDM9_HUMAN	R	121	ENSP00000296682:K121R	ENSP00000296682:K121R	K	+	2	0	PRDM9	23556899	0.000000	0.05858	0.000000	0.03702	0.120000	0.20174	-0.705000	0.05052	-0.510000	0.06523	-0.446000	0.05623	AAG	PRDM9	-	NULL		0.393	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM9	HGNC	protein_coding	OTTHUMT00000366375.1	A	NM_020227		23521142	+1	no_errors	ENST00000296682	ensembl	human	known	70_37	missense	SNP	0.000	G
PRG4	10216	genome.wustl.edu	37	1	186273271	186273271	+	Missense_Mutation	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:186273271G>C	ENST00000445192.2	+	5	396	c.351G>C	c.(349-351)aaG>aaC	p.K117N	PRG4_ENST00000367483.4_Missense_Mutation_p.K76N|PRG4_ENST00000367485.4_Intron|PRG4_ENST00000367484.3_Missense_Mutation_p.K76N|PRG4_ENST00000367486.3_Missense_Mutation_p.K117N	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	117					cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						CATCTTCAAAGAAAGCACCTC	0.408																																																	0													190.0	161.0	171.0					1																	186273271		2203	4300	6503	SO:0001583	missense	10216			U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.351G>C	1.37:g.186273271G>C	ENSP00000399679:p.Lys117Asn		Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Missense_Mutation	SNP	pfam_Somatomedin_B_dom,pfam_Hemopexin/matrixin_repeat,superfamily_Hemopexin/matrixin,smart_Somatomedin_B_dom,smart_Hemopexin/matrixin_repeat,pfscan_Somatomedin_B_dom,prints_Somatomedin_B_chordata	p.K117N	ENST00000445192.2	37	c.351	CCDS1369.1	1	.	.	.	.	.	.	.	.	.	.	G	9.594	1.126933	0.20959	.	.	ENSG00000116690	ENST00000367486;ENST00000367484;ENST00000367483;ENST00000445192	T;T;T;T	0.05513	3.43;3.54;3.5;3.51	5.38	4.46	0.54185	.	0.138592	0.32563	N	0.005922	T	0.14141	0.0342	M	0.65975	2.015	0.22354	N	0.99917	D;D	0.63880	0.988;0.993	P;P	0.57057	0.654;0.812	T	0.11743	-1.0575	10	0.72032	D	0.01	-9.8056	5.1191	0.14851	0.1687:0.1799:0.6514:0.0	.	117;76	Q92954;Q92954-2	PRG4_HUMAN;.	N	117;76;76;117	ENSP00000356456:K117N;ENSP00000356454:K76N;ENSP00000356453:K76N;ENSP00000399679:K117N	ENSP00000356453:K76N	K	+	3	2	PRG4	184539894	0.987000	0.35691	0.970000	0.41538	0.032000	0.12392	1.508000	0.35769	2.520000	0.84964	0.585000	0.79938	AAG	PRG4	-	NULL		0.408	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRG4	HGNC	protein_coding	OTTHUMT00000086346.1	G	NM_005807		186273271	+1	no_errors	ENST00000445192	ensembl	human	known	70_37	missense	SNP	0.836	C
PRICKLE2	166336	genome.wustl.edu	37	3	64083625	64083625	+	3'UTR	SNP	C	C	G			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr3:64083625C>G	ENST00000295902.6	-	0	4222				PRICKLE2-AS1_ENST00000476308.1_RNA|PRICKLE2_ENST00000564377.1_3'UTR|RP11-129B22.1_ENST00000482609.1_RNA|PRICKLE2-AS1_ENST00000460946.1_RNA	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)						establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		AGAGCCCCCTCAGAATCCTTC	0.493																																																	0																																										SO:0001624	3_prime_UTR_variant	100652759			AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.*1102G>C	3.37:g.64083625C>G			Q0VF44	RNA	SNP	-	NULL	ENST00000295902.6	37	NULL	CCDS2902.1	3																																																																																			RP11-129B22.1	-	-		0.493	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	PRICKLE2-AS1	Clone_based_vega_gene	protein_coding	OTTHUMT00000352219.1	C	NM_198859		64083625	+1	no_errors	ENST00000482609	ensembl	human	known	70_37	rna	SNP	0.000	G
PRKCZ	5590	genome.wustl.edu	37	1	2087451	2087451	+	Silent	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:2087451G>A	ENST00000400921.2	+	7	1028	c.345G>A	c.(343-345)caG>caA	p.Q115Q	PRKCZ_ENST00000400920.1_Silent_p.Q115Q|PRKCZ_ENST00000479263.1_3'UTR	NM_001033581.1	NP_001028753.1	Q05513	KPCZ_HUMAN	protein kinase C, zeta	298	Interaction with SQSTM1. {ECO:0000250}.				actin cytoskeleton reorganization (GO:0031532)|activation of phospholipase D activity (GO:0031584)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|inflammatory response (GO:0006954)|insulin receptor signaling pathway (GO:0008286)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|membrane hyperpolarization (GO:0060081)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hydrolase activity (GO:0051346)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of protein complex assembly (GO:0031333)|neuron projection extension (GO:1990138)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of interleukin-10 secretion (GO:2001181)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T-helper 2 cell cytokine production (GO:2000553)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|protein heterooligomerization (GO:0051291)|protein kinase C signaling (GO:0070528)|protein localization to plasma membrane (GO:0072659)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle transport along microtubule (GO:0047496)	apical cortex (GO:0045179)|apical plasma membrane (GO:0016324)|axon hillock (GO:0043203)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|myelin sheath abaxonal region (GO:0035748)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	ATP binding (GO:0005524)|insulin receptor substrate binding (GO:0043560)|potassium channel regulator activity (GO:0015459)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(4)|endometrium(1)|large_intestine(5)|lung(5)|stomach(1)	18	all_cancers(77;0.000177)|all_epithelial(69;6.41e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.96e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.3e-23)|GBM - Glioblastoma multiforme(42;2.85e-08)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00294)|BRCA - Breast invasive adenocarcinoma(365;0.00493)|STAD - Stomach adenocarcinoma(132;0.00669)|KIRC - Kidney renal clear cell carcinoma(229;0.0411)|Lung(427;0.213)	Tamoxifen(DB00675)	ACTGGGTACAGACAGAGAAGC	0.527																																																	0													176.0	161.0	166.0					1																	2087451		2203	4300	6503	SO:0001819	synonymous_variant	5590			BC014270	CCDS37.1, CCDS41229.1, CCDS55563.1	1p36.33-p36.2	2009-07-10			ENSG00000067606	ENSG00000067606	2.7.11.1		9412	protein-coding gene	gene with protein product		176982					Standard	NM_001242874		Approved	PKC2	uc001aiq.3	Q05513	OTTHUMG00000001238	ENST00000400921.2:c.345G>A	1.37:g.2087451G>A			A8K4N0|A8MU64|B7Z2J7|E9PCW2|Q15207|Q5SYT5|Q969S4	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_OPR_PB1,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_OPR_PB1,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_PKC_zeta,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd	p.Q298	ENST00000400921.2	37	c.894	CCDS41229.1	1																																																																																			PRKCZ	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_PKC_zeta,pfscan_Prot_kinase_cat_dom		0.527	PRKCZ-009	KNOWN	basic|CCDS	protein_coding	PRKCZ	HGNC	protein_coding	OTTHUMT00000098533.3	G	NM_002744		2087451	+1	no_errors	ENST00000378567	ensembl	human	known	70_37	silent	SNP	1.000	A
PRKD1	5587	genome.wustl.edu	37	14	30396556	30396556	+	Missense_Mutation	SNP	T	T	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr14:30396556T>A	ENST00000331968.5	-	1	392	c.163A>T	c.(163-165)Atc>Ttc	p.I55F	PRKD1_ENST00000415220.2_Missense_Mutation_p.I55F	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	55					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		CTCAGGCCGATCTGCAGATGG	0.711																																																	0													11.0	10.0	11.0					14																	30396556		2168	4260	6428	SO:0001583	missense	5587				CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.163A>T	14.37:g.30396556T>A	ENSP00000333568:p.Ile55Phe		A6NL64|B2RAF6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd	p.I55F	ENST00000331968.5	37	c.163	CCDS9637.1	14	.	.	.	.	.	.	.	.	.	.	T	15.01	2.707512	0.48412	.	.	ENSG00000184304	ENST00000331968;ENST00000415220	T;T	0.67345	-0.26;-0.26	3.9	3.9	0.45041	.	0.000000	0.56097	U	0.000026	T	0.55593	0.1930	L	0.42245	1.32	0.58432	D	0.999999	B	0.14438	0.01	B	0.19148	0.024	T	0.49707	-0.8911	10	0.15499	T	0.54	-6.8746	12.4006	0.55410	0.0:0.0:0.0:1.0	.	55	Q15139	KPCD1_HUMAN	F	55	ENSP00000333568:I55F;ENSP00000390535:I55F	ENSP00000333568:I55F	I	-	1	0	PRKD1	29466307	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.987000	0.63857	1.407000	0.46875	0.377000	0.23210	ATC	PRKD1	-	NULL		0.711	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRKD1	HGNC	protein_coding	OTTHUMT00000276611.2	T	NM_002742		30396556	-1	no_errors	ENST00000331968	ensembl	human	known	70_37	missense	SNP	1.000	A
LZTS3	9762	genome.wustl.edu	37	20	3146539	3146539	+	Silent	SNP	G	G	A	rs577156264		TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr20:3146539G>A	ENST00000329152.3	-	2	2324	c.927C>T	c.(925-927)ttC>ttT	p.F309F	LZTS3_ENST00000360342.3_Silent_p.F309F|LZTS3_ENST00000337576.5_Silent_p.F309F			O60299	LZTS3_HUMAN		309						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)											AGCAGGCCGCGAAAGGCAGGC	0.697																																																	0													14.0	15.0	15.0					20																	3146539		2151	4218	6369	SO:0001819	synonymous_variant	9762																														ENST00000329152.3:c.927C>T	20.37:g.3146539G>A			A2A2Q7|D3DVX6|Q8IXX8	Silent	SNP	pfam_Fez1	p.F309	ENST00000329152.3	37	c.927	CCDS13049.1	20																																																																																			PROSAPIP1	-	NULL		0.697	LZTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROSAPIP1	Uniprot_genename	protein_coding	OTTHUMT00000077715.2	G			3146539	-1	no_errors	ENST00000329152	ensembl	human	known	70_37	silent	SNP	0.994	A
PROCR	10544	genome.wustl.edu	37	20	33764083	33764083	+	Silent	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr20:33764083G>A	ENST00000216968.4	+	3	517	c.435G>A	c.(433-435)ccG>ccA	p.P145P	EDEM2_ENST00000540582.1_Intron	NM_006404.3	NP_006395.2	Q9UNN8	EPCR_HUMAN	protein C receptor, endothelial	145					antigen processing and presentation (GO:0019882)|blood coagulation (GO:0007596)|immune response (GO:0006955)|negative regulation of coagulation (GO:0050819)	cell surface (GO:0009986)|centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			breast(1)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	10			BRCA - Breast invasive adenocarcinoma(18;0.0152)		Drotrecogin alfa(DB00055)	GTTTCCGGCCGGAGAGAGCCT	0.602																																																	0													79.0	73.0	75.0					20																	33764083		2203	4300	6503	SO:0001819	synonymous_variant	10544			L35545	CCDS13248.1	20q11.2	2010-05-04	2010-05-04		ENSG00000101000	ENSG00000101000		"""CD molecules"""	9452	protein-coding gene	gene with protein product		600646				7929370, 10518938	Standard	NM_006404		Approved	EPCR, CCD41, CD201	uc002xbt.3	Q9UNN8	OTTHUMG00000032323	ENST00000216968.4:c.435G>A	20.37:g.33764083G>A			B2RC04|Q14218|Q6IB56|Q96CB3|Q9ULX1	Silent	SNP	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	p.P145	ENST00000216968.4	37	c.435	CCDS13248.1	20																																																																																			PROCR	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog		0.602	PROCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROCR	HGNC	protein_coding	OTTHUMT00000078843.3	G			33764083	+1	no_errors	ENST00000216968	ensembl	human	known	70_37	silent	SNP	0.020	A
PROX2	283571	genome.wustl.edu	37	14	75329962	75329962	+	Missense_Mutation	SNP	G	G	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr14:75329962G>T	ENST00000445876.1	-	1	575	c.576C>A	c.(574-576)caC>caA	p.H192Q	PROX2_ENST00000556489.2_Missense_Mutation_p.H192Q|PROX2_ENST00000556084.2_Missense_Mutation_p.H192Q			Q3B8N5	PROX2_HUMAN	prospero homeobox 2	192					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			kidney(1)|large_intestine(2)|lung(3)	6			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00652)		TACCTTGCTGGTGGTCACCGT	0.597																																																	0													41.0	40.0	40.0					14																	75329962		1962	4127	6089	SO:0001583	missense	283571				CCDS45136.1, CCDS45136.2, CCDS73663.1	14q24.3	2012-10-02			ENSG00000119608	ENSG00000119608		"""Homeoboxes / PROS class"""	26715	protein-coding gene	gene with protein product		615094					Standard	NM_001080408		Approved	FLJ36749	uc031qpi.1	Q3B8N5	OTTHUMG00000171481	ENST00000445876.1:c.576C>A	14.37:g.75329962G>T	ENSP00000405932:p.His192Gln		C9J5W1|Q8N9Q3	Missense_Mutation	SNP	pfam_Prox1,superfamily_Homeodomain-like	p.H192Q	ENST00000445876.1	37	c.576	CCDS45136.2	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.862|9.862	1.196595|1.196595	0.22037|0.22037	.|.	.|.	ENSG00000119608|ENSG00000119608	ENST00000556489;ENST00000389664;ENST00000424024;ENST00000445876|ENST00000556084	T;T|.	0.40756|.	1.02;1.02|.	5.28|5.28	-0.198|-0.198	0.13224|0.13224	.|.	0.841842|.	0.10763|.	N|.	0.636871|.	T|T	0.26738|0.26738	0.0654|0.0654	L|L	0.44542|0.44542	1.39|1.39	0.09310|0.09310	N|N	1|1	B;B|.	0.17667|.	0.008;0.023|.	B;B|.	0.11329|.	0.006;0.004|.	T|T	0.26883|0.26883	-1.0090|-1.0090	10|5	0.25106|.	T|.	0.35|.	-0.0877|-0.0877	1.1257|1.1257	0.01734|0.01734	0.2679:0.3045:0.2865:0.1412|0.2679:0.3045:0.2865:0.1412	.|.	192;192|.	G3V3G0;Q3B8N5-2|.	.;.|.	Q|N	192|192	ENSP00000451223:H192Q;ENSP00000405932:H192Q|.	ENSP00000374315:H192Q|.	H|T	-|-	3|2	2|0	PROX2|PROX2	74399715|74399715	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.252000|0.252000	0.25951|0.25951	-0.038000|-0.038000	0.12144|0.12144	0.066000|0.066000	0.16515|0.16515	0.555000|0.555000	0.69702|0.69702	CAC|ACC	PROX2	-	NULL		0.597	PROX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PROX2	HGNC	protein_coding		G			75329962	-1	no_errors	ENST00000445876	ensembl	human	known	70_37	missense	SNP	0.000	T
PRPF38B	55119	genome.wustl.edu	37	1	109241261	109241261	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:109241261G>A	ENST00000370025.4	+	5	863	c.594G>A	c.(592-594)atG>atA	p.M198I	PRPF38B_ENST00000370021.1_Missense_Mutation_p.M87I	NM_018061.2	NP_060531.2	Q5VTL8	PR38B_HUMAN	pre-mRNA processing factor 38B	198					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			NS(1)|kidney(3)|large_intestine(5)|lung(8)|prostate(1)|skin(1)	19		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0149)|Lung(183;0.0888)|COAD - Colon adenocarcinoma(174;0.113)|Epithelial(280;0.161)		GCTGTGTAATGACCATTGGAG	0.373																																																	0													126.0	122.0	123.0					1																	109241261		2203	4300	6503	SO:0001583	missense	55119			AL833950	CCDS788.1	1p13.3	2013-10-03	2013-10-03		ENSG00000134186	ENSG00000134186			25512	protein-coding gene	gene with protein product			"""PRP38 pre-mRNA processing factor 38 (yeast) domain containing B"""				Standard	NM_018061		Approved	FLJ10330, NET1	uc001dvv.4	Q5VTL8	OTTHUMG00000010991	ENST00000370025.4:c.594G>A	1.37:g.109241261G>A	ENSP00000359042:p.Met198Ile		Q05DD6|Q32Q58|Q5VTL9|Q6PK39|Q7Z6E2|Q86WF3|Q8IWG9|Q9NW40	Missense_Mutation	SNP	pfam_PRP38	p.M198I	ENST00000370025.4	37	c.594	CCDS788.1	1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.166488	0.78339	.	.	ENSG00000134186	ENST00000370025;ENST00000370021	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.50752	0.1634	L	0.48877	1.53	0.80722	D	1	P	0.37207	0.587	B	0.42112	0.376	T	0.47586	-0.9106	9	0.19147	T	0.46	.	19.9311	0.97118	0.0:0.0:1.0:0.0	.	198	Q5VTL8	PR38B_HUMAN	I	198;87	.	ENSP00000359038:M87I	M	+	3	0	PRPF38B	109042784	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.444000	0.97578	2.714000	0.92807	0.655000	0.94253	ATG	PRPF38B	-	pfam_PRP38		0.373	PRPF38B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF38B	HGNC	protein_coding	OTTHUMT00000030231.1	G	NM_018061		109241261	+1	no_errors	ENST00000370025	ensembl	human	known	70_37	missense	SNP	1.000	A
PRPF4B	8899	genome.wustl.edu	37	6	4037792	4037792	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr6:4037792C>T	ENST00000337659.6	+	3	1500	c.1400C>T	c.(1399-1401)tCt>tTt	p.S467F	PRPF4B_ENST00000538861.1_Missense_Mutation_p.S453F	NM_003913.4	NP_003904.3	Q13523	PRP4B_HUMAN	pre-mRNA processing factor 4B	467	Arg/Lys-rich (basic).				mRNA splicing, via spliceosome (GO:0000398)|protein phosphorylation (GO:0006468)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|chromosome (GO:0005694)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(3)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	22	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				AGAAGCAGATCTCCTCGGAGA	0.438																																																	0													93.0	76.0	81.0					6																	4037792		2203	4300	6503	SO:0001583	missense	8899			U48736	CCDS4488.1	6p24.2	2013-10-03	2013-10-03		ENSG00000112739	ENSG00000112739			17346	protein-coding gene	gene with protein product		602338	"""PRP4 pre-mRNA processing factor 4 homolog B (yeast)"""			9628581, 11418604	Standard	XR_241936		Approved	Prp4, PR4H, KIAA0536	uc003mvv.3	Q13523	OTTHUMG00000014157	ENST00000337659.6:c.1400C>T	6.37:g.4037792C>T	ENSP00000337194:p.Ser467Phe		A8K5C9|Q5D0F6|Q5TAY8|Q8IVC3|Q8TDP2|Q96QT7|Q9UEE6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S467F	ENST00000337659.6	37	c.1400	CCDS4488.1	6	.	.	.	.	.	.	.	.	.	.	C	16.73	3.204667	0.58234	.	.	ENSG00000112739	ENST00000337659;ENST00000538861	T;T	0.71103	-0.53;-0.54	5.09	4.21	0.49690	.	0.000000	0.64402	D	0.000001	T	0.56630	0.1998	M	0.61703	1.905	0.58432	D	0.999996	B	0.09022	0.002	B	0.06405	0.002	T	0.63871	-0.6539	10	0.62326	D	0.03	.	13.9078	0.63848	0.0:0.9247:0.0:0.0753	.	467	Q13523	PRP4B_HUMAN	F	467;453	ENSP00000337194:S467F;ENSP00000439331:S453F	ENSP00000337194:S467F	S	+	2	0	PRPF4B	3982791	0.999000	0.42202	1.000000	0.80357	0.977000	0.68977	3.599000	0.54045	2.342000	0.79632	0.561000	0.74099	TCT	PRPF4B	-	NULL		0.438	PRPF4B-011	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF4B	HGNC	protein_coding	OTTHUMT00000314018.2	C			4037792	+1	no_errors	ENST00000337659	ensembl	human	known	70_37	missense	SNP	1.000	T
PTCH2	8643	genome.wustl.edu	37	1	45292952	45292952	+	Missense_Mutation	SNP	C	C	T	rs376329398		TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:45292952C>T	ENST00000372192.3	-	16	2531	c.2401G>A	c.(2401-2403)Gct>Act	p.A801T	PTCH2_ENST00000447098.2_Missense_Mutation_p.A801T	NM_003738.4	NP_003729.3	Q9Y6C5	PTC2_HUMAN	patched 2	801					epidermis development (GO:0008544)|hair cycle (GO:0042633)|negative regulation of smoothened signaling pathway (GO:0045879)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|smoothened binding (GO:0005119)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	50	Acute lymphoblastic leukemia(166;0.155)					CGCCCAGAAGCCCAGTCCTGG	0.632									Basal Cell Nevus syndrome																																								0								C	THR/ALA,THR/ALA	0,4406		0,0,2203	62.0	68.0	66.0		2401,2401	3.9	1.0	1		66	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	PTCH2	NM_003738.4,NM_001166292.1	58,58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	801/1204,801/1147	45292952	1,13005	2203	4300	6503	SO:0001583	missense	8643	Familial Cancer Database	Gorlin syndrome, Gorlin-Golz syndrome, Naevoid Basal Cell Carcinoma syndrome, NBCCS	AF091501	CCDS516.1, CCDS53312.1	1p34.1	2010-06-24	2010-06-24		ENSG00000117425	ENSG00000117425			9586	protein-coding gene	gene with protein product		603673	"""patched (Drosophila) homolog 2"", ""patched homolog 2 (Drosophila)"""			9811851, 9931336	Standard	NM_003738		Approved		uc010olf.2	Q9Y6C5	OTTHUMG00000008490	ENST00000372192.3:c.2401G>A	1.37:g.45292952C>T	ENSP00000361266:p.Ala801Thr		O95341|O95856|Q53Z57|Q5QP87|Q6UX14	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD,tigrfam_TM_rcpt_patched	p.A801T	ENST00000372192.3	37	c.2401	CCDS516.1	1	.	.	.	.	.	.	.	.	.	.	C	13.41	2.229571	0.39399	0.0	1.16E-4	ENSG00000117425	ENST00000447098;ENST00000372192	D;D	0.82803	-1.65;-1.65	4.85	3.92	0.45320	.	0.000000	0.44097	D	0.000500	T	0.75391	0.3843	L	0.34521	1.04	0.43271	D	0.995224	P;B	0.36048	0.534;0.444	B;B	0.42030	0.373;0.146	T	0.70096	-0.4966	10	0.22109	T	0.4	-28.6512	9.7393	0.40409	0.0:0.7638:0.1541:0.0821	.	801;801	Q9Y6C5-2;Q9Y6C5	.;PTC2_HUMAN	T	801	ENSP00000389703:A801T;ENSP00000361266:A801T	ENSP00000361266:A801T	A	-	1	0	PTCH2	45065539	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.210000	0.51129	2.402000	0.81655	0.557000	0.71058	GCT	PTCH2	-	pfam_Patched,tigrfam_TM_rcpt_patched		0.632	PTCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCH2	HGNC	protein_coding	OTTHUMT00000023428.4	C	NM_003738		45292952	-1	no_errors	ENST00000372192	ensembl	human	known	70_37	missense	SNP	1.000	T
