#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVarCov_SOL	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZNF112	7771	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	44832524	44832525	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	CT	CT	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr19:44832524_44832525delCT	ENST00000337401.4	-	5	1891_1892	c.1803_1804delAG	c.(1801-1806)agagttfs	p.RV601fs	ZNF112_ENST00000354340.4_Frame_Shift_Del_p.RV595fs|ZNF112_ENST00000536500.1_Frame_Shift_Del_p.RV618fs	NM_001083335.1	NP_001076804.1	Q9UJU3	ZN112_HUMAN	zinc finger protein 112	601					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										CCAGTGTGAACTCTCTGATGGC	0.47																																					p.602_602del		.											.	.	.	0			c.1804_1805del						.																																			SO:0001589	frameshift_variant	7771	exon5			TGTGAACTCTCTG	AF198358		19q13.2	2014-02-06	2012-11-27		ENSG00000062370	ENSG00000062370		"""Zinc fingers, C2H2-type"""	12892	protein-coding gene	gene with protein product		603994	"""zinc finger protein 112 homolog (mouse)"", ""zinc finger protein 228"""	ZFP112, ZNF228			Standard	NM_013380		Approved			Q9UJU3	OTTHUMG00000182357	ENST00000337401.4:c.1803_1804delAG	19.37:g.44832528_44832529delCT	ENSP00000337081:p.Arg601fs	75	0		61	12	NM_001083335	A4FU53|Q9HCA7	Frame_Shift_Del	DEL	ENST00000337401.4	37	CCDS54276.1																																																																																			.		0.470	ZNF112-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460744.1	NM_013380	
ARID1A	8289	hgsc.bcm.edu	37	1	27107135	27107136	+	Frame_Shift_Ins	INS	-	-	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	-	-	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:27107135_27107136insA	ENST00000324856.7	+	20	7117_7118	c.6746_6747insA	c.(6745-6750)tcagagfs	p.E2250fs	ARID1A_ENST00000457599.2_Frame_Shift_Ins_p.E2033fs|ARID1A_ENST00000540690.1_Frame_Shift_Ins_p.E578fs|ARID1A_ENST00000374152.2_Frame_Shift_Ins_p.E1867fs	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	2250					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.(2287)fs(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GAGAACCACTCAGAGTTTACTC	0.515			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.S2249fs		.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.,2	.	842	1	Insertion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(1)	c.6746_6747insA						.																																			SO:0001589	frameshift_variant	8289	exon20			ACCACTCAGAGTT	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.6747dupA	1.37:g.27107136_27107136dupA	ENSP00000320485:p.Glu2250fs	16	0		15	10	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Frame_Shift_Ins	INS	ENST00000324856.7	37	CCDS285.1																																																																																			.		0.515	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
BAP1	8314	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	52437802	52437802	+	Frame_Shift_Del	DEL	T	T	-			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr3:52437802delT	ENST00000460680.1	-	13	1830	c.1359delA	c.(1357-1359)aaafs	p.K453fs	BAP1_ENST00000296288.5_Frame_Shift_Del_p.K435fs	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.K453fs*15(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		TCTGGGACTCTTTGAGCTTCT	0.592			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.E454fs	GBM(101;493 1458 7992 21037 25532)	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	.	.	1	Deletion - Frameshift(1)	kidney(1)	c.1360delG						.						82.0	84.0	84.0					3																	52437802		2203	4300	6503	SO:0001589	frameshift_variant	8314	exon13			GGACTCTTTGAGC	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1359delA	3.37:g.52437802delT	ENSP00000417132:p.Lys453fs	28	0		17	11	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Frame_Shift_Del	DEL	ENST00000460680.1	37	CCDS2853.1																																																																																			.		0.592	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
CNTNAP5	129684	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	125320826	125320826	+	Frame_Shift_Del	DEL	G	G	-			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr2:125320826delG	ENST00000431078.1	+	11	2043	c.1679delG	c.(1678-1680)agcfs	p.S560fs		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	560	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		CATGGAGGAAGCTGCTCCCAG	0.423																																					p.S560fs		.											.	.	.	0			c.1678delA						.						89.0	80.0	83.0					2																	125320826		1941	4146	6087	SO:0001589	frameshift_variant	129684	exon11			GAGGAAGCTGCTC	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.1679delG	2.37:g.125320826delG	ENSP00000399013:p.Ser560fs	50	0		42	16	NM_130773	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Frame_Shift_Del	DEL	ENST00000431078.1	37	CCDS46401.1																																																																																			.		0.423	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
ZNF185	7739	hgsc.bcm.edu	37	X	152085855	152085856	+	Frame_Shift_Ins	INS	-	-	TA			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	-	-	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chrX:152085855_152085856insTA	ENST00000370268.4	+	5	327_328	c.290_291insTA	c.(289-294)agctctfs	p.S98fs	ZNF185_ENST00000539731.1_Frame_Shift_Ins_p.S98fs|ZNF185_ENST00000318529.8_5'Flank|ZNF185_ENST00000449285.2_Frame_Shift_Ins_p.S98fs|ZNF185_ENST00000318504.7_Frame_Shift_Ins_p.S98fs|ZNF185_ENST00000324823.6_5'UTR|ZNF185_ENST00000370270.2_Frame_Shift_Ins_p.S98fs|ZNF185_ENST00000535861.1_Frame_Shift_Ins_p.S98fs			O15231	ZN185_HUMAN	zinc finger protein 185 (LIM domain)	98						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(3)	12	Acute lymphoblastic leukemia(192;6.56e-05)					CCCATAGACAGCTCTTCCCAGC	0.619																																					p.S97fs		.											.	.	.	0			c.290_291insTA						.																																			SO:0001589	frameshift_variant	7739	exon5			TAGACAGCTCTTC	AK056517	CCDS48184.1, CCDS55528.1, CCDS55529.1, CCDS55530.1, CCDS55531.1, CCDS55532.1, CCDS69832.1	Xq28	2012-08-08			ENSG00000147394	ENSG00000147394		"""Zinc fingers, C2H2-type"""	12976	protein-coding gene	gene with protein product		300381				9268636	Standard	NM_001178106		Approved		uc011myg.2	O15231	OTTHUMG00000024187	Exception_encountered	X.37:g.152085855_152085856insTA	ENSP00000359291:p.Ser98fs	58	0		53	25	NM_001178106	A4FTV3|A6NME5|B4DLE9|B7Z771|B8K2L9|B8K2M0|B8K2M1|B8K2M2|E9PFR6|F5GXF7|F5GZL4|F8W8V7|H0Y4M8|O00345|Q8N1R8|Q9NSD2	Frame_Shift_Ins	INS	ENST00000370268.4	37	CCDS48184.1																																																																																			.		0.619	ZNF185-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000377480.1	NM_007150	
FOXK1	221937	hgsc.bcm.edu;bcgsc.ca	37	7	4796750	4796750	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr7:4796750G>T	ENST00000328914.4	+	5	1176	c.1176G>T	c.(1174-1176)caG>caT	p.Q392H	FOXK1_ENST00000446823.1_Missense_Mutation_p.Q229H	NM_001037165.1	NP_001032242.1			forkhead box K1											breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		TCGTGGAACAGGCATTCCGGA	0.587																																					p.Q392H		.											.	.	.	0			c.G1176T						.						92.0	101.0	98.0					7																	4796750		2203	4300	6503	SO:0001583	missense	221937	exon5			GGAACAGGCATTC	BK004104	CCDS34591.1	7p22	2006-12-15			ENSG00000164916	ENSG00000164916		"""Forkhead boxes"""	23480	protein-coding gene	gene with protein product						15202027	Standard	NM_001037165		Approved	IMAGE:5164497	uc003snc.1	P85037	OTTHUMG00000151739	ENST00000328914.4:c.1176G>T	7.37:g.4796750G>T	ENSP00000328720:p.Gln392His	75	0		81	4	NM_001037165		Missense_Mutation	SNP	ENST00000328914.4	37	CCDS34591.1	.	.	.	.	.	.	.	.	.	.	G	19.78	3.891371	0.72524	.	.	ENSG00000164916	ENST00000446823;ENST00000450194;ENST00000328914;ENST00000545598	D;D	0.95656	-3.77;-3.77	5.8	3.98	0.46160	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.000000	0.85682	D	0.000000	D	0.96109	0.8732	L	0.52126	1.63	0.51767	D	0.999936	D;D	0.89917	0.996;1.0	D;D	0.87578	0.997;0.998	D	0.95231	0.8342	10	0.87932	D	0	.	8.8617	0.35261	0.2557:0.0:0.7443:0.0	.	392;229	P85037;P85037-2	FOXK1_HUMAN;.	H	229;156;392;275	ENSP00000394442:Q229H;ENSP00000328720:Q392H	ENSP00000328720:Q392H	Q	+	3	2	FOXK1	4763276	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	2.779000	0.47734	0.773000	0.33404	0.655000	0.94253	CAG	.		0.587	FOXK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323729.2		
ACSM5	54988	hgsc.bcm.edu	37	16	20448431	20448431	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr16:20448431C>A	ENST00000331849.4	+	11	1513	c.1366C>A	c.(1366-1368)Cga>Aga	p.R456R		NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	456					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)	p.R456R(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						CACAGGGGACCGAGCTCGCAT	0.488																																					p.R456R		.											ACSM5,NS,carcinoma,0,1	ACSM5	0	1	Substitution - coding silent(1)	lung(1)	c.C1366A						.						167.0	155.0	159.0					16																	20448431		2203	4300	6503	SO:0001819	synonymous_variant	54988	exon11			GGGGACCGAGCTC		CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.1366C>A	16.37:g.20448431C>A		52	0		51	3	NM_017888	Q96AV1|Q96CX8|Q9NWV3	Silent	SNP	ENST00000331849.4	37	CCDS10585.1																																																																																			.		0.488	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254413.1	NM_017888	
MID1	4281	hgsc.bcm.edu;bcgsc.ca	37	X	10422989	10422989	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chrX:10422989C>A	ENST00000317552.4	-	9	1976	c.1576G>T	c.(1576-1578)Ggg>Tgg	p.G526W	MID1_ENST00000380785.1_Missense_Mutation_p.G526W|MID1_ENST00000380787.1_Missense_Mutation_p.G526W|MID1_ENST00000380779.1_Missense_Mutation_p.G526W|MID1_ENST00000380780.1_Missense_Mutation_p.G526W|MID1_ENST00000479925.1_5'UTR|MID1_ENST00000380782.2_Missense_Mutation_p.G526W|MID1_ENST00000453318.2_Missense_Mutation_p.G526W	NM_000381.3|NM_033289.1	NP_000372.1|NP_150631.1	O15344	TRI18_HUMAN	midline 1	526	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				microtubule cytoskeleton organization (GO:0000226)|negative regulation of microtubule depolymerization (GO:0007026)|pattern specification process (GO:0007389)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein localization to microtubule (GO:0035372)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	ligase activity (GO:0016874)|microtubule binding (GO:0008017)|phosphoprotein binding (GO:0051219)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	26						CCATAGCTCCCCTGGCTGGTG	0.448																																					p.G526W		.											.	.	.	0			c.G1576T						.						193.0	141.0	159.0					X																	10422989		2203	4300	6503	SO:0001583	missense	4281	exon9			AGCTCCCCTGGCT	Y13667	CCDS14138.1, CCDS75952.1, CCDS75953.1	Xp22	2014-06-18	2014-06-18		ENSG00000101871	ENSG00000101871		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	7095	protein-coding gene	gene with protein product	"""Opitz/BBB syndrome"""	300552				9354791, 9425238	Standard	NM_001098624		Approved	OS, FXY, TRIM18, RNF59	uc004cti.4	O15344	OTTHUMG00000021127	ENST00000317552.4:c.1576G>T	X.37:g.10422989C>A	ENSP00000312678:p.Gly526Trp	99	0		69	5	NM_001193277	B2RCG2|O75361|Q9BZX5	Missense_Mutation	SNP	ENST00000317552.4	37	CCDS14138.1	.	.	.	.	.	.	.	.	.	.	C	19.88	3.909504	0.72868	.	.	ENSG00000101871	ENST00000453318;ENST00000317552;ENST00000380785;ENST00000380779;ENST00000380787;ENST00000380780;ENST00000380782;ENST00000454373	T;T;T;T;T;T;T	0.61510	0.1;0.1;0.1;0.1;0.1;0.1;0.1	5.76	4.9	0.64082	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	0.102387	0.64402	N	0.000002	T	0.69115	0.3075	L	0.51422	1.61	0.54753	D	0.999981	D;D;D	0.67145	0.996;0.996;0.993	D;D;D	0.74348	0.983;0.983;0.928	T	0.67711	-0.5600	10	0.38643	T	0.18	.	13.8155	0.63290	0.0:0.9252:0.0:0.0748	.	526;526;476	A8K5A0;O15344;B4DLX8	.;TRI18_HUMAN;.	W	526;526;526;526;526;526;526;476	ENSP00000414521:G526W;ENSP00000312678:G526W;ENSP00000370162:G526W;ENSP00000370156:G526W;ENSP00000370164:G526W;ENSP00000370157:G526W;ENSP00000370159:G526W	ENSP00000312678:G526W	G	-	1	0	MID1	10382989	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	4.328000	0.59253	1.208000	0.43306	0.600000	0.82982	GGG	.		0.448	MID1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055738.1		
DCAF8L2	347442	hgsc.bcm.edu;bcgsc.ca	37	X	27765742	27765742	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chrX:27765742G>T	ENST00000451261.2	+	5	1129	c.730G>T	c.(730-732)Gcc>Tcc	p.A244S		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	244										central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						CACCCGGCTGGCCAGTAGCGG	0.532																																					p.A244S		.											.	.	.	0			c.G730T						.						104.0	78.0	86.0					X																	27765742		692	1591	2283	SO:0001583	missense	347442	exon1			CGGCTGGCCAGTA		CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.730G>T	X.37:g.27765742G>T	ENSP00000462745:p.Ala244Ser	52	0		43	4	NM_001136533	B2RXH9|J3KT06	Missense_Mutation	SNP	ENST00000451261.2	37	CCDS59162.1																																																																																			.		0.532	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056143.4	XM_293354	
SLC25A2	83884	hgsc.bcm.edu	37	5	140683227	140683227	+	Missense_Mutation	SNP	G	G	C			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr5:140683227G>C	ENST00000239451.4	-	1	385	c.206C>G	c.(205-207)cCg>cGg	p.P69R		NM_031947.2	NP_114153.1	Q9BXI2	ORNT2_HUMAN	solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 2	69					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|urea cycle (GO:0000050)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)		p.P69L(1)		breast(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	19		all_lung(500;0.000249)|Lung NSC(810;0.0011)|Ovarian(839;0.00556)|Breast(839;0.0173)|all_hematologic(541;0.152)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00204)	L-Ornithine(DB00129)	CATAAGTGCCGGGCCGGTGCC	0.577																																					p.P69R		.											SLC25A2,NS,carcinoma,0,1	SLC25A2	0	1	Substitution - Missense(1)	breast(1)	c.C206G						.						79.0	77.0	78.0					5																	140683227		2203	4300	6503	SO:0001583	missense	83884	exon1			AGTGCCGGGCCGG	AF332005	CCDS4258.1	5q31.3	2013-05-22			ENSG00000120329	ENSG00000120329		"""Solute carriers"""	22921	protein-coding gene	gene with protein product		608157				11004451	Standard	NM_031947		Approved	ORNT2	uc003ljf.3	Q9BXI2	OTTHUMG00000129604	ENST00000239451.4:c.206C>G	5.37:g.140683227G>C	ENSP00000239451:p.Pro69Arg	16	0		17	2	NM_031947	Q496C1|Q6XUI0|Q8NFZ2	Missense_Mutation	SNP	ENST00000239451.4	37	CCDS4258.1	.	.	.	.	.	.	.	.	.	.	G	12.45	1.942908	0.34283	.	.	ENSG00000120329	ENST00000239451	D	0.82619	-1.63	3.72	2.83	0.33086	Mitochondrial carrier domain (2);	0.000000	0.85682	U	0.000000	D	0.93207	0.7836	H	0.96970	3.915	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93969	0.7247	10	0.72032	D	0.01	-11.7774	11.3746	0.49719	0.0:0.1859:0.8141:0.0	.	69	Q9BXI2	ORNT2_HUMAN	R	69	ENSP00000239451:P69R	ENSP00000239451:P69R	P	-	2	0	SLC25A2	140663411	1.000000	0.71417	0.037000	0.18230	0.019000	0.09904	8.721000	0.91446	1.141000	0.42275	0.585000	0.79938	CCG	.		0.577	SLC25A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251799.2	NM_031947	
HERC2	8924	hgsc.bcm.edu;bcgsc.ca	37	15	28492030	28492030	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr15:28492030C>A	ENST00000261609.7	-	22	3357	c.3249G>T	c.(3247-3249)atG>atT	p.M1083I		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		AACCAACACCCATTAGCTCTG	0.448																																					p.M1083I		.											.	.	.	0			c.G3249T						.						89.0	76.0	80.0					15																	28492030		2203	4300	6503	SO:0001583	missense	8924	exon22			AACACCCATTAGC	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.3249G>T	15.37:g.28492030C>A	ENSP00000261609:p.Met1083Ile	83	0		100	4	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	C	2.651	-0.281947	0.05642	.	.	ENSG00000128731	ENST00000261609	T	0.37058	1.22	5.43	4.41	0.53225	.	0.057111	0.64402	D	0.000001	T	0.15219	0.0367	N	0.08118	0	0.30689	N	0.751491	B	0.10296	0.003	B	0.09377	0.004	T	0.14727	-1.0462	10	0.13470	T	0.59	.	6.1893	0.20516	0.0:0.6915:0.0:0.3085	.	1083	O95714	HERC2_HUMAN	I	1083	ENSP00000261609:M1083I	ENSP00000261609:M1083I	M	-	3	0	HERC2	26165625	1.000000	0.71417	1.000000	0.80357	0.216000	0.24613	1.620000	0.36976	2.546000	0.85860	0.650000	0.86243	ATG	.		0.448	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
ATP11A	23250	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	13	113512205	113512205	+	Missense_Mutation	SNP	G	G	A	rs371031585		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr13:113512205G>A	ENST00000487903.1	+	21	2580	c.2492G>A	c.(2491-2493)aGc>aAc	p.S831N	ATP11A_ENST00000283558.8_Missense_Mutation_p.S831N|ATP11A_ENST00000375630.2_Missense_Mutation_p.S831N|ATP11A_ENST00000375645.3_Missense_Mutation_p.S831N			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	831					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				AATGATGTCAGCATGATTCTG	0.473																																					p.S831N		.											.	.	.	0			c.G2492A						.						178.0	160.0	166.0					13																	113512205		2203	4300	6503	SO:0001583	missense	23250	exon21			ATGTCAGCATGAT	AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.2492G>A	13.37:g.113512205G>A	ENSP00000420387:p.Ser831Asn	27	0		29	4	NM_032189	Q5VXT2	Missense_Mutation	SNP	ENST00000487903.1	37	CCDS32011.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.313026|5.313026	0.95655|0.95655	.|.	.|.	ENSG00000068650|ENSG00000068650	ENST00000418678|ENST00000487903;ENST00000375630;ENST00000375645;ENST00000283558;ENST00000432166	.|T;T;T;T	.|0.65364	.|-0.15;-0.15;-0.15;-0.15	5.32|5.32	5.32|5.32	0.75619|0.75619	.|HAD-like domain (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.78755|0.78755	0.4333|0.4333	M|M	0.66378|0.66378	2.025|2.025	0.80722|0.80722	D|D	1|1	.|D;D;P	.|0.89917	.|1.0;0.975;0.937	.|D;D;P	.|0.91635	.|0.999;0.919;0.669	T|T	0.78607|0.78607	-0.2138|-0.2138	5|10	.|0.51188	.|T	.|0.08	.|.	19.3647|19.3647	0.94458|0.94458	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|831;831;831	.|E9PCW5;E9PEJ6;P98196	.|.;.;AT11A_HUMAN	T|N	806|831;831;831;831;272	.|ENSP00000420387:S831N;ENSP00000364781:S831N;ENSP00000364796:S831N;ENSP00000283558:S831N	.|ENSP00000283558:S831N	A|S	+|+	1|2	0|0	ATP11A|ATP11A	112560206|112560206	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.925000|0.925000	0.55904|0.55904	9.357000|9.357000	0.97099|0.97099	2.633000|2.633000	0.89246|0.89246	0.655000|0.655000	0.94253|0.94253	GCA|AGC	.		0.473	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045834.3	NM_015205	
NEB	4703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	152547337	152547337	+	Missense_Mutation	SNP	A	A	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr2:152547337A>T	ENST00000172853.10	-	24	2361	c.2214T>A	c.(2212-2214)caT>caA	p.H738Q	NEB_ENST00000397345.3_Missense_Mutation_p.H738Q|NEB_ENST00000604864.1_Missense_Mutation_p.H738Q|NEB_ENST00000427231.2_Missense_Mutation_p.H738Q|NEB_ENST00000603639.1_Missense_Mutation_p.H738Q|NEB_ENST00000409198.1_Missense_Mutation_p.H738Q			P20929	NEBU_HUMAN	nebulin	738					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		CTTTGTAGGTATGCTAGAAAA	0.363																																					p.H738Q		.											.	.	.	0			c.T2214A						.						102.0	97.0	99.0					2																	152547337		1896	4111	6007	SO:0001583	missense	4703	exon24			GTAGGTATGCTAG	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.2214T>A	2.37:g.152547337A>T	ENSP00000172853:p.His738Gln	63	0		44	11	NM_004543	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	A	15.71	2.912553	0.52439	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.05199	3.48;3.49;3.49;3.48	5.04	-1.37	0.09056	.	0.000000	0.56097	D	0.000029	T	0.07234	0.0183	L	0.54323	1.7	0.80722	D	1	B;B	0.32893	0.146;0.389	B;B	0.37451	0.07;0.25	T	0.31166	-0.9953	10	0.25106	T	0.35	.	10.4345	0.44428	0.5035:0.0:0.4965:0.0	.	371;738	Q86TG3;P20929	.;NEBU_HUMAN	Q	738	ENSP00000386259:H738Q;ENSP00000380505:H738Q;ENSP00000416578:H738Q;ENSP00000172853:H738Q	ENSP00000172853:H738Q	H	-	3	2	NEB	152255583	0.983000	0.35010	0.999000	0.59377	0.876000	0.50452	0.254000	0.18314	-0.023000	0.13963	0.260000	0.18958	CAT	.		0.363	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
PTH2	113091	hgsc.bcm.edu	37	19	49926533	49926533	+	Missense_Mutation	SNP	G	G	C	rs200733272|rs371950649	byFrequency	TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr19:49926533G>C	ENST00000270631.1	-	1	165	c.64C>G	c.(64-66)Ctg>Gtg	p.L22V	CTD-3148I10.1_ENST00000576655.1_5'Flank	NM_178449.3	NP_848544.1	Q96A98	TIP39_HUMAN	parathyroid hormone 2	22					neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)		p.L22V(2)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(262;0.0015)|GBM - Glioblastoma multiforme(486;0.044)|Lung(386;0.0785)|LUSC - Lung squamous cell carcinoma(496;0.0836)		GGCACCACcagcagcagcagc	0.692													g|||	17	0.00339457	0.003	0.0043	5008	,	,		11369	0.004		0.002	False		,,,				2504	0.0041				p.L22V		.											PTH2,NS,carcinoma,0,9	PTH2	0	2	Substitution - Missense(2)	endometrium(2)	c.C64G						.		VAL/LEU	12,4376		0,12,2182	12.0	16.0	14.0		64	3.3	0.0	19		14	11,8561		0,11,4275	no	missense	PTH2	NM_178449.3	32	0,23,6457	CC,CG,GG		0.1283,0.2735,0.1775	possibly-damaging	22/101	49926533	23,12937	2194	4286	6480	SO:0001583	missense	113091	exon1			CCACCAGCAGCAG	AY037555	CCDS12763.1	19q13.33	2013-02-28				ENSG00000142538		"""Endogenous ligands"""	30828	protein-coding gene	gene with protein product	"""tuberoinfundibular 39 residues"""	608386				11861531	Standard	NM_178449		Approved	TIP39	uc002pnn.1	Q96A98		ENST00000270631.1:c.64C>G	19.37:g.49926533G>C	ENSP00000270631:p.Leu22Val	71	1		63	3	NM_178449	Q96DJ4	Missense_Mutation	SNP	ENST00000270631.1	37	CCDS12763.1	.	.	.	.	.	.	.	.	.	.	g	6.292	0.421904	0.11928	0.002735	0.001283	ENSG00000142538	ENST00000270631	.	.	.	4.3	3.26	0.37387	.	0.489236	0.15528	U	0.257640	T	0.26521	0.0648	L	0.27053	0.805	0.09310	N	1	P	0.46142	0.873	B	0.39419	0.299	T	0.08066	-1.0740	9	0.87932	D	0	-7.2733	12.3672	0.55234	0.0:0.1717:0.8283:0.0	.	22	Q96A98	TIP39_HUMAN	V	22	.	ENSP00000270631:L22V	L	-	1	2	PTH2	54618345	0.088000	0.21588	0.012000	0.15200	0.011000	0.07611	-0.504000	0.06375	0.947000	0.37659	-0.370000	0.07254	CTG	.		0.692	PTH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465366.1	NM_178449	
CD109	135228	hgsc.bcm.edu	37	6	74492445	74492445	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr6:74492445C>A	ENST00000287097.5	+	18	2184	c.2072C>A	c.(2071-2073)cCa>cAa	p.P691Q	CD109_ENST00000422508.2_Missense_Mutation_p.P614Q|CD109_ENST00000437994.2_Missense_Mutation_p.P691Q			Q6YHK3	CD109_HUMAN	CD109 molecule	691	Bait region (approximate). {ECO:0000250}.				negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)	p.P691L(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						AAGCATTTTCCAGAGACTTGG	0.363																																					p.P691Q		.											CD109,NS,carcinoma,0,1	CD109	0	1	Substitution - Missense(1)	lung(1)	c.C2072A						.						141.0	133.0	136.0					6																	74492445		2203	4300	6503	SO:0001583	missense	135228	exon18			ATTTTCCAGAGAC	AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.2072C>A	6.37:g.74492445C>A	ENSP00000287097:p.Pro691Gln	91	0		48	2	NM_133493	A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Missense_Mutation	SNP	ENST00000287097.5	37	CCDS4982.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.612890	0.87258	.	.	ENSG00000156535	ENST00000437994;ENST00000422508;ENST00000287097	T;T;T	0.36699	1.24;1.5;1.26	4.58	4.58	0.56647	.	0.195509	0.43747	D	0.000522	T	0.38401	0.1039	N	0.19112	0.55	0.58432	D	0.999999	D;D;D	0.89917	0.996;1.0;0.999	D;D;D	0.87578	0.928;0.998;0.978	T	0.46789	-0.9166	10	0.87932	D	0	.	17.9462	0.89039	0.0:1.0:0.0:0.0	.	614;691;691	Q6YHK3-2;Q6YHK3-4;Q6YHK3	.;.;CD109_HUMAN	Q	691;614;691	ENSP00000388062:P691Q;ENSP00000404475:P614Q;ENSP00000287097:P691Q	ENSP00000287097:P691Q	P	+	2	0	CD109	74549166	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	6.171000	0.71926	2.532000	0.85374	0.650000	0.86243	CCA	.		0.363	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041230.3	NM_133493	
CHD1	1105	hgsc.bcm.edu	37	5	98192174	98192174	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr5:98192174C>A	ENST00000284049.3	-	35	5192	c.5043G>T	c.(5041-5043)caG>caT	p.Q1681H		NM_001270.2	NP_001261.2	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	1681					chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)	p.Q1681Q(1)		NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	49		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	AAGGAGATCTCTGATCTAGTG	0.443																																					p.Q1681H		.											CHD1,NS,carcinoma,0,1	CHD1	0	1	Substitution - coding silent(1)	prostate(1)	c.G5043T						.						95.0	88.0	91.0					5																	98192174		2203	4299	6502	SO:0001583	missense	1105	exon35			AGATCTCTGATCT	AF006513	CCDS34204.1	5q15-q21	2008-07-18			ENSG00000153922	ENSG00000153922			1915	protein-coding gene	gene with protein product		602118				8460153, 9326634	Standard	XM_005271866		Approved		uc003knf.3	O14646	OTTHUMG00000162744	ENST00000284049.3:c.5043G>T	5.37:g.98192174C>A	ENSP00000284049:p.Gln1681His	49	0		47	2	NM_001270	Q17RZ3	Missense_Mutation	SNP	ENST00000284049.3	37	CCDS34204.1	.	.	.	.	.	.	.	.	.	.	C	11.92	1.783816	0.31593	.	.	ENSG00000153922	ENST00000422663;ENST00000284049	D	0.91011	-2.77	5.82	4.95	0.65309	.	0.000000	0.32444	U	0.006099	D	0.93831	0.8027	M	0.63843	1.955	0.58432	D	0.999994	D	0.57571	0.98	D	0.69654	0.965	D	0.93481	0.6827	10	0.45353	T	0.12	.	14.6476	0.68772	0.0:0.9303:0.0:0.0696	.	1681	O14646	CHD1_HUMAN	H	271;1681	ENSP00000284049:Q1681H	ENSP00000284049:Q1681H	Q	-	3	2	CHD1	98220074	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.722000	0.25925	1.466000	0.48025	0.655000	0.94253	CAG	.		0.443	CHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370295.1	NM_001270	
F13A1	2162	hgsc.bcm.edu	37	6	6305670	6305670	+	Missense_Mutation	SNP	C	C	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr6:6305670C>T	ENST00000264870.3	-	3	498	c.233G>A	c.(232-234)cGc>cAc	p.R78H		NM_000129.3	NP_000120.2	P00488	F13A_HUMAN	coagulation factor XIII, A1 polypeptide	78					blood coagulation (GO:0007596)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.R78L(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	62	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	CTGCCCTCTGCGGACAATCAG	0.478																																					p.R78H		.											F13A1,NS,adenocarcinoma,0,2	F13A1	0	1	Substitution - Missense(1)	lung(1)	c.G233A	GRCh37	CM040029	F13A1	M		.						272.0	212.0	232.0					6																	6305670		2203	4300	6503	SO:0001583	missense	2162	exon3			CCTCTGCGGACAA	M14539	CCDS4496.1	6p24.2-p23	2014-01-24			ENSG00000124491	ENSG00000124491		"""Transglutaminases"""	3531	protein-coding gene	gene with protein product		134570		F13A			Standard	NM_000129		Approved		uc003mwv.3	P00488	OTTHUMG00000014186	ENST00000264870.3:c.233G>A	6.37:g.6305670C>T	ENSP00000264870:p.Arg78His	55	0		47	2	NM_000129	Q59HA7|Q8N6X2|Q96P24|Q9BX29	Missense_Mutation	SNP	ENST00000264870.3	37	CCDS4496.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.5|21.5	4.158952|4.158952	0.78226|0.78226	.|.	.|.	ENSG00000124491|ENSG00000124491	ENST00000451619|ENST00000264870;ENST00000414279;ENST00000431222	.|D;D	.|0.98947	.|-5.26;-5.26	5.48|5.48	5.48|5.48	0.80851|0.80851	.|Immunoglobulin E-set (1);Transglutaminase, N-terminal (1);Immunoglobulin-like fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.99245|0.99245	0.9737|0.9737	M|M	0.88640|0.88640	2.97|2.97	0.58432|0.58432	D|D	0.999999|0.999999	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	D|D	0.99537|0.99537	1.0962|1.0962	5|10	.|0.87932	.|D	.|0	.|.	16.8495|16.8495	0.85990|0.85990	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|78	.|P00488	.|F13A_HUMAN	T|H	103|78;78;116	.|ENSP00000264870:R78H;ENSP00000413334:R78H	.|ENSP00000264870:R78H	A|R	-|-	1|2	0|0	F13A1|F13A1	6250669|6250669	1.000000|1.000000	0.71417|0.71417	0.335000|0.335000	0.25508|0.25508	0.774000|0.774000	0.43823|0.43823	5.980000|5.980000	0.70516|0.70516	2.572000|2.572000	0.86782|0.86782	0.585000|0.585000	0.79938|0.79938	GCA|CGC	.		0.478	F13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039756.3	NM_000129	
APLF	200558	hgsc.bcm.edu	37	2	68765137	68765137	+	Missense_Mutation	SNP	G	G	A	rs139666972	byFrequency	TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr2:68765137G>A	ENST00000303795.4	+	7	1109	c.938G>A	c.(937-939)aGa>aAa	p.R313K	APLF_ENST00000471727.1_3'UTR	NM_173545.2	NP_775816.1	Q8IW19	APLF_HUMAN	aprataxin and PNKP like factor	313				Missing (in Ref. 1; BAF83530). {ECO:0000305}.	cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of DNA ligation (GO:0051106)|regulation of isotype switching (GO:0045191)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	3'-5' exonuclease activity (GO:0008408)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|endodeoxyribonuclease activity (GO:0004520)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	25						GCCACTAAAAGAACACCACAT	0.388																																					p.R313K		.											.,7	.	69	0			c.G938A						.						84.0	75.0	78.0					2																	68765137		2203	4285	6488	SO:0001583	missense	200558	exon7			CTAAAAGAACACC	BC030711	CCDS1888.1	2p14	2014-02-20	2008-10-01	2008-10-01	ENSG00000169621	ENSG00000169621			28724	protein-coding gene	gene with protein product	"""XRCC1-interacting protein 1"", ""zinc finger, CX5CX6HX5H motif containing 1"""	611035	"""chromosome 2 open reading frame 13"""	C2orf13		18474613, 18077224, 17353262	Standard	NM_173545		Approved	MGC47799, Xip1, ZCCHH1	uc002sep.3	Q8IW19	OTTHUMG00000129566	ENST00000303795.4:c.938G>A	2.37:g.68765137G>A	ENSP00000307004:p.Arg313Lys	43	1		42	4	NM_173545	A8K476|Q53P47|Q53PB9|Q53QU0	Missense_Mutation	SNP	ENST00000303795.4	37	CCDS1888.1	.	.	.	.	.	.	.	.	.	.	.	2.207	-0.381684	0.04966	.	.	ENSG00000169621	ENST00000303795	T	0.23552	1.9	5.39	0.0457	0.14231	.	1.235800	0.05550	N	0.567293	T	0.13286	0.0322	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.21280	-1.0250	10	0.02654	T	1	.	1.339	0.02150	0.3456:0.1431:0.3738:0.1375	.	313	Q8IW19	APLF_HUMAN	K	313	ENSP00000307004:R313K	ENSP00000307004:R313K	R	+	2	0	APLF	68618641	0.023000	0.18921	0.000000	0.03702	0.001000	0.01503	0.368000	0.20399	-0.045000	0.13468	0.557000	0.71058	AGA	.		0.388	APLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251759.1	NM_173545	
SKIV2L	6499	hgsc.bcm.edu	37	6	31935499	31935499	+	Nonsense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr6:31935499C>A	ENST00000375394.2	+	22	2704	c.2591C>A	c.(2590-2592)tCg>tAg	p.S864*	DXO_ENST00000478221.1_5'Flank|SKIV2L_ENST00000544581.1_Nonsense_Mutation_p.S671*	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	864					ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						CAGGTCTCCTCGAACTCCACC	0.582																																					p.S864X		.											SKIV2L_ENST00000375394,colon,carcinoma,0,2	SKIV2L_ENST00000375394	0	0			c.C2591A						.						78.0	91.0	87.0					6																	31935499		1510	2709	4219	SO:0001587	stop_gained	6499	exon22			TCTCCTCGAACTC		CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.2591C>A	6.37:g.31935499C>A	ENSP00000364543:p.Ser864*	42	0		45	4	NM_006929	O15005|Q12902|Q15476|Q5ST66	Nonsense_Mutation	SNP	ENST00000375394.2	37	CCDS4731.1	.	.	.	.	.	.	.	.	.	.	C	42	9.508728	0.99190	.	.	ENSG00000204351	ENST00000375394;ENST00000433155;ENST00000544581	.	.	.	5.22	5.22	0.72569	.	0.239499	0.41294	D	0.000920	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.8776	16.043	0.80698	0.0:1.0:0.0:0.0	.	.	.	.	X	864;706;671	.	ENSP00000364543:S864X	S	+	2	0	SKIV2L	32043478	0.992000	0.36948	0.966000	0.40874	0.956000	0.61745	3.624000	0.54231	2.588000	0.87417	0.655000	0.94253	TCG	.		0.582	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076264.3		
DGCR8	54487	hgsc.bcm.edu	37	22	20073625	20073625	+	Nonsense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr22:20073625G>T	ENST00000351989.3	+	2	568	c.139G>T	c.(139-141)Gag>Tag	p.E47*	MIR3618_ENST00000580330.1_RNA|DGCR8_ENST00000407755.1_Nonsense_Mutation_p.E47*|DGCR8_ENST00000383024.2_Nonsense_Mutation_p.E47*|MIR1306_ENST00000408439.1_RNA	NM_022720.6	NP_073557.3	Q8WYQ5	DGCR8_HUMAN	DGCR8 microprocessor complex subunit	47	Necessary for interaction with NCL.|Necessary for nuclear localization and retention.				gene expression (GO:0010467)|primary miRNA processing (GO:0031053)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)	p.E47Q(1)		NS(2)|breast(1)|endometrium(5)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	Colorectal(54;0.0993)					CAGTGGTGCAGAGGTAATGGA	0.602																																					p.E47X		.											DGCR8,NS,NS,0,1	DGCR8	0	1	Substitution - Missense(1)	NS(1)	c.G139T						.						70.0	70.0	70.0					22																	20073625		2203	4300	6503	SO:0001587	stop_gained	54487	exon2			GGTGCAGAGGTAA	AF165527, AB050770	CCDS13773.1, CCDS54501.1	22q11.2	2013-05-02	2013-05-02		ENSG00000128191	ENSG00000128191			2847	protein-coding gene	gene with protein product		609030	"""chromosome 22 open reading frame 12"", ""DiGeorge syndrome critical region gene 8"""	C22orf12		21454614	Standard	NM_001190326		Approved	DGCRK6, Gy1, pasha	uc002zri.3	Q8WYQ5	OTTHUMG00000150503	ENST00000351989.3:c.139G>T	22.37:g.20073625G>T	ENSP00000263209:p.Glu47*	47	0		38	2	NM_001190326	B2R8G1|Q6DCB2|Q6MZE9|Q6Y2L0|Q96G39|Q96GP8|Q9H6L8|Q9H6T7|Q9NRW2	Nonsense_Mutation	SNP	ENST00000351989.3	37	CCDS13773.1	.	.	.	.	.	.	.	.	.	.	G	40	7.951099	0.98577	.	.	ENSG00000128191	ENST00000351989;ENST00000383024;ENST00000457069;ENST00000407755	.	.	.	5.28	5.28	0.74379	.	0.046440	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-22.4852	18.6866	0.91567	0.0:0.0:1.0:0.0	.	.	.	.	X	47	.	ENSP00000263209:E47X	E	+	1	0	DGCR8	18453625	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.231000	0.95317	2.739000	0.93911	0.491000	0.48974	GAG	.		0.602	DGCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318654.1		
ZNF583	147949	hgsc.bcm.edu;bcgsc.ca	37	19	56934339	56934339	+	Silent	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr19:56934339G>T	ENST00000333201.9	+	5	522	c.312G>T	c.(310-312)gtG>gtT	p.V104V	ZNF583_ENST00000291598.7_Silent_p.V104V	NM_001159861.1|NM_152478.2	NP_001153333.1|NP_689691.2	Q96ND8	ZN583_HUMAN	zinc finger protein 583	104					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0564)		TTGTGACAGTGGGAGCAAGAC	0.378																																					p.V104V		.											.	.	.	0			c.G312T						.						91.0	85.0	87.0					19																	56934339		2203	4300	6503	SO:0001819	synonymous_variant	147949	exon5			GACAGTGGGAGCA	AK055592	CCDS12943.1	19q13.43	2013-09-20			ENSG00000198440	ENSG00000198440		"""Zinc fingers, C2H2-type"", ""-"""	26427	protein-coding gene	gene with protein product							Standard	NM_152478		Approved	FLJ31030	uc010ygl.1	Q96ND8	OTTHUMG00000168874	ENST00000333201.9:c.312G>T	19.37:g.56934339G>T		91	0		94	4	NM_001159861	O14850|Q2NKK3	Silent	SNP	ENST00000333201.9	37	CCDS12943.1																																																																																			.		0.378	ZNF583-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401453.1	NM_152478	
SIRPA	140885	hgsc.bcm.edu	37	20	1903045	1903045	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr20:1903045C>A	ENST00000358771.4	+	4	993	c.841C>A	c.(841-843)Cag>Aag	p.Q281K	SIRPA_ENST00000356025.3_Missense_Mutation_p.Q281K|SIRPA_ENST00000400068.3_Missense_Mutation_p.Q281K	NM_001040023.1	NP_001035112.1	P78324	SHPS1_HUMAN	signal-regulatory protein alpha	281	Ig-like C1-type 2.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	21				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		GTTCTACCCCCAGAGACTACA	0.537																																					p.Q281K	GBM(155;1668 1920 5945 42733 48121)	.											.	.	.	0			c.C841A						.						87.0	80.0	83.0					20																	1903045		2203	4298	6501	SO:0001583	missense	140885	exon5			TACCCCCAGAGAC	D86043	CCDS13022.1	20p13	2013-01-11	2006-03-29	2006-03-29	ENSG00000198053	ENSG00000198053		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	9662	protein-coding gene	gene with protein product		602461	"""protein tyrosine phosphatase, non-receptor type substrate 1"""	PTPNS1		9070220, 9062191, 16339511	Standard	XM_005260669		Approved	SHPS1, SIRP, MYD-1, BIT, P84, SHPS-1, SIRPalpha, CD172a, SIRPalpha2, MFR, SIRP-ALPHA-1	uc002wfr.3	P78324	OTTHUMG00000031682	ENST00000358771.4:c.841C>A	20.37:g.1903045C>A	ENSP00000351621:p.Gln281Lys	69	0		67	5	NM_001040022	A2A2E1|A8K411|B2R6C3|O00683|O43799|Q8N517|Q8TAL8|Q9H0Z2|Q9UDX2|Q9UIJ6|Q9Y4U9	Missense_Mutation	SNP	ENST00000358771.4	37	CCDS13022.1	.	.	.	.	.	.	.	.	.	.	C	1.156	-0.645100	0.03531	.	.	ENSG00000198053	ENST00000400068;ENST00000356025;ENST00000358771	T;T;T	0.02579	4.24;4.24;4.24	5.35	-3.39	0.04868	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	1.456800	0.04018	N	0.299283	T	0.01905	0.0060	N	0.25485	0.75	0.09310	N	1	B;B;B	0.21225	0.017;0.053;0.012	B;B;B	0.22386	0.011;0.011;0.039	T	0.42799	-0.9430	10	0.02654	T	1	.	3.9723	0.09458	0.5097:0.195:0.2182:0.0771	.	261;281;281	B4DP97;P78324-2;P78324	.;.;SHPS1_HUMAN	K	281	ENSP00000382941:Q281K;ENSP00000348307:Q281K;ENSP00000351621:Q281K	ENSP00000348307:Q281K	Q	+	1	0	SIRPA	1851045	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.328000	0.07945	-0.303000	0.08856	-0.176000	0.13171	CAG	.		0.537	SIRPA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077568.2	NM_080792	
C10orf131	100127889	hgsc.bcm.edu	37	10	97687099	97687099	+	Intron	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr10:97687099G>T	ENST00000423344.2	+	7	508				ENTPD1-AS1_ENST00000454638.1_RNA|ENTPD1-AS1_ENST00000452728.1_RNA|ENTPD1-AS1_ENST00000416301.1_RNA|ENTPD1-AS1_ENST00000451364.1_RNA	NM_001130446.2	NP_001123918.2	A6NCD4	CJ131_HUMAN	chromosome 10 open reading frame 131											endometrium(1)|kidney(1)	2						GGTTGGATTTGTTTGCCTCCC	0.398																																					.		.											.	.	.	0			.						.						183.0	155.0	163.0					10																	97687099		692	1591	2283	SO:0001627	intron_variant	0	.			GGATTTGTTTGCC		CCDS58090.1	10q24.1	2012-05-30			ENSG00000173088	ENSG00000173088			31667	protein-coding gene	gene with protein product							Standard	NM_001130446		Approved	bA690P14.3	uc010qoo.2	A6NCD4	OTTHUMG00000018824	ENST00000423344.2:c.312+10G>T	10.37:g.97687099G>T		55	0		45	4	.	B1AMZ2|B4DG41	RNA	SNP	ENST00000423344.2	37	CCDS58090.1																																																																																			.		0.398	C10orf131-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000468148.1	NM_001098847	
DNAH7	56171	hgsc.bcm.edu	37	2	196671535	196671535	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr2:196671535G>T	ENST00000312428.6	-	54	10205	c.10105C>A	c.(10105-10107)Cct>Act	p.P3369T		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3369					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						CATTCTTCAGGGAAAACCTCA	0.338																																					p.P3369T		.											.	.	.	0			c.C10105A						.						129.0	115.0	119.0					2																	196671535		1845	4089	5934	SO:0001583	missense	56171	exon54			CTTCAGGGAAAAC	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.10105C>A	2.37:g.196671535G>T	ENSP00000311273:p.Pro3369Thr	111	0		72	4	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	37	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.657674	0.88154	.	.	ENSG00000118997	ENST00000312428	T	0.17370	2.28	5.53	5.53	0.82687	Dynein heavy chain (1);	0.113777	0.33457	U	0.004886	T	0.58424	0.2121	H	0.96142	3.775	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.71210	-0.4660	10	0.72032	D	0.01	.	19.2483	0.93912	0.0:0.0:1.0:0.0	.	3369	Q8WXX0	DYH7_HUMAN	T	3369	ENSP00000311273:P3369T	ENSP00000311273:P3369T	P	-	1	0	DNAH7	196379780	1.000000	0.71417	0.997000	0.53966	0.974000	0.67602	8.922000	0.92789	2.882000	0.98803	0.655000	0.94253	CCT	.		0.338	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
PDE3A	5139	hgsc.bcm.edu;bcgsc.ca	37	12	20801776	20801776	+	Missense_Mutation	SNP	C	C	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr12:20801776C>T	ENST00000359062.3	+	13	2760	c.2720C>T	c.(2719-2721)gCc>gTc	p.A907V	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	907	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	GCAATTTTGGCCACTGACCTG	0.353																																					p.A907V		.											.	.	.	0			c.C2720T						.						109.0	103.0	105.0					12																	20801776		2203	4300	6503	SO:0001583	missense	5139	exon13			TTTTGGCCACTGA		CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.2720C>T	12.37:g.20801776C>T	ENSP00000351957:p.Ala907Val	88	0		86	4	NM_000921	O60865|Q13348|Q17RD1	Missense_Mutation	SNP	ENST00000359062.3	37	CCDS31754.1	.	.	.	.	.	.	.	.	.	.	C	32	5.166831	0.94768	.	.	ENSG00000172572	ENST00000359062	D	0.86769	-2.17	5.33	5.33	0.75918	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.103999	0.64402	D	0.000003	D	0.96119	0.8735	H	0.96833	3.89	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97274	0.9913	10	0.87932	D	0	.	19.3805	0.94530	0.0:1.0:0.0:0.0	.	907	Q14432	PDE3A_HUMAN	V	907	ENSP00000351957:A907V	ENSP00000351957:A907V	A	+	2	0	PDE3A	20693043	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.338000	0.79269	2.653000	0.90120	0.557000	0.71058	GCC	.		0.353	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2		
ELN	2006	hgsc.bcm.edu	37	7	73470731	73470731	+	Silent	SNP	C	C	A	rs376496267		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr7:73470731C>A	ENST00000252034.7	+	20	1680	c.1281C>A	c.(1279-1281)ccC>ccA	p.P427P	ELN_ENST00000429192.1_Silent_p.P432P|ELN_ENST00000414324.1_Silent_p.P422P|ELN_ENST00000380584.4_Silent_p.P413P|ELN_ENST00000380553.4_Silent_p.P310P|ELN_ENST00000380575.4_Silent_p.P417P|ELN_ENST00000445912.1_Silent_p.P427P|ELN_ENST00000380576.5_Silent_p.P427P|ELN_ENST00000358929.4_Silent_p.P427P|ELN_ENST00000320399.6_Silent_p.P427P|ELN_ENST00000320492.7_Intron|ELN_ENST00000357036.5_Silent_p.P432P|ELN_ENST00000380562.4_Silent_p.P427P|ELN_ENST00000458204.1_Silent_p.P417P	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	0	Ala-rich.				blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				GAGGTGTTCCCGGAGTCGGAG	0.617			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																														p.P432P		.		Dom	yes		7	7q11.23	2006	elastin	yes	L	ELN,NS,carcinoma,0,1	ELN	0	0			c.C1296A						.						103.0	99.0	100.0					7																	73470731		2203	4300	6503	SO:0001819	synonymous_variant	2006	exon20			TGTTCCCGGAGTC		CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.1281C>A	7.37:g.73470731C>A		39	0		37	3	NM_001081753	B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Silent	SNP	ENST00000252034.7	37	CCDS5562.2																																																																																			.		0.617	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316913.1	NM_000501	
ZNF804A	91752	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	185802286	185802286	+	Silent	SNP	T	T	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr2:185802286T>A	ENST00000302277.6	+	4	2757	c.2163T>A	c.(2161-2163)acT>acA	p.T721T		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	721							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						ATTCTAGAACTTACTGTTGTT	0.323																																					p.T721T		.											.	.	.	0			c.T2163A						.						55.0	52.0	53.0					2																	185802286		2203	4295	6498	SO:0001819	synonymous_variant	91752	exon4			TAGAACTTACTGT	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.2163T>A	2.37:g.185802286T>A		42	0		39	9	NM_194250	A7E253|Q6ZN26	Silent	SNP	ENST00000302277.6	37	CCDS2291.1																																																																																			.		0.323	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250	
LINC00283	100874057	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	103396598	103396598	+	RNA	SNP	T	T	C			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr13:103396598T>C	ENST00000430111.1	+	0	971									long intergenic non-protein coding RNA 283																		ACTCATACTTTTCTTGCCTAT	0.333																																					p.K2150R		.											.	.	.	0			c.A6449G						.						126.0	95.0	105.0					13																	103396598		692	1591	2283			643677	exon4			ATACTTTTCTTGC			13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		13.37:g.103396598T>C		41	0		23	5	NM_001146197		Missense_Mutation	SNP	ENST00000430111.1	37																																																																																				.		0.333	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	antisense	OTTHUMT00000045714.1		
MGA	23269	hgsc.bcm.edu	37	15	42028642	42028642	+	Missense_Mutation	SNP	C	C	A	rs367727094		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr15:42028642C>A	ENST00000570161.1	+	12	4180	c.4180C>A	c.(4180-4182)Cgt>Agt	p.R1394S	MGA_ENST00000545763.1_Missense_Mutation_p.R1394S|MGA_ENST00000566586.1_Missense_Mutation_p.R1394S|MGA_ENST00000219905.7_Missense_Mutation_p.R1394S|MGA_ENST00000389936.4_Missense_Mutation_p.R1394S			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TTATTCTTCTCGTGTGAAAAT	0.468																																					p.R1394S		.											MGA,NS,carcinoma,0,1	MGA	0	0			c.C4180A						.						69.0	67.0	67.0					15																	42028642		1881	4115	5996	SO:0001583	missense	23269	exon13			TCTTCTCGTGTGA	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.4180C>A	15.37:g.42028642C>A	ENSP00000457035:p.Arg1394Ser	47	0		43	3	NM_001080541	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000570161.1	37	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	C	19.16	3.773531	0.69992	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	T;T;D	0.86497	2.44;2.44;-2.13	5.82	5.82	0.92795	.	0.709020	0.12124	N	0.497423	D	0.89259	0.6664	N	0.24115	0.695	0.33246	D	0.557887	D;D	0.89917	0.998;1.0	D;D	0.81914	0.994;0.995	D	0.89503	0.3765	10	0.87932	D	0	.	13.9907	0.64364	0.252:0.748:0.0:0.0	.	1394;1394	F5H7K2;E7ENI0	.;.	S	1394	ENSP00000219905:R1394S;ENSP00000374586:R1394S;ENSP00000442467:R1394S	ENSP00000219905:R1394S	R	+	1	0	MGA	39815934	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.829000	0.48128	2.757000	0.94681	0.585000	0.79938	CGT	.		0.468	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