PTGFRN	5738	genome.wustl.edu	37	1	117509728	117509728	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:117509728C>T	ENST00000393203.2	+	6	1982	c.1835C>T	c.(1834-1836)tCt>tTt	p.S612F	PTGFRN_ENST00000496699.1_3'UTR	NM_020440.2	NP_065173.2	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor inhibitor	612	Ig-like C2-type 5.				lipid particle organization (GO:0034389)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)	46	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)		GACCAGGATTCTGTGGTGAAG	0.502																																																	0													128.0	131.0	130.0					1																	117509728		2203	4300	6503	SO:0001583	missense	5738			AB014734	CCDS890.1	1p13.1	2013-01-29	2013-01-25		ENSG00000134247	ENSG00000134247		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9601	protein-coding gene	gene with protein product		601204	"""prostaglandin F2 receptor negative regulator"""			8655148	Standard	NM_020440		Approved	FPRP, EWI-F, CD9P-1, FLJ11001, KIAA1436, SMAP-6, CD315	uc001egv.1	Q9P2B2	OTTHUMG00000012028	ENST00000393203.2:c.1835C>T	1.37:g.117509728C>T	ENSP00000376899:p.Ser612Phe		Q5VVU9|Q8N2K6	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.S612F	ENST00000393203.2	37	c.1835	CCDS890.1	1	.	.	.	.	.	.	.	.	.	.	C	19.57	3.853192	0.71719	.	.	ENSG00000134247	ENST00000393203;ENST00000544471	T	0.04360	3.64	5.56	5.56	0.83823	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.373568	0.29868	N	0.010997	T	0.08447	0.0210	L	0.50333	1.59	0.42832	D	0.994026	D	0.53462	0.96	P	0.59761	0.863	T	0.00986	-1.1490	10	0.72032	D	0.01	-12.7753	13.0339	0.58859	0.0:0.8383:0.1617:0.0	.	612	Q9P2B2	FPRP_HUMAN	F	612;471	ENSP00000376899:S612F	ENSP00000376899:S612F	S	+	2	0	PTGFRN	117311251	0.962000	0.33011	0.337000	0.25536	0.997000	0.91878	4.471000	0.60182	2.787000	0.95880	0.650000	0.86243	TCT	PTGFRN	-	smart_Ig_sub		0.502	PTGFRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGFRN	HGNC	protein_coding	OTTHUMT00000033271.1	C	NM_020440		117509728	+1	no_errors	ENST00000393203	ensembl	human	known	70_37	missense	SNP	0.518	T
PTGFRN	5738	genome.wustl.edu	37	1	117509950	117509950	+	Nonsense_Mutation	SNP	C	C	G			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:117509950C>G	ENST00000393203.2	+	6	2204	c.2057C>G	c.(2056-2058)tCa>tGa	p.S686*	PTGFRN_ENST00000496699.1_3'UTR	NM_020440.2	NP_065173.2	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor inhibitor	686					lipid particle organization (GO:0034389)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)	46	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)		TTCCAAACCTCAGGTGAGCAG	0.493																																																	0													40.0	41.0	41.0					1																	117509950		2203	4300	6503	SO:0001587	stop_gained	5738			AB014734	CCDS890.1	1p13.1	2013-01-29	2013-01-25		ENSG00000134247	ENSG00000134247		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9601	protein-coding gene	gene with protein product		601204	"""prostaglandin F2 receptor negative regulator"""			8655148	Standard	NM_020440		Approved	FPRP, EWI-F, CD9P-1, FLJ11001, KIAA1436, SMAP-6, CD315	uc001egv.1	Q9P2B2	OTTHUMG00000012028	ENST00000393203.2:c.2057C>G	1.37:g.117509950C>G	ENSP00000376899:p.Ser686*		Q5VVU9|Q8N2K6	Nonsense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.S686*	ENST00000393203.2	37	c.2057	CCDS890.1	1	.	.	.	.	.	.	.	.	.	.	C	42	9.363836	0.99148	.	.	ENSG00000134247	ENST00000393203;ENST00000544471	.	.	.	5.56	5.56	0.83823	.	0.449452	0.24488	N	0.038087	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-3.327	17.3816	0.87406	0.0:1.0:0.0:0.0	.	.	.	.	X	686;545	.	ENSP00000376899:S686X	S	+	2	0	PTGFRN	117311473	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.635000	0.67841	2.787000	0.95880	0.650000	0.86243	TCA	PTGFRN	-	NULL		0.493	PTGFRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGFRN	HGNC	protein_coding	OTTHUMT00000033271.1	C	NM_020440		117509950	+1	no_errors	ENST00000393203	ensembl	human	known	70_37	nonsense	SNP	1.000	G
PTPRD	5789	genome.wustl.edu	37	9	8499796	8499796	+	Missense_Mutation	SNP	A	A	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr9:8499796A>T	ENST00000381196.4	-	22	2716	c.2173T>A	c.(2173-2175)Tca>Aca	p.S725T	PTPRD_ENST00000540109.1_Missense_Mutation_p.S725T|PTPRD_ENST00000356435.5_Missense_Mutation_p.S725T|PTPRD_ENST00000397606.3_Intron|PTPRD_ENST00000397611.3_Intron|PTPRD_ENST00000360074.4_Missense_Mutation_p.S712T|PTPRD_ENST00000358503.5_Missense_Mutation_p.S712T|PTPRD_ENST00000355233.5_Intron|PTPRD_ENST00000486161.1_Intron|PTPRD_ENST00000397617.3_Intron|PTPRD_ENST00000471274.1_5'UTR|PTPRD_ENST00000537002.1_Intron	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	725	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		ACAGATGTTGAGTTGACAGCC	0.458										TSP Lung(15;0.13)																																							0													140.0	126.0	131.0					9																	8499796		2203	4300	6503	SO:0001583	missense	5789			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.2173T>A	9.37:g.8499796A>T	ENSP00000370593:p.Ser725Thr		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like,prints_Tyr_Pase_rcpt/non-rcpt	p.S725T	ENST00000381196.4	37	c.2173	CCDS43786.1	9	.	.	.	.	.	.	.	.	.	.	A	15.49	2.847985	0.51164	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000540109	T;T;T;T;T	0.59083	0.29;0.29;0.29;0.29;0.29	5.69	3.26	0.37387	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.061345	0.64402	D	0.000002	T	0.74129	0.3676	M	0.86343	2.81	0.45822	D	0.998697	D;P;D	0.61697	0.99;0.517;0.979	P;B;P	0.59703	0.786;0.171;0.862	T	0.76252	-0.3027	9	.	.	.	.	12.4471	0.55657	0.726:0.274:0.0:0.0	.	712;725;725	G3XAE2;Q2HXI4;P23468	.;.;PTPRD_HUMAN	T	725;725;712;712;725	ENSP00000370593:S725T;ENSP00000348812:S725T;ENSP00000353187:S712T;ENSP00000351293:S712T;ENSP00000438164:S725T	.	S	-	1	0	PTPRD	8489796	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.078000	0.76821	0.398000	0.25338	0.482000	0.46254	TCA	PTPRD	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.458	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRD	HGNC	protein_coding	OTTHUMT00000055395.3	A			8499796	-1	no_errors	ENST00000356435	ensembl	human	known	70_37	missense	SNP	1.000	T
PTPRM	5797	genome.wustl.edu	37	18	8143731	8143731	+	Silent	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr18:8143731C>T	ENST00000332175.8	+	14	3291	c.2254C>T	c.(2254-2256)Ctg>Ttg	p.L752L	PTPRM_ENST00000400060.4_Silent_p.L752L|PTPRM_ENST00000580170.1_Silent_p.L752L|PTPRM_ENST00000400053.4_Silent_p.L690L|PTPRM_ENST00000444013.1_Silent_p.L539L	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	752					homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				GGGCATCTTGCTGTTCGTGAT	0.448																																																	0													191.0	182.0	185.0					18																	8143731		2203	4300	6503	SO:0001819	synonymous_variant	5797			X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.2254C>T	18.37:g.8143731C>T			A7MBN1|D3DUH8|J3QL11	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.L752	ENST00000332175.8	37	c.2254	CCDS11840.1	18																																																																																			PTPRM	-	NULL		0.448	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRM	HGNC	protein_coding	OTTHUMT00000254456.1	C			8143731	+1	no_errors	ENST00000400060	ensembl	human	known	70_37	silent	SNP	1.000	T
PTPRR	5801	genome.wustl.edu	37	12	71286716	71286716	+	Nonsense_Mutation	SNP	G	G	A	rs200295461		TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr12:71286716G>A	ENST00000283228.2	-	2	552	c.100C>T	c.(100-102)Cag>Tag	p.Q34*		NM_002849.3	NP_002840.2	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	34					ERBB2 signaling pathway (GO:0038128)|in utero embryonic development (GO:0001701)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		CTCTTCTTCTGATTAATTGCC	0.388																																																	0													103.0	109.0	107.0					12																	71286716		2203	4300	6503	SO:0001587	stop_gained	5801			D64053	CCDS8998.1, CCDS44945.1, CCDS55847.1, CCDS55848.1	12q15	2011-10-07			ENSG00000153233	ENSG00000153233		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9680	protein-coding gene	gene with protein product		602853		PTPRQ		7557444, 10393441	Standard	NM_002849		Approved	PTPBR7, PTP-SL, EC-PTP, PCPTP1	uc001swi.2	Q15256	OTTHUMG00000169502	ENST00000283228.2:c.100C>T	12.37:g.71286716G>A	ENSP00000283228:p.Gln34*		B2R5Z7|B7Z3J1|F5GXR7|O00342|Q92682|Q9UE65	Nonsense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_rcpt_R/non-rcpt_5,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_KIM-con,prints_Tyr_Pase_rcpt/non-rcpt	p.Q34*	ENST00000283228.2	37	c.100	CCDS8998.1	12	.	.	.	.	.	.	.	.	.	.	G	42	9.224654	0.99106	.	.	ENSG00000153233	ENST00000283228	.	.	.	5.86	5.86	0.93980	.	0.000000	0.37669	U	0.002000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-1.7829	19.1878	0.93651	0.0:0.0:1.0:0.0	.	.	.	.	X	34	.	ENSP00000283228:Q34X	Q	-	1	0	PTPRR	69572983	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.764000	0.74960	2.776000	0.95493	0.650000	0.86243	CAG	PTPRR	-	pirsf_Tyr_Pase_rcpt_R/non-rcpt_5		0.388	PTPRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRR	HGNC	protein_coding	OTTHUMT00000404485.1	G	NM_002849		71286716	-1	no_errors	ENST00000283228	ensembl	human	known	70_37	nonsense	SNP	1.000	A
PTX4	390667	genome.wustl.edu	37	16	1537772	1537772	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr16:1537772C>T	ENST00000447419.2	-	2	366	c.341G>A	c.(340-342)cGa>cAa	p.R114Q	PTX4_ENST00000440447.2_Missense_Mutation_p.R114Q|PTX4_ENST00000293922.1_Missense_Mutation_p.R109Q			Q96A99	PTX4_HUMAN	pentraxin 4, long	114						extracellular region (GO:0005576)	metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17						TTTCCGGCCTCGGCGCTGCAG	0.687																																																	0													37.0	42.0	40.0					16																	1537772		2199	4297	6496	SO:0001583	missense	390667				CCDS32362.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000251692	ENSG00000251692			14171	protein-coding gene	gene with protein product		613442	"""chromosome 16 open reading frame 38"""	C16orf38			Standard	NM_001013658		Approved		uc010uvf.2	Q96A99		ENST00000447419.2:c.341G>A	16.37:g.1537772C>T	ENSP00000445277:p.Arg114Gln			Missense_Mutation	SNP	pfam_Pentaxin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	p.R114Q	ENST00000447419.2	37	c.341		16	.	.	.	.	.	.	.	.	.	.	C	9.966	1.224221	0.22457	.	.	ENSG00000251692	ENST00000447419;ENST00000293922	T;T	0.08546	3.26;3.08	5.55	4.6	0.57074	.	0.309061	0.29273	N	0.012621	T	0.09202	0.0227	L	0.54323	1.7	0.09310	N	1	P	0.50272	0.933	B	0.42087	0.375	T	0.24119	-1.0169	10	0.25106	T	0.35	.	8.7002	0.34320	0.0:0.8279:0.0:0.1721	.	109	Q96A99-2	.	Q	114;109	ENSP00000445277:R114Q;ENSP00000293922:R109Q	ENSP00000293922:R109Q	R	-	2	0	PTX4	1477773	0.000000	0.05858	0.004000	0.12327	0.001000	0.01503	0.506000	0.22658	1.359000	0.45940	-0.291000	0.09656	CGA	PTX4	-	NULL		0.687	PTX4-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	PTX4	HGNC	protein_coding	OTTHUMT00000432526.1	C	NM_001013658		1537772	-1	no_errors	ENST00000447419	ensembl	human	known	70_37	missense	SNP	0.022	T
RGS3	5998	genome.wustl.edu	37	9	116346522	116346522	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr9:116346522G>A	ENST00000374140.2	+	21	3039	c.2830G>A	c.(2830-2832)Gag>Aag	p.E944K	RGS3_ENST00000374134.3_Missense_Mutation_p.E265K|RGS3_ENST00000350696.5_Missense_Mutation_p.E944K|RP11-168K11.2_ENST00000428429.1_RNA|RGS3_ENST00000342620.5_Intron|RGS3_ENST00000343817.5_Missense_Mutation_p.E663K|RGS3_ENST00000462143.1_Missense_Mutation_p.E265K|RGS3_ENST00000394646.3_Intron	NM_001282923.1|NM_144488.4	NP_001269852.1|NP_652759.3	P49796	RGS3_HUMAN	regulator of G-protein signaling 3	944					inactivation of MAPK activity (GO:0000188)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	48						GACGCACAGCGAGGGCAGCCT	0.701																																																	0													45.0	46.0	46.0					9																	116346522		2203	4299	6502	SO:0001583	missense	5998			AF006610	CCDS6797.1, CCDS6798.1, CCDS35113.1, CCDS35114.1, CCDS43869.1, CCDS65111.1	9q32	2008-02-05	2007-08-14		ENSG00000138835	ENSG00000138835		"""Regulators of G-protein signaling"""	9999	protein-coding gene	gene with protein product		602189	"""regulator of G-protein signalling 3"""			8602223, 11034339	Standard	NM_001276260		Approved	C2PA, FLJ20370, PDZ-RGS3	uc004bhq.4	P49796	OTTHUMG00000021048	ENST00000374140.2:c.2830G>A	9.37:g.116346522G>A	ENSP00000363255:p.Glu944Lys		A6NHA0|A8K0V1|B3KUB2|Q5VXB8|Q5VXC1|Q5VZ05|Q5VZ06|Q6ZRM5|Q8IUQ1|Q8NC47|Q8NFN4|Q8NFN5|Q8NFN6|Q8TD59|Q8TD68|Q8WV02|Q8WXA0	Missense_Mutation	SNP	pfam_Regulat_G_prot_signal,pfam_C2_Ca-dep,pfam_PDZ,superfamily_Regulat_G_prot_signal_superfam,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,smart_C2_Ca-dep,smart_PDZ,smart_Regulat_G_prot_signal,pfscan_C2_membr_targeting,pfscan_PDZ,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.E944K	ENST00000374140.2	37	c.2830	CCDS43869.1	9	.	.	.	.	.	.	.	.	.	.	G	32	5.174666	0.94807	.	.	ENSG00000138835	ENST00000374140;ENST00000350696;ENST00000343817;ENST00000474719;ENST00000462143;ENST00000374134;ENST00000467805	T;T;T;T;T;D	0.89617	0.3;0.3;-0.15;-0.34;-0.34;-2.54	5.52	5.52	0.82312	.	0.130064	0.49916	D	0.000126	D	0.91365	0.7276	L	0.34521	1.04	0.80722	D	1	D;P;D;P;P;P	0.89917	1.0;0.903;1.0;0.903;0.844;0.916	D;B;D;B;B;B	0.91635	0.999;0.247;0.998;0.247;0.125;0.329	D	0.92016	0.5622	10	0.62326	D	0.03	.	16.1652	0.81750	0.0:0.0:1.0:0.0	.	283;840;265;663;834;944	B4DWF9;P49796-6;Q6ZV17;P49796-4;B3KWG8;P49796	.;.;.;.;.;RGS3_HUMAN	K	944;944;663;112;265;265;110	ENSP00000363255:E944K;ENSP00000259406:E944K;ENSP00000340284:E663K;ENSP00000420356:E265K;ENSP00000363249:E265K;ENSP00000417994:E110K	ENSP00000340284:E663K	E	+	1	0	RGS3	115386343	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.195000	0.77798	2.576000	0.86940	0.555000	0.69702	GAG	RGS3	-	NULL		0.701	RGS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS3	HGNC	protein_coding	OTTHUMT00000055561.3	G	NM_017790		116346522	+1	no_errors	ENST00000350696	ensembl	human	known	70_37	missense	SNP	1.000	A
RNPC3	55599	genome.wustl.edu	37	1	104076467	104076467	+	Frame_Shift_Del	DEL	A	A	-			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:104076467delA	ENST00000533099.1	+	4	583	c.347delA	c.(346-348)gaafs	p.E116fs	RNPC3_ENST00000524631.1_Frame_Shift_Del_p.E116fs|RNPC3_ENST00000423855.2_Frame_Shift_Del_p.E116fs			Q96LT9	RBM40_HUMAN	RNA-binding region (RNP1, RRM) containing 3	116	Necessary for interaction with PDCD7.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Lung(183;0.111)|Epithelial(280;0.122)|all cancers(265;0.125)|Colorectal(144;0.163)		TCAGGCTCTGAAAAAAAAAAA	0.318																																																	0										85,435,1262		6,1,72,18,398,396	50.0	39.0	43.0			4.6	0.6	1		49	197,914,2651		20,3,154,16,879,809	no	codingComplex	RNPC3	NM_017619.3		26,4,226,34,1277,1205	A1A1,A1A2,A1R,A2A2,A2R,RR		29.5322,29.1807,29.4192			104076467	282,1349,3913	692	1590	2282	SO:0001589	frameshift_variant	55599			AB058742, AY099329	CCDS781.1	1p21.1	2013-07-16			ENSG00000185946	ENSG00000185946		"""RNA binding motif (RRM) containing"""	18666	protein-coding gene	gene with protein product	"""U11/U12 snRNP 65K"""					14974681, 15146077	Standard	NM_017619		Approved	KIAA1839, FLJ20008, RBM40, SNRNP65	uc010oun.2	Q96LT9	OTTHUMG00000166613	ENST00000533099.1:c.347delA	1.37:g.104076467delA	ENSP00000432886:p.Glu116fs		A8K1C9|D3DT74|Q5TZ87|Q96FK7|Q96JI8|Q9NSU7|Q9NXX2	Frame_Shift_Del	DEL	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.K119fs	ENST00000533099.1	37	c.347	CCDS781.1	1																																																																																			RNPC3	-	NULL		0.318	RNPC3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNPC3	HGNC	protein_coding	OTTHUMT00000390812.1	A	NM_017619		104076467	+1	no_errors	ENST00000423855	ensembl	human	known	70_37	frame_shift_del	DEL	0.784	-
ROBO1	6091	genome.wustl.edu	37	3	78735011	78735011	+	Missense_Mutation	SNP	C	C	G			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr3:78735011C>G	ENST00000464233.1	-	10	1340	c.1227G>C	c.(1225-1227)caG>caC	p.Q409H	ROBO1_ENST00000436010.2_Missense_Mutation_p.Q370H|ROBO1_ENST00000495273.1_Missense_Mutation_p.Q373H|ROBO1_ENST00000467549.1_Missense_Mutation_p.Q373H	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	409	Ig-like C2-type 4.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		GGTCGCCAGTCTGGGAGACTG	0.403																																																	0													55.0	56.0	55.0					3																	78735011		1915	4105	6020	SO:0001583	missense	6091			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.1227G>C	3.37:g.78735011C>G	ENSP00000420321:p.Gln409His		B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.Q409H	ENST00000464233.1	37	c.1227	CCDS54611.1	3	.	.	.	.	.	.	.	.	.	.	C	15.62	2.888000	0.52014	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27	5.42	5.42	0.78866	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin V-set, subgroup (1);Immunoglobulin-like fold (1);	0.051456	0.85682	D	0.000000	T	0.70745	0.3259	N	0.25485	0.75	0.51482	D	0.999921	D;D;D;D;D	0.89917	0.985;1.0;0.999;0.999;0.999	P;D;D;D;D	0.91635	0.877;0.984;0.999;0.976;0.983	T	0.68108	-0.5496	9	.	.	.	.	13.8553	0.63522	0.0:0.9265:0.0:0.0735	.	373;409;373;373;370	Q1RMC7;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;ROBO1_HUMAN;.;.;.	H	370;373;409;373;373;409	ENSP00000406043:Q370H;ENSP00000420321:Q409H;ENSP00000420637:Q373H;ENSP00000417992:Q373H	.	Q	-	3	2	ROBO1	78817701	1.000000	0.71417	1.000000	0.80357	0.432000	0.31715	2.141000	0.42168	2.700000	0.92200	0.563000	0.77884	CAG	ROBO1	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like		0.403	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO1	HGNC	protein_coding	OTTHUMT00000352610.1	C	NM_002941		78735011	-1	no_errors	ENST00000464233	ensembl	human	known	70_37	missense	SNP	1.000	G
ROCK2	9475	genome.wustl.edu	37	2	11337678	11337678	+	Missense_Mutation	SNP	G	G	C	rs376988314		TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr2:11337678G>C	ENST00000315872.6	-	26	3701	c.3253C>G	c.(3253-3255)Cag>Gag	p.Q1085E	ROCK2_ENST00000401753.1_Missense_Mutation_p.Q842E	NM_004850.3	NP_004841.2	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein kinase 2	1085					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|neural tube closure (GO:0001843)|positive regulation of centrosome duplication (GO:0010825)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of circadian rhythm (GO:0042752)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|rhythmic process (GO:0048511)|smooth muscle contraction (GO:0006939)	centrosome (GO:0005813)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(10)|prostate(1)|skin(4)|stomach(3)|urinary_tract(2)	43	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		AGTTCTTTCTGATACTTGATC	0.353																																																	0													189.0	169.0	175.0					2																	11337678		1857	4095	5952	SO:0001583	missense	9475			D87931	CCDS42654.1	2p24	2013-01-10			ENSG00000134318	ENSG00000134318	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10252	protein-coding gene	gene with protein product		604002				9933571	Standard	NM_004850		Approved		uc002rbd.1	O75116	OTTHUMG00000149916	ENST00000315872.6:c.3253C>G	2.37:g.11337678G>C	ENSP00000317985:p.Gln1085Glu		Q53QZ0|Q53SJ7|Q9UQN5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Rho-bd,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_tRNA-bd_arm,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,pirsf_Rho-assoc_coiled-coil_kin,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.Q1085E	ENST00000315872.6	37	c.3253	CCDS42654.1	2	.	.	.	.	.	.	.	.	.	.	G	25.7	4.662830	0.88251	.	.	ENSG00000134318	ENST00000315872;ENST00000401753;ENST00000399089	T;T	0.62788	-0.0;1.01	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.80839	0.4700	M	0.79693	2.465	0.80722	D	1	D	0.69078	0.997	D	0.69654	0.965	T	0.81389	-0.0955	10	0.54805	T	0.06	.	19.8689	0.96843	0.0:0.0:1.0:0.0	.	1085	O75116	ROCK2_HUMAN	E	1085;842;443	ENSP00000317985:Q1085E;ENSP00000385509:Q842E	ENSP00000317985:Q1085E	Q	-	1	0	ROCK2	11255129	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.809000	0.99208	2.695000	0.91970	0.557000	0.71058	CAG	ROCK2	-	pirsf_Rho-assoc_coiled-coil_kin		0.353	ROCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROCK2	HGNC	protein_coding	OTTHUMT00000313886.3	G			11337678	-1	no_errors	ENST00000315872	ensembl	human	known	70_37	missense	SNP	1.000	C
RPAIN	84268	genome.wustl.edu	37	17	5329310	5329310	+	Missense_Mutation	SNP	G	G	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr17:5329310G>T	ENST00000381209.3	+	4	903	c.333G>T	c.(331-333)gaG>gaT	p.E111D	RPAIN_ENST00000381208.5_Missense_Mutation_p.E111D|CTC-524C5.2_ENST00000575890.1_RNA|RPAIN_ENST00000327154.6_Missense_Mutation_p.E111D|RPAIN_ENST00000574003.1_Intron|RPAIN_ENST00000536255.2_Intron|RPAIN_ENST00000405578.4_Missense_Mutation_p.E111D	NM_001033002.3	NP_001028174.2	Q86UA6	RIP_HUMAN	RPA interacting protein	111					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)|protein import into nucleus (GO:0006606)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)	metal ion binding (GO:0046872)|protein complex binding (GO:0032403)			breast(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)	6						TCATCAGCGAGTATGAGAAGA	0.473																																																	0													74.0	60.0	65.0					17																	5329310		2203	4300	6503	SO:0001583	missense	84268			AY775314	CCDS32536.1, CCDS54075.1, CCDS54076.1, CCDS54077.1, CCDS54079.1	17p13.2	2014-02-12	2006-05-08			ENSG00000129197			28641	protein-coding gene	gene with protein product						16135809, 16008515	Standard	NM_001033002		Approved	MGC4189, RIP, hRIP	uc010vsz.1	Q86UA6		ENST00000381209.3:c.333G>T	17.37:g.5329310G>T	ENSP00000370606:p.Glu111Asp		B4DI36|B4DTX7|E9PES3|J3KNH8|Q4G2Y0|Q4G2Y5|Q4G2Y8|Q6B4V9|Q6B4W0|Q6B4W1|Q6B4W4|Q86X49|Q9BT00	Missense_Mutation	SNP	NULL	p.E111D	ENST00000381209.3	37	c.333	CCDS32536.1	17	.	.	.	.	.	.	.	.	.	.	G	17.40	3.381037	0.61845	.	.	ENSG00000129197	ENST00000381209;ENST00000381208;ENST00000539417;ENST00000405578;ENST00000327154	T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75	5.41	-0.281	0.12882	.	0.095034	0.64402	D	0.000001	T	0.63212	0.2492	M	0.79258	2.445	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	T	0.62637	-0.6812	10	0.56958	D	0.05	-5.4204	9.3418	0.38085	0.4575:0.0:0.5425:0.0	.	111;111;111;111	F5GYE1;E9PES3;E9PDG9;Q86UA6	.;.;.;RIP_HUMAN	D	111	ENSP00000370606:E111D;ENSP00000370605:E111D;ENSP00000446453:E111D;ENSP00000385814:E111D;ENSP00000315069:E111D	ENSP00000315069:E111D	E	+	3	2	RPAIN	5270034	0.992000	0.36948	0.889000	0.34880	0.747000	0.42532	0.080000	0.14802	0.077000	0.16863	-0.253000	0.11424	GAG	RPAIN	-	NULL		0.473	RPAIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPAIN	HGNC	protein_coding	OTTHUMT00000439373.1	G	NM_001033002		5329310	+1	no_errors	ENST00000405578	ensembl	human	known	70_37	missense	SNP	0.979	T
RRBP1	6238	genome.wustl.edu	37	20	17640216	17640216	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr20:17640216C>T	ENST00000377813.1	-	3	1240	c.937G>A	c.(937-939)Gag>Aag	p.E313K	RRBP1_ENST00000246043.4_Missense_Mutation_p.E313K|RRBP1_ENST00000360807.4_Intron|RRBP1_ENST00000377807.2_Intron|RRBP1_ENST00000455029.2_Intron			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	313	41 X 10 AA approximate tandem repeats of [TN]-Q-[GSA]-[KRQT]-K-[ATGSV]-[ED]- [GTAS]-[ATIS]-[PQTAS].				osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						TGGGCCCCCTCTGCCTTTTTG	0.642																																																	0																																										SO:0001583	missense	6238			AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.937G>A	20.37:g.17640216C>T	ENSP00000367044:p.Glu313Lys		A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Missense_Mutation	SNP	pfam_Rib_rcpt_KP,superfamily_Ribosome_recyc_fac_dom	p.E313K	ENST00000377813.1	37	c.937		20	.	.	.	.	.	.	.	.	.	.	C	18.02	3.530885	0.64972	.	.	ENSG00000125844	ENST00000377813;ENST00000246043	T;T	0.55760	0.5;0.5	5.28	3.16	0.36331	.	.	.	.	.	T	0.53916	0.1826	.	.	.	0.18873	N	0.999981	.	.	.	.	.	.	T	0.47812	-0.9088	6	0.38643	T	0.18	-27.5077	13.5374	0.61653	0.0:0.7021:0.2979:0.0	.	.	.	.	K	313	ENSP00000367044:E313K;ENSP00000246043:E313K	ENSP00000246043:E313K	E	-	1	0	RRBP1	17588216	0.000000	0.05858	0.011000	0.14972	0.002000	0.02628	0.049000	0.14099	1.528000	0.49103	-0.176000	0.13171	GAG	RRBP1	-	NULL		0.642	RRBP1-002	NOVEL	basic	protein_coding	RRBP1	HGNC	protein_coding	OTTHUMT00000078125.1	C	NM_001042576		17640216	-1	no_errors	ENST00000246043	ensembl	human	known	70_37	missense	SNP	0.004	T
RRNAD1	51093	genome.wustl.edu	37	1	156705540	156705540	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:156705540G>A	ENST00000368216.4	+	7	1775	c.1145G>A	c.(1144-1146)cGa>cAa	p.R382Q	RRNAD1_ENST00000368218.4_Silent_p.A220A|RRNAD1_ENST00000476229.1_Silent_p.A97A|MRPL24_ENST00000478899.1_5'Flank	NM_015997.3	NP_057081.3	Q96FB5	RRNAD_HUMAN	ribosomal RNA adenine dimethylase domain containing 1	382						integral component of membrane (GO:0016021)	rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)	9						GGGCTACAGCGAGTGGGGCTA	0.547																																																	0													78.0	71.0	74.0					1																	156705540		2203	4300	6503	SO:0001583	missense	51093			BC011382	CCDS1154.1, CCDS44246.1	1q23.1	2011-01-28	2011-01-28	2011-01-28	ENSG00000143303	ENSG00000143303			24273	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 66"""	C1orf66		10810093, 310876	Standard	NM_015997		Approved	CGI-41	uc001fpu.3	Q96FB5	OTTHUMG00000041302	ENST00000368216.4:c.1145G>A	1.37:g.156705540G>A	ENSP00000357199:p.Arg382Gln		D3DVC7|Q4VX71|Q5SZ03|Q9Y358	Missense_Mutation	SNP	NULL	p.R382Q	ENST00000368216.4	37	c.1145	CCDS1154.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.21|15.21	2.764513|2.764513	0.49574|0.49574	.|.	.|.	ENSG00000143303|ENSG00000143303	ENST00000522237|ENST00000368216	.|T	.|0.47177	.|0.85	4.93|4.93	4.93|4.93	0.64822|0.64822	.|.	.|0.069785	.|0.64402	.|D	.|0.000017	T|T	0.51381|0.51381	0.1671|0.1671	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|D	.|0.69078	.|0.997	.|P	.|0.56865	.|0.808	T|T	0.55366|0.55366	-0.8152|-0.8152	4|9	.|0.59425	.|D	.|0.04	-14.6586|-14.6586	12.7396|12.7396	0.57243|0.57243	0.0:0.0:0.8351:0.1649|0.0:0.0:0.8351:0.1649	.|.	.|382	.|Q96FB5	.|RRNAD_HUMAN	K|Q	122|382	.|ENSP00000357199:R382Q	.|ENSP00000357199:R382Q	E|R	+|+	1|2	0|0	RRNAD1|RRNAD1	154972164|154972164	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.925000|0.925000	0.55904|0.55904	5.776000|5.776000	0.68924|0.68924	2.555000|2.555000	0.86185|0.86185	0.655000|0.655000	0.94253|0.94253	GAG|CGA	RRNAD1	-	NULL		0.547	RRNAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRNAD1	HGNC	protein_coding	OTTHUMT00000098973.1	G	NM_015997		156705540	+1	no_errors	ENST00000368216	ensembl	human	known	70_37	missense	SNP	1.000	A
RTBDN	83546	genome.wustl.edu	37	19	12936680	12936680	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr19:12936680C>T	ENST00000458671.2	-	6	682	c.530G>A	c.(529-531)gGa>gAa	p.G177E	RTBDN_ENST00000592204.1_Missense_Mutation_p.G187E|CTD-2265O21.3_ENST00000588469.1_RNA|RTBDN_ENST00000322912.5_Missense_Mutation_p.G209E|RTBDN_ENST00000393233.2_3'UTR|RTBDN_ENST00000589272.1_3'UTR	NM_001080997.2	NP_001074466.1	Q9BSG5	RTBDN_HUMAN	retbindin	177						extracellular region (GO:0005576)				kidney(1)|large_intestine(5)|liver(1)|lung(4)|prostate(1)	12						GTGACGGGCTCCAGGAGCAGC	0.662											OREG0025275	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													29.0	26.0	27.0					19																	12936680		2202	4299	6501	SO:0001583	missense	83546			AY028917	CCDS12283.1, CCDS45994.1, CCDS59355.1, CCDS59356.1	19p13	2006-03-22				ENSG00000132026			30310	protein-coding gene	gene with protein product		609553				12107411	Standard	NM_001080997		Approved	FLJ36353	uc002mvj.4	Q9BSG5		ENST00000458671.2:c.530G>A	19.37:g.12936680C>T	ENSP00000416375:p.Gly177Glu	683	F1T0I8|Q9BWT5	Missense_Mutation	SNP	pfam_Folate_rcpt-like	p.G209E	ENST00000458671.2	37	c.626	CCDS45994.1	19	.	.	.	.	.	.	.	.	.	.	C	22.9	4.350845	0.82132	.	.	ENSG00000132026	ENST00000322912;ENST00000458671	T;T	0.75821	-0.97;-0.97	4.53	3.41	0.39046	Folate receptor-like (1);	0.000000	0.44285	D	0.000477	D	0.82332	0.5014	M	0.68317	2.08	0.35190	D	0.773254	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.86208	0.1623	10	0.72032	D	0.01	-38.5844	9.9357	0.41550	0.0:0.7927:0.2073:0.0	.	209;177	Q9BSG5-2;Q9BSG5	.;RTBDN_HUMAN	E	209;177	ENSP00000326253:G209E;ENSP00000416375:G177E	ENSP00000326253:G209E	G	-	2	0	RTBDN	12797680	0.201000	0.23410	0.126000	0.21872	0.453000	0.32348	1.172000	0.31908	2.513000	0.84729	0.591000	0.81541	GGA	RTBDN	-	pfam_Folate_rcpt-like		0.662	RTBDN-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	RTBDN	HGNC	protein_coding	OTTHUMT00000451513.1	C	NM_031429		12936680	-1	no_errors	ENST00000322912	ensembl	human	known	70_37	missense	SNP	0.071	T
HNRNPH3	3189	genome.wustl.edu	37	10	70105422	70105422	+	IGR	SNP	C	C	A	rs534515297		TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr10:70105422C>A	ENST00000265866.7	+	0	2339				RUFY2_ENST00000602465.1_3'UTR|RUFY2_ENST00000265865.3_3'UTR|RUFY2_ENST00000388768.2_3'UTR	NM_012207.2|NM_021644.3	NP_036339.1|NP_067676.2	P31942	HNRH3_HUMAN	heterogeneous nuclear ribonucleoprotein H3 (2H9)						epithelial cell differentiation (GO:0030855)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)	11						GTACCAAATACTGACCGAAAG	0.343																																																	0																																										SO:0001628	intergenic_variant	55680				CCDS7278.1, CCDS7279.1	10q22	2013-02-12		2008-04-18	ENSG00000096746	ENSG00000096746		"""RNA binding motif (RRM) containing"""	5043	protein-coding gene	gene with protein product		602324		HNRPH3		8999868	Standard	NM_021644		Approved	2H9	uc001jnw.4	P31942	OTTHUMG00000018349		10.37:g.70105422C>A			A8K682|B3KRE1|Q9BSX1|Q9NP53|Q9NP96|Q9NPA7|Q9NPI4|Q9UFU4|Q9Y4J5	RNA	SNP	-	NULL	ENST00000265866.7	37	NULL	CCDS7278.1	10																																																																																			RUFY2	-	-		0.343	HNRNPH3-012	KNOWN	basic|appris_principal|CCDS	protein_coding	RUFY2	HGNC	protein_coding	OTTHUMT00000090165.1	C			70105422	-1	no_errors	ENST00000466187	ensembl	human	known	70_37	rna	SNP	0.004	A
S1PR3	1903	genome.wustl.edu	37	9	91616521	91616521	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr9:91616521C>T	ENST00000375846.3	+	1	5101	c.406C>T	c.(406-408)Cgg>Tgg	p.R136W	S1PR3_ENST00000358157.2_Missense_Mutation_p.R136W			Q99500	S1PR3_HUMAN	sphingosine-1-phosphate receptor 3	136					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|anatomical structure morphogenesis (GO:0009653)|cytokine production (GO:0001816)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of establishment of endothelial barrier (GO:1903141)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of interleukin-1 beta production (GO:0032651)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|integrin binding (GO:0005178)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(1)	34						CGCCATCGAGCGGCACTTGAC	0.597											OREG0019291	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													113.0	91.0	98.0					9																	91616521		2203	4300	6503	SO:0001583	missense	1903			AF022139	CCDS6680.1	9q22.1-q22.2	2012-08-08	2008-04-30	2008-04-30	ENSG00000213694	ENSG00000213694		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3167	protein-coding gene	gene with protein product	"""sphingosine-1-phosphate receptor 3"""	601965	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 3"""	EDG3		8878560, 9409733	Standard	NM_005226		Approved	EDG-3	uc004aqe.4	Q99500	OTTHUMG00000020173	ENST00000375846.3:c.406C>T	9.37:g.91616521C>T	ENSP00000365006:p.Arg136Trp	1283	Q5SQD8|Q7Z5I2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_EDG3_rcpt,prints_S1P_rcpt,prints_GPCR_Rhodpsn,prints_EDG1_rcpt,prints_Cnbnoid_rcpt	p.R136W	ENST00000375846.3	37	c.406	CCDS6680.1	9	.	.	.	.	.	.	.	.	.	.	C	16.50	3.140389	0.56936	.	.	ENSG00000213694	ENST00000358157;ENST00000375846	D;D	0.97186	-4.28;-4.28	5.04	1.93	0.25924	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.98792	0.9593	H	0.95611	3.695	0.52501	D	0.999955	D	0.89917	1.0	D	0.97110	1.0	D	0.99655	1.0992	10	0.87932	D	0	.	14.6989	0.69142	0.5396:0.4604:0.0:0.0	.	136	Q99500	S1PR3_HUMAN	W	136	ENSP00000350878:R136W;ENSP00000365006:R136W	ENSP00000350878:R136W	R	+	1	2	S1PR3	90806341	0.990000	0.36364	0.990000	0.47175	0.938000	0.57974	0.306000	0.19279	0.237000	0.21200	-0.310000	0.09108	CGG	S1PR3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.597	S1PR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S1PR3	HGNC	protein_coding	OTTHUMT00000052979.2	C	NM_005226		91616521	+1	no_errors	ENST00000358157	ensembl	human	known	70_37	missense	SNP	0.997	T
SAMSN1	64092	genome.wustl.edu	37	21	15858251	15858251	+	Silent	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr21:15858251G>A	ENST00000400566.1	-	8	1185	c.1104C>T	c.(1102-1104)atC>atT	p.I368I	SAMSN1_ENST00000400564.1_Silent_p.I200I|SAMSN1_ENST00000285670.2_Silent_p.I436I	NM_022136.4	NP_071419.3	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization signals 1	368					negative regulation of adaptive immune response (GO:0002820)|negative regulation of B cell activation (GO:0050869)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)	cell projection (GO:0042995)|cytosol (GO:0005829)|nucleus (GO:0005634)	phosphotyrosine binding (GO:0001784)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	24				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		TTGGCTCTGTGATAATAATCT	0.388																																																	0													163.0	148.0	152.0					21																	15858251		1863	4126	5989	SO:0001819	synonymous_variant	64092			AF222927	CCDS42906.1, CCDS58786.1, CCDS74774.1	21q11	2013-01-10	2006-12-13		ENSG00000155307	ENSG00000155307		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	10528	protein-coding gene	gene with protein product	"""nuclear localization signals, SAM and SH3 domain containing 1"", ""SAM and SH3 domain containing 2"", ""hematopoietic adapter-containing SH3 and sterile &#945;-motif (SAM) domains 1"", ""Src homology domain 3 (SH3)-containing adapter protein SH3 lymphocyte protein 2"""	607978				11536050, 11594764	Standard	NM_022136		Approved	NASH1, SASH2, SH3D6B, HACS1, SLy2	uc002yjv.1	Q9NSI8	OTTHUMG00000074317	ENST00000400566.1:c.1104C>T	21.37:g.15858251G>A			B3KWJ3|F8WAA1|Q8NFF7|Q9C041	Silent	SNP	pfam_rSAM/SH3_domain-containing,pfam_SAM_2,pfam_SAM_type1,pfam_SH3_2,superfamily_SAM/pointed,superfamily_SH3_domain,smart_SH3_domain,smart_SAM,pfscan_SAM	p.I368	ENST00000400566.1	37	c.1104	CCDS42906.1	21																																																																																			SAMSN1	-	NULL		0.388	SAMSN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMSN1	HGNC	protein_coding	OTTHUMT00000157914.1	G			15858251	-1	no_errors	ENST00000400566	ensembl	human	known	70_37	silent	SNP	0.993	A
TIPIN	54962	genome.wustl.edu	37	15	66639586	66639586	+	Intron	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr15:66639586G>C	ENST00000261881.4	-	6	561				Y_RNA_ENST00000411339.1_RNA|SCARNA14_ENST00000516903.1_RNA|TIPIN_ENST00000367709.4_Intron	NM_017858.2	NP_060328	Q9BVW5	TIPIN_HUMAN	TIMELESS interacting protein						cell cycle phase transition (GO:0044770)|DNA replication checkpoint (GO:0000076)|intra-S DNA damage checkpoint (GO:0031573)|mitotic nuclear division (GO:0007067)|positive regulation of cell proliferation (GO:0008284)|regulation of nuclear cell cycle DNA replication (GO:0033262)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)				autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	7						TAACTATACAGACCCTGTCGG	0.378																																																	0													40.0	35.0	36.0					15																	66639586		876	1991	2867	SO:0001627	intron_variant	692149			BK001386	CCDS10215.1	15q22.31	2012-03-02	2006-08-08		ENSG00000075131	ENSG00000075131			30750	protein-coding gene	gene with protein product	"""CSM3 homolog (S. cerevisiae)"""	610716				12875843, 17102137	Standard	NM_017858		Approved	FLJ20516	uc002apr.2	Q9BVW5	OTTHUMG00000133188	ENST00000261881.4:c.475+1811C>G	15.37:g.66639586G>C			B2CW64|Q9NWZ6	RNA	SNP	-	NULL	ENST00000261881.4	37	NULL	CCDS10215.1	15																																																																																			SCARNA14	-	-		0.378	TIPIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCARNA14	HGNC	protein_coding	OTTHUMT00000256897.2	G	NM_017858		66639586	-1	no_errors	ENST00000516903	ensembl	human	known	70_37	rna	SNP	1.000	C
SCML4	256380	genome.wustl.edu	37	6	108066240	108066240	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr6:108066240C>T	ENST00000369020.3	-	5	840	c.595G>A	c.(595-597)Gat>Aat	p.D199N	SCML4_ENST00000369022.2_Missense_Mutation_p.D141N|SCML4_ENST00000479803.1_5'Flank|SCML4_ENST00000369021.3_Missense_Mutation_p.D170N	NM_198081.3	NP_932347.2	Q8N228	SCML4_HUMAN	sex comb on midleg-like 4 (Drosophila)	199					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(1)	25		all_cancers(87;3.26e-06)|Acute lymphoblastic leukemia(125;3.08e-08)|all_hematologic(75;1.15e-06)|all_epithelial(87;0.00142)|Colorectal(196;0.0316)		BRCA - Breast invasive adenocarcinoma(108;0.01)|Epithelial(106;0.0509)|all cancers(137;0.0586)|OV - Ovarian serous cystadenocarcinoma(136;0.0758)		AAGAGGTCATCGCACAGGAGG	0.592																																																	0													76.0	65.0	69.0					6																	108066240		2203	4300	6503	SO:0001583	missense	256380				CCDS5060.2, CCDS69163.1, CCDS75500.1	6q21	2013-01-10			ENSG00000146285	ENSG00000146285		"""Sterile alpha motif (SAM) domain containing"""	21397	protein-coding gene	gene with protein product							Standard	NM_001286409		Approved	dJ47M23.1	uc010kdf.3	Q8N228	OTTHUMG00000015313	ENST00000369020.3:c.595G>A	6.37:g.108066240C>T	ENSP00000358016:p.Asp199Asn		B0QZ10|B0QZ11|B7ZBX3|Q5JXD0|Q5T0T6|Q8IYY6	Missense_Mutation	SNP	pfam_DUF3588	p.D170N	ENST00000369020.3	37	c.508	CCDS5060.2	6	.	.	.	.	.	.	.	.	.	.	C	32	5.110379	0.94292	.	.	ENSG00000146285	ENST00000369022;ENST00000369020;ENST00000369021;ENST00000440927	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	5.38	5.38	0.77491	.	0.256395	0.44902	D	0.000414	T	0.57095	0.2030	M	0.64567	1.98	0.58432	D	0.999997	D;D;D	0.76494	0.999;0.998;0.999	D;D;P	0.70016	0.937;0.967;0.875	T	0.57213	-0.7850	10	0.62326	D	0.03	.	19.3333	0.94303	0.0:1.0:0.0:0.0	.	199;199;170	B4E0X3;Q8N228;Q8N228-3	.;SCML4_HUMAN;.	N	141;199;170;170	ENSP00000358018:D141N;ENSP00000358016:D199N;ENSP00000358017:D170N;ENSP00000404688:D170N	ENSP00000358016:D199N	D	-	1	0	SCML4	108172933	1.000000	0.71417	0.993000	0.49108	0.604000	0.37047	7.320000	0.79064	2.793000	0.96121	0.655000	0.94253	GAT	SCML4	-	pfam_DUF3588		0.592	SCML4-005	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	SCML4	HGNC	protein_coding	OTTHUMT00000041700.3	C	XM_171128		108066240	-1	no_errors	ENST00000369021	ensembl	human	known	70_37	missense	SNP	1.000	T
SCO1	6341	genome.wustl.edu	37	17	10600725	10600725	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr17:10600725C>T	ENST00000255390.5	-	1	160	c.100G>A	c.(100-102)Gag>Aag	p.E34K	SCO1_ENST00000582053.1_Intron|ADPRM_ENST00000379774.4_5'Flank|SCO1_ENST00000577427.1_Missense_Mutation_p.E34K	NM_004589.2	NP_004580.1	O75880	SCO1_HUMAN	SCO1 cytochrome c oxidase assembly protein	34					cellular copper ion homeostasis (GO:0006878)|copper ion transport (GO:0006825)|generation of precursor metabolites and energy (GO:0006091)|respiratory chain complex IV assembly (GO:0008535)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|myofibril (GO:0030016)	copper ion binding (GO:0005507)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|urinary_tract(1)	10						GCAGTCCCCTCGGCTGGGCCC	0.672																																					Melanoma(128;591 1731 19711 31891 44645)												0													12.0	13.0	12.0					17																	10600725		2197	4286	6483	SO:0001583	missense	6341			AF026852	CCDS11158.1	17p13.1	2012-10-15	2012-10-15		ENSG00000133028	ENSG00000133028		"""Mitochondrial respiratory chain complex assembly factors"""	10603	protein-coding gene	gene with protein product		603644	"""SCO (cytochrome oxidase deficient, yeast) homolog 1"", ""SCO cytochrome oxidase deficient homolog 1 (yeast)"""	SCOD1		9878253	Standard	NM_004589		Approved		uc002gmr.4	O75880	OTTHUMG00000130364	ENST00000255390.5:c.100G>A	17.37:g.10600725C>T	ENSP00000255390:p.Glu34Lys		B2RDM0	Missense_Mutation	SNP	pfam_SCO1/SenC,pfam_AhpC/TSA,superfamily_Thioredoxin-like_fold,pirsf_Synth_of_cyt-c-oxidase_Sco1/2	p.E34K	ENST00000255390.5	37	c.100	CCDS11158.1	17	.	.	.	.	.	.	.	.	.	.	C	13.96	2.393707	0.42410	.	.	ENSG00000133028	ENST00000255390;ENST00000396047	D	0.84800	-1.9	4.12	-0.292	0.12839	.	1.927050	0.01846	N	0.035634	T	0.70622	0.3245	N	0.12182	0.205	0.09310	N	1	B;B	0.11235	0.004;0.002	B;B	0.06405	0.002;0.001	T	0.60037	-0.7341	10	0.07813	T	0.8	-2.4052	7.627	0.28218	0.0:0.4066:0.4973:0.0962	.	34;34	A8MY34;O75880	.;SCO1_HUMAN	K	34	ENSP00000255390:E34K	ENSP00000255390:E34K	E	-	1	0	SCO1	10541450	0.000000	0.05858	0.000000	0.03702	0.066000	0.16364	-0.634000	0.05477	0.012000	0.14892	-0.165000	0.13383	GAG	SCO1	-	pirsf_Synth_of_cyt-c-oxidase_Sco1/2		0.672	SCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCO1	HGNC	protein_coding	OTTHUMT00000252729.2	C	NM_004589		10600725	-1	no_errors	ENST00000255390	ensembl	human	known	70_37	missense	SNP	0.000	T