CDC27	996	hgsc.bcm.edu	37	17	45216149	45216149	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr17:45216149C>A	ENST00000066544.3	-	13	1753	c.1660G>T	c.(1660-1662)Gtt>Ttt	p.V554F	CDC27_ENST00000531206.1_Missense_Mutation_p.V560F|CDC27_ENST00000527547.1_Missense_Mutation_p.V553F|CDC27_ENST00000446365.2_Missense_Mutation_p.V493F	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	554					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.V554F(2)|p.V560F(1)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TTTGACAGAACTGAAAGAGCA	0.353																																					p.V560F		.											CDC27_ENST00000531206,NS,carcinoma,0,2	CDC27_ENST00000531206	0	3	Substitution - Missense(3)	prostate(3)	c.G1678T						.																																			SO:0001583	missense	996	exon13			ACAGAACTGAAAG	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1660G>T	17.37:g.45216149C>A	ENSP00000066544:p.Val554Phe	58	0		37	2	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.183994	0.78677	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	T;T;T;T	0.65178	-0.14;-0.14;0.15;-0.13	5.72	5.72	0.89469	Tetratricopeptide repeat-containing (1);	0.053020	0.85682	D	0.000000	T	0.33177	0.0854	N	0.01140	-0.99	0.58432	D	0.999997	B;B;P;B	0.36535	0.25;0.413;0.557;0.158	B;B;B;B	0.35073	0.052;0.195;0.195;0.07	T	0.44847	-0.9301	10	0.10111	T	0.7	-9.8133	17.3689	0.87371	0.0:1.0:0.0:0.0	.	493;553;560;554	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	F	554;560;493;553	ENSP00000066544:V554F;ENSP00000434614:V560F;ENSP00000392802:V493F;ENSP00000437339:V553F	ENSP00000066544:V554F	V	-	1	0	CDC27	42571148	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.487000	0.81328	2.706000	0.92434	0.650000	0.86243	GTT	.		0.353	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
PDZD2	23037	hgsc.bcm.edu	37	5	32093091	32093091	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr5:32093091C>A	ENST00000438447.1	+	21	8194	c.7806C>A	c.(7804-7806)acC>acA	p.T2602T	PDZD2_ENST00000282493.3_Silent_p.T2602T			O15018	PDZD2_HUMAN	PDZ domain containing 2	2602					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						CGAAATCTACCATCCTAACTC	0.433											OREG0016544	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T2602T		.											.	.	.	0			c.C7806A						.						82.0	83.0	82.0					5																	32093091		2203	4300	6503	SO:0001819	synonymous_variant	23037	exon20			ATCTACCATCCTA	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.7806C>A	5.37:g.32093091C>A		77	0	829	80	4	NM_178140	Q9BXD4	Silent	SNP	ENST00000438447.1	37	CCDS34137.1																																																																																			.		0.433	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
VARS	7407	hgsc.bcm.edu	37	6	31752382	31752382	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr6:31752382G>T	ENST00000375663.3	-	11	1897	c.1457C>A	c.(1456-1458)tCt>tAt	p.S486Y	VARS_ENST00000482996.1_5'Flank|VARS_ENST00000444930.2_Missense_Mutation_p.S191Y	NM_006295.2	NP_006286.1	P26640	SYVC_HUMAN	valyl-tRNA synthetase	486					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)	p.S486C(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	30					L-Valine(DB00161)	CTCAATGTCAGAGATGGCGGA	0.592																																					p.S486Y		.											VARS,NS,carcinoma,0,1	VARS	0	1	Substitution - Missense(1)	lung(1)	c.C1457A						.						95.0	80.0	85.0					6																	31752382		1511	2709	4220	SO:0001583	missense	7407	exon11			ATGTCAGAGATGG	BC012808	CCDS34412.1	6p21.3	2011-07-01		2005-07-05	ENSG00000204394	ENSG00000204394	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	12651	protein-coding gene	gene with protein product	"""valine tRNA ligase 1, cytoplasmic"""	192150	"""valyl-tRNA synthetase 2"""	VARS2		15779907	Standard	XM_005249362		Approved		uc003nxe.3	P26640	OTTHUMG00000031286	ENST00000375663.3:c.1457C>A	6.37:g.31752382G>T	ENSP00000364815:p.Ser486Tyr	24	0		20	2	NM_006295	B0V1N1|B4DZ61|Q5JQ90|Q96E77|Q9UQM2	Missense_Mutation	SNP	ENST00000375663.3	37	CCDS34412.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.869130	0.91587	.	.	ENSG00000204394	ENST00000375663;ENST00000444930	T;T	0.52983	0.64;0.64	5.55	5.55	0.83447	Rossmann-like alpha/beta/alpha sandwich fold (1);Aminoacyl-tRNA synthetase, class Ia (1);	0.073201	0.64402	D	0.000007	T	0.80949	0.4722	H	0.99590	4.645	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.89142	0.3517	10	0.87932	D	0	-8.2595	17.0061	0.86393	0.0:0.0:1.0:0.0	.	486	P26640	SYVC_HUMAN	Y	486;191	ENSP00000364815:S486Y;ENSP00000398317:S191Y	ENSP00000364815:S486Y	S	-	2	0	VARS	31860361	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	2.597000	0.87782	0.655000	0.94253	TCT	.		0.592	VARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076619.2	NM_006295	
DNAH5	1767	hgsc.bcm.edu	37	5	13859644	13859644	+	Nonsense_Mutation	SNP	C	C	A	rs147339019		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr5:13859644C>A	ENST00000265104.4	-	30	4971	c.4867G>T	c.(4867-4869)Gag>Tag	p.E1623*	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1623	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					ATCCAGCTCTCGATGATGTCT	0.418									Kartagener syndrome																												p.E1623X		.											DNAH5,NS,malignant_melanoma,0,1	DNAH5	0	0			c.G4867T						.						155.0	151.0	152.0					5																	13859644		2203	4300	6503	SO:0001587	stop_gained	1767	exon30	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AGCTCTCGATGAT	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.4867G>T	5.37:g.13859644C>A	ENSP00000265104:p.Glu1623*	45	0		39	2	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Nonsense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	C	47	13.529229	0.99747	.	.	ENSG00000039139	ENST00000265104	.	.	.	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.4818	0.95013	0.0:1.0:0.0:0.0	.	.	.	.	X	1623	.	ENSP00000265104:E1623X	E	-	1	0	DNAH5	13912644	1.000000	0.71417	0.996000	0.52242	0.809000	0.45718	7.529000	0.81952	2.667000	0.90743	0.563000	0.77884	GAG	.		0.418	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
ABCB5	340273	hgsc.bcm.edu	37	7	20766683	20766683	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr7:20766683G>T	ENST00000404938.2	+	22	3298	c.2646G>T	c.(2644-2646)gaG>gaT	p.E882D	ABCB5_ENST00000258738.6_Missense_Mutation_p.E437D	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	882	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						AAGCTTTGGAGAATATACGTA	0.328																																					p.E882D		.											ABCB5_ENST00000404938,bladder,carcinoma,0,2	ABCB5_ENST00000404938	0	0			c.G2646T						.						93.0	98.0	96.0					7																	20766683		2203	4300	6503	SO:0001583	missense	340273	exon22			TTTGGAGAATATA	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.2646G>T	7.37:g.20766683G>T	ENSP00000384881:p.Glu882Asp	53	0		47	3	NM_001163941	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	ENST00000404938.2	37	CCDS55090.1	.	.	.	.	.	.	.	.	.	.	G	13.31	2.199980	0.38905	.	.	ENSG00000004846	ENST00000404938;ENST00000258738	D;D	0.89939	-2.59;-2.59	4.54	1.62	0.23740	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.187601	0.35040	N	0.003500	D	0.85155	0.5632	L	0.56199	1.76	0.33295	D	0.56402	B;B;B	0.27951	0.116;0.006;0.195	B;B;B	0.37943	0.082;0.035;0.261	T	0.81311	-0.0990	10	0.45353	T	0.12	.	4.425	0.11498	0.2301:0.0:0.5956:0.1743	.	882;60;437	A7BKA4;A0ASV4;Q2M3G0	.;.;ABCB5_HUMAN	D	882;437	ENSP00000384881:E882D;ENSP00000258738:E437D	ENSP00000258738:E437D	E	+	3	2	ABCB5	20733208	0.977000	0.34250	1.000000	0.80357	0.991000	0.79684	-0.044000	0.12023	0.356000	0.24157	0.655000	0.94253	GAG	.		0.328	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559	
USP34	9736	hgsc.bcm.edu;bcgsc.ca	37	2	61413903	61413903	+	IGR	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr2:61413903G>T	ENST00000398571.2	-	0	11357				AHSA2_ENST00000394457.3_Silent_p.L132L|AHSA2_ENST00000489653.1_3'UTR|AHSA2_ENST00000410073.1_Silent_p.L141L|AHSA2_ENST00000357022.2_Silent_p.L132L	NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34						positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			CACTGCAGCTGACCCCCCTAA	0.338																																					p.L132L		.											.	.	.	0			c.G396T						.						39.0	41.0	40.0					2																	61413903		2201	4299	6500	SO:0001628	intergenic_variant	130872	exon6			GCAGCTGACCCCC	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265		2.37:g.61413903G>T		95	0		56	4	NM_152392	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Silent	SNP	ENST00000398571.2	37	CCDS42686.1																																																																																			.		0.338	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
CPA6	57094	hgsc.bcm.edu	37	8	68658284	68658284	+	Silent	SNP	C	C	A	rs369835154		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr8:68658284C>A	ENST00000297770.4	-	1	296	c.81G>T	c.(79-81)ccG>ccT	p.P27P	CPA6_ENST00000297769.4_5'UTR|CPA6_ENST00000518549.1_Silent_p.P27P	NM_020361.4	NP_065094.3	Q8N4T0	CBPA6_HUMAN	carboxypeptidase A6	27						proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(5)	26			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)			GGCTGTGCCCCGGTTGCAGAA	0.527																																					p.P27P		.											CPA6,caecum,carcinoma,0,1	CPA6	0	0			c.G81T						.						47.0	46.0	46.0					8																	68658284		2203	4300	6503	SO:0001819	synonymous_variant	57094	exon1			GTGCCCCGGTTGC	AF221594	CCDS6200.1	8q12.3	2012-02-10			ENSG00000165078	ENSG00000165078			17245	protein-coding gene	gene with protein product		609562				11836249	Standard	NM_020361		Approved	CPAH	uc003xxq.4	Q8N4T0	OTTHUMG00000164575	ENST00000297770.4:c.81G>T	8.37:g.68658284C>A		49	0		31	3	NM_020361	Q8NEX8|Q8TDE8|Q9NRI9	Silent	SNP	ENST00000297770.4	37	CCDS6200.1																																																																																			.		0.527	CPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379296.2	NM_020361	
NOTCH4	4855	hgsc.bcm.edu;bcgsc.ca	37	6	32169249	32169249	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr6:32169249G>T	ENST00000375023.3	-	22	3922	c.3784C>A	c.(3784-3786)Cac>Aac	p.H1262N		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	1262					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						TTGTGGAAGTGATCATGGCAG	0.557																																					p.H1262N		.											.	.	.	0			c.C3784A						.						75.0	74.0	74.0					6																	32169249		1509	2709	4218	SO:0001583	missense	4855	exon22			GGAAGTGATCATG		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.3784C>A	6.37:g.32169249G>T	ENSP00000364163:p.His1262Asn	43	0		98	5	NM_004557	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	ENST00000375023.3	37	CCDS34420.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.211324	0.79240	.	.	ENSG00000204301	ENST00000375023	D	0.81739	-1.53	4.57	4.57	0.56435	Notch domain (4);	0.000000	0.41097	D	0.000942	T	0.68421	0.2999	L	0.55017	1.72	0.80722	D	1	B	0.06786	0.001	B	0.15052	0.012	T	0.69829	-0.5039	10	0.51188	T	0.08	.	14.9337	0.70935	0.0:0.0:1.0:0.0	.	1262	Q99466	NOTC4_HUMAN	N	1262	ENSP00000364163:H1262N	ENSP00000364163:H1262N	H	-	1	0	NOTCH4	32277227	1.000000	0.71417	0.982000	0.44146	0.977000	0.68977	9.423000	0.97461	2.407000	0.81776	0.555000	0.69702	CAC	.		0.557	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2		
PUM1	9698	hgsc.bcm.edu;bcgsc.ca	37	1	31467928	31467928	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:31467928C>A	ENST00000257075.5	-	6	953	c.860G>T	c.(859-861)gGg>gTg	p.G287V	PUM1_ENST00000440538.2_Missense_Mutation_p.G287V|PUM1_ENST00000423018.2_Missense_Mutation_p.G191V|PUM1_ENST00000424085.2_Intron|PUM1_ENST00000373741.4_Missense_Mutation_p.G323V|PUM1_ENST00000373742.2_Missense_Mutation_p.G227V|PUM1_ENST00000426105.2_Missense_Mutation_p.G287V|PUM1_ENST00000373747.3_Missense_Mutation_p.G287V	NM_014676.2	NP_055491.1	Q14671	PUM1_HUMAN	pumilio RNA-binding family member 1	287					membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(17)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		TGCATCAATCCCATTCTGCAC	0.373																																					p.G287V		.											.	.	.	0			c.G860T						.						344.0	316.0	326.0					1																	31467928		2203	4300	6503	SO:0001583	missense	9698	exon6			TCAATCCCATTCT	AF315592	CCDS338.1, CCDS44099.1	1p35.2	2013-09-02	2013-09-02		ENSG00000134644	ENSG00000134644			14957	protein-coding gene	gene with protein product		607204	"""pumilio (Drosophila) homolog 1"", ""pumilio homolog 1 (Drosophila)"""				Standard	NM_001020658		Approved	PUMH1, KIAA0099	uc001bsh.1	Q14671	OTTHUMG00000003795	ENST00000257075.5:c.860G>T	1.37:g.31467928C>A	ENSP00000257075:p.Gly287Val	95	0		56	4	NM_014676	A8K6W4|B4DG92|D3DPN3|E9PCJ0|Q53HH5|Q5VXY7|Q9HAN1	Missense_Mutation	SNP	ENST00000257075.5	37	CCDS338.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.9|24.9	4.581741|4.581741	0.86748|0.86748	.|.	.|.	ENSG00000134644|ENSG00000134644	ENST00000257075;ENST00000373747;ENST00000426105;ENST00000440538;ENST00000373741;ENST00000423018;ENST00000373742;ENST00000543952|ENST00000525843;ENST00000532678	T;T;T;T;T;T;T|.	0.52983|.	0.83;1.16;1.14;1.04;1.1;0.64;0.75|.	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77565|0.77565	0.4149|0.4149	M|M	0.73962|0.73962	2.25|2.25	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D;D|.	0.97110|.	1.0;0.994;1.0;0.998;1.0;1.0;1.0|.	T|T	0.75758|0.75758	-0.3205|-0.3205	10|5	0.87932|.	D|.	0|.	-6.1631|-6.1631	19.635|19.635	0.95728|0.95728	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	227;191;323;287;287;287;287|.	B4DG92;E7EWT3;Q5T1Z8;Q14671-2;Q14671;E9PCJ0;Q5T1Z4|.	.;.;.;.;PUM1_HUMAN;.;.|.	V|C	287;287;287;287;323;191;227;287|303;8	ENSP00000257075:G287V;ENSP00000362852:G287V;ENSP00000391723:G287V;ENSP00000401777:G287V;ENSP00000362846:G323V;ENSP00000399440:G191V;ENSP00000362847:G227V|.	ENSP00000257075:G287V|.	G|W	-|-	2|3	0|0	PUM1|PUM1	31240515|31240515	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	6.490000|6.490000	0.73645|0.73645	2.733000|2.733000	0.93635|0.93635	0.655000|0.655000	0.94253|0.94253	GGG|TGG	.		0.373	PUM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000010671.1		
SPAG16	79582	hgsc.bcm.edu	37	2	215275017	215275017	+	Missense_Mutation	SNP	G	G	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr2:215275017G>A	ENST00000331683.5	+	16	1969	c.1874G>A	c.(1873-1875)gGc>gAc	p.G625D	AC107218.3_ENST00000412896.1_RNA|AC107218.3_ENST00000437883.1_RNA|VWC2L_ENST00000312504.5_5'Flank|SPAG16_ENST00000374309.3_Missense_Mutation_p.G531D|VWC2L_ENST00000427124.1_5'Flank	NM_024532.4	NP_078808.3	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16	625					cilium assembly (GO:0042384)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)		p.G625D(1)		endometrium(4)|kidney(1)|large_intestine(15)|lung(27)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	56		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		GGCTCTGACGGCACAGTTCGA	0.512																																					p.G625D		.											SPAG16,colon,carcinoma,0,1	SPAG16	0	1	Substitution - Missense(1)	large_intestine(1)	c.G1874A						.						117.0	111.0	113.0					2																	215275017		2203	4300	6503	SO:0001583	missense	79582	exon16			CTGACGGCACAGT	AF310672	CCDS2396.1, CCDS46508.1	2q34	2013-05-21			ENSG00000144451	ENSG00000144451		"""WD repeat domain containing"""	23225	protein-coding gene	gene with protein product		612173				12391165, 11867345	Standard	NM_024532		Approved	PF20, FLJ22724, DKFZp666P1710, WDR29	uc002veq.4	Q8N0X2	OTTHUMG00000133015	ENST00000331683.5:c.1874G>A	2.37:g.215275017G>A	ENSP00000332592:p.Gly625Asp	17	0		14	2	NM_024532	Q498B7|Q658W1|Q68DB3|Q6I9Z6|Q8N9C7|Q9H601	Missense_Mutation	SNP	ENST00000331683.5	37	CCDS2396.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.232969	0.79688	.	.	ENSG00000144451	ENST00000331683;ENST00000374309;ENST00000451561	T;T;T	0.65732	-0.17;-0.17;-0.17	5.48	5.48	0.80851	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.56097	D	0.000022	T	0.79173	0.4401	M	0.78916	2.43	0.51012	D	0.999906	D;P;D	0.89917	1.0;0.909;1.0	D;P;D	0.97110	1.0;0.688;1.0	T	0.75434	-0.3319	10	0.26408	T	0.33	.	17.8811	0.88841	0.0:0.0:1.0:0.0	.	531;565;625	B4DYB5;Q4G1A2;Q8N0X2	.;.;SPG16_HUMAN	D	625;531;249	ENSP00000332592:G625D;ENSP00000363428:G531D;ENSP00000416600:G249D	ENSP00000332592:G625D	G	+	2	0	SPAG16	214983262	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.853000	0.69496	2.737000	0.93849	0.563000	0.77884	GGC	.		0.512	SPAG16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256601.2	NM_024532	
ACSS3	79611	hgsc.bcm.edu	37	12	81536974	81536974	+	Nonsense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr12:81536974C>A	ENST00000548058.1	+	5	1779	c.869C>A	c.(868-870)tCa>tAa	p.S290*	ACSS3_ENST00000261206.3_Nonsense_Mutation_p.S289*			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	290						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						CCTGTTCTTTCAGAACACCCA	0.453																																					p.S290X		.											ACSS3,bladder,carcinoma,0,1	ACSS3	0	0			c.C869A						.						128.0	116.0	120.0					12																	81536974		2203	4300	6503	SO:0001587	stop_gained	79611	exon5			TTCTTTCAGAACA		CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.869C>A	12.37:g.81536974C>A	ENSP00000449535:p.Ser290*	58	0		50	3	NM_024560	Q8NC66	Nonsense_Mutation	SNP	ENST00000548058.1	37	CCDS9022.1	.	.	.	.	.	.	.	.	.	.	C	37	6.173881	0.97348	.	.	ENSG00000111058	ENST00000548058;ENST00000261206	.	.	.	5.58	5.58	0.84498	.	0.054145	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	-9.7518	19.9439	0.97175	0.0:1.0:0.0:0.0	.	.	.	.	X	290;289	.	ENSP00000261206:S289X	S	+	2	0	ACSS3	80061105	1.000000	0.71417	0.974000	0.42286	0.845000	0.48019	7.561000	0.82288	2.797000	0.96272	0.561000	0.74099	TCA	.		0.453	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407794.1	NM_024560	
PWP1	11137	hgsc.bcm.edu	37	12	108097519	108097519	+	Missense_Mutation	SNP	G	G	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr12:108097519G>A	ENST00000412830.3	+	10	1129	c.961G>A	c.(961-963)Gat>Aat	p.D321N	PWP1_ENST00000541166.1_Missense_Mutation_p.D259N	NM_007062.1	NP_008993.1	Q13610	PWP1_HUMAN	PWP1 homolog (S. cerevisiae)	321					transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(3)|endometrium(4)|kidney(1)|large_intestine(8)|lung(6)|urinary_tract(1)	23						TGGCTCATATGATAAGTAAGA	0.398																																					p.D321N		.											PWP1,colon,carcinoma,0,1	PWP1	0	0			c.G961A						.						183.0	172.0	176.0					12																	108097519		2203	4300	6503	SO:0001583	missense	11137	exon10			TCATATGATAAGT	BC000067	CCDS9114.1	12q23.3	2013-06-10				ENSG00000136045		"""WD repeat domain containing"""	17015	protein-coding gene	gene with protein product	"""endonuclein"""					7828893, 11850830	Standard	NM_007062		Approved	IEF-SSP-9502	uc001tmo.1	Q13610	OTTHUMG00000169913	ENST00000412830.3:c.961G>A	12.37:g.108097519G>A	ENSP00000387365:p.Asp321Asn	41	0		28	2	NM_007062	A8K3R6|Q7Z3X9	Missense_Mutation	SNP	ENST00000412830.3	37	CCDS9114.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.707786	0.89018	.	.	ENSG00000136045	ENST00000412830;ENST00000258531;ENST00000541166	D;D	0.88975	-2.45;-2.45	5.99	5.99	0.97316	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.96442	0.8839	H	0.94620	3.56	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96641	0.9474	10	0.72032	D	0.01	.	20.1322	0.98003	0.0:0.0:1.0:0.0	.	321	Q13610	PWP1_HUMAN	N	321;321;259	ENSP00000387365:D321N;ENSP00000445249:D259N	ENSP00000258531:D321N	D	+	1	0	PWP1	106621649	1.000000	0.71417	1.000000	0.80357	0.388000	0.30384	9.333000	0.96459	2.857000	0.98124	0.650000	0.86243	GAT	.		0.398	PWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406539.1	NM_007062	
LRP8	7804	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	1	53730058	53730058	+	Missense_Mutation	SNP	C	C	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:53730058C>T	ENST00000306052.6	-	10	1539	c.1438G>A	c.(1438-1440)Gac>Aac	p.D480N	LRP8_ENST00000371454.2_Missense_Mutation_p.D480N|LRP8_ENST00000354412.3_Missense_Mutation_p.D351N|LRP8_ENST00000465675.1_Missense_Mutation_p.D33N|LRP8_ENST00000460214.1_5'Flank|LRP8_ENST00000347547.2_Missense_Mutation_p.D310N	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	480					ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						CTGGCCTTGTCCATGTAGGCG	0.567																																					p.D480N		.											.	.	.	0			c.G1438A						.						67.0	55.0	59.0					1																	53730058		2203	4300	6503	SO:0001583	missense	7804	exon10			CCTTGTCCATGTA	D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.1438G>A	1.37:g.53730058C>T	ENSP00000303634:p.Asp480Asn	14	0		15	5	NM_004631	B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Missense_Mutation	SNP	ENST00000306052.6	37	CCDS578.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.77|18.77	3.694360|3.694360	0.68386|0.68386	.|.	.|.	ENSG00000157193|ENSG00000157193	ENST00000306052;ENST00000371454;ENST00000465675;ENST00000354412;ENST00000347547|ENST00000475501	D;D;D;D;D|.	0.95853|.	-3.83;-3.83;-3.83;-3.83;-3.83|.	5.13|5.13	5.13|5.13	0.70059|0.70059	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);|.	.|.	.|.	.|.	.|.	T|.	0.50956|.	0.1646|.	N|N	0.16016|0.16016	0.355|0.355	0.50313|0.50313	D|D	0.999865|0.999865	B;P;B;D;P;B|.	0.76494|.	0.423;0.558;0.06;0.999;0.715;0.423|.	P;B;B;D;P;P|.	0.83275|.	0.455;0.342;0.118;0.996;0.612;0.455|.	T|.	0.45220|.	-0.9276|.	9|.	0.46703|.	T|.	0.11|.	.|.	18.7706|18.7706	0.91890|0.91890	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	33;351;310;480;480;33|.	B3KU40;Q14114-2;Q14114-4;Q14114-3;Q14114;E9PP15|.	.;.;.;.;LRP8_HUMAN;.|.	N|X	480;480;33;351;310|168	ENSP00000303634:D480N;ENSP00000360509:D480N;ENSP00000437009:D33N;ENSP00000346391:D351N;ENSP00000334522:D310N|.	ENSP00000303634:D480N|.	D|W	-|-	1|3	0|0	LRP8|LRP8	53502646|53502646	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.961000|0.961000	0.63080|0.63080	2.309000|2.309000	0.43699|0.43699	2.660000|2.660000	0.90430|0.90430	0.557000|0.557000	0.71058|0.71058	GAC|TGG	.		0.567	LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000024699.1	NM_004631	
FDXR	2232	hgsc.bcm.edu	37	17	72859251	72859251	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr17:72859251G>T	ENST00000293195.5	-	11	1370	c.1292C>A	c.(1291-1293)cCc>cAc	p.P431H	FDXR_ENST00000455107.2_3'UTR|GRIN2C_ENST00000578159.1_5'Flank|FDXR_ENST00000581530.1_Missense_Mutation_p.P437H|FDXR_ENST00000582944.1_Missense_Mutation_p.P423H|FDXR_ENST00000420580.2_Missense_Mutation_p.P391H|GRIN2C_ENST00000347612.4_5'Flank|FDXR_ENST00000442102.2_Missense_Mutation_p.P474H|FDXR_ENST00000583917.1_Missense_Mutation_p.P403H|FDXR_ENST00000413947.2_Missense_Mutation_p.P462H|FDXR_ENST00000544854.1_Missense_Mutation_p.P379H	NM_001258014.1|NM_004110.3|NM_024417.2	NP_001244943.1|NP_004101.2|NP_077728.2	P22570	ADRO_HUMAN	ferredoxin reductase	431					cholesterol metabolic process (GO:0008203)|generation of precursor metabolites and energy (GO:0006091)|NADPH oxidation (GO:0070995)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ferredoxin-NADP+ reductase activity (GO:0004324)|NADPH binding (GO:0070402)|NADPH-adrenodoxin reductase activity (GO:0015039)	p.P437L(2)		central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16	all_lung(278;0.172)|Lung NSC(278;0.207)				Flavin adenine dinucleotide(DB03147)	GGGGCCAGAGGGGAGCAACCC	0.647																																					p.P474H		.											FDXR,NS,carcinoma,0,1	FDXR	0	2	Substitution - Missense(2)	lung(2)	c.C1421A						.						41.0	37.0	38.0					17																	72859251		2203	4300	6503	SO:0001583	missense	2232	exon11			CCAGAGGGGAGCA	J03826	CCDS11707.1, CCDS58591.1, CCDS58592.1, CCDS58593.1, CCDS58594.1, CCDS58595.1, CCDS58596.1	17q25.1	2013-06-18			ENSG00000161513	ENSG00000161513	1.18.1.6		3642	protein-coding gene	gene with protein product	"""adrenodoxin-NADP(+) reductase"", ""adrenodoxin reductase"""	103270		ADXR		2969697	Standard	NM_001258014		Approved		uc010wrl.2	P22570	OTTHUMG00000179026	ENST00000293195.5:c.1292C>A	17.37:g.72859251G>T	ENSP00000293195:p.Pro431His	51	0		42	2	NM_001258012	B4DDI7|B4DHX5|B4DQQ4|B4DX24|B7Z7G2|E7EQC1|Q13716|Q4PJI0|Q9BU12	Missense_Mutation	SNP	ENST00000293195.5	37	CCDS58593.1	.	.	.	.	.	.	.	.	.	.	G	11.88	1.769832	0.31320	.	.	ENSG00000161513	ENST00000420580;ENST00000544854;ENST00000293195;ENST00000442102;ENST00000413947	T;T;T;T	0.21734	3.04;3.06;1.99;1.99	4.74	4.74	0.60224	NAD(P)-binding domain (1);	0.298300	0.34802	N	0.003674	T	0.34424	0.0897	M	0.72479	2.2	0.20196	N	0.999925	D;D;P;P;P;P;B;P;B;P	0.58620	0.983;0.979;0.93;0.911;0.888;0.887;0.037;0.911;0.037;0.931	P;P;P;P;P;B;B;P;B;P	0.57009	0.811;0.799;0.692;0.493;0.472;0.406;0.016;0.493;0.016;0.472	T	0.22347	-1.0219	10	0.45353	T	0.12	-8.894	6.9186	0.24374	0.0953:0.179:0.7257:0.0	.	391;474;462;429;379;462;431;423;431;437	B4DQQ4;B4DHX5;E7EQC1;B4DDI9;B7Z7G2;B4DDI7;Q6GSK2;B4DX24;P22570;P22570-2	.;.;.;.;.;.;.;.;ADRO_HUMAN;.	H	391;379;437;474;462	ENSP00000414172:P391H;ENSP00000445432:P379H;ENSP00000416515:P474H;ENSP00000408595:P462H	ENSP00000293195:P437H	P	-	2	0	FDXR	70370846	0.199000	0.23386	0.894000	0.35097	0.115000	0.19883	2.880000	0.48530	2.171000	0.68590	0.462000	0.41574	CCC	.		0.647	FDXR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000444449.1	NM_004110	
CDCA2	157313	hgsc.bcm.edu;bcgsc.ca	37	8	25364722	25364722	+	Missense_Mutation	SNP	A	A	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr8:25364722A>T	ENST00000330560.3	+	15	3017	c.2540A>T	c.(2539-2541)aAt>aTt	p.N847I	CDCA2_ENST00000380665.3_Missense_Mutation_p.N832I|CDCA2_ENST00000521098.2_3'UTR	NM_152562.2	NP_689775.2	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2	847					mitotic nuclear division (GO:0007067)|positive regulation of protein dephosphorylation (GO:0035307)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(7)|lung(10)|ovary(1)|prostate(3)	35		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		TTGGAAAAAAATGGAAATCAC	0.393																																					p.N847I		.											.	.	.	0			c.A2540T						.						68.0	65.0	66.0					8																	25364722		2203	4300	6503	SO:0001583	missense	157313	exon15			AAAAAAATGGAAA	BG354575	CCDS6049.1	8p21.2	2014-06-12			ENSG00000184661	ENSG00000184661			14623	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 81"""					12188893, 16492807	Standard	NM_152562		Approved	Repo-Man, PPP1R81	uc003xep.1	Q69YH5	OTTHUMG00000099429	ENST00000330560.3:c.2540A>T	8.37:g.25364722A>T	ENSP00000328228:p.Asn847Ile	89	0		85	4	NM_152562	Q3SX74|Q4G0W0|Q5RKN0|Q69YI4|Q6P464|Q8N7C1	Missense_Mutation	SNP	ENST00000330560.3	37	CCDS6049.1	.	.	.	.	.	.	.	.	.	.	A	12.10	1.835951	0.32421	.	.	ENSG00000184661	ENST00000330560;ENST00000380665;ENST00000434814	T;T	0.31769	1.48;1.48	5.7	-8.7	0.00851	.	1.043780	0.07463	N	0.900914	T	0.16896	0.0406	L	0.38175	1.15	0.09310	N	1	B;B	0.10296	0.003;0.003	B;B	0.12156	0.007;0.007	T	0.35450	-0.9788	10	0.48119	T	0.1	-0.7768	3.3881	0.07278	0.2832:0.3451:0.2833:0.0883	.	832;847	E9PEI0;Q69YH5	.;CDCA2_HUMAN	I	847;832;246	ENSP00000328228:N847I;ENSP00000370040:N832I	ENSP00000328228:N847I	N	+	2	0	CDCA2	25420639	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-2.221000	0.01216	-0.999000	0.03442	0.528000	0.53228	AAT	.		0.393	CDCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216891.3	NM_152562	
WDR26	80232	hgsc.bcm.edu;bcgsc.ca	37	1	224605987	224605987	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:224605987G>T	ENST00000414423.2	-	6	1187	c.994C>A	c.(994-996)Ctg>Atg	p.L332M	WDR26_ENST00000366852.2_3'UTR|WDR26_ENST00000295024.6_Missense_Mutation_p.L185M	NM_001115113.2|NM_025160.6	NP_001108585.2|NP_079436.4	Q9H7D7	WDR26_HUMAN	WD repeat domain 26	332						cytoplasm (GO:0005737)|nucleus (GO:0005634)				biliary_tract(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)	18				GBM - Glioblastoma multiforme(131;0.0104)		TCTATAAGCAGAGACACAGAA	0.378																																					p.L332M		.											.	.	.	0			c.C994A						.						84.0	90.0	88.0					1																	224605987		2203	4300	6503	SO:0001583	missense	80232	exon6			TAAGCAGAGACAC	AK024669	CCDS31037.1, CCDS31037.2	1q42.13	2013-01-09			ENSG00000162923	ENSG00000162923		"""WD repeat domain containing"""	21208	protein-coding gene	gene with protein product	"""GID complex subunit 7 homolog (S. cerevisiae)"""						Standard	NM_001115113		Approved	FLJ21016, GID7	uc001hop.4	Q9H7D7	OTTHUMG00000037636	ENST00000414423.2:c.994C>A	1.37:g.224605987G>T	ENSP00000408108:p.Leu332Met	78	0		65	4	NM_025160	A0MNN3|Q4G100|Q59EC4|Q5GLZ9|Q86UY4|Q9H3C2	Missense_Mutation	SNP	ENST00000414423.2	37	CCDS31037.2	.	.	.	.	.	.	.	.	.	.	G	25.0	4.587982	0.86851	.	.	ENSG00000162923	ENST00000414423;ENST00000295024	T;T	0.76316	-1.01;-0.65	5.98	5.98	0.97165	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.90072	0.6899	M	0.86268	2.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.992;0.996	D	0.90136	0.4210	10	0.66056	D	0.02	.	20.4561	0.99145	0.0:0.0:1.0:0.0	.	332;316	Q9H7D7;Q9H7D7-2	WDR26_HUMAN;.	M	332;185	ENSP00000408108:L332M;ENSP00000295024:L185M	ENSP00000295024:L185M	L	-	1	2	WDR26	222672610	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.723000	0.74742	2.847000	0.97988	0.591000	0.81541	CTG	.		0.378	WDR26-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000091760.2	NM_025160	
XAGE3	170626	hgsc.bcm.edu;bcgsc.ca	37	X	52893907	52893907	+	Silent	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chrX:52893907G>T	ENST00000346279.3	-	4	280	c.210C>A	c.(208-210)ctC>ctA	p.L70L	XAGE3_ENST00000375491.3_Silent_p.L70L	NM_133179.2	NP_573440.1	Q8WTP9	XAGE3_HUMAN	X antigen family, member 3	70										kidney(1)|large_intestine(1)|lung(2)	4						ACAGCTCCTGGAGATCAGCTT	0.413																																					p.L70L		.											.	.	.	0			c.C210A						.						61.0	57.0	58.0					X																	52893907		2203	4299	6502	SO:0001819	synonymous_variant	170626	exon4			CTCCTGGAGATCA	BG354572	CCDS14347.1	Xp11.22	2010-09-27	2004-06-07	2005-01-27	ENSG00000171402	ENSG00000171402			14618	protein-coding gene	gene with protein product	"""cancer/testis antigen family 12, member 3a"", ""cancer/testis antigen family 12, member 3b"""	300740	"""placenta-specific 6; G antigen, family D, 4"""	PLAC6, GAGED4			Standard	NM_133179		Approved	XAGE-3, pp9012, CT12.3a, CT12.3b	uc004dre.3	Q8WTP9	OTTHUMG00000021587	ENST00000346279.3:c.210C>A	X.37:g.52893907G>T		105	0		98	5	NM_133179	Q5JS82|Q8WYS9	Silent	SNP	ENST00000346279.3	37	CCDS14347.1																																																																																			.		0.413	XAGE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056686.1	NM_133179	
C10orf71	118461	hgsc.bcm.edu	37	10	50530860	50530860	+	Silent	SNP	G	G	T	rs374572081		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr10:50530860G>T	ENST00000374144.3	+	3	558	c.270G>T	c.(268-270)acG>acT	p.T90T	C10orf71_ENST00000323868.4_Silent_p.T90T			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	90										endometrium(1)	1						CACAGGGCACGGAACATTCGG	0.572																																					p.T90T		.											C10orf71_ENST00000374144,NS,carcinoma,0,2	C10orf71_ENST00000374144	0	0			c.G270T						.						90.0	98.0	96.0					10																	50530860		1970	4146	6116	SO:0001819	synonymous_variant	118461	exon3			GGGCACGGAACAT	AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.270G>T	10.37:g.50530860G>T		48	0		30	2	NM_001135196	A0AVL8	Silent	SNP	ENST00000374144.3	37	CCDS44387.1																																																																																			.		0.572	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047984.2	NM_199459	
CCT6A	908	hgsc.bcm.edu	37	7	56119584	56119584	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr7:56119584C>A	ENST00000275603.4	+	1	262	c.43C>A	c.(43-45)Cga>Aga	p.R15R	CCT6A_ENST00000335503.3_Silent_p.R15R|PSPH_ENST00000395471.3_5'Flank|PSPH_ENST00000275605.3_5'Flank|CCT6A_ENST00000540286.1_Intron	NM_001762.3	NP_001753.1	P40227	TCPZ_HUMAN	chaperonin containing TCP1, subunit 6A (zeta 1)	15					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(1)|cervix(2)|endometrium(1)|large_intestine(4)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)	15	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CGAGGTGGCCCGAGCGCAGGC	0.667																																					p.R15R		.											.	.	.	0			c.C43A						.						9.0	9.0	9.0					7																	56119584		2139	4200	6339	SO:0001819	synonymous_variant	908	exon1			GTGGCCCGAGCGC	M94083	CCDS5523.1, CCDS34640.1	7p11.2	2011-09-02			ENSG00000146731	ENSG00000146731		"""Heat Shock Proteins / Chaperonins"""	1620	protein-coding gene	gene with protein product		104613		CCT6		1352881, 8034610	Standard	NM_001762		Approved	TTCP20, TCPZ, Cctz, HTR3, TCP20	uc003trl.1	P40227	OTTHUMG00000022842	ENST00000275603.4:c.43C>A	7.37:g.56119584C>A		58	0		78	4	NM_001762	A6NCD2|Q3KP28|Q75LP4|Q96S46	Silent	SNP	ENST00000275603.4	37	CCDS5523.1																																																																																			.		0.667	CCT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251526.2	NM_001762	
ZNF442	79973	hgsc.bcm.edu;bcgsc.ca	37	19	12461025	12461025	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr19:12461025C>A	ENST00000242804.4	-	6	1956	c.1374G>T	c.(1372-1374)gaG>gaT	p.E458D	ZNF442_ENST00000438182.1_Missense_Mutation_p.E389D|CTD-3105H18.13_ENST00000563695.2_lincRNA	NM_030824.2	NP_110451.1	Q9H7R0	ZN442_HUMAN	zinc finger protein 442	458					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	31						TATAGGGTTTCTCTCCAGTGT	0.388																																					p.E458D		.											.	.	.	0			c.G1374T						.						62.0	67.0	65.0					19																	12461025		2203	4300	6503	SO:0001583	missense	79973	exon6			GGGTTTCTCTCCA	AK024418	CCDS12271.1	19p13.13	2013-01-08			ENSG00000198342	ENSG00000198342		"""Zinc fingers, C2H2-type"", ""-"""	20877	protein-coding gene	gene with protein product							Standard	NM_030824		Approved	FLJ14356	uc002mtr.1	Q9H7R0	OTTHUMG00000156411	ENST00000242804.4:c.1374G>T	19.37:g.12461025C>A	ENSP00000242804:p.Glu458Asp	49	0		65	4	NM_030824	B4DJ48	Missense_Mutation	SNP	ENST00000242804.4	37	CCDS12271.1	.	.	.	.	.	.	.	.	.	.	C	12.47	1.948516	0.34377	.	.	ENSG00000198342	ENST00000242804;ENST00000438182	T;T	0.26810	1.71;1.71	0.832	-0.303	0.12792	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17408	0.0418	L	0.38649	1.16	0.25754	N	0.985021	B	0.02656	0.0	B	0.08055	0.003	T	0.24440	-1.0160	9	0.54805	T	0.06	.	5.0343	0.14426	0.0:0.7556:0.0:0.2444	.	458	Q9H7R0	ZN442_HUMAN	D	458;389	ENSP00000242804:E458D;ENSP00000388634:E389D	ENSP00000242804:E458D	E	-	3	2	ZNF442	12322025	1.000000	0.71417	0.839000	0.33178	0.585000	0.36419	1.743000	0.38258	-0.071000	0.12886	0.313000	0.20887	GAG	.		0.388	ZNF442-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344109.1	NM_030824	
HKDC1	80201	hgsc.bcm.edu	37	10	70992818	70992818	+	Missense_Mutation	SNP	G	G	T	rs555319606		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr10:70992818G>T	ENST00000354624.5	+	4	557	c.424G>T	c.(424-426)Gat>Tat	p.D142Y	RP11-227H15.4_ENST00000450995.1_RNA|HKDC1_ENST00000395086.2_Missense_Mutation_p.D142Y	NM_025130.3	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1	142	Hexokinase type-1 1.				carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)	cytosol (GO:0005829)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|mannokinase activity (GO:0019158)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						GAAGACCAAAGATTTAAAGCA	0.468													G|||	1	0.000199681	0.0	0.0	5008	,	,		21183	0.001		0.0	False		,,,				2504	0.0				p.D142Y		.											HKDC1,NS,carcinoma,0,1	HKDC1	0	0			c.G424T						.						104.0	98.0	100.0					10																	70992818		2203	4300	6503	SO:0001583	missense	80201	exon4			ACCAAAGATTTAA		CCDS7288.1	10q22.1	2006-10-24			ENSG00000156510	ENSG00000156510			23302	protein-coding gene	gene with protein product						12477932	Standard	NM_025130		Approved	FLJ37767, FLJ22761	uc001jpf.4	Q2TB90	OTTHUMG00000018371	ENST00000354624.5:c.424G>T	10.37:g.70992818G>T	ENSP00000346643:p.Asp142Tyr	26	0		33	3	NM_025130	B5MDN9|Q2TB91|Q5VTC7|Q7Z373|Q8WU37|Q96EH2|Q9H5Y9	Missense_Mutation	SNP	ENST00000354624.5	37	CCDS7288.1	.	.	.	.	.	.	.	.	.	.	G	9.957	1.221795	0.22457	.	.	ENSG00000156510	ENST00000354624;ENST00000395087;ENST00000395086	D;D	0.99089	-5.41;-5.41	4.3	2.42	0.29668	Hexokinase, N-terminal (1);	0.750686	0.12984	N	0.423042	D	0.96534	0.8869	L	0.41415	1.275	0.09310	N	1	B	0.19073	0.033	B	0.17433	0.018	D	0.93351	0.6718	10	0.66056	D	0.02	-0.602	4.9403	0.13961	0.2813:0.1575:0.5612:0.0	.	142	Q2TB90	HKDC1_HUMAN	Y	142	ENSP00000346643:D142Y;ENSP00000378521:D142Y	ENSP00000346643:D142Y	D	+	1	0	HKDC1	70662824	0.360000	0.24964	0.499000	0.27577	0.916000	0.54674	1.069000	0.30641	0.550000	0.28991	0.561000	0.74099	GAT	.		0.468	HKDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048389.1	NM_025130	
BIRC6	57448	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	32724972	32724972	+	Missense_Mutation	SNP	A	A	G			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr2:32724972A>G	ENST00000421745.2	+	46	8961	c.8827A>G	c.(8827-8829)Aga>Gga	p.R2943G		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	2943					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					ATACAGTGCAAGAGTGTCTGT	0.403																																					p.R2943G	Pancreas(94;175 1509 16028 18060 45422)	.											.	.	.	0			c.A8827G						.						108.0	107.0	107.0					2																	32724972		2203	4300	6503	SO:0001583	missense	57448	exon46			AGTGCAAGAGTGT	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.8827A>G	2.37:g.32724972A>G	ENSP00000393596:p.Arg2943Gly	27	0		28	9	NM_016252	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	A	14.75	2.629788	0.46944	.	.	ENSG00000115760	ENST00000421745	T	0.74526	-0.85	5.13	3.93	0.45458	.	0.058487	0.64402	D	0.000002	T	0.64057	0.2564	L	0.50333	1.59	0.50467	D	0.99987	B	0.33694	0.421	B	0.30646	0.118	T	0.61023	-0.7146	10	0.22706	T	0.39	.	10.4159	0.44322	0.5864:0.4136:0.0:0.0	.	2943	Q9NR09	BIRC6_HUMAN	G	2943	ENSP00000393596:R2943G	ENSP00000393596:R2943G	R	+	1	2	BIRC6	32578476	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.825000	0.55730	2.046000	0.60703	0.533000	0.62120	AGA	.		0.403	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
BMS1P4	729096	hgsc.bcm.edu	37	10	75464597	75464597	+	RNA	SNP	A	A	C	rs539648760|rs68141424	byFrequency	TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr10:75464597A>C	ENST00000399449.3	-	0	1480				RP11-574K11.28_ENST00000580790.1_RNA|RP11-574K11.29_ENST00000415917.2_lincRNA|RNA5SP320_ENST00000516263.1_RNA																							ctccctctcaaaaaaaaaaaa	0.473																																					.		.											.	.	.	0			.						.																																					729096	.			CTCTCAAAAAAAA																													10.37:g.75464597A>C		59	0		46	6	.		RNA	SNP	ENST00000399449.3	37																																																																																				.		0.473	RP11-464F9.1-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript	OTTHUMT00000048674.2		
RASGRP2	10235	hgsc.bcm.edu;bcgsc.ca	37	11	64509528	64509528	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr11:64509528G>T	ENST00000354024.3	-	3	382	c.130C>A	c.(130-132)Ccc>Acc	p.P44T	RASGRP2_ENST00000377494.1_Missense_Mutation_p.P44T|RASGRP2_ENST00000394428.1_Intron|RASGRP2_ENST00000394430.1_Missense_Mutation_p.P44T|RASGRP2_ENST00000377486.3_Missense_Mutation_p.P44T|RASGRP2_ENST00000377487.1_Missense_Mutation_p.P44T|RASGRP2_ENST00000394429.1_Intron|RASGRP2_ENST00000394432.3_Missense_Mutation_p.P44T|RASGRP2_ENST00000377497.3_Missense_Mutation_p.P44T|RASGRP2_ENST00000377489.1_Missense_Mutation_p.P44T	NM_153819.1	NP_722541.1	Q7LDG7	GRP2_HUMAN	RAS guanyl releasing protein 2 (calcium and DAG-regulated)	44	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				blood coagulation (GO:0007596)|cellular response to calcium ion (GO:0071277)|platelet activation (GO:0030168)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						ATGTACCAGGGGTGCATCATG	0.652																																					p.P44T		.											.	.	.	0			c.C130A						.						44.0	42.0	43.0					11																	64509528		2201	4297	6498	SO:0001583	missense	10235	exon3			ACCAGGGGTGCAT	U78170	CCDS31598.1	11q13	2014-09-17			ENSG00000068831	ENSG00000068831		"""EF-hand domain containing"""	9879	protein-coding gene	gene with protein product		605577				9789079	Standard	NM_001098670		Approved	CALDAG-GEFI	uc009ypv.3	Q7LDG7	OTTHUMG00000045420	ENST00000354024.3:c.130C>A	11.37:g.64509528G>T	ENSP00000338864:p.Pro44Thr	44	0		47	4	NM_001098671	A6NDC7|O00538|Q9UL65	Missense_Mutation	SNP	ENST00000354024.3	37	CCDS31598.1	.	.	.	.	.	.	.	.	.	.	G	13.67	2.305151	0.40795	.	.	ENSG00000068831	ENST00000377494;ENST00000394432;ENST00000377497;ENST00000354024;ENST00000431822;ENST00000377486;ENST00000377487;ENST00000377489;ENST00000394430;ENST00000439594;ENST00000377485;ENST00000430645	T;T;T;T;T;T;T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55;1.55	4.67	3.76	0.43208	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (3);	0.059521	0.64402	D	0.000002	T	0.34164	0.0888	L	0.57536	1.79	0.49582	D	0.9998	P	0.36577	0.558	B	0.41271	0.352	T	0.20840	-1.0263	10	0.59425	D	0.04	-24.1534	11.3297	0.49468	0.0923:0.0:0.9077:0.0	.	44	Q7LDG7	GRP2_HUMAN	T	44	ENSP00000366714:P44T;ENSP00000377953:P44T;ENSP00000366717:P44T;ENSP00000338864:P44T;ENSP00000399114:P44T;ENSP00000366706:P44T;ENSP00000366707:P44T;ENSP00000366709:P44T;ENSP00000377951:P44T;ENSP00000366705:P44T;ENSP00000401314:P44T	ENSP00000338864:P44T	P	-	1	0	RASGRP2	64266104	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.999000	0.63934	1.290000	0.44636	0.313000	0.20887	CCC	.		0.652	RASGRP2-002	NOVEL	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142062.1	NM_153819	
ZHX3	23051	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	39832673	39832673	+	Missense_Mutation	SNP	G	G	C			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr20:39832673G>C	ENST00000309060.3	-	4	1299	c.884C>G	c.(883-885)gCc>gGc	p.A295G	ZHX3_ENST00000558993.1_Intron|ZHX3_ENST00000560361.1_Missense_Mutation_p.A295G|ZHX3_ENST00000544979.2_Missense_Mutation_p.A295G|ZHX3_ENST00000557816.1_Intron|ZHX3_ENST00000559234.1_Missense_Mutation_p.A295G|ZHX3_ENST00000540170.1_Missense_Mutation_p.A295G|ZHX3_ENST00000432768.2_Missense_Mutation_p.A295G			Q9H4I2	ZHX3_HUMAN	zinc fingers and homeoboxes 3	295	Required for homodimerization and interaction with NFYA.				cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of osteoblast differentiation (GO:0045669)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|kidney(5)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		Myeloproliferative disorder(115;0.00425)				TTTGGGAAGGGCCTTGGCCGT	0.572																																					p.A295G		.											.	.	.	0			c.C884G						.						91.0	80.0	84.0					20																	39832673		2203	4300	6503	SO:0001583	missense	23051	exon3			GGAAGGGCCTTGG	AB007855	CCDS13315.1	20q12	2012-03-09	2004-01-29	2004-01-30	ENSG00000174306	ENSG00000174306		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	15935	protein-coding gene	gene with protein product		609598	"""triple homeobox 1"""	TIX1		9455477	Standard	XM_005260343		Approved	KIAA0395	uc002xjs.1	Q9H4I2	OTTHUMG00000032481	ENST00000309060.3:c.884C>G	20.37:g.39832673G>C	ENSP00000312222:p.Ala295Gly	31	0		33	15	NM_015035	E1P5W5|F5H820|O43145|Q6NUJ7	Missense_Mutation	SNP	ENST00000309060.3	37	CCDS13315.1	.	.	.	.	.	.	.	.	.	.	G	12.48	1.950830	0.34471	.	.	ENSG00000174306	ENST00000309060;ENST00000373263;ENST00000540170;ENST00000544979;ENST00000373262;ENST00000432768	T;T;T;T;T	0.30981	1.51;2.92;2.92;2.71;1.51	6.07	6.07	0.98685	.	0.231325	0.42294	D	0.000734	T	0.19087	0.0458	N	0.08118	0	0.22457	N	0.999083	B;B;B	0.31077	0.004;0.004;0.307	B;B;B	0.30572	0.012;0.012;0.117	T	0.23868	-1.0176	10	0.49607	T	0.09	-12.0795	15.3709	0.74564	0.0:0.0:0.8606:0.1393	.	295;295;295	A8K8Q0;Q9H4I2;F5H820	.;ZHX3_HUMAN;.	G	295;295;295;295;73;295	ENSP00000312222:A295G;ENSP00000362360:A295G;ENSP00000442290:A295G;ENSP00000443783:A295G;ENSP00000415498:A295G	ENSP00000312222:A295G	A	-	2	0	ZHX3	39266087	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.065000	0.57513	2.884000	0.98904	0.655000	0.94253	GCC	.		0.572	ZHX3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079262.3	NM_015035	
ABCA7	10347	hgsc.bcm.edu	37	19	1052100	1052100	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr19:1052100G>T	ENST00000263094.6	+	22	3353	c.3122G>T	c.(3121-3123)cGc>cTc	p.R1041L	ABCA7_ENST00000433129.1_Missense_Mutation_p.R1041L|ABCA7_ENST00000435683.2_Missense_Mutation_p.R903L	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	1041					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGAAGGCCCGCCTGCCCCTG	0.672																																					p.R1041L		.											ABCA7,caecum,carcinoma,0,1	ABCA7	0	0			c.G3122T						.						24.0	24.0	24.0					19																	1052100		2186	4279	6465	SO:0001583	missense	10347	exon22			AGGCCCGCCTGCC	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.3122G>T	19.37:g.1052100G>T	ENSP00000263094:p.Arg1041Leu	16	0		21	2	NM_019112	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	ENST00000263094.6	37	CCDS12055.1	.	.	.	.	.	.	.	.	.	.	g	10.10	1.258293	0.23051	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	D;D	0.86432	-2.12;-2.12	4.44	-7.01	0.01594	.	.	.	.	.	T	0.69151	0.3079	N	0.16790	0.44	0.09310	N	1	B;B	0.12630	0.006;0.001	B;B	0.13407	0.009;0.002	T	0.54364	-0.8305	9	0.30078	T	0.28	.	2.9362	0.05815	0.1702:0.2792:0.3863:0.1643	.	903;1041	Q8IZY2-2;Q8IZY2	.;ABCA7_HUMAN	L	1041	ENSP00000263094:R1041L;ENSP00000414062:R1041L	ENSP00000263094:R1041L	R	+	2	0	ABCA7	1003100	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-1.104000	0.03326	-0.620000	0.05641	-0.330000	0.08379	CGC	.		0.672	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
PCED1A	64773	hgsc.bcm.edu	37	20	2819363	2819363	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr20:2819363C>A	ENST00000360652.2	-	5	975	c.473G>T	c.(472-474)cGg>cTg	p.R158L	PCED1A_ENST00000356872.3_Missense_Mutation_p.R107L|VPS16_ENST00000380445.3_5'Flank|VPS16_ENST00000380469.3_5'Flank	NM_022760.4	NP_073597.2	Q9H1Q7	PED1A_HUMAN	PC-esterase domain containing 1A	158																	CAGGTTCTCCCGGTAGCTCTC	0.582																																					p.R158L		.											FAM113A,colon,carcinoma,0,1	FAM113A	0	0			c.G473T						.						172.0	154.0	160.0					20																	2819363		2203	4300	6503	SO:0001583	missense	64773	exon5			TTCTCCCGGTAGC	AK026029	CCDS13035.1, CCDS59442.1	20p13	2012-06-11	2012-06-11	2012-06-11	ENSG00000132635	ENSG00000132635			16212	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 81"", ""family with sequence similarity 113, member A"""	C20orf81, FAM113A		20056006	Standard	NM_022760		Approved	bA12M19.1, FLJ22376	uc002wgz.2	Q9H1Q7	OTTHUMG00000031716	ENST00000360652.2:c.473G>T	20.37:g.2819363C>A	ENSP00000353868:p.Arg158Leu	18	0		33	2	NM_022760	Q5JUA5|Q5JUA6|Q6PK19|Q86WF5|Q96CG7|Q9H1Q6|Q9H6D1	Missense_Mutation	SNP	ENST00000360652.2	37	CCDS13035.1	.	.	.	.	.	.	.	.	.	.	C	12.12	1.844032	0.32606	.	.	ENSG00000132635	ENST00000356872;ENST00000360652;ENST00000448755;ENST00000439542	T;T;T;T	0.20200	2.09;2.09;2.09;2.09	3.89	2.93	0.34026	Esterase, SGNH hydrolase-type (1);Esterase, SGNH hydrolase-type, subgroup (1);	0.151472	0.40908	D	0.000997	T	0.10723	0.0262	N	0.13235	0.315	0.39966	D	0.974729	B;B	0.24426	0.031;0.103	B;B	0.24701	0.034;0.055	T	0.12192	-1.0557	10	0.33141	T	0.24	-7.013	6.7152	0.23300	0.0:0.872:0.0:0.128	.	107;158	Q9H1Q7-2;Q9H1Q7	.;F113A_HUMAN	L	107;158;107;158	ENSP00000349334:R107L;ENSP00000353868:R158L;ENSP00000388935:R107L;ENSP00000401711:R158L	ENSP00000349334:R107L	R	-	2	0	FAM113A	2767363	0.494000	0.26043	0.922000	0.36590	0.442000	0.32017	0.684000	0.25364	2.205000	0.71048	0.462000	0.41574	CGG	.		0.582	PCED1A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077676.2	NM_022760	