SEMA6D	80031	genome.wustl.edu	37	15	48056979	48056979	+	Missense_Mutation	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr15:48056979G>C	ENST00000316364.5	+	12	1681	c.1242G>C	c.(1240-1242)aaG>aaC	p.K414N	SEMA6D_ENST00000536845.2_Missense_Mutation_p.K414N|SEMA6D_ENST00000389433.2_Missense_Mutation_p.K414N|SEMA6D_ENST00000389428.3_Missense_Mutation_p.K414N|SEMA6D_ENST00000389425.3_Missense_Mutation_p.K414N|SEMA6D_ENST00000558816.1_Missense_Mutation_p.K414N|SEMA6D_ENST00000558014.1_Missense_Mutation_p.K414N|SEMA6D_ENST00000358066.4_Missense_Mutation_p.K414N|SEMA6D_ENST00000355997.3_Missense_Mutation_p.K414N|SEMA6D_ENST00000537942.1_Missense_Mutation_p.K414N|SEMA6D_ENST00000354744.4_Missense_Mutation_p.K414N|SEMA6D_ENST00000389432.2_Missense_Mutation_p.K414N	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	414	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		GGTTCACAAAGACTCGGGTCA	0.522																																																	0													77.0	72.0	74.0					15																	48056979		2198	4297	6495	SO:0001583	missense	80031			AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.1242G>C	15.37:g.48056979G>C	ENSP00000324857:p.Lys414Asn		A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,pfscan_Semaphorin/CD100_Ag	p.K414N	ENST00000316364.5	37	c.1242	CCDS32225.1	15	.	.	.	.	.	.	.	.	.	.	G	15.20	2.763972	0.49574	.	.	ENSG00000137872	ENST00000537942;ENST00000536845;ENST00000316364;ENST00000389433;ENST00000389432;ENST00000354744;ENST00000358066;ENST00000389428;ENST00000355997;ENST00000389425	T;T;T;T;T;T;T;T;T;T	0.12255	2.7;2.7;2.7;2.7;2.7;2.7;2.7;2.7;2.7;2.7	5.59	3.73	0.42828	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.27098	0.0664	L	0.53780	1.695	0.80722	D	1	P;B;P;D;P	0.67145	0.544;0.099;0.544;0.996;0.544	B;B;B;D;B	0.74023	0.236;0.058;0.236;0.982;0.236	T	0.00992	-1.1488	10	0.54805	T	0.06	.	6.9825	0.24711	0.3781:0.0:0.6219:0.0	.	414;414;414;414;414	Q8NFY4-3;A6NM95;Q8NFY4-4;Q8NFY4;Q8NFY4-2	.;.;.;SEM6D_HUMAN;.	N	414	ENSP00000442040:K414N;ENSP00000446152:K414N;ENSP00000324857:K414N;ENSP00000374084:K414N;ENSP00000374083:K414N;ENSP00000346786:K414N;ENSP00000350770:K414N;ENSP00000374079:K414N;ENSP00000348276:K414N;ENSP00000374076:K414N	ENSP00000324857:K414N	K	+	3	2	SEMA6D	45844271	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.462000	0.45049	0.726000	0.32339	0.655000	0.94253	AAG	SEMA6D	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag		0.522	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SEMA6D	HGNC	protein_coding	OTTHUMT00000416868.1	G	NM_024966		48056979	+1	no_errors	ENST00000316364	ensembl	human	known	70_37	missense	SNP	1.000	C
SLC16A3	9123	genome.wustl.edu	37	17	80195168	80195168	+	Silent	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr17:80195168C>T	ENST00000581287.1	+	3	2844	c.522C>T	c.(520-522)taC>taT	p.Y174Y	SLC16A3_ENST00000582743.1_Silent_p.Y174Y|SLC16A3_ENST00000392339.1_Silent_p.Y174Y|SLC16A3_ENST00000392341.1_Silent_p.Y174Y	NM_001206951.1|NM_001206952.1	NP_001193880.1|NP_001193881.1	O15427	MOT4_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 3	174					blood coagulation (GO:0007596)|cellular metabolic process (GO:0044237)|leukocyte migration (GO:0050900)|monocarboxylic acid transport (GO:0015718)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|poly(A) RNA binding (GO:0044822)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9	Breast(20;0.00285)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.227)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0149)		Gamma Hydroxybutyric Acid(DB01440)|Niacin(DB00627)|Pyruvic acid(DB00119)	AGGACCGCTACGGCTGGCGGG	0.711																																					Pancreas(52;652 1135 19190 37282 52456)												0													6.0	6.0	6.0					17																	80195168		2121	4174	6295	SO:0001819	synonymous_variant	9123			U81800	CCDS11804.1	17q25.3	2013-07-18	2013-07-18		ENSG00000141526	ENSG00000141526		"""Solute carriers"""	10924	protein-coding gene	gene with protein product		603877	"""solute carrier family 16 (monocarboxylic acid transporters), member 3"", ""solute carrier family 16, member 3 (monocarboxylic acid transporter 4)"""			9425115	Standard	NM_004207		Approved	MCT3, MCT4	uc021ufm.1	O15427	OTTHUMG00000178832	ENST00000581287.1:c.522C>T	17.37:g.80195168C>T			B3KXG8|Q2M1P8	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	p.Y174	ENST00000581287.1	37	c.522	CCDS11804.1	17																																																																																			SLC16A3	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt		0.711	SLC16A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A3	HGNC	protein_coding	OTTHUMT00000443498.1	C	NM_004207		80195168	+1	no_errors	ENST00000392339	ensembl	human	known	70_37	silent	SNP	0.214	T
SLC16A3	9123	genome.wustl.edu	37	17	80195570	80195570	+	Silent	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr17:80195570G>A	ENST00000581287.1	+	3	3246	c.924G>A	c.(922-924)gcG>gcA	p.A308A	SLC16A3_ENST00000582743.1_Silent_p.A308A|SLC16A3_ENST00000392339.1_Silent_p.A308A|SLC16A3_ENST00000392341.1_Silent_p.A308A	NM_001206951.1|NM_001206952.1	NP_001193880.1|NP_001193881.1	O15427	MOT4_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 3	308					blood coagulation (GO:0007596)|cellular metabolic process (GO:0044237)|leukocyte migration (GO:0050900)|monocarboxylic acid transport (GO:0015718)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|poly(A) RNA binding (GO:0044822)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9	Breast(20;0.00285)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.227)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0149)		Gamma Hydroxybutyric Acid(DB01440)|Niacin(DB00627)|Pyruvic acid(DB00119)	ACGGCCTCGCGGACCTGGCGG	0.662																																					Pancreas(52;652 1135 19190 37282 52456)												0													54.0	56.0	55.0					17																	80195570		2202	4299	6501	SO:0001819	synonymous_variant	9123			U81800	CCDS11804.1	17q25.3	2013-07-18	2013-07-18		ENSG00000141526	ENSG00000141526		"""Solute carriers"""	10924	protein-coding gene	gene with protein product		603877	"""solute carrier family 16 (monocarboxylic acid transporters), member 3"", ""solute carrier family 16, member 3 (monocarboxylic acid transporter 4)"""			9425115	Standard	NM_004207		Approved	MCT3, MCT4	uc021ufm.1	O15427	OTTHUMG00000178832	ENST00000581287.1:c.924G>A	17.37:g.80195570G>A			B3KXG8|Q2M1P8	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	p.A308	ENST00000581287.1	37	c.924	CCDS11804.1	17																																																																																			SLC16A3	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt		0.662	SLC16A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A3	HGNC	protein_coding	OTTHUMT00000443498.1	G	NM_004207		80195570	+1	no_errors	ENST00000392339	ensembl	human	known	70_37	silent	SNP	0.051	A
SLC18A3	6572	genome.wustl.edu	37	10	50819456	50819456	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr10:50819456G>A	ENST00000374115.3	+	1	1110	c.670G>A	c.(670-672)Gga>Aga	p.G224R	CHAT_ENST00000339797.1_Intron|CHAT_ENST00000337653.2_5'Flank|CHAT_ENST00000395559.2_5'Flank|CHAT_ENST00000351556.3_5'Flank|CHAT_ENST00000395562.2_5'Flank	NM_003055.2	NP_003046.2	Q16572	VACHT_HUMAN	solute carrier family 18 (vesicular acetylcholine transporter), member 3	224					acetylcholine transport (GO:0015870)|cation transmembrane transport (GO:0098655)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)			endometrium(6)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	43						CATTAGCTTCGGAAGCCTAGT	0.642																																																	0													23.0	29.0	27.0					10																	50819456		2203	4300	6503	SO:0001583	missense	6572			BC007765	CCDS7231.1	10q11.2	2013-07-18	2013-07-18		ENSG00000187714	ENSG00000187714		"""Solute carriers"""	10936	protein-coding gene	gene with protein product		600336				8071310	Standard	NM_003055		Approved	VACHT	uc001jhw.3	Q16572	OTTHUMG00000018196	ENST00000374115.3:c.670G>A	10.37:g.50819456G>A	ENSP00000363229:p.Gly224Arg		B2R7S1	Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.G224R	ENST00000374115.3	37	c.670	CCDS7231.1	10	.	.	.	.	.	.	.	.	.	.	G	28.6	4.935374	0.92458	.	.	ENSG00000187714	ENST00000374115	T	0.77877	-1.13	5.27	5.27	0.74061	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.64402	U	0.000002	D	0.91751	0.7391	H	0.94582	3.555	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93912	0.7198	10	0.87932	D	0	-0.5111	18.8783	0.92347	0.0:0.0:1.0:0.0	.	224	Q16572	VACHT_HUMAN	R	224	ENSP00000363229:G224R	ENSP00000363229:G224R	G	+	1	0	SLC18A3	50489462	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	9.620000	0.98373	2.464000	0.83262	0.561000	0.74099	GGA	SLC18A3	-	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.642	SLC18A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC18A3	HGNC	protein_coding	OTTHUMT00000047995.1	G	NM_003055		50819456	+1	no_errors	ENST00000374115	ensembl	human	known	70_37	missense	SNP	1.000	A
SLC26A10	65012	genome.wustl.edu	37	12	58019078	58019078	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr12:58019078G>A	ENST00000320442.4	+	12	1749	c.1438G>A	c.(1438-1440)Gct>Act	p.A480T	SLC26A10_ENST00000379218.2_3'UTR|SLC26A10_ENST00000490243.1_3'UTR	NM_133489.2	NP_597996.2	Q8NG04	S2610_HUMAN	solute carrier family 26, member 10	480	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.					integral component of membrane (GO:0016021)	antiporter activity (GO:0015297)|sulfate transmembrane transporter activity (GO:0015116)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)	19	Melanoma(17;0.122)					TGCAGATGCTGCTGGGGCCAG	0.547																																																	0													200.0	186.0	191.0					12																	58019078		2203	4300	6503	SO:0001583	missense	65012				CCDS8949.2	12q13	2013-07-18			ENSG00000135502	ENSG00000135502		"""Solute carriers"""	14470	protein-coding gene	gene with protein product							Standard	NM_133489		Approved		uc001spe.3	Q8NG04	OTTHUMG00000128505	ENST00000320442.4:c.1438G>A	12.37:g.58019078G>A	ENSP00000320217:p.Ala480Thr		A6NMJ2|B6ZDQ3|Q6ZWI7	Missense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom	p.A480T	ENST00000320442.4	37	c.1438	CCDS8949.2	12	.	.	.	.	.	.	.	.	.	.	.	17.55	3.418484	0.62622	.	.	ENSG00000135502	ENST00000320442	D	0.88046	-2.33	4.4	2.48	0.30137	Sulphate transporter/antisigma-factor antagonist STAS (4);	.	.	.	.	D	0.86900	0.6044	L	0.42529	1.33	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.82230	-0.0560	9	0.08599	T	0.76	.	6.6838	0.23134	0.0989:0.0:0.7196:0.1815	.	480	Q8NG04	S2610_HUMAN	T	480	ENSP00000320217:A480T	ENSP00000320217:A480T	A	+	1	0	SLC26A10	56305345	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.718000	0.54919	1.147000	0.42369	0.655000	0.94253	GCT	SLC26A10	-	pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom		0.547	SLC26A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A10	HGNC	protein_coding	OTTHUMT00000250311.2	G			58019078	+1	no_errors	ENST00000320442	ensembl	human	known	70_37	missense	SNP	1.000	A
SLC30A1	7779	genome.wustl.edu	37	1	211748962	211748962	+	Missense_Mutation	SNP	A	A	G			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:211748962A>G	ENST00000367001.4	-	2	1421	c.1292T>C	c.(1291-1293)gTt>gCt	p.V431A		NM_021194.2	NP_067017.2	Q9Y6M5	ZNT1_HUMAN	solute carrier family 30 (zinc transporter), member 1	431					cadmium ion transmembrane transport (GO:0070574)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|cellular zinc ion homeostasis (GO:0006882)|detoxification of cadmium ion (GO:0071585)|in utero embryonic development (GO:0001701)|negative regulation of calcium ion import (GO:0090281)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of zinc ion transmembrane import (GO:0071584)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	calcium channel inhibitor activity (GO:0019855)|zinc ion transmembrane transporter activity (GO:0005385)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(3)|prostate(1)	11				OV - Ovarian serous cystadenocarcinoma(81;0.00535)|GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.0604)|Epithelial(68;0.0978)		TTCACACGGAACTACACTTGA	0.458																																																	0													105.0	97.0	100.0					1																	211748962		2203	4300	6503	SO:0001583	missense	7779			AF323590	CCDS1499.1	1q32.3	2013-05-22			ENSG00000170385	ENSG00000170385		"""Solute carriers"""	11012	protein-coding gene	gene with protein product		609521		ZNT1			Standard	NM_021194		Approved	ZRC1	uc001hio.1	Q9Y6M5	OTTHUMG00000036995	ENST00000367001.4:c.1292T>C	1.37:g.211748962A>G	ENSP00000355968:p.Val431Ala		Q0VAK9|Q9BZF6	Missense_Mutation	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.V431A	ENST00000367001.4	37	c.1292	CCDS1499.1	1	.	.	.	.	.	.	.	.	.	.	A	0.027	-1.361930	0.01235	.	.	ENSG00000170385	ENST00000367001	T	0.62232	0.04	5.51	0.373	0.16178	.	0.307407	0.34986	N	0.003525	T	0.31167	0.0788	N	0.08118	0	0.25152	N	0.990413	B	0.02656	0.0	B	0.01281	0.0	T	0.18493	-1.0335	10	0.08837	T	0.75	-4.5749	6.2033	0.20587	0.2537:0.3875:0.3588:0.0	.	431	Q9Y6M5	ZNT1_HUMAN	A	431	ENSP00000355968:V431A	ENSP00000355968:V431A	V	-	2	0	SLC30A1	209815585	1.000000	0.71417	0.336000	0.25522	0.658000	0.38924	3.411000	0.52672	0.065000	0.16485	-0.418000	0.06021	GTT	SLC30A1	-	NULL		0.458	SLC30A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A1	HGNC	protein_coding	OTTHUMT00000104738.2	A			211748962	-1	no_errors	ENST00000367001	ensembl	human	known	70_37	missense	SNP	0.784	G
SLC4A4	8671	genome.wustl.edu	37	4	72363244	72363245	+	Frame_Shift_Ins	INS	-	-	T	rs202188375		TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr4:72363244_72363245insT	ENST00000264485.5	+	16	2118_2119	c.2001_2002insT	c.(2002-2004)tttfs	p.F668fs	SLC4A4_ENST00000351898.6_Frame_Shift_Ins_p.F668fs|SLC4A4_ENST00000340595.3_Frame_Shift_Ins_p.F624fs|SLC4A4_ENST00000425175.1_Frame_Shift_Ins_p.F668fs	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	668					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	TTGACTGGGCATTTTTGTCGAA	0.356																																																	0																																										SO:0001589	frameshift_variant	8671			AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.2006dupT	4.37:g.72363249_72363249dupT	ENSP00000264485:p.Phe668fs		C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Frame_Shift_Ins	INS	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.L668fs	ENST00000264485.5	37	c.2001_2002	CCDS43236.1	4																																																																																			SLC4A4	-	pfam_HCO3_transpt_C,tigrfam_HCO3_transpt_euk		0.356	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A4	HGNC	protein_coding	OTTHUMT00000362090.1	-	NM_003759		72363245	+1	no_errors	ENST00000425175	ensembl	human	known	70_37	frame_shift_ins	INS	0.007:0.005	T
SLC39A8	64116	genome.wustl.edu	37	4	103180638	103180638	+	IGR	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr4:103180638G>C	ENST00000394833.2	-	0	3238				SLC39A8_ENST00000424970.2_Missense_Mutation_p.Q434E	NM_001135148.1|NM_022154.5	NP_001128620.1|NP_071437.3	Q9C0K1	S39A8_HUMAN	solute carrier family 39 (zinc transporter), member 8						transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|organelle membrane (GO:0031090)|plasma membrane (GO:0005886)	metal ion transmembrane transporter activity (GO:0046873)			large_intestine(1)|lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Hepatocellular(203;0.217)		all cancers(1;9.78e-10)|OV - Ovarian serous cystadenocarcinoma(123;1.52e-09)|GBM - Glioblastoma multiforme(1;0.000142)		AAATGAAGTTGAGATTTGATG	0.333																																																	0													212.0	174.0	185.0					4																	103180638		692	1591	2283	SO:0001628	intergenic_variant	64116				CCDS3656.1, CCDS47117.1	4q22-q24	2013-05-22			ENSG00000138821	ENSG00000138821		"""Solute carriers"""	20862	protein-coding gene	gene with protein product		608732	"""solute carrier family 39 (metal ion transporter), member 8"""			12504855, 12659941	Standard	NM_001135146		Approved	BIGM103	uc003hwc.2	Q9C0K1	OTTHUMG00000131120		4.37:g.103180638G>C			B4E2H3|Q96SM9|Q9BVC0|Q9NSA4	Missense_Mutation	SNP	pfam_ZIP	p.Q434E	ENST00000394833.2	37	c.1300	CCDS3656.1	4	.	.	.	.	.	.	.	.	.	.	G	5.953	0.359753	0.11239	.	.	ENSG00000138821	ENST00000424970	T	0.68479	-0.33	2.29	-1.83	0.07833	.	.	.	.	.	T	0.44180	0.1281	.	.	.	0.09310	N	1	B	0.12630	0.006	B	0.09377	0.004	T	0.17048	-1.0382	8	0.29301	T	0.29	.	3.8453	0.08933	0.2716:0.3978:0.3306:0.0	.	434	B4E2H3	.	E	434	ENSP00000394548:Q434E	ENSP00000394548:Q434E	Q	-	1	0	SLC39A8	103399661	0.001000	0.12720	0.010000	0.14722	0.069000	0.16628	-1.169000	0.03120	-0.585000	0.05905	-0.676000	0.03789	CAA	SLC39A8	-	NULL		0.333	SLC39A8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC39A8	HGNC	protein_coding	OTTHUMT00000253798.1	G	NM_022154		103180638	-1	no_errors	ENST00000424970	ensembl	human	known	70_37	missense	SNP	0.015	C
SLC9C1	285335	genome.wustl.edu	37	3	111901081	111901081	+	Missense_Mutation	SNP	C	C	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr3:111901081C>A	ENST00000305815.5	-	21	2800	c.2548G>T	c.(2548-2550)Gtg>Ttg	p.V850L	SLC9C1_ENST00000487372.1_Missense_Mutation_p.V802L	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	850					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										GAATCAAGCACCTCTTTCTTT	0.333																																																	0													81.0	89.0	86.0					3																	111901081		2203	4299	6502	SO:0001583	missense	285335			AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.2548G>T	3.37:g.111901081C>A	ENSP00000306627:p.Val850Leu		Q6ZRP4|Q7RTP2	Missense_Mutation	SNP	pfam_Cation/H_exchanger,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom	p.V850L	ENST00000305815.5	37	c.2548	CCDS33817.1	3	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.389603	0.00200	.	.	ENSG00000172139	ENST00000305815;ENST00000487372	T;T	0.75050	-0.9;-0.88	5.81	-8.02	0.01118	.	0.901085	0.09556	N	0.786269	T	0.37019	0.0988	N	0.04090	-0.28	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.40776	-0.9545	10	0.02654	T	1	.	4.0012	0.09580	0.0931:0.5049:0.1702:0.2317	.	802;850	Q4G0N8-2;Q4G0N8	.;S9A10_HUMAN	L	850;802	ENSP00000306627:V850L;ENSP00000420688:V802L	ENSP00000306627:V850L	V	-	1	0	SLC9A10	113383771	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.184000	0.03076	-2.115000	0.00831	-1.854000	0.00565	GTG	SLC9C1	-	NULL		0.333	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9C1	HGNC	protein_coding	OTTHUMT00000354066.1	C	NM_183061		111901081	-1	no_errors	ENST00000305815	ensembl	human	known	70_37	missense	SNP	0.000	A
SPATA31E1	286234	genome.wustl.edu	37	9	90503153	90503153	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr9:90503153C>T	ENST00000325643.5	+	4	3817	c.3751C>T	c.(3751-3753)Cag>Tag	p.Q1251*		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	1251					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CAACCAGCTTCAGCTGGAGAA	0.557																																																	0													68.0	67.0	68.0					9																	90503153		2203	4300	6503	SO:0001587	stop_gained	286234			AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.3751C>T	9.37:g.90503153C>T	ENSP00000322640:p.Gln1251*		B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Nonsense_Mutation	SNP	NULL	p.Q1251*	ENST00000325643.5	37	c.3751	CCDS6676.1	9	.	.	.	.	.	.	.	.	.	.	c	36	5.771337	0.96922	.	.	ENSG00000177992	ENST00000325643	.	.	.	2.27	-2.86	0.05717	.	1.771760	0.03731	N	0.253453	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	.	7.1784	0.25757	0.0:0.3181:0.0:0.6819	.	.	.	.	X	1251	.	ENSP00000322640:Q1251X	Q	+	1	0	C9orf79	89692973	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.440000	0.02412	-0.811000	0.04369	-0.136000	0.14681	CAG	SPATA31E1	-	NULL		0.557	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31E1	HGNC	protein_coding	OTTHUMT00000052954.2	C	NM_178828		90503153	+1	no_errors	ENST00000325643	ensembl	human	known	70_37	nonsense	SNP	0.000	T
SPRY1	10252	genome.wustl.edu	37	4	124323415	124323415	+	Missense_Mutation	SNP	C	C	G			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr4:124323415C>G	ENST00000394339.2	+	2	1009	c.669C>G	c.(667-669)tgC>tgG	p.C223W	SPRY1_ENST00000339241.1_Missense_Mutation_p.C223W	NM_001258039.1|NM_005841.2	NP_001244968.1|NP_005832.1	O43609	SPY1_HUMAN	sprouty homolog 1, antagonist of FGF signaling (Drosophila)	223	Cys-rich.|SPR. {ECO:0000255|PROSITE- ProRule:PRU00572}.				epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				NS(1)|large_intestine(4)|lung(2)|ovary(1)|skin(3)	11						CCTGCATGTGCTTAGTCAAGG	0.507																																																	0													256.0	212.0	227.0					4																	124323415		2203	4300	6503	SO:0001583	missense	10252			AF041037	CCDS3731.1	4q	2009-04-17	2001-11-28		ENSG00000164056	ENSG00000164056			11269	protein-coding gene	gene with protein product		602465	"""sprouty (Drosophila) homolog 1 (antagonist of FGF signaling)"""			9458049, 15962011	Standard	NM_001258038		Approved	hSPRY1	uc003ifa.4	O43609	OTTHUMG00000133071	ENST00000394339.2:c.669C>G	4.37:g.124323415C>G	ENSP00000377871:p.Cys223Trp		D3DNX6|Q6PNE0	Missense_Mutation	SNP	pfam_Sprouty	p.C223W	ENST00000394339.2	37	c.669	CCDS3731.1	4	.	.	.	.	.	.	.	.	.	.	C	14.80	2.642906	0.47153	.	.	ENSG00000164056	ENST00000339241;ENST00000394339	T;T	0.63744	-0.06;-0.06	5.06	3.28	0.37604	.	0.000000	0.85682	D	0.000000	T	0.67850	0.2937	L	0.43646	1.37	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.63800	-0.6555	9	.	.	.	-13.2995	8.0708	0.30689	0.0:0.7423:0.0:0.2577	.	223	O43609	SPY1_HUMAN	W	223	ENSP00000343785:C223W;ENSP00000377871:C223W	.	C	+	3	2	SPRY1	124542865	0.998000	0.40836	0.980000	0.43619	0.998000	0.95712	1.346000	0.33964	0.668000	0.31126	0.561000	0.74099	TGC	SPRY1	-	pfam_Sprouty		0.507	SPRY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRY1	HGNC	protein_coding	OTTHUMT00000256711.1	C			124323415	+1	no_errors	ENST00000339241	ensembl	human	known	70_37	missense	SNP	1.000	G
SPRY3	10251	genome.wustl.edu	37	X	155003588	155003588	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chrX:155003588C>T	ENST00000302805.2	+	2	486	c.55C>T	c.(55-57)Cgc>Tgc	p.R19C		NM_005840.1	NP_005831.1	O43610	SPY3_HUMAN	sprouty homolog 3 (Drosophila)	19					multicellular organismal development (GO:0007275)|regulation of signal transduction (GO:0009966)	cytoplasm (GO:0005737)|membrane (GO:0016020)						all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TGAACAGCTGCGCTCTACTCA	0.488																																																	0													216.0	211.0	213.0					X																	155003588		2203	4296	6499	SO:0001583	missense	10251			AF041038	CCDS14769.4	Xq28 and Yq12	2008-02-05	2001-11-28		ENSG00000168939	ENSG00000168939		"""Pseudoautosomal regions / PAR2"""	11271	protein-coding gene	gene with protein product	"""antagonist of FGF signaling"""	300531	"""sprouty (Drosophila) homolog 2"""			9458049	Standard	NM_005840		Approved	HSPRY3	uc004fnq.1	O43610	OTTHUMG00000022675	ENST00000302805.2:c.55C>T	X.37:g.155003588C>T	ENSP00000302978:p.Arg19Cys		A8K0H8	Missense_Mutation	SNP	pfam_Sprouty	p.R19C	ENST00000302805.2	37	c.55	CCDS14769.4	X	.	.	.	.	.	.	.	.	.	.	C	10.22	1.290273	0.23478	.	.	ENSG00000168939	ENST00000302805;ENST00000369437	T	0.59906	0.23	3.14	2.25	0.28309	.	0.071232	0.53938	D	0.000043	T	0.42539	0.1207	.	.	.	0.18873	N	0.999987	B;B	0.21905	0.062;0.004	B;B	0.11329	0.006;0.001	T	0.43343	-0.9397	9	0.87932	D	0	-16.6501	7.3007	0.26418	0.0:0.8512:0.0:0.1488	.	19;19	Q6ZUP3;O43610	.;SPY3_HUMAN	C	19	ENSP00000302978:R19C	ENSP00000302978:R19C	R	+	1	0	SPRY3	154656782	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	1.575000	0.36493	1.593000	0.50029	0.279000	0.19357	CGC	SPRY3	-	NULL		0.488	SPRY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRY3	HGNC	protein_coding	OTTHUMT00000058823.2	C	NM_005840		155003588	+1	no_errors	ENST00000302805	ensembl	human	known	70_37	missense	SNP	1.000	T
STAT5A	6776	genome.wustl.edu	37	17	40441935	40441935	+	Silent	SNP	C	C	G			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr17:40441935C>G	ENST00000345506.4	+	4	822	c.180C>G	c.(178-180)ctC>ctG	p.L60L	STAT5A_ENST00000452307.2_Silent_p.L60L|STAT5A_ENST00000546010.2_Silent_p.L60L|STAT5A_ENST00000588868.1_Silent_p.L60L|STAT5A_ENST00000590949.1_Silent_p.L60L	NM_003152.3	NP_003143.2	P42229	STA5A_HUMAN	signal transducer and activator of transcription 5A	60					2-oxoglutarate metabolic process (GO:0006103)|allantoin metabolic process (GO:0000255)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|luteinization (GO:0001553)|mammary gland epithelium development (GO:0061180)|natural killer cell differentiation (GO:0001779)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of mast cell apoptotic process (GO:0033026)|oxaloacetate metabolic process (GO:0006107)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mast cell differentiation (GO:0060376)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin signaling pathway (GO:0038161)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription, DNA-templated (GO:0006351)|valine metabolic process (GO:0006573)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	calcium ion binding (GO:0005509)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	14		all_cancers(22;1.56e-06)|all_epithelial(22;3.17e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.128)		CCACCCAGCTCCTGGAGGGCC	0.597																																																	0													38.0	34.0	35.0					17																	40441935		2203	4300	6503	SO:0001819	synonymous_variant	6776			U43185	CCDS11424.1, CCDS74066.1, CCDS74067.1	17q11.2	2013-02-14			ENSG00000126561	ENSG00000126561		"""SH2 domain containing"""	11366	protein-coding gene	gene with protein product		601511		STAT5		7719937, 8631883	Standard	NM_003152		Approved	MGF	uc002hzj.2	P42229	OTTHUMG00000150725	ENST00000345506.4:c.180C>G	17.37:g.40441935C>G			Q1KLZ6	Silent	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,smart_SH2,pfscan_SH2	p.L60	ENST00000345506.4	37	c.180	CCDS11424.1	17																																																																																			STAT5A	-	pfam_STAT_TF_prot_interaction,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction		0.597	STAT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAT5A	HGNC	protein_coding	OTTHUMT00000319804.1	C	NM_003152		40441935	+1	no_errors	ENST00000345506	ensembl	human	known	70_37	silent	SNP	1.000	G
SYBU	55638	genome.wustl.edu	37	8	110587517	110587517	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr8:110587517G>A	ENST00000422135.1	-	8	2125	c.1610C>T	c.(1609-1611)tCt>tTt	p.S537F	SYBU_ENST00000446070.2_Missense_Mutation_p.S536F|SYBU_ENST00000529175.1_Missense_Mutation_p.S331F|SYBU_ENST00000529690.1_Missense_Mutation_p.S407F|SYBU_ENST00000440310.1_Missense_Mutation_p.S537F|SYBU_ENST00000399066.3_Missense_Mutation_p.S534F|SYBU_ENST00000532779.1_Missense_Mutation_p.S469F|SYBU_ENST00000408889.3_Missense_Mutation_p.S418F|SYBU_ENST00000533171.1_Missense_Mutation_p.S537F|SYBU_ENST00000419099.1_Missense_Mutation_p.S536F|SYBU_ENST00000424158.2_Missense_Mutation_p.S542F|SYBU_ENST00000276646.9_Missense_Mutation_p.S537F|SYBU_ENST00000528647.1_Missense_Mutation_p.S536F|SYBU_ENST00000527707.1_5'Flank|SYBU_ENST00000533065.1_Missense_Mutation_p.S418F|SYBU_ENST00000533895.1_Missense_Mutation_p.S536F|SYBU_ENST00000408908.2_Missense_Mutation_p.S537F|SYBU_ENST00000528331.1_Missense_Mutation_p.S418F|SYBU_ENST00000433638.1_Missense_Mutation_p.S537F	NM_001099744.1	NP_001093214.1	Q9NX95	SYBU_HUMAN	syntabulin (syntaxin-interacting)	537					regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|dense body (GO:0097433)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	30						CACTAAGGCAGAGAGGGACTC	0.542																																																	0													64.0	67.0	66.0					8																	110587517		1917	4130	6047	SO:0001583	missense	55638			AB040905	CCDS43763.1, CCDS43764.1, CCDS47912.1, CCDS55271.1	8q23.2	2010-08-27				ENSG00000147642			26011	protein-coding gene	gene with protein product	"""syntaphilin-like"""	611568				17611281, 16750881, 16157705, 15656992, 15459722	Standard	NM_001099743		Approved	FLJ20366, GOLSYN, KIAA1472, OCSYN, SNPHL	uc003ynj.4	Q9NX95		ENST00000422135.1:c.1610C>T	8.37:g.110587517G>A	ENSP00000407118:p.Ser537Phe		A8K354|B3KQX3|B3KU61|Q5R1T1|Q5R1T2|Q5R1T3|Q5Y2M6|Q8ND49|Q8TCR6|Q96D80|Q9P256	Missense_Mutation	SNP	NULL	p.S537F	ENST00000422135.1	37	c.1610	CCDS47912.1	8	.	.	.	.	.	.	.	.	.	.	G	13.57	2.277728	0.40294	.	.	ENSG00000147642	ENST00000533895;ENST00000424158;ENST00000532779;ENST00000399066;ENST00000446070;ENST00000528331;ENST00000529175;ENST00000276646;ENST00000528647;ENST00000422135;ENST00000419099;ENST00000433638;ENST00000408908;ENST00000440310;ENST00000408889;ENST00000533065;ENST00000529690;ENST00000533171	.	.	.	5.44	5.44	0.79542	.	0.529393	0.20368	N	0.093716	T	0.71517	0.3349	M	0.66939	2.045	0.29615	N	0.846646	D;P;P;D;D	0.76494	0.998;0.955;0.473;0.998;0.999	D;P;B;D;D	0.68943	0.93;0.804;0.19;0.93;0.961	T	0.68788	-0.5316	9	0.87932	D	0	-5.5917	18.4396	0.90660	0.0:0.0:1.0:0.0	.	407;469;536;537;534	B7Z4D2;Q9NX95-2;Q9NX95-3;Q9NX95;Q9NX95-4	.;.;.;SYBU_HUMAN;.	F	536;542;469;534;536;418;331;537;536;537;536;537;537;537;418;418;407;537	.	ENSP00000276646:S537F	S	-	2	0	SYBU	110656693	0.776000	0.28616	0.116000	0.21606	0.693000	0.40251	4.294000	0.59043	2.837000	0.97791	0.655000	0.94253	TCT	SYBU	-	NULL		0.542	SYBU-204	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYBU	HGNC	protein_coding	OTTHUMT00000385501.1	G	NM_017786		110587517	-1	no_errors	ENST00000276646	ensembl	human	known	70_37	missense	SNP	0.401	A
SYCP2	10388	genome.wustl.edu	37	20	58443602	58443602	+	Missense_Mutation	SNP	C	C	T	rs148819194		TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr20:58443602C>T	ENST00000357552.3	-	38	4079	c.3854G>A	c.(3853-3855)cGc>cAc	p.R1285H	SYCP2_ENST00000371001.2_Missense_Mutation_p.R1285H			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	1285					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			TATTCTTTTGCGACTAAGATG	0.323													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16400	0.0		0.0	False		,,,				2504	0.0																0								C	HIS/ARG	4,4402	8.1+/-20.4	0,4,2199	83.0	81.0	82.0		3854	-0.2	0.1	20	dbSNP_134	82	1,8597	1.2+/-3.3	0,1,4298	no	missense	SYCP2	NM_014258.2	29	0,5,6497	TT,TC,CC		0.0116,0.0908,0.0384	possibly-damaging	1285/1531	58443602	5,12999	2203	4299	6502	SO:0001583	missense	10388			Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.3854G>A	20.37:g.58443602C>T	ENSP00000350162:p.Arg1285His		A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	NULL	p.R1285H	ENST00000357552.3	37	c.3854	CCDS13482.1	20	.	.	.	.	.	.	.	.	.	.	C	13.43	2.235471	0.39498	9.08E-4	1.16E-4	ENSG00000196074	ENST00000371001;ENST00000357552	T;T	0.14893	2.47;2.47	5.77	-0.153	0.13403	.	0.717774	0.13323	N	0.396549	T	0.11495	0.0280	L	0.40543	1.245	0.09310	N	1	B	0.21381	0.055	B	0.16722	0.016	T	0.25117	-1.0141	10	0.48119	T	0.1	2.7894	3.6838	0.08320	0.4088:0.3109:0.0:0.2803	.	1285	Q9BX26	SYCP2_HUMAN	H	1285	ENSP00000360040:R1285H;ENSP00000350162:R1285H	ENSP00000350162:R1285H	R	-	2	0	SYCP2	57876997	0.442000	0.25633	0.147000	0.22382	0.511000	0.34104	0.162000	0.16501	0.070000	0.16634	0.591000	0.81541	CGC	SYCP2	-	NULL		0.323	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2	HGNC	protein_coding	OTTHUMT00000079930.3	C	NM_014258		58443602	-1	no_errors	ENST00000357552	ensembl	human	known	70_37	missense	SNP	0.055	T
SYNE1	23345	genome.wustl.edu	37	6	152552684	152552684	+	Missense_Mutation	SNP	T	T	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr6:152552684T>A	ENST00000367255.5	-	114	21482	c.20881A>T	c.(20881-20883)Aac>Tac	p.N6961Y	SYNE1_ENST00000341594.5_Missense_Mutation_p.N6573Y|SYNE1_ENST00000448038.1_Missense_Mutation_p.N6890Y|SYNE1_ENST00000356820.4_Missense_Mutation_p.N1485Y|SYNE1_ENST00000265368.4_Missense_Mutation_p.N6961Y|SYNE1_ENST00000423061.1_Missense_Mutation_p.N6890Y	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6961					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGTTTACAGTTAATGTCTATC	0.358										HNSCC(10;0.0054)																																							0													70.0	64.0	66.0					6																	152552684		2203	4300	6503	SO:0001583	missense	23345			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.20881A>T	6.37:g.152552684T>A	ENSP00000356224:p.Asn6961Tyr		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.N6961Y	ENST00000367255.5	37	c.20881	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	T	19.31	3.802204	0.70682	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.54675	0.65;0.64;0.56;0.64;0.75;2.65	6.03	4.85	0.62838	.	0.000000	0.64402	D	0.000002	T	0.61223	0.2330	M	0.71581	2.175	0.46849	D	0.999223	D;D;D	0.76494	0.997;0.997;0.999	P;P;D	0.67725	0.898;0.898;0.953	T	0.67624	-0.5623	10	0.72032	D	0.01	.	13.3646	0.60676	0.0:0.0:0.1316:0.8684	.	6961;6961;6890	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	Y	6961;6890;6961;6890;6573;1485	ENSP00000356224:N6961Y;ENSP00000396024:N6890Y;ENSP00000265368:N6961Y;ENSP00000390975:N6890Y;ENSP00000341887:N6573Y;ENSP00000349276:N1485Y	ENSP00000265368:N6961Y	N	-	1	0	SYNE1	152594377	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.168000	0.64978	1.061000	0.40601	0.533000	0.62120	AAC	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_Spectrin/alpha-actinin		0.358	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	T	NM_182961		152552684	-1	no_errors	ENST00000265368	ensembl	human	known	70_37	missense	SNP	1.000	A
SYNPO2L	79933	genome.wustl.edu	37	10	75407373	75407373	+	Silent	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr10:75407373G>C	ENST00000394810.2	-	4	2186	c.2037C>G	c.(2035-2037)ctC>ctG	p.L679L	SYNPO2L_ENST00000372873.4_Silent_p.L455L	NM_001114133.1	NP_001107605.1	Q9H987	SYP2L_HUMAN	synaptopodin 2-like	679	Pro-rich.					cytoskeleton (GO:0005856)|nucleus (GO:0005634)|Z disc (GO:0030018)				breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Prostate(51;0.0112)					CTTCAGCCCCGAGGCTCAGAG	0.597																																																	0													74.0	85.0	81.0					10																	75407373		2203	4300	6503	SO:0001819	synonymous_variant	79933			AK022983	CCDS7331.1, CCDS44438.1	10q22.3	2007-12-19			ENSG00000166317	ENSG00000166317			23532	protein-coding gene	gene with protein product							Standard	XM_005270158		Approved	FLJ12921	uc001jut.4	Q9H987	OTTHUMG00000018471	ENST00000394810.2:c.2037C>G	10.37:g.75407373G>C			A5PKV9|Q68A20	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L679	ENST00000394810.2	37	c.2037	CCDS44438.1	10																																																																																			SYNPO2L	-	NULL		0.597	SYNPO2L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNPO2L	HGNC	protein_coding	OTTHUMT00000316562.2	G	NM_024875		75407373	-1	no_errors	ENST00000394810	ensembl	human	known	70_37	silent	SNP	0.959	C
SYT8	90019	genome.wustl.edu	37	11	1852698	1852698	+	5'Flank	SNP	C	C	G			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr11:1852698C>G	ENST00000381968.3	+	0	0				SYT8_ENST00000436964.2_Intron|SYT8_ENST00000535046.1_Missense_Mutation_p.P6A	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII						acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CTCTTCCAAGCCAGGCAGCCC	0.692																																																	0																																										SO:0001631	upstream_gene_variant	90019			AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026		11.37:g.1852698C>G	Exception_encountered		A6NFJ4|Q9NSV9	Missense_Mutation	SNP	NULL	p.P6A	ENST00000381968.3	37	c.16	CCDS7726.2	11	.	.	.	.	.	.	.	.	.	.	c	12.15	1.851958	0.32699	.	.	ENSG00000149043	ENST00000535046	T	0.25085	1.82	2.56	-2.11	0.07187	.	.	.	.	.	T	0.18841	0.0452	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.34254	-0.9836	6	0.87932	D	0	.	0.3589	0.00361	0.2038:0.3245:0.2005:0.2712	.	.	.	.	A	6	ENSP00000443325:P6A	ENSP00000443325:P6A	P	+	1	0	SYT8	1809274	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.125000	0.03257	-0.504000	0.06577	-0.671000	0.03813	CCA	SYT8	-	NULL		0.692	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYT8	HGNC	protein_coding	OTTHUMT00000025013.4	C			1852698	+1	no_errors	ENST00000535046	ensembl	human	known	70_37	missense	SNP	0.000	G
TARSL2	123283	genome.wustl.edu	37	15	102215848	102215848	+	Silent	SNP	C	C	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr15:102215848C>A	ENST00000335968.3	-	13	1959	c.1743G>T	c.(1741-1743)ccG>ccT	p.P581P		NM_152334.2	NP_689547.2	A2RTX5	SYTC2_HUMAN	threonyl-tRNA synthetase-like 2	581					threonyl-tRNA aminoacylation (GO:0006435)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(14)|ovary(2)|skin(1)|urinary_tract(1)	29	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GGAAGTTTTCCGGCCTTGTTG	0.408																																																	0													146.0	139.0	141.0					15																	102215848		2203	4300	6503	SO:0001819	synonymous_variant	123283			AL833188	CCDS10394.1	15q26.3	2008-02-05			ENSG00000185418	ENSG00000185418			24728	protein-coding gene	gene with protein product							Standard	NM_152334		Approved	FLJ25005	uc002bxm.3	A2RTX5	OTTHUMG00000149869	ENST00000335968.3:c.1743G>T	15.37:g.102215848C>A			B2RMP7|Q6B0A1|Q6IS76|Q96LW3|Q96MP4	Silent	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_TGS,pfam_tRNA_SAD,superfamily_Thr/Ala-tRNA-synth_IIc_edit,superfamily_Anticodon-bd,superfamily_TGS-like,smart_tRNA_SAD,pfscan_aa-tRNA-synth_II,prints_Thr-tRNA-ligase_IIa,tigrfam_Thr-tRNA-ligase_IIa	p.P581	ENST00000335968.3	37	c.1743	CCDS10394.1	15																																																																																			TARSL2	-	pfam_aa-tRNA-synt_IIb_cons-dom,pfscan_aa-tRNA-synth_II,tigrfam_Thr-tRNA-ligase_IIa		0.408	TARSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARSL2	HGNC	protein_coding	OTTHUMT00000313619.3	C	NM_152334		102215848	-1	no_errors	ENST00000335968	ensembl	human	known	70_37	silent	SNP	0.910	A
TEDDM1	127670	genome.wustl.edu	37	1	182369123	182369123	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr1:182369123C>T	ENST00000367565.1	-	1	628	c.498G>A	c.(496-498)atG>atA	p.M166I		NM_172000.3	NP_741997.3	Q5T9Z0	TEDM1_HUMAN	transmembrane epididymal protein 1	166						integral component of membrane (GO:0016021)				haematopoietic_and_lymphoid_tissue(1)|lung(4)|ovary(2)	7						AGGAGCCCATCATCAGAATCA	0.517																																																	0													73.0	75.0	74.0					1																	182369123		2203	4300	6503	SO:0001583	missense	127670			AJ515384	CCDS30953.1	1q25.3	2009-09-17		2005-08-09	ENSG00000203730	ENSG00000203730			30233	protein-coding gene	gene with protein product	"""putative membrane protein HE9"", ""transmembrane protein 45C"", ""epididymal protein 9"""						Standard	NM_172000		Approved	HE9, Epdd1, TMEM45C, EDDM9	uc001gpe.3	Q5T9Z0	OTTHUMG00000037398	ENST00000367565.1:c.498G>A	1.37:g.182369123C>T	ENSP00000356536:p.Met166Ile		Q8IVJ0	Missense_Mutation	SNP	pfam_DUF716_TMEM45	p.M166I	ENST00000367565.1	37	c.498	CCDS30953.1	1	.	.	.	.	.	.	.	.	.	.	c	6.544	0.468551	0.12461	.	.	ENSG00000203730	ENST00000367565	T	0.40756	1.02	4.92	-4.14	0.03892	.	1.343820	0.04646	N	0.406104	T	0.32645	0.0836	L	0.39898	1.24	0.09310	N	1	B	0.14012	0.009	B	0.15052	0.012	T	0.24870	-1.0148	10	0.28530	T	0.3	-10.9514	9.9629	0.41708	0.1082:0.1774:0.639:0.0754	.	166	Q5T9Z0	TEDM1_HUMAN	I	166	ENSP00000356536:M166I	ENSP00000356536:M166I	M	-	3	0	TEDDM1	180635746	0.209000	0.23505	0.004000	0.12327	0.519000	0.34347	-0.565000	0.05929	-1.080000	0.03109	-0.215000	0.12644	ATG	TEDDM1	-	pfam_DUF716_TMEM45		0.517	TEDDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEDDM1	HGNC	protein_coding	OTTHUMT00000091029.1	C	NM_172000		182369123	-1	no_errors	ENST00000367565	ensembl	human	known	70_37	missense	SNP	0.002	T
THSD7A	221981	genome.wustl.edu	37	7	11630259	11630259	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr7:11630259C>T	ENST00000423059.4	-	4	1532	c.1281G>A	c.(1279-1281)tgG>tgA	p.W427*		NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	427	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		CTGTAGTTCTCCAGCCATACC	0.488										HNSCC(18;0.044)																																							0													27.0	31.0	30.0					7																	11630259		1999	4183	6182	SO:0001587	stop_gained	221981				CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.1281G>A	7.37:g.11630259C>T	ENSP00000406482:p.Trp427*			Nonsense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.W427*	ENST00000423059.4	37	c.1281	CCDS47543.1	7	.	.	.	.	.	.	.	.	.	.	C	42	9.345157	0.99143	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	.	.	.	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.5407	0.99260	0.0:1.0:0.0:0.0	.	.	.	.	X	427	.	ENSP00000262042:W427X	W	-	3	0	THSD7A	11596784	1.000000	0.71417	0.999000	0.59377	0.847000	0.48162	7.818000	0.86416	2.865000	0.98341	0.655000	0.94253	TGG	THSD7A	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.488	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THSD7A	HGNC	protein_coding	OTTHUMT00000325944.4	C	XM_928187.2		11630259	-1	no_errors	ENST00000423059	ensembl	human	known	70_37	nonsense	SNP	1.000	T
TLE4	7091	genome.wustl.edu	37	9	82323513	82323513	+	Missense_Mutation	SNP	A	A	G			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr9:82323513A>G	ENST00000376552.2	+	13	2093	c.1075A>G	c.(1075-1077)Agc>Ggc	p.S359G	TLE4_ENST00000376537.4_Missense_Mutation_p.S391G|TLE4_ENST00000265284.6_Missense_Mutation_p.S334G|TLE4_ENST00000376534.4_5'UTR|TLE4_ENST00000376520.4_Missense_Mutation_p.S391G|TLE4_ENST00000376544.3_Missense_Mutation_p.S290G	NM_007005.3	NP_008936.2	Q04727	TLE4_HUMAN	transducin-like enhancer of split 4	359					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						TGCAGCCTCAAGCCTAAGGAC	0.463																																																	0																																										SO:0001583	missense	7091			M99439	CCDS43837.1, CCDS65069.1, CCDS65070.1, CCDS75851.1	9q21.32	2014-03-07	2014-03-07		ENSG00000106829	ENSG00000106829		"""WD repeat domain containing"""	11840	protein-coding gene	gene with protein product		605132	"""transducin-like enhancer of split 4, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005252167		Approved	E(spI), ESG, GRG4	uc004alc.3	Q04727	OTTHUMG00000020072	ENST00000376552.2:c.1075A>G	9.37:g.82323513A>G	ENSP00000365735:p.Ser359Gly		F8W6T6|Q3ZCS1|Q5T1Y2|Q6PCB3|Q9BZ07|Q9BZ08|Q9BZ09|Q9NSL3|Q9ULF9	Missense_Mutation	SNP	pfam_Groucho/TLE_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Groucho_enhance	p.S391G	ENST00000376552.2	37	c.1171	CCDS43837.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	8.376|8.376	0.836399|0.836399	0.16891|0.16891	.|.	.|.	ENSG00000106829|ENSG00000106829	ENST00000496114|ENST00000376552;ENST00000376544;ENST00000376520;ENST00000376537;ENST00000265284;ENST00000490347;ENST00000467142	.|T;T;T;T;T;T;T	.|0.43294	.|0.96;0.95;1.03;1.03;1.09;2.03;1.72	6.16|6.16	5.04|5.04	0.67666|0.67666	.|.	.|0.082902	.|0.85682	.|D	.|0.000000	T|T	0.09512|0.09512	0.0234|0.0234	N|N	0.00538|0.00538	-1.39|-1.39	0.80722|0.80722	D|D	1|1	.|B;B;B;B	.|0.02656	.|0.0;0.0;0.0;0.0	.|B;B;B;B	.|0.04013	.|0.0;0.001;0.0;0.0	T|T	0.36866|0.36866	-0.9730|-0.9730	5|10	.|0.02654	.|T	.|1	-24.0296|-24.0296	3.5276|3.5276	0.07765|0.07765	0.7031:0.0:0.2969:0.0|0.7031:0.0:0.2969:0.0	.|.	.|334;290;391;359	.|F8W6T6;Q04727-2;Q04727-3;Q04727	.|.;.;.;TLE4_HUMAN	R|G	149|359;290;391;391;334;178;87	.|ENSP00000365735:S359G;ENSP00000365727:S290G;ENSP00000365703:S391G;ENSP00000365720:S391G;ENSP00000265284:S334G;ENSP00000417844:S178G;ENSP00000418409:S87G	.|ENSP00000265284:S334G	K|S	+|+	2|1	0|0	TLE4|TLE4	81513333|81513333	1.000000|1.000000	0.71417|0.71417	0.974000|0.974000	0.42286|0.42286	0.986000|0.986000	0.74619|0.74619	6.533000|6.533000	0.73829|0.73829	2.367000|2.367000	0.80283|0.80283	0.528000|0.528000	0.53228|0.53228	AAG|AGC	TLE4	-	NULL		0.463	TLE4-008	KNOWN	basic|appris_principal|CCDS	protein_coding	TLE4	HGNC	protein_coding	OTTHUMT00000052792.4	A	XM_212237		82323513	+1	no_errors	ENST00000376520	ensembl	human	known	70_37	missense	SNP	1.000	G