ZNF264	9422	hgsc.bcm.edu	37	19	57723025	57723025	+	Nonsense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr19:57723025C>A	ENST00000263095.6	+	4	974	c.560C>A	c.(559-561)tCa>tAa	p.S187*	ZNF264_ENST00000536056.1_Nonsense_Mutation_p.S187*	NM_003417.4	NP_003408.1	O43296	ZN264_HUMAN	zinc finger protein 264	187					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	27		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)		AGCCATAACTCATGTGAGTCA	0.433																																					p.S187X		.											ZNF264,NS,carcinoma,0,1	ZNF264	0	0			c.C560A						.						92.0	84.0	87.0					19																	57723025		2203	4300	6503	SO:0001587	stop_gained	9422	exon4			ATAACTCATGTGA	AB007872	CCDS33127.1	19q13.4	2013-01-08				ENSG00000083844		"""Zinc fingers, C2H2-type"", ""-"""	13057	protein-coding gene	gene with protein product		604668				9455477	Standard	NM_003417		Approved	KIAA0412	uc002qob.3	O43296		ENST00000263095.6:c.560C>A	19.37:g.57723025C>A	ENSP00000263095:p.Ser187*	33	0		38	2	NM_003417	A8K8Y9|Q9P1V0	Nonsense_Mutation	SNP	ENST00000263095.6	37	CCDS33127.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.966008	0.92855	.	.	ENSG00000083844	ENST00000263095;ENST00000536056	.	.	.	1.79	1.79	0.24919	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	.	6.3505	0.21373	0.0:0.8336:0.0:0.1664	.	.	.	.	X	187	.	ENSP00000263095:S187X	S	+	2	0	ZNF264	62414837	0.075000	0.21258	0.009000	0.14445	0.060000	0.15804	1.169000	0.31871	1.325000	0.45301	0.555000	0.69702	TCA	.		0.433	ZNF264-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465080.1		
KLHL3	26249	hgsc.bcm.edu	37	5	136997638	136997638	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr5:136997638C>A	ENST00000309755.4	-	7	1162	c.719G>T	c.(718-720)cGa>cTa	p.R240L	KLHL3_ENST00000508657.1_Missense_Mutation_p.R208L|KLHL3_ENST00000506491.1_Missense_Mutation_p.R158L|KLHL3_ENST00000506873.1_5'UTR|KLHL3_ENST00000394937.3_Missense_Mutation_p.R240L|KLHL3_ENST00000541417.1_Missense_Mutation_p.R120L	NM_017415.2	NP_059111.2	Q9UH77	KLHL3_HUMAN	kelch-like family member 3	240	BACK.				distal tubule morphogenesis (GO:0072156)|ion homeostasis (GO:0050801)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|renal sodium ion absorption (GO:0070294)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	structural molecule activity (GO:0005198)			breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|stomach(1)|upper_aerodigestive_tract(1)	21		all_hematologic(541;3.67e-07)|Breast(839;7.61e-05)|Prostate(281;0.000825)|Ovarian(839;0.0481)|all_lung(232;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	GBM - Glioblastoma multiforme(465;0.0223)		GAGAGGAAGTCGGACATGTTC	0.443																																					p.R240L		.											KLHL3,colon,carcinoma,-1,1	KLHL3	-1	0			c.G719T						.						161.0	135.0	144.0					5																	136997638		2203	4300	6503	SO:0001583	missense	26249	exon7			GGAAGTCGGACAT	AB032955	CCDS4192.1, CCDS58969.1, CCDS58970.1	5q31	2013-01-30	2013-01-30		ENSG00000146021	ENSG00000146021		"""Kelch-like"", ""BTB/POZ domain containing"""	6354	protein-coding gene	gene with protein product		605775	"""kelch (Drosophila)-like 3"", ""kelch-like 3 (Drosophila)"""			10843806	Standard	NM_017415		Approved	KIAA1129	uc010jek.3	Q9UH77	OTTHUMG00000129155	ENST00000309755.4:c.719G>T	5.37:g.136997638C>A	ENSP00000312397:p.Arg240Leu	73	0		47	2	NM_017415	B2RBK7|Q9UH75|Q9UH76|Q9ULU0|Q9Y6V6	Missense_Mutation	SNP	ENST00000309755.4	37	CCDS4192.1	.	.	.	.	.	.	.	.	.	.	C	34	5.362881	0.95877	.	.	ENSG00000146021	ENST00000506491;ENST00000508657;ENST00000309755;ENST00000541417;ENST00000505853;ENST00000394937	T;T;T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44;-1.44;-1.44	4.99	4.99	0.66335	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	D	0.94159	0.8126	H	0.98559	4.265	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.994;1.0;0.999;1.0;1.0	D	0.96128	0.9090	10	0.87932	D	0	.	18.8301	0.92135	0.0:1.0:0.0:0.0	.	9;200;208;240;240	B7Z6E2;D6RH21;Q9UH77-2;Q9UH77;Q8N4I8	.;.;.;KLHL3_HUMAN;.	L	158;208;240;120;200;240	ENSP00000424828:R158L;ENSP00000422099:R208L;ENSP00000312397:R240L;ENSP00000440319:R120L;ENSP00000426173:R200L;ENSP00000378395:R240L	ENSP00000312397:R240L	R	-	2	0	KLHL3	137025537	1.000000	0.71417	0.985000	0.45067	0.902000	0.53008	7.567000	0.82357	2.767000	0.95098	0.655000	0.94253	CGA	.		0.443	KLHL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251220.2		
ATP11B	23200	hgsc.bcm.edu;bcgsc.ca	37	3	182583433	182583433	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr3:182583433C>A	ENST00000323116.5	+	13	1650	c.1390C>A	c.(1390-1392)Cat>Aat	p.H464N		NM_014616.2	NP_055431.1	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B	464					aminophospholipid transport (GO:0015917)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|ion transmembrane transporter activity (GO:0015075)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	41	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			CAACTTATCCCATCTTACAAC	0.323																																					p.H464N		.											.	.	.	0			c.C1390A						.						89.0	92.0	91.0					3																	182583433		2203	4300	6503	SO:0001583	missense	23200	exon13			TTATCCCATCTTA	AF156548	CCDS33896.1	3q27	2010-04-20	2007-09-19		ENSG00000058063	ENSG00000058063		"""ATPases / P-type"""	13553	protein-coding gene	gene with protein product		605869	"""ATPase, Class VI, type 11B"""			10231032, 11015572	Standard	NM_014616		Approved	ATPIF, ATPIR, KIAA0956	uc003flb.3	Q9Y2G3	OTTHUMG00000158295	ENST00000323116.5:c.1390C>A	3.37:g.182583433C>A	ENSP00000321195:p.His464Asn	86	0		73	4	NM_014616	Q96FN1|Q9UKK7	Missense_Mutation	SNP	ENST00000323116.5	37	CCDS33896.1	.	.	.	.	.	.	.	.	.	.	C	12.48	1.949865	0.34377	.	.	ENSG00000058063	ENST00000323116	D	0.95724	-3.79	5.2	5.2	0.72013	ATPase, cation-transporting, domain N (1);HAD-like domain (1);	0.723943	0.12199	N	0.490471	D	0.87289	0.6140	N	0.04636	-0.2	0.80722	D	1	B;B	0.19817	0.039;0.01	B;B	0.15052	0.01;0.012	T	0.80797	-0.1222	10	0.15066	T	0.55	.	11.0764	0.48034	0.0:0.9072:0.0:0.0928	.	38;464	B3KSJ2;Q9Y2G3	.;AT11B_HUMAN	N	464	ENSP00000321195:H464N	ENSP00000321195:H464N	H	+	1	0	ATP11B	184066127	0.000000	0.05858	0.929000	0.37066	0.724000	0.41520	0.780000	0.26760	2.689000	0.91719	0.650000	0.86243	CAT	.		0.323	ATP11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350598.1	NM_014616	
NFYB	4801	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	12	104517018	104517018	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr12:104517018G>T	ENST00000240055.3	-	5	642	c.415C>A	c.(415-417)Cag>Aag	p.Q139K	RNA5SP370_ENST00000362545.1_RNA|NFYB_ENST00000551727.1_Missense_Mutation_p.Q139K	NM_006166.3	NP_006157.1	P25208	NFYB_HUMAN	nuclear transcription factor Y, beta	139	B domain.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	CCAAT-binding factor complex (GO:0016602)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			large_intestine(1)|lung(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	6						CTGAATTTCTGAAGGTATAAT	0.363																																					p.Q139K		.											.	.	.	0			c.C415A						.						76.0	74.0	75.0					12																	104517018		2203	4300	6503	SO:0001583	missense	4801	exon5			ATTTCTGAAGGTA		CCDS9098.1	12q22-q23	2008-11-11				ENSG00000120837			7805	protein-coding gene	gene with protein product		189904				1774067, 9612081	Standard	NM_006166		Approved	CBF-A, HAP3, NF-YB	uc001tkl.1	P25208	OTTHUMG00000170176	ENST00000240055.3:c.415C>A	12.37:g.104517018G>T	ENSP00000240055:p.Gln139Lys	38	0		29	4	NM_006166	A8K7B9|Q96IY8	Missense_Mutation	SNP	ENST00000240055.3	37	CCDS9098.1	.	.	.	.	.	.	.	.	.	.	.	20.7	4.029601	0.75504	.	.	ENSG00000120837	ENST00000240055;ENST00000551727	T;T	0.21932	1.98;1.98	5.49	5.49	0.81192	Histone-fold (2);	0.111193	0.64402	D	0.000006	T	0.28067	0.0692	M	0.72894	2.215	0.80722	D	1	B	0.31435	0.323	B	0.24394	0.053	T	0.07065	-1.0792	10	0.59425	D	0.04	-18.2343	19.3764	0.94512	0.0:0.0:1.0:0.0	.	139	P25208	NFYB_HUMAN	K	139	ENSP00000240055:Q139K;ENSP00000447486:Q139K	ENSP00000240055:Q139K	Q	-	1	0	NFYB	103041148	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.731000	0.98807	2.582000	0.87167	0.591000	0.81541	CAG	.		0.363	NFYB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407786.1		
ERC2	26059	hgsc.bcm.edu	37	3	56468705	56468705	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr3:56468705G>T	ENST00000288221.6	-	2	586	c.331C>A	c.(331-333)Cac>Aac	p.H111N		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	111						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)		p.H111Y(1)		breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		ACATCTGTGTGGGAAAGTCCA	0.527																																					p.H111N		.											ERC2_ENST00000288221,trunk,malignant_melanoma,0,1	ERC2_ENST00000288221	0	1	Substitution - Missense(1)	skin(1)	c.C331A						.						187.0	183.0	184.0					3																	56468705		2013	4161	6174	SO:0001583	missense	26059	exon2			CTGTGTGGGAAAG	AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.331C>A	3.37:g.56468705G>T	ENSP00000288221:p.His111Asn	41	0		31	2	NM_015576	Q2T9F6|Q86TK4	Missense_Mutation	SNP	ENST00000288221.6	37	CCDS46851.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.022133	0.75275	.	.	ENSG00000187672	ENST00000288221	T	0.29142	1.58	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.28632	0.0709	L	0.40543	1.245	0.39822	D	0.972849	B	0.32620	0.378	B	0.24006	0.05	T	0.06588	-1.0818	10	0.52906	T	0.07	-25.03	20.024	0.97514	0.0:0.0:1.0:0.0	.	111	O15083	ERC2_HUMAN	N	111	ENSP00000288221:H111N	ENSP00000288221:H111N	H	-	1	0	ERC2	56443745	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.876000	0.87215	2.718000	0.92993	0.655000	0.94253	CAC	.		0.527	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350884.2	NM_015576	
ADAMTS16	170690	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	5318295	5318295	+	Silent	SNP	C	C	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr5:5318295C>T	ENST00000274181.7	+	22	3598	c.3460C>T	c.(3460-3462)Ctg>Ttg	p.L1154L		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	1154	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						CGTGCAGTGCCTGGCTGGGGG	0.652																																					p.L1154L		.											.	.	.	0			c.C3460T						.						34.0	40.0	38.0					5																	5318295		2079	4193	6272	SO:0001819	synonymous_variant	170690	exon22			CAGTGCCTGGCTG	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.3460C>T	5.37:g.5318295C>T		29	0		21	14	NM_139056	C6G490|Q8IVE2	Silent	SNP	ENST00000274181.7	37	CCDS43299.1																																																																																			.		0.652	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
AHNAK	79026	hgsc.bcm.edu;bcgsc.ca	37	11	62287880	62287880	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr11:62287880G>T	ENST00000378024.4	-	5	14283	c.14009C>A	c.(14008-14010)cCa>cAa	p.P4670Q	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	4670					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				ATCCACATCTGGGCCCTCTCC	0.507																																					p.P4670Q		.											.	.	.	0			c.C14009A						.						240.0	247.0	245.0					11																	62287880		2202	4299	6501	SO:0001583	missense	79026	exon5			ACATCTGGGCCCT	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.14009C>A	11.37:g.62287880G>T	ENSP00000367263:p.Pro4670Gln	75	0		83	4	NM_001620	A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	G	13.86	2.363398	0.41902	.	.	ENSG00000124942	ENST00000378024	T	0.05786	3.39	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.38268	0.1034	H	0.97564	4.03	0.46901	D	0.999247	D	0.76494	0.999	D	0.79784	0.993	T	0.55927	-0.8063	10	0.62326	D	0.03	-2.1121	13.2611	0.60106	0.0:0.0:0.8412:0.1588	.	4670	Q09666	AHNK_HUMAN	Q	4670	ENSP00000367263:P4670Q	ENSP00000367263:P4670Q	P	-	2	0	AHNAK	62044456	1.000000	0.71417	0.992000	0.48379	0.247000	0.25773	5.242000	0.65389	2.397000	0.81536	0.549000	0.68633	CCA	.		0.507	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
LARS2	23395	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	45500306	45500306	+	Silent	SNP	A	A	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr3:45500306A>T	ENST00000415258.1	+	7	819	c.678A>T	c.(676-678)tcA>tcT	p.S226S	LARS2_ENST00000265537.3_Silent_p.S226S|LARS2_ENST00000414984.1_Silent_p.S183S			Q15031	SYLM_HUMAN	leucyl-tRNA synthetase 2, mitochondrial	226					gene expression (GO:0010467)|leucyl-tRNA aminoacylation (GO:0006429)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|leucine-tRNA ligase activity (GO:0004823)			endometrium(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				BRCA - Breast invasive adenocarcinoma(193;0.0122)|KIRC - Kidney renal clear cell carcinoma(197;0.0313)|Kidney(197;0.0372)	L-Leucine(DB00149)	ATGGCTGTTCATGGCGTTCTG	0.483																																					p.S226S		.											.	.	.	0			c.A678T						.						133.0	122.0	126.0					3																	45500306		2203	4300	6503	SO:0001819	synonymous_variant	23395	exon8			CTGTTCATGGCGT	AJ312685	CCDS2728.1	3p21.3	2012-10-26			ENSG00000011376	ENSG00000011376	6.1.1.4	"""Aminoacyl tRNA synthetases / Class I"""	17095	protein-coding gene	gene with protein product	"""leucine tRNA ligase 2, mitochondrial"""	604544				20194621, 15123417	Standard	NM_015340		Approved	KIAA0028, LEURS, MGC26121	uc003cop.1	Q15031	OTTHUMG00000133177	ENST00000415258.1:c.678A>T	3.37:g.45500306A>T		33	0		25	20	NM_015340		Silent	SNP	ENST00000415258.1	37	CCDS2728.1																																																																																			.		0.483	LARS2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345001.1	NM_015340	
COPB2	9276	hgsc.bcm.edu	37	3	139097937	139097937	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr3:139097937G>T	ENST00000333188.5	-	4	488	c.307C>A	c.(307-309)Cgc>Agc	p.R103S	COPB2_ENST00000507777.1_Missense_Mutation_p.R74S|COPB2_ENST00000510491.1_5'UTR	NM_004766.2	NP_004757.1	P35606	COPB2_HUMAN	coatomer protein complex, subunit beta 2 (beta prime)	103					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)	structural molecule activity (GO:0005198)	p.R103C(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	24						GCAATACAGCGAATGTAGTCT	0.383																																					p.R103S		.											COPB2,caecum,carcinoma,0,1	COPB2	0	1	Substitution - Missense(1)	large_intestine(1)	c.C307A						.						124.0	116.0	119.0					3																	139097937		2203	4300	6503	SO:0001583	missense	9276	exon4			TACAGCGAATGTA	BC000326	CCDS3108.1	3q23	2013-01-10			ENSG00000184432	ENSG00000184432		"""WD repeat domain containing"""	2232	protein-coding gene	gene with protein product		606990				9858824	Standard	NM_004766		Approved	beta'-COP, betaprime-COP	uc003etf.4	P35606	OTTHUMG00000159959	ENST00000333188.5:c.307C>A	3.37:g.139097937G>T	ENSP00000329419:p.Arg103Ser	49	0		65	3	NM_004766	B4DZI8	Missense_Mutation	SNP	ENST00000333188.5	37	CCDS3108.1	.	.	.	.	.	.	.	.	.	.	G	32	5.180202	0.94846	.	.	ENSG00000184432	ENST00000333188;ENST00000507777;ENST00000515006;ENST00000512153;ENST00000513274;ENST00000512242;ENST00000514508	T;T;T;T;T;T;T	0.81078	0.2;0.2;-1.45;0.2;0.2;0.2;-1.45	5.64	5.64	0.86602	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.86477	0.5942	L	0.38838	1.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87108	0.2183	10	0.87932	D	0	-21.7541	20.0639	0.97700	0.0:0.0:1.0:0.0	.	103;103	B4E2C9;P35606	.;COPB2_HUMAN	S	103;74;103;74;74;74;74	ENSP00000329419:R103S;ENSP00000422295:R74S;ENSP00000423271:R103S;ENSP00000422547:R74S;ENSP00000424144:R74S;ENSP00000427185:R74S;ENSP00000422469:R74S	ENSP00000329419:R103S	R	-	1	0	COPB2	140580627	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.639000	0.98448	2.817000	0.96982	0.557000	0.71058	CGC	.		0.383	COPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358495.2	NM_004766	
OPA1	4976	hgsc.bcm.edu	37	3	193372782	193372782	+	Nonsense_Mutation	SNP	G	G	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr3:193372782G>A	ENST00000392438.3	+	20	2213	c.1979G>A	c.(1978-1980)tGg>tAg	p.W660*	OPA1_ENST00000361828.2_Nonsense_Mutation_p.W678*|OPA1_ENST00000361150.2_Nonsense_Mutation_p.W661*|OPA1_ENST00000361908.3_Nonsense_Mutation_p.W697*|OPA1_ENST00000361715.2_Nonsense_Mutation_p.W679*|OPA1_ENST00000361510.2_Nonsense_Mutation_p.W715*	NM_015560.2	NP_056375.2	O60313	OPA1_HUMAN	optic atrophy 1 (autosomal dominant)	660					apoptotic process (GO:0006915)|axon transport of mitochondrion (GO:0019896)|cellular senescence (GO:0090398)|GTP catabolic process (GO:0006184)|inner mitochondrial membrane organization (GO:0007007)|mitochondrial fission (GO:0000266)|mitochondrial fusion (GO:0008053)|mitochondrion organization (GO:0007005)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neural tube closure (GO:0001843)|visual perception (GO:0007601)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial crista (GO:0030061)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)			breast(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(4)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(2)	31	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		CTTAAACAGTGGACTGATAAA	0.368																																					p.W715X		.											.	.	.	0			c.G2144A						.						89.0	89.0	89.0					3																	193372782		2203	4300	6503	SO:0001587	stop_gained	4976	exon22			AACAGTGGACTGA	AB011139	CCDS33917.1, CCDS43186.1	3q29	2014-09-17			ENSG00000198836	ENSG00000198836			8140	protein-coding gene	gene with protein product	"""mitochondrial dynamin-like GTPase"", ""dynamin-like guanosine triphosphatase"", ""Dynamin-like 120 kDa protein, mitochondrial"""	605290				9490303	Standard	NM_015560		Approved	NTG, KIAA0567, FLJ12460, NPG, MGM1	uc003ftg.3	O60313	OTTHUMG00000149897	ENST00000392438.3:c.1979G>A	3.37:g.193372782G>A	ENSP00000376233:p.Trp660*	76	0		76	4	NM_130837	D3DNW4	Nonsense_Mutation	SNP	ENST00000392438.3	37	CCDS43186.1	.	.	.	.	.	.	.	.	.	.	G	41	9.056640	0.99051	.	.	ENSG00000198836	ENST00000361908;ENST00000392438;ENST00000361510;ENST00000361715;ENST00000361828;ENST00000361150	.	.	.	5.83	5.83	0.93111	.	0.056293	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.9602	19.0981	0.93263	0.0:0.0:1.0:0.0	.	.	.	.	X	697;660;715;679;678;661	.	ENSP00000354781:W661X	W	+	2	0	OPA1	194855476	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.869000	0.99810	2.753000	0.94483	0.585000	0.79938	TGG	.		0.368	OPA1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313812.2	NM_130837	
SETX	23064	hgsc.bcm.edu	37	9	135202917	135202917	+	Silent	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr9:135202917G>T	ENST00000224140.5	-	10	4250	c.4068C>A	c.(4066-4068)ccC>ccA	p.P1356P	SETX_ENST00000372169.2_Silent_p.P1356P|SETX_ENST00000393220.1_Silent_p.P1356P	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	1356					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.P1356P(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		TTTGTGATTTGGGTCTGATCT	0.358																																					p.P1356P		.											SETX,NS,carcinoma,0,1	SETX	0	1	Substitution - coding silent(1)	lung(1)	c.C4068A						.						96.0	96.0	96.0					9																	135202917		2203	4300	6503	SO:0001819	synonymous_variant	23064	exon10			TGATTTGGGTCTG	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.4068C>A	9.37:g.135202917G>T		53	0		39	2	NM_015046	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Silent	SNP	ENST00000224140.5	37	CCDS6947.1																																																																																			.		0.358	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3	NM_015046	
OR5I1	10798	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	55703319	55703319	+	Silent	SNP	C	C	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr11:55703319C>T	ENST00000301532.3	-	1	557	c.558G>A	c.(556-558)ctG>ctA	p.L186L		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	186					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						ATAGTTTAAGCAGGGGAGGGA	0.403																																					p.L186L		.											.	.	.	0			c.G558A						.						57.0	63.0	61.0					11																	55703319		2199	4292	6491	SO:0001819	synonymous_variant	10798	exon1			TTTAAGCAGGGGA	BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.558G>A	11.37:g.55703319C>T		66	0		55	7	NM_006637	Q6IEU4	Silent	SNP	ENST00000301532.3	37	CCDS7949.1																																																																																			.		0.403	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391528.1	NM_006637	
MMP8	4317	hgsc.bcm.edu;bcgsc.ca	37	11	102592253	102592253	+	Silent	SNP	G	G	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr11:102592253G>A	ENST00000236826.3	-	4	599	c.501C>T	c.(499-501)caC>caT	p.H167H		NM_002424.2	NP_002415.1	P22894	MMP8_HUMAN	matrix metallopeptidase 8 (neutrophil collagenase)	167					collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(4)|skin(6)|stomach(1)|urinary_tract(1)	32	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)	Marimastat(DB00786)	AATTGTCACCGTGATCTGAAA	0.428																																					p.H167H		.											.	.	.	0			c.C501T						.						136.0	117.0	123.0					11																	102592253		2203	4299	6502	SO:0001819	synonymous_variant	4317	exon4			GTCACCGTGATCT	J05556	CCDS8320.1	11q21-q22	2008-02-05	2005-08-08		ENSG00000118113	ENSG00000118113	3.4.24.34		7175	protein-coding gene	gene with protein product		120355	"""matrix metalloproteinase 8 (neutrophil collagenase)"""	CLG1			Standard	NM_002424		Approved		uc001phe.2	P22894	OTTHUMG00000167587	ENST00000236826.3:c.501C>T	11.37:g.102592253G>A		107	0		77	4	NM_002424	Q45F99	Silent	SNP	ENST00000236826.3	37	CCDS8320.1	.	.	.	.	.	.	.	.	.	.	G	7.340	0.620687	0.14193	.	.	ENSG00000118113	ENST00000438475	.	.	.	5.75	3.39	0.38822	.	.	.	.	.	T	0.57755	0.2075	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50874	-0.8776	4	.	.	.	.	8.2254	0.31566	0.7329:0.0:0.2671:0.0	.	.	.	.	W	143	.	.	R	-	1	2	MMP8	102097463	0.999000	0.42202	1.000000	0.80357	0.899000	0.52679	2.167000	0.42415	0.456000	0.26937	-0.982000	0.02568	CGG	.		0.428	MMP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395223.1	NM_002424	
CASP1	834	hgsc.bcm.edu	37	11	104899882	104899882	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr11:104899882C>A	ENST00000533400.1	-	7	1010	c.975G>T	c.(973-975)aaG>aaT	p.K325N	CASP1_ENST00000593315.1_Missense_Mutation_p.K304N|CASP1_ENST00000525825.1_Missense_Mutation_p.K304N|CASP1_ENST00000598974.1_Missense_Mutation_p.K325N|CASP1_ENST00000594519.1_Intron|CASP1_ENST00000446369.1_Intron|CASP1_ENST00000528974.1_Missense_Mutation_p.K286N|CASP1_ENST00000415981.2_Intron|CASP1_ENST00000393136.4_Missense_Mutation_p.K304N|CASP1_ENST00000534497.1_Intron|CASP1_ENST00000353247.5_Intron|CASP1_ENST00000531166.1_Intron|CASP1_ENST00000436863.3_Missense_Mutation_p.K325N|CASP1_ENST00000527979.1_Missense_Mutation_p.K288N|CASP1_ENST00000526568.1_Missense_Mutation_p.K232N	NM_001257118.1	NP_001244047.1	P29466	CASP1_HUMAN	caspase 1, apoptosis-related cysteine peptidase	325					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic substance (GO:0071310)|execution phase of apoptosis (GO:0097194)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|membrane hyperpolarization (GO:0060081)|mitochondrial depolarization (GO:0051882)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 alpha secretion (GO:0050717)|positive regulation of interleukin-1 beta secretion (GO:0050718)|programmed necrotic cell death (GO:0097300)|proteolysis (GO:0006508)|pyroptosis (GO:0070269)|regulation of inflammatory response (GO:0050727)|response to ATP (GO:0033198)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|IPAF inflammasome complex (GO:0072557)|NLRP1 inflammasome complex (GO:0072558)|NLRP3 inflammasome complex (GO:0072559)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|cysteine-type endopeptidase activity (GO:0004197)|endopeptidase activity (GO:0004175)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000525)|Epithelial(105;0.0128)|all cancers(92;0.0482)	Minocycline(DB01017)	CGATAAAATCCTTCTCTATGT	0.398																																					p.K325N	NSCLC(41;1246 1743 4934)	.											.	.	.	0			c.G975T						.						122.0	113.0	116.0					11																	104899882		2202	4299	6501	SO:0001583	missense	834	exon7			AAAATCCTTCTCT	U13697	CCDS8329.1, CCDS8330.1, CCDS8331.1, CCDS8332.1, CCDS53704.1	11q23	2012-02-29	2012-02-29		ENSG00000137752	ENSG00000137752		"""Caspases"""	1499	protein-coding gene	gene with protein product	"""caspase-1"", ""interleukin 1, beta, convertase"""	147678	"""caspase 1, apoptosis-related cysteine protease (interleukin 1, beta, convertase)"", ""caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)"""	IL1BC		1373520, 9250871	Standard	NM_033292		Approved	ICE	uc001pim.5	P29466	OTTHUMG00000048072	ENST00000533400.1:c.975G>T	11.37:g.104899882C>A	ENSP00000433138:p.Lys325Asn	70	0		59	3	NM_001257118	B5MDZ1|Q53EY6|Q6DMQ1|Q6GSS3|Q6PI75|Q9UCN3	Missense_Mutation	SNP	ENST00000533400.1	37	CCDS8330.1	.	.	.	.	.	.	.	.	.	.	.	14.61	2.586446	0.46110	.	.	ENSG00000137752	ENST00000532439;ENST00000526568;ENST00000527979;ENST00000533400;ENST00000436863;ENST00000393136;ENST00000525825;ENST00000528974	T;T;T;T;T;T;T;T	0.21734	1.99;1.99;1.99;1.99;1.99;1.99;1.99;1.99	4.34	1.7	0.24286	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase non-catalytic subunit p10 (1);Peptidase C14, caspase precursor p45, core (1);	0.172475	0.51477	D	0.000090	T	0.43411	0.1246	M	0.88450	2.955	0.26959	N	0.965852	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.995;0.999;1.0;0.999;1.0	T	0.28364	-1.0046	10	0.49607	T	0.09	.	3.1042	0.06336	0.1928:0.5081:0.0:0.2991	.	286;325;304;325;288;232	B4DVD8;A8K249;P29466-2;P29466;G3V169;P29466-3	.;.;.;CASP1_HUMAN;.;.	N	174;232;288;325;325;304;304;286	ENSP00000435536:K174N;ENSP00000434250:K232N;ENSP00000432340:K288N;ENSP00000433138:K325N;ENSP00000410076:K325N;ENSP00000376844:K304N;ENSP00000434779:K304N;ENSP00000434259:K286N	ENSP00000376844:K304N	K	-	3	2	CASP1	104405092	0.998000	0.40836	0.993000	0.49108	0.663000	0.39108	0.306000	0.19279	0.267000	0.21916	0.557000	0.71058	AAG	.		0.398	CASP1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388116.1	NM_033292	
KATNAL2	83473	hgsc.bcm.edu	37	18	44603829	44603829	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr18:44603829C>A	ENST00000592005.1	+	5	924	c.251C>A	c.(250-252)cCg>cAg	p.P84Q	RP11-49K24.4_ENST00000592747.1_RNA|KATNAL2_ENST00000245121.5_Missense_Mutation_p.P331Q|KATNAL2_ENST00000356157.7_Missense_Mutation_p.P403Q					katanin p60 subunit A-like 2									p.P331L(1)		central_nervous_system(2)|endometrium(3)|large_intestine(8)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	27						TCTAACCTGCCGTGGTAAGAG	0.428																																					p.P331Q		.											KATNAL2,colon,carcinoma,0,1	KATNAL2	0	1	Substitution - Missense(1)	large_intestine(1)	c.C992A						.						114.0	102.0	106.0					18																	44603829		2203	4300	6503	SO:0001583	missense	83473	exon12			ACCTGCCGTGGTA	BC034999	CCDS32828.1	18q21.1	2010-04-21			ENSG00000167216	ENSG00000167216		"""ATPases / AAA-type"""	25387	protein-coding gene	gene with protein product		614697				12477932	Standard	NM_031303		Approved	MGC33211, DKFZP667C165	uc002lco.3	Q8IYT4		ENST00000592005.1:c.251C>A	18.37:g.44603829C>A	ENSP00000467610:p.Pro84Gln	39	0		43	3	NM_031303		Missense_Mutation	SNP	ENST00000592005.1	37		.	.	.	.	.	.	.	.	.	.	C	19.81	3.895752	0.72639	.	.	ENSG00000167216	ENST00000356157;ENST00000245121;ENST00000454462	D;D	0.95412	-3.7;-3.7	5.83	5.83	0.93111	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.98538	0.9512	H	0.94385	3.53	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99056	1.0829	10	0.87932	D	0	-2.0E-4	20.1208	0.97960	0.0:1.0:0.0:0.0	.	171;403	F8WBL0;Q8IYT4	.;KATL2_HUMAN	Q	403;331;171	ENSP00000348478:P403Q;ENSP00000245121:P331Q	ENSP00000245121:P331Q	P	+	2	0	KATNAL2	42857827	1.000000	0.71417	0.989000	0.46669	0.262000	0.26303	7.431000	0.80335	2.758000	0.94735	0.655000	0.94253	CCG	.		0.428	KATNAL2-008	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000446324.2	NM_031303	
HTN1	3346	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	70918808	70918808	+	Silent	SNP	C	C	T	rs577124582	byFrequency	TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr4:70918808C>T	ENST00000511674.1	+	2	86	c.15C>T	c.(13-15)gtC>gtT	p.V5V	HTN1_ENST00000246896.3_Silent_p.V5V			P15515	HIS1_HUMAN	histatin 1	5					biomineral tissue development (GO:0031214)|defense response to bacterium (GO:0042742)|defense response to fungus (GO:0050832)|killing of cells of other organism (GO:0031640)	extracellular region (GO:0005576)				endometrium(1)|large_intestine(1)|lung(2)|skin(2)	6						AGTTTTTTGTCTTTGCTTTAG	0.313													C|||	3	0.000599042	0.0	0.0	5008	,	,		19141	0.0		0.0	False		,,,				2504	0.0031				p.V5V		.											.	.	.	0			c.C15T						.						176.0	159.0	165.0					4																	70918808		2202	4298	6500	SO:0001819	synonymous_variant	3346	exon2			TTTTGTCTTTGCT		CCDS3534.1	4q13	2008-02-05			ENSG00000126550	ENSG00000126550			5283	protein-coding gene	gene with protein product		142701					Standard	NM_002159		Approved	HIS1	uc003hex.3	P15515	OTTHUMG00000129397	ENST00000511674.1:c.15C>T	4.37:g.70918808C>T		93	0		57	17	NM_002159		Silent	SNP	ENST00000511674.1	37	CCDS3534.1																																																																																			.		0.313	HTN1-005	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362220.2		
ZFHX4	79776	hgsc.bcm.edu;bcgsc.ca	37	8	77617104	77617104	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr8:77617104G>T	ENST00000521891.2	+	2	1229	c.781G>T	c.(781-783)Gac>Tac	p.D261Y	ZFHX4_ENST00000518282.1_Missense_Mutation_p.D261Y|ZFHX4_ENST00000455469.2_Missense_Mutation_p.D261Y|ZFHX4_ENST00000050961.6_Missense_Mutation_p.D261Y|ZFHX4_ENST00000517683.1_Intron	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	261					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TAACAATGTGGACTTGTCCAA	0.418										HNSCC(33;0.089)																											p.D261Y		.											ZFHX4,colon,carcinoma,0,1	ZFHX4	0	0			c.G781T						.						193.0	190.0	191.0					8																	77617104		2121	4272	6393	SO:0001583	missense	79776	exon2			AATGTGGACTTGT		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.781G>T	8.37:g.77617104G>T	ENSP00000430497:p.Asp261Tyr	111	0		87	4	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	12.99	2.102809	0.37145	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.56103	0.48;0.51;0.48;0.48	5.43	5.43	0.79202	.	0.000000	0.47093	U	0.000256	T	0.72653	0.3487	M	0.67953	2.075	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.999;0.999;0.999	T	0.73795	-0.3870	10	0.72032	D	0.01	.	19.4356	0.94792	0.0:0.0:1.0:0.0	.	261;261;261;261	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	Y	261	ENSP00000430497:D261Y;ENSP00000399605:D261Y;ENSP00000050961:D261Y;ENSP00000430848:D261Y	ENSP00000050961:D261Y	D	+	1	0	ZFHX4	77779659	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.263000	0.95617	2.826000	0.97356	0.655000	0.94253	GAC	.		0.418	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
CUL2	8453	hgsc.bcm.edu	37	10	35327979	35327979	+	Missense_Mutation	SNP	C	C	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr10:35327979C>T	ENST00000374748.1	-	10	1059	c.746G>A	c.(745-747)cGa>cAa	p.R249Q	CUL2_ENST00000537177.1_Missense_Mutation_p.R268Q|CUL2_ENST00000374746.1_Missense_Mutation_p.R249Q|CUL2_ENST00000374742.1_Missense_Mutation_p.R249Q|CUL2_ENST00000374751.3_Missense_Mutation_p.R249Q|CUL2_ENST00000602371.1_Missense_Mutation_p.R192Q|CUL2_ENST00000374749.3_Missense_Mutation_p.R249Q			Q13617	CUL2_HUMAN	cullin 2	249					cell cycle arrest (GO:0007050)|cellular response to hypoxia (GO:0071456)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul2-RING ubiquitin ligase complex (GO:0031462)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|VCB complex (GO:0030891)	ubiquitin protein ligase binding (GO:0031625)	p.R249Q(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|prostate(2)|skin(1)|urinary_tract(2)	31						TTTTCGACATCGAATTTCTTC	0.318																																					p.R268Q		.											CUL2,rectum,carcinoma,0,1	CUL2	0	1	Substitution - Missense(1)	large_intestine(1)	c.G803A						.						116.0	106.0	109.0					10																	35327979		2203	4296	6499	SO:0001583	missense	8453	exon9			CGACATCGAATTT	U83410	CCDS7179.1, CCDS73086.1	10p11.2	2011-05-24			ENSG00000108094	ENSG00000108094			2552	protein-coding gene	gene with protein product		603135				8681378	Standard	NM_003591		Approved		uc021ppa.1	Q13617	OTTHUMG00000017950	ENST00000374748.1:c.746G>A	10.37:g.35327979C>T	ENSP00000363880:p.Arg249Gln	72	0		75	3	NM_001198778	B3KT95|B7Z6K8|D3DRY6|G3V1S2|O00200|Q5T2B6|Q9UNF9	Missense_Mutation	SNP	ENST00000374748.1	37	CCDS7179.1	.	.	.	.	.	.	.	.	.	.	C	36	5.889487	0.97068	.	.	ENSG00000108094	ENST00000374751;ENST00000374748;ENST00000374746;ENST00000374749;ENST00000374754;ENST00000374742;ENST00000537177	T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87	6.16	6.16	0.99307	Cullin, N-terminal (1);Cullin repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.73063	0.3539	M	0.89095	3.005	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	T	0.75900	-0.3154	10	0.87932	D	0	-8.0139	20.8598	0.99761	0.0:1.0:0.0:0.0	.	249;268;249	Q5T2B5;G3V1S2;Q13617	.;.;CUL2_HUMAN	Q	249;249;249;249;192;249;268	ENSP00000363883:R249Q;ENSP00000363880:R249Q;ENSP00000363878:R249Q;ENSP00000363881:R249Q;ENSP00000363874:R249Q;ENSP00000444856:R268Q	ENSP00000363874:R249Q	R	-	2	0	CUL2	35367985	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.818000	0.86416	2.937000	0.99478	0.650000	0.86243	CGA	.		0.318	CUL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047538.1	NM_003591	
BTRC	8945	hgsc.bcm.edu	37	10	103294590	103294590	+	Nonsense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr10:103294590G>T	ENST00000370187.3	+	10	1388	c.1270G>T	c.(1270-1272)Gga>Tga	p.G424*	BTRC_ENST00000408038.2_Nonsense_Mutation_p.G388*|BTRC_ENST00000393441.4_Nonsense_Mutation_p.G383*	NM_033637.3	NP_378663.1	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing E3 ubiquitin protein ligase	424					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to organic cyclic compound (GO:0071407)|G2/M transition of mitotic cell cycle (GO:0000086)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(4)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	27		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		GGTGCTGGTCGGACACCGAGC	0.453																																					p.G424X		.											.	.	.	0			c.G1270T						.						223.0	205.0	211.0					10																	103294590		2203	4300	6503	SO:0001587	stop_gained	8945	exon10			CTGGTCGGACACC	Y14153	CCDS7511.1, CCDS7512.1, CCDS73183.1	10q24.32	2013-01-10	2012-02-23		ENSG00000166167	ENSG00000166167		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1144	protein-coding gene	gene with protein product		603482	"""beta-transducin repeat containing"""			9660940, 10331953, 18354483	Standard	NM_033637		Approved	bTrCP, betaTrCP, FBXW1A, Fwd1, beta-TrCP1, bTrCP1	uc001kta.4	Q9Y297	OTTHUMG00000018932	ENST00000370187.3:c.1270G>T	10.37:g.103294590G>T	ENSP00000359206:p.Gly424*	54	0		58	4	NM_033637	B5MD49|Q5W141|Q5W142|Q9Y213	Nonsense_Mutation	SNP	ENST00000370187.3	37	CCDS7512.1	.	.	.	.	.	.	.	.	.	.	G	39	7.566404	0.98361	.	.	ENSG00000166167	ENST00000370187;ENST00000393441;ENST00000408038	.	.	.	5.69	5.69	0.88448	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-15.6759	19.8154	0.96566	0.0:0.0:1.0:0.0	.	.	.	.	X	424;383;388	.	ENSP00000359206:G424X	G	+	1	0	BTRC	103284580	1.000000	0.71417	0.983000	0.44433	0.985000	0.73830	9.869000	0.99810	2.699000	0.92147	0.655000	0.94253	GGA	.		0.453	BTRC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049936.1	NM_033637	
LRP8	7804	hgsc.bcm.edu;bcgsc.ca	37	1	53716447	53716447	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:53716447G>T	ENST00000306052.6	-	17	2692	c.2591C>A	c.(2590-2592)cCa>cAa	p.P864Q	LRP8_ENST00000371454.2_Missense_Mutation_p.P864Q|LRP8_ENST00000354412.3_Missense_Mutation_p.P660Q|LRP8_ENST00000465675.1_Missense_Mutation_p.P417Q|LRP8_ENST00000347547.2_Missense_Mutation_p.P694Q	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	864					ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						CCTGTAGACTGGGTTGTCAAA	0.463																																					p.P864Q		.											.	.	.	0			c.C2591A						.						345.0	287.0	307.0					1																	53716447		2203	4300	6503	SO:0001583	missense	7804	exon17			TAGACTGGGTTGT	D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.2591C>A	1.37:g.53716447G>T	ENSP00000303634:p.Pro864Gln	37	0		35	4	NM_004631	B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Missense_Mutation	SNP	ENST00000306052.6	37	CCDS578.1	.	.	.	.	.	.	.	.	.	.	G	32	5.138170	0.94560	.	.	ENSG00000157193	ENST00000306052;ENST00000371454;ENST00000465675;ENST00000354412;ENST00000347547	T;T;T;T;T	0.25579	1.79;1.79;1.79;1.79;1.79	5.41	5.41	0.78517	.	.	.	.	.	T	0.59418	0.2192	M	0.86805	2.84	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.999;1.0;0.997;1.0;1.0	T	0.66670	-0.5865	9	0.87932	D	0	.	19.1903	0.93663	0.0:0.0:1.0:0.0	.	417;660;694;864;864;417	B3KU40;Q14114-2;Q14114-4;Q14114-3;Q14114;E9PP15	.;.;.;.;LRP8_HUMAN;.	Q	864;864;417;660;694	ENSP00000303634:P864Q;ENSP00000360509:P864Q;ENSP00000437009:P417Q;ENSP00000346391:P660Q;ENSP00000334522:P694Q	ENSP00000303634:P864Q	P	-	2	0	LRP8	53489035	1.000000	0.71417	0.987000	0.45799	0.991000	0.79684	9.855000	0.99526	2.524000	0.85096	0.557000	0.71058	CCA	.		0.463	LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000024699.1	NM_004631	
EIF3B	8662	hgsc.bcm.edu	37	7	2411439	2411439	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr7:2411439C>A	ENST00000360876.4	+	11	1698	c.1642C>A	c.(1642-1644)Cga>Aga	p.R548R	EIF3B_ENST00000397011.2_Silent_p.R548R	NM_001037283.1	NP_001032360.1			eukaryotic translation initiation factor 3, subunit B											breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	24		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		TGAAATTTTCCGAATGAGGGA	0.408																																					p.R548R		.											.	.	.	0			c.C1642A						.						115.0	112.0	113.0					7																	2411439		2203	4300	6503	SO:0001819	synonymous_variant	8662	exon11			ATTTTCCGAATGA	U62583	CCDS5332.1	7p22	2013-02-12	2007-07-27	2007-07-27	ENSG00000106263	ENSG00000106263		"""RNA binding motif (RRM) containing"""	3280	protein-coding gene	gene with protein product		603917	"""eukaryotic translation initiation factor 3, subunit 9 eta, 116kDa"""	EIF3S9		8995410	Standard	NM_001037283		Approved	PRT1, eIF3b	uc003sly.3	P55884	OTTHUMG00000022839	ENST00000360876.4:c.1642C>A	7.37:g.2411439C>A		89	0		95	4	NM_001037283		Silent	SNP	ENST00000360876.4	37	CCDS5332.1																																																																																			.		0.408	EIF3B-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207006.1		
TFCP2	7024	hgsc.bcm.edu	37	12	51503017	51503017	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr12:51503017C>A	ENST00000257915.5	-	6	1062	c.604G>T	c.(604-606)Ggt>Tgt	p.G202C	TFCP2_ENST00000548115.1_Intron|TFCP2_ENST00000307660.4_Intron|TFCP2_ENST00000549867.1_Missense_Mutation_p.G202C	NM_001173452.1|NM_005653.4	NP_001166923.1|NP_005644.2	Q12800	TFCP2_HUMAN	transcription factor CP2	202	DNA-binding.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)	23						TTTTCTCCACCATGTTTCCTC	0.463																																					p.G202C		.											.	.	.	0			c.G604T						.						159.0	147.0	151.0					12																	51503017		2203	4300	6503	SO:0001583	missense	7024	exon6			CTCCACCATGTTT	U03494	CCDS8808.1, CCDS55827.1	12q13	2004-01-05				ENSG00000135457			11748	protein-coding gene	gene with protein product		189889				8157699	Standard	NM_005653		Approved	CP2, LSF, LBP-1C, TFCP2C	uc001rxw.3	Q12800	OTTHUMG00000169621	ENST00000257915.5:c.604G>T	12.37:g.51503017C>A	ENSP00000257915:p.Gly202Cys	57	0		74	3	NM_001173452	A8K5E9|Q12801|Q9UD75|Q9UD77	Missense_Mutation	SNP	ENST00000257915.5	37	CCDS8808.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.593526	0.86953	.	.	ENSG00000135457	ENST00000257915;ENST00000549867;ENST00000548108	T;T;T	0.40476	1.51;1.65;1.03	5.61	4.72	0.59763	CP2 transcription factor (1);	0.000000	0.85682	D	0.000000	T	0.68403	0.2997	M	0.87180	2.865	0.80722	D	1	D;D;D	0.89917	0.997;1.0;0.999	D;D;D	0.97110	0.967;1.0;0.996	T	0.75340	-0.3352	10	0.87932	D	0	-16.3092	13.9806	0.64301	0.0:0.9257:0.0:0.0743	.	202;202;202	F8VX55;Q12800;Q12800-4	.;TFCP2_HUMAN;.	C	202;202;104	ENSP00000257915:G202C;ENSP00000449742:G202C;ENSP00000449280:G104C	ENSP00000257915:G202C	G	-	1	0	TFCP2	49789284	1.000000	0.71417	0.988000	0.46212	0.998000	0.95712	7.723000	0.84788	1.528000	0.49103	0.655000	0.94253	GGT	.		0.463	TFCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405119.1	NM_005653	
SLC38A6	145389	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	61446086	61446086	+	5'Flank	SNP	T	T	C			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr14:61446086T>C	ENST00000267488.4	+	0	0				RP11-193F5.1_ENST00000553946.1_RNA|SLC38A6_ENST00000456840.2_5'Flank|SLC38A6_ENST00000354886.2_5'Flank|TRMT5_ENST00000261249.6_Missense_Mutation_p.Y177C	NM_153811.2	NP_722518.2	Q8IZM9	S38A6_HUMAN	solute carrier family 38, member 6						amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(108;0.0981)		AAAGTGTTCATATGTTAGTTC	0.368																																					p.Y177C		.											.	.	.	0			c.A530G						.						111.0	110.0	110.0					14																	61446086		2203	4300	6503	SO:0001631	upstream_gene_variant	57570	exon2			TGTTCATATGTTA	AF070578	CCDS9751.1, CCDS53900.1	14q23.1	2013-05-22			ENSG00000139974	ENSG00000139974		"""Solute carriers"""	19863	protein-coding gene	gene with protein product							Standard	NM_153811		Approved	NAT-1	uc001xfh.2	Q8IZM9	OTTHUMG00000140335		14.37:g.61446086T>C	Exception_encountered	84	0		43	7	NM_020810	C9JWA6|Q86SY5	Missense_Mutation	SNP	ENST00000267488.4	37	CCDS9751.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.070849	0.76301	.	.	ENSG00000126814	ENST00000261249	T	0.48522	0.81	4.54	4.54	0.55810	.	0.000000	0.85682	D	0.000000	T	0.70316	0.3210	M	0.83223	2.63	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.76247	-0.3029	10	0.87932	D	0	-17.5222	14.3319	0.66564	0.0:0.0:0.0:1.0	.	177	Q32P41	TRM5_HUMAN	C	177	ENSP00000261249:Y177C	ENSP00000261249:Y177C	Y	-	2	0	TRMT5	60515839	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.479000	0.81095	2.014000	0.59158	0.533000	0.62120	TAT	.		0.368	SLC38A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276957.1		
SATL1	340562	hgsc.bcm.edu;bcgsc.ca	37	X	84358922	84358922	+	Splice_Site	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chrX:84358922C>A	ENST00000395409.3	-	2	1641		c.e2-1		SATL1_ENST00000332921.5_Splice_Site|SATL1_ENST00000509231.1_Splice_Site			Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1								N-acetyltransferase activity (GO:0008080)			NS(1)|breast(5)|endometrium(2)|large_intestine(3)|lung(13)|skin(3)|stomach(1)|urinary_tract(1)	29						CAGCCAATTCCTGTCAAAGTA	0.323																																					.		.											.	.	.	0			c.1642-1G>T						.						105.0	85.0	92.0					X																	84358922		2203	4300	6503	SO:0001630	splice_region_variant	340562	exon3			CAATTCCTGTCAA	BC043215	CCDS35343.1, CCDS35343.2	Xq21	2008-02-05			ENSG00000184788	ENSG00000184788			27992	protein-coding gene	gene with protein product						12477932	Standard	NM_001012980		Approved		uc004een.3	Q86VE3	OTTHUMG00000021931	ENST00000395409.3:c.1081-1G>T	X.37:g.84358922C>A		91	0		69	4	NM_001012980	A0AVK7|E9PB72|Q5H8V9	Splice_Site	SNP	ENST00000395409.3	37		.	.	.	.	.	.	.	.	.	.	C	16.14	3.038662	0.55003	.	.	ENSG00000184788	ENST00000395409;ENST00000332921;ENST00000509231	.	.	.	5.26	4.4	0.53042	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.1137	0.36744	0.0:0.8963:0.0:0.1037	.	.	.	.	.	-1	.	.	.	-	.	.	SATL1	84245578	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.096000	0.41738	1.011000	0.39340	0.556000	0.70494	.	.		0.323	SATL1-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_291339	Intron
IGSF10	285313	hgsc.bcm.edu	37	3	151156014	151156014	+	Missense_Mutation	SNP	G	G	A	rs377142937		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr3:151156014G>A	ENST00000282466.3	-	6	6334	c.6335C>T	c.(6334-6336)gCg>gTg	p.A2112V	IGSF10_ENST00000495443.1_5'UTR	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	2112	Ig-like C2-type 7.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)		p.A2112V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TCCTTCCTCCGCTACCCCAAC	0.448																																					p.A2112V		.											IGSF10,NS,carcinoma,0,1	IGSF10	0	1	Substitution - Missense(1)	endometrium(1)	c.C6335T						.	G	VAL/ALA,VAL/ALA,VAL/ALA	0,4406		0,0,2203	107.0	102.0	104.0		416,272,6335	5.9	0.3	3		104	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	IGSF10	NM_001178145.1,NM_001178146.1,NM_178822.4	64,64,64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	139/651,91/603,2112/2624	151156014	1,13005	2203	4300	6503	SO:0001583	missense	285313	exon6			TCCTCCGCTACCC	AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.6335C>T	3.37:g.151156014G>A	ENSP00000282466:p.Ala2112Val	72	0		45	3	NM_178822	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	37	CCDS3160.1	.	.	.	.	.	.	.	.	.	.	G	18.49	3.634545	0.67130	0.0	1.16E-4	ENSG00000152580	ENST00000282466	T	0.28666	1.6	5.86	5.86	0.93980	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.138761	0.32624	N	0.005853	T	0.46946	0.1419	L	0.32530	0.975	0.28347	N	0.921094	D;P	0.89917	1.0;0.937	D;P	0.74348	0.983;0.651	T	0.31971	-0.9924	10	0.36615	T	0.2	.	20.1865	0.98220	0.0:0.0:1.0:0.0	.	2112;139	Q6WRI0;Q6WRI0-2	IGS10_HUMAN;.	V	2112	ENSP00000282466:A2112V	ENSP00000282466:A2112V	A	-	2	0	IGSF10	152638704	0.995000	0.38212	0.294000	0.24946	0.952000	0.60782	7.259000	0.78381	2.775000	0.95449	0.655000	0.94253	GCG	.		0.448	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