TM9SF3	56889	genome.wustl.edu	37	10	98303715	98303715	+	Intron	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr10:98303715G>A	ENST00000371142.4	-	9	1402				TM9SF3_ENST00000490192.1_5'UTR	NM_020123.3	NP_064508.3	Q9HD45	TM9S3_HUMAN	transmembrane 9 superfamily member 3							integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(2)|prostate(1)	15		Colorectal(252;0.158)		Epithelial(162;1.84e-09)|all cancers(201;2.84e-08)		TTCCAGGACTGAGTATGAACT	0.318																																																	0																																										SO:0001627	intron_variant	56889			AF160213, AF269150	CCDS7450.1	10q24.2	2006-04-12			ENSG00000077147	ENSG00000077147			21529	protein-coding gene	gene with protein product						11530251, 11595169	Standard	NM_020123		Approved	SMBP	uc001kmm.4	Q9HD45	OTTHUMG00000018834	ENST00000371142.4:c.1185+117C>T	10.37:g.98303715G>A			Q5TB57|Q6UWE7|Q9NWL8|Q9P0G9|Q9UHW8	RNA	SNP	-	NULL	ENST00000371142.4	37	NULL	CCDS7450.1	10																																																																																			TM9SF3	-	-		0.318	TM9SF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM9SF3	HGNC	protein_coding	OTTHUMT00000049610.2	G	NM_020123		98303715	-1	no_errors	ENST00000490192	ensembl	human	known	70_37	rna	SNP	0.000	A
TMEM102	284114	genome.wustl.edu	37	17	7339258	7339258	+	Missense_Mutation	SNP	T	T	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr17:7339258T>A	ENST00000323206.1	+	2	341	c.68T>A	c.(67-69)cTc>cAc	p.L23H	TMEM102_ENST00000396568.1_Missense_Mutation_p.L23H|RP11-104H15.7_ENST00000575310.1_RNA|FGF11_ENST00000575235.1_5'Flank|RP11-104H15.9_ENST00000570444.1_RNA	NM_178518.2	NP_848613.1	Q8N9M5	TM102_HUMAN	transmembrane protein 102	23					apoptotic process (GO:0006915)|positive regulation of cell adhesion (GO:0045785)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T cell migration (GO:2000406)|regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901028)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to cytokine (GO:0034097)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|protein complex (GO:0043234)				kidney(1)|lung(3)|skin(1)	5		Prostate(122;0.173)				GCTCGGCCGCTCACGGACATC	0.687																																																	0													26.0	36.0	33.0					17																	7339258		2174	4272	6446	SO:0001583	missense	284114			AK094197	CCDS11104.1	17p13.1	2008-04-21			ENSG00000181284	ENSG00000181284			26722	protein-coding gene	gene with protein product		613936				12477932	Standard	NM_178518		Approved	FLJ36878	uc002ggx.1	Q8N9M5	OTTHUMG00000132901	ENST00000323206.1:c.68T>A	17.37:g.7339258T>A	ENSP00000315387:p.Leu23His		D3DTP8	Missense_Mutation	SNP	NULL	p.L23H	ENST00000323206.1	37	c.68	CCDS11104.1	17	.	.	.	.	.	.	.	.	.	.	T	24.8	4.570001	0.86542	.	.	ENSG00000181284	ENST00000323206;ENST00000396568	T;T	0.52526	0.66;0.66	5.53	5.53	0.82687	.	0.000000	0.47093	D	0.000252	T	0.66218	0.2767	M	0.65975	2.015	0.45822	D	0.998692	D	0.89917	1.0	D	0.80764	0.994	T	0.69781	-0.5052	10	0.87932	D	0	-3.2723	13.6199	0.62130	0.0:0.0:0.0:1.0	.	23	Q8N9M5	TM102_HUMAN	H	23	ENSP00000315387:L23H;ENSP00000379815:L23H	ENSP00000315387:L23H	L	+	2	0	TMEM102	7279982	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	3.852000	0.55934	2.108000	0.64289	0.533000	0.62120	CTC	TMEM102	-	NULL		0.687	TMEM102-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM102	HGNC	protein_coding	OTTHUMT00000256405.1	T	NM_178518		7339258	+1	no_errors	ENST00000323206	ensembl	human	known	70_37	missense	SNP	1.000	A
TMEM132C	92293	genome.wustl.edu	37	12	129189821	129189821	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr12:129189821C>T	ENST00000435159.2	+	9	2308	c.2308C>T	c.(2308-2310)Cga>Tga	p.R770*	TMEM132C_ENST00000315208.8_Nonsense_Mutation_p.R386*|TMEM132C_ENST00000537538.1_Nonsense_Mutation_p.R155*	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	770						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						CCCACTGATCCGAGTGGACAT	0.642																																																	0													24.0	29.0	27.0					12																	129189821		692	1591	2283	SO:0001587	stop_gained	92293			AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.2308C>T	12.37:g.129189821C>T	ENSP00000410852:p.Arg770*		Q69YX8	Nonsense_Mutation	SNP	NULL	p.R770*	ENST00000435159.2	37	c.2308		12	.	.	.	.	.	.	.	.	.	.	C	37	6.414742	0.97546	.	.	ENSG00000181234	ENST00000435159;ENST00000315208;ENST00000537538	.	.	.	4.84	3.86	0.44501	.	0.121402	0.33875	N	0.004469	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.0737	0.42347	0.4706:0.5294:0.0:0.0	.	.	.	.	X	770;386;155	.	ENSP00000324458:R386X	R	+	1	2	TMEM132C	127755774	0.818000	0.29161	0.940000	0.37924	0.559000	0.35586	2.102000	0.41796	2.230000	0.72887	0.655000	0.94253	CGA	TMEM132C	-	NULL		0.642	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	TMEM132C	HGNC	protein_coding		C	XM_044062		129189821	+1	no_errors	ENST00000435159	ensembl	human	known	70_37	nonsense	SNP	0.991	T
TNFAIP2	7127	genome.wustl.edu	37	14	103592960	103592960	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr14:103592960C>T	ENST00000560869.1	+	2	805	c.166C>T	c.(166-168)Cag>Tag	p.Q56*	TNFAIP2_ENST00000333007.1_Nonsense_Mutation_p.Q56*|TNFAIP2_ENST00000451723.2_5'Flank			Q03169	TNAP2_HUMAN	tumor necrosis factor, alpha-induced protein 2	56					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|exocytosis (GO:0006887)	exocyst (GO:0000145)|extracellular space (GO:0005615)				NS(1)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	11		Melanoma(154;0.155)	Epithelial(46;0.191)			GAAGAAGGGTCAGCCCAGCTC	0.607																																																	0													15.0	15.0	15.0					14																	103592960		2135	4233	6368	SO:0001587	stop_gained	7127				CCDS9979.1	14q32	2011-01-31				ENSG00000185215			11895	protein-coding gene	gene with protein product	"""exocyst complex component 3-like 3"""	603300				1374453	Standard	NM_006291		Approved	B94, EXOC3L3	uc001ymm.1	Q03169		ENST00000560869.1:c.166C>T	14.37:g.103592960C>T	ENSP00000452634:p.Gln56*		Q86VI0	Nonsense_Mutation	SNP	pfam_Sec6	p.Q56*	ENST00000560869.1	37	c.166	CCDS9979.1	14	.	.	.	.	.	.	.	.	.	.	C	17.05	3.289023	0.59976	.	.	ENSG00000185215	ENST00000333007	.	.	.	4.1	3.21	0.36854	.	0.899723	0.09406	N	0.806572	.	.	.	.	.	.	0.21105	N	0.999785	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.576	7.6888	0.28557	0.0:0.8833:0.0:0.1167	.	.	.	.	X	56	.	ENSP00000332326:Q56X	Q	+	1	0	TNFAIP2	102662713	0.012000	0.17670	0.011000	0.14972	0.424000	0.31475	1.774000	0.38573	1.059000	0.40554	0.561000	0.74099	CAG	TNFAIP2	-	NULL		0.607	TNFAIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFAIP2	HGNC	protein_coding	OTTHUMT00000415674.1	C	NM_006291		103592960	+1	no_errors	ENST00000333007	ensembl	human	known	70_37	nonsense	SNP	0.010	T
TNRC18	84629	genome.wustl.edu	37	7	5417088	5417088	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr7:5417088G>A	ENST00000430969.1	-	7	2723	c.2375C>T	c.(2374-2376)tCt>tTt	p.S792F	TNRC18_ENST00000399537.4_Missense_Mutation_p.S792F	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	792							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GGGGTCGGCAGACCAGCGACC	0.706																																																	0													9.0	11.0	10.0					7																	5417088		1907	4088	5995	SO:0001583	missense	84629			U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.2375C>T	7.37:g.5417088G>A	ENSP00000395538:p.Ser792Phe		A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.S792F	ENST00000430969.1	37	c.2375	CCDS47534.1	7	.	.	.	.	.	.	.	.	.	.	G	13.50	2.257168	0.39896	.	.	ENSG00000182095	ENST00000399537;ENST00000430969;ENST00000413081	T;T	0.13657	2.57;2.57	4.86	4.86	0.63082	.	.	.	.	.	T	0.29850	0.0746	L	0.54323	1.7	0.30587	N	0.761931	D	0.71674	0.998	P	0.61940	0.896	T	0.07712	-1.0758	9	0.59425	D	0.04	.	13.6999	0.62602	0.0:0.1546:0.8454:0.0	.	792	O15417	TNC18_HUMAN	F	792;792;194	ENSP00000382452:S792F;ENSP00000395538:S792F	ENSP00000382452:S792F	S	-	2	0	TNRC18	5383614	1.000000	0.71417	0.919000	0.36401	0.776000	0.43924	7.386000	0.79775	2.231000	0.72958	0.561000	0.74099	TCT	TNRC18	-	NULL		0.706	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNRC18	HGNC	protein_coding		G			5417088	-1	no_errors	ENST00000399537	ensembl	human	known	70_37	missense	SNP	0.998	A
TNXB	7148	genome.wustl.edu	37	6	32053854	32053854	+	Missense_Mutation	SNP	G	G	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr6:32053854G>T	ENST00000375244.3	-	7	3022	c.2821C>A	c.(2821-2823)Cct>Act	p.P941T	TNXB_ENST00000375247.2_Missense_Mutation_p.P941T			P22105	TENX_HUMAN	tenascin XB	1030	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						CCTGAGGGAGGAGGCTCATCG	0.622																																																	0													8.0	10.0	9.0					6																	32053854		1201	2505	3706	SO:0001583	missense	7148			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.2821C>A	6.37:g.32053854G>T	ENSP00000364393:p.Pro941Thr		P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.P941T	ENST00000375244.3	37	c.2821		6	.	.	.	.	.	.	.	.	.	.	G	15.55	2.866281	0.51588	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.54675	0.72;0.56	3.82	3.82	0.43975	.	.	.	.	.	T	0.30792	0.0776	L	0.29908	0.895	0.26612	N	0.972823	P	0.36616	0.561	B	0.43916	0.436	T	0.14924	-1.0455	9	0.37606	T	0.19	.	11.1378	0.48386	0.0:0.0:1.0:0.0	.	941	P22105-3	.	T	941	ENSP00000364393:P941T;ENSP00000364396:P941T	ENSP00000364393:P941T	P	-	1	0	TNXB	32161832	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	4.631000	0.61304	1.980000	0.57719	0.558000	0.71614	CCT	TNXB	-	NULL		0.622	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000268927.2	G	NM_019105		32053854	-1	no_errors	ENST00000375247	ensembl	human	known	70_37	missense	SNP	1.000	T
TRERF1	55809	genome.wustl.edu	37	6	42231041	42231041	+	Intron	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr6:42231041G>A	ENST00000372922.4	-	8	2447				TRERF1_ENST00000372917.4_Intron|TRERF1_ENST00000541110.1_Missense_Mutation_p.S634F|TRERF1_ENST00000340840.2_Intron|TRERF1_ENST00000354325.2_Intron	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1						cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GTGTGGGGGAGAGAGGGTCAT	0.652																																																	0													53.0	58.0	56.0					6																	42231041		2203	4300	6503	SO:0001627	intron_variant	55809			AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.1884+16C>T	6.37:g.42231041G>A			Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Missense_Mutation	SNP	pfam_ELM2_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_SANT/Myb,pfscan_ELM2_dom,pfscan_Znf_C2H2	p.S634F	ENST00000372922.4	37	c.1901	CCDS4867.1	6	.	.	.	.	.	.	.	.	.	.	G	22.3	4.278166	0.80692	.	.	ENSG00000124496	ENST00000541110	T	0.14516	2.5	4.94	4.94	0.65067	.	.	.	.	.	T	0.30355	0.0762	.	.	.	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.04481	-1.0948	8	0.48119	T	0.1	.	18.1653	0.89723	0.0:0.0:1.0:0.0	.	634	Q05GC8	.	F	634	ENSP00000439689:S634F	ENSP00000439689:S634F	S	-	2	0	TRERF1	42339019	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.023000	0.70848	2.294000	0.77228	0.561000	0.74099	TCT	TRERF1	-	NULL		0.652	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRERF1	HGNC	protein_coding	OTTHUMT00000040551.2	G	NM_033502		42231041	-1	no_errors	ENST00000541110	ensembl	human	known	70_37	missense	SNP	1.000	A
TRIM32	22954	genome.wustl.edu	37	9	119460693	119460693	+	Missense_Mutation	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr9:119460693G>C	ENST00000450136.1	+	2	833	c.672G>C	c.(670-672)caG>caC	p.Q224H	ASTN2_ENST00000361209.2_Intron|ASTN2_ENST00000373996.3_Intron|ASTN2_ENST00000361477.3_Intron|ASTN2_ENST00000313400.4_Intron|TRIM32_ENST00000373983.2_Missense_Mutation_p.Q224H	NM_001099679.1|NM_012210.3	NP_001093149.1|NP_036342.2	Q13049	TRI32_HUMAN	tripartite motif containing 32	224					fat cell differentiation (GO:0045444)|innate immune response (GO:0045087)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of proteolysis (GO:0045862)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of type I interferon production (GO:0032479)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|striated muscle myosin thick filament (GO:0005863)	ligase activity (GO:0016874)|myosin binding (GO:0017022)|protein self-association (GO:0043621)|RNA binding (GO:0003723)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|translation initiation factor binding (GO:0031369)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	26						TAGAGGAGCAGAGTTACCTGC	0.532																																					Esophageal Squamous(92;212 1916 19711 26951)												0													75.0	68.0	70.0					9																	119460693		2203	4300	6503	SO:0001583	missense	22954			U18543	CCDS6817.1	9q33.1	2014-09-17	2011-01-25		ENSG00000119401	ENSG00000119401		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16380	protein-coding gene	gene with protein product		602290	"""limb girdle muscular dystrophy 2H (autosomal recessive)"", ""tripartite motif-containing 32"""	LGMD2H		11331580, 7778269, 16606853	Standard	NM_001099679		Approved	HT2A, TATIP, BBS11	uc004bjx.2	Q13049	OTTHUMG00000021026	ENST00000450136.1:c.672G>C	9.37:g.119460693G>C	ENSP00000408292:p.Gln224His		Q9NQP8	Missense_Mutation	SNP	pfam_NHL_repeat,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,pfscan_NHL_repeat_subgr,pfscan_Znf_B-box,pfscan_Znf_RING	p.Q224H	ENST00000450136.1	37	c.672	CCDS6817.1	9	.	.	.	.	.	.	.	.	.	.	G	13.04	2.119623	0.37436	.	.	ENSG00000119401	ENST00000450136;ENST00000373983	T;T	0.64803	-0.12;-0.12	5.36	5.36	0.76844	.	0.000000	0.64402	D	0.000001	T	0.66036	0.2749	L	0.29908	0.895	0.49051	D	0.999746	D	0.65815	0.995	D	0.74674	0.984	T	0.63708	-0.6576	9	.	.	.	-19.4755	10.695	0.45894	0.1479:0.0:0.8521:0.0	.	224	Q13049	TRI32_HUMAN	H	224	ENSP00000408292:Q224H;ENSP00000363095:Q224H	.	Q	+	3	2	TRIM32	118500514	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.723000	0.47277	2.486000	0.83907	0.655000	0.94253	CAG	TRIM32	-	NULL		0.532	TRIM32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM32	HGNC	protein_coding	OTTHUMT00000055466.2	G	NM_012210		119460693	+1	no_errors	ENST00000373983	ensembl	human	known	70_37	missense	SNP	1.000	C
TRIM37	4591	genome.wustl.edu	37	17	57134235	57134235	+	Splice_Site	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr17:57134235C>T	ENST00000262294.7	-	13	1459		c.e13+1		TRIM37_ENST00000376149.3_Splice_Site|TRIM37_ENST00000393065.2_Splice_Site|TRIM37_ENST00000393066.3_Splice_Site|RN7SL716P_ENST00000580539.1_RNA	NM_015294.3	NP_056109.1	O94972	TRI37_HUMAN	tripartite motif containing 37						aggresome assembly (GO:0070842)|negative regulation of centriole replication (GO:0046600)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autoubiquitination (GO:0051865)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisome (GO:0005777)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(13)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					TTTCCTGTTACCTTAAAATCA	0.313									Mulibrey Nanism																																								0													130.0	122.0	124.0					17																	57134235		2201	4300	6501	SO:0001630	splice_region_variant	4591	Familial Cancer Database	Perheentupa syndrome	AB020705	CCDS32694.1, CCDS45746.1	17q	2014-02-17	2011-01-25	2001-11-30		ENSG00000108395		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	7523	protein-coding gene	gene with protein product	"""RING-B-box-coiled-coil protein"""	605073	"""tripartite motif-containing 37"""	MUL		9106536, 10888877	Standard	NM_015294		Approved	KIAA0898, POB1, TEF3	uc002iwy.4	O94972		ENST00000262294.7:c.1199+1G>A	17.37:g.57134235C>T			Q7Z3E6|Q8IYF7|Q8WYF7	Splice_Site	SNP	-	e13+1	ENST00000262294.7	37	c.1199+1	CCDS32694.1	17	.	.	.	.	.	.	.	.	.	.	C	19.73	3.882759	0.72410	.	.	ENSG00000108395	ENST00000393066;ENST00000262294;ENST00000376149;ENST00000393065	.	.	.	5.56	4.59	0.56863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5037	0.67739	0.0:0.9293:0.0:0.0707	.	.	.	.	.	-1	.	.	.	-	.	.	TRIM37	54489017	1.000000	0.71417	1.000000	0.80357	0.783000	0.44284	7.814000	0.86154	1.334000	0.45468	0.591000	0.81541	.	TRIM37	-	-		0.313	TRIM37-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM37	HGNC	protein_coding	OTTHUMT00000445930.1	C	NM_015294	Intron	57134235	-1	no_errors	ENST00000262294	ensembl	human	known	70_37	splice_site	SNP	1.000	T
TRUB2	26995	genome.wustl.edu	37	9	131071960	131071960	+	Missense_Mutation	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr9:131071960G>C	ENST00000372890.4	-	8	1198	c.865C>G	c.(865-867)Cag>Gag	p.Q289E	TRUB2_ENST00000460320.1_5'Flank|TRUB2_ENST00000546104.1_Missense_Mutation_p.Q233E	NM_015679.1	NP_056494.1	O95900	TRUB2_HUMAN	TruB pseudouridine (psi) synthase family member 2	289					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			kidney(2)|large_intestine(2)|lung(3)|ovary(1)	8						GCAGCTACCTGAGGGGTAGCA	0.652																																																	0													53.0	51.0	51.0					9																	131071960		2203	4300	6503	SO:0001583	missense	26995			AK001956	CCDS6897.1	9q34.11	2014-01-28	2013-09-02		ENSG00000167112	ENSG00000167112			17170	protein-coding gene	gene with protein product		610727	"""TruB pseudouridine (psi) synthase homolog 2 (E. coli)"""			12736709	Standard	NM_015679		Approved	CLONE24922	uc004buq.1	O95900	OTTHUMG00000020741	ENST00000372890.4:c.865C>G	9.37:g.131071960G>C	ENSP00000361982:p.Gln289Glu		B7Z7G5	Missense_Mutation	SNP	pfam_PsdUridine_synth,superfamily_PsdUridine_synth_cat_dom	p.Q289E	ENST00000372890.4	37	c.865	CCDS6897.1	9	.	.	.	.	.	.	.	.	.	.	G	11.07	1.530800	0.27387	.	.	ENSG00000167112	ENST00000372890;ENST00000546104	T;T	0.16196	2.36;2.36	5.68	3.85	0.44370	Pseudouridine synthase, catalytic domain (1);	0.296736	0.29594	N	0.011707	T	0.08268	0.0206	N	0.14661	0.345	0.21184	N	0.999766	B	0.12013	0.005	B	0.11329	0.006	T	0.38436	-0.9661	10	0.02654	T	1	-20.5685	10.6271	0.45514	0.0:0.1119:0.5714:0.3167	.	289	O95900	TRUB2_HUMAN	E	289;233	ENSP00000361982:Q289E;ENSP00000438084:Q233E	ENSP00000361982:Q289E	Q	-	1	0	TRUB2	130111781	1.000000	0.71417	0.986000	0.45419	0.386000	0.30323	3.358000	0.52284	0.753000	0.32945	0.561000	0.74099	CAG	TRUB2	-	superfamily_PsdUridine_synth_cat_dom		0.652	TRUB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRUB2	HGNC	protein_coding	OTTHUMT00000054419.1	G	NM_015679		131071960	-1	no_errors	ENST00000372890	ensembl	human	known	70_37	missense	SNP	0.993	C
TRUB2	26995	genome.wustl.edu	37	9	131072039	131072039	+	Silent	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr9:131072039G>A	ENST00000372890.4	-	8	1119	c.786C>T	c.(784-786)ttC>ttT	p.F262F	TRUB2_ENST00000460320.1_5'UTR|TRUB2_ENST00000546104.1_Silent_p.F206F	NM_015679.1	NP_056494.1	O95900	TRUB2_HUMAN	TruB pseudouridine (psi) synthase family member 2	262					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			kidney(2)|large_intestine(2)|lung(3)|ovary(1)	8						CTAGCGTGAAGAAGCCGTCGC	0.582																																																	0													94.0	83.0	87.0					9																	131072039		2203	4300	6503	SO:0001819	synonymous_variant	26995			AK001956	CCDS6897.1	9q34.11	2014-01-28	2013-09-02		ENSG00000167112	ENSG00000167112			17170	protein-coding gene	gene with protein product		610727	"""TruB pseudouridine (psi) synthase homolog 2 (E. coli)"""			12736709	Standard	NM_015679		Approved	CLONE24922	uc004buq.1	O95900	OTTHUMG00000020741	ENST00000372890.4:c.786C>T	9.37:g.131072039G>A			B7Z7G5	Silent	SNP	pfam_PsdUridine_synth,superfamily_PsdUridine_synth_cat_dom	p.F262	ENST00000372890.4	37	c.786	CCDS6897.1	9																																																																																			TRUB2	-	superfamily_PsdUridine_synth_cat_dom		0.582	TRUB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRUB2	HGNC	protein_coding	OTTHUMT00000054419.1	G	NM_015679		131072039	-1	no_errors	ENST00000372890	ensembl	human	known	70_37	silent	SNP	0.985	A
TRUB2	26995	genome.wustl.edu	37	9	131073194	131073194	+	Silent	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr9:131073194G>A	ENST00000372890.4	-	7	975	c.642C>T	c.(640-642)ctC>ctT	p.L214L	TRUB2_ENST00000460320.1_5'UTR|TRUB2_ENST00000546104.1_Silent_p.L158L	NM_015679.1	NP_056494.1	O95900	TRUB2_HUMAN	TruB pseudouridine (psi) synthase family member 2	214					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			kidney(2)|large_intestine(2)|lung(3)|ovary(1)	8						GTGCAAAGTAGAGGCATCGGA	0.562																																																	0													136.0	130.0	132.0					9																	131073194		2203	4300	6503	SO:0001819	synonymous_variant	26995			AK001956	CCDS6897.1	9q34.11	2014-01-28	2013-09-02		ENSG00000167112	ENSG00000167112			17170	protein-coding gene	gene with protein product		610727	"""TruB pseudouridine (psi) synthase homolog 2 (E. coli)"""			12736709	Standard	NM_015679		Approved	CLONE24922	uc004buq.1	O95900	OTTHUMG00000020741	ENST00000372890.4:c.642C>T	9.37:g.131073194G>A			B7Z7G5	Silent	SNP	pfam_PsdUridine_synth,superfamily_PsdUridine_synth_cat_dom	p.L214	ENST00000372890.4	37	c.642	CCDS6897.1	9																																																																																			TRUB2	-	pfam_PsdUridine_synth,superfamily_PsdUridine_synth_cat_dom		0.562	TRUB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRUB2	HGNC	protein_coding	OTTHUMT00000054419.1	G	NM_015679		131073194	-1	no_errors	ENST00000372890	ensembl	human	known	70_37	silent	SNP	0.953	A
TSPAN5	10098	genome.wustl.edu	37	4	99407914	99407914	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr4:99407914C>T	ENST00000305798.3	-	3	656	c.254G>A	c.(253-255)cGg>cAg	p.R85Q	TSPAN5_ENST00000505184.1_Missense_Mutation_p.R14Q|TSPAN5_ENST00000509168.1_5'UTR	NM_005723.3	NP_005714.2	P62079	TSN5_HUMAN	tetraspanin 5	85					establishment of protein localization to plasma membrane (GO:0090002)|positive regulation of Notch signaling pathway (GO:0045747)|protein maturation (GO:0051604)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)	p.R85L(1)		kidney(2)|large_intestine(6)|lung(5)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(123;1.89e-07)		AGTGTTTTCCCGTAGCGCTCC	0.483																																																	1	Substitution - Missense(1)	lung(1)											146.0	134.0	138.0					4																	99407914		2203	4300	6503	SO:0001583	missense	10098				CCDS3646.1	4q22.3	2013-02-14	2005-03-21	2005-03-21	ENSG00000168785	ENSG00000168785		"""Tetraspanins"""	17753	protein-coding gene	gene with protein product		613136	"""transmembrane 4 superfamily member 9"""	TM4SF9			Standard	NM_005723		Approved	Tspan-5, NET-4	uc003hub.3	P62079	OTTHUMG00000131008	ENST00000305798.3:c.254G>A	4.37:g.99407914C>T	ENSP00000307701:p.Arg85Gln		B2RDY2|O60628|O60746|Q6FHE5|Q9JLY1	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.R85Q	ENST00000305798.3	37	c.254	CCDS3646.1	4	.	.	.	.	.	.	.	.	.	.	C	19.11	3.764461	0.69878	.	.	ENSG00000168785	ENST00000305798;ENST00000505184;ENST00000515287;ENST00000511651	T;T;T;T	0.80909	-1.43;-1.43;-1.43;-1.43	5.51	5.51	0.81932	Tetraspanin, conserved site (1);	0.052518	0.64402	D	0.000001	D	0.89687	0.6787	M	0.75615	2.305	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	D	0.90021	0.4128	10	0.87932	D	0	.	19.614	0.95622	0.0:1.0:0.0:0.0	.	85	P62079	TSN5_HUMAN	Q	85;14;14;14	ENSP00000307701:R85Q;ENSP00000423916:R14Q;ENSP00000423504:R14Q;ENSP00000426248:R14Q	ENSP00000307701:R85Q	R	-	2	0	TSPAN5	99626937	1.000000	0.71417	0.986000	0.45419	0.970000	0.65996	7.495000	0.81514	2.873000	0.98535	0.561000	0.74099	CGG	TSPAN5	-	pfam_Tetraspanin/Peripherin,prints_Tetraspanin		0.483	TSPAN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN5	HGNC	protein_coding	OTTHUMT00000253641.2	C	NM_005723		99407914	-1	no_errors	ENST00000305798	ensembl	human	known	70_37	missense	SNP	0.998	T
TSSC4	10078	genome.wustl.edu	37	11	2424522	2424522	+	Missense_Mutation	SNP	G	G	A	rs375904217		TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr11:2424522G>A	ENST00000333256.6	+	3	1102	c.659G>A	c.(658-660)cGa>cAa	p.R220Q	TSSC4_ENST00000380996.5_Missense_Mutation_p.R156Q|AC124057.5_ENST00000433035.1_RNA|TSSC4_ENST00000467308.1_Intron|TSSC4_ENST00000451491.2_Missense_Mutation_p.R220Q|TSSC4_ENST00000380992.1_Intron			Q9Y5U2	TSSC4_HUMAN	tumor suppressing subtransferable candidate 4	220										endometrium(3)|large_intestine(1)|lung(4)	8		all_epithelial(84;0.000161)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.0137)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.00145)|LUSC - Lung squamous cell carcinoma(625;0.19)		AAACCAGTCCGAGGGGTCGAA	0.662																																																	0								G	GLN/ARG	0,4402		0,0,2201	45.0	51.0	48.0		659	2.9	0.1	11		48	1,8597	1.2+/-3.3	0,1,4298	no	missense	TSSC4	NM_005706.2	43	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	220/330	2424522	1,12999	2201	4299	6500	SO:0001583	missense	10078			AF125568	CCDS7735.1, CCDS73241.1	11p15.5	2008-02-05			ENSG00000184281	ENSG00000184281			12386	protein-coding gene	gene with protein product		603852				10072438	Standard	XM_005252722		Approved		uc001lwl.3	Q9Y5U2	OTTHUMG00000009895	ENST00000333256.6:c.659G>A	11.37:g.2424522G>A	ENSP00000331087:p.Arg220Gln		C9JS66|Q86VL2|Q9BRS6	Missense_Mutation	SNP	NULL	p.R220Q	ENST00000333256.6	37	c.659	CCDS7735.1	11	.	.	.	.	.	.	.	.	.	.	G	12.91	2.079848	0.36662	0.0	1.16E-4	ENSG00000184281	ENST00000380996;ENST00000333256;ENST00000440813;ENST00000451491	T;T;T;T	0.28069	1.94;2.19;1.63;2.19	2.92	2.92	0.33932	.	0.293880	0.26234	U	0.025542	T	0.41880	0.1178	M	0.70595	2.14	0.09310	N	1	D;D	0.71674	0.998;0.998	P;P	0.58620	0.794;0.842	T	0.23261	-1.0193	10	0.59425	D	0.04	-6.126	4.28	0.10827	0.2799:0.0:0.7201:0.0	.	220;156	Q9Y5U2;Q9Y5U2-2	TSSC4_HUMAN;.	Q	156;220;156;220	ENSP00000370384:R156Q;ENSP00000331087:R220Q;ENSP00000416937:R156Q;ENSP00000411224:R220Q	ENSP00000331087:R220Q	R	+	2	0	TSSC4	2381098	0.015000	0.18098	0.063000	0.19743	0.219000	0.24729	1.964000	0.40462	1.966000	0.57179	0.462000	0.41574	CGA	TSSC4	-	NULL		0.662	TSSC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSSC4	HGNC	protein_coding	OTTHUMT00000027369.3	G	NM_005706		2424522	+1	no_errors	ENST00000333256	ensembl	human	known	70_37	missense	SNP	0.044	A
NDUFA13	51079	genome.wustl.edu	37	19	19625906	19625906	+	5'Flank	SNP	G	G	C			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr19:19625906G>C	ENST00000507754.4	+	0	0				CTC-260F20.3_ENST00000555938.1_5'Flank|YJEFN3_ENST00000608404.1_5'Flank|TSSK6_ENST00000585580.3_Missense_Mutation_p.Q111E|TSSK6_ENST00000360913.3_Missense_Mutation_p.Q111E|NDUFA13_ENST00000503283.1_5'Flank|NDUFA13_ENST00000252576.5_5'Flank|NDUFA13_ENST00000512771.3_5'Flank|NDUFA13_ENST00000428459.2_5'Flank			Q9P0J0	NDUAD_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13						apoptotic signaling pathway (GO:0097190)|cellular metabolic process (GO:0044237)|cellular response to interferon-beta (GO:0035458)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell growth (GO:0030308)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of peptidase activity (GO:0010952)|positive regulation of protein catabolic process (GO:0045732)|protein import into mitochondrial inner membrane (GO:0045039)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain (GO:0005746)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|NADH dehydrogenase activity (GO:0003954)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)	12						TCGCGCGCCTGAACTCCGGGG	0.642																																																	0													37.0	39.0	38.0					19																	19625906		2203	4299	6502	SO:0001631	upstream_gene_variant	83983			AF261134	CCDS12404.1, CCDS12404.2	19p13.11	2011-07-04			ENSG00000186010	ENSG00000186010		"""Mitochondrial respiratory chain complex / Complex I"""	17194	protein-coding gene	gene with protein product	"""complex I B16.6 subunit"""	609435				12837546, 10924506, 15367666	Standard	NM_015965		Approved	CGI-39, CDA016, GRIM-19, GRIM19, B16.6		Q9P0J0	OTTHUMG00000162211		19.37:g.19625906G>C	Exception_encountered		B4DF76|K7EK58|Q6PKI0|Q9H2L3|Q9Y327	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Q111E	ENST00000507754.4	37	c.331	CCDS12404.2	19	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.630151	0.00813	.	.	ENSG00000178093	ENST00000360913	T	0.62941	-0.01	4.85	4.85	0.62838	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.186126	0.25833	U	0.028007	T	0.31167	0.0788	N	0.01535	-0.81	0.27086	N	0.962963	B	0.02656	0.0	B	0.09377	0.004	T	0.05022	-1.0911	10	0.02654	T	1	.	15.4918	0.75611	0.0:0.0:1.0:0.0	.	111	Q9BXA6	TSSK6_HUMAN	E	111	ENSP00000354168:Q111E	ENSP00000354168:Q111E	Q	-	1	0	TSSK6	19486906	0.998000	0.40836	0.920000	0.36463	0.010000	0.07245	4.089000	0.57685	2.252000	0.74401	0.306000	0.20318	CAG	TSSK6	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.642	NDUFA13-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	TSSK6	HGNC	protein_coding	OTTHUMT00000367916.6	G	NM_015965		19625906	-1	no_errors	ENST00000360913	ensembl	human	known	70_37	missense	SNP	0.863	C
TTN	7273	genome.wustl.edu	37	2	179615204	179615204	+	Intron	SNP	C	C	T	rs571048846		TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr2:179615204C>T	ENST00000591111.1	-	45	10585				TTN_ENST00000589042.1_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000342992.6_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000360870.5_Missense_Mutation_p.V3975M|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TACCACGTCACTATAGGTTGA	0.338																																																	0													74.0	74.0	74.0					2																	179615204		2203	4299	6502	SO:0001627	intron_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+2646G>A	2.37:g.179615204C>T			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Titin_Z,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.V3975M	ENST00000591111.1	37	c.11923		2	.	.	.	.	.	.	.	.	.	.	C	16.91	3.252010	0.59212	.	.	ENSG00000155657	ENST00000360870	T	0.76968	-1.06	5.35	5.35	0.76521	.	.	.	.	.	D	0.89901	0.6849	M	0.91459	3.21	0.80722	D	1	D	0.76494	0.999	D	0.74023	0.982	D	0.91615	0.5306	9	0.72032	D	0.01	.	14.6895	0.69072	0.0:0.9279:0.0:0.0721	.	3975	Q8WZ42-6	.	M	3975	ENSP00000354117:V3975M	ENSP00000354117:V3975M	V	-	1	0	TTN	179323449	1.000000	0.71417	0.847000	0.33407	0.564000	0.35744	4.604000	0.61112	2.661000	0.90470	0.655000	0.94253	GTG	TTN	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.338	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	C	NM_133378		179615204	-1	no_errors	ENST00000360870	ensembl	human	known	70_37	missense	SNP	0.971	T
UQCRB	7381	genome.wustl.edu	37	8	97244130	97244130	+	Missense_Mutation	SNP	C	C	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr8:97244130C>A	ENST00000287022.5	-	3	233	c.130G>T	c.(130-132)Gta>Tta	p.V44L	UQCRB_ENST00000518406.1_Missense_Mutation_p.V44L|UQCRB_ENST00000523920.1_Missense_Mutation_p.V44L|UQCRB_ENST00000517523.1_Missense_Mutation_p.V12L	NM_001199975.2|NM_006294.4	NP_001186904.1|NP_006285.1	P14927	QCR7_HUMAN	ubiquinol-cytochrome c reductase binding protein	44					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|oxidation-reduction process (GO:0055114)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrial respiratory chain complex III (GO:0005750)				kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	10	Breast(36;5.16e-05)					GCTTCTTTTACATCTTCATCC	0.378																																																	0													104.0	96.0	99.0					8																	97244130		2203	4300	6503	SO:0001583	missense	7381			X13585	CCDS6269.1, CCDS59107.1	8q22	2011-07-04			ENSG00000156467	ENSG00000156467		"""Mitochondrial respiratory chain complex / Complex III"""	12582	protein-coding gene	gene with protein product	"""ubiquinol-cytochrome c reductase, complex III subunit VI"", ""cytochrome b-c1 complex subunit 7"""	191330		UQBP		2167087, 2543413, 3056408	Standard	NM_006294		Approved	QP-C, QCR7, UQCR6	uc022ayx.1	P14927	OTTHUMG00000164711	ENST00000287022.5:c.130G>T	8.37:g.97244130C>A	ENSP00000287022:p.Val44Leu		E5RJU0|Q6FGD1	Missense_Mutation	SNP	pfam_Cyt-d_ubiquinol_oxidase_14kDa,superfamily_Cyt-d_ubiquinol_oxidase_14kDa	p.V44L	ENST00000287022.5	37	c.130	CCDS6269.1	8	.	.	.	.	.	.	.	.	.	.	C	13.57	2.275728	0.40294	.	.	ENSG00000156467	ENST00000287022;ENST00000517523;ENST00000518406;ENST00000523920	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	5.4	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.55593	0.1930	M	0.84585	2.705	0.80722	D	1	B	0.34313	0.448	B	0.37480	0.251	T	0.62407	-0.6861	10	0.87932	D	0	-17.1962	12.6793	0.56912	0.0:0.9233:0.0:0.0767	.	44	P14927	QCR7_HUMAN	L	44;12;44;44	ENSP00000287022:V44L;ENSP00000429787:V12L;ENSP00000430494:V44L;ENSP00000430560:V44L	ENSP00000287022:V44L	V	-	1	0	UQCRB	97313306	1.000000	0.71417	0.541000	0.28102	0.321000	0.28281	5.809000	0.69172	1.297000	0.44761	-0.186000	0.12905	GTA	UQCRB	-	pfam_Cyt-d_ubiquinol_oxidase_14kDa,superfamily_Cyt-d_ubiquinol_oxidase_14kDa		0.378	UQCRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UQCRB	HGNC	protein_coding	OTTHUMT00000379863.1	C	NM_006294		97244130	-1	no_errors	ENST00000521036	ensembl	human	known	70_37	missense	SNP	1.000	A
UROC1	131669	genome.wustl.edu	37	3	126201220	126201220	+	Nonsense_Mutation	SNP	C	C	A	rs202033813		TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr3:126201220C>A	ENST00000290868.2	-	20	2052	c.1999G>T	c.(1999-2001)Gag>Tag	p.E667*	UROC1_ENST00000383579.3_Nonsense_Mutation_p.E727*	NM_144639.2	NP_653240.1	Q96N76	HUTU_HUMAN	urocanate hydratase 1	667					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	urocanate hydratase activity (GO:0016153)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(1)|skin(1)	39				GBM - Glioblastoma multiforme(114;0.17)		AGCACCCGCTCGTCCTCCACC	0.647																																																	0													62.0	48.0	53.0					3																	126201220		2203	4299	6502	SO:0001587	stop_gained	131669			AK055862	CCDS3038.1, CCDS54636.1	3q21.2	2012-08-21	2012-08-21		ENSG00000159650	ENSG00000159650	4.2.1.49		26444	protein-coding gene	gene with protein product	"""urocanase 1"""	613012	"""urocanase domain containing 1"""			19304569	Standard	NM_144639		Approved	FLJ31300, HMFN0320	uc010hsi.2	Q96N76	OTTHUMG00000162753	ENST00000290868.2:c.1999G>T	3.37:g.126201220C>A	ENSP00000290868:p.Glu667*		E9PE13|Q14C64|Q68CJ7	Nonsense_Mutation	SNP	pfam_Urocanase_dom,superfamily_Urocanase_dom,pirsf_Urocanase	p.E667*	ENST00000290868.2	37	c.1999	CCDS3038.1	3	.	.	.	.	.	.	.	.	.	.	C	18.26	3.583972	0.65992	.	.	ENSG00000159650	ENST00000290868;ENST00000383579	.	.	.	4.56	3.68	0.42216	.	0.171064	0.49916	D	0.000122	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	-8.7028	7.3131	0.26485	0.0:0.7965:0.0:0.2035	.	.	.	.	X	667;727	.	ENSP00000290868:E667X	E	-	1	0	UROC1	127683910	0.967000	0.33354	0.025000	0.17156	0.018000	0.09664	2.429000	0.44758	1.015000	0.39444	-0.339000	0.08088	GAG	UROC1	-	NULL		0.647	UROC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UROC1	HGNC	protein_coding	OTTHUMT00000370325.2	C	NM_144639		126201220	-1	no_errors	ENST00000290868	ensembl	human	known	70_37	nonsense	SNP	0.849	A
USP26	83844	genome.wustl.edu	37	X	132159937	132159937	+	Missense_Mutation	SNP	T	T	G	rs146525524	byFrequency	TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chrX:132159937T>G	ENST00000511190.1	-	6	2781	c.2312A>C	c.(2311-2313)aAc>aCc	p.N771T	USP26_ENST00000370832.1_Missense_Mutation_p.N771T|USP26_ENST00000406273.1_Missense_Mutation_p.N771T	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	771	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					TCTTAGGAGGTTCTTTGTGTG	0.453																																					NSCLC(104;342 1621 36940 47097 52632)												0								T	THR/ASN	0,3835		0,0,0,1632,571	96.0	98.0	97.0		2312	1.5	0.0	X	dbSNP_134	97	1,6727		0,0,1,2428,1871	no	missense	USP26	NM_031907.1	65	0,0,1,4060,2442	GG,GT,G,TT,T		0.0149,0.0,0.0095	benign	771/914	132159937	1,10562	2203	4300	6503	SO:0001583	missense	83844			AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.2312A>C	X.37:g.132159937T>G	ENSP00000423390:p.Asn771Thr		B9WRT6|Q5H9H4	Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.N771T	ENST00000511190.1	37	c.2312	CCDS14635.1	X	.	.	.	.	.	.	.	.	.	.	T	9.099	1.003681	0.19121	0.0	1.49E-4	ENSG00000134588	ENST00000370832;ENST00000511190;ENST00000406273	T;T;T	0.74421	-0.84;-0.84;-0.84	3.92	1.51	0.23008	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.744085	0.11534	N	0.554422	T	0.60971	0.2310	L	0.34521	1.04	0.09310	N	1	B	0.25105	0.118	B	0.32090	0.14	T	0.53464	-0.8435	10	0.48119	T	0.1	-0.7571	2.4063	0.04414	0.2114:0.2383:0.0:0.5503	.	771	Q9BXU7	UBP26_HUMAN	T	771	ENSP00000359869:N771T;ENSP00000423390:N771T;ENSP00000384360:N771T	ENSP00000359869:N771T	N	-	2	0	USP26	131987603	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.123000	0.10611	0.206000	0.20587	-0.314000	0.08810	AAC	USP26	-	pfam_Peptidase_C19,pfscan_Peptidase_C19		0.453	USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	USP26	HGNC	protein_coding	OTTHUMT00000359441.1	T	NM_031907		132159937	-1	no_errors	ENST00000370832	ensembl	human	known	70_37	missense	SNP	0.000	G
VWA2	340706	genome.wustl.edu	37	10	116048803	116048803	+	Silent	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr10:116048803C>T	ENST00000392982.3	+	12	1927	c.1677C>T	c.(1675-1677)ctC>ctT	p.L559L	VWA2_ENST00000603594.1_Silent_p.L559L			Q5GFL6	VWA2_HUMAN	von Willebrand factor A domain containing 2	559	VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				calcium-independent cell-matrix adhesion (GO:0007161)|protein homooligomerization (GO:0051260)|regulation of insulin receptor signaling pathway (GO:0046626)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)	26				Epithelial(162;0.036)|all cancers(201;0.0793)		GCTGTGCCCTCCAGTTTGAGG	0.592																																																	0													76.0	71.0	73.0					10																	116048803		2203	4300	6503	SO:0001819	synonymous_variant	340706			AK127756	CCDS7589.1, CCDS7589.2	10q25.3	2009-11-06			ENSG00000165816	ENSG00000165816			24709	protein-coding gene	gene with protein product						15580307, 14506275	Standard	NM_001272046		Approved	FLJ45857, FLJ16213, CCSP-2, AMACO, NET42	uc001lbl.2	Q5GFL6	OTTHUMG00000019082	ENST00000392982.3:c.1677C>T	10.37:g.116048803C>T			A1A5D4|B5MDJ8|Q6ZS39|Q6ZWJ7|Q708C5|Q70UZ8	Silent	SNP	pfam_VWF_A,pfam_EG-like_dom,pfam_EGF_extracell,smart_VWF_A,smart_EG-like_dom,smart_EGF-like_Ca-bd,pfscan_EG-like_dom,pfscan_VWF_A	p.L559	ENST00000392982.3	37	c.1677		10																																																																																			VWA2	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.592	VWA2-001	KNOWN	basic|appris_principal	protein_coding	VWA2	HGNC	protein_coding	OTTHUMT00000050456.3	C	NM_198496		116048803	+1	no_errors	ENST00000392982	ensembl	human	known	70_37	silent	SNP	0.253	T
WIZ	58525	genome.wustl.edu	37	19	15538983	15538983	+	Intron	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr19:15538983G>A	ENST00000389282.4	-	6	3314				WIZ_ENST00000263381.7_Intron|WIZ_ENST00000545156.1_Missense_Mutation_p.S327L|WIZ_ENST00000599686.3_Intron|WIZ_ENST00000599910.2_Missense_Mutation_p.S330L			O95785	WIZ_HUMAN	widely interspaced zinc finger motifs						positive regulation of nuclear cell cycle DNA replication (GO:0010571)|protein heterotrimerization (GO:0070208)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	24						TGCGGCGGCCGAGAGGTCCTG	0.687																																																	0																																										SO:0001627	intron_variant	58525			AK091183	CCDS42516.1	19p13.12	2012-10-05	2007-01-18		ENSG00000011451	ENSG00000011451		"""Zinc fingers, C2H2-type"""	30917	protein-coding gene	gene with protein product			"""WIZ zinc finger"""			9795207, 12226707	Standard	NM_021241		Approved	ZNF803	uc002nbb.4	O95785		ENST00000389282.4:c.3101-639C>T	19.37:g.15538983G>A			B3KVH1|B7ZM82|M0QY21|Q4G0E0|Q6P6B0|Q6ZN24|Q7LDY6|Q7LDZ1|Q96IG5|Q96SQ6|Q9BUR8|Q9NPT1	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S327L	ENST00000389282.4	37	c.980		19	.	.	.	.	.	.	.	.	.	.	G	14.29	2.490477	0.44249	.	.	ENSG00000011451	ENST00000545156	.	.	.	4.87	3.84	0.44239	.	.	.	.	.	T	0.36276	0.0961	.	.	.	0.23361	N	0.997832	.	.	.	.	.	.	T	0.18116	-1.0347	5	0.39692	T	0.17	.	6.8177	0.23839	0.0913:0.0:0.7319:0.1768	.	.	.	.	L	327	.	ENSP00000445824:S327L	S	-	2	0	WIZ	15399983	0.990000	0.36364	1.000000	0.80357	0.981000	0.71138	1.568000	0.36418	2.258000	0.74832	0.563000	0.77884	TCG	WIZ	-	NULL		0.687	WIZ-201	KNOWN	basic|appris_principal	protein_coding	WIZ	HGNC	protein_coding		G	NM_021241		15538983	-1	no_errors	ENST00000545156	ensembl	human	known	70_37	missense	SNP	0.993	A