EPB41L5	57669	hgsc.bcm.edu;bcgsc.ca	37	2	120925069	120925069	+	Silent	SNP	C	C	A	rs538183746		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr2:120925069C>A	ENST00000263713.5	+	23	2204	c.1990C>A	c.(1990-1992)Cgg>Agg	p.R664R	EPB41L5_ENST00000443902.2_Silent_p.R664R|EPB41L5_ENST00000488691.1_3'UTR|EPB41L5_ENST00000452780.1_Silent_p.R664R	NM_020909.3	NP_065960.2	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5	664					actomyosin structure organization (GO:0031032)|apical constriction (GO:0003383)|axial mesoderm morphogenesis (GO:0048319)|cellular response to transforming growth factor beta stimulus (GO:0071560)|ectoderm development (GO:0007398)|embryonic foregut morphogenesis (GO:0048617)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|in utero embryonic development (GO:0001701)|left/right axis specification (GO:0070986)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of protein binding (GO:0032091)|neural plate morphogenesis (GO:0001839)|paraxial mesoderm development (GO:0048339)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein binding (GO:0032092)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of establishment of protein localization (GO:0070201)|somite rostral/caudal axis specification (GO:0032525)|substrate-dependent cell migration, cell attachment to substrate (GO:0006931)|unidimensional cell growth (GO:0009826)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(12)|ovary(1)	26						GATCACACCCCGGTGGATTGT	0.343																																					p.R664R		.											EPB41L5,caecum,carcinoma,0,1	EPB41L5	0	0			c.C1990A						.						168.0	152.0	157.0					2																	120925069		2203	4300	6503	SO:0001819	synonymous_variant	57669	exon23			ACACCCCGGTGGA	AK023019	CCDS2130.1, CCDS54392.1, CCDS54393.1	2q14.2	2009-07-28			ENSG00000115109	ENSG00000115109			19819	protein-coding gene	gene with protein product		611730					Standard	NM_001184937		Approved	KIAA1548, FLJ12957, BE37, YMO1	uc002tmg.3	Q9HCM4	OTTHUMG00000131433	ENST00000263713.5:c.1990C>A	2.37:g.120925069C>A		42	0		62	4	NM_020909	Q7Z5S1|Q8IZ12|Q9H975	Silent	SNP	ENST00000263713.5	37	CCDS2130.1																																																																																			.		0.343	EPB41L5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254230.2	NM_020909	
PHLDB2	90102	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	111604232	111604232	+	Silent	SNP	A	A	G			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr3:111604232A>G	ENST00000431670.2	+	2	1719	c.1308A>G	c.(1306-1308)agA>agG	p.R436R	PHLDB2_ENST00000478922.1_Silent_p.R436R|PHLDB2_ENST00000477695.1_Silent_p.R436R|PHLDB2_ENST00000412622.1_Silent_p.R436R|PHLDB2_ENST00000393923.3_Silent_p.R463R|PHLDB2_ENST00000481953.1_Silent_p.R436R|PHLDB2_ENST00000393925.3_Silent_p.R436R	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	436						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						GGGAGGAAAGACTCAGGGAGC	0.517																																					p.R463R		.											PHLDB2_ENST00000431670,NS,carcinoma,0,2	PHLDB2_ENST00000431670	0	0			c.A1389G						.						64.0	69.0	67.0					3																	111604232		2203	4300	6503	SO:0001819	synonymous_variant	90102	exon3			GGAAAGACTCAGG		CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.1308A>G	3.37:g.111604232A>G		27	0		22	15	NM_001134437	A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Silent	SNP	ENST00000431670.2	37	CCDS46886.1																																																																																			.		0.517	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354337.1	NM_145753	
TOPBP1	11073	hgsc.bcm.edu;bcgsc.ca	37	3	133337058	133337058	+	Splice_Site	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr3:133337058C>A	ENST00000260810.5	-	21	3722	c.3591G>T	c.(3589-3591)caG>caT	p.Q1197H		NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	1197					cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						TCTTGTTACCCTGTTTAGCAA	0.353								Other conserved DNA damage response genes																													p.Q1197H	Ovarian(21;193 658 4424 15423 17362)	.											.	.	.	0			c.G3591T						.						75.0	68.0	70.0					3																	133337058		1821	4087	5908	SO:0001630	splice_region_variant	11073	exon21			GTTACCCTGTTTA	AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.3592+1G>T	3.37:g.133337058C>A		72	0		60	4	NM_007027	B7Z7W8|Q7LGC1|Q9UEB9	Missense_Mutation	SNP	ENST00000260810.5	37	CCDS46919.1	.	.	.	.	.	.	.	.	.	.	C	9.702	1.154690	0.21371	.	.	ENSG00000163781	ENST00000260810	T	0.12465	2.68	5.87	0.776	0.18532	.	0.441141	0.28146	N	0.016428	T	0.06735	0.0172	N	0.19112	0.55	0.31204	N	0.699396	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.10042	-1.0647	10	0.42905	T	0.14	.	3.1076	0.06347	0.1212:0.4999:0.1188:0.26	.	1110;1197	A0AV47;Q92547	.;TOPB1_HUMAN	H	1197	ENSP00000260810:Q1197H	ENSP00000260810:Q1197H	Q	-	3	2	TOPBP1	134819748	0.959000	0.32827	0.998000	0.56505	0.871000	0.50021	-0.033000	0.12246	0.472000	0.27344	0.655000	0.94253	CAG	.		0.353	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357254.1	NM_007027	Missense_Mutation
AHI1	54806	hgsc.bcm.edu	37	6	135763821	135763821	+	Nonsense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr6:135763821G>T	ENST00000367800.4	-	12	2027	c.1811C>A	c.(1810-1812)tCa>tAa	p.S604*	AHI1_ENST00000327035.6_Nonsense_Mutation_p.S604*|AHI1_ENST00000417892.2_5'UTR|AHI1_ENST00000457866.2_Nonsense_Mutation_p.S604*	NM_001134830.1	NP_001128302.1	Q8N157	AHI1_HUMAN	Abelson helper integration site 1	604					cellular protein localization (GO:0034613)|central nervous system development (GO:0007417)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|cloaca development (GO:0035844)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|Kupffer's vesicle development (GO:0070121)|left/right axis specification (GO:0070986)|morphogenesis of a polarized epithelium (GO:0001738)|negative regulation of apoptotic process (GO:0043066)|otic vesicle development (GO:0071599)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of polarized epithelial cell differentiation (GO:0030862)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pronephric duct morphogenesis (GO:0039023)|pronephric nephron tubule morphogenesis (GO:0039008)|protein localization to organelle (GO:0033365)|regulation of behavior (GO:0050795)|retina layer formation (GO:0010842)|specification of axis polarity (GO:0065001)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vesicle targeting (GO:0006903)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|nonmotile primary cilium (GO:0031513)|photoreceptor outer segment (GO:0001750)|primary cilium (GO:0072372)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)	37	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		TGCATTTAGTGAGAAGAGGTG	0.368																																					p.S604X		.											.	.	.	0			c.C1811A						.						63.0	56.0	58.0					6																	135763821		1835	4093	5928	SO:0001587	stop_gained	54806	exon13			TTTAGTGAGAAGA	AJ459824	CCDS47483.1, CCDS47484.1	6q23.2	2013-01-10	2005-11-29		ENSG00000135541	ENSG00000135541		"""WD repeat domain containing"""	21575	protein-coding gene	gene with protein product	"""Jouberin"""	608894	"""Abelson helper integration site"""			15060101, 16240161	Standard	NM_017651		Approved	FLJ20069, ORF1, JBTS3	uc003qgj.3	Q8N157	OTTHUMG00000015631	ENST00000367800.4:c.1811C>A	6.37:g.135763821G>T	ENSP00000356774:p.Ser604*	197	0		95	4	NM_001134832	E1P584|Q4FD35|Q504T3|Q5TCP9|Q6P098|Q6PIT6|Q8NDX0|Q9H0H2	Nonsense_Mutation	SNP	ENST00000367800.4	37	CCDS47483.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.487913|7.487913	0.98316|0.98316	.|.	.|.	ENSG00000135541|ENSG00000135541	ENST00000367799|ENST00000367800;ENST00000457866;ENST00000265602;ENST00000327035;ENST00000367801	.|.	.|.	.|.	5.82|5.82	5.82|5.82	0.92795|0.92795	.|.	.|0.069173	.|0.64402	.|D	.|0.000011	T|.	0.32406|.	0.0828|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.32025|.	-0.9922|.	4|.	.|0.02654	.|T	.|1	-12.3066|-12.3066	19.6984|19.6984	0.96043|0.96043	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	N|X	104|604	.|.	.|ENSP00000265602:S604X	H|S	-|-	1|2	0|0	AHI1|AHI1	135805514|135805514	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	6.593000|6.593000	0.74100|0.74100	2.739000|2.739000	0.93911|0.93911	0.655000|0.655000	0.94253|0.94253	CAC|TCA	.		0.368	AHI1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391948.1	NM_017651	
COL18A1	80781	hgsc.bcm.edu	37	21	46932175	46932175	+	Missense_Mutation	SNP	C	C	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr21:46932175C>T	ENST00000359759.4	+	41	5149	c.5128C>T	c.(5128-5130)Cgg>Tgg	p.R1710W	SLC19A1_ENST00000567670.1_Intron|SLC19A1_ENST00000468508.1_5'Flank|COL18A1_ENST00000355480.5_Missense_Mutation_p.R1475W|COL18A1_ENST00000400337.2_Missense_Mutation_p.R1295W			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	1710	Nonhelical region 11 (NC11).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		TGAGACGTGGCGGACGGAGGC	0.701																																					p.R1472W		.											.	.	.	0			c.C4414T						.						18.0	23.0	22.0					21																	46932175		2092	4189	6281	SO:0001583	missense	80781	exon42			ACGTGGCGGACGG		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.5128C>T	21.37:g.46932175C>T	ENSP00000352798:p.Arg1710Trp	42	0		34	4	NM_030582	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Missense_Mutation	SNP	ENST00000359759.4	37		.	.	.	.	.	.	.	.	.	.	C	19.17	3.776640	0.70107	.	.	ENSG00000182871	ENST00000400337;ENST00000400347;ENST00000355480;ENST00000359759;ENST00000539645;ENST00000342220	T;T;T;T	0.56611	0.45;0.45;0.45;0.45	4.36	1.35	0.21983	Collagenase NC10/endostatin (1);C-type lectin fold (1);C-type lectin-like (1);	0.068562	0.56097	U	0.000024	T	0.72827	0.3509	M	0.87180	2.865	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.80764	0.994;0.991;0.99;0.983	T	0.75368	-0.3342	10	0.87932	D	0	.	12.2931	0.54829	0.4401:0.5599:0.0:0.0	.	1710;1292;1475;1295	P39060;D3DSM4;P39060-1;P39060-2	COIA1_HUMAN;.;.;.	W	1295;1295;1475;1710;1710;643	ENSP00000383191:R1295W;ENSP00000347665:R1475W;ENSP00000352798:R1710W;ENSP00000339118:R643W	ENSP00000339118:R643W	R	+	1	2	COL18A1	45756603	0.991000	0.36638	0.750000	0.31169	0.415000	0.31203	0.313000	0.19415	0.043000	0.15746	0.478000	0.44815	CGG	.		0.701	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1		
AFG3L1P	172	hgsc.bcm.edu	37	16	90050893	90050893	+	RNA	SNP	A	A	G			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr16:90050893A>G	ENST00000437774.1	+	0	662					NR_003226.1				AFG3-like AAA ATPase 1, pseudogene																		GTTGAATATCATACTCACTGC	0.483																																					.		.											.	.	.	0			.						.						94.0	79.0	84.0					16																	90050893		692	1591	2283			172	.			AATATCATACTCA	AJ001495		16q24.3	2013-10-17	2013-10-17	2010-10-28	ENSG00000223959	ENSG00000223959		"""ATPases / AAA-type"""	314	pseudogene	pseudogene		603020	"""AFG3 ATPase family gene 3-like 1 (S. cerevisiae), pseudogene"", ""AFG3 ATPase family member 3-like 1 (S. cerevisiae), pseudogene"""	AFG3, AFG3L1		9545647, 11549317	Standard	NR_003228		Approved		uc002fpz.1		OTTHUMG00000138987		16.37:g.90050893A>G		56	0		30	13	.		RNA	SNP	ENST00000437774.1	37																																																																																				.		0.483	AFG3L1P-004	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000316791.1	NR_003226	
NT5C1B	93034	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	18766068	18766068	+	Silent	SNP	G	G	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr2:18766068G>A	ENST00000359846.2	-	5	692	c.615C>T	c.(613-615)cgC>cgT	p.R205R	NT5C1B_ENST00000600945.1_Silent_p.R205R|NT5C1B-RDH14_ENST00000532967.1_Silent_p.R205R|NT5C1B_ENST00000460052.1_5'Flank|NT5C1B_ENST00000304081.4_Silent_p.R145R|RNU6-1215P_ENST00000384441.1_RNA	NM_001002006.2|NM_001199086.1|NM_001199087.1|NM_001199088.1	NP_001002006.1|NP_001186015.1|NP_001186016.1|NP_001186017.1	Q96P26	5NT1B_HUMAN	5'-nucleotidase, cytosolic IB	205					nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				TTTTGGTGCTGCGCCGGGAGC	0.711																																					p.R222R		.											.	.	.	0			c.C666T						.						18.0	21.0	20.0					2																	18766068		2195	4284	6479	SO:0001819	synonymous_variant	93034	exon5			GGTGCTGCGCCGG	AF356185	CCDS33149.1, CCDS33150.1	2p24.2	2010-08-13			ENSG00000185013	ENSG00000185013	3.1.3.5		17818	protein-coding gene	gene with protein product		610526				11690631	Standard	NM_033253		Approved	AIRP, CN-IB		Q96P26	OTTHUMG00000151765	ENST00000359846.2:c.615C>T	2.37:g.18766068G>A		93	0		67	23	NM_001199087	B5MCR0|B7ZVX7|Q53RX2|Q8N9W3|Q8NA26|Q96DU5|Q96KE6|Q96M25|Q96SA3	Silent	SNP	ENST00000359846.2	37	CCDS33150.1																																																																																			.		0.711	NT5C1B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000323822.1		
HSPA9	3313	hgsc.bcm.edu;bcgsc.ca	37	5	137894311	137894311	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr5:137894311C>A	ENST00000297185.3	-	12	1571	c.1446G>T	c.(1444-1446)gtG>gtT	p.V482V	SNORD63_ENST00000384262.1_RNA|HSPA9_ENST00000501917.2_Intron|SNORD63_ENST00000411005.1_RNA	NM_004134.6	NP_004125.3	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 (mortalin)	482					cellular protein metabolic process (GO:0044267)|negative regulation of apoptotic process (GO:0043066)|protein export from nucleus (GO:0006611)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(1)|kidney(4)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(1)	28			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CTTTAATTTCCACTTGCGTTT	0.418																																					p.V482V		.											.	.	.	0			c.G1446T						.						156.0	146.0	149.0					5																	137894311		2203	4300	6503	SO:0001819	synonymous_variant	3313	exon12			AATTTCCACTTGC	L11066	CCDS4208.1	5q31.1	2011-09-02	2006-10-31	2006-10-31	ENSG00000113013	ENSG00000113013		"""Heat shock proteins / HSP70"""	5244	protein-coding gene	gene with protein product		600548	"""heat shock 70kDa protein 9B (mortalin-2)"""	HSPA9B		7684501	Standard	NM_004134		Approved	GRP75, PBP74, mot-2, mthsp75	uc003ldf.3	P38646	OTTHUMG00000129206	ENST00000297185.3:c.1446G>T	5.37:g.137894311C>A		53	0		52	4	NM_004134	B2RCM1|P30036|P31932|Q1HB43|Q53H23|Q6GU03|Q9BWB7|Q9UC56	Silent	SNP	ENST00000297185.3	37	CCDS4208.1																																																																																			.		0.418	HSPA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251285.1	NM_004134	
SMC5	23137	hgsc.bcm.edu	37	9	72967112	72967112	+	Silent	SNP	G	G	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr9:72967112G>A	ENST00000361138.5	+	25	3229	c.3171G>A	c.(3169-3171)ctG>ctA	p.L1057L	SMC5_ENST00000471372.1_3'UTR	NM_015110.3	NP_055925.2	Q8IY18	SMC5_HUMAN	structural maintenance of chromosomes 5	1057					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|telomere maintenance via recombination (GO:0000722)	cell junction (GO:0030054)|chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)	p.L1057L(1)		breast(1)|central_nervous_system(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(4)	35						TACAGCTCCTGCAAAATCTTC	0.328																																					p.L1057L		.											SMC5,head_neck,malignant_melanoma,0,1	SMC5	0	1	Substitution - coding silent(1)	skin(1)	c.G3171A						.						72.0	74.0	73.0					9																	72967112		2203	4300	6503	SO:0001819	synonymous_variant	23137	exon25			GCTCCTGCAAAAT	AB011166	CCDS6632.1	9q21.11	2008-02-05	2006-07-06	2006-07-06	ENSG00000198887	ENSG00000198887		"""Structural maintenance of chromosomes proteins"""	20465	protein-coding gene	gene with protein product		609386	"""SMC5 structural maintenance of chromosomes 5-like 1 (yeast)"""	SMC5L1		9628581	Standard	NM_015110		Approved	KIAA0594	uc004ahr.2	Q8IY18	OTTHUMG00000019992	ENST00000361138.5:c.3171G>A	9.37:g.72967112G>A		54	0		33	3	NM_015110	A6NM81|O60335|Q05D92|Q5VZ60|Q96SB9	Silent	SNP	ENST00000361138.5	37	CCDS6632.1																																																																																			.		0.328	SMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052603.1	NM_015110	
SLURP1	57152	hgsc.bcm.edu	37	8	143823221	143823221	+	Splice_Site	SNP	C	C	A	rs200727790		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr8:143823221C>A	ENST00000246515.1	-	2	203	c.178G>T	c.(178-180)Gag>Tag	p.E60*		NM_020427.2	NP_065160.1	P55000	SLUR1_HUMAN	secreted LY6/PLAUR domain containing 1	60	UPAR/Ly6.				cell activation (GO:0001775)|cell adhesion (GO:0007155)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)	p.E60*(1)		breast(1)|lung(7)|ovary(1)	9	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					CTGGCCTCACCTGCCTCCACC	0.662																																					p.E60X		.											SLURP1,NS,carcinoma,0,1	SLURP1	0	1	Substitution - Nonsense(1)	lung(1)	c.G178T						.						84.0	73.0	77.0					8																	143823221		2203	4300	6503	SO:0001630	splice_region_variant	57152	exon2			CCTCACCTGCCTC	AY579080	CCDS6387.1	8q24.3	2004-11-16			ENSG00000126233	ENSG00000126233			18746	protein-coding gene	gene with protein product	"""lymphocyte antigen 6-like secreted"", ""ARS component B"""	606119				11285253, 10211827	Standard	NM_020427		Approved	ARS, ANUP, MDM, ArsB, LY6LS	uc003ywy.3	P55000	OTTHUMG00000164685	ENST00000246515.1:c.178+1G>T	8.37:g.143823221C>A		81	0		87	4	NM_020427	Q53YJ6|Q6PUA6|Q92483	Nonsense_Mutation	SNP	ENST00000246515.1	37	CCDS6387.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.995585	0.74703	.	.	ENSG00000126233	ENST00000246515	.	.	.	4.17	4.17	0.49024	.	0.489617	0.17603	N	0.168354	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-6.4654	12.2983	0.54860	0.0:1.0:0.0:0.0	.	.	.	.	X	60	.	.	E	-	1	0	SLURP1	143820223	0.313000	0.24554	0.873000	0.34254	0.076000	0.17211	2.122000	0.41987	2.028000	0.59812	0.462000	0.41574	GAG	.		0.662	SLURP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379741.1	NM_020427	Nonsense_Mutation
ITGB7	3695	hgsc.bcm.edu	37	12	53588035	53588035	+	Nonsense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr12:53588035C>A	ENST00000267082.5	-	10	1486	c.1255G>T	c.(1255-1257)Gag>Tag	p.E419*	ITGB7_ENST00000422257.3_Nonsense_Mutation_p.E419*|ITGB7_ENST00000338737.4_Nonsense_Mutation_p.E419*|ITGB7_ENST00000550743.2_Nonsense_Mutation_p.E419*	NM_000889.1	NP_000880.1	P26010	ITB7_HUMAN	integrin, beta 7	419					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte tethering or rolling (GO:0050901)|multicellular organismal development (GO:0007275)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alpha4-beta7 complex (GO:0034669)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)	p.E419K(1)		NS(2)|breast(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GCCTTACCCTCCCTCTTCTCA	0.587																																					p.E419X		.											ITGB7,NS,NS,0,1	ITGB7	0	1	Substitution - Missense(1)	NS(1)	c.G1255T						.						183.0	155.0	164.0					12																	53588035		2203	4300	6503	SO:0001587	stop_gained	3695	exon10			TACCCTCCCTCTT		CCDS8849.1	12q13.1	2010-03-23				ENSG00000139626		"""Integrins"""	6162	protein-coding gene	gene with protein product		147559				2040616	Standard	XM_005268851		Approved		uc001scc.3	P26010		ENST00000267082.5:c.1255G>T	12.37:g.53588035C>A	ENSP00000267082:p.Glu419*	33	0		42	2	NM_000889	Q9UCP7|Q9UCS7	Nonsense_Mutation	SNP	ENST00000267082.5	37	CCDS8849.1	.	.	.	.	.	.	.	.	.	.	C	36	5.699275	0.96802	.	.	ENSG00000139626	ENST00000422257;ENST00000267082;ENST00000338737;ENST00000542497	.	.	.	4.91	3.06	0.35304	.	1.413410	0.04969	N	0.463500	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	.	2.128	0.03743	0.1554:0.5038:0.1683:0.1725	.	.	.	.	X	419	.	ENSP00000267082:E419X	E	-	1	0	ITGB7	51874302	0.002000	0.14202	0.002000	0.10522	0.312000	0.27988	0.907000	0.28531	0.583000	0.29574	0.655000	0.94253	GAG	.		0.587	ITGB7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405821.2		
TSNARE1	203062	hgsc.bcm.edu;bcgsc.ca	37	8	143425475	143425475	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr8:143425475C>A	ENST00000307180.3	-	4	714	c.597G>T	c.(595-597)ctG>ctT	p.L199L	TSNARE1_ENST00000519651.1_Intron|TSNARE1_ENST00000520166.1_Silent_p.L199L|TSNARE1_ENST00000524325.1_Silent_p.L199L	NM_145003.3	NP_659440.2	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	199					intracellular protein transport (GO:0006886)|synaptic vesicle exocytosis (GO:0016079)	integral component of membrane (GO:0016021)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			breast(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(6)|ovary(2)|stomach(2)|urinary_tract(1)	20	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					GGAGGTCGCCCAGCTTGCGCC	0.692																																					p.L199L		.											.	.	.	0			c.G597T						.						30.0	31.0	30.0					8																	143425475		2199	4293	6492	SO:0001819	synonymous_variant	203062	exon4			GTCGCCCAGCTTG			8q24.3	2005-08-18							26437	protein-coding gene	gene with protein product						14702039	Standard	XM_005250828		Approved	FLJ31164	uc003ywk.3	Q96NA8		ENST00000307180.3:c.597G>T	8.37:g.143425475C>A		63	0		57	4	NM_145003	B7ZLB0|Q14D03	Silent	SNP	ENST00000307180.3	37	CCDS6384.1																																																																																			.		0.692	TSNARE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_145003	
STAT5A	6776	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	40460310	40460310	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr17:40460310C>A	ENST00000345506.4	+	17	2663	c.2021C>A	c.(2020-2022)cCc>cAc	p.P674H	STAT5A_ENST00000587646.1_Missense_Mutation_p.P162H|STAT5A_ENST00000588868.1_Missense_Mutation_p.P643H|STAT5A_ENST00000452307.2_Missense_Mutation_p.P671H|STAT5A_ENST00000590949.1_Missense_Mutation_p.P674H|STAT5A_ENST00000546010.2_Missense_Mutation_p.P644H	NM_003152.3	NP_003143.2	P42229	STA5A_HUMAN	signal transducer and activator of transcription 5A	674	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				2-oxoglutarate metabolic process (GO:0006103)|allantoin metabolic process (GO:0000255)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|luteinization (GO:0001553)|mammary gland epithelium development (GO:0061180)|natural killer cell differentiation (GO:0001779)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of mast cell apoptotic process (GO:0033026)|oxaloacetate metabolic process (GO:0006107)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mast cell differentiation (GO:0060376)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin signaling pathway (GO:0038161)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription, DNA-templated (GO:0006351)|valine metabolic process (GO:0006573)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	calcium ion binding (GO:0005509)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	14		all_cancers(22;1.56e-06)|all_epithelial(22;3.17e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.128)		CCTGACCGCCCCAAGGATGAG	0.602																																					p.P674H		.											.	.	.	0			c.C2021A						.						72.0	67.0	69.0					17																	40460310		2203	4300	6503	SO:0001583	missense	6776	exon17			ACCGCCCCAAGGA	U43185	CCDS11424.1, CCDS74066.1, CCDS74067.1	17q11.2	2013-02-14			ENSG00000126561	ENSG00000126561		"""SH2 domain containing"""	11366	protein-coding gene	gene with protein product		601511		STAT5		7719937, 8631883	Standard	NM_003152		Approved	MGF	uc002hzj.2	P42229	OTTHUMG00000150725	ENST00000345506.4:c.2021C>A	17.37:g.40460310C>A	ENSP00000341208:p.Pro674His	44	0		40	4	NM_003152	Q1KLZ6	Missense_Mutation	SNP	ENST00000345506.4	37	CCDS11424.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.949630	0.92660	.	.	ENSG00000126561	ENST00000345506;ENST00000546010;ENST00000540577;ENST00000452307	D;D;D	0.97138	-4.26;-4.26;-4.26	5.06	5.06	0.68205	SH2 motif (3);	0.000000	0.85682	D	0.000000	D	0.98701	0.9564	M	0.89785	3.06	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.98;1.0	D;D;D;P;D	0.74023	0.975;0.973;0.964;0.883;0.982	D	0.99804	1.1037	10	0.87932	D	0	-32.9185	18.4321	0.90630	0.0:1.0:0.0:0.0	.	674;671;644;645;674	A8K6I5;Q8WWS9;Q1KLZ6;Q59GY7;P42229	.;.;.;.;STA5A_HUMAN	H	674;644;645;671	ENSP00000341208:P674H;ENSP00000443107:P644H;ENSP00000400320:P671H	ENSP00000341208:P674H	P	+	2	0	STAT5A	37713836	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.781000	0.85668	2.368000	0.80403	0.561000	0.74099	CCC	.		0.602	STAT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319804.1	NM_003152	
NEFH	4744	hgsc.bcm.edu;bcgsc.ca	37	22	29885828	29885828	+	Silent	SNP	C	C	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr22:29885828C>T	ENST00000310624.6	+	4	2232	c.2199C>T	c.(2197-2199)ccC>ccT	p.P733P		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	739	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.P733P(1)		cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						CAAAGACCCCCGAGAAGGCCA	0.542																																					p.P733P		.											NEFH,NS,carcinoma,0,2	NEFH	0	1	Substitution - coding silent(1)	endometrium(1)	c.C2199T						.						103.0	107.0	106.0					22																	29885828		2203	4300	6503	SO:0001819	synonymous_variant	4744	exon4			GACCCCCGAGAAG		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.2199C>T	22.37:g.29885828C>T		69	0		77	5	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.542	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
SLC22A10	387775	hgsc.bcm.edu	37	11	63066993	63066993	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr11:63066993G>T	ENST00000332793.6	+	6	964	c.962G>T	c.(961-963)aGa>aTa	p.R321I	SLC22A10_ENST00000544661.1_Missense_Mutation_p.R166I|SLC22A10_ENST00000535888.1_Missense_Mutation_p.R111I|SLC22A10_ENST00000525620.1_3'UTR|SLC22A10_ENST00000526800.1_Missense_Mutation_p.R161I	NM_001039752.3	NP_001034841.3	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	321						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)	p.R321K(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28					Conjugated Estrogens(DB00286)|Probenecid(DB01032)|Salicylic acid(DB00936)	AAGGTTGTAAGATCCACCATG	0.423																																					p.R321I		.											SLC22A10,bladder,carcinoma,0,1	SLC22A10	0	1	Substitution - Missense(1)	urinary_tract(1)	c.G962T						.						112.0	110.0	111.0					11																	63066993		1990	4163	6153	SO:0001583	missense	387775	exon6			TTGTAAGATCCAC	AP003420	CCDS41661.1	11q12.3	2013-05-22	2008-01-11		ENSG00000184999	ENSG00000184999		"""Solute carriers"""	18057	protein-coding gene	gene with protein product		607580	"""solute carrier family 22 (organic anion/cation transporter), member 10"""			11327718	Standard	NM_001039752		Approved	OAT5, hOAT5	uc009yor.3	Q63ZE4	OTTHUMG00000165197	ENST00000332793.6:c.962G>T	11.37:g.63066993G>T	ENSP00000327569:p.Arg321Ile	49	0		45	2	NM_001039752	Q68CJ0	Missense_Mutation	SNP	ENST00000332793.6	37	CCDS41661.1	.	.	.	.	.	.	.	.	.	.	G	10.96	1.498052	0.26861	.	.	ENSG00000184999	ENST00000535888;ENST00000544661;ENST00000332793;ENST00000526800	T;T;T;T	0.74106	-0.81;-0.81;-0.81;-0.26	4.46	1.48	0.22813	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	.	.	.	.	T	0.74382	0.3709	M	0.65498	2.005	0.09310	N	1	B;P	0.36837	0.139;0.571	B;P	0.46208	0.273;0.507	T	0.65059	-0.6260	9	0.54805	T	0.06	.	4.1786	0.10363	0.2865:0.1716:0.5419:0.0	.	161;321	E9PJB1;Q63ZE4	.;S22AA_HUMAN	I	111;166;321;161	ENSP00000444602:R111I;ENSP00000445667:R166I;ENSP00000327569:R321I;ENSP00000433908:R161I	ENSP00000327569:R321I	R	+	2	0	SLC22A10	62823569	0.004000	0.15560	0.001000	0.08648	0.278000	0.26855	-0.128000	0.10531	0.152000	0.19188	0.579000	0.79373	AGA	.		0.423	SLC22A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382622.3	NM_001039752	
APC	324	hgsc.bcm.edu	37	5	112175124	112175124	+	Missense_Mutation	SNP	C	C	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr5:112175124C>T	ENST00000457016.1	+	16	4213	c.3833C>T	c.(3832-3834)tCa>tTa	p.S1278L	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Missense_Mutation_p.S1278L|APC_ENST00000508376.2_Missense_Mutation_p.S1278L			P25054	APC_HUMAN	adenomatous polyposis coli	1278	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.S1278*(1)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AGTTCATTATCATCTTTGTCA	0.343		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.S1278L	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	.	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,colon,carcinoma,0,3	APC	0	3	Substitution - Nonsense(1)|Unknown(1)|Deletion - Frameshift(1)	large_intestine(1)|soft_tissue(1)|skin(1)	c.C3833T	GRCh37	CI984194|CM010758	APC	I|M		.						53.0	56.0	55.0					5																	112175124		2202	4300	6502	SO:0001583	missense	324	exon17	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	CATTATCATCTTT	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3833C>T	5.37:g.112175124C>T	ENSP00000413133:p.Ser1278Leu	35	0		49	2	NM_001127510	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.020312	0.75275	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	D;D;D;D	0.88046	-2.33;-2.33;-2.33;-2.33	6.03	6.03	0.97812	.	0.114891	0.64402	D	0.000010	D	0.94042	0.8091	M	0.79926	2.475	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.93070	0.6482	9	.	.	.	-13.7606	20.1672	0.98154	0.0:1.0:0.0:0.0	.	1280;1278	Q4LE70;P25054	.;APC_HUMAN	L	1278	ENSP00000413133:S1278L;ENSP00000257430:S1278L;ENSP00000427089:S1278L;ENSP00000423828:S1278L	.	S	+	2	0	APC	112203023	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.487000	0.81328	2.861000	0.98227	0.655000	0.94253	TCA	.		0.343	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
ZNF613	79898	hgsc.bcm.edu	37	19	52448266	52448266	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr19:52448266G>T	ENST00000293471.6	+	6	1809	c.1130G>T	c.(1129-1131)tGt>tTt	p.C377F	ZNF613_ENST00000601794.1_3'UTR|ZNF613_ENST00000391794.4_Missense_Mutation_p.C341F	NM_001031721.3	NP_001026891.2	Q6PF04	ZN613_HUMAN	zinc finger protein 613	377					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	19		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.0183)		TGCCGTGATTGTGGAAAAGGC	0.403																																					p.C377F		.											ZNF613,NS,carcinoma,0,1	ZNF613	0	0			c.G1130T						.						96.0	91.0	93.0					19																	52448266		2203	4300	6503	SO:0001583	missense	79898	exon6			GTGATTGTGGAAA	AK027565	CCDS12844.1, CCDS33089.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	25827	protein-coding gene	gene with protein product						12477932	Standard	NM_001031721		Approved	FLJ13590	uc002pxz.2	Q6PF04		ENST00000293471.6:c.1130G>T	19.37:g.52448266G>T	ENSP00000293471:p.Cys377Phe	39	0		50	3	NM_001031721	Q96SS9	Missense_Mutation	SNP	ENST00000293471.6	37	CCDS33089.1	.	.	.	.	.	.	.	.	.	.	G	18.14	3.557027	0.65425	.	.	ENSG00000176024	ENST00000293471;ENST00000391794;ENST00000535279	D;D	0.85861	-2.04;-2.04	3.25	3.25	0.37280	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.37053	N	0.002279	D	0.94729	0.8299	H	0.97365	3.99	0.43137	D	0.994881	D	0.89917	1.0	D	0.91635	0.999	D	0.96402	0.9297	10	0.87932	D	0	.	13.7721	0.63032	0.0:0.0:1.0:0.0	.	377	Q6PF04	ZN613_HUMAN	F	377;341;51	ENSP00000293471:C377F;ENSP00000375671:C341F	ENSP00000293471:C377F	C	+	2	0	ZNF613	57140078	1.000000	0.71417	0.951000	0.38953	0.991000	0.79684	8.269000	0.89878	1.828000	0.53243	0.655000	0.94253	TGT	.		0.403	ZNF613-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461104.2	NM_024840	
HAO1	54363	hgsc.bcm.edu	37	20	7886918	7886918	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr20:7886918C>A	ENST00000378789.3	-	4	655	c.604G>T	c.(604-606)Gac>Tac	p.D202Y		NM_017545.2	NP_060015.1	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase (glycolate oxidase) 1	202	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				cellular nitrogen compound metabolic process (GO:0034641)|fatty acid alpha-oxidation (GO:0001561)|glycolate catabolic process (GO:0046296)|glyoxylate metabolic process (GO:0046487)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|glycolate oxidase activity (GO:0008891)|glyoxylate oxidase activity (GO:0047969)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						AGTCCACTGTCGTCTCCAAAA	0.363																																					p.D202Y		.											HAO1,NS,carcinoma,0,1	HAO1	0	0			c.G604T						.						108.0	105.0	106.0					20																	7886918		2203	4300	6503	SO:0001583	missense	54363	exon4			CACTGTCGTCTCC	AL021879	CCDS13100.1	20p12	2005-01-10			ENSG00000101323	ENSG00000101323	1.1.3.15		4809	protein-coding gene	gene with protein product		605023		GOX1		9891009	Standard	NM_017545		Approved	GOX	uc002wmw.1	Q9UJM8	OTTHUMG00000031841	ENST00000378789.3:c.604G>T	20.37:g.7886918C>A	ENSP00000368066:p.Asp202Tyr	60	0		42	2	NM_017545	Q14CQ0|Q9UPZ0|Q9Y3I7	Missense_Mutation	SNP	ENST00000378789.3	37	CCDS13100.1	.	.	.	.	.	.	.	.	.	.	C	12.72	2.023639	0.35701	.	.	ENSG00000101323	ENST00000378789	T	0.30448	1.53	5.54	4.44	0.53790	Aldolase-type TIM barrel (1);FMN-dependent dehydrogenase (1);	0.430200	0.30547	N	0.009392	T	0.26919	0.0659	L	0.48362	1.52	0.43308	D	0.995318	B;B	0.14438	0.01;0.01	B;B	0.19666	0.026;0.026	T	0.06267	-1.0836	10	0.59425	D	0.04	-2.2629	8.2222	0.31547	0.0:0.2296:0.0:0.7704	.	202;202	A8K058;Q9UJM8	.;HAOX1_HUMAN	Y	202	ENSP00000368066:D202Y	ENSP00000368066:D202Y	D	-	1	0	HAO1	7834918	0.978000	0.34361	0.928000	0.36995	0.411000	0.31082	1.845000	0.39279	0.938000	0.37419	-0.469000	0.05056	GAC	.		0.363	HAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077926.2		
UBE4A	9354	hgsc.bcm.edu;ucsc.edu	37	11	118263498	118263498	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr11:118263498G>T	ENST00000431736.2	+	19	3055	c.2983G>T	c.(2983-2985)Gcc>Tcc	p.A995S	UBE4A_ENST00000545354.1_Missense_Mutation_p.A460S|UBE4A_ENST00000252108.3_Missense_Mutation_p.A988S					ubiquitination factor E4A											autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(7)|liver(2)|lung(14)|ovary(3)|prostate(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	56	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		CTATGCAGATGCCTGTGATGA	0.468																																					p.A995S		.											.	.	.	0			c.G2983T						.						181.0	162.0	169.0					11																	118263498		2200	4296	6496	SO:0001583	missense	9354	exon19			GCAGATGCCTGTG	D50916	CCDS8396.1, CCDS55790.1	11q23.3	2013-01-28	2011-05-19					"""U-box domain containing"""	12499	protein-coding gene	gene with protein product		603753	"""ubiquitination factor E4A (homologous to yeast UFD2)"", ""ubiquitination factor E4A (UFD2 homolog, yeast)"""			10089879	Standard	NM_004788		Approved	UBOX2, UFD2, KIAA0126, E4	uc001psv.3	Q14139	OTTHUMG00000168100	ENST00000431736.2:c.2983G>T	11.37:g.118263498G>T	ENSP00000387362:p.Ala995Ser	16	0		34	4	NM_004788		Missense_Mutation	SNP	ENST00000431736.2	37	CCDS8396.1	.	.	.	.	.	.	.	.	.	.	G	36	5.617751	0.96649	.	.	ENSG00000110344	ENST00000252108;ENST00000431736;ENST00000545354	T;T	0.52754	0.66;0.65	5.95	5.95	0.96441	U box domain (1);	0.000000	0.85682	D	0.000000	T	0.73289	0.3568	M	0.85373	2.75	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.68039	0.955;0.909	T	0.75110	-0.3433	10	0.59425	D	0.04	-9.2261	20.3931	0.98965	0.0:0.0:1.0:0.0	.	988;995	Q14139;Q14139-2	UBE4A_HUMAN;.	S	988;995;460	ENSP00000252108:A988S;ENSP00000387362:A995S	ENSP00000252108:A988S	A	+	1	0	UBE4A	117768708	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	9.869000	0.99810	2.824000	0.97209	0.655000	0.94253	GCC	.		0.468	UBE4A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398143.1	NM_004788	
TAF1	6872	hgsc.bcm.edu	37	X	70586052	70586052	+	5'Flank	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chrX:70586052C>A	ENST00000373790.4	+	0	0				TAF1_ENST00000276072.3_5'Flank|TAF1_ENST00000449580.1_5'Flank|TAF1_ENST00000423759.1_5'Flank	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa						cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				tccccctcccctctccccact	0.537																																					.		.											.	.	.	0			.						.																																			SO:0001631	upstream_gene_variant	618	.			CCTCCCCTCTCCC		CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723		X.37:g.70586052C>A	Exception_encountered	76	0		84	4	.	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	RNA	SNP	ENST00000373790.4	37	CCDS35325.1																																																																																			.		0.537	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058995.2	NM_004606	
DNAH5	1767	hgsc.bcm.edu	37	5	13820578	13820578	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr5:13820578G>T	ENST00000265104.4	-	41	6822	c.6718C>A	c.(6718-6720)Cct>Act	p.P2240T		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2240	AAA 2. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.P2240T(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AGTTTCCAAGGAGGATGGTTG	0.512									Kartagener syndrome																												p.P2240T		.											DNAH5,NS,carcinoma,0,1	DNAH5	0	1	Substitution - Missense(1)	lung(1)	c.C6718A						.						101.0	91.0	94.0					5																	13820578		2203	4300	6503	SO:0001583	missense	1767	exon41	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	TCCAAGGAGGATG	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.6718C>A	5.37:g.13820578G>T	ENSP00000265104:p.Pro2240Thr	31	0		36	3	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	G	17.54	3.415387	0.62511	.	.	ENSG00000039139	ENST00000265104	T	0.49432	0.78	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.47783	0.1464	L	0.58101	1.795	0.80722	D	1	B	0.28470	0.213	B	0.27500	0.08	T	0.38090	-0.9677	10	0.27082	T	0.32	.	19.4023	0.94635	0.0:0.0:1.0:0.0	.	2240	Q8TE73	DYH5_HUMAN	T	2240	ENSP00000265104:P2240T	ENSP00000265104:P2240T	P	-	1	0	DNAH5	13873578	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.675000	0.98638	2.579000	0.87056	0.650000	0.86243	CCT	.		0.512	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
THAP6	152815	hgsc.bcm.edu	37	4	76452236	76452236	+	Nonsense_Mutation	SNP	G	G	T	rs372598193		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr4:76452236G>T	ENST00000311638.3	+	5	549	c.481G>T	c.(481-483)Gag>Tag	p.E161*	THAP6_ENST00000502620.1_Intron|THAP6_ENST00000504190.1_Intron|THAP6_ENST00000507557.1_Intron|THAP6_ENST00000507885.1_Intron|THAP6_ENST00000507556.1_Intron|THAP6_ENST00000380837.3_Nonsense_Mutation_p.E119*|THAP6_ENST00000514480.1_Nonsense_Mutation_p.E161*	NM_144721.4	NP_653322.1	Q8TBB0	THAP6_HUMAN	THAP domain containing 6	161						microtubule cytoskeleton (GO:0015630)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			lung(5)	5			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			TGTGATCGGCGAGCTAGAGGA	0.358																																					p.E161X		.											.	.	.	0			c.G481T						.						72.0	73.0	72.0					4																	76452236		2203	4300	6503	SO:0001587	stop_gained	152815	exon5			ATCGGCGAGCTAG	BC022989	CCDS3568.1	4q21.21	2013-01-25			ENSG00000174796	ENSG00000174796		"""THAP (C2CH-type zinc finger) domain containing"""	23189	protein-coding gene	gene with protein product		612535				12575992	Standard	NM_144721		Approved	MGC30052	uc003him.3	Q8TBB0	OTTHUMG00000130108	ENST00000311638.3:c.481G>T	4.37:g.76452236G>T	ENSP00000309007:p.Glu161*	91	0		98	4	NM_144721	B4E146|Q5HYJ7|Q5JPC6	Nonsense_Mutation	SNP	ENST00000311638.3	37	CCDS3568.1	.	.	.	.	.	.	.	.	.	.	G	19.71	3.878402	0.72294	.	.	ENSG00000174796	ENST00000311638;ENST00000380837;ENST00000514480	.	.	.	4.46	3.6	0.41247	.	1.300180	0.05171	N	0.499540	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	-15.8992	10.4619	0.44585	0.0:0.1968:0.8031:0.0	.	.	.	.	X	161;119;161	.	ENSP00000309007:E161X	E	+	1	0	THAP6	76671260	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	2.854000	0.48325	1.441000	0.47550	0.655000	0.94253	GAG	.		0.358	THAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252414.1	NM_144721	
SORBS1	10580	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	97197306	97197306	+	Missense_Mutation	SNP	T	T	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr10:97197306T>A	ENST00000361941.3	-	2	43	c.17A>T	c.(16-18)gAt>gTt	p.D6V	SORBS1_ENST00000371227.4_Missense_Mutation_p.D6V|SORBS1_ENST00000371249.2_Missense_Mutation_p.D6V|SORBS1_ENST00000371239.1_Missense_Mutation_p.D6V|SORBS1_ENST00000277982.5_Missense_Mutation_p.D6V|SORBS1_ENST00000371245.3_Missense_Mutation_p.D6V|SORBS1_ENST00000353505.5_Missense_Mutation_p.D6V|SORBS1_ENST00000354106.3_Missense_Mutation_p.D6V|SORBS1_ENST00000306402.6_Missense_Mutation_p.D6V|SORBS1_ENST00000371241.1_Missense_Mutation_p.D6V|SORBS1_ENST00000607232.1_Missense_Mutation_p.D6V|SORBS1_ENST00000347291.4_Missense_Mutation_p.D6V|SORBS1_ENST00000393949.1_Missense_Mutation_p.D6V|SORBS1_ENST00000371246.2_Missense_Mutation_p.D6V|SORBS1_ENST00000371247.2_Missense_Mutation_p.D6V|SORBS1_ENST00000474353.2_5'UTR	NM_001034954.1	NP_001030126			sorbin and SH3 domain containing 1											NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		GGAACCACCATCACATTCTGC	0.507																																					p.D6V		.											.	.	.	0			c.A17T						.						143.0	122.0	129.0					10																	97197306		2203	4300	6503	SO:0001583	missense	10580	exon2			CCACCATCACATT	AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000361941.3:c.17A>T	10.37:g.97197306T>A	ENSP00000355136:p.Asp6Val	40	0		32	4	NM_001034955		Missense_Mutation	SNP	ENST00000361941.3	37	CCDS31255.1	.	.	.	.	.	.	.	.	.	.	T	14.33	2.503905	0.44558	.	.	ENSG00000095637	ENST00000371245;ENST00000306402;ENST00000371249;ENST00000371247;ENST00000371227;ENST00000371246;ENST00000393949;ENST00000353505;ENST00000347291;ENST00000361941;ENST00000277982;ENST00000371241;ENST00000354106;ENST00000371239	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.16324	3.15;2.57;2.35;2.86;2.77;3.16;2.67;3.15;2.53;2.86;3.16;2.36;2.67;2.41	5.1	5.1	0.69264	.	0.000000	0.37348	N	0.002128	T	0.27349	0.0671	L	0.27053	0.805	0.42039	D	0.991067	P;B;D;P;D;D;B;D;D;P;P	0.69078	0.87;0.442;0.997;0.835;0.976;0.957;0.142;0.957;0.993;0.745;0.941	B;B;D;P;P;P;B;P;D;P;P	0.69479	0.124;0.137;0.964;0.65;0.742;0.843;0.313;0.791;0.917;0.448;0.856	T	0.04053	-1.0981	10	0.87932	D	0	-12.606	12.5672	0.56316	0.0:0.0:0.0:1.0	.	6;6;6;6;6;6;6;6;6;6;6	B7Z9B7;B4DTX5;F2Z2S3;Q9BX66-11;Q9BX66-10;Q9BX66-9;Q9BX66-4;Q9BX66-8;Q9BX66-3;Q9BX66;Q9BX66-2	.;.;.;.;.;.;.;.;.;SRBS1_HUMAN;.	V	6	ENSP00000360291:D6V;ENSP00000302556:D6V;ENSP00000360295:D6V;ENSP00000360293:D6V;ENSP00000360271:D6V;ENSP00000360292:D6V;ENSP00000377521:D6V;ENSP00000343998:D6V;ENSP00000277985:D6V;ENSP00000355136:D6V;ENSP00000277982:D6V;ENSP00000360285:D6V;ENSP00000277984:D6V;ENSP00000360283:D6V	ENSP00000277982:D6V	D	-	2	0	SORBS1	97187296	0.999000	0.42202	0.961000	0.40146	0.271000	0.26615	4.662000	0.61525	2.050000	0.60909	0.455000	0.32223	GAT	.		0.507	SORBS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049517.1		
SEMA6A	57556	hgsc.bcm.edu	37	5	115831161	115831161	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr5:115831161G>T	ENST00000343348.6	-	6	1179	c.392C>A	c.(391-393)gCa>gAa	p.A131E	CTB-118N6.3_ENST00000508640.1_RNA|SEMA6A_ENST00000510263.1_Missense_Mutation_p.A131E|CTB-118N6.3_ENST00000510682.1_RNA|SEMA6A_ENST00000503962.1_5'UTR|CTB-118N6.3_ENST00000514214.1_RNA|SEMA6A_ENST00000257414.8_Missense_Mutation_p.A131E	NM_020796.3	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A	131	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|centrosome localization (GO:0051642)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|positive regulation of neuron migration (GO:2001224)|semaphorin-plexin signaling pathway (GO:0071526)	axon (GO:0030424)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		GACAAACAATGCATCATCGTT	0.373																																					p.A131E		.											.	.	.	0			c.C392A						.						89.0	85.0	86.0					5																	115831161		1860	4105	5965	SO:0001583	missense	57556	exon6			AACAATGCATCAT	AB037789	CCDS47256.1, CCDS75288.1	5q23.1	2014-07-29			ENSG00000092421			"""Semaphorins"""	10738	protein-coding gene	gene with protein product	"""sema VIa"""	605885		SEMAQ		9204478, 10993894	Standard	XM_006714663		Approved	KIAA1368, SEMA6A1, SEMA, HT018	uc010jck.3	Q9H2E6	OTTHUMG00000162987	ENST00000343348.6:c.392C>A	5.37:g.115831161G>T	ENSP00000345512:p.Ala131Glu	76	0		69	4	NM_020796	Q9P2H9	Missense_Mutation	SNP	ENST00000343348.6	37	CCDS47256.1	.	.	.	.	.	.	.	.	.	.	G	10.57	1.387500	0.25031	.	.	ENSG00000092421	ENST00000343348;ENST00000257414;ENST00000510263;ENST00000515009	T;T;T;T	0.10573	2.86;2.86;2.86;2.86	6.08	5.17	0.71159	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.238465	0.49916	D	0.000122	T	0.09730	0.0239	N	0.17312	0.475	0.80722	D	1	B;B	0.19817	0.012;0.039	B;B	0.29716	0.088;0.106	T	0.13656	-1.0501	10	0.66056	D	0.02	.	14.0786	0.64905	0.0766:0.0:0.9234:0.0	.	131;131	Q9H2E6;Q9H2E6-2	SEM6A_HUMAN;.	E	131	ENSP00000345512:A131E;ENSP00000257414:A131E;ENSP00000424388:A131E;ENSP00000421935:A131E	ENSP00000257414:A131E	A	-	2	0	SEMA6A	115859060	1.000000	0.71417	0.052000	0.19188	0.054000	0.15201	6.661000	0.74422	1.493000	0.48517	-0.345000	0.07892	GCA	.		0.373	SEMA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371270.1	NM_020796	
FURIN	5045	hgsc.bcm.edu;bcgsc.ca	37	15	91421361	91421361	+	Splice_Site	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr15:91421361G>T	ENST00000268171.3	+	8	946		c.e8-1			NM_002569.2	NP_002560.1	P09958	FURIN_HUMAN	furin (paired basic amino acid cleaving enzyme)						cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of low-density lipoprotein particle receptor catabolic process (GO:0032804)|negative regulation of transforming growth factor beta1 production (GO:0032911)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-translational protein modification (GO:0043687)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)|regulation of protein catabolic process (GO:0042176)|secretion by cell (GO:0032940)|signal peptide processing (GO:0006465)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|nerve growth factor binding (GO:0048406)|peptidase activity (GO:0008233)|peptide binding (GO:0042277)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(4)|endometrium(4)|large_intestine(3)|liver(2)|lung(13)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	36	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			TTCACGGCCAGGGGTGCGCAT	0.672																																					.		.											.	.	.	0			c.668-1G>T						.						49.0	49.0	49.0					15																	91421361		2198	4298	6496	SO:0001630	splice_region_variant	5045	exon8			CGGCCAGGGGTGC	X17094	CCDS10364.1	15q26.1	2007-01-24	2002-12-04	2002-12-06	ENSG00000140564	ENSG00000140564			8568	protein-coding gene	gene with protein product		136950	"""paired basic amino acid cleaving enzyme (furin, membrane associated receptor protein)"""	PCSK3, FUR, PACE		2251280, 1741956	Standard	NM_002569		Approved	SPC1	uc002bpu.1	P09958	OTTHUMG00000149831	ENST00000268171.3:c.668-1G>T	15.37:g.91421361G>T		71	0		62	4	NM_002569	Q14336|Q6LBS3|Q9UCZ5	Splice_Site	SNP	ENST00000268171.3	37	CCDS10364.1	.	.	.	.	.	.	.	.	.	.	G	18.03	3.532441	0.64972	.	.	ENSG00000140564	ENST00000268171	.	.	.	4.45	4.45	0.53987	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3345	0.87276	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FURIN	89222365	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	9.168000	0.94781	2.313000	0.78055	0.456000	0.33151	.	.		0.672	FURIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313492.1	NM_002569	Intron