WWOX	51741	genome.wustl.edu	37	16	78466571	78466571	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr16:78466571G>A	ENST00000566780.1	+	8	1344	c.978G>A	c.(976-978)atG>atA	p.M326I	WWOX_ENST00000408984.3_Missense_Mutation_p.M326I|WWOX_ENST00000402655.2_Intron|WWOX_ENST00000406884.2_Intron|WWOX_ENST00000539474.2_Intron	NM_016373.2	NP_057457.1	Q9NZC7	WWOX_HUMAN	WW domain containing oxidoreductase	326	Interaction with MAPT. {ECO:0000250}.				cellular response to transforming growth factor beta stimulus (GO:0071560)|extrinsic apoptotic signaling pathway (GO:0097191)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of Wnt signaling pathway (GO:0030178)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system morphogenesis (GO:0048705)|steroid metabolic process (GO:0008202)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	coenzyme binding (GO:0050662)|cofactor binding (GO:0048037)|enzyme binding (GO:0019899)|oxidoreductase activity (GO:0016491)|protein dimerization activity (GO:0046983)			large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	7		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)		CTGGAAATATGATGTACTCCA	0.547																																																	0													175.0	178.0	177.0					16																	78466571		2092	4210	6302	SO:0001583	missense	51741			AF187015	CCDS42196.1, CCDS42197.1	16q23.3-q24.1	2012-08-15	2002-01-14		ENSG00000186153	ENSG00000186153	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	12799	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 41C, member 1"""	605131	"""WW domain-containing oxidoreductase"""			10786676, 10861292, 19027726	Standard	XR_243411		Approved	FOR, WOX1, SDR41C1	uc002ffk.3	Q9NZC7	OTTHUMG00000176851	ENST00000566780.1:c.978G>A	16.37:g.78466571G>A	ENSP00000457230:p.Met326Ile		A8K323|Q5MYT5|Q96KM3|Q96RF2|Q9BTT8|Q9NPC9|Q9NRF4|Q9NRF5|Q9NRF6|Q9NRK1|Q9NZC5	Missense_Mutation	SNP	pfam_WW_Rsp5_WWP,pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP,prints_Glc/ribitol_DH	p.M326I	ENST00000566780.1	37	c.978	CCDS42196.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.1|22.1	4.238044|4.238044	0.79800|0.79800	.|.	.|.	ENSG00000186153|ENSG00000186153	ENST00000299644|ENST00000408984	.|T	.|0.18016	.|2.24	5.93|5.93	5.93|5.93	0.95920|0.95920	.|NAD(P)-binding domain (1);	.|0.085772	.|0.85682	.|N	.|0.000000	T|T	0.19725|0.19725	0.0474|0.0474	N|N	0.12853|0.12853	0.265|0.265	0.80722|0.80722	D|D	1|1	.|D	.|0.55172	.|0.97	.|P	.|0.53102	.|0.718	T|T	0.04976|0.04976	-1.0914|-1.0914	6|10	0.19147|0.26408	T|T	0.46|0.33	.|.	20.3261|20.3261	0.98701|0.98701	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|326	.|Q9NZC7	.|WWOX_HUMAN	N|I	168|326	.|ENSP00000386161:M326I	ENSP00000299644:D168N|ENSP00000386161:M326I	D|M	+|+	1|3	0|0	WWOX|WWOX	77024072|77024072	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.920000|0.920000	0.55202|0.55202	9.476000|9.476000	0.97823|0.97823	2.814000|2.814000	0.96858|0.96858	0.655000|0.655000	0.94253|0.94253	GAT|ATG	WWOX	-	prints_Glc/ribitol_DH		0.547	WWOX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	WWOX	HGNC	protein_coding	OTTHUMT00000434328.1	G			78466571	+1	no_errors	ENST00000566780	ensembl	human	known	70_37	missense	SNP	1.000	A
ZBTB33	10009	genome.wustl.edu	37	X	119388904	119388904	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chrX:119388904C>T	ENST00000326624.2	+	2	1862	c.1634C>T	c.(1633-1635)aCa>aTa	p.T545I	ZBTB33_ENST00000557385.1_Missense_Mutation_p.T545I	NM_006777.3	NP_006768.1	Q86T24	KAISO_HUMAN	zinc finger and BTB domain containing 33	545	Interaction with CTNND1. {ECO:0000250}.|Required for DNA-binding. {ECO:0000250}.				intracellular signal transduction (GO:0035556)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(2)|endometrium(6)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	26						ATTCATCACACAGGGGAGCGA	0.398																																																	0													135.0	122.0	126.0					X																	119388904		2203	4300	6503	SO:0001583	missense	10009			BC042753	CCDS14596.1	Xq23	2013-01-09			ENSG00000177485	ENSG00000177485		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16682	protein-coding gene	gene with protein product		300329					Standard	NM_001184742		Approved	ZNF-kaiso, kaiso, WUGSC:H_DJ525N14.1, KAISO, ZNF348	uc004esn.1	Q86T24	OTTHUMG00000171159	ENST00000326624.2:c.1634C>T	X.37:g.119388904C>T	ENSP00000314153:p.Thr545Ile		B2R5U6|O00319|Q7Z361|Q8IVP6|Q8N3P0	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.T545I	ENST00000326624.2	37	c.1634	CCDS14596.1	X	.	.	.	.	.	.	.	.	.	.	C	17.36	3.369321	0.61624	.	.	ENSG00000177485;ENSG00000177485;ENSG00000258974	ENST00000326624;ENST00000540105;ENST00000557385	T;T	0.25749	1.78;1.78	5.55	5.55	0.83447	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.50411	0.1614	M	0.64676	1.99	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.51779	-0.8662	10	0.87932	D	0	-12.2244	17.3434	0.87303	0.0:1.0:0.0:0.0	.	545	Q86T24	KAISO_HUMAN	I	545	ENSP00000314153:T545I;ENSP00000450969:T545I	ENSP00000314153:T545I	T	+	2	0	ZBTB33;AC002086.1	119272932	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.308000	0.77769	0.513000	0.50165	ACA	ZBTB33	-	pfscan_Znf_C2H2		0.398	ZBTB33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB33	HGNC	protein_coding	OTTHUMT00000058085.2	C	NM_006777		119388904	+1	no_errors	ENST00000326624	ensembl	human	known	70_37	missense	SNP	1.000	T
ZFPL1	7542	genome.wustl.edu	37	11	64854019	64854019	+	Missense_Mutation	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr11:64854019C>T	ENST00000294258.3	+	4	499	c.347C>T	c.(346-348)tCc>tTc	p.S116F	CDCA5_ENST00000275517.3_5'Flank|CDCA5_ENST00000404147.3_5'Flank|AP003068.6_ENST00000525544.2_5'Flank	NM_006782.3	NP_006773.2	O95159	ZFPL1_HUMAN	zinc finger protein-like 1	116					regulation of transcription, DNA-templated (GO:0006355)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	11						CCCGTGGCCTCCGCACTGAGA	0.657																																																	0													65.0	71.0	69.0					11																	64854019		2201	4297	6498	SO:0001583	missense	7542				CCDS8092.1	11q13	2013-01-08			ENSG00000162300	ENSG00000162300			12868	protein-coding gene	gene with protein product	"""zinc-finger protein in MEN1 region"""					9653652	Standard	NM_006782		Approved	D11S750, MCG4	uc001ocq.1	O95159	OTTHUMG00000165597	ENST00000294258.3:c.347C>T	11.37:g.64854019C>T	ENSP00000294258:p.Ser116Phe		A8K7E9|O14616|Q9UID0	Missense_Mutation	SNP	NULL	p.S116F	ENST00000294258.3	37	c.347	CCDS8092.1	11	.	.	.	.	.	.	.	.	.	.	C	11.69	1.713635	0.30413	.	.	ENSG00000162300	ENST00000294258;ENST00000526334;ENST00000526945;ENST00000532200	T	0.46063	0.88	5.49	4.57	0.56435	.	0.235401	0.42821	D	0.000660	T	0.32852	0.0843	L	0.38175	1.15	0.80722	D	1	P	0.39157	0.662	B	0.36845	0.234	T	0.16100	-1.0414	10	0.49607	T	0.09	-20.9878	12.4269	0.55553	0.0:0.9159:0.0:0.0841	.	116	O95159	ZFPL1_HUMAN	F	116;116;110;116	ENSP00000294258:S116F	ENSP00000294258:S116F	S	+	2	0	ZFPL1	64610595	0.942000	0.31987	0.906000	0.35671	0.050000	0.14768	3.187000	0.50950	2.578000	0.87016	0.462000	0.41574	TCC	ZFPL1	-	NULL		0.657	ZFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPL1	HGNC	protein_coding	OTTHUMT00000385196.1	C	NM_006782		64854019	+1	no_errors	ENST00000294258	ensembl	human	known	70_37	missense	SNP	0.771	T
ZKSCAN3	80317	genome.wustl.edu	37	6	28327424	28327424	+	Nonsense_Mutation	SNP	G	G	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr6:28327424G>T	ENST00000377255.3	+	3	358	c.61G>T	c.(61-63)Gag>Tag	p.E21*	ZKSCAN3_ENST00000341464.5_Intron|ZKSCAN3_ENST00000252211.2_Nonsense_Mutation_p.E21*	NM_001242894.1	NP_001229823.1	Q9BRR0	ZKSC3_HUMAN	zinc finger with KRAB and SCAN domains 3	21					autophagy (GO:0006914)|lysosome organization (GO:0007040)|negative regulation of autophagy (GO:0010507)|negative regulation of cellular senescence (GO:2000773)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(4)|large_intestine(3)|lung(8)|pancreas(1)|skin(2)|stomach(2)|urinary_tract(1)	21						AGACCAGATGGAGCTTCTGGT	0.552																																																	0													88.0	91.0	90.0					6																	28327424		2203	4300	6503	SO:0001587	stop_gained	80317			U71601	CCDS4650.1, CCDS56408.1	6p22.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000189298		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13853	protein-coding gene	gene with protein product		612791	"""zinc finger protein 306"", ""zinc finger protein 309"""	ZNF306, ZNF309		10520746, 22531714	Standard	NM_024493		Approved	Zfp47, ZF47, ZSCAN35	uc003nle.4	Q9BRR0	OTTHUMG00000014521	ENST00000377255.3:c.61G>T	6.37:g.28327424G>T	ENSP00000366465:p.Glu21*		B2R8W2|B3KVC0|H7BXX1|Q5VXH3|Q92972|Q9H4T3	Nonsense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E21*	ENST00000377255.3	37	c.61	CCDS4650.1	6	.	.	.	.	.	.	.	.	.	.	.	21.3	4.126049	0.77436	.	.	ENSG00000189298	ENST00000252211;ENST00000454413;ENST00000377255	.	.	.	3.83	-0.185	0.13276	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	3.0628	0.06205	0.4128:0.0:0.3977:0.1896	.	.	.	.	X	21	.	ENSP00000252211:E21X	E	+	1	0	ZKSCAN3	28435403	0.001000	0.12720	0.000000	0.03702	0.126000	0.20510	0.751000	0.26348	0.055000	0.16094	-0.262000	0.10625	GAG	ZKSCAN3	-	NULL		0.552	ZKSCAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN3	HGNC	protein_coding	OTTHUMT00000040189.3	G	NM_024493		28327424	+1	no_errors	ENST00000252211	ensembl	human	known	70_37	nonsense	SNP	0.000	T
ZMIZ2	83637	genome.wustl.edu	37	7	44804562	44804562	+	Silent	SNP	C	C	T			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr7:44804562C>T	ENST00000309315.4	+	15	2074	c.1951C>T	c.(1951-1953)Ctg>Ttg	p.L651L	ZMIZ2_ENST00000441627.1_Silent_p.L651L|ZMIZ2_ENST00000433667.1_Silent_p.L619L|ZMIZ2_ENST00000265346.7_Silent_p.L625L|ZMIZ2_ENST00000413916.1_Silent_p.L593L	NM_031449.3	NP_113637.3	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2	651					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						GCTGGAGGGCCTGGAGGTGGA	0.562																																					NSCLC(20;604 852 1948 16908 50522)												0													110.0	115.0	113.0					7																	44804562		2084	4252	6336	SO:0001819	synonymous_variant	83637			AK090415	CCDS43576.1, CCDS43577.1, CCDS75591.1	7p13	2009-11-06			ENSG00000122515	ENSG00000122515		"""Zinc fingers, MIZ-type"""	22229	protein-coding gene	gene with protein product		611196					Standard	XM_005249866		Approved	KIAA1886, hZIMP7, ZIMP7, DKFZp761I2123, NET27	uc003tlr.3	Q8NF64	OTTHUMG00000155817	ENST00000309315.4:c.1951C>T	7.37:g.44804562C>T			A4D2K7|D3DVL1|O94790|Q0VGB4|Q659A8|Q6JKL5|Q8WTX8|Q96Q01|Q9BQH7	Silent	SNP	pfam_Znf_MIZ,pfscan_Znf_MIZ	p.L651	ENST00000309315.4	37	c.1951	CCDS43576.1	7																																																																																			ZMIZ2	-	pfscan_Znf_MIZ		0.562	ZMIZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMIZ2	HGNC	protein_coding	OTTHUMT00000341790.1	C	NM_031449		44804562	+1	no_errors	ENST00000309315	ensembl	human	known	70_37	silent	SNP	1.000	T
ZNF225	7768	genome.wustl.edu	37	19	44635874	44635874	+	Silent	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr19:44635874G>A	ENST00000262894.6	+	5	1387	c.1107G>A	c.(1105-1107)gaG>gaA	p.E369E	ZNF225_ENST00000592780.1_3'UTR|ZNF225_ENST00000590612.1_Silent_p.E369E	NM_013362.2	NP_037494.2	Q9UK10	ZN225_HUMAN	zinc finger protein 225	369					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	16		Prostate(69;0.0352)|all_neural(266;0.202)				ACACAGGGGAGAAGCCATATA	0.433																																																	0													71.0	78.0	76.0					19																	44635874		2176	4284	6460	SO:0001819	synonymous_variant	7768			AF187991	CCDS46100.1	19q13.31	2013-01-08				ENSG00000256294		"""Zinc fingers, C2H2-type"", ""-"""	13018	protein-coding gene	gene with protein product							Standard	NM_013362		Approved		uc002oyj.1	Q9UK10		ENST00000262894.6:c.1107G>A	19.37:g.44635874G>A			A8K8S2|Q53F12|Q9NS46|Q9UID8	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E369	ENST00000262894.6	37	c.1107	CCDS46100.1	19																																																																																			ZNF225	-	pfscan_Znf_C2H2		0.433	ZNF225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF225	HGNC	protein_coding	OTTHUMT00000460581.1	G			44635874	+1	no_errors	ENST00000262894	ensembl	human	known	70_37	silent	SNP	0.977	A
ZNF385D	79750	genome.wustl.edu	37	3	21465554	21465554	+	Silent	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr3:21465554G>A	ENST00000281523.2	-	7	1373	c.855C>T	c.(853-855)caC>caT	p.H285H		NM_024697.2	NP_078973.1	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D	285						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(1)|prostate(1)|skin(4)	46						TACTGCTAATGTGCTATTAAA	0.378																																																	0													118.0	116.0	116.0					3																	21465554		2203	4300	6503	SO:0001819	synonymous_variant	79750			BC007212	CCDS2636.1	3p24.3	2012-10-05	2007-12-06	2007-12-06	ENSG00000151789	ENSG00000151789			26191	protein-coding gene	gene with protein product			"""zinc finger protein 659"""	ZNF659		12477932	Standard	NM_024697		Approved	FLJ22419	uc003cce.3	Q9H6B1	OTTHUMG00000130484	ENST00000281523.2:c.855C>T	3.37:g.21465554G>A				Silent	SNP	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like	p.H285	ENST00000281523.2	37	c.855	CCDS2636.1	3																																																																																			ZNF385D	-	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like		0.378	ZNF385D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF385D	HGNC	protein_coding	OTTHUMT00000252884.1	G	NM_024697		21465554	-1	no_errors	ENST00000281523	ensembl	human	known	70_37	silent	SNP	1.000	A
ZNF526	116115	genome.wustl.edu	37	19	42729234	42729234	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr19:42729234G>A	ENST00000301215.3	+	3	904	c.679G>A	c.(679-681)Gag>Aag	p.E227K		NM_133444.1	NP_597701.1	Q8TF50	ZN526_HUMAN	zinc finger protein 526	227	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(3)	22		Prostate(69;0.0704)				AGAGAAAGAGGAGCGCAATGG	0.557																																																	0													102.0	77.0	85.0					19																	42729234		2203	4300	6503	SO:0001583	missense	116115			AB075831	CCDS12598.1	19q13.31	2013-01-08				ENSG00000167625		"""Zinc fingers, C2H2-type"""	29415	protein-coding gene	gene with protein product		614387				11853319	Standard	NM_133444		Approved	KIAA1951, MGC4267	uc002osz.1	Q8TF50		ENST00000301215.3:c.679G>A	19.37:g.42729234G>A	ENSP00000301215:p.Glu227Lys		B3KV29|Q69YI2|Q96E24	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E227K	ENST00000301215.3	37	c.679	CCDS12598.1	19	.	.	.	.	.	.	.	.	.	.	G	14.72	2.620020	0.46736	.	.	ENSG00000167625	ENST00000437878;ENST00000301215	T	0.09630	2.96	4.52	4.52	0.55395	.	0.174690	0.44285	D	0.000470	T	0.20740	0.0499	L	0.44542	1.39	0.43187	D	0.995011	D	0.76494	0.999	D	0.69654	0.965	T	0.02132	-1.1208	10	0.06494	T	0.89	-11.1656	16.5388	0.84380	0.0:0.0:1.0:0.0	.	227	Q8TF50	ZN526_HUMAN	K	83;227	ENSP00000301215:E227K	ENSP00000301215:E227K	E	+	1	0	ZNF526	47421074	0.996000	0.38824	0.782000	0.31804	0.432000	0.31715	4.781000	0.62389	2.514000	0.84764	0.563000	0.77884	GAG	ZNF526	-	NULL		0.557	ZNF526-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF526	HGNC	protein_coding	OTTHUMT00000463681.2	G	XM_057401		42729234	+1	no_errors	ENST00000301215	ensembl	human	known	70_37	missense	SNP	0.998	A
ZNF526	116115	genome.wustl.edu	37	19	42729255	42729255	+	Missense_Mutation	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr19:42729255G>A	ENST00000301215.3	+	3	925	c.700G>A	c.(700-702)Gag>Aag	p.E234K		NM_133444.1	NP_597701.1	Q8TF50	ZN526_HUMAN	zinc finger protein 526	234	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(3)	22		Prostate(69;0.0704)				GTTggaggaggaggaagagga	0.562																																																	0													115.0	70.0	85.0					19																	42729255		2203	4300	6503	SO:0001583	missense	116115			AB075831	CCDS12598.1	19q13.31	2013-01-08				ENSG00000167625		"""Zinc fingers, C2H2-type"""	29415	protein-coding gene	gene with protein product		614387				11853319	Standard	NM_133444		Approved	KIAA1951, MGC4267	uc002osz.1	Q8TF50		ENST00000301215.3:c.700G>A	19.37:g.42729255G>A	ENSP00000301215:p.Glu234Lys		B3KV29|Q69YI2|Q96E24	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E234K	ENST00000301215.3	37	c.700	CCDS12598.1	19	.	.	.	.	.	.	.	.	.	.	G	10.01	1.233466	0.22626	.	.	ENSG00000167625	ENST00000437878;ENST00000301215	T	0.09538	2.97	4.38	3.34	0.38264	.	0.423244	0.25058	N	0.033476	T	0.08537	0.0212	L	0.43152	1.355	0.29120	N	0.880294	B	0.06786	0.001	B	0.06405	0.002	T	0.30707	-0.9969	10	0.06757	T	0.87	-11.4393	11.4435	0.50110	0.0913:0.0:0.9087:0.0	.	234	Q8TF50	ZN526_HUMAN	K	90;234	ENSP00000301215:E234K	ENSP00000301215:E234K	E	+	1	0	ZNF526	47421095	0.998000	0.40836	1.000000	0.80357	0.622000	0.37654	2.824000	0.48088	1.182000	0.42928	0.563000	0.77884	GAG	ZNF526	-	NULL		0.562	ZNF526-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF526	HGNC	protein_coding	OTTHUMT00000463681.2	G	XM_057401		42729255	+1	no_errors	ENST00000301215	ensembl	human	known	70_37	missense	SNP	1.000	A
ZNF609	23060	genome.wustl.edu	37	15	64966714	64966714	+	Nonsense_Mutation	SNP	C	C	G			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr15:64966714C>G	ENST00000326648.3	+	4	1789	c.1661C>G	c.(1660-1662)tCa>tGa	p.S554*	ZNF609_ENST00000559364.1_3'UTR	NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	554						nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GCATCTGTCTCACAAAAAGGT	0.532																																																	0													110.0	97.0	101.0					15																	64966714		2203	4299	6502	SO:0001587	stop_gained	23060			BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.1661C>G	15.37:g.64966714C>G	ENSP00000316527:p.Ser554*		Q0D2I2	Nonsense_Mutation	SNP	pfscan_Znf_C2H2	p.S554*	ENST00000326648.3	37	c.1661	CCDS32270.1	15	.	.	.	.	.	.	.	.	.	.	C	13.03	2.116632	0.37339	.	.	ENSG00000180357	ENST00000326648	.	.	.	5.62	4.69	0.59074	.	0.494643	0.22652	N	0.057302	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-3.4595	12.0511	0.53507	0.1363:0.7326:0.1311:0.0	.	.	.	.	X	554	.	ENSP00000316527:S554X	S	+	2	0	ZNF609	62753767	0.162000	0.22906	0.004000	0.12327	0.019000	0.09904	4.035000	0.57297	1.329000	0.45376	0.655000	0.94253	TCA	ZNF609	-	NULL		0.532	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF609	HGNC	protein_coding	OTTHUMT00000418130.1	C	XM_042833		64966714	+1	no_errors	ENST00000326648	ensembl	human	known	70_37	nonsense	SNP	0.073	G
ZNF623	9831	genome.wustl.edu	37	8	144732899	144732899	+	Missense_Mutation	SNP	C	C	T	rs373149668		TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr8:144732899C>T	ENST00000501748.2	+	1	946	c.857C>T	c.(856-858)aCa>aTa	p.T286I	ZNF623_ENST00000526926.1_Missense_Mutation_p.T246I|ZNF623_ENST00000458270.2_Missense_Mutation_p.T246I	NM_014789.3	NP_055604	O75123	ZN623_HUMAN	zinc finger protein 623	286					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(3)|large_intestine(6)|lung(11)|prostate(1)|stomach(1)|urinary_tract(3)	27	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			CAGATCCACACAGAAGTGAAA	0.468																																																	0								C	ILE/THR,ILE/THR	1,4405	2.1+/-5.4	0,1,2202	90.0	82.0	85.0		737,857	3.3	1.0	8		85	0,8600		0,0,4300	no	missense,missense	ZNF623	NM_001082480.1,NM_014789.3	89,89	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	246/497,286/537	144732899	1,13005	2203	4300	6503	SO:0001583	missense	9831			AB014528	CCDS34957.1, CCDS47931.1	8q24.3	2013-01-08				ENSG00000183309		"""Zinc fingers, C2H2-type"""	29084	protein-coding gene	gene with protein product						9734811	Standard	NM_014789		Approved	KIAA0628	uc003yzd.2	O75123		ENST00000501748.2:c.857C>T	8.37:g.144732899C>T	ENSP00000445979:p.Thr286Ile		A4FU80|B4DGP3|E7ENV5	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T286I	ENST00000501748.2	37	c.857	CCDS34957.1	8	.	.	.	.	.	.	.	.	.	.	C	21.4	4.144887	0.77888	2.27E-4	0.0	ENSG00000183309	ENST00000526926;ENST00000328466;ENST00000458270;ENST00000532796;ENST00000501748	T;T;T	0.25749	1.78;1.78;1.78	4.25	3.3	0.37823	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.47563	0.1452	M	0.75085	2.285	0.34176	D	0.670376	D	0.76494	0.999	D	0.67382	0.951	T	0.62604	-0.6819	9	0.87932	D	0	-6.3541	11.9541	0.52970	0.0:0.8226:0.1774:0.0	.	286	O75123	ZN623_HUMAN	I	246;246;246;286;286	ENSP00000435232:T246I;ENSP00000411139:T246I;ENSP00000445979:T286I	ENSP00000330358:T246I	T	+	2	0	ZNF623	144804042	0.992000	0.36948	0.961000	0.40146	0.995000	0.86356	3.049000	0.49869	2.359000	0.80004	0.655000	0.94253	ACA	ZNF623	-	pfscan_Znf_C2H2		0.468	ZNF623-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF623	HGNC	protein_coding	OTTHUMT00000382522.3	C	NM_014789		144732899	+1	no_errors	ENST00000501748	ensembl	human	known	70_37	missense	SNP	0.995	T
ZNF665	79788	genome.wustl.edu	37	19	53669311	53669311	+	Silent	SNP	G	G	A			TCGA-Q1-A6DT-01A-11D-A32I-09	TCGA-Q1-A6DT-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3b423342-bc9a-4c60-9f5e-992e4aa439fa	6d359d66-e4c7-479a-99f7-38829c1b83bd	g.chr19:53669311G>A	ENST00000600412.1	-	2	352	c.237C>T	c.(235-237)agC>agT	p.S79S	ZNF665_ENST00000396424.3_Silent_p.S144S|CTD-2245F17.2_ENST00000600257.1_RNA			Q9H7R5	ZN665_HUMAN	zinc finger protein 665	79					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	35				GBM - Glioblastoma multiforme(134;0.0196)		GTGACTGAAAGCTTACTCCAA	0.388																																																	0													118.0	125.0	123.0					19																	53669311		2152	4277	6429	SO:0001819	synonymous_variant	79788				CCDS46169.1	19q13.42	2013-01-08				ENSG00000197497		"""Zinc fingers, C2H2-type"", ""-"""	25885	protein-coding gene	gene with protein product							Standard	NM_024733		Approved	FLJ14345	uc010eqm.1	Q9H7R5		ENST00000600412.1:c.237C>T	19.37:g.53669311G>A			A8K5T8	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S144	ENST00000600412.1	37	c.432		19																																																																																			ZNF665	-	NULL		0.388	ZNF665-002	PUTATIVE	not_organism_supported|basic	protein_coding	ZNF665	HGNC	protein_coding	OTTHUMT00000464179.1	G	NM_024733		53669311	-1	no_errors	ENST00000396424	ensembl	human	known	70_37	silent	SNP	0.000	A