FAM45A	404636	hgsc.bcm.edu	37	10	120867507	120867507	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr10:120867507G>T	ENST00000361432.2	+	2	109	c.83G>T	c.(82-84)tGg>tTg	p.W28L	FAM45A_ENST00000544016.1_5'UTR|FAM45A_ENST00000535029.1_Missense_Mutation_p.W28L	NM_207009.2	NP_996892.1	Q8TCE6	FA45A_HUMAN	family with sequence similarity 45, member A	28										breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	14		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0293)		GAAGTTCTGTGGGTGTGGTGT	0.433																																					p.W28L		.											.	.	.	0			c.G83T						.						146.0	139.0	141.0					10																	120867507		2203	4300	6503	SO:0001583	missense	404636	exon2			TTCTGTGGGTGTG	AF168713	CCDS7609.1	10q25	2008-09-04			ENSG00000119979	ENSG00000119979			31793	protein-coding gene	gene with protein product							Standard	NM_207009		Approved			Q8TCE6	OTTHUMG00000019143	ENST00000361432.2:c.83G>T	10.37:g.120867507G>T	ENSP00000354688:p.Trp28Leu	89	0		89	5	NM_207009	B1AMV6|B4DDC3|D3DRC8|Q9NXW4	Missense_Mutation	SNP	ENST00000361432.2	37	CCDS7609.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.178369	0.78564	.	.	ENSG00000119979	ENST00000535029;ENST00000546291;ENST00000361432	.	.	.	5.86	4.95	0.65309	.	0.000000	0.85682	D	0.000000	T	0.69557	0.3124	L	0.46614	1.455	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.68554	-0.5378	9	0.37606	T	0.19	.	15.5412	0.76048	0.0:0.1372:0.8628:0.0	.	20;28	Q8TCE6-2;Q8TCE6	.;FA45A_HUMAN	L	28	.	ENSP00000354688:W28L	W	+	2	0	FAM45A	120857497	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.059000	0.93902	1.485000	0.48380	0.558000	0.71614	TGG	.		0.433	FAM45A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050623.1	NM_207009	
MYF5	4617	hgsc.bcm.edu	37	12	81110964	81110964	+	Missense_Mutation	SNP	C	C	T	rs375022310		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr12:81110964C>T	ENST00000228644.3	+	1	274	c.122C>T	c.(121-123)gCg>gTg	p.A41V		NM_005593.2	NP_005584.2	P13349	MYF5_HUMAN	myogenic factor 5	41					camera-type eye development (GO:0043010)|cartilage condensation (GO:0001502)|embryonic skeletal system morphogenesis (GO:0048704)|extracellular matrix organization (GO:0030198)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|muscle tissue morphogenesis (GO:0060415)|ossification (GO:0001503)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)	protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(8)|lung(15)|ovary(2)|pancreas(1)	30						GCCTTCGGAGCGCACAAAGCA	0.622																																					p.A41V		.											MYF5,colon,carcinoma,0,1	MYF5	0	0			c.C122T						.						37.0	34.0	35.0					12																	81110964		2203	4300	6503	SO:0001583	missense	4617	exon1			TCGGAGCGCACAA		CCDS9020.1	12q21	2013-05-21			ENSG00000111049	ENSG00000111049		"""Basic helix-loop-helix proteins"""	7565	protein-coding gene	gene with protein product		159990				8978788, 12105204	Standard	NM_005593		Approved	bHLHc2	uc001szg.2	P13349	OTTHUMG00000170166	ENST00000228644.3:c.122C>T	12.37:g.81110964C>T	ENSP00000228644:p.Ala41Val	26	0		21	2	NM_005593	Q6ISR9	Missense_Mutation	SNP	ENST00000228644.3	37	CCDS9020.1	.	.	.	.	.	.	.	.	.	.	C	14.57	2.573703	0.45902	.	.	ENSG00000111049	ENST00000228644	T	0.77229	-1.08	6.17	1.04	0.20106	Myogenic basic muscle-specific protein (2);	0.275748	0.39985	N	0.001209	T	0.64360	0.2591	L	0.47016	1.485	0.33258	D	0.559396	B	0.09022	0.002	B	0.11329	0.006	T	0.55541	-0.8125	10	0.16896	T	0.51	-2.5878	6.4832	0.22075	0.0:0.5536:0.239:0.2073	.	41	P13349	MYF5_HUMAN	V	41	ENSP00000228644:A41V	ENSP00000228644:A41V	A	+	2	0	MYF5	79635095	0.094000	0.21725	0.151000	0.22473	0.960000	0.62799	0.484000	0.22308	-0.074000	0.12820	-0.137000	0.14449	GCG	.		0.622	MYF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407757.1	NM_005593	
ARHGAP19	84986	hgsc.bcm.edu	37	10	99052058	99052058	+	Intron	SNP	G	G	C			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr10:99052058G>C	ENST00000358531.4	-	1	85				ARHGAP19-SLIT1_ENST00000358308.3_Intron|ARHGAP19-SLIT1_ENST00000453547.2_Intron|ARHGAP19-SLIT1_ENST00000316676.8_Intron	NM_001204300.1|NM_032900.5	NP_001191229.1|NP_116289.4	Q14CB8	RHG19_HUMAN	Rho GTPase activating protein 19						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(2)|urinary_tract(1)	13		Colorectal(252;0.0854)		Epithelial(162;7.65e-09)|all cancers(201;4.49e-07)		GCGCCAAAGCGATCAGCGCTG	0.647																																					.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	0	.			CAAAGCGATCAGC	AK074122	CCDS7454.2, CCDS58092.1, CCDS73175.1	10q24.2	2011-06-29			ENSG00000213390	ENSG00000213390		"""Rho GTPase activating proteins"""	23724	protein-coding gene	gene with protein product		611587					Standard	NM_032900		Approved	FLJ00194, MGC14258	uc001knb.3	Q14CB8	OTTHUMG00000018845	ENST00000358531.4:c.56+270C>G	10.37:g.99052058G>C		19	0		17	7	.	A1XCP1|B4DZR1|Q14CF2|Q5J8M2|Q5T460|Q5T462|Q68DG6|Q8N9X1|Q8NF34|Q8TEK1	RNA	SNP	ENST00000358531.4	37	CCDS7454.2																																																																																			.		0.647	ARHGAP19-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049647.2	NM_032900	
DIS3L2	129563	hgsc.bcm.edu;bcgsc.ca	37	2	232894774	232894774	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr2:232894774C>A	ENST00000409307.1	+	4	350	c.350C>A	c.(349-351)cCc>cAc	p.P117H	DIS3L2_ENST00000470087.1_3'UTR|DIS3L2_ENST00000325385.7_Missense_Mutation_p.P117H|DIS3L2_ENST00000360410.4_Missense_Mutation_p.P117H|DIS3L2_ENST00000409401.3_Missense_Mutation_p.P117H|DIS3L2_ENST00000273009.6_Missense_Mutation_p.P117H					DIS3 like 3'-5' exoribonuclease 2											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		AAACTGCTTCCCGAGGAGCAT	0.433																																					p.P117H		.											.	.	.	0			c.C350A						.						149.0	145.0	146.0					2																	232894774		1863	4098	5961	SO:0001583	missense	129563	exon5			TGCTTCCCGAGGA	BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000409307.1:c.350C>A	2.37:g.232894774C>A	ENSP00000386799:p.Pro117His	95	0		69	4	NM_001257282		Missense_Mutation	SNP	ENST00000409307.1	37	CCDS42834.1	.	.	.	.	.	.	.	.	.	.	C	19.81	3.896904	0.72639	.	.	ENSG00000144535	ENST00000273009;ENST00000542873;ENST00000325385;ENST00000360410;ENST00000409401;ENST00000441279;ENST00000431466;ENST00000409307	T;T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55;1.55	5.53	4.64	0.57946	.	0.000000	0.64402	D	0.000001	T	0.63721	0.2535	M	0.89715	3.055	0.53688	D	0.99997	D;D	0.89917	1.0;1.0	D;D	0.91635	0.984;0.999	T	0.73655	-0.3914	10	0.72032	D	0.01	-10.901	16.3508	0.83204	0.0:0.8679:0.1321:0.0	.	117;117	Q8IYB7;Q8IYB7-4	DI3L2_HUMAN;.	H	117	ENSP00000273009:P117H;ENSP00000315569:P117H;ENSP00000353584:P117H;ENSP00000386594:P117H;ENSP00000390467:P117H;ENSP00000386799:P117H	ENSP00000273009:P117H	P	+	2	0	DIS3L2	232603018	1.000000	0.71417	0.848000	0.33437	0.946000	0.59487	6.595000	0.74109	1.315000	0.45114	0.557000	0.71058	CCC	.		0.433	DIS3L2-015	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330988.1	NM_152383	
LGI2	55203	hgsc.bcm.edu;bcgsc.ca	37	4	25014069	25014069	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr4:25014069G>T	ENST00000382114.4	-	7	893	c.708C>A	c.(706-708)ttC>ttA	p.F236L		NM_018176.3	NP_060646.2	Q8N0V4	LGI2_HUMAN	leucine-rich repeat LGI family, member 2	236						extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(2)	33		Breast(46;0.173)				TCTTGGAGTTGAACGTATCCA	0.468																																					p.F236L		.											.	.	.	0			c.C708A						.						130.0	112.0	118.0					4																	25014069		2203	4300	6503	SO:0001583	missense	55203	exon7			GGAGTTGAACGTA	AJ487516	CCDS3431.1	4p15.31	2008-07-28			ENSG00000153012	ENSG00000153012			18710	protein-coding gene	gene with protein product		608301				12023020, 16014869	Standard	NM_018176		Approved	KIAA1916, FLJ10675	uc003grf.2	Q8N0V4	OTTHUMG00000097749	ENST00000382114.4:c.708C>A	4.37:g.25014069G>T	ENSP00000371548:p.Phe236Leu	59	0		52	4	NM_018176	Q3MIN2|Q8NDW6|Q96PX2|Q9NVK4	Missense_Mutation	SNP	ENST00000382114.4	37	CCDS3431.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.669902	0.88348	.	.	ENSG00000153012	ENST00000382114	D	0.86497	-2.13	4.81	3.96	0.45880	.	0.000000	0.85682	D	0.000000	D	0.91047	0.7183	M	0.71036	2.16	0.58432	D	0.999999	D	0.55385	0.971	P	0.60068	0.868	D	0.90772	0.4673	10	0.49607	T	0.09	-31.395	12.9169	0.58211	0.0788:0.0:0.9212:0.0	.	236	Q8N0V4	LGI2_HUMAN	L	236	ENSP00000371548:F236L	ENSP00000371548:F236L	F	-	3	2	LGI2	24623167	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.263000	0.51546	1.147000	0.42369	0.555000	0.69702	TTC	.		0.468	LGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214978.1		
TLR8	51311	hgsc.bcm.edu	37	X	12939080	12939080	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chrX:12939080C>A	ENST00000218032.6	+	2	2008	c.1921C>A	c.(1921-1923)Ctg>Atg	p.L641M	TLR8_ENST00000311912.5_Missense_Mutation_p.L659M	NM_138636.4	NP_619542.1	Q9NR97	TLR8_HUMAN	toll-like receptor 8	641					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|regulation of cytokine secretion (GO:0050707)|response to virus (GO:0009615)|toll-like receptor 8 signaling pathway (GO:0034158)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50					Imiquimod(DB00724)	TCTCAAGAATCTGACACGTCT	0.393																																					p.L641M		.											.	.	.	0			c.C1921A						.						60.0	60.0	60.0					X																	12939080		2203	4296	6499	SO:0001583	missense	51311	exon2			AAGAATCTGACAC	AF246971	CCDS14152.1, CCDS14153.1	Xp22	2009-11-23			ENSG00000101916	ENSG00000101916		"""CD molecules"""	15632	protein-coding gene	gene with protein product		300366				11022119	Standard	NM_138636		Approved	CD288	uc004cve.3	Q9NR97	OTTHUMG00000021145	ENST00000218032.6:c.1921C>A	X.37:g.12939080C>A	ENSP00000218032:p.Leu641Met	92	0		89	4	NM_138636	B3Y654|D1CS70|D1CS76|Q495P4|Q6UXL6|Q9NYG9	Missense_Mutation	SNP	ENST00000218032.6	37	CCDS14152.1	.	.	.	.	.	.	.	.	.	.	C	7.285	0.609822	0.14066	.	.	ENSG00000101916	ENST00000218032;ENST00000311912	D;D	0.82526	-1.62;-1.62	5.82	3.74	0.42951	.	0.000000	0.31884	N	0.006912	D	0.90239	0.6948	M	0.89095	3.005	0.25520	N	0.987371	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.82026	-0.0661	10	0.87932	D	0	.	5.5248	0.16953	0.147:0.5574:0.0:0.2957	.	641;659	Q9NR97;D1CS70	TLR8_HUMAN;.	M	641;659	ENSP00000218032:L641M;ENSP00000312082:L659M	ENSP00000218032:L641M	L	+	1	2	TLR8	12849001	0.040000	0.19996	0.030000	0.17652	0.014000	0.08584	0.366000	0.20365	1.225000	0.43566	0.600000	0.82982	CTG	.		0.393	TLR8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055784.2	NM_016610	
ADAM17	6868	hgsc.bcm.edu;bcgsc.ca	37	2	9661362	9661362	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr2:9661362C>A	ENST00000310823.3	-	8	1109	c.927G>T	c.(925-927)aaG>aaT	p.K309N		NM_003183.4	NP_003174.3	P78536	ADA17_HUMAN	ADAM metallopeptidase domain 17	309	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell motility (GO:0048870)|collagen catabolic process (GO:0030574)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|germinal center formation (GO:0002467)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil mediated immunity (GO:0002446)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of chemokine production (GO:0032722)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|proteolysis (GO:0006508)|regulation of mast cell apoptotic process (GO:0033025)|response to drug (GO:0042493)|response to high density lipoprotein particle (GO:0055099)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|wound healing, spreading of epidermal cells (GO:0035313)	actin cytoskeleton (GO:0015629)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|interleukin-6 receptor binding (GO:0005138)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|Notch binding (GO:0005112)|PDZ domain binding (GO:0030165)|zinc ion binding (GO:0008270)			breast(1)|cervix(4)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	28	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.225)		CCCAAGCATCCTTTTCTTCAT	0.393																																					p.K309N		.											.	.	.	0			c.G927T						.						262.0	229.0	240.0					2																	9661362		2203	4300	6503	SO:0001583	missense	6868	exon8			AGCATCCTTTTCT	U69611	CCDS1665.1	2p25	2010-08-05	2008-07-31		ENSG00000151694	ENSG00000151694		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	195	protein-coding gene	gene with protein product		603639	"""tumor necrosis factor, alpha, converting enzyme"""	TACE		9034190, 9574564	Standard	NM_003183		Approved	cSVP, CD156B	uc002qzu.3	P78536	OTTHUMG00000090425	ENST00000310823.3:c.927G>T	2.37:g.9661362C>A	ENSP00000309968:p.Lys309Asn	59	0		74	4	NM_003183	O60226	Missense_Mutation	SNP	ENST00000310823.3	37	CCDS1665.1	.	.	.	.	.	.	.	.	.	.	C	19.63	3.863236	0.71949	.	.	ENSG00000151694	ENST00000310823	D	0.86694	-2.16	5.53	2.72	0.32119	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (1);	0.040994	0.85682	D	0.000000	T	0.81992	0.4940	N	0.26042	0.785	0.80722	D	1	P;P	0.49358	0.923;0.923	P;P	0.50825	0.651;0.651	T	0.76055	-0.3099	10	0.19590	T	0.45	.	10.2125	0.43150	0.0:0.6643:0.0:0.3357	.	309;309	B2RNB2;P78536	.;ADA17_HUMAN	N	309	ENSP00000309968:K309N	ENSP00000309968:K309N	K	-	3	2	ADAM17	9578813	0.999000	0.42202	1.000000	0.80357	0.996000	0.88848	0.548000	0.23314	0.815000	0.34398	0.555000	0.69702	AAG	.		0.393	ADAM17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206857.1		
CHRNG	1146	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	233408058	233408058	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr2:233408058G>T	ENST00000389494.3	+	8	900	c.879G>T	c.(877-879)aaG>aaT	p.K293N	CHRNG_ENST00000389492.3_Missense_Mutation_p.K241N	NM_005199.4	NP_005190.4	P07510	ACHG_HUMAN	cholinergic receptor, nicotinic, gamma (muscle)	293					muscle contraction (GO:0006936)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)			breast(2)|endometrium(3)|large_intestine(4)|lung(12)|upper_aerodigestive_tract(1)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;6.39e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00079)|LUSC - Lung squamous cell carcinoma(224;0.00757)|Lung(119;0.0086)	Galantamine(DB00674)	TTGTGGCCAAGAAGGTGCCTG	0.582																																					p.K293N		.											.	.	.	0			c.G879T						.						98.0	93.0	95.0					2																	233408058		2203	4300	6503	SO:0001583	missense	1146	exon8			GGCCAAGAAGGTG	X01715	CCDS33400.1	2q37.1	2012-10-02	2012-02-07		ENSG00000196811	ENSG00000196811		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1967	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, gamma (muscle)"""	100730	"""cholinergic receptor, nicotinic, gamma"""	ACHRG			Standard	NM_005199		Approved		uc002vsx.1	P07510	OTTHUMG00000153327	ENST00000389494.3:c.879G>T	2.37:g.233408058G>T	ENSP00000374145:p.Lys293Asn	24	0		22	4	NM_005199	B3KWM8|Q14DU4|Q53RG2	Missense_Mutation	SNP	ENST00000389494.3	37	CCDS33400.1	.	.	.	.	.	.	.	.	.	.	G	19.56	3.851152	0.71719	.	.	ENSG00000196811	ENST00000389494;ENST00000541596;ENST00000389492	D;D	0.84660	-1.88;-1.88	4.96	3.14	0.36123	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.378135	0.29314	N	0.012514	D	0.86347	0.5911	M	0.67953	2.075	0.46317	D	0.998986	P;P	0.52842	0.956;0.853	P;P	0.53313	0.723;0.583	D	0.84852	0.0814	10	0.72032	D	0.01	.	7.0286	0.24954	0.1487:0.0:0.71:0.1414	.	241;293	Q14DU4;P07510	.;ACHG_HUMAN	N	293;293;241	ENSP00000374145:K293N;ENSP00000374143:K241N	ENSP00000374143:K241N	K	+	3	2	CHRNG	233116302	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.582000	0.67477	0.680000	0.31366	0.313000	0.20887	AAG	.		0.582	CHRNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330743.1	NM_005199	
COL17A1	1308	hgsc.bcm.edu	37	10	105819419	105819419	+	Nonsense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr10:105819419G>T	ENST00000353479.5	-	15	1489	c.1199C>A	c.(1198-1200)tCa>tAa	p.S400*	COL17A1_ENST00000393211.3_Nonsense_Mutation_p.S400*|COL17A1_ENST00000369733.3_Nonsense_Mutation_p.S400*	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	400	Nonhelical region (NC16).				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		TTTTAGGCCTGAGTCAGCATT	0.413																																					p.S400X		.											.	.	.	0			c.C1199A						.						212.0	187.0	196.0					10																	105819419		2203	4300	6503	SO:0001587	stop_gained	1308	exon15			AGGCCTGAGTCAG	M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.1199C>A	10.37:g.105819419G>T	ENSP00000340937:p.Ser400*	75	0		54	4	NM_000494	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Nonsense_Mutation	SNP	ENST00000353479.5	37	CCDS7554.1	.	.	.	.	.	.	.	.	.	.	G	36	5.698916	0.96802	.	.	ENSG00000065618	ENST00000353479;ENST00000369733;ENST00000541872;ENST00000393211	.	.	.	5.61	3.77	0.43336	.	0.478185	0.17159	N	0.184771	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	-0.7055	11.9038	0.52699	0.1424:0.0:0.8576:0.0	.	.	.	.	X	400;400;384;400	.	ENSP00000340937:S400X	S	-	2	0	COL17A1	105809409	1.000000	0.71417	0.024000	0.17045	0.276000	0.26787	6.557000	0.73937	0.745000	0.32763	-0.140000	0.14226	TCA	.		0.413	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050181.1	NM_130778, NM_000494	
FBXW2	26190	hgsc.bcm.edu	37	9	123550286	123550286	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr9:123550286G>T	ENST00000608872.1	-	3	438	c.251C>A	c.(250-252)tCt>tAt	p.S84Y	FBXW2_ENST00000340778.5_Missense_Mutation_p.S84Y	NM_012164.3	NP_036296.2	Q9UKT8	FBXW2_HUMAN	F-box and WD repeat domain containing 2	84	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				cellular protein modification process (GO:0006464)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)			ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	4						CCACTGTTTAGAGACGAGGCA	0.463																																					p.S84Y		.											FBXW2_ENST00000373926,NS,carcinoma,0,1	FBXW2_ENST00000373926	0	0			c.C251A						.						109.0	104.0	105.0					9																	123550286		1939	4152	6091	SO:0001583	missense	26190	exon3			TGTTTAGAGACGA	AF129531	CCDS43872.1	9q34	2013-01-09	2007-02-08		ENSG00000119402	ENSG00000119402		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13608	protein-coding gene	gene with protein product		609071	"""F-box and WD-40 domain protein 2"""			10531035, 10828603	Standard	NM_012164		Approved	FBW2, Md6, Fwd2	uc004bkm.1	Q9UKT8	OTTHUMG00000020576	ENST00000608872.1:c.251C>A	9.37:g.123550286G>T	ENSP00000476369:p.Ser84Tyr	37	0		32	2	NM_012164	B3KRL8|Q4VXH2|Q7Z4V6|Q8WV51|Q9HA09|Q9UKA3	Missense_Mutation	SNP	ENST00000608872.1	37	CCDS43872.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.953943	0.73902	.	.	ENSG00000119402	ENST00000373926;ENST00000340778;ENST00000444833	T;T	0.53423	0.62;0.62	5.95	5.95	0.96441	F-box domain, cyclin-like (3);F-box domain, Skp2-like (1);	0.049584	0.85682	D	0.000000	T	0.67832	0.2935	M	0.89414	3.03	0.53688	D	0.999976	P;D;P	0.55385	0.936;0.971;0.948	P;P;P	0.52109	0.466;0.69;0.601	T	0.74484	-0.3650	10	0.87932	D	0	-7.5316	17.887	0.88858	0.0:0.0:1.0:0.0	.	84;84;84	Q9UKT8-2;B2RAW3;Q9UKT8	.;.;FBXW2_HUMAN	Y	84	ENSP00000363036:S84Y;ENSP00000341161:S84Y	ENSP00000341161:S84Y	S	-	2	0	FBXW2	122590107	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.594000	0.67557	2.824000	0.97209	0.655000	0.94253	TCT	.		0.463	FBXW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053834.2		
TADA2A	6871	hgsc.bcm.edu	37	17	35827572	35827572	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr17:35827572C>A	ENST00000394395.2	+	12	1011	c.838C>A	c.(838-840)Cga>Aga	p.R280R	TADA2A_ENST00000591992.1_3'UTR|TADA2A_ENST00000225396.6_Silent_p.R280R	NM_001166105.1	NP_001159577.1	O75478	TAD2A_HUMAN	transcriptional adaptor 2A	280					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|zinc ion binding (GO:0008270)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|lung(3)|prostate(1)|skin(1)	13						ATTTGAACTCCGAAGGGAAAT	0.378																																					p.R280R		.											TADA2A_ENST00000394395,NS,carcinoma,0,2	TADA2A_ENST00000394395	0	0			c.C838A						.						100.0	89.0	93.0					17																	35827572		2203	4300	6503	SO:0001819	synonymous_variant	6871	exon12			GAACTCCGAAGGG	AK022767	CCDS11319.1, CCDS45656.1	17q12-q21	2014-04-10	2009-10-02	2009-10-02	ENSG00000108264	ENSG00000276234			11531	protein-coding gene	gene with protein product		602276	"""transcriptional adaptor 2 (ADA2 homolog, yeast)-like"""	TADA2L		8552087	Standard	XM_006722043		Approved	ADA2, hADA2, ADA2A	uc002hnt.3	O75478	OTTHUMG00000188469	ENST00000394395.2:c.838C>A	17.37:g.35827572C>A		46	0		41	3	NM_001488	A8MVD0|B3KMU9|Q9BVJ0|Q9UCW2|Q9UP49	Silent	SNP	ENST00000394395.2	37	CCDS11319.1																																																																																			.		0.378	TADA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256677.3	NM_001488	
SDK2	54549	hgsc.bcm.edu	37	17	71394551	71394551	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr17:71394551C>A	ENST00000392650.3	-	23	3111	c.3111G>T	c.(3109-3111)gaG>gaT	p.E1037D	SDK2_ENST00000388726.3_Missense_Mutation_p.E1037D	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1037	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						ACTCCTCTCCCTCCCCAACCA	0.627																																					p.E1037D		.											.	.	.	0			c.G3111T						.						91.0	83.0	85.0					17																	71394551		2203	4300	6503	SO:0001583	missense	54549	exon23			CTCTCCCTCCCCA	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.3111G>T	17.37:g.71394551C>A	ENSP00000376421:p.Glu1037Asp	126	0		94	4	NM_001144952	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	37	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	C	8.411	0.844250	0.16963	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893	T;T;T	0.57595	0.39;0.39;0.39	4.55	2.57	0.30868	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.179938	0.47852	D	0.000213	T	0.41743	0.1172	L	0.53671	1.685	0.45541	D	0.998497	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.002;0.001	T	0.19877	-1.0292	10	0.09843	T	0.71	.	10.2196	0.43190	0.0:0.8394:0.0:0.1606	.	1037;1037;1037	Q58EX2-2;Q58EX2;Q58EX2-3	.;SDK2_HUMAN;.	D	661;1037;1037;213;1037	ENSP00000376421:E1037D;ENSP00000373378:E1037D;ENSP00000407098:E213D	ENSP00000324967:E1037D	E	-	3	2	SDK2	68906146	0.579000	0.26725	1.000000	0.80357	0.787000	0.44495	0.228000	0.17814	0.552000	0.29026	0.462000	0.41574	GAG	.		0.627	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064	
DNM3	26052	hgsc.bcm.edu	37	1	172061989	172061989	+	Missense_Mutation	SNP	C	C	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:172061989C>T	ENST00000355305.5	+	13	1676	c.1519C>T	c.(1519-1521)Cac>Tac	p.H507Y	DNM3_ENST00000367733.2_Missense_Mutation_p.H507Y|DNM3_ENST00000367731.1_Missense_Mutation_p.H507Y|DNM3_ENST00000520906.1_Missense_Mutation_p.H507Y|DNM3_ENST00000358155.4_Missense_Mutation_p.H507Y			Q9UQ16	DYN3_HUMAN	dynamin 3	507					endocytosis (GO:0006897)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|synapse assembly (GO:0007416)	dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(16)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						CAGTCAGGTTCACAAGAAAAC	0.363																																					p.H507Y		.											.	.	.	0			c.C1519T						.						68.0	64.0	65.0					1																	172061989		1852	4087	5939	SO:0001583	missense	26052	exon13			CAGGTTCACAAGA	AL136712	CCDS44276.1, CCDS60356.1	1q24.1	2013-01-10			ENSG00000197959	ENSG00000197959		"""Pleckstrin homology (PH) domain containing"""	29125	protein-coding gene	gene with protein product	"""Dyna III"""	611445				10048485	Standard	NM_015569		Approved	KIAA0820	uc001gie.4	Q9UQ16	OTTHUMG00000034913	ENST00000355305.5:c.1519C>T	1.37:g.172061989C>T	ENSP00000347457:p.His507Tyr	48	0		82	3	NM_001136127	A9Z1Y1|O14982|O95555|Q1MTM8|Q5W129|Q6P2G1|Q9H0P3|Q9H548|Q9NQ68|Q9NQN6	Missense_Mutation	SNP	ENST00000355305.5	37		.	.	.	.	.	.	.	.	.	.	C	12.60	1.987804	0.35036	.	.	ENSG00000197959	ENST00000359070;ENST00000358155;ENST00000367733;ENST00000355305;ENST00000367731;ENST00000520906;ENST00000523513	D;D;D;D;D;D	0.93488	-3.05;-2.9;-3.06;-3.05;-3.23;-2.88	5.92	5.92	0.95590	.	0.427245	0.28671	N	0.014538	T	0.79353	0.4431	N	0.08118	0	0.36674	D	0.878687	B;B;B;B	0.30709	0.224;0.152;0.291;0.165	B;B;B;B	0.26969	0.068;0.04;0.064;0.075	T	0.81232	-0.1026	10	0.59425	D	0.04	.	12.8807	0.58015	0.1727:0.8272:0.0:0.0	.	507;507;507;507	E5RHK8;Q9UQ16-2;Q9UQ16-3;Q6P2G1	.;.;.;.	Y	507;507;507;507;507;507;397	ENSP00000350876:H507Y;ENSP00000356707:H507Y;ENSP00000347457:H507Y;ENSP00000356705:H507Y;ENSP00000429701:H507Y;ENSP00000429416:H397Y	ENSP00000347457:H507Y	H	+	1	0	DNM3	170328612	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.383000	0.44354	2.814000	0.96858	0.585000	0.79938	CAC	.		0.363	DNM3-003	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000084531.1	NM_015569	
SCGB1D2	10647	hgsc.bcm.edu	37	11	62010926	62010926	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr11:62010926G>T	ENST00000244926.3	+	2	319	c.221G>T	c.(220-222)cGa>cTa	p.R74L	RP11-703H8.9_ENST00000529875.1_RNA	NM_006551.3	NP_006542.1	O95969	SG1D2_HUMAN	secretoglobin, family 1D, member 2	74						extracellular space (GO:0005615)				breast(1)|endometrium(1)|lung(1)	3						CTTCAGAAACGAAGCCTCATT	0.473																																					p.R74L		.											SCGB1D2,NS,malignant_melanoma,0,1	SCGB1D2	0	0			c.G221T						.						144.0	130.0	135.0					11																	62010926		2202	4299	6501	SO:0001583	missense	10647	exon2			AGAAACGAAGCCT	AJ224172	CCDS8017.1	11q13	2011-12-14			ENSG00000124935	ENSG00000124935		"""Secretoglobins"""	18396	protein-coding gene	gene with protein product	"""prostatein-like lipophilin B"", ""lipophilin B (uteroglobin family member), prostatein-like"""	615061				10066439, 9720917, 22155607	Standard	XM_006718422		Approved	LPHB, LIPB	uc001ntb.3	O95969	OTTHUMG00000167508	ENST00000244926.3:c.221G>T	11.37:g.62010926G>T	ENSP00000244926:p.Arg74Leu	57	0		38	2	NM_006551	Q2M3N9	Missense_Mutation	SNP	ENST00000244926.3	37	CCDS8017.1	.	.	.	.	.	.	.	.	.	.	G	12.36	1.913321	0.33815	.	.	ENSG00000124935	ENST00000244926	T	0.37584	1.19	2.4	0.441	0.16577	.	0.449156	0.15680	N	0.249950	T	0.49592	0.1566	.	.	.	0.09310	N	1	D	0.89917	1.0	D	0.79108	0.992	T	0.28870	-1.0030	9	0.54805	T	0.06	.	4.7486	0.13049	0.3105:0.0:0.6895:0.0	.	74	O95969	SG1D2_HUMAN	L	74	ENSP00000244926:R74L	ENSP00000244926:R74L	R	+	2	0	SCGB1D2	61767502	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-1.716000	0.01878	0.138000	0.18790	0.306000	0.20318	CGA	.		0.473	SCGB1D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394859.1	NM_006551	
PRM2	5620	hgsc.bcm.edu	37	16	11367212	11367212	+	IGR	SNP	G	G	T	rs376400498		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr16:11367212G>T	ENST00000241808.4	-	0	680				RMI2_ENST00000572173.1_Intron|PRM3_ENST00000327157.2_Silent_p.R81R|SNORA48_ENST00000390926.1_RNA	NM_002762.2	NP_002753.2	P04554	PRM2_HUMAN	protamine 2						cell differentiation (GO:0030154)|chromosome condensation (GO:0030261)|DNA packaging (GO:0006323)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.0?(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(2)	7						TCCTCCTGCCGCTCAGGCTCC	0.677																																					p.R81R		.											PRM3,colon,carcinoma,0,1	PRM3	0	1	Whole gene deletion(1)	haematopoietic_and_lymphoid_tissue(1)	c.C241A						.						16.0	26.0	22.0					16																	11367212		1990	3917	5907	SO:0001628	intergenic_variant	58531	exon1			CCTGCCGCTCAGG		CCDS42118.1, CCDS66944.1	16p13.13	2013-10-17			ENSG00000122304	ENSG00000122304			9448	protein-coding gene	gene with protein product	"""cancer/testis antigen family 94, member 2"""	182890				16632464	Standard	NM_001286356		Approved	CT94.2	uc002dau.1	P04554	OTTHUMG00000172317		16.37:g.11367212G>T		31	0		24	2	NM_021247	Q6ZMM0	Silent	SNP	ENST00000241808.4	37	CCDS42118.1																																																																																			.		0.677	PRM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417808.1		
DUOX2	50506	hgsc.bcm.edu	37	15	45394116	45394116	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr15:45394116C>A	ENST00000603300.1	-	21	2928	c.2726G>T	c.(2725-2727)cGg>cTg	p.R909L	DUOX2_ENST00000389039.6_Missense_Mutation_p.R909L	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	909	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)	p.R909Q(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		TCCCGACTCCCGGAACATAGA	0.582																																					p.R909L		.											DUOX2,brain,primitive_neuroectodermal_tumour-medulloblastoma,0,1	DUOX2	0	1	Substitution - Missense(1)	central_nervous_system(1)	c.G2726T						.						99.0	84.0	89.0					15																	45394116		2198	4298	6496	SO:0001583	missense	50506	exon21			GACTCCCGGAACA	AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.2726G>T	15.37:g.45394116C>A	ENSP00000475084:p.Arg909Leu	51	0		42	2	NM_014080	A8MQ13|D2XI64|Q9NR02|Q9UHF9	Missense_Mutation	SNP	ENST00000603300.1	37	CCDS10117.1	.	.	.	.	.	.	.	.	.	.	C	14.60	2.583437	0.46006	.	.	ENSG00000140279	ENST00000389039	.	.	.	5.84	3.96	0.45880	EF-hand-like domain (1);	0.499217	0.23468	N	0.047850	T	0.43809	0.1264	L	0.34521	1.04	0.36451	D	0.866073	B;B	0.18610	0.002;0.029	B;B	0.17098	0.002;0.017	T	0.45056	-0.9287	9	0.52906	T	0.07	-17.3591	7.5862	0.27993	0.0:0.6766:0.0:0.3234	.	909;471	Q9NRD8;Q59GU9	DUOX2_HUMAN;.	L	909	.	ENSP00000373691:R909L	R	-	2	0	DUOX2	43181408	0.968000	0.33430	1.000000	0.80357	0.996000	0.88848	0.225000	0.17757	0.821000	0.34540	0.655000	0.94253	CGG	.		0.582	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_014080	
MUC20	200958	hgsc.bcm.edu	37	3	195452841	195452841	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr3:195452841C>A	ENST00000447234.2	+	2	1493	c.1367C>A	c.(1366-1368)tCc>tAc	p.S456Y	MUC20_ENST00000436408.1_Missense_Mutation_p.S456Y|MUC20_ENST00000320736.6_Missense_Mutation_p.S285Y|MUC20_ENST00000445522.2_Missense_Mutation_p.S421Y	NM_001282506.1	NP_001269435.1	Q8N307	MUC20_HUMAN	mucin 20, cell surface associated	456	Involved in oligomerization.				activation of MAPK activity (GO:0000187)|cellular protein metabolic process (GO:0044267)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein homooligomerization (GO:0051260)	basal plasma membrane (GO:0009925)|cell projection (GO:0042995)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)		p.S456F(1)		NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)	23	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		TCGTCCACCTCCGATCCACCA	0.567																																					p.S285Y		.											MUC20,trunk,malignant_melanoma,0,1	MUC20	0	1	Substitution - Missense(1)	skin(1)	c.C854A						.						50.0	44.0	46.0					3																	195452841		2153	4251	6404	SO:0001583	missense	200958	exon3			CCACCTCCGATCC	AB037780	CCDS63877.1	3q29	2008-08-07	2006-03-14		ENSG00000176945	ENSG00000176945		"""Mucins"""	23282	protein-coding gene	gene with protein product		610360				14565953	Standard	NM_001282506		Approved	FLJ14408, KIAA1359	uc010hzo.3	Q8N307	OTTHUMG00000155823	ENST00000447234.2:c.1367C>A	3.37:g.195452841C>A	ENSP00000414350:p.Ser456Tyr	51	0		48	4	NM_152673	Q6UX97|Q76I83|Q76I85|Q86ST8|Q8NBY6|Q96KA1|Q9P2I8	Missense_Mutation	SNP	ENST00000447234.2	37		.	.	.	.	.	.	.	.	.	.	C	8.857	0.946063	0.18356	.	.	ENSG00000176945	ENST00000447234;ENST00000320736;ENST00000436408;ENST00000445522	T;T;T;T	0.23147	2.37;2.48;2.53;1.92	4.38	3.42	0.39159	.	0.724278	0.11997	N	0.509172	T	0.32071	0.0817	N	0.24115	0.695	0.09310	N	1	D	0.64830	0.994	D	0.66847	0.947	T	0.09037	-1.0693	10	0.62326	D	0.03	-0.1037	7.0399	0.25015	0.0:0.8552:0.0:0.1448	.	285	E9PH32	.	Y	456;285;456;421	ENSP00000414350:S456Y;ENSP00000325431:S285Y;ENSP00000396774:S456Y;ENSP00000405629:S421Y	ENSP00000325431:S285Y	S	+	2	0	MUC20	196938512	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-0.003000	0.12901	1.050000	0.40346	0.514000	0.50259	TCC	.		0.567	MUC20-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000341835.1	NM_152673	
OR10H1	26539	hgsc.bcm.edu	37	19	15918728	15918728	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr19:15918728C>A	ENST00000334920.2	-	1	208	c.120G>T	c.(118-120)ctG>ctT	p.L40L		NM_013940.2	NP_039228.1	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H, member 1	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|skin(2)|urinary_tract(1)	29						GCAGGTTGCCCAGCAGCGTGA	0.597																																					p.L40L		.											OR10H1,right_upper_lobe,carcinoma,0,1	OR10H1	0	0			c.G120T						.						135.0	118.0	124.0					19																	15918728		2203	4297	6500	SO:0001819	synonymous_variant	26539	exon1			GTTGCCCAGCAGC	AC004510	CCDS12335.1	19p13.1	2012-08-09				ENSG00000186723		"""GPCR / Class A : Olfactory receptors"""	8172	protein-coding gene	gene with protein product							Standard	NM_013940		Approved		uc002nbq.2	Q9Y4A9		ENST00000334920.2:c.120G>T	19.37:g.15918728C>A		37	0		50	3	NM_013940	Q6IFQ2|Q96R59	Silent	SNP	ENST00000334920.2	37	CCDS12335.1																																																																																			.		0.597	OR10H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460364.1		
IVD	3712	hgsc.bcm.edu;bcgsc.ca	37	15	40702955	40702955	+	Missense_Mutation	SNP	C	C	T	rs376324882		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr15:40702955C>T	ENST00000249760.2	+	4	758	c.415C>T	c.(415-417)Cgc>Tgc	p.R139C	IVD_ENST00000487418.2_Missense_Mutation_p.R142C|IVD_ENST00000479013.2_Missense_Mutation_p.R112C|IVD_ENST00000490194.1_3'UTR	NM_002225.3	NP_002216.2	P26440	IVD_HUMAN	isovaleryl-CoA dehydrogenase	139					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	flavin adenine dinucleotide binding (GO:0050660)|isovaleryl-CoA dehydrogenase activity (GO:0008470)			kidney(1)|lung(5)|ovary(2)|prostate(1)	9		all_cancers(109;1.19e-18)|all_epithelial(112;1.52e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.65e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0808)	Flavin adenine dinucleotide(DB03147)	CCAGCTTGTACGCAATGGGAA	0.512																																					p.R142C	GBM(31;293 617 7486 32527 34655)	.											.	.	.	0			c.C424T						.						68.0	56.0	60.0					15																	40702955		2203	4300	6503	SO:0001583	missense	3712	exon4			CTTGTACGCAATG	AF038317	CCDS10057.1, CCDS10057.2, CCDS53930.1	15q14-q15	2010-05-11	2010-05-11		ENSG00000128928	ENSG00000128928	1.3.99.10		6186	protein-coding gene	gene with protein product		607036	"""isovaleryl Coenzyme A dehydrogenase"", ""isovaleryl CoA dehydrogenase"""			2063866	Standard	NM_002225		Approved	ACAD2	uc001zls.3	P26440	OTTHUMG00000129984	ENST00000249760.2:c.415C>T	15.37:g.40702955C>T	ENSP00000249760:p.Arg139Cys	46	0		56	4	NM_002225	B2RCV5|B3KVI7|J3KR54|Q53XZ9|Q96AF6	Missense_Mutation	SNP	ENST00000249760.2	37		.	.	.	.	.	.	.	.	.	.	C	26.0	4.698007	0.88830	.	.	ENSG00000128928	ENST00000249760;ENST00000479013;ENST00000487418	D;D;D	0.99755	-6.64;-6.64;-6.64	5.17	5.17	0.71159	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA dehydrogenase, N-terminal (1);Acyl-CoA dehydrogenase/oxidase, N-terminal (1);	0.098170	0.64402	D	0.000001	D	0.99837	0.9926	H	0.95079	3.62	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.988;0.995	D	0.96838	0.9616	10	0.87932	D	0	.	14.5737	0.68229	0.1465:0.8535:0.0:0.0	.	139;112	P26440;B3KVI7	IVD_HUMAN;.	C	139;112;142	ENSP00000249760:R139C;ENSP00000417990:R112C;ENSP00000418397:R142C	ENSP00000249760:R139C	R	+	1	0	IVD	38490247	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	5.803000	0.69129	2.691000	0.91804	0.655000	0.94253	CGC	.		0.512	IVD-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
ZPR1	8882	hgsc.bcm.edu;bcgsc.ca	37	11	116657702	116657702	+	Missense_Mutation	SNP	G	G	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr11:116657702G>A	ENST00000227322.3	-	3	466	c.407C>T	c.(406-408)gCc>gTc	p.A136V		NM_003904.3	NP_003895.1	O75312	ZPR1_HUMAN		136					apoptotic process involved in development (GO:1902742)|axon development (GO:0061564)|Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA endoreduplication (GO:0042023)|inner cell mass cell proliferation (GO:0001833)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of motor neuron apoptotic process (GO:2000672)|positive regulation of gene expression (GO:0010628)|positive regulation of growth (GO:0045927)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of RNA splicing (GO:0033120)|positive regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071931)|pre-mRNA catabolic process (GO:1990261)|regulation of myelination (GO:0031641)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|spinal cord development (GO:0021510)|trophectodermal cell proliferation (GO:0001834)	axon (GO:0030424)|Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|SMN complex (GO:0032797)	translation initiation factor binding (GO:0031369)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	9	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.61e-06)|all cancers(92;0.000139)|OV - Ovarian serous cystadenocarcinoma(223;0.153)		CTGGCTAAAGGCAGGAATTTC	0.453																																					p.A136V		.											.	.	.	0			c.C407T						.						164.0	169.0	167.0					11																	116657702		2201	4296	6497	SO:0001583	missense	8882	exon3			CTAAAGGCAGGAA																												ENST00000227322.3:c.407C>T	11.37:g.116657702G>A	ENSP00000227322:p.Ala136Val	81	0		63	4	NM_003904	Q2TAA0	Missense_Mutation	SNP	ENST00000227322.3	37	CCDS8375.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.5|22.5	4.300229|4.300229	0.81136|0.81136	.|.	.|.	ENSG00000109917|ENSG00000109917	ENST00000227322|ENST00000444935	T|.	0.43688|.	0.94|.	5.3|5.3	5.3|5.3	0.74995|0.74995	Zinc finger, ZPR1-type (3);|.	0.099589|.	0.64402|.	D|.	0.000002|.	T|T	0.73984|0.73984	0.3657|0.3657	M|M	0.63169|0.63169	1.94|1.94	0.80722|0.80722	D|D	1|1	P;P|.	0.47841|.	0.785;0.901|.	B;P|.	0.46585|.	0.343;0.521|.	T|T	0.71636|0.71636	-0.4533|-0.4533	10|5	0.22706|.	T|.	0.39|.	-9.9865|-9.9865	19.313|19.313	0.94199|0.94199	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	85;136|.	B4DVT8;O75312|.	.;ZPR1_HUMAN|.	V|S	136|136	ENSP00000227322:A136V|.	ENSP00000227322:A136V|.	A|P	-|-	2|1	0|0	ZNF259|ZNF259	116162912|116162912	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	8.679000|8.679000	0.91220|0.91220	2.622000|2.622000	0.88805|0.88805	0.555000|0.555000	0.69702|0.69702	GCC|CCT	.		0.453	ZNF259-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106283.2		
EIF3A	8661	hgsc.bcm.edu;bcgsc.ca	37	10	120820340	120820340	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr10:120820340C>A	ENST00000369144.3	-	9	1371	c.1244G>T	c.(1243-1245)aGg>aTg	p.R415M	SNORA19_ENST00000410656.1_RNA|EIF3A_ENST00000541549.1_Missense_Mutation_p.R381M|SNORA19_ENST00000384737.1_RNA	NM_003750.2	NP_003741.1	P56537	IF6_HUMAN	eukaryotic translation initiation factor 3, subunit A	0					mature ribosome assembly (GO:0042256)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal subunit export from nucleus (GO:0000054)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lamin filament (GO:0005638)|nucleus (GO:0005634)	ribosomal large subunit binding (GO:0043023)|ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)			endometrium(8)|kidney(4)|large_intestine(14)|lung(22)|prostate(1)|skin(4)|urinary_tract(3)	56		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		AGGTTGTTCCCTAACCCAATT	0.333																																					p.R415M		.											.	.	.	0			c.G1244T						.						146.0	146.0	146.0					10																	120820340		2203	4300	6503	SO:0001583	missense	8661	exon9			TGTTCCCTAACCC	U78311	CCDS7608.1	10q26.11	2007-08-03	2007-07-27	2007-07-27	ENSG00000107581	ENSG00000107581			3271	protein-coding gene	gene with protein product		602039	"""eukaryotic translation initiation factor 3, subunit 10 theta, 150/170kDa"""	EIF3, EIF3S10		9054404, 8590280	Standard	NM_003750		Approved	eIF3-theta, eIF3-p170, KIAA0139, eIF3a, TIF32	uc001ldu.3	Q14152	OTTHUMG00000019144	ENST00000369144.3:c.1244G>T	10.37:g.120820340C>A	ENSP00000358140:p.Arg415Met	56	0		74	4	NM_003750	B7ZBG9|Q6IBN8|Q96TD5	Missense_Mutation	SNP	ENST00000369144.3	37	CCDS7608.1	.	.	.	.	.	.	.	.	.	.	C	15.25	2.777392	0.49786	.	.	ENSG00000107581	ENST00000369144;ENST00000541549	T;T	0.33654	1.4;1.4	5.92	4.08	0.47627	Proteasome component (PCI) domain (1);	0.169796	0.26959	U	0.021628	T	0.33702	0.0872	N	0.22421	0.69	0.44409	D	0.997323	P	0.43938	0.822	P	0.51487	0.671	T	0.06110	-1.0845	10	0.44086	T	0.13	-7.945	8.8039	0.34925	0.0:0.7006:0.0:0.2994	.	415	Q14152	EIF3A_HUMAN	M	415;381	ENSP00000358140:R415M;ENSP00000438178:R381M	ENSP00000358140:R415M	R	-	2	0	EIF3A	120810330	0.997000	0.39634	0.978000	0.43139	0.975000	0.68041	1.942000	0.40243	0.854000	0.35336	0.467000	0.42956	AGG	.		0.333	EIF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050634.1	NM_003750	
STT3A	3703	hgsc.bcm.edu	37	11	125484040	125484040	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr11:125484040G>T	ENST00000529196.1	+	15	1819	c.1613G>T	c.(1612-1614)cGa>cTa	p.R538L	STT3A_ENST00000392708.4_Missense_Mutation_p.R538L|STT3A_ENST00000531491.1_Missense_Mutation_p.R446L			P46977	STT3A_HUMAN	STT3A, subunit of the oligosaccharyltransferase complex (catalytic)	538					cellular protein metabolic process (GO:0044267)|co-translational protein modification (GO:0043686)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			NS(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(15)|skin(1)	33	all_hematologic(175;0.228)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0996)		ATGGCAAACCGAACAATTTTA	0.408																																					p.R538L		.											STT3A,colon,carcinoma,0,1	STT3A	0	0			c.G1613T						.						211.0	194.0	200.0					11																	125484040		2201	4299	6500	SO:0001583	missense	3703	exon14			CAAACCGAACAAT	BC020965	CCDS8458.1, CCDS60998.1	11q23.3	2013-03-06	2013-03-06	2006-02-07	ENSG00000134910	ENSG00000134910	2.4.99.18		6172	protein-coding gene	gene with protein product	"""dolichyl-diphosphooligosaccharide protein glycotransferase"""	601134	"""integral membrane protein 1"", ""STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae)"", ""STT3A, cataylic subunit of the oligosaccharyltransferase complex"""	ITM1		8941377, 8634329, 10234787	Standard	NM_152713		Approved	TMC, MGC9042, STT3-A	uc001qcd.2	P46977	OTTHUMG00000165852	ENST00000529196.1:c.1613G>T	11.37:g.125484040G>T	ENSP00000436962:p.Arg538Leu	53	0		68	3	NM_152713	B4DJ24|E9PNQ1|Q86XU9|Q8TE35|Q8WUB4	Missense_Mutation	SNP	ENST00000529196.1	37	CCDS8458.1	.	.	.	.	.	.	.	.	.	.	G	35	5.414419	0.96092	.	.	ENSG00000134910	ENST00000392708;ENST00000529196;ENST00000531491	D;D;D	0.91011	-2.77;-2.77;-2.77	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	D	0.97318	0.9123	H	0.96861	3.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.994;0.999	D	0.97925	1.0317	10	0.87932	D	0	-15.5287	19.984	0.97341	0.0:0.0:1.0:0.0	.	446;538	B4DJ24;P46977	.;STT3A_HUMAN	L	538;538;446	ENSP00000376472:R538L;ENSP00000436962:R538L;ENSP00000432820:R446L	ENSP00000376472:R538L	R	+	2	0	STT3A	124989250	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	9.869000	0.99810	2.820000	0.97059	0.650000	0.86243	CGA	.		0.408	STT3A-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386691.1	NM_152713	
ICK	22858	hgsc.bcm.edu;bcgsc.ca	37	6	52880912	52880912	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr6:52880912C>A	ENST00000350082.5	-	8	1146	c.800G>T	c.(799-801)tGg>tTg	p.W267L	ICK_ENST00000356971.3_Missense_Mutation_p.W267L	NM_014920.3	NP_055735.1	Q9UPZ9	ICK_HUMAN	intestinal cell (MAK-like) kinase	267	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159, ECO:0000305}.				intracellular signal transduction (GO:0035556)|multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(3)|stomach(1)	31	Lung NSC(77;0.103)					CTTGGGATCCCACTGAAGCAT	0.418																																					p.W267L		.											.	.	.	0			c.G800T						.						134.0	131.0	132.0					6																	52880912		2203	4300	6503	SO:0001583	missense	22858	exon9			GGATCCCACTGAA	AB023153	CCDS4949.1	6p12.3-p11.2	2008-02-05			ENSG00000112144	ENSG00000112144			21219	protein-coding gene	gene with protein product		612325				12103360	Standard	NM_014920		Approved	MRK, LCK2, KIAA0936, MGC46090	uc003pbi.2	Q9UPZ9	OTTHUMG00000014870	ENST00000350082.5:c.800G>T	6.37:g.52880912C>A	ENSP00000263043:p.Trp267Leu	58	0		79	4	NM_016513	A7MD41|O75985|Q5THL2|Q8IYH8|Q9BX17|Q9NYX3	Missense_Mutation	SNP	ENST00000350082.5	37	CCDS4949.1	.	.	.	.	.	.	.	.	.	.	C	33	5.262298	0.95368	.	.	ENSG00000112144	ENST00000350082;ENST00000356971	T;T	0.38722	1.12;1.12	5.53	5.53	0.82687	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.26593	0.0650	N	0.00996	-1.065	0.80722	D	1	D;D	0.67145	0.996;0.966	D;D	0.64687	0.923;0.928	T	0.60306	-0.7289	10	0.52906	T	0.07	-0.0204	19.8389	0.96675	0.0:1.0:0.0:0.0	.	267;267	Q9UPZ9-2;Q9UPZ9	.;ICK_HUMAN	L	267	ENSP00000263043:W267L;ENSP00000349458:W267L	ENSP00000263043:W267L	W	-	2	0	ICK	52988871	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.574000	0.82434	2.755000	0.94549	0.650000	0.86243	TGG	.		0.418	ICK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040952.1	NM_016513	
RBMX	27316	hgsc.bcm.edu;bcgsc.ca	37	X	135958731	135958731	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chrX:135958731C>A	ENST00000320676.7	-	5	626	c.472G>T	c.(472-474)Ggg>Tgg	p.G158W	RBMX_ENST00000496459.2_5'Flank|RBMX_ENST00000570135.1_Missense_Mutation_p.G23W|SNORD61_ENST00000384252.1_RNA|RBMX_ENST00000431446.3_Intron|RBMX_ENST00000562646.1_Missense_Mutation_p.G158W|RBMX_ENST00000565438.1_Missense_Mutation_p.G30W	NM_002139.3	NP_002130.2	P38159	RBMX_HUMAN	RNA binding motif protein, X-linked	158					cellular response to interleukin-1 (GO:0071347)|gene expression (GO:0010467)|membrane protein ectodomain proteolysis (GO:0006509)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|osteoblast differentiation (GO:0001649)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|supraspliceosomal complex (GO:0044530)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|urinary_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					GGAGGACCCCCACTTCTTGGT	0.453																																					p.G158W		.											.	.	.	0			c.G472T						.						117.0	108.0	111.0					X																	135958731		2203	4300	6503	SO:0001583	missense	27316	exon5			GACCCCCACTTCT		CCDS14661.1, CCDS55510.1	Xq26	2013-05-23	2003-09-12		ENSG00000147274	ENSG00000147274		"""RNA binding motif (RRM) containing"""	9910	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G"""	300199	"""RNA binding motif protein, X chromosome"""			10391206, 10391207	Standard	NM_002139		Approved	RNMX, hnRNP-G, HNRNPG	uc004fae.2	P38159	OTTHUMG00000022517	ENST00000320676.7:c.472G>T	X.37:g.135958731C>A	ENSP00000359645:p.Gly158Trp	73	0		73	4	NM_002139	B4E3U4|D3DWH0|E9PG86|Q5JQ67|Q8N8Y7|Q969R3	Missense_Mutation	SNP	ENST00000320676.7	37	CCDS14661.1	.	.	.	.	.	.	.	.	.	.	.	26.2	4.716947	0.89205	.	.	ENSG00000147274	ENST00000320676;ENST00000449161	T	0.79352	-1.26	5.39	5.39	0.77823	.	0.000000	0.64402	U	0.000001	D	0.84079	0.5393	L	0.46741	1.465	0.80722	D	1	D;D	0.65815	0.992;0.995	P;D	0.63957	0.711;0.92	D	0.84616	0.0681	10	0.51188	T	0.08	.	18.3251	0.90251	0.0:1.0:0.0:0.0	.	158;145	P38159;Q8N8Y7	HNRPG_HUMAN;.	W	158;145	ENSP00000359645:G158W	ENSP00000359645:G158W	G	-	1	0	RBMX	135786397	1.000000	0.71417	0.998000	0.56505	0.847000	0.48162	6.819000	0.75262	2.267000	0.75376	0.504000	0.49776	GGG	.		0.453	RBMX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058507.1	NM_002139	
LYST	1130	hgsc.bcm.edu	37	1	235878584	235878584	+	Missense_Mutation	SNP	C	C	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:235878584C>T	ENST00000389794.3	-	42	9875	c.9701G>A	c.(9700-9702)gGc>gAc	p.G3234D	LYST_ENST00000389793.2_Missense_Mutation_p.G3234D|LYST_ENST00000473037.1_5'UTR			Q99698	LYST_HUMAN	lysosomal trafficking regulator	3234	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.				blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			ATAGTGGGAGCCATAGTGATA	0.463																																					p.G3234D		.											LYST,NS,carcinoma,0,1	LYST	0	0			c.G9701A						.						106.0	106.0	106.0					1																	235878584		2203	4300	6503	SO:0001583	missense	1130	exon42			TGGGAGCCATAGT	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.9701G>A	1.37:g.235878584C>T	ENSP00000374444:p.Gly3234Asp	59	0		30	2	NM_000081	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	37	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	C	32	5.156672	0.94686	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.66995	-0.24;-0.24	5.26	5.26	0.73747	BEACH domain (4);	0.047998	0.85682	D	0.000000	D	0.86855	0.6033	M	0.93763	3.455	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90057	0.4153	10	0.66056	D	0.02	.	18.5007	0.90879	0.0:1.0:0.0:0.0	.	3234	Q99698	LYST_HUMAN	D	3234	ENSP00000374444:G3234D;ENSP00000374443:G3234D	ENSP00000374443:G3234D	G	-	2	0	LYST	233945207	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.487000	0.81328	2.457000	0.83068	0.460000	0.39030	GGC	.		0.463	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
MTMR12	54545	hgsc.bcm.edu	37	5	32274182	32274182	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr5:32274182C>A	ENST00000382142.3	-	3	359	c.189G>T	c.(187-189)caG>caT	p.Q63H	MTMR12_ENST00000264934.5_Missense_Mutation_p.Q63H|MTMR12_ENST00000280285.5_Missense_Mutation_p.Q63H	NM_001040446.1	NP_001035536.1	Q9C0I1	MTMRC_HUMAN	myotubularin related protein 12	63						cytoplasm (GO:0005737)	phosphatase activity (GO:0016791)			breast(3)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						AGGAATCTTCCTGGACATACT	0.458																																					p.Q63H		.											MTMR12,NS,carcinoma,0,1	MTMR12	0	0			c.G189T						.						172.0	149.0	157.0					5																	32274182		2203	4300	6503	SO:0001583	missense	54545	exon3			ATCTTCCTGGACA	AB051469	CCDS34138.1, CCDS75230.1	5p15.33	2011-06-09	2005-04-07	2005-04-07	ENSG00000150712	ENSG00000150712		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	18191	protein-coding gene	gene with protein product		606501	"""phosphatidylinositol-3-phosphate associated protein"""	PIP3AP		11504939, 12495846	Standard	XM_005248313		Approved	3-PAP, FLJ20476, KIAA1682, 3PAP	uc003jhq.3	Q9C0I1	OTTHUMG00000161978	ENST00000382142.3:c.189G>T	5.37:g.32274182C>A	ENSP00000371577:p.Gln63His	48	0		42	2	NM_001040446	Q69YJ4|Q6PFW3|Q96QU2|Q9NX27	Missense_Mutation	SNP	ENST00000382142.3	37	CCDS34138.1	.	.	.	.	.	.	.	.	.	.	C	18.43	3.621667	0.66787	.	.	ENSG00000150712	ENST00000280285;ENST00000382142;ENST00000264934	D;D;D	0.95518	-3.73;-3.4;-3.26	4.8	3.93	0.45458	.	0.000000	0.85682	D	0.000000	D	0.96451	0.8842	M	0.63428	1.95	0.45791	D	0.998675	D;D;D	0.76494	0.998;0.999;0.998	D;D;D	0.85130	0.994;0.997;0.993	D	0.95711	0.8758	10	0.62326	D	0.03	.	8.5828	0.33640	0.0:0.771:0.0:0.229	.	63;63;63	Q9C0I1-3;Q9C0I1-2;Q9C0I1	.;.;MTMRC_HUMAN	H	63	ENSP00000280285:Q63H;ENSP00000371577:Q63H;ENSP00000264934:Q63H	ENSP00000264934:Q63H	Q	-	3	2	MTMR12	32309939	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.360000	0.34125	1.137000	0.42214	0.549000	0.68633	CAG	.		0.458	MTMR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366579.1	NM_019061	
ECT2	1894	hgsc.bcm.edu;bcgsc.ca	37	3	172473321	172473321	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr3:172473321C>A	ENST00000392692.3	+	4	435	c.259C>A	c.(259-261)Cct>Act	p.P87T	ECT2_ENST00000232458.5_Intron|ECT2_ENST00000540509.1_Missense_Mutation_p.P87T|ECT2_ENST00000427830.1_Intron|ECT2_ENST00000441497.2_Intron|ECT2_ENST00000417960.1_Intron	NM_001258315.1	NP_001245244.1	Q9H8V3	ECT2_HUMAN	epithelial cell transforming 2	87					activation of protein kinase activity (GO:0032147)|activation of Rac GTPase activity (GO:0032863)|activation of Rho GTPase activity (GO:0032862)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular response to calcium ion (GO:0071277)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|cytokinesis (GO:0000910)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of Rho GTPase activity (GO:0032321)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|centralspindlin complex (GO:0097149)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)|protein homodimerization activity (GO:0042803)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.33e-14)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)			AGAAAGTTGTCCTGGAAAATC	0.313																																					p.P87T		.											.	.	.	0			c.C259A						.																																			SO:0001583	missense	1894	exon4			AGTTGTCCTGGAA	AA206473	CCDS3220.1, CCDS58860.1	3q26.1-q26.2	2014-03-11	2014-03-11		ENSG00000114346	ENSG00000114346		"""Rho guanine nucleotide exchange factors"""	3155	protein-coding gene	gene with protein product		600586	"""epithelial cell transforming sequence 2 oncogene"""			8464478, 10579713	Standard	NM_018098		Approved	ARHGEF31	uc003fil.2	Q9H8V3	OTTHUMG00000156762	ENST00000392692.3:c.259C>A	3.37:g.172473321C>A	ENSP00000376457:p.Pro87Thr	65	0		86	4	NM_001258315	Q0MT80|Q2M269|Q6U836|Q9NSV8|Q9NVW9	Missense_Mutation	SNP	ENST00000392692.3	37	CCDS58860.1	.	.	.	.	.	.	.	.	.	.	C	13.16	2.152914	0.38021	.	.	ENSG00000114346	ENST00000392692;ENST00000366090;ENST00000438041;ENST00000540509	T;T;T;T	0.63580	-0.05;0.93;0.92;-0.05	5.58	4.7	0.59300	.	0.234078	0.35096	U	0.003444	T	0.42108	0.1188	.	.	.	0.80722	D	1	B	0.17038	0.02	B	0.16722	0.016	T	0.27468	-1.0073	9	0.10377	T	0.69	.	11.9974	0.53212	0.0:0.8628:0.0:0.1371	.	87	Q9H8V3	ECT2_HUMAN	T	87	ENSP00000376457:P87T;ENSP00000403446:P87T;ENSP00000389108:P87T;ENSP00000443160:P87T	ENSP00000403446:P87T	P	+	1	0	ECT2	173956015	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.430000	0.44766	2.628000	0.89032	0.491000	0.48974	CCT	.		0.313	ECT2-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000345994.2	NM_018098	
EAPP	55837	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	35005377	35005377	+	Missense_Mutation	SNP	T	T	G			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr14:35005377T>G	ENST00000250454.3	-	2	260	c.179A>C	c.(178-180)gAa>gCa	p.E60A		NM_018453.3	NP_060923.2	Q56P03	EAPP_HUMAN	E2F-associated phosphoprotein	60					negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(2)	12	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00342)|Epithelial(34;0.18)	GBM - Glioblastoma multiforme(112;0.0196)		CTTTTCAAATTCATCTTCACT	0.373																																					p.E60A		.											.	.	.	0			c.A179C						.						108.0	97.0	101.0					14																	35005377		1834	4091	5925	SO:0001583	missense	55837	exon2			TCAAATTCATCTT	AF217512	CCDS41941.1	14q13	2007-03-26	2007-03-26	2007-03-26		ENSG00000129518			19312	protein-coding gene	gene with protein product		609486	"""chromosome 14 open reading frame 11"""	C14orf11		15716352	Standard	NM_018453		Approved	BM036, FLJ20578	uc001wsd.1	Q56P03		ENST00000250454.3:c.179A>C	14.37:g.35005377T>G	ENSP00000250454:p.Glu60Ala	42	0		44	10	NM_018453	Q9BVF4|Q9NWV5|Q9NZ86	Missense_Mutation	SNP	ENST00000250454.3	37	CCDS41941.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.303961	0.81136	.	.	ENSG00000129518	ENST00000250454;ENST00000554792	T;T	0.53206	0.64;0.63	5.75	4.6	0.57074	.	0.136243	0.64402	D	0.000004	T	0.67757	0.2927	M	0.79475	2.455	0.58432	D	0.999995	D	0.89917	1.0	D	0.83275	0.996	T	0.71066	-0.4700	10	0.72032	D	0.01	-24.8306	11.9355	0.52870	0.0:0.0679:0.0:0.9321	.	60	Q56P03	EAPP_HUMAN	A	60;39	ENSP00000250454:E60A;ENSP00000450908:E39A	ENSP00000250454:E60A	E	-	2	0	EAPP	34075128	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.163000	0.77524	1.117000	0.41842	0.533000	0.62120	GAA	.		0.373	EAPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409847.1	NM_018453	
PCSK2	5126	hgsc.bcm.edu	37	20	17462334	17462334	+	Silent	SNP	G	G	T	rs556701460		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr20:17462334G>T	ENST00000262545.2	+	12	1851	c.1536G>T	c.(1534-1536)acG>acT	p.T512T	PCSK2_ENST00000536609.1_Silent_p.T477T|PCSK2_ENST00000459871.1_3'UTR|PCSK2_ENST00000377899.1_Silent_p.T493T	NM_002594.3	NP_002585.2	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	512					cellular protein metabolic process (GO:0044267)|embryo development (GO:0009790)|enkephalin processing (GO:0034230)|insulin processing (GO:0030070)|islet amyloid polypeptide processing (GO:0034231)|nervous system development (GO:0007399)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|perikaryon (GO:0043204)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|lung(17)|ovary(3)|pancreas(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	53					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CTGTCATCACGGTCAACGCAA	0.542													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19089	0.0		0.0	False		,,,				2504	0.0				p.T512T		.											PCSK2,colon,carcinoma,0,1	PCSK2	0	0			c.G1536T						.						125.0	96.0	106.0					20																	17462334		2203	4300	6503	SO:0001819	synonymous_variant	5126	exon12			CATCACGGTCAAC	AK312341	CCDS13125.1, CCDS56179.1, CCDS56180.1	20p11.2	2008-08-01			ENSG00000125851	ENSG00000125851			8744	protein-coding gene	gene with protein product	"""neuroendocrine convertase 2"", ""KEX2-like endoprotease 2"""	162151		NEC2		1765368	Standard	NM_001201528		Approved	PC2, SPC2	uc002wpm.3	P16519	OTTHUMG00000031941	ENST00000262545.2:c.1536G>T	20.37:g.17462334G>T		67	0		50	3	NM_002594	B1ANH9|B4DFQ3|Q14927|Q5JYQ1|Q8IWA8|Q9NQG3|Q9NUG1|Q9UJC6	Silent	SNP	ENST00000262545.2	37	CCDS13125.1																																																																																			.		0.542	PCSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078120.2	NM_002594	
CILP	8483	hgsc.bcm.edu	37	15	65489606	65489606	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr15:65489606C>A	ENST00000261883.4	-	9	3184	c.3018G>T	c.(3016-3018)ctG>ctT	p.L1006L		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	1006					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						ACTTGAACTCCAGACAGGCAG	0.607																																					p.L1006L		.											.	.	.	0			c.G3018T						.						81.0	63.0	69.0					15																	65489606		2202	4299	6501	SO:0001819	synonymous_variant	8483	exon9			GAACTCCAGACAG	AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.3018G>T	15.37:g.65489606C>A		17	0		25	4	NM_003613	B2R8F7|Q6UW99|Q8IYI5	Silent	SNP	ENST00000261883.4	37	CCDS10203.1																																																																																			.		0.607	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256829.1	NM_003613	
TMEM38B	55151	hgsc.bcm.edu	37	9	108456998	108456998	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr9:108456998C>A	ENST00000374692.3	+	1	174	c.57C>A	c.(55-57)ccC>ccA	p.P19P		NM_018112.1	NP_060582.1	Q9NVV0	TM38B_HUMAN	transmembrane protein 38B	19						integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum membrane (GO:0033017)	potassium channel activity (GO:0005267)			kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	13						CCATGTTTCCCTTTTTTGACA	0.622																																					p.P19P		.											TMEM38B,caecum,carcinoma,0,1	TMEM38B	0	0			c.C57A						.						110.0	91.0	97.0					9																	108456998		2203	4300	6503	SO:0001819	synonymous_variant	55151	exon1			GTTTCCCTTTTTT	BC031938	CCDS6768.1	9q31.3	2013-05-23	2004-12-21	2004-12-22	ENSG00000095209	ENSG00000095209			25535	protein-coding gene	gene with protein product		611236	"""chromosome 9 open reading frame 87"""	C9orf87		17611541, 23316006	Standard	NM_018112		Approved	FLJ10493, bA219P18.1, D4Ertd89e, TRIC-B	uc004bcu.2	Q9NVV0	OTTHUMG00000020429	ENST00000374692.3:c.57C>A	9.37:g.108456998C>A		93	0		61	3	NM_018112	Q5JR63|Q5SVN5|Q5SVN6|Q5VTE2|Q6IA97	Silent	SNP	ENST00000374692.3	37	CCDS6768.1																																																																																			.		0.622	TMEM38B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053517.1	NM_018112	
CDC73	79577	hgsc.bcm.edu	37	1	193094241	193094241	+	Splice_Site	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:193094241G>T	ENST00000367435.3	+	2	315		c.e2-1			NM_024529.4	NP_078805.3	Q6P1J9	CDC73_HUMAN	cell division cycle 73						cell cycle (GO:0007049)|cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein destabilization (GO:0031648)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(14)|ovary(1)|pancreas(1)|parathyroid(51)|skin(1)|upper_aerodigestive_tract(1)	87						AATTATTTCAGGACTGGAAAG	0.348																																					.		.											CDC73,NS,carcinoma,0,1	CDC73	0	0			c.132-1G>T						.						111.0	109.0	110.0					1																	193094241		2203	4300	6503	SO:0001630	splice_region_variant	79577	exon2			ATTTCAGGACTGG	AF312865	CCDS1382.1	1q25	2014-09-17	2013-01-17	2005-07-20	ENSG00000134371	ENSG00000134371			16783	protein-coding gene	gene with protein product	"""Paf1/RNA polymerase II complex component"""	607393	"""chromosome 1 open reading frame 28"", ""hyperparathyroidism 2 (with jaw tumor)"", ""cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"", ""hyperparathyroidism 1"""	C1orf28, HRPT2, HRPT1		11318611, 15632063, 18755853	Standard	NM_024529		Approved	parafibromin, FIHP	uc001gtb.3	Q6P1J9	OTTHUMG00000035676	ENST00000367435.3:c.132-1G>T	1.37:g.193094241G>T		71	0		71	3	NM_024529	A6NLZ8|B2RBR2|Q6PK51|Q96A07|Q9H245|Q9H5L7	Splice_Site	SNP	ENST00000367435.3	37	CCDS1382.1	.	.	.	.	.	.	.	.	.	.	G	19.47	3.833411	0.71258	.	.	ENSG00000134371	ENST00000367435;ENST00000445394	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.108	0.93305	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CDC73	191360864	1.000000	0.71417	0.995000	0.50966	0.778000	0.44026	9.546000	0.98097	2.512000	0.84698	0.591000	0.81541	.	.		0.348	CDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086696.2	NM_024529	Intron
OPRK1	4986	hgsc.bcm.edu	37	8	54142028	54142028	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr8:54142028G>T	ENST00000265572.3	-	4	1269	c.972C>A	c.(970-972)agC>agA	p.S324R	RP11-162D9.3_ENST00000524425.1_RNA|OPRK1_ENST00000520287.1_Missense_Mutation_p.S324R|OPRK1_ENST00000524278.1_Missense_Mutation_p.S235R	NM_000912.3	NP_000903.2	P41145	OPRK_HUMAN	opioid receptor, kappa 1	324					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-inhibiting opioid receptor signaling pathway (GO:0031635)|behavior (GO:0007610)|defense response to virus (GO:0051607)|immune response (GO:0006955)|locomotory behavior (GO:0007626)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of saliva secretion (GO:0046877)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dynorphin receptor activity (GO:0038048)|opioid receptor activity (GO:0004985)	p.S324R(1)		NS(2)|breast(3)|endometrium(3)|kidney(12)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	43		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	TGGGATTCAGGCTACTGTTGG	0.512																																					p.S324R		.											OPRK1,NS,carcinoma,0,2	OPRK1	0	1	Substitution - Missense(1)	lung(1)	c.C972A						.						78.0	71.0	73.0					8																	54142028		2203	4300	6503	SO:0001583	missense	4986	exon4			ATTCAGGCTACTG		CCDS6152.1, CCDS64895.1	8q11.2	2014-05-21			ENSG00000082556	ENSG00000082556		"""GPCR / Class A : Opioid receptors"""	8154	protein-coding gene	gene with protein product		165196				8188308	Standard	XM_005251252		Approved	KOR, OPRK	uc003xri.1	P41145	OTTHUMG00000164276	ENST00000265572.3:c.972C>A	8.37:g.54142028G>T	ENSP00000265572:p.Ser324Arg	32	0		18	2	NM_000912	E5RHC9|Q499G4	Missense_Mutation	SNP	ENST00000265572.3	37	CCDS6152.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.419620	0.83559	.	.	ENSG00000082556	ENST00000265572;ENST00000524278;ENST00000520287;ENST00000396798	T;T;T	0.38560	1.13;1.13;1.13	5.8	4.92	0.64577	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.73345	0.3575	H	0.94345	3.525	0.80722	D	1	D	0.71674	0.998	D	0.75020	0.985	T	0.82210	-0.0570	10	0.87932	D	0	.	15.0098	0.71542	0.0683:0.0:0.9317:0.0	.	324	P41145	OPRK_HUMAN	R	324;235;324;310	ENSP00000265572:S324R;ENSP00000430923:S235R;ENSP00000429706:S324R	ENSP00000265572:S324R	S	-	3	2	OPRK1	54304581	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.912000	0.63335	1.454000	0.47793	0.650000	0.86243	AGC	.		0.512	OPRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378048.1		
AKR7A2	8574	hgsc.bcm.edu	37	1	19632584	19632584	+	Silent	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:19632584G>T	ENST00000235835.3	-	6	867	c.846C>A	c.(844-846)gcC>gcA	p.A282A	RNU6-1099P_ENST00000363533.1_RNA	NM_003689.3	NP_003680.2	O43488	ARK72_HUMAN	aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)	282					carbohydrate metabolic process (GO:0005975)|cellular aldehyde metabolic process (GO:0006081)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|electron carrier activity (GO:0009055)|phenanthrene-9,10-epoxide hydrolase activity (GO:0019119)	p.A282A(1)		central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00461)|BRCA - Breast invasive adenocarcinoma(304;1.83e-05)|Kidney(64;0.000167)|GBM - Glioblastoma multiforme(114;0.00115)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CGCCATATGCGGCCTGCAGGG	0.632																																					p.A282A		.											AKR7A2,colon,carcinoma,0,2	AKR7A2	0	1	Substitution - coding silent(1)	large_intestine(1)	c.C846A						.						81.0	76.0	78.0					1																	19632584		2203	4300	6503	SO:0001819	synonymous_variant	8574	exon6			ATATGCGGCCTGC	AF026947	CCDS194.1	1p36.13	2010-09-30			ENSG00000053371	ENSG00000053371		"""Aldo-keto reductases"""	389	protein-coding gene	gene with protein product		603418				9576847	Standard	NM_003689		Approved	AFAR	uc001bbw.3	O43488	OTTHUMG00000002522	ENST00000235835.3:c.846C>A	1.37:g.19632584G>T		24	0		25	2	NM_003689	O75749|Q5TG63	Silent	SNP	ENST00000235835.3	37	CCDS194.1																																																																																			.		0.632	AKR7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007165.2	NM_003689	
NAP1L1	4673	hgsc.bcm.edu	37	12	76447054	76447054	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr12:76447054C>A	ENST00000261182.8	-	10	1333	c.847G>T	c.(847-849)Ggg>Tgg	p.G283W	NAP1L1_ENST00000535020.2_Missense_Mutation_p.G283W|NAP1L1_ENST00000393263.3_Missense_Mutation_p.G283W|NAP1L1_ENST00000542344.1_Missense_Mutation_p.G241W|NAP1L1_ENST00000547993.1_Missense_Mutation_p.G100W|NAP1L1_ENST00000549596.1_Missense_Mutation_p.G283W|NAP1L1_ENST00000544816.1_Missense_Mutation_p.G100W|NAP1L1_ENST00000548044.1_Missense_Mutation_p.G242W|NAP1L1_ENST00000547773.1_Missense_Mutation_p.G220W|NAP1L1_ENST00000431879.3_Missense_Mutation_p.G215W|NAP1L1_ENST00000552342.1_Missense_Mutation_p.G294W	NM_004537.4|NM_139207.2	NP_004528.1|NP_631946.1	P55209	NP1L1_HUMAN	nucleosome assembly protein 1-like 1	283					DNA replication (GO:0006260)|nucleosome assembly (GO:0006334)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	9		Colorectal(145;0.09)				CGAACTGTCCCACGTCCCTTG	0.363																																					p.G283W		.											.	.	.	0			c.G847T						.						137.0	139.0	138.0					12																	76447054		2203	4300	6503	SO:0001583	missense	4673	exon10			CTGTCCCACGTCC		CCDS9013.1	12q21.1	2010-03-17			ENSG00000187109	ENSG00000187109			7637	protein-coding gene	gene with protein product		164060				8297347	Standard	NM_004537		Approved	NRP, NAP1, NAP1L, MGC8688, MGC23410	uc001sxx.2	P55209		ENST00000261182.8:c.847G>T	12.37:g.76447054C>A	ENSP00000261182:p.Gly283Trp	88	0		89	4	NM_004537	B3KNT8	Missense_Mutation	SNP	ENST00000261182.8	37	CCDS9013.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.997618	0.93227	.	.	ENSG00000187109	ENST00000261182;ENST00000552056;ENST00000393263;ENST00000431879;ENST00000547773;ENST00000544816;ENST00000542344;ENST00000535020;ENST00000549596;ENST00000547993;ENST00000552342;ENST00000548044	T;T;T;T;T;T;T;T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.77505	0.4140	M	0.91872	3.25	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;0.999;0.999	T	0.81326	-0.0983	10	0.87932	D	0	.	20.4025	0.99000	0.0:1.0:0.0:0.0	.	283;241;294;283;215;220;283	F5H4R6;B7Z9C2;F8W0J6;B3KNT8;B3KV44;F8W543;P55209	.;.;.;.;.;.;NP1L1_HUMAN	W	283;277;283;215;220;100;241;283;283;100;294;242	ENSP00000261182:G283W;ENSP00000450236:G277W;ENSP00000376947:G283W;ENSP00000409795:G215W;ENSP00000448167:G220W;ENSP00000437507:G100W;ENSP00000444759:G241W;ENSP00000445008:G283W;ENSP00000447793:G283W;ENSP00000448007:G100W;ENSP00000447196:G294W;ENSP00000449649:G242W	ENSP00000261182:G283W	G	-	1	0	NAP1L1	74733321	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.783000	0.85696	2.828000	0.97474	0.650000	0.86243	GGG	.		0.363	NAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405850.3	NM_139207	
FOSL1	8061	hgsc.bcm.edu	37	11	65664318	65664318	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr11:65664318C>A	ENST00000312562.2	-	2	445	c.259G>T	c.(259-261)Ggg>Tgg	p.G87W	FOSL1_ENST00000532401.1_Missense_Mutation_p.G87W|FOSL1_ENST00000531493.1_Missense_Mutation_p.G87W|FOSL1_ENST00000448083.2_Intron	NM_005438.3	NP_005429.1	P15407	FOSL1_HUMAN	FOS-like antigen 1	87					cellular defense response (GO:0006968)|cellular response to extracellular stimulus (GO:0031668)|chemotaxis (GO:0006935)|female pregnancy (GO:0007565)|in utero embryonic development (GO:0001701)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to gravity (GO:0009629)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to virus (GO:0009615)|transcription from RNA polymerase II promoter (GO:0006366)|vitellogenesis (GO:0007296)	cytosol (GO:0005829)|neuron projection (GO:0043005)|nucleus (GO:0005634)|presynaptic membrane (GO:0042734)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	10				READ - Rectum adenocarcinoma(159;0.168)		GGAGGCGGCCCCAGGGCCCGG	0.647																																					p.G87W		.											FOSL1,NS,neuroblastoma,0,1	FOSL1	0	0			c.G259T						.						39.0	45.0	43.0					11																	65664318		2201	4296	6497	SO:0001583	missense	8061	exon2			GCGGCCCCAGGGC	BC016648	CCDS8121.1, CCDS73324.1	11q13	2013-01-10			ENSG00000175592	ENSG00000175592		"""basic leucine zipper proteins"""	13718	protein-coding gene	gene with protein product		136515				2107490	Standard	XM_005274311		Approved	fra-1	uc001ogg.1	P15407	OTTHUMG00000166715	ENST00000312562.2:c.259G>T	11.37:g.65664318C>A	ENSP00000310170:p.Gly87Trp	55	0		41	2	NM_005438	B4DR11|Q6FG51	Missense_Mutation	SNP	ENST00000312562.2	37	CCDS8121.1	.	.	.	.	.	.	.	.	.	.	C	19.99	3.929629	0.73327	.	.	ENSG00000175592	ENST00000455710;ENST00000312562;ENST00000531493;ENST00000532401	T	0.79749	-1.3	5.04	5.04	0.67666	.	0.188435	0.45867	D	0.000334	D	0.86280	0.5895	L	0.55990	1.75	0.48185	D	0.999609	D	0.76494	0.999	D	0.66847	0.947	D	0.87424	0.2384	10	0.87932	D	0	-24.0023	14.2849	0.66240	0.0:1.0:0.0:0.0	.	87	P15407	FOSL1_HUMAN	W	87	ENSP00000310170:G87W	ENSP00000310170:G87W	G	-	1	0	FOSL1	65420894	0.998000	0.40836	0.999000	0.59377	0.968000	0.65278	4.708000	0.61859	2.523000	0.85059	0.655000	0.94253	GGG	.		0.647	FOSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391168.2	NM_005438	
OR2A5	393046	hgsc.bcm.edu	37	7	143748127	143748127	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr7:143748127C>A	ENST00000408906.2	+	1	667	c.633C>A	c.(631-633)ctC>ctA	p.L211L		NM_012365.1	NP_036497.1	Q96R48	OR2A5_HUMAN	olfactory receptor, family 2, subfamily A, member 5	211						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(3)|large_intestine(5)|lung(23)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	38	Melanoma(164;0.0783)					TGGGGCCGCTCTGCCTGGTGC	0.602																																					p.L211L		.											OR2A5,right_lower_lobe,carcinoma,0,1	OR2A5	0	0			c.C633A						.						126.0	129.0	128.0					7																	143748127		2012	4172	6184	SO:0001819	synonymous_variant	393046	exon1			GCCGCTCTGCCTG	U86278	CCDS43668.1	7q35	2013-09-20	2003-11-24		ENSG00000221836	ENSG00000221836		"""GPCR / Class A : Olfactory receptors"""	8232	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 5"""	OR2A8, OR2A26		9500546	Standard	NM_012365		Approved	OR7-138, OR7-141	uc011ktw.2	Q96R48	OTTHUMG00000158006	ENST00000408906.2:c.633C>A	7.37:g.143748127C>A		53	0		44	2	NM_012365	B9EGX2|O43885|O43888	Silent	SNP	ENST00000408906.2	37	CCDS43668.1																																																																																			.		0.602	OR2A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349986.1		
CACNA1C	775	hgsc.bcm.edu;bcgsc.ca	37	12	2721141	2721141	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr12:2721141G>T	ENST00000347598.4	+	30	3850	c.3850G>T	c.(3850-3852)Gtg>Ttg	p.V1284L	CACNA1C_ENST00000399629.1_Missense_Mutation_p.V1264L|CACNA1C_ENST00000402845.3_Missense_Mutation_p.V1264L|CACNA1C_ENST00000399641.1_Missense_Mutation_p.V1264L|CACNA1C_ENST00000399638.1_Missense_Mutation_p.V1264L|CACNA1C_ENST00000399603.1_Missense_Mutation_p.V1264L|CACNA1C_ENST00000399621.1_Missense_Mutation_p.V1264L|CACNA1C_ENST00000399601.1_Missense_Mutation_p.V1264L|CACNA1C_ENST00000399606.1_Missense_Mutation_p.V1284L|CACNA1C_ENST00000406454.3_Missense_Mutation_p.V1264L|CACNA1C_ENST00000399637.1_Missense_Mutation_p.V1264L|CACNA1C_ENST00000399649.1_Missense_Mutation_p.V1264L|CACNA1C_ENST00000399595.1_Missense_Mutation_p.V1264L|CACNA1C_ENST00000399597.1_Missense_Mutation_p.V1264L|CACNA1C_ENST00000399655.1_Missense_Mutation_p.V1264L|CACNA1C_ENST00000327702.7_Missense_Mutation_p.V1264L|CACNA1C_ENST00000335762.5_Missense_Mutation_p.V1289L|CACNA1C_ENST00000480911.1_Missense_Mutation_p.V1264L|CACNA1C_ENST00000399634.1_Missense_Mutation_p.V1264L|CACNA1C_ENST00000344100.3_Missense_Mutation_p.V1264L|CACNA1C_ENST00000399591.1_Missense_Mutation_p.V1264L|CACNA1C_ENST00000399617.1_Missense_Mutation_p.V1264L|CACNA1C_ENST00000399644.1_Missense_Mutation_p.V1264L	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1284					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CCTCTTCACCGTGGAGATGAT	0.547																																					p.V1284L		.											.	.	.	0			c.G3850T						.						119.0	114.0	116.0					12																	2721141		2180	4292	6472	SO:0001583	missense	775	exon30			TTCACCGTGGAGA	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.3850G>T	12.37:g.2721141G>T	ENSP00000266376:p.Val1284Leu	39	0		45	4	NM_199460	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	37	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	G	19.72	3.879420	0.72294	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.98345	-4.88;-4.88;-4.23;-4.88;-4.23;-4.88;-4.88;-4.88;-4.88;-4.88;-4.23;-4.88;-4.88;-4.88;-4.23;-4.88;-4.88;-4.88;-4.88;-4.88;-4.88;-4.88;-4.88	5.2	4.24	0.50183	.	0.066942	0.64402	D	0.000010	D	0.96839	0.8968	N	0.12471	0.22	0.58432	D	0.999995	D;D;P;D;D;D;D;B;B;D;D;B;D;D;D;D;B;D;B;D;D;D;D;B;D	0.76494	0.994;0.999;0.633;0.989;0.998;0.999;0.998;0.392;0.33;0.998;0.999;0.177;0.998;0.999;0.996;0.984;0.214;0.999;0.016;0.999;0.999;0.999;0.999;0.05;0.999	D;D;P;D;D;D;D;P;B;D;D;B;D;D;D;D;B;D;B;D;D;D;D;B;D	0.85130	0.987;0.997;0.492;0.987;0.997;0.997;0.997;0.463;0.218;0.997;0.997;0.174;0.997;0.996;0.996;0.972;0.072;0.997;0.025;0.997;0.997;0.997;0.997;0.06;0.995	D	0.94360	0.7587	10	0.13470	T	0.59	.	14.8326	0.70159	0.0:0.0:0.8555:0.1445	.	1264;1261;1284;1264;1264;1264;1264;1264;1264;1284;1264;1235;1284;1264;1264;1264;1264;1264;1264;1264;1264;1264;1264;1264;1264	Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;F5H638;Q13936-12	.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	L	1289;1264;1264;1264;1264;1264;1264;1264;1264;1264;1284;1284;1264;1264;1264;1264;1264;1264;1264;1264;1264;1264;1264;1105	ENSP00000336982:V1289L;ENSP00000382563:V1264L;ENSP00000437936:V1264L;ENSP00000382552:V1264L;ENSP00000382547:V1264L;ENSP00000382506:V1264L;ENSP00000382530:V1264L;ENSP00000382546:V1264L;ENSP00000382500:V1264L;ENSP00000382549:V1264L;ENSP00000266376:V1284L;ENSP00000382515:V1284L;ENSP00000382510:V1264L;ENSP00000341092:V1264L;ENSP00000382537:V1264L;ENSP00000329877:V1264L;ENSP00000382557:V1264L;ENSP00000385724:V1264L;ENSP00000382512:V1264L;ENSP00000382542:V1264L;ENSP00000382526:V1264L;ENSP00000385896:V1264L;ENSP00000382504:V1264L	ENSP00000323129:V1105L	V	+	1	0	CACNA1C	2591402	1.000000	0.71417	0.954000	0.39281	0.996000	0.88848	6.695000	0.74593	2.570000	0.86706	0.655000	0.94253	GTG	.		0.547	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719	
CAMK2G	818	hgsc.bcm.edu	37	10	75574960	75574960	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr10:75574960G>T	ENST00000351293.3	-	18	1358	c.1301C>A	c.(1300-1302)cCa>cAa	p.P434Q	CAMK2G_ENST00000423381.1_Missense_Mutation_p.P527Q|CAMK2G_ENST00000372765.1_Missense_Mutation_p.P455Q|RP11-574K11.5_ENST00000434147.1_RNA|CAMK2G_ENST00000394762.2_Missense_Mutation_p.P472Q|CAMK2G_ENST00000322680.3_Missense_Mutation_p.P495Q|CAMK2G_ENST00000305762.7_Missense_Mutation_p.P468Q|CAMK2G_ENST00000322635.3_Missense_Mutation_p.P466Q|CAMK2G_ENST00000472912.1_5'UTR	NM_001222.3|NM_172173.2	NP_001213.2|NP_751913.1	Q13555	KCC2G_HUMAN	calcium/calmodulin-dependent protein kinase II gamma	497					calcium ion transport (GO:0006816)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|dephosphorylation (GO:0016311)|G1/S transition of mitotic cell cycle (GO:0000082)|insulin secretion (GO:0030073)|interferon-gamma-mediated signaling pathway (GO:0060333)|nervous system development (GO:0007399)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of calcium ion transport (GO:0051924)|regulation of relaxation of cardiac muscle (GO:1901897)|regulation of skeletal muscle adaptation (GO:0014733)|synaptic transmission (GO:0007268)	calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)	ATP binding (GO:0005524)|calcium-dependent protein serine/threonine phosphatase activity (GO:0004723)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|protein homodimerization activity (GO:0042803)			kidney(2)|large_intestine(2)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	15	Prostate(51;0.0112)				Bosutinib(DB06616)	GTGGACGTGTGGGTTTAGGAT	0.597																																					p.P495Q		.											.	.	.	0			c.C1484A						.						152.0	123.0	133.0					10																	75574960		2203	4300	6503	SO:0001583	missense	818	exon20			ACGTGTGGGTTTA	U81554	CCDS7336.1, CCDS7337.1, CCDS7338.1, CCDS73153.1	10q22	2008-10-30	2008-10-30		ENSG00000148660	ENSG00000148660			1463	protein-coding gene	gene with protein product		602123	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma"""	CAMKG		8287681	Standard	NM_001204492		Approved		uc001jvm.2	Q13555	OTTHUMG00000018492	ENST00000351293.3:c.1301C>A	10.37:g.75574960G>T	ENSP00000277853:p.Pro434Gln	30	0		46	3	NM_172171	O00561|O15378|Q13279|Q13282|Q13556|Q5SQZ3|Q5SQZ4|Q5SWX4|Q7KYX5|Q8N4I3|Q8NIA4	Missense_Mutation	SNP	ENST00000351293.3	37	CCDS7336.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.884627	0.91814	.	.	ENSG00000148660	ENST00000351293;ENST00000322635;ENST00000423381;ENST00000394763;ENST00000322680;ENST00000394762;ENST00000433289;ENST00000305762;ENST00000372765	T;T;T;T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83	5.51	4.61	0.57282	Calcium/calmodulin-dependent protein kinase II, association-domain (1);	0.000000	0.85682	D	0.000000	T	0.75191	0.3816	M	0.92412	3.305	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	T	0.82131	-0.0609	10	0.87932	D	0	.	14.3252	0.66515	0.0711:0.0:0.9289:0.0	.	468;527;434;457;497;466;495	Q13555-4;Q13555-6;Q13555-10;A8K6N9;Q13555;Q13555-5;Q13555-8	.;.;.;.;KCC2G_HUMAN;.;.	Q	434;466;527;497;495;472;392;468;455	ENSP00000277853:P434Q;ENSP00000315599:P466Q;ENSP00000410298:P527Q;ENSP00000319060:P495Q;ENSP00000378243:P472Q;ENSP00000393784:P392Q;ENSP00000307082:P468Q;ENSP00000361851:P455Q	ENSP00000307082:P468Q	P	-	2	0	CAMK2G	75244966	1.000000	0.71417	0.942000	0.38095	0.998000	0.95712	9.476000	0.97823	1.321000	0.45227	0.655000	0.94253	CCA	.		0.597	CAMK2G-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048715.1	NM_172169	
HOXA10	3206	hgsc.bcm.edu	37	7	27210430	27210430	+	3'UTR	SNP	T	T	G	rs79213620		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr7:27210430T>G	ENST00000283921.4	-	0	2320				HOXA-AS4_ENST00000519694.1_RNA|RP1-170O19.20_ENST00000465941.1_Intron|HOXA9_ENST00000497089.1_5'Flank|HOXA-AS4_ENST00000519935.1_RNA|RP1-170O19.20_ENST00000470747.4_Intron|HOXA10_ENST00000521421.1_5'Flank|HOXA-AS4_ENST00000523790.1_RNA|MIR196B_ENST00000384852.1_RNA	NM_018951.3	NP_061824.3	P31260	HXA10_HUMAN	homeobox A10						anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|male gonad development (GO:0008584)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	9						GTATTTATAGTTTTTTTCTTT	0.299																																					.		.											.	.	.	0			.						.																																			SO:0001624	3_prime_UTR_variant	3206	.			TTATAGTTTTTTT		CCDS5410.2	7p15.2	2011-06-20	2005-12-22		ENSG00000253293	ENSG00000253293		"""Homeoboxes / ANTP class : HOXL subclass"""	5100	protein-coding gene	gene with protein product		142957	"""homeo box A10"""	HOX1H, HOX1		1973146, 1358459	Standard	NR_037939		Approved		uc011jzm.2	P31260	OTTHUMG00000023436	ENST00000283921.4:c.*1088A>C	7.37:g.27210430T>G		96	0		89	5	.	O43370|O43605|Q15949|Q504T1	RNA	SNP	ENST00000283921.4	37	CCDS5410.2																																																																																			.		0.299	HOXA10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358724.2		
MRPL18	29074	hgsc.bcm.edu	37	6	160218528	160218528	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr6:160218528C>A	ENST00000367034.4	+	3	571	c.449C>A	c.(448-450)cCg>cAg	p.P150Q	PNLDC1_ENST00000392167.3_5'Flank|PNLDC1_ENST00000610273.1_5'Flank|MRPL18_ENST00000480842.1_3'UTR	NM_014161.3	NP_054880.2	Q9H0U6	RM18_HUMAN	mitochondrial ribosomal protein L18	150					rRNA import into mitochondrion (GO:0035928)|translation (GO:0006412)	extracellular space (GO:0005615)|mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)	5S rRNA binding (GO:0008097)|structural constituent of ribosome (GO:0003735)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)	11		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.44e-18)|BRCA - Breast invasive adenocarcinoma(81;5.79e-06)		CAACCAACCCCGTGGGAGGCA	0.418																																					p.P150Q		.											MRPL18,NS,carcinoma,0,1	MRPL18	0	0			c.C449A						.						79.0	73.0	75.0					6																	160218528		2203	4300	6503	SO:0001583	missense	29074	exon3			CAACCCCGTGGGA	AF161556	CCDS5270.1	6q25.3	2012-09-13			ENSG00000112110	ENSG00000112110		"""Mitochondrial ribosomal proteins / large subunits"""	14477	protein-coding gene	gene with protein product		611831				11042152, 11551941	Standard	NM_014161		Approved	HSPC071	uc003qsw.4	Q9H0U6	OTTHUMG00000015942	ENST00000367034.4:c.449C>A	6.37:g.160218528C>A	ENSP00000356001:p.Pro150Gln	79	0		46	3	NM_014161	Q5TAP9|Q9NZW8	Missense_Mutation	SNP	ENST00000367034.4	37	CCDS5270.1	.	.	.	.	.	.	.	.	.	.	C	16.22	3.061361	0.55432	.	.	ENSG00000112110	ENST00000367034	T	0.46451	0.87	4.82	3.96	0.45880	.	0.000000	0.85682	D	0.000000	T	0.50240	0.1604	M	0.83692	2.655	0.43766	D	0.99628	D	0.55172	0.97	P	0.61592	0.891	T	0.53034	-0.8495	10	0.25751	T	0.34	-6.8474	12.8085	0.57628	0.0:0.9216:0.0:0.0784	.	150	Q9H0U6	RM18_HUMAN	Q	150	ENSP00000356001:P150Q	ENSP00000356001:P150Q	P	+	2	0	MRPL18	160138518	0.996000	0.38824	0.101000	0.21167	0.450000	0.32258	6.021000	0.70832	1.245000	0.43885	0.655000	0.94253	CCG	.		0.418	MRPL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042925.1		
CCDC178	374864	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	30950047	30950047	+	Missense_Mutation	SNP	A	A	T	rs376232207		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr18:30950047A>T	ENST00000383096.3	-	6	497	c.315T>A	c.(313-315)gaT>gaA	p.D105E	CCDC178_ENST00000406524.2_Missense_Mutation_p.D105E|CCDC178_ENST00000579947.1_Missense_Mutation_p.D105E|CCDC178_ENST00000402325.1_Missense_Mutation_p.D105E|CCDC178_ENST00000300227.8_Missense_Mutation_p.D105E|CCDC178_ENST00000403303.1_Missense_Mutation_p.D105E|CCDC178_ENST00000579916.1_Missense_Mutation_p.D105E|CCDC178_ENST00000583930.1_Missense_Mutation_p.D105E			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	105																	TGGACTCCACATCTTGGATGT	0.378																																					p.D105E		.											.	.	.	0			c.T315A						.						94.0	86.0	89.0					18																	30950047		2203	4299	6502	SO:0001583	missense	374864	exon5			CTCCACATCTTGG	AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.315T>A	18.37:g.30950047A>T	ENSP00000372576:p.Asp105Glu	23	0		31	13	NM_001105528	A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Missense_Mutation	SNP	ENST00000383096.3	37	CCDS42424.1	.	.	.	.	.	.	.	.	.	.	A	12.95	2.091223	0.36855	.	.	ENSG00000166960	ENST00000403303;ENST00000383096;ENST00000300227;ENST00000406524;ENST00000402325;ENST00000399177	T;T;T;T;T;T	0.46451	2.46;2.46;2.44;2.45;2.45;0.87	5.63	-1.63	0.08345	.	.	.	.	.	T	0.23171	0.0560	L	0.31752	0.955	0.24389	N	0.994751	P;P;P;P;P	0.40107	0.703;0.506;0.506;0.506;0.506	B;B;B;B;B	0.40101	0.319;0.203;0.319;0.203;0.319	T	0.14420	-1.0473	9	0.18276	T	0.48	-12.4118	1.0935	0.01668	0.3907:0.2987:0.1661:0.1445	.	105;105;105;105;105	F8W7A7;A1L4G8;B5MD75;Q5BJE1-2;Q5BJE1	.;.;.;.;CR034_HUMAN	E	105	ENSP00000385591:D105E;ENSP00000372576:D105E;ENSP00000300227:D105E;ENSP00000385867:D105E;ENSP00000385234:D105E;ENSP00000382130:D105E	ENSP00000300227:D105E	D	-	3	2	C18orf34	29204045	0.924000	0.31332	0.984000	0.44739	0.894000	0.52154	0.468000	0.22051	-0.165000	0.10908	-0.256000	0.11100	GAT	.		0.378	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255373.2	NM_198995	
UXS1	80146	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	106761718	106761718	+	Missense_Mutation	SNP	C	C	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr2:106761718C>T	ENST00000409501.3	-	6	442	c.385G>A	c.(385-387)Gtg>Atg	p.V129M	UXS1_ENST00000283148.7_Missense_Mutation_p.V134M|UXS1_ENST00000479621.1_5'UTR|UXS1_ENST00000428048.2_Intron|UXS1_ENST00000540130.1_Missense_Mutation_p.V72M			Q8NBZ7	UXS1_HUMAN	UDP-glucuronate decarboxylase 1	129					protein tetramerization (GO:0051262)|UDP-D-xylose biosynthetic process (GO:0033320)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)|UDP-glucuronate decarboxylase activity (GO:0048040)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)	17						CAGTGCTCCACGTTTCTCTTC	0.522																																					p.V134M		.											UXS1_ENST00000409501,NS,carcinoma,0,2	UXS1_ENST00000409501	0	0			c.G400A						.						103.0	103.0	103.0					2																	106761718		2021	4165	6186	SO:0001583	missense	80146	exon6			GCTCCACGTTTCT	AK027244	CCDS46378.1, CCDS58720.1, CCDS58721.1	2q12.2	2012-02-22			ENSG00000115652	ENSG00000115652	4.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	17729	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 6E, member 12"""	609749				19027726	Standard	NM_001253875		Approved	FLJ23591, UGD, SDR6E1	uc002tdn.3	Q8NBZ7	OTTHUMG00000153150	ENST00000409501.3:c.385G>A	2.37:g.106761718C>T	ENSP00000387019:p.Val129Met	50	0		35	7	NM_001253875	Q8NBX3|Q9H5C2	Missense_Mutation	SNP	ENST00000409501.3	37	CCDS46378.1	.	.	.	.	.	.	.	.	.	.	C	35	5.438564	0.96168	.	.	ENSG00000115652	ENST00000283148;ENST00000540130;ENST00000409501;ENST00000457835	D;D;D;D	0.93366	-3.21;-3.21;-3.21;-3.21	5.84	5.84	0.93424	NAD-dependent epimerase/dehydratase (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.96996	0.9019	M	0.82193	2.58	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.71414	0.953;0.973	D	0.97034	0.9752	10	0.87932	D	0	-9.4627	20.1381	0.98040	0.0:1.0:0.0:0.0	.	134;129	Q8NBZ7-2;Q8NBZ7	.;UXS1_HUMAN	M	134;72;129;72	ENSP00000283148:V134M;ENSP00000438265:V72M;ENSP00000387019:V129M;ENSP00000399316:V72M	ENSP00000283148:V134M	V	-	1	0	UXS1	106128150	1.000000	0.71417	0.992000	0.48379	0.993000	0.82548	7.456000	0.80751	2.763000	0.94921	0.650000	0.86243	GTG	.		0.522	UXS1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329778.1	NM_025076.3	
KCNQ2	3785	hgsc.bcm.edu	37	20	62071037	62071037	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr20:62071037C>A	ENST00000359125.2	-	6	1015	c.841G>T	c.(841-843)Ggg>Tgg	p.G281W	KCNQ2_ENST00000370224.1_Missense_Mutation_p.G281W|KCNQ2_ENST00000360480.3_Missense_Mutation_p.G281W|KCNQ2_ENST00000354587.3_Missense_Mutation_p.G281W|KCNQ2_ENST00000344425.5_Missense_Mutation_p.G281W|KCNQ2_ENST00000359689.1_Missense_Mutation_p.G281W|KCNQ2_ENST00000357249.2_Missense_Mutation_p.G281W|KCNQ2_ENST00000344462.4_Missense_Mutation_p.G281W	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	281					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.G281W(2)		biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	TACTTGTCCCCGTAGCCAATG	0.642																																					p.G281W		.											.	.	.	2	Substitution - Missense(2)	lung(2)	c.G841T						.						201.0	146.0	165.0					20																	62071037		2203	4300	6503	SO:0001583	missense	3785	exon6			TGTCCCCGTAGCC	AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.841G>T	20.37:g.62071037C>A	ENSP00000352035:p.Gly281Trp	84	0		91	4	NM_172106	O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Missense_Mutation	SNP	ENST00000359125.2	37	CCDS13520.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.477549	0.84640	.	.	ENSG00000075043	ENST00000357249;ENST00000359125;ENST00000370226;ENST00000354587;ENST00000359689;ENST00000430658;ENST00000360480;ENST00000344462;ENST00000370224;ENST00000370222;ENST00000370221;ENST00000344425	D;D;D;D;D;D;D;D;D;D;D;D	0.99252	-5.63;-5.63;-5.63;-5.63;-5.63;-5.63;-5.63;-5.63;-5.63;-5.63;-5.63;-5.63	4.01	4.01	0.46588	Ion transport (1);	0.135280	0.48767	D	0.000166	D	0.99677	0.9879	H	0.98682	4.3	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;0.999;0.999;0.999;1.0	D	0.97089	0.9789	10	0.87932	D	0	-32.3429	16.4798	0.84155	0.0:1.0:0.0:0.0	.	281;281;281;281;281;281	B4DEP4;Q53Y30;O43526-3;O43526-2;O43526-4;O43526	.;.;.;.;.;KCNQ2_HUMAN	W	281	ENSP00000349789:G281W;ENSP00000352035:G281W;ENSP00000359246:G281W;ENSP00000346601:G281W;ENSP00000352718:G281W;ENSP00000399612:G281W;ENSP00000353668:G281W;ENSP00000339611:G281W;ENSP00000359244:G281W;ENSP00000359242:G281W;ENSP00000359241:G281W;ENSP00000345523:G281W	ENSP00000345523:G281W	G	-	1	0	KCNQ2	61541481	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	5.854000	0.69503	1.908000	0.55244	0.561000	0.74099	GGG	.		0.642	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080353.1	NM_172109	
CASQ1	844	hgsc.bcm.edu;bcgsc.ca	37	1	160169648	160169648	+	Missense_Mutation	SNP	C	C	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:160169648C>T	ENST00000368078.3	+	10	1188	c.992C>T	c.(991-993)cCa>cTa	p.P331L	CASQ1_ENST00000467691.1_Missense_Mutation_p.P52L|RP11-536C5.7_ENST00000418602.1_RNA|CASQ1_ENST00000368079.3_Missense_Mutation_p.P325L			P31415	CASQ1_HUMAN	calsequestrin 1 (fast-twitch, skeletal muscle)	331					endoplasmic reticulum organization (GO:0007029)|ion transmembrane transport (GO:0034220)|protein polymerization (GO:0051258)|regulation of sequestering of calcium ion (GO:0051282)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to heat (GO:0009408)|response to organic substance (GO:0010033)|sarcomere organization (GO:0045214)|skeletal muscle tissue development (GO:0007519)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna lumen (GO:0014804)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(1)	21	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CAGCTGGTCCCATACTGGGAG	0.498																																					p.P331L		.											.	.	.	0			c.C992T						.						177.0	149.0	159.0					1																	160169648		2203	4300	6503	SO:0001583	missense	844	exon10			TGGTCCCATACTG	S73775	CCDS1198.1, CCDS1198.2	1q21	2011-10-19			ENSG00000143318	ENSG00000143318		"""Protein disulfide isomerases"""	1512	protein-coding gene	gene with protein product	"""calsequestrin 1, fast-twitch, skeletal muscle"", ""calmitine"""	114250		CASQ		8406504, 2321095	Standard	NM_001231		Approved	PDIB1	uc010pja.2	P31415	OTTHUMG00000031607	ENST00000368078.3:c.992C>T	1.37:g.160169648C>T	ENSP00000357057:p.Pro331Leu	37	0		62	4	NM_001231	B1AKZ2|B2R863|Q8TBW7	Missense_Mutation	SNP	ENST00000368078.3	37	CCDS1198.2	.	.	.	.	.	.	.	.	.	.	C	21.8	4.202672	0.79127	.	.	ENSG00000143318	ENST00000368079;ENST00000368078;ENST00000441151;ENST00000467691	T;T;T	0.73258	-0.73;-0.73;-0.73	5.17	4.25	0.50352	Thioredoxin-like fold (2);	0.053996	0.85682	D	0.000000	T	0.78368	0.4272	M	0.76002	2.32	0.80722	D	1	D	0.89917	1.0	D	0.71656	0.974	T	0.81042	-0.1112	10	0.52906	T	0.07	.	14.7726	0.69691	0.0:0.8545:0.1455:0.0	.	331	P31415	CASQ1_HUMAN	L	325;331;246;52	ENSP00000357058:P325L;ENSP00000357057:P331L;ENSP00000418051:P52L	ENSP00000357057:P331L	P	+	2	0	CASQ1	158436272	1.000000	0.71417	0.751000	0.31187	0.998000	0.95712	6.994000	0.76251	1.395000	0.46643	0.655000	0.94253	CCA	.		0.498	CASQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077412.1	NM_001231	
GREM1	26585	hgsc.bcm.edu;broad.mit.edu	37	15	33023106	33023106	+	Missense_Mutation	SNP	A	A	G			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr15:33023106A>G	ENST00000300177.4	+	2	404	c.215A>G	c.(214-216)gAg>gGg	p.E72G	GREM1_ENST00000322805.4_Intron|GREM1_ENST00000560830.1_Intron|GREM1_ENST00000560677.1_Intron	NM_001191322.1|NM_001191323.1|NM_013372.6	NP_001178251.1|NP_001178252.1|NP_037504.1	O60565	GREM1_HUMAN	gremlin 1, DAN family BMP antagonist	72					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell morphogenesis (GO:0000902)|collagen fibril organization (GO:0030199)|determination of dorsal identity (GO:0048263)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of bone mineralization (GO:0030502)|negative regulation of bone mineralization involved in bone maturation (GO:1900158)|negative regulation of bone remodeling (GO:0046851)|negative regulation of bone trabecula formation (GO:1900155)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-tyrosine autophosphorylation (GO:1900086)|positive regulation of receptor activity (GO:2000273)|positive regulation of receptor internalization (GO:0002092)|positive regulation of telomerase activity (GO:0051973)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|regulation of epithelial to mesenchymal transition (GO:0010717)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	BMP binding (GO:0036122)|morphogen activity (GO:0016015)|receptor agonist activity (GO:0048018)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(1)|endometrium(1)|large_intestine(1)|lung(6)|prostate(1)	10		all_lung(180;1.49e-09)		all cancers(64;2.97e-18)|Epithelial(43;3.15e-12)|GBM - Glioblastoma multiforme(186;2.32e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0107)		CCCGGGGAGGAGGTGCTGGAG	0.652																																					p.E72G		.											.	.	.	0			c.A215G						.						29.0	32.0	31.0					15																	33023106		2201	4300	6501	SO:0001583	missense	26585	exon2			GGGAGGAGGTGCT		CCDS10029.1, CCDS53927.1	15q13.3	2014-02-07	2013-02-26	2004-05-07	ENSG00000166923	ENSG00000166923			2001	protein-coding gene	gene with protein product		603054	"""cysteine knot superfamily 1, BMP antagonist 1"", ""gremlin 1, cysteine knot superfamily, homolog (Xenopus laevis)"", ""gremlin 1"", ""colorectal adenoma and carcinoma 1"""	CKTSF1B1, CRAC1		9660951, 10026205, 22561515	Standard	NM_013372		Approved	DRM, gremlin, DAND2, HMPS	uc001zhe.2	O60565	OTTHUMG00000129319	ENST00000300177.4:c.215A>G	15.37:g.33023106A>G	ENSP00000300177:p.Glu72Gly	9	0		11	5	NM_013372	Q52LV3|Q8N914|Q8N936	Missense_Mutation	SNP	ENST00000300177.4	37	CCDS10029.1	.	.	.	.	.	.	.	.	.	.	A	32	5.158590	0.94686	.	.	ENSG00000166923	ENST00000300177	T	0.31769	1.48	5.57	5.57	0.84162	DAN (1);	0.000000	0.85682	D	0.000000	T	0.54854	0.1884	M	0.76838	2.35	0.80722	D	1	D	0.55800	0.973	P	0.61201	0.885	T	0.59794	-0.7387	10	0.66056	D	0.02	-15.9253	15.74	0.77887	1.0:0.0:0.0:0.0	.	72	O60565	GREM1_HUMAN	G	72	ENSP00000300177:E72G	ENSP00000300177:E72G	E	+	2	0	GREM1	30810398	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.530000	0.81962	2.133000	0.65898	0.533000	0.62120	GAG	.		0.652	GREM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251455.2	NM_013372	
NNT	23530	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	43704461	43704461	+	Silent	SNP	A	A	G			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr5:43704461A>G	ENST00000264663.5	+	22	3437	c.3216A>G	c.(3214-3216)acA>acG	p.T1072T	NNT_ENST00000512996.2_Silent_p.T941T|NNT_ENST00000344920.4_Silent_p.T1072T	NM_012343.3	NP_036475.3	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	1072					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)|proton transport (GO:0015992)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	NAD binding (GO:0051287)|NAD(P)+ transhydrogenase (AB-specific) activity (GO:0008750)|NAD(P)+ transhydrogenase (B-specific) activity (GO:0003957)|NAD(P)+ transhydrogenase activity (GO:0008746)|NADP binding (GO:0050661)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(7)|large_intestine(6)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(6;2.58e-06)					CCAAGAAAACATGTGACGCGC	0.438																																					p.T1072T		.											.	.	.	0			c.A3216G						.						148.0	127.0	134.0					5																	43704461		2203	4299	6502	SO:0001819	synonymous_variant	23530	exon22			GAAAACATGTGAC	U40490	CCDS3949.1	5p12	2008-02-05			ENSG00000112992	ENSG00000112992	1.6.1.1		7863	protein-coding gene	gene with protein product		607878				9271681, 9524818	Standard	NM_182977		Approved		uc003jof.3	Q13423	OTTHUMG00000096961	ENST00000264663.5:c.3216A>G	5.37:g.43704461A>G		38	0		32	11	NM_182977	Q16796|Q2TB60|Q8N3V4	Silent	SNP	ENST00000264663.5	37	CCDS3949.1																																																																																			.		0.438	NNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214026.1	NM_182977	
CTSA	5476	hgsc.bcm.edu	37	20	44523350	44523350	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr20:44523350C>A	ENST00000372459.2	+	8	1032	c.839C>A	c.(838-840)cCg>cAg	p.P280Q	CTSA_ENST00000372484.3_Missense_Mutation_p.P298Q|CTSA_ENST00000354880.5_Missense_Mutation_p.P281Q|CTSA_ENST00000191018.5_Missense_Mutation_p.P280Q|RP3-337O18.9_ENST00000607703.1_RNA			P10619	PPGB_HUMAN	cathepsin A	280					glycosphingolipid metabolic process (GO:0006687)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|enzyme activator activity (GO:0008047)|serine-type carboxypeptidase activity (GO:0004185)	p.P298L(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|skin(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.0122)				CTCTATGCCCCGTGTGCTGGA	0.597																																					p.P298Q		.											CTSA,NS,carcinoma,0,1	CTSA	0	1	Substitution - Missense(1)	endometrium(1)	c.C893A						.						99.0	95.0	96.0					20																	44523350		2203	4300	6503	SO:0001583	missense	5476	exon9			ATGCCCCGTGTGC	M22960	CCDS13385.2, CCDS46609.1, CCDS54467.1	20q13.12	2012-02-10	2006-12-05	2006-12-05	ENSG00000064601	ENSG00000064601	3.4.16.5	"""Cathepsins"""	9251	protein-coding gene	gene with protein product	"""carboxypeptidase C"", ""lysosomal protective protein"", ""carboxypeptidase-L"", ""carboxypeptidase Y-like kininase"", ""deamidase"", ""lysosomal carboxypeptidase A"", ""urinary kininase"""	613111	"""protective protein for beta-galactosidase (galactosialidosis)"""	GSL, PPGB		2071143	Standard	NM_000308		Approved		uc002xqh.3	P10619	OTTHUMG00000033078	ENST00000372459.2:c.839C>A	20.37:g.44523350C>A	ENSP00000361537:p.Pro280Gln	51	0		31	3	NM_000308	B2R798|Q561W6|Q5JZH1|Q96KJ2|Q9BR08|Q9BW68	Missense_Mutation	SNP	ENST00000372459.2	37	CCDS46609.1	.	.	.	.	.	.	.	.	.	.	C	15.83	2.948985	0.53186	.	.	ENSG00000064601	ENST00000354880;ENST00000372484;ENST00000191018;ENST00000419493;ENST00000372459	T;T;T;T;T	0.73897	-0.79;-0.79;-0.79;-0.79;-0.79	4.69	4.69	0.59074	.	0.100142	0.64402	D	0.000001	T	0.76321	0.3971	M	0.76002	2.32	0.80722	D	1	B;B;B	0.30973	0.302;0.219;0.099	B;B;B	0.32465	0.146;0.066;0.066	T	0.77632	-0.2515	10	0.51188	T	0.08	-0.1199	18.1587	0.89702	0.0:1.0:0.0:0.0	.	280;280;297	B4E324;P10619;Q59EV6	.;PPGB_HUMAN;.	Q	281;298;280;263;280	ENSP00000346952:P281Q;ENSP00000361562:P298Q;ENSP00000191018:P280Q;ENSP00000408533:P263Q;ENSP00000361537:P280Q	ENSP00000191018:P280Q	P	+	2	0	CTSA	43956757	0.948000	0.32251	0.870000	0.34147	0.622000	0.37654	4.598000	0.61069	2.599000	0.87857	0.561000	0.74099	CCG	.		0.597	CTSA-012	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471297.2	NM_000308	
ZNF536	9745	hgsc.bcm.edu	37	19	31039277	31039277	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr19:31039277C>A	ENST00000355537.3	+	4	2898	c.2751C>A	c.(2749-2751)tcC>tcA	p.S917S		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	917					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.S917S(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					TCCAAGGGTCCTTGCAAGCTT	0.493																																					p.S917S		.											ZNF536,caecum,carcinoma,0,1	ZNF536	0	1	Substitution - coding silent(1)	large_intestine(1)	c.C2751A						.						187.0	193.0	191.0					19																	31039277		2203	4300	6503	SO:0001819	synonymous_variant	9745	exon4			AGGGTCCTTGCAA		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2751C>A	19.37:g.31039277C>A		36	0		36	2	NM_014717	A2RU18	Silent	SNP	ENST00000355537.3	37	CCDS32984.1																																																																																			.		0.493	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
PBRM1	55193	hgsc.bcm.edu	37	3	52668817	52668817	+	Nonsense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr3:52668817C>A	ENST00000296302.7	-	11	1103	c.1102G>T	c.(1102-1104)Gag>Tag	p.E368*	PBRM1_ENST00000356770.4_Nonsense_Mutation_p.E336*|PBRM1_ENST00000394830.3_Nonsense_Mutation_p.E368*|PBRM1_ENST00000337303.4_Nonsense_Mutation_p.E368*|PBRM1_ENST00000409767.1_Nonsense_Mutation_p.E368*|PBRM1_ENST00000409057.1_Nonsense_Mutation_p.E368*|PBRM1_ENST00000410007.1_Nonsense_Mutation_p.E368*|PBRM1_ENST00000409114.3_Nonsense_Mutation_p.E368*			Q86U86	PB1_HUMAN	polybromo 1	368					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.E368*(4)|p.E336*(2)		breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GACTCTCCCTCTTCATAGCGT	0.373			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																p.E368X		.		Rec	yes		3	3p21	55193	polybromo 1		E	PBRM1_ENST00000356770,NS,carcinoma,0,5	PBRM1_ENST00000356770	0	6	Substitution - Nonsense(6)	kidney(6)	c.G1102T						.						72.0	70.0	71.0					3																	52668817		2203	4300	6503	SO:0001587	stop_gained	55193	exon12			CTCCCTCTTCATA	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.1102G>T	3.37:g.52668817C>A	ENSP00000296302:p.Glu368*	28	0		11	3	NM_018313	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Nonsense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	C	38	7.060397	0.98036	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	.	.	.	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	-22.6802	20.2566	0.98424	0.0:1.0:0.0:0.0	.	.	.	.	X	336;368;368;368;368;368;368;368;368;312	.	ENSP00000296302:E368X	E	-	1	0	PBRM1	52643857	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.487000	0.81328	2.793000	0.96121	0.561000	0.74099	GAG	.		0.373	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165	
OR5AC2	81050	hgsc.bcm.edu;bcgsc.ca	37	3	97806872	97806872	+	Missense_Mutation	SNP	C	C	A	rs377586613		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr3:97806872C>A	ENST00000358642.2	+	1	856	c.856C>A	c.(856-858)Ctg>Atg	p.L286M		NM_054106.1	NP_473447.1	Q9NZP5	O5AC2_HUMAN	olfactory receptor, family 5, subfamily AC, member 2	286					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|large_intestine(3)|lung(13)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	28						TATAATTCCCCTGCTAAACCC	0.378																																					p.L286M		.											.	.	.	0			c.C856A						.						86.0	84.0	85.0					3																	97806872		2203	4300	6503	SO:0001583	missense	81050	exon1			ATTCCCCTGCTAA	AF179759	CCDS33796.1	3q11.2	2013-09-23			ENSG00000196578	ENSG00000196578		"""GPCR / Class A : Olfactory receptors"""	15431	protein-coding gene	gene with protein product							Standard	NM_054106		Approved	HSA1	uc011bgs.2	Q9NZP5	OTTHUMG00000160083	ENST00000358642.2:c.856C>A	3.37:g.97806872C>A	ENSP00000351466:p.Leu286Met	62	0		48	4	NM_054106		Missense_Mutation	SNP	ENST00000358642.2	37	CCDS33796.1	.	.	.	.	.	.	.	.	.	.	C	0.059	-1.229937	0.01518	.	.	ENSG00000196578	ENST00000358642	T	0.37058	1.22	4.51	-0.0915	0.13661	GPCR, rhodopsin-like superfamily (1);	0.308537	0.17700	U	0.164971	T	0.30510	0.0767	N	0.25060	0.705	0.09310	N	1	D	0.63046	0.992	D	0.69824	0.966	T	0.29181	-1.0020	10	0.02654	T	1	-9.3846	4.1663	0.10308	0.0:0.3026:0.3293:0.3681	.	286	Q9NZP5	O5AC2_HUMAN	M	286	ENSP00000351466:L286M	ENSP00000351466:L286M	L	+	1	2	OR5AC2	99289562	0.000000	0.05858	0.004000	0.12327	0.095000	0.18619	-1.263000	0.02850	-0.207000	0.10187	0.590000	0.80494	CTG	.		0.378	OR5AC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359116.1		
SIGLEC9	27180	hgsc.bcm.edu	37	19	51628378	51628378	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr19:51628378C>A	ENST00000250360.3	+	1	214	c.147C>A	c.(145-147)ggC>ggA	p.G49G	SIGLEC9_ENST00000440804.3_Silent_p.G49G	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	49	Ig-like V-type.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)	p.G49G(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		CCTCGCATGGCTGGATTTACC	0.577																																					p.G49G		.											SIGLEC9,NS,carcinoma,0,1	SIGLEC9	0	1	Substitution - coding silent(1)	lung(1)	c.C147A						.						133.0	91.0	105.0					19																	51628378		2203	4300	6503	SO:0001819	synonymous_variant	27180	exon1			GCATGGCTGGATT	AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.147C>A	19.37:g.51628378C>A		48	0		56	3	NM_001198558	Q6GTU4|Q9BYI9	Silent	SNP	ENST00000250360.3	37	CCDS12825.1																																																																																			.		0.577	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464224.1	NM_014441	
NOS3	4846	hgsc.bcm.edu	37	7	150698924	150698924	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr7:150698924C>A	ENST00000484524.1	+	12	1518	c.1518C>A	c.(1516-1518)tcC>tcA	p.S506S	NOS3_ENST00000461406.1_Silent_p.S300S|NOS3_ENST00000297494.3_Silent_p.S506S|NOS3_ENST00000467517.1_Silent_p.S506S	NM_001160111.1	NP_001153583.1	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGAAGATCTCCGCCTCGCTCA	0.662																																					p.S506S		.											NOS3,NS,carcinoma,0,1	NOS3	0	0			c.C1518A						.						55.0	53.0	54.0					7																	150698924		2203	4300	6503	SO:0001819	synonymous_variant	4846	exon12			GATCTCCGCCTCG		CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000484524.1:c.1518C>A	7.37:g.150698924C>A		24	0		31	3	NM_001160111	Q495E5	Silent	SNP	ENST00000484524.1	37	CCDS55182.1																																																																																			.		0.662	NOS3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351550.1	NM_000603	
BDP1	55814	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	70754623	70754623	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr5:70754623C>A	ENST00000358731.4	+	2	693	c.430C>A	c.(430-432)Cga>Aga	p.R144R	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	144	Interaction with ZBTB43.				gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		AGACAGATACCGAATATACAA	0.398																																					p.R144R		.											.	.	.	0			c.C430A						.						106.0	99.0	101.0					5																	70754623		1880	4112	5992	SO:0001819	synonymous_variant	55814	exon2			AGATACCGAATAT	AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.430C>A	5.37:g.70754623C>A		52	0		41	4	NM_018429	Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Silent	SNP	ENST00000358731.4	37	CCDS43328.1																																																																																			.		0.398	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2	NM_018429	
MAP3K13	9175	hgsc.bcm.edu	37	3	185184616	185184616	+	Missense_Mutation	SNP	G	G	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr3:185184616G>A	ENST00000265026.3	+	10	1842	c.1508G>A	c.(1507-1509)cGt>cAt	p.R503H	MAP3K13_ENST00000446828.1_Missense_Mutation_p.R296H|MAP3K13_ENST00000535426.1_Missense_Mutation_p.R359H|MAP3K13_ENST00000443863.1_Missense_Mutation_p.R359H|MAP3K13_ENST00000424227.1_Missense_Mutation_p.R503H	NM_004721.4	NP_004712.1			mitogen-activated protein kinase kinase kinase 13									p.R503H(2)		NS(1)|biliary_tract(1)|breast(3)|endometrium(3)|kidney(1)|large_intestine(13)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			TTCTGCAGGCGTGAGCAAGCA	0.458																																					p.R503H		.											MAP3K13_ENST00000424227,NS,carcinoma,0,2	MAP3K13_ENST00000424227	0	2	Substitution - Missense(2)	lung(2)	c.G1508A						.						129.0	108.0	115.0					3																	185184616		2203	4300	6503	SO:0001583	missense	9175	exon10			GCAGGCGTGAGCA	BC031677	CCDS3270.1, CCDS56298.1	3q27	2011-06-09			ENSG00000073803	ENSG00000073803		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6852	protein-coding gene	gene with protein product	"""leucine zipper-bearing kinase"""	604915				9353328	Standard	NM_004721		Approved	LZK, MEKK13	uc003fpi.3	O43283	OTTHUMG00000156673	ENST00000265026.3:c.1508G>A	3.37:g.185184616G>A	ENSP00000265026:p.Arg503His	44	0		43	2	NM_004721		Missense_Mutation	SNP	ENST00000265026.3	37	CCDS3270.1	.	.	.	.	.	.	.	.	.	.	G	34	5.312914	0.95655	.	.	ENSG00000073803	ENST00000446828;ENST00000424227;ENST00000443863;ENST00000535426;ENST00000265026	T;T;T;T;T	0.26373	1.74;1.74;1.74;1.74;1.74	5.56	5.56	0.83823	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.44891	0.1315	L	0.36672	1.1	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.993;0.996;0.99	T	0.30119	-0.9989	10	0.66056	D	0.02	.	19.9052	0.97004	0.0:0.0:1.0:0.0	.	359;296;503	O43283-4;O43283-5;O43283	.;.;M3K13_HUMAN	H	296;503;359;359;503	ENSP00000411483:R296H;ENSP00000399910:R503H;ENSP00000409325:R359H;ENSP00000439257:R359H;ENSP00000265026:R503H	ENSP00000265026:R503H	R	+	2	0	MAP3K13	186667310	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	9.695000	0.98691	2.776000	0.95493	0.655000	0.94253	CGT	.		0.458	MAP3K13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345268.1	NM_004721	
DDHD1	80821	hgsc.bcm.edu	37	14	53619480	53619480	+	Missense_Mutation	SNP	T	T	C	rs140904345|rs55671452|rs200797826	byFrequency	TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr14:53619480T>C	ENST00000323669.5	-	1	336	c.337A>G	c.(337-339)Agc>Ggc	p.S113G	DDHD1_ENST00000395606.1_Missense_Mutation_p.S113G|RP11-547D23.1_ENST00000554235.1_RNA|DDHD1_ENST00000357758.3_Missense_Mutation_p.S113G|AL356020.1_ENST00000584587.1_RNA	NM_001160148.1	NP_001153620.1	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1	113					cell death (GO:0008219)|lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)	25	Breast(41;0.037)					GACAAGGAGCTGCCGCCGCCG	0.701																																					p.S113G		.											.,102	.	202	0			c.A337G						.						6.0	8.0	7.0					14																	53619480		1971	3847	5818	SO:0001583	missense	80821	exon1			AGGAGCTGCCGCC	AB051492	CCDS9714.1, CCDS53895.1, CCDS53896.1	14q21	2012-11-23			ENSG00000100523	ENSG00000100523			19714	protein-coding gene	gene with protein product	"""phosphatidic acid-preferring phospholipase A1"""	614603	"""spastic paraplegia 28 (autosomal recessive)"""	SPG28		11214970, 20359546	Standard	NM_030637		Approved	KIAA1705, PA-PLA1	uc001xai.3	Q8NEL9	OTTHUMG00000140305	ENST00000323669.5:c.337A>G	14.37:g.53619480T>C	ENSP00000327104:p.Ser113Gly	11	0		10	2	NM_001160147	G5E9D1|Q8WVH3|Q96LL2|Q9C0F8	Missense_Mutation	SNP	ENST00000323669.5	37	CCDS53895.1	.	.	.	.	.	.	.	.	.	.	T	16.03	3.006520	0.54361	.	.	ENSG00000100523	ENST00000323669;ENST00000395606;ENST00000357758;ENST00000395610	.	.	.	3.77	2.61	0.31194	.	0.746995	0.12231	N	0.487421	T	0.35566	0.0936	N	0.22421	0.69	0.20975	N	0.999816	P;B;P	0.52577	0.954;0.0;0.954	D;B;D	0.66351	0.916;0.0;0.943	T	0.17167	-1.0378	9	0.18276	T	0.48	-5.0646	3.2899	0.06945	0.0:0.2878:0.2128:0.4994	.	113;113;113	G5E9D1;Q8NEL9;Q8NEL9-2	.;DDHD1_HUMAN;.	G	113	.	ENSP00000327104:S113G	S	-	1	0	DDHD1	52689230	.	.	0.767000	0.31495	0.958000	0.62258	.	.	0.510000	0.28216	0.374000	0.22700	AGC	.		0.701	DDHD1-003	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276901.1		
ABI3	51225	hgsc.bcm.edu	37	17	47299965	47299965	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr17:47299965C>A	ENST00000225941.1	+	8	1487	c.989C>A	c.(988-990)tCt>tAt	p.S330Y	ABI3_ENST00000419580.2_Missense_Mutation_p.S324Y	NM_001135186.1|NM_016428.2	NP_001128658.1|NP_057512	Q9P2A4	ABI3_HUMAN	ABI family, member 3	330	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cellular component movement (GO:0006928)|regulation of cell migration (GO:0030334)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|membrane (GO:0016020)		p.S330F(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	12			Epithelial(5;6.37e-06)|all cancers(6;6.36e-05)			CTCTCCTTCTCTGAGGGCACT	0.572										HNSCC(55;0.14)																											p.S330Y		.											ABI3,scalp,carcinoma,0,1	ABI3	0	1	Substitution - Missense(1)	skin(1)	c.C989A						.						129.0	90.0	103.0					17																	47299965		2203	4300	6503	SO:0001583	missense	51225	exon8			CCTTCTCTGAGGG	AB037886	CCDS11546.1, CCDS45725.1	17q21.3	2011-03-04	2008-09-12		ENSG00000108798	ENSG00000108798			29859	protein-coding gene	gene with protein product		606363				10978530, 11956071	Standard	NM_001135186		Approved	NESH, SSH3BP3	uc002iop.1	Q9P2A4	OTTHUMG00000161306	ENST00000225941.1:c.989C>A	17.37:g.47299965C>A	ENSP00000225941:p.Ser330Tyr	22	0		24	2	NM_016428	C9IZN8|Q9H0P6	Missense_Mutation	SNP	ENST00000225941.1	37	CCDS11546.1	.	.	.	.	.	.	.	.	.	.	C	18.10	3.548225	0.65311	.	.	ENSG00000108798	ENST00000225941;ENST00000419580	T;T	0.52526	0.66;0.66	5.17	3.05	0.35203	Src homology-3 domain (5);	0.604104	0.15938	N	0.237322	T	0.30070	0.0753	N	0.17564	0.495	0.09310	N	0.999998	B;P	0.34864	0.418;0.473	B;B	0.37451	0.162;0.25	T	0.13045	-1.0524	10	0.46703	T	0.11	-14.9291	5.6317	0.17514	0.3191:0.5765:0.0:0.1044	.	324;330	Q9P2A4-2;Q9P2A4	.;ABI3_HUMAN	Y	330;324	ENSP00000225941:S330Y;ENSP00000406651:S324Y	ENSP00000225941:S330Y	S	+	2	0	ABI3	44654964	0.000000	0.05858	0.804000	0.32291	0.862000	0.49288	0.554000	0.23407	1.180000	0.42898	0.462000	0.41574	TCT	.		0.572	ABI3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364475.1	NM_016428	
PLEKHS1	79949	hgsc.bcm.edu;bcgsc.ca	37	10	115537285	115537285	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr10:115537285G>T	ENST00000369310.3	+	12	1846	c.1284G>T	c.(1282-1284)atG>atT	p.M428I	PLEKHS1_ENST00000361048.1_Intron|PLEKHS1_ENST00000369309.1_Intron|PLEKHS1_ENST00000354462.3_Intron|PLEKHS1_ENST00000369312.4_Intron	NM_182601.1	NP_872407.1	Q5SXH7	PKHS1_HUMAN	pleckstrin homology domain containing, family S member 1	0																	GAGCTTGCATGGAATCAGACT	0.433																																					p.M428I		.											.	.	.	0			c.G1284T						.						10.0	8.0	9.0					10																	115537285		874	1980	2854	SO:0001583	missense	79949	exon12			TTGCATGGAATCA	AK027190	CCDS7583.1, CCDS53580.1, CCDS53581.1	10q26.11	2013-01-11	2012-05-31	2012-05-31	ENSG00000148735	ENSG00000148735		"""Pleckstrin homology (PH) domain containing"""	26285	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 81"""	C10orf81		12477932	Standard	NM_024889		Approved	FLJ23537, bA211N11.2	uc001lat.2	Q5SXH7	OTTHUMG00000019074	ENST00000369310.3:c.1284G>T	10.37:g.115537285G>T	ENSP00000358316:p.Met428Ile	64	0		53	4	NM_182601	A8KA02|B3KX00|B6EDE1|Q5SXH8|Q5SXI0|Q6ZQR5|Q8NE42|Q9H5D9	Missense_Mutation	SNP	ENST00000369310.3	37	CCDS53580.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.44|10.44	1.351464|1.351464	0.24512|0.24512	.|.	.|.	ENSG00000148735|ENSG00000148735	ENST00000448805|ENST00000369310	.|T	.|0.43294	.|0.95	4.51|4.51	-3.35|-3.35	0.04928|0.04928	.|.	.|2.452770	.|0.00738	.|N	.|0.000995	.|T	.|0.33000	.|0.0848	L|L	0.43152|0.43152	1.355|1.355	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	.|T	.|0.19549	.|-1.0302	.|10	.|0.49607	.|T	.|0.09	5.178|5.178	4.0462|4.0462	0.09774|0.09774	0.2844:0.0:0.2208:0.4949|0.2844:0.0:0.2208:0.4949	.|.	.|428	.|Q5SXH7-5	.|.	X|I	159|428	.|ENSP00000358316:M428I	.|ENSP00000358316:M428I	G|M	+|+	1|3	0|0	C10orf81|C10orf81	115527275|115527275	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.003000|0.003000	0.03518|0.03518	-0.628000|-0.628000	0.05515|0.05515	-0.617000|-0.617000	0.05664|0.05664	0.650000|0.650000	0.86243|0.86243	GGA|ATG	.		0.433	PLEKHS1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050432.1	NM_024889	
EIF3J	8669	hgsc.bcm.edu	37	15	44849831	44849831	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr15:44849831G>T	ENST00000261868.5	+	6	692	c.554G>T	c.(553-555)cGa>cTa	p.R185L	RP11-151N17.1_ENST00000558006.1_RNA|EIF3J_ENST00000424492.3_Missense_Mutation_p.R136L|EIF3J_ENST00000535391.1_Intron	NM_003758.2	NP_003749.2			eukaryotic translation initiation factor 3, subunit J											endometrium(1)|large_intestine(5)|liver(2)|skin(1)	9		all_cancers(109;2.81e-14)|all_epithelial(112;2.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;3.13e-20)|GBM - Glioblastoma multiforme(94;9.81e-07)|COAD - Colon adenocarcinoma(120;0.0754)|Colorectal(105;0.0758)		GTCTTAGTTCGAGATGTGTGT	0.313																																					p.R185L		.											.	.	.	0			c.G554T						.						59.0	66.0	63.0					15																	44849831		2198	4295	6493	SO:0001583	missense	8669	exon6			TAGTTCGAGATGT	U97670	CCDS10111.1, CCDS61612.1, CCDS61613.1	15q21.1	2014-05-13	2007-07-27	2007-07-27	ENSG00000104131	ENSG00000104131			3270	protein-coding gene	gene with protein product		603910	"""eukaryotic translation initiation factor 3, subunit 1 alpha, 35kDa"""	EIF3S1		9822659	Standard	NM_001284335		Approved	eIF3-p35, eIF3-alpha, eIF3j	uc001ztv.3	O75822	OTTHUMG00000131158	ENST00000261868.5:c.554G>T	15.37:g.44849831G>T	ENSP00000261868:p.Arg185Leu	49	0		77	3	NM_003758		Missense_Mutation	SNP	ENST00000261868.5	37	CCDS10111.1	.	.	.	.	.	.	.	.	.	.	G	32	5.152867	0.94645	.	.	ENSG00000104131	ENST00000261868;ENST00000424492	T;T	0.56611	0.45;0.45	5.77	5.77	0.91146	Eukaryotic translation initiation factor 3-like domain (1);	0.000000	0.85682	D	0.000000	T	0.72724	0.3496	M	0.67700	2.07	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.74023	0.957;0.982	T	0.73956	-0.3819	10	0.87932	D	0	.	19.9835	0.97338	0.0:0.0:1.0:0.0	.	136;185	F5H425;O75822	.;EIF3J_HUMAN	L	185;136	ENSP00000261868:R185L;ENSP00000414548:R136L	ENSP00000261868:R185L	R	+	2	0	EIF3J	42637123	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.629000	0.83207	2.726000	0.93360	0.655000	0.94253	CGA	.		0.313	EIF3J-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253850.1	NM_003758	
Unknown	0	hgsc.bcm.edu	37	13	25507440	25507440	+	IGR	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr13:25507440G>T								CENPJ (10422 upstream) : TPTE2P1 (7299 downstream)																							TGGGCCCCCAGAGGCAGAGGA	0.547																																					.		.											.	.	.	0			.						.																																			SO:0001628	intergenic_variant	646405	.			CCCCCAGAGGCAG																													13.37:g.25507440G>T		49	0		45	4	.		RNA	SNP		37																																																																																				.	0	0.547								
AQP7	364	hgsc.bcm.edu	37	9	33385274	33385274	+	3'UTR	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr9:33385274C>A	ENST00000537089.1	-	0	1158				AQP7_ENST00000377425.4_Intron			O14520	AQP7_HUMAN	aquaporin 7						excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)			NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		CACCCACCACCAGTTCTCCCC	0.612																																					p.W253L		.											AQP7,NS,carcinoma,0,1	AQP7	0	0			c.G758T						.						65.0	68.0	67.0					9																	33385274		2202	4300	6502	SO:0001624	3_prime_UTR_variant	364	exon8			CACCACCAGTTCT	AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000537089.1:c.*342G>T	9.37:g.33385274C>A		86	0		79	4	NM_001170	Q08E94|Q5T5L9|Q8NHM3	Missense_Mutation	SNP	ENST00000537089.1	37		.	.	.	.	.	.	.	.	.	.	c	16.63	3.178069	0.57692	.	.	ENSG00000165269	ENST00000379507;ENST00000297988;ENST00000439678	T;T;T	0.11930	2.73;2.73;2.73	4.27	4.27	0.50696	Aquaporin-like (2);	0.460401	0.28301	N	0.015842	T	0.15609	0.0376	.	.	.	0.80722	D	1	B	0.24426	0.103	B	0.32980	0.156	T	0.04870	-1.0921	9	0.62326	D	0.03	-8.5196	12.1166	0.53868	0.0:1.0:0.0:0.0	.	253	O14520	AQP7_HUMAN	L	252;253;161	ENSP00000368821:W252L;ENSP00000297988:W253L;ENSP00000410138:W161L	ENSP00000297988:W253L	W	-	2	0	AQP7	33375274	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	7.278000	0.78587	2.235000	0.73313	0.537000	0.68136	TGG	.		0.612	AQP7-202	KNOWN	basic	protein_coding	protein_coding		NM_001170	
MMRN1	22915	hgsc.bcm.edu	37	4	90816624	90816624	+	Missense_Mutation	SNP	G	G	A	rs139015467		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr4:90816624G>A	ENST00000394980.1	+	2	821	c.502G>A	c.(502-504)Gtt>Att	p.V168I	MMRN1_ENST00000394981.1_Missense_Mutation_p.V134I|MMRN1_ENST00000264790.2_Missense_Mutation_p.V168I			Q13201	MMRN1_HUMAN	multimerin 1	168					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)		p.V168F(1)		breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		cattggaggcgttggaggcac	0.488																																					p.V168I		.											MMRN1,NS,carcinoma,0,1	MMRN1	0	1	Substitution - Missense(1)	ovary(1)	c.G502A						.	A	ILE/VAL	0,4406		0,0,2203	57.0	58.0	57.0		502	-0.2	0.0	4	dbSNP_134	57	2,8598	2.2+/-6.3	0,2,4298	no	missense	MMRN1	NM_007351.2	29	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	168/1229	90816624	2,13004	2203	4300	6503	SO:0001583	missense	22915	exon1			GGAGGCGTTGGAG	U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.502G>A	4.37:g.90816624G>A	ENSP00000378431:p.Val168Ile	77	0		45	2	NM_007351	Q4W5L1|Q6P3T8|Q6ZUL9	Missense_Mutation	SNP	ENST00000394980.1	37	CCDS3635.1	.	.	.	.	.	.	.	.	.	.	g	4.011	-0.000654	0.07819	0.0	2.33E-4	ENSG00000138722	ENST00000394980;ENST00000264790;ENST00000394981	T;T;T	0.71222	0.17;0.17;-0.55	0.119	-0.238	0.13055	.	.	.	.	.	T	0.40171	0.1106	N	0.08118	0	0.09310	N	1	P;P	0.42456	0.78;0.672	B;B	0.35688	0.208;0.103	T	0.29119	-1.0022	8	0.33940	T	0.23	.	.	.	.	.	134;168	Q13201-2;Q13201	.;MMRN1_HUMAN	I	168;168;134	ENSP00000378431:V168I;ENSP00000264790:V168I;ENSP00000378432:V134I	ENSP00000264790:V168I	V	+	1	0	MMRN1	91035647	0.012000	0.17670	0.042000	0.18584	0.078000	0.17371	-0.687000	0.05156	-1.142000	0.02869	-1.148000	0.01847	GTT	0.000		0.488	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253546.2	NM_007351	
MUC4	4585	hgsc.bcm.edu	37	3	195509559	195509559	+	Silent	SNP	G	G	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr3:195509559G>A	ENST00000463781.3	-	2	9351	c.8892C>T	c.(8890-8892)acC>acT	p.T2964T	MUC4_ENST00000475231.1_Silent_p.T2964T|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T2964T(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGTGTCGGTGACAGGAA	0.582																																					p.T2964T		.											MUC4_ENST00000463781,NS,carcinoma,-1,1	MUC4_ENST00000463781	-1	1	Substitution - coding silent(1)	endometrium(1)	c.C8892T						.						9.0	8.0	8.0					3																	195509559		627	1488	2115	SO:0001819	synonymous_variant	4585	exon2			AGTGTCGGTGACA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8892C>T	3.37:g.195509559G>A		128	0		97	5	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
CCNA2	890	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	122739257	122739257	+	Missense_Mutation	SNP	A	A	G			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr4:122739257A>G	ENST00000274026.5	-	7	1495	c.1192T>C	c.(1192-1194)Tac>Cac	p.Y398H		NM_001237.3	NP_001228	P20248	CCNA2_HUMAN	cyclin A2	398					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic G2 DNA damage checkpoint (GO:0007095)|mitotic nuclear division (GO:0007067)|organ regeneration (GO:0031100)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|response to estradiol (GO:0032355)|response to glucagon (GO:0033762)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	12						GCTTTGAGGTAGGTCTGGTGA	0.383																																					p.Y398H		.											.	.	.	0			c.T1192C						.						173.0	163.0	166.0					4																	122739257		2203	4300	6503	SO:0001583	missense	890	exon7			TGAGGTAGGTCTG		CCDS3723.1	4q27	2012-07-12			ENSG00000145386	ENSG00000145386			1578	protein-coding gene	gene with protein product		123835		CCNA, CCN1		1675006	Standard	NM_001237		Approved		uc003iec.4	P20248	OTTHUMG00000133072	ENST00000274026.5:c.1192T>C	4.37:g.122739257A>G	ENSP00000274026:p.Tyr398His	49	0		28	8	NM_001237	A8K7B6|Q2M3U6|Q4W5P4|Q6LER8	Missense_Mutation	SNP	ENST00000274026.5	37	CCDS3723.1	.	.	.	.	.	.	.	.	.	.	A	16.24	3.065985	0.55539	.	.	ENSG00000145386	ENST00000274026	T	0.19669	2.13	5.92	5.92	0.95590	Cyclin, C-terminal (1);Cyclin-like (2);	0.190335	0.48286	D	0.000194	T	0.25865	0.0630	L	0.35644	1.08	0.58432	D	0.999993	B	0.18741	0.03	B	0.40741	0.339	T	0.08785	-1.0705	10	0.09590	T	0.72	.	16.3593	0.83251	1.0:0.0:0.0:0.0	.	398	P20248	CCNA2_HUMAN	H	398	ENSP00000274026:Y398H	ENSP00000274026:Y398H	Y	-	1	0	CCNA2	122958707	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.191000	0.72063	2.267000	0.75376	0.383000	0.25322	TAC	.		0.383	CCNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256712.2	NM_001237	
SF3B1	23451	hgsc.bcm.edu	37	2	198269868	198269868	+	Nonsense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr2:198269868C>A	ENST00000335508.6	-	11	1562	c.1471G>T	c.(1471-1473)Gag>Tag	p.E491*	SNORA4_ENST00000365564.1_RNA|SF3B1_ENST00000462613.1_5'Flank	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	491	Interaction with PPP1R8.				anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TCTTTTTGCTCTTCTGGACTA	0.299			Mis		myelodysplastic syndrome																																p.E491X		.		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	.	.	.	0			c.G1471T						.						54.0	56.0	55.0					2																	198269868		2202	4297	6499	SO:0001587	stop_gained	23451	exon11			TTTGCTCTTCTGG	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.1471G>T	2.37:g.198269868C>A	ENSP00000335321:p.Glu491*	66	0		63	4	NM_012433	E9PCH3	Nonsense_Mutation	SNP	ENST00000335508.6	37	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	C	38	7.057910	0.98032	.	.	ENSG00000115524	ENST00000335508	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.9254	0.97100	0.0:1.0:0.0:0.0	.	.	.	.	X	491	.	ENSP00000335321:E491X	E	-	1	0	SF3B1	197978113	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.707000	0.84623	2.710000	0.92621	0.655000	0.94253	GAG	.		0.299	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
NCOA3	8202	hgsc.bcm.edu	37	20	46279833	46279833	+	Silent	SNP	G	G	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr20:46279833G>A	ENST00000371998.3	+	20	3950	c.3759G>A	c.(3757-3759)caG>caA	p.Q1253Q	NCOA3_ENST00000371997.3_Silent_p.Q1244Q|NCOA3_ENST00000341724.6_Silent_p.Q1179Q|NCOA3_ENST00000372004.3_Silent_p.Q1249Q			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	1253	Acetyltransferase.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						agcagcagcagcaacagcagc	0.547																																					p.Q1253Q		.											NCOA3,NS,carcinoma,0,3	NCOA3	0	0			c.G3759A						.						46.0	53.0	50.0					20																	46279833		2202	4300	6502	SO:0001819	synonymous_variant	8202	exon20			GCAGCAGCAACAG	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.3759G>A	20.37:g.46279833G>A		24	1		25	2	NM_181659	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Silent	SNP	ENST00000371998.3	37	CCDS13407.1																																																																																			.		0.547	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	
LYST	1130	hgsc.bcm.edu	37	1	235827341	235827341	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:235827341C>A	ENST00000389794.3	-	52	11384	c.11210G>T	c.(11209-11211)tGg>tTg	p.W3737L	LYST_ENST00000389793.2_Missense_Mutation_p.W3737L|LYST_ENST00000473037.1_5'UTR			Q99698	LYST_HUMAN	lysosomal trafficking regulator	3737					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.W3737L(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			CTTTAAGTCCCATGTGCTCCA	0.348																																					p.W3737L		.											.	.	.	1	Substitution - Missense(1)	lung(1)	c.G11210T						.						132.0	135.0	134.0					1																	235827341		2203	4300	6503	SO:0001583	missense	1130	exon52			AAGTCCCATGTGC	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.11210G>T	1.37:g.235827341C>A	ENSP00000374444:p.Trp3737Leu	79	0		77	4	NM_000081	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	37	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	C	31	5.071100	0.93950	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.27557	1.66;1.66	5.97	5.97	0.96955	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.47893	0.1470	L	0.42686	1.345	0.80722	D	1	D	0.58620	0.983	P	0.60173	0.87	T	0.23691	-1.0181	10	0.52906	T	0.07	.	20.4171	0.99027	0.0:1.0:0.0:0.0	.	3737	Q99698	LYST_HUMAN	L	3737	ENSP00000374444:W3737L;ENSP00000374443:W3737L	ENSP00000374443:W3737L	W	-	2	0	LYST	233893964	1.000000	0.71417	0.998000	0.56505	0.975000	0.68041	7.759000	0.85235	2.832000	0.97577	0.585000	0.79938	TGG	.		0.348	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
MEPE	56955	hgsc.bcm.edu	37	4	88767342	88767342	+	Missense_Mutation	SNP	G	G	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr4:88767342G>A	ENST00000424957.3	+	4	1395	c.1322G>A	c.(1321-1323)cGt>cAt	p.R441H	MEPE_ENST00000560249.1_Missense_Mutation_p.R328H|MEPE_ENST00000361056.3_Missense_Mutation_p.R441H|MEPE_ENST00000508016.1_3'UTR|MEPE_ENST00000497649.2_Missense_Mutation_p.R417H|MEPE_ENST00000395102.4_Missense_Mutation_p.R472H|MEPE_ENST00000540395.1_Missense_Mutation_p.R328H	NM_001184694.1	NP_001171623.1	Q9NQ76	MEPE_HUMAN	matrix extracellular phosphoglycoprotein	441					biomineral tissue development (GO:0031214)|negative regulation of bone mineralization (GO:0030502)|regulation of bone remodeling (GO:0046850)|skeletal system development (GO:0001501)	proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(19)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000432)		ATTCCTTCTCGTGGTCTTGAT	0.388																																					p.R441H		.											MEPE,NS,carcinoma,0,1	MEPE	0	0			c.G1322A						.						71.0	67.0	68.0					4																	88767342		2203	4300	6503	SO:0001583	missense	56955	exon4			CTTCTCGTGGTCT	AJ276396	CCDS3625.1, CCDS54776.1	4q21.1	2008-08-29	2008-08-29		ENSG00000152595	ENSG00000152595			13361	protein-coding gene	gene with protein product		605912	"""matrix, extracellular phosphoglycoprotein with ASARM motif (bone)"""			10945470	Standard	NM_020203		Approved		uc003hqy.3	Q9NQ76	OTTHUMG00000130592	ENST00000424957.3:c.1322G>A	4.37:g.88767342G>A	ENSP00000416984:p.Arg441His	52	1		36	2	NM_020203	A1A4X9|A8MTA3|D2CFR4|F5H5C5	Missense_Mutation	SNP	ENST00000424957.3	37	CCDS3625.1	.	.	.	.	.	.	.	.	.	.	G	1.024	-0.684037	0.03353	.	.	ENSG00000152595	ENST00000424957;ENST00000395102;ENST00000497649;ENST00000540395;ENST00000361056	T;T;T;T;T	0.40756	1.02;1.02;1.03;1.04;1.02	4.89	-9.77	0.00500	.	1.688310	0.03320	N	0.191774	T	0.17023	0.0409	N	0.12637	0.245	0.09310	N	1	B	0.16603	0.018	B	0.09377	0.004	T	0.10989	-1.0606	10	0.08837	T	0.75	0.4654	5.3449	0.16004	0.5997:0.1927:0.1186:0.0889	.	441	Q9NQ76	MEPE_HUMAN	H	441;472;417;328;441	ENSP00000416984:R441H;ENSP00000378534:R472H;ENSP00000422747:R417H;ENSP00000443491:R328H;ENSP00000354341:R441H	ENSP00000354341:R441H	R	+	2	0	MEPE	88986366	0.000000	0.05858	0.000000	0.03702	0.114000	0.19823	-0.755000	0.04782	-2.573000	0.00466	-0.251000	0.11542	CGT	.		0.388	MEPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253038.1		
KLHL2	11275	hgsc.bcm.edu	37	4	166200025	166200025	+	Intron	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr4:166200025C>A	ENST00000226725.6	+	6	803				KLHL2_ENST00000514860.1_Intron|KLHL2_ENST00000538127.1_Intron|KLHL2_ENST00000421009.2_Intron|KLHL2_ENST00000509028.1_Intron|KLHL2_ENST00000506761.1_Intron	NM_007246.3	NP_009177.3	O95198	KLHL2_HUMAN	kelch-like family member 2						protein ubiquitination (GO:0016567)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)	actin binding (GO:0003779)			endometrium(3)|large_intestine(5)|lung(4)|prostate(1)|urinary_tract(1)	14	all_hematologic(180;0.221)			GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)		AGACTGGTCCCCTAAACACCC	0.458																																					.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	2713	.			TGGTCCCCTAAAC	AF059569	CCDS34094.1, CCDS54815.1, CCDS54816.1	4q21.2	2013-01-30	2013-01-30		ENSG00000109466	ENSG00000109466		"""Kelch-like"", ""BTB/POZ domain containing"""	6353	protein-coding gene	gene with protein product	"""mayven"""	605774	"""kelch (Drosophila)-like 2 (Mayven)"", ""kelch-like 2, Mayven (Drosophila)"""			10397770, 16035103	Standard	NM_007246		Approved	MAV	uc011cjm.2	O95198	OTTHUMG00000161294	ENST00000226725.6:c.545-15486C>A	4.37:g.166200025C>A		108	0		92	4	.	A6NCM7|B2RD18|B4DFH7|F5H6M3|Q8N484|Q8TBH5	RNA	SNP	ENST00000226725.6	37	CCDS34094.1																																																																																			.		0.458	KLHL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364439.1		
CELF5	60680	hgsc.bcm.edu	37	19	3281207	3281207	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr19:3281207C>A	ENST00000292672.2	+	6	651	c.614C>A	c.(613-615)tCc>tAc	p.S205Y	CELF5_ENST00000541430.2_Missense_Mutation_p.S205Y	NM_021938.3	NP_068757.2	Q8N6W0	CELF5_HUMAN	CUGBP, Elav-like family member 5	205	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			kidney(1)|large_intestine(2)|lung(7)|ovary(2)|skin(1)	13						GGAGCCTCCTCCAGCCTGGTG	0.667																																					p.S205Y		.											CELF5,NS,malignant_melanoma,0,2	CELF5	0	0			c.C614A						.						61.0	62.0	61.0					19																	3281207		2203	4300	6503	SO:0001583	missense	60680	exon6			CCTCCTCCAGCCT	AF248649	CCDS12106.1, CCDS54197.1	19p13	2013-02-12	2010-02-19	2010-02-19		ENSG00000161082		"""RNA binding motif (RRM) containing"""	14058	protein-coding gene	gene with protein product		612680	"""Bruno (Drosophila) -like 5, RNA binding protein"", ""bruno-like 5, RNA binding protein (Drosophila)"""	BRUNOL5		10893231	Standard	NM_001172673		Approved		uc002lxm.3	Q8N6W0		ENST00000292672.2:c.614C>A	19.37:g.3281207C>A	ENSP00000292672:p.Ser205Tyr	44	0		51	3	NM_021938	D6W614|O75253|Q59GP2|Q86VW6|Q9BZC0|Q9NR86	Missense_Mutation	SNP	ENST00000292672.2	37	CCDS12106.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.016471	0.75161	.	.	ENSG00000161082	ENST00000292672;ENST00000541430;ENST00000334293	T;T;T	0.36157	3.35;1.53;1.27	4.15	4.15	0.48705	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.060463	0.64402	D	0.000002	T	0.45377	0.1339	L	0.34521	1.04	0.80722	D	1	D;D;P	0.76494	0.999;0.995;0.954	P;P;B	0.60415	0.874;0.852;0.446	T	0.50233	-0.8852	10	0.87932	D	0	-14.4095	15.3991	0.74823	0.0:1.0:0.0:0.0	.	91;205;205	B4DFI3;Q8N6W0-2;Q8N6W0	.;.;CELF5_HUMAN	Y	205;205;91	ENSP00000292672:S205Y;ENSP00000443498:S205Y;ENSP00000335182:S91Y	ENSP00000292672:S205Y	S	+	2	0	CELF5	3232207	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.699000	0.84547	2.040000	0.60383	0.462000	0.41574	TCC	.		0.667	CELF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452574.1	NM_021938	
PLBD1	79887	hgsc.bcm.edu	37	12	14664306	14664306	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr12:14664306C>A	ENST00000240617.5	-	8	1726	c.1074G>T	c.(1072-1074)ctG>ctT	p.L358L		NM_024829.5	NP_079105.4	Q6P4A8	PLBL1_HUMAN	phospholipase B domain containing 1	358					glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	16						TCTTCAGGTCCAGAACCATGT	0.383																																					p.L358L		.											.	.	.	0			c.G1074T						.						148.0	128.0	135.0					12																	14664306		2203	4300	6503	SO:0001819	synonymous_variant	79887	exon8			CAGGTCCAGAACC	BC000909	CCDS31751.1	12p13.1	2013-10-11			ENSG00000121316	ENSG00000121316			26215	protein-coding gene	gene with protein product	"""PLB homolog 1 (Dictyostelium)"""					15193148, 19019078	Standard	NM_024829		Approved	FLJ22662	uc001rcc.1	Q6P4A8	OTTHUMG00000168821	ENST00000240617.5:c.1074G>T	12.37:g.14664306C>A		85	0		90	3	NM_024829	A8K4E9|Q9BVV3|Q9H625	Silent	SNP	ENST00000240617.5	37	CCDS31751.1																																																																																			.		0.383	PLBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401203.1	NM_024829	
ST8SIA4	7903	hgsc.bcm.edu	37	5	100222104	100222104	+	Missense_Mutation	SNP	C	C	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr5:100222104C>T	ENST00000231461.5	-	3	756	c.446G>A	c.(445-447)gGc>gAc	p.G149D	ST8SIA4_ENST00000507360.2_5'UTR|ST8SIA4_ENST00000451528.2_Missense_Mutation_p.G149D	NM_005668.4	NP_005659.1	Q92187	SIA8D_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4	149					axon guidance (GO:0007411)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)	25		all_cancers(142;1.5e-07)|all_epithelial(76;1.43e-10)|Prostate(80;0.000644)|Lung NSC(167;0.0059)|all_lung(232;0.00914)|Ovarian(225;0.024)|Colorectal(57;0.09)|Breast(839;0.203)		COAD - Colon adenocarcinoma(37;0.00402)		TAACAGAATGCCAGAATTTCC	0.383																																					p.G149D		.											ST8SIA4,NS,lymphoid_neoplasm,0,1	ST8SIA4	0	0			c.G446A						.						96.0	94.0	95.0					5																	100222104		2203	4300	6503	SO:0001583	missense	7903	exon3			AGAATGCCAGAAT	L41680	CCDS4091.1, CCDS47252.1	5q21	2013-03-01	2003-01-14	2005-02-07	ENSG00000113532	ENSG00000113532		"""Sialyltransferases"""	10871	protein-coding gene	gene with protein product	"""ST8Sia IV"""	602547	"""sialyltransferase 8 (alpha-2, 8-polysialytransferase) D"""	SIAT8D		7624364	Standard	NM_005668		Approved	PST, PST1	uc003knk.3	Q92187	OTTHUMG00000128727	ENST00000231461.5:c.446G>A	5.37:g.100222104C>T	ENSP00000231461:p.Gly149Asp	49	0		43	2	NM_175052	A8KA07|G3V104|Q8N1F4|Q92693	Missense_Mutation	SNP	ENST00000231461.5	37	CCDS4091.1	.	.	.	.	.	.	.	.	.	.	C	33	5.240932	0.95272	.	.	ENSG00000113532	ENST00000231461;ENST00000451528	T;T	0.61627	0.09;0.09	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	D	0.85146	0.5630	H	0.96691	3.865	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89346	0.3657	10	0.87932	D	0	-9.6147	19.3049	0.94157	0.0:1.0:0.0:0.0	.	149	Q92187	SIA8D_HUMAN	D	149	ENSP00000231461:G149D;ENSP00000428914:G149D	ENSP00000231461:G149D	G	-	2	0	ST8SIA4	100250003	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.456000	0.80751	2.809000	0.96659	0.557000	0.71058	GGC	.		0.383	ST8SIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250632.3	NM_005668	
GOLT1A	127845	hgsc.bcm.edu	37	1	204170901	204170901	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:204170901C>A	ENST00000308302.3	-	3	341	c.156G>T	c.(154-156)ctG>ctT	p.L52L	GOLT1A_ENST00000475517.1_5'Flank	NM_198447.1	NP_940849.1			golgi transport 1A											kidney(1)|lung(2)|urinary_tract(1)	4	all_cancers(21;0.0165)|Breast(84;0.179)|all_epithelial(62;0.242)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.244)			AGGTCTTCCTCAGGCCAATGA	0.592																																					p.L52L		.											GOLT1A,bladder,carcinoma,0,1	GOLT1A	0	0			c.G156T						.						116.0	120.0	119.0					1																	204170901		2203	4300	6503	SO:0001819	synonymous_variant	127845	exon3			CTTCCTCAGGCCA	BC058832	CCDS1443.1	1q32.1	2010-06-24	2010-06-24		ENSG00000174567	ENSG00000174567			24766	protein-coding gene	gene with protein product			"""golgi transport 1 homolog A (S. cerevisiae)"""			12477932	Standard	NM_198447		Approved	FLJ42654, CGI-141, YMR292W, GOT1, MGC62027	uc001has.1	Q6ZVE7	OTTHUMG00000036056	ENST00000308302.3:c.156G>T	1.37:g.204170901C>A		39	0		38	2	NM_198447		Silent	SNP	ENST00000308302.3	37	CCDS1443.1																																																																																			.		0.592	GOLT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087887.1	NM_198447	
ARHGEF7	8874	hgsc.bcm.edu	37	13	111953840	111953840	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr13:111953840C>A	ENST00000218789.5	+	20	2453	c.1956C>A	c.(1954-1956)acC>acA	p.T652T	ARHGEF7_ENST00000370623.3_Silent_p.T678T|ARHGEF7_ENST00000426073.2_Silent_p.T593T|ARHGEF7_ENST00000375736.4_Silent_p.T593T|ARHGEF7_ENST00000375737.5_Silent_p.T668T			Q14155	ARHG7_HUMAN	Rho guanine nucleotide exchange factor (GEF) 7	0					apoptotic signaling pathway (GO:0097190)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|hematopoietic progenitor cell differentiation (GO:0002244)|lamellipodium assembly (GO:0030032)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of GTPase activity (GO:0043547)|positive regulation of lamellipodium morphogenesis (GO:2000394)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase binding (GO:0019901)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	41	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			TTGTGGATACCGTATATGCAT	0.378																																					p.T593T		.											ARHGEF7_ENST00000375736,NS,carcinoma,0,1	ARHGEF7_ENST00000375736	0	0			c.C1779A						.						295.0	247.0	263.0					13																	111953840		2203	4300	6503	SO:0001819	synonymous_variant	8874	exon19			GGATACCGTATAT	D63476	CCDS9521.1, CCDS32009.1, CCDS45068.1, CCDS45069.1	13q33.3	2013-01-10			ENSG00000102606	ENSG00000102606		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15607	protein-coding gene	gene with protein product	"""SH3 domain-containing proline-rich protein"", ""PAK-interacting exchange factor beta"", ""rho"", ""guanine nucleotide exchange factor 7"""	605477				9207241, 9726964	Standard	NM_003899		Approved	KIAA0142, PIXB, DKFZp761K1021, Nbla10314, DKFZp686C12170, BETA-PIX, COOL1, P85SPR, P85, P85COOL1, P50BP, PAK3, P50	uc001vrs.2	Q14155	OTTHUMG00000017357	ENST00000218789.5:c.1956C>A	13.37:g.111953840C>A		120	0		74	3	NM_003899	B1ALK6|B1ALK8|Q3LIA4|Q5W9H0|Q6P9G3|Q6PII2|Q86W63|Q8N3M1	Silent	SNP	ENST00000218789.5	37																																																																																				.		0.378	ARHGEF7-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000045805.3	NM_001113511	
CELSR2	1952	hgsc.bcm.edu	37	1	109792751	109792751	+	Missense_Mutation	SNP	T	T	C	rs200277265		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:109792751T>C	ENST00000271332.3	+	1	111	c.50T>C	c.(49-51)cTg>cCg	p.L17P		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	17					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		ccgccgccgctgctgctgctg	0.751																																					p.L17P	NSCLC(158;1285 2011 34800 34852 42084)	.											CELSR2,colon,carcinoma,0,1	CELSR2	0	0			c.T50C						.						8.0	10.0	9.0					1																	109792751		1799	3668	5467	SO:0001583	missense	1952	exon1			CGCCGCTGCTGCT	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.50T>C	1.37:g.109792751T>C	ENSP00000271332:p.Leu17Pro	6	1		7	4	NM_001408	Q5T2Y7|Q92566	Missense_Mutation	SNP	ENST00000271332.3	37	CCDS796.1	.	.	.	.	.	.	.	.	.	.	N	5.977	0.364215	0.11296	.	.	ENSG00000143126	ENST00000271332	T	0.70631	-0.5	4.25	-3.77	0.04346	.	.	.	.	.	T	0.20251	0.0487	N	0.08118	0	0.58432	P	4.000000000004E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.13098	-1.0522	8	0.51188	T	0.08	.	1.1702	0.01823	0.161:0.339:0.1649:0.3351	.	17	Q9HCU4	CELR2_HUMAN	P	17	ENSP00000271332:L17P	ENSP00000271332:L17P	L	+	2	0	CELSR2	109594274	0.000000	0.05858	0.003000	0.11579	0.062000	0.15995	-0.618000	0.05578	-0.422000	0.07405	0.404000	0.27445	CTG	.		0.751	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
MS4A7	58475	hgsc.bcm.edu;bcgsc.ca	37	11	60152623	60152623	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr11:60152623C>A	ENST00000300184.3	+	3	406	c.210C>A	c.(208-210)ccC>ccA	p.P70P	MS4A7_ENST00000358246.1_Intron|MS4A7_ENST00000530234.2_Silent_p.P70P|MS4A14_ENST00000531787.1_Intron|MS4A7_ENST00000534016.1_Intron	NM_021201.4|NM_206939.1	NP_067024.1|NP_996822.1	Q9GZW8	MS4A7_HUMAN	membrane-spanning 4-domains, subfamily A, member 7	70						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(2)|lung(8)|ovary(1)|skin(1)	20						TTTTTGCTCCCTACCCCTCCC	0.483																																					p.P70P		.											.	.	.	0			c.C210A						.						207.0	205.0	205.0					11																	60152623		2203	4300	6503	SO:0001819	synonymous_variant	58475	exon3			TGCTCCCTACCCC	AB026043	CCDS7985.1, CCDS7986.1	11q12	2008-03-25				ENSG00000166927			13378	protein-coding gene	gene with protein product		606502				11245982, 11401424	Standard	NM_021201		Approved	CD20L4, CFFM4, MS4A8	uc001npf.3	Q9GZW8		ENST00000300184.3:c.210C>A	11.37:g.60152623C>A		80	0		56	4	NM_021201	A6NP53|Q6IAG8	Silent	SNP	ENST00000300184.3	37	CCDS7985.1																																																																																			.		0.483	MS4A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394299.1		
SCN2A	6326	hgsc.bcm.edu	37	2	166170618	166170618	+	Splice_Site	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr2:166170618G>T	ENST00000375437.2	+	10	1673	c.1383G>T	c.(1381-1383)caG>caT	p.Q461H	SCN2A_ENST00000375427.2_Splice_Site_p.Q461H|SCN2A_ENST00000357398.3_Splice_Site_p.Q461H|SCN2A_ENST00000283256.6_Splice_Site_p.Q461H	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	461					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.Q461Q(1)		NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AAGAAGCTCAGGTATAGTGAA	0.398																																					p.Q461H		.											SCN2A_ENST00000375437,colon,carcinoma,0,5	SCN2A_ENST00000375437	0	1	Substitution - coding silent(1)	ovary(1)	c.G1383T						.						50.0	48.0	49.0					2																	166170618		2202	4299	6501	SO:0001630	splice_region_variant	6326	exon9			AGCTCAGGTATAG	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.1383+1G>T	2.37:g.166170618G>T		31	0		23	2	NM_001040143	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	ENST00000375437.2	37	CCDS33314.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.279553	0.80692	.	.	ENSG00000136531	ENST00000424833;ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D;D	0.96651	-4.08;-4.0;-4.0;-4.0;-4.0	5.77	5.77	0.91146	.	0.303220	0.29321	N	0.012497	D	0.97617	0.9219	L	0.53729	1.69	0.80722	D	1	P;D	0.71674	0.785;0.998	P;D	0.81914	0.753;0.995	D	0.97722	1.0197	10	0.62326	D	0.03	.	20.3626	0.98863	0.0:0.0:1.0:0.0	.	461;461	Q99250-2;Q99250	.;SCN2A_HUMAN	H	461	ENSP00000406454:Q461H;ENSP00000364586:Q461H;ENSP00000349973:Q461H;ENSP00000283256:Q461H;ENSP00000364576:Q461H	ENSP00000283256:Q461H	Q	+	3	2	SCN2A	165878864	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	7.968000	0.87980	2.885000	0.99019	0.655000	0.94253	CAG	.		0.398	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	Missense_Mutation
FGB	2244	hgsc.bcm.edu	37	4	155491687	155491687	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr4:155491687G>T	ENST00000302068.4	+	8	1424	c.1361G>T	c.(1360-1362)tGg>tTg	p.W454L	FGB_ENST00000502545.1_3'UTR|FGB_ENST00000509493.1_Missense_Mutation_p.W235L	NM_005141.4	NP_005132.2	P02675	FIBB_HUMAN	fibrinogen beta chain	454	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|cellular response to interleukin-1 (GO:0071347)|cellular response to leptin stimulus (GO:0044320)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	chaperone binding (GO:0051087)|structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(2)|lung(22)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	CAGTACACCTGGGACATGGCA	0.468																																					p.W454L	NSCLC(106;1133 1613 21870 46110 52656)	.											.	.	.	0			c.G1361T						.						209.0	175.0	187.0					4																	155491687		2203	4300	6503	SO:0001583	missense	2244	exon8			ACACCTGGGACAT		CCDS3786.1	4q28	2014-09-17			ENSG00000171564	ENSG00000171564		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3662	protein-coding gene	gene with protein product		134830	"""fibrinogen, B beta polypeptide"""				Standard	NM_005141		Approved		uc003ioa.4	P02675	OTTHUMG00000150331	ENST00000302068.4:c.1361G>T	4.37:g.155491687G>T	ENSP00000306099:p.Trp454Leu	70	0		52	4	NM_005141	A0JLR9|B2R7G3|Q32Q65|Q3KPF2	Missense_Mutation	SNP	ENST00000302068.4	37	CCDS3786.1	.	.	.	.	.	.	.	.	.	.	G	11.70	1.716382	0.30413	.	.	ENSG00000171564	ENST00000302068;ENST00000537843;ENST00000509493	T;T	0.76060	-0.99;-0.99	5.38	4.54	0.55810	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 2 (1);	0.167297	0.52532	D	0.000077	T	0.51058	0.1652	N	0.05050	-0.12	0.47905	D	0.999545	P;B	0.41848	0.763;0.003	B;B	0.36845	0.234;0.006	T	0.56498	-0.7969	10	0.42905	T	0.14	.	10.7203	0.46036	0.0715:0.1318:0.7967:0.0	.	437;454	B4E1D3;P02675	.;FIBB_HUMAN	L	454;437;235	ENSP00000306099:W454L;ENSP00000426757:W235L	ENSP00000306099:W454L	W	+	2	0	FGB	155711137	1.000000	0.71417	1.000000	0.80357	0.622000	0.37654	2.888000	0.48594	1.430000	0.47334	0.655000	0.94253	TGG	.		0.468	FGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317595.1	NM_005141	
MGAM	8972	hgsc.bcm.edu	37	7	141754596	141754596	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr7:141754596C>A	ENST00000549489.2	+	27	3297	c.3202C>A	c.(3202-3204)Ctg>Atg	p.L1068M	MGAM_ENST00000475668.2_Missense_Mutation_p.L1068M	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1068	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.L1068L(4)		cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TCCAGTCCCTCTGAACATACC	0.433																																					p.L1068M		.											MGAM_ENST00000549489,NS,carcinoma,0,3	MGAM_ENST00000549489	0	4	Substitution - coding silent(4)	prostate(4)	c.C3202A						.						159.0	150.0	153.0					7																	141754596		1906	4114	6020	SO:0001583	missense	8972	exon27			GTCCCTCTGAACA	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.3202C>A	7.37:g.141754596C>A	ENSP00000447378:p.Leu1068Met	103	0		75	3	NM_004668	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	37	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	C	11.59	1.683746	0.29872	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	T	0.33865	1.39	4.1	1.02	0.19986	Glycoside hydrolase-type carbohydrate-binding (1);	0.000000	0.31949	N	0.006814	T	0.42449	0.1203	M	0.73319	2.225	0.28662	N	0.906103	D	0.56746	0.977	P	0.54026	0.74	T	0.30822	-0.9965	10	0.39692	T	0.17	.	5.1464	0.14987	0.1457:0.5931:0.0:0.2611	.	1068	O43451	MGA_HUMAN	M	1068;1068;945	ENSP00000447378:L1068M	ENSP00000316431:L945M	L	+	1	2	MGAM	141401065	0.642000	0.27260	0.812000	0.32479	0.035000	0.12851	1.200000	0.32247	0.164000	0.19529	0.305000	0.20034	CTG	.		0.433	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		
FANCC	2176	hgsc.bcm.edu;bcgsc.ca	37	9	97934327	97934327	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr9:97934327G>T	ENST00000289081.3	-	5	702	c.448C>A	c.(448-450)Ctt>Att	p.L150I	FANCC_ENST00000375305.1_Missense_Mutation_p.L150I|snoU13_ENST00000459065.1_RNA	NM_000136.2	NP_000127.2	Q00597	FANCC_HUMAN	Fanconi anemia, complementation group C	150					DNA repair (GO:0006281)|germ cell development (GO:0007281)|myeloid cell homeostasis (GO:0002262)|nucleotide-excision repair (GO:0006289)|protein complex assembly (GO:0006461)|removal of superoxide radicals (GO:0019430)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				kidney(1)|skin(1)|upper_aerodigestive_tract(1)	3		Acute lymphoblastic leukemia(62;0.138)				ACATTTTTAAGCAAACCAGGA	0.323			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.L150I		.	yes	Rec		Fanconi anaemia C	9	9q22.3	2176	"""Fanconi anemia, complementation group C"""		L	.	.	.	0			c.C448A						.						62.0	66.0	65.0					9																	97934327		2203	4298	6501	SO:0001583	missense	2176	exon5	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	TTTTAAGCAAACC	BC006303	CCDS35071.1, CCDS75861.1	9q22.3	2014-09-17			ENSG00000158169	ENSG00000158169		"""Fanconi anemia, complementation groups"""	3584	protein-coding gene	gene with protein product		613899		FACC		1303234	Standard	NM_001243743		Approved	FAC, FA3	uc004avh.3	Q00597	OTTHUMG00000020279	ENST00000289081.3:c.448C>A	9.37:g.97934327G>T	ENSP00000289081:p.Leu150Ile	109	0		94	4	NM_001243743	B1ALR8	Missense_Mutation	SNP	ENST00000289081.3	37	CCDS35071.1	.	.	.	.	.	.	.	.	.	.	G	18.54	3.646340	0.67358	.	.	ENSG00000158169	ENST00000289081;ENST00000375305;ENST00000433829	T;T;T	0.55234	0.53;0.53;0.53	5.34	5.34	0.76211	.	0.141425	0.46145	D	0.000319	T	0.68155	0.2970	M	0.66939	2.045	0.34530	D	0.709147	D;D	0.71674	0.998;0.992	D;D	0.69307	0.963;0.939	T	0.76534	-0.2924	10	0.66056	D	0.02	-20.3743	12.6663	0.56844	0.0:0.1783:0.8217:0.0	.	150;150	B1ALR7;Q00597	.;FANCC_HUMAN	I	150	ENSP00000289081:L150I;ENSP00000364454:L150I;ENSP00000406908:L150I	ENSP00000289081:L150I	L	-	1	0	FANCC	96974148	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	1.925000	0.40074	2.937000	0.99478	0.650000	0.86243	CTT	.		0.323	FANCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053219.1	NM_000136	
KLHL31	401265	hgsc.bcm.edu	37	6	53519311	53519311	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr6:53519311G>T	ENST00000407079.1	-	1	759	c.760C>A	c.(760-762)Ctt>Att	p.L254I	KLHL31_ENST00000370905.3_Missense_Mutation_p.L254I			Q9H511	KLH31_HUMAN	kelch-like family member 31	254	BACK.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)			p.L254I(1)		autonomic_ganglia(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(3)	20	Lung NSC(77;0.0158)					TTGCTCAAAAGATCTGCAGCG	0.388																																					p.L254I		.											KLHL31,NS,carcinoma,0,1	KLHL31	0	1	Substitution - Missense(1)	lung(1)	c.C760A						.						134.0	129.0	131.0					6																	53519311		2203	4300	6503	SO:0001583	missense	401265	exon2			TCAAAAGATCTGC		CCDS34478.1	6p12.1	2013-09-27	2013-02-22	2007-01-09	ENSG00000124743	ENSG00000124743		"""Kelch-like"", ""BTB/POZ domain containing"""	21353	protein-coding gene	gene with protein product		610749	"""kelch repeat and BTB (POZ) domain containing 1"", ""kelch-like 31 (Drosophila)"""	KBTBD1			Standard	NM_001003760		Approved	bA345L23.2, BKLHD6	uc003pcb.4	Q9H511	OTTHUMG00000014882	ENST00000407079.1:c.760C>A	6.37:g.53519311G>T	ENSP00000384644:p.Leu254Ile	60	0		43	2	NM_001003760	A6N9J2|B2RP49	Missense_Mutation	SNP	ENST00000407079.1	37	CCDS34478.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.342623	0.82022	.	.	ENSG00000124743	ENST00000370905;ENST00000407079	T;T	0.72051	-0.62;-0.62	5.82	5.82	0.92795	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	T	0.79155	0.4398	M	0.71581	2.175	0.80722	D	1	D	0.63046	0.992	P	0.58077	0.832	T	0.80259	-0.1457	10	0.72032	D	0.01	.	20.093	0.97828	0.0:0.0:1.0:0.0	.	254	Q9H511	KLH31_HUMAN	I	254	ENSP00000359942:L254I;ENSP00000384644:L254I	ENSP00000359942:L254I	L	-	1	0	KLHL31	53627270	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.869000	0.99810	2.756000	0.94617	0.561000	0.74099	CTT	.		0.388	KLHL31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040965.1	NM_001003760	
PNN	5411	hgsc.bcm.edu	37	14	39645733	39645733	+	Missense_Mutation	SNP	G	G	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr14:39645733G>A	ENST00000216832.4	+	3	255	c.188G>A	c.(187-189)cGt>cAt	p.R63H	RP11-407N17.4_ENST00000556537.1_lincRNA|PNN_ENST00000556530.1_Missense_Mutation_p.R63H|PNN_ENST00000553331.1_Missense_Mutation_p.R63H	NM_002687.3	NP_002678	Q9H307	PININ_HUMAN	pinin, desmosome associated protein	63	Necessary for interaction with RNPS1.|Necessary for interactions with KRT8, KRT18 and KRT19.|Necessary for mediating alternative 5' splicing.				cell adhesion (GO:0007155)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(2)|stomach(1)	27	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0119)		AATTTCAGGCGTGGATTCTCA	0.373																																					p.R63H		.											.	.	.	0			c.G188A						.						78.0	79.0	78.0					14																	39645733		2203	4300	6503	SO:0001583	missense	5411	exon3			TCAGGCGTGGATT	U77718	CCDS9671.1	14q21.1	2010-07-02			ENSG00000100941	ENSG00000100941			9162	protein-coding gene	gene with protein product		603154				8922384	Standard	NM_002687		Approved	memA	uc001wuw.4	Q9H307	OTTHUMG00000028821	ENST00000216832.4:c.188G>A	14.37:g.39645733G>A	ENSP00000216832:p.Arg63His	84	0		78	3	NM_002687	B4DZX8|O60899|Q53EM7|Q6P5X4|Q7KYL1|Q99738|Q9UHZ9|Q9UQR9	Missense_Mutation	SNP	ENST00000216832.4	37	CCDS9671.1	.	.	.	.	.	.	.	.	.	.	G	33	5.249053	0.95305	.	.	ENSG00000100941	ENST00000553331;ENST00000216832;ENST00000556530	T	0.37235	1.21	5.46	5.46	0.80206	Pinin/SDK (2);	0.000000	0.85682	D	0.000000	T	0.59101	0.2169	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.60037	-0.7341	10	0.66056	D	0.02	-7.8952	18.9328	0.92572	0.0:0.0:1.0:0.0	.	63	Q9H307	PININ_HUMAN	H	63	ENSP00000216832:R63H	ENSP00000216832:R63H	R	+	2	0	PNN	38715484	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	8.582000	0.90791	2.565000	0.86533	0.655000	0.94253	CGT	.		0.373	PNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276776.2	NM_002687	
ZNF432	9668	hgsc.bcm.edu;bcgsc.ca	37	19	52538068	52538068	+	Silent	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr19:52538068G>T	ENST00000594154.1	-	5	1076	c.864C>A	c.(862-864)ccC>ccA	p.P288P	ZNF432_ENST00000221315.5_Silent_p.P288P			O94892	ZN432_HUMAN	zinc finger protein 432	288					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	29		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.0054)|OV - Ovarian serous cystadenocarcinoma(262;0.0182)		TGCATATGTAGGGTTTCTCTC	0.383																																					p.P288P		.											.	.	.	0			c.C864A						.						95.0	95.0	95.0					19																	52538068		2203	4300	6503	SO:0001819	synonymous_variant	9668	exon5			TATGTAGGGTTTC	AB018341	CCDS12848.1	19q13.41	2013-01-08				ENSG00000256087		"""Zinc fingers, C2H2-type"", ""-"""	20810	protein-coding gene	gene with protein product						9872452	Standard	NM_014650		Approved	KIAA0798	uc002pyk.3	O94892		ENST00000594154.1:c.864C>A	19.37:g.52538068G>T		36	0		34	4	NM_014650		Silent	SNP	ENST00000594154.1	37	CCDS12848.1																																																																																			.		0.383	ZNF432-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462410.1	NM_014650	
TBX20	57057	hgsc.bcm.edu	37	7	35271118	35271118	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr7:35271118C>A	ENST00000408931.3	-	6	1414	c.888G>T	c.(886-888)gaG>gaT	p.E296D		NM_001077653.2|NM_001166220.1	NP_001071121.1|NP_001159692.1	Q9UMR3	TBX20_HUMAN	T-box 20	296					aortic valve morphogenesis (GO:0003180)|atrial septum morphogenesis (GO:0060413)|blood circulation (GO:0008015)|cardiac chamber formation (GO:0003207)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|dorsal/ventral pattern formation (GO:0009953)|embryonic heart tube elongation (GO:0036306)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion formation (GO:0003272)|endocardial cushion morphogenesis (GO:0003203)|endoderm formation (GO:0001706)|foramen ovale closure (GO:0035922)|heart looping (GO:0001947)|lateral mesoderm formation (GO:0048370)|muscle contraction (GO:0006936)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|outflow tract septum morphogenesis (GO:0003148)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve formation (GO:0003193)|pulmonary vein morphogenesis (GO:0060577)|tricuspid valve development (GO:0003175)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E296D(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(9)|prostate(1)|skin(1)|stomach(1)	18						CTCATTACCTCTCAATGTCAG	0.403																																					p.E296D		.											TBX20_ENST00000408931,colon,carcinoma,-1,1	TBX20_ENST00000408931	-1	1	Substitution - Missense(1)	central_nervous_system(1)	c.G888T						.						72.0	65.0	67.0					7																	35271118		2203	4300	6503	SO:0001583	missense	57057	exon6			TTACCTCTCAATG	AJ237589	CCDS43568.1	7p14.3	2014-09-17			ENSG00000164532	ENSG00000164532		"""T-boxes"""	11598	protein-coding gene	gene with protein product		606061				10936053	Standard	NM_001077653		Approved		uc011kas.2	Q9UMR3	OTTHUMG00000099411	ENST00000408931.3:c.888G>T	7.37:g.35271118C>A	ENSP00000386170:p.Glu296Asp	54	0		72	3	NM_001077653	A4D1Y6|Q000T4|Q0IJ70|Q0VAS1|Q9Y2N5	Missense_Mutation	SNP	ENST00000408931.3	37	CCDS43568.1	.	.	.	.	.	.	.	.	.	.	C	15.22	2.769369	0.49680	.	.	ENSG00000164532	ENST00000408931	D	0.88741	-2.42	5.46	4.39	0.52855	.	0.046709	0.85682	D	0.000000	D	0.82495	0.5049	N	0.24115	0.695	0.58432	D	0.999995	B	0.30033	0.266	B	0.35039	0.194	T	0.78783	-0.2069	10	0.22706	T	0.39	.	15.1133	0.72375	0.0:0.92:0.0:0.08	.	296	Q9UMR3	TBX20_HUMAN	D	296	ENSP00000386170:E296D	ENSP00000386170:E296D	E	-	3	2	TBX20	35237643	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.077000	0.57598	2.554000	0.86153	0.511000	0.50034	GAG	.		0.403	TBX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216870.2	NM_020417	
ARHGAP35	2909	hgsc.bcm.edu	37	19	47423517	47423517	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr19:47423517C>A	ENST00000404338.3	+	1	1585	c.1585C>A	c.(1585-1587)Cga>Aga	p.R529R		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	529	FF 4.				axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)	p.R529*(2)									AGAGGAACAGCGATTTAAAGC	0.443																																					p.R529R		.											GRLF1_ENST00000317082,bladder,carcinoma,0,6	GRLF1_ENST00000317082	0	2	Substitution - Nonsense(2)	lung(2)	c.C1585A						.						157.0	153.0	155.0					19																	47423517		1968	4152	6120	SO:0001819	synonymous_variant	2909	exon1			GAACAGCGATTTA	M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.1585C>A	19.37:g.47423517C>A		36	0		41	2	NM_004491	A7E2A4|Q14452|Q9C0E1	Silent	SNP	ENST00000404338.3	37	CCDS46127.1																																																																																			.		0.443	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466652.1	NM_004491	
OR2M1P	388762	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	248285660	248285660	+	IGR	SNP	C	C	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:248285660C>T								OR2L13 (21436 upstream) : OR2M5 (22789 downstream)																							AATTTGTAGACTTATGACTGC	0.448																																					.		.											.	.	.	0			.						.																																			SO:0001628	intergenic_variant	388762	.			TGTAGACTTATGA																													1.37:g.248285660C>T		88	0		57	28	.		RNA	SNP		37																																																																																				.	0	0.448								
DFNB59	494513	hgsc.bcm.edu	37	2	179325879	179325879	+	Nonsense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr2:179325879G>T	ENST00000409117.3	+	7	1293	c.937G>T	c.(937-939)Gga>Tga	p.G313*	DFNB59_ENST00000375129.4_Nonsense_Mutation_p.G313*	NM_001042702.3	NP_001036167.1	Q0ZLH3	PJVK_HUMAN	deafness, autosomal recessive 59	313					sensory perception of sound (GO:0007605)	neuronal cell body (GO:0043025)				breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)			CATACTCTGTGGAATGGGGAA	0.418																																					p.G313X		.											DFNB59,NS,carcinoma,0,1	DFNB59	0	0			c.G937T						.						186.0	170.0	175.0					2																	179325879		1857	4113	5970	SO:0001587	stop_gained	494513	exon7			CTCTGTGGAATGG	BC020859, BQ887979	CCDS42787.1	2q31.2	2011-07-01			ENSG00000204311	ENSG00000204311			29502	protein-coding gene	gene with protein product		610219				16804542	Standard	NM_001042702		Approved	pejvakin	uc002umi.4	Q0ZLH3	OTTHUMG00000154425	ENST00000409117.3:c.937G>T	2.37:g.179325879G>T	ENSP00000386647:p.Gly313*	60	0		48	2	NM_001042702	A0PK14|B9EJE2	Nonsense_Mutation	SNP	ENST00000409117.3	37	CCDS42787.1	.	.	.	.	.	.	.	.	.	.	G	34	5.375129	0.95923	.	.	ENSG00000204311	ENST00000409117;ENST00000375129	.	.	.	5.77	5.77	0.91146	.	0.000000	0.64402	U	0.000019	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-19.5847	19.978	0.97315	0.0:0.0:1.0:0.0	.	.	.	.	X	313	.	ENSP00000364271:G313X	G	+	1	0	DFNB59	179034125	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.733000	0.93635	0.557000	0.71058	GGA	.		0.418	DFNB59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335160.1		
RACGAP1	29127	hgsc.bcm.edu;bcgsc.ca	37	12	50395035	50395035	+	Splice_Site	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr12:50395035G>T	ENST00000427314.2	-	9	773	c.550C>A	c.(550-552)Cgc>Agc	p.R184S	RACGAP1_ENST00000434422.1_Splice_Site_p.R184S|RACGAP1_ENST00000454520.2_Splice_Site_p.R184S|RACGAP1_ENST00000547061.1_5'UTR|RACGAP1_ENST00000551016.1_Splice_Site_p.R184S|RACGAP1_ENST00000547905.1_Splice_Site_p.R184S|RACGAP1_ENST00000312377.5_Splice_Site_p.R184S	NM_013277.3	NP_037409.2			Rac GTPase activating protein 1											cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(6)	14						CTAGTAGAGCGCTAGAAAGGA	0.458																																					p.R184S		.											RACGAP1,NS,carcinoma,0,1	RACGAP1	0	0			c.C550A						.						55.0	56.0	56.0					12																	50395035		2203	4300	6503	SO:0001630	splice_region_variant	29127	exon9			TAGAGCGCTAGAA		CCDS8795.1	12q13	2004-05-17				ENSG00000161800			9804	protein-coding gene	gene with protein product		604980				9497316	Standard	NM_013277		Approved	MgcRacGAP	uc001rvs.2	Q9H0H5		ENST00000427314.2:c.550-1C>A	12.37:g.50395035G>T		44	0		51	4	NM_013277		Missense_Mutation	SNP	ENST00000427314.2	37	CCDS8795.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.689722	0.88735	.	.	ENSG00000161800	ENST00000427314;ENST00000312377;ENST00000434422;ENST00000454520;ENST00000551016;ENST00000547905;ENST00000552310;ENST00000550149;ENST00000546786;ENST00000546595	T;T;T;T;T;T;T;T;T;T	0.70869	-0.52;-0.52;-0.52;-0.52;-0.52;-0.52;-0.52;-0.52;-0.52;-0.52	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.77164	0.4090	M	0.78637	2.42	0.80722	D	1	D	0.54772	0.968	P	0.48063	0.565	T	0.76737	-0.2849	10	0.33940	T	0.23	-7.9015	18.2003	0.89836	0.0:0.0:1.0:0.0	.	184	Q9H0H5	RGAP1_HUMAN	S	184;184;184;184;184;184;184;110;110;126	ENSP00000404190:R184S;ENSP00000309871:R184S;ENSP00000413241:R184S;ENSP00000404808:R184S;ENSP00000449374:R184S;ENSP00000449370:R184S;ENSP00000448697:R184S;ENSP00000446642:R110S;ENSP00000447429:R110S;ENSP00000449963:R126S	ENSP00000309871:R184S	R	-	1	0	RACGAP1	48681302	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	6.961000	0.76042	2.718000	0.92993	0.655000	0.94253	CGC	.		0.458	RACGAP1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405997.1	NM_013277	Missense_Mutation
DENND4A	10260	hgsc.bcm.edu	37	15	65983620	65983620	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr15:65983620C>A	ENST00000431932.2	-	22	3388	c.3180G>T	c.(3178-3180)ttG>ttT	p.L1060F	DENND4A_ENST00000567323.1_5'Flank|DENND4A_ENST00000443035.3_Missense_Mutation_p.L1103F	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	1060					positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						CATCAGCTCCCAATTTTTCAA	0.388																																					p.L1103F		.											.	.	.	0			c.G3309T						.						49.0	45.0	46.0					15																	65983620		1810	4063	5873	SO:0001583	missense	10260	exon23			AGCTCCCAATTTT	AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.3180G>T	15.37:g.65983620C>A	ENSP00000396830:p.Leu1060Phe	38	0		35	4	NM_001144823	E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Missense_Mutation	SNP	ENST00000431932.2	37	CCDS45285.1	.	.	.	.	.	.	.	.	.	.	C	14.60	2.584032	0.46110	.	.	ENSG00000174485	ENST00000443035;ENST00000431932	T;T	0.09445	3.07;2.98	5.33	-0.00268	0.14028	.	0.481200	0.17793	N	0.161825	T	0.15825	0.0381	L	0.44542	1.39	0.44976	D	0.997997	D;D	0.76494	0.997;0.999	D;D	0.66716	0.916;0.946	T	0.28073	-1.0055	10	0.62326	D	0.03	.	1.0519	0.01582	0.2345:0.3125:0.1202:0.3328	.	1103;1060	E7EPL3;Q7Z401	.;MYCPP_HUMAN	F	1103;1060	ENSP00000391167:L1103F;ENSP00000396830:L1060F	ENSP00000396830:L1060F	L	-	3	2	DENND4A	63770674	0.906000	0.30813	0.993000	0.49108	0.737000	0.42083	-0.115000	0.10741	0.034000	0.15491	-0.253000	0.11424	TTG	.		0.388	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419611.1	NM_005848	
BMP6	654	hgsc.bcm.edu;ucsc.edu	37	6	7881499	7881499	+	3'UTR	SNP	T	T	C			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr6:7881499T>C	ENST00000283147.6	+	0	2624				TXNDC5_ENST00000539054.1_3'UTR	NM_001718.4	NP_001709.1	P22004	BMP6_HUMAN	bone morphogenetic protein 6						BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular response to mechanical stimulus (GO:0071260)|endochondral ossification (GO:0001958)|eye development (GO:0001654)|growth (GO:0040007)|immune response (GO:0006955)|inflammatory response (GO:0006954)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|osteoblast differentiation (GO:0001649)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of bone mineralization (GO:0030501)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to activity (GO:0014823)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to retinoic acid (GO:0032526)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|type B pancreatic cell development (GO:0003323)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)|protein heterodimerization activity (GO:0046982)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	23	Ovarian(93;0.0721)					GTTAGGGGGATGAGCATGCTG	0.378																																					.		.											.	.	.	0			.						.																																			SO:0001624	3_prime_UTR_variant	100526836	.			GGGGGATGAGCAT	AF083030	CCDS4503.1	6p24-p23	2014-01-30	2003-10-06		ENSG00000153162	ENSG00000153162		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1073	protein-coding gene	gene with protein product		112266	"""vegetal related growth factor (TGFB-related)"""	VGR		1427904, 1453478	Standard	NM_001718		Approved	VGR1	uc003mxu.4	P22004	OTTHUMG00000014217	ENST00000283147.6:c.*923T>C	6.37:g.7881499T>C		64	0		62	24	.	Q5TCP3	RNA	SNP	ENST00000283147.6	37	CCDS4503.1																																																																																			.		0.378	BMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039794.1	NM_001718	
PTPN4	5775	hgsc.bcm.edu	37	2	120684190	120684190	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr2:120684190C>A	ENST00000263708.2	+	13	1789	c.1018C>A	c.(1018-1020)Caa>Aaa	p.Q340K		NM_002830.3	NP_002821.1	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)	340					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)	p.Q340*(1)		endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|urinary_tract(1)	30					Alendronate(DB00630)	AACTGAAGTCCAATCAGTTCA	0.299																																					p.Q340K		.											PTPN4,NS,carcinoma,0,1	PTPN4	0	1	Substitution - Nonsense(1)	lung(1)	c.C1018A						.						105.0	114.0	111.0					2																	120684190		2203	4298	6501	SO:0001583	missense	5775	exon13			GAAGTCCAATCAG		CCDS2129.1	2q14.2	2011-06-09			ENSG00000088179	ENSG00000088179		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9656	protein-coding gene	gene with protein product		176878				1648233	Standard	NM_002830		Approved	PTPMEG	uc002tmf.2	P29074	OTTHUMG00000131436	ENST00000263708.2:c.1018C>A	2.37:g.120684190C>A	ENSP00000263708:p.Gln340Lys	58	0		58	3	NM_002830	B2RBV8|Q9UDA7	Missense_Mutation	SNP	ENST00000263708.2	37	CCDS2129.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.324151	0.81580	.	.	ENSG00000088179	ENST00000263708	D	0.93307	-3.2	4.75	4.75	0.60458	FERM adjacent (FA) (1);	0.000000	0.85682	D	0.000000	D	0.97056	0.9038	M	0.89095	3.005	0.80722	D	1	D	0.59357	0.985	D	0.67103	0.949	D	0.97489	1.0052	10	0.62326	D	0.03	.	18.2932	0.90137	0.0:1.0:0.0:0.0	.	340	P29074	PTN4_HUMAN	K	340	ENSP00000263708:Q340K	ENSP00000263708:Q340K	Q	+	1	0	PTPN4	120400660	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.701000	0.74624	2.602000	0.87976	0.591000	0.81541	CAA	.		0.299	PTPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254233.2		
GBF1	8729	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	104117876	104117876	+	Missense_Mutation	SNP	G	G	A	rs369887575		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr10:104117876G>A	ENST00000369983.3	+	9	980	c.720G>A	c.(718-720)atG>atA	p.M240I		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	240					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		CACGCCATATGACCAAAGTCA	0.502																																					p.M240I		.											.	.	.	0			c.G720A						.	G	ILE/MET,ILE/MET,ILE/MET	0,4406		0,0,2203	194.0	192.0	193.0		720,720,720	2.9	1.0	10		193	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	GBF1	NM_001199378.1,NM_001199379.1,NM_004193.2	10,10,10	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign	240/1857,240/1856,240/1860	104117876	1,13005	2203	4300	6503	SO:0001583	missense	8729	exon9			CCATATGACCAAA	D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.720G>A	10.37:g.104117876G>A	ENSP00000359000:p.Met240Ile	38	0		36	5	NM_001199378	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Missense_Mutation	SNP	ENST00000369983.3	37	CCDS7533.1	.	.	.	.	.	.	.	.	.	.	G	11.48	1.651735	0.29336	0.0	1.16E-4	ENSG00000107862	ENST00000369983	T	0.09255	3.0	5.92	2.93	0.34026	.	0.373318	0.35151	N	0.003406	T	0.05181	0.0138	N	0.19112	0.55	0.26792	N	0.96939	B;B;B;B	0.09022	0.0;0.0;0.002;0.001	B;B;B;B	0.11329	0.0;0.0;0.004;0.006	T	0.30621	-0.9972	10	0.29301	T	0.29	-1.1472	0.3824	0.00397	0.2185:0.2066:0.2977:0.2772	.	240;240;240;240	Q149P1;Q149P0;Q92538;Q504U7	.;.;GBF1_HUMAN;.	I	240	ENSP00000359000:M240I	ENSP00000359000:M240I	M	+	3	0	GBF1	104107866	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.762000	0.38451	0.807000	0.34208	0.555000	0.69702	ATG	.		0.502	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050051.1		
CSF1	1435	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	110458281	110458281	+	Missense_Mutation	SNP	G	G	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:110458281G>A	ENST00000329608.6	+	3	579	c.188G>A	c.(187-189)tGc>tAc	p.C63Y	CSF1_ENST00000526001.1_3'UTR|CSF1_ENST00000369801.1_Missense_Mutation_p.C63Y|CSF1_ENST00000369802.3_Missense_Mutation_p.C63Y|CSF1_ENST00000420111.2_Missense_Mutation_p.C63Y|CSF1_ENST00000344188.5_Missense_Mutation_p.C63Y	NM_000757.5|NM_172211.3	NP_000748|NP_757350.1	P09603	CSF1_HUMAN	colony stimulating factor 1 (macrophage)	63					branching involved in mammary gland duct morphogenesis (GO:0060444)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|developmental process involved in reproduction (GO:0003006)|hemopoiesis (GO:0030097)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary duct terminal end bud growth (GO:0060763)|mammary gland fat development (GO:0060611)|monocyte activation (GO:0042117)|odontogenesis (GO:0042476)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|osteoclast proliferation (GO:0002158)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of monocyte differentiation (GO:0045657)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of macrophage derived foam cell differentiation (GO:0010743)|regulation of ossification (GO:0030278)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|macrophage colony-stimulating factor receptor binding (GO:0005157)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	20		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Acute lymphoblastic leukemia(138;0.204)		Lung(183;0.0238)|Colorectal(144;0.112)|all cancers(265;0.117)|Epithelial(280;0.127)|LUSC - Lung squamous cell carcinoma(189;0.135)		GAGACCTCGTGCCAAATTACA	0.493																																					p.C63Y		.											.	.	.	0			c.G188A						.						184.0	159.0	168.0					1																	110458281		2203	4300	6503	SO:0001583	missense	1435	exon3			CCTCGTGCCAAAT	BC021117	CCDS816.1, CCDS817.1, CCDS30797.1	1p13.3	2012-09-20			ENSG00000184371	ENSG00000184371			2432	protein-coding gene	gene with protein product		120420				1540160	Standard	NM_172210		Approved	M-CSF, MCSF, MGC31930	uc001dyw.4	P09603	OTTHUMG00000011646	ENST00000329608.6:c.188G>A	1.37:g.110458281G>A	ENSP00000327513:p.Cys63Tyr	56	0		72	13	NM_172210	A8K6J5|Q13130|Q14086|Q14806|Q5VVF3|Q5VVF4|Q9UQR8	Missense_Mutation	SNP	ENST00000329608.6	37	CCDS816.1	.	.	.	.	.	.	.	.	.	.	G	11.81	1.750790	0.31046	.	.	ENSG00000184371	ENST00000527192;ENST00000525659;ENST00000357302;ENST00000344188;ENST00000329608;ENST00000488198;ENST00000369802;ENST00000420111;ENST00000369801	T;T;T;T;T;T;T;T;T	0.14391	2.51;2.51;2.51;2.51;2.51;2.51;2.51;2.51;2.51	5.45	4.53	0.55603	Four-helical cytokine-like, core (1);	0.000000	0.85682	D	0.000000	T	0.25232	0.0613	M	0.71581	2.175	0.45995	D	0.998808	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.02728	-1.1118	10	0.66056	D	0.02	.	12.5667	0.56314	0.0:0.1672:0.8328:0.0	.	63;63;63	P09603-3;P09603;P09603-2	.;CSF1_HUMAN;.	Y	70;22;63;63;63;22;63;63;63	ENSP00000434527:C70Y;ENSP00000431547:C22Y;ENSP00000349854:C63Y;ENSP00000342718:C63Y;ENSP00000327513:C63Y;ENSP00000433837:C22Y;ENSP00000358817:C63Y;ENSP00000407317:C63Y;ENSP00000358816:C63Y	ENSP00000327513:C63Y	C	+	2	0	CSF1	110259804	1.000000	0.71417	0.592000	0.28758	0.010000	0.07245	5.059000	0.64306	1.427000	0.47276	-0.315000	0.08773	TGC	.		0.493	CSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032208.1	NM_000757	
GREB1L	80000	hgsc.bcm.edu	37	18	19076555	19076555	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr18:19076555G>T	ENST00000580732.2	+	21	3668	c.3287G>T	c.(3286-3288)gGg>gTg	p.G1096V	GREB1L_ENST00000424526.1_Missense_Mutation_p.G1096V|GREB1L_ENST00000269218.6_Missense_Mutation_p.G987V|GREB1L_ENST00000400483.4_3'UTR			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	1096						integral component of membrane (GO:0016021)		p.G1096V(1)		breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						GACCTCAGCGGGAAGGAGCAG	0.597																																					p.G1096V		.											GREB1L,NS,carcinoma,0,1	GREB1L	0	1	Substitution - Missense(1)	kidney(1)	c.G3287T						.						70.0	73.0	72.0					18																	19076555		692	1591	2283	SO:0001583	missense	80000	exon21			TCAGCGGGAAGGA	AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.3287G>T	18.37:g.19076555G>T	ENSP00000464162:p.Gly1096Val	33	0		38	2	NM_001142966	A4QN17|Q9H8F1	Missense_Mutation	SNP	ENST00000580732.2	37	CCDS45836.1	.	.	.	.	.	.	.	.	.	.	G	16.24	3.067043	0.55539	.	.	ENSG00000141449	ENST00000424526;ENST00000269218	T;T	0.06687	3.27;3.27	5.59	3.53	0.40419	.	0.154112	0.43579	D	0.000559	T	0.05502	0.0145	N	0.19112	0.55	0.80722	D	1	B;B;B	0.30686	0.161;0.29;0.161	B;B;B	0.35413	0.079;0.202;0.116	T	0.35943	-0.9768	10	0.59425	D	0.04	-10.0782	2.6333	0.04951	0.2624:0.2978:0.4398:0.0	.	987;1096;470	Q9C091-3;Q9C091;B4DDS9	.;GRB1L_HUMAN;.	V	1096;987	ENSP00000412060:G1096V;ENSP00000269218:G987V	ENSP00000269218:G987V	G	+	2	0	GREB1L	17330553	1.000000	0.71417	0.998000	0.56505	0.950000	0.60333	6.128000	0.71650	1.327000	0.45338	0.609000	0.83330	GGG	.		0.597	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443782.2	NM_024935	
NEFH	4744	hgsc.bcm.edu	37	22	29885823	29885823	+	Missense_Mutation	SNP	A	A	T	rs145125701		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr22:29885823A>T	ENST00000310624.6	+	4	2227	c.2194A>T	c.(2194-2196)Acc>Tcc	p.T732S		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	738	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AGAAGCAAAGACCCCCGAGAA	0.542																																					p.T732S		.											NEFH,NS,lymphoid_neoplasm,0,2	NEFH	0	0			c.A2194T						.						105.0	109.0	108.0					22																	29885823		2203	4300	6503	SO:0001583	missense	4744	exon4			GCAAAGACCCCCG		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.2194A>T	22.37:g.29885823A>T	ENSP00000311997:p.Thr732Ser	67	0		78	4	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Missense_Mutation	SNP	ENST00000310624.6	37	CCDS13858.1	.	.	.	.	.	.	.	.	.	.	a	0.001	-3.519686	0.00010	.	.	ENSG00000100285	ENST00000328842;ENST00000310624	T	0.80033	-1.33	3.79	0.344	0.16006	.	0.265420	0.27315	N	0.019939	T	0.34803	0.0910	N	0.00185	-1.9	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.50939	-0.8768	10	0.02654	T	1	.	4.2709	0.10785	0.1831:0.1132:0.0:0.7037	.	738	P12036	NFH_HUMAN	S	732	ENSP00000311997:T732S	ENSP00000311997:T732S	T	+	1	0	NEFH	28215823	0.000000	0.05858	0.661000	0.29709	0.007000	0.05969	-2.683000	0.00835	-0.106000	0.12110	-2.653000	0.00148	ACC	.		0.542	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
EDF1	8721	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	139754378	139754378	+	IGR	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr9:139754378C>A	ENST00000224073.1	-	0	640				MAMDC4_ENST00000485732.1_3'UTR|MAMDC4_ENST00000317446.2_Silent_p.G1078G|MAMDC4_ENST00000445819.1_Silent_p.G1157G	NM_003792.2	NP_003783.1	O60869	EDF1_HUMAN	endothelial differentiation-related factor 1						endothelial cell differentiation (GO:0045446)|multicellular organismal development (GO:0007275)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			lung(1)	1	all_cancers(76;0.0841)|all_epithelial(76;0.217)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		CTGTGGTTGGCAGTGCCCTCC	0.637																																					p.G1078G		.											.	.	.	0			c.C3234A						.						65.0	64.0	64.0					9																	139754378		2199	4300	6499	SO:0001628	intergenic_variant	158056	exon26			GGTTGGCAGTGCC	AJ005259	CCDS7011.1, CCDS7012.1, CCDS65193.1	9q34.3	2009-11-06			ENSG00000107223	ENSG00000107223			3164	protein-coding gene	gene with protein product	"""multiprotein bridging factor-1"""	605107				9813014, 15112053	Standard	NM_003792		Approved	EDF-1	uc004cjt.1	O60869	OTTHUMG00000020948		9.37:g.139754378C>A		40	0		32	9	NM_206920	Q5T5T2|Q9UIM1	Silent	SNP	ENST00000224073.1	37	CCDS7011.1	.	.	.	.	.	.	.	.	.	.	.	6.044	0.376501	0.11466	.	.	ENSG00000177943	ENST00000413647	.	.	.	4.77	-9.53	0.00575	.	.	.	.	.	T	0.13500	0.0327	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	T	0.16394	-1.0404	4	.	.	.	-10.9375	0.7988	0.01071	0.1878:0.1984:0.2681:0.3457	.	.	.	.	K	1143	.	.	Q	+	1	0	MAMDC4	138874199	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-2.219000	0.01218	-1.861000	0.01153	-0.258000	0.10820	CAG	.		0.637	EDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055143.1		
PAX6	5080	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	31823198	31823198	+	Missense_Mutation	SNP	A	A	G			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	A	A	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr11:31823198A>G	ENST00000379132.3	-	5	548	c.268T>C	c.(268-270)Tat>Cat	p.Y90H	PAX6_ENST00000379111.2_Missense_Mutation_p.Y90H|PAX6_ENST00000379123.5_Missense_Mutation_p.Y90H|PAX6_ENST00000379115.4_Missense_Mutation_p.Y104H|PAX6_ENST00000241001.8_Missense_Mutation_p.Y90H|PAX6_ENST00000379107.2_Missense_Mutation_p.Y104H|PAX6_ENST00000419022.1_Missense_Mutation_p.Y104H|PAX6_ENST00000533156.1_5'Flank|PAX6_ENST00000379129.2_Missense_Mutation_p.Y104H			P26367	PAX6_HUMAN	paired box 6	90	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				astrocyte differentiation (GO:0048708)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|cerebral cortex regionalization (GO:0021796)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|cornea development in camera-type eye (GO:0061303)|dorsal/ventral axis specification (GO:0009950)|embryonic camera-type eye morphogenesis (GO:0048596)|eye development (GO:0001654)|eye photoreceptor cell development (GO:0042462)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain-midbrain boundary formation (GO:0021905)|glucose homeostasis (GO:0042593)|hindbrain development (GO:0030902)|iris morphogenesis (GO:0061072)|keratinocyte differentiation (GO:0030216)|lacrimal gland development (GO:0032808)|lens development in camera-type eye (GO:0002088)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|neuron migration (GO:0001764)|oligodendrocyte cell fate specification (GO:0021778)|organ morphogenesis (GO:0009887)|pancreatic A cell development (GO:0003322)|pituitary gland development (GO:0021983)|positive regulation of cell fate specification (GO:0042660)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of gene expression (GO:0010628)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to organelle (GO:0033365)|protein ubiquitination (GO:0016567)|regulation of cell migration (GO:0030334)|regulation of timing of cell differentiation (GO:0048505)|regulation of transcription from RNA polymerase II promoter involved in somatic motor neuron fate commitment (GO:0021918)|regulation of transcription from RNA polymerase II promoter involved in spinal cord motor neuron fate specification (GO:0021912)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|salivary gland morphogenesis (GO:0007435)|signal transduction involved in regulation of gene expression (GO:0023019)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell differentiation (GO:0003309)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)	35	Lung SC(675;0.225)					TCCCGCTTATACTGGGCTATT	0.502									Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation																												p.Y104H		.											.	.	.	0			c.T310C						.						97.0	94.0	95.0					11																	31823198		2202	4299	6501	SO:0001583	missense	5080	exon7	Familial Cancer Database	WAGR syndrome	GCTTATACTGGGC	AY707088	CCDS31451.1, CCDS31452.1	11p13	2014-09-17	2007-07-12		ENSG00000007372	ENSG00000007372		"""Paired boxes"", ""Homeoboxes / PRD class"""	8620	protein-coding gene	gene with protein product	"""aniridia, keratitis"""	607108	"""paired box gene 6 (aniridia, keratitis)"""	AN2		1302030	Standard	NM_001127612		Approved	D11S812E, AN, WAGR	uc021qfm.1	P26367	OTTHUMG00000041447	ENST00000379132.3:c.268T>C	11.37:g.31823198A>G	ENSP00000368427:p.Tyr90His	40	0		58	14	NM_001604	Q6N006|Q99413	Missense_Mutation	SNP	ENST00000379132.3	37	CCDS31451.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.377396	0.82682	.	.	ENSG00000007372	ENST00000419022;ENST00000379132;ENST00000379129;ENST00000379107;ENST00000241001;ENST00000379115;ENST00000379111;ENST00000379123;ENST00000379109;ENST00000533333	D;D;D;D;D;D;D;D;D;D	0.99494	-6.01;-6.01;-6.01;-6.01;-6.01;-6.01;-6.01;-6.01;-6.01;-6.01	5.35	5.35	0.76521	Paired box protein, N-terminal (3);Winged helix-turn-helix transcription repressor DNA-binding (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99579	0.9848	M	0.91459	3.21	0.80722	D	1	D;D	0.64830	0.981;0.994	D;D	0.68943	0.917;0.961	D	0.97910	1.0308	10	0.87932	D	0	.	15.3268	0.74172	1.0:0.0:0.0:0.0	.	104;90	F1T0F8;P26367	.;PAX6_HUMAN	H	104;90;104;104;90;104;90;90;90;45	ENSP00000404100:Y104H;ENSP00000368427:Y90H;ENSP00000368424:Y104H;ENSP00000368401:Y104H;ENSP00000241001:Y90H;ENSP00000368410:Y104H;ENSP00000368406:Y90H;ENSP00000368418:Y90H;ENSP00000368403:Y90H;ENSP00000451372:Y45H	ENSP00000241001:Y90H	Y	-	1	0	PAX6	31779774	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.297000	0.96120	2.013000	0.59113	0.528000	0.53228	TAT	.		0.502	PAX6-008	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000099293.4	NM_001604	
CFAP74	85452	hgsc.bcm.edu	37	1	1887065	1887065	+	IGR	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:1887065C>A								TMEM52 (36353 upstream) : C1orf222 (32497 downstream)																							CCTCAGCCCCCTGGAATGCTG	0.597																																					p.Q747H		.											KIAA1751,colon,carcinoma,0,1	KIAA1751	0	0			c.G2241T						.						60.0	66.0	64.0					1																	1887065		1917	4100	6017	SO:0001628	intergenic_variant	85452	exon18			AGCCCCCTGGAAT																													1.37:g.1887065C>A		47	0		41	2	NM_001080484		Missense_Mutation	SNP		37		.	.	.	.	.	.	.	.	.	.	C	9.902	1.207117	0.22205	.	.	ENSG00000142609	ENST00000270720	.	.	.	1.45	1.45	0.22620	.	1.015600	0.07994	U	0.987606	T	0.17023	0.0409	N	0.14661	0.345	0.18873	N	0.999984	D	0.53885	0.963	B	0.39706	0.307	T	0.15694	-1.0428	9	0.87932	D	0	.	6.2966	0.21089	0.0:1.0:0.0:0.0	.	747	Q9C0B2	K1751_HUMAN	H	747	.	ENSP00000270720:Q747H	Q	-	3	2	C1orf222	1876925	0.003000	0.15002	0.011000	0.14972	0.168000	0.22595	0.202000	0.17295	1.097000	0.41459	0.462000	0.41574	CAG	.	0	0.597								
C9orf131	138724	hgsc.bcm.edu	37	9	35043842	35043842	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr9:35043842G>T	ENST00000312292.5	+	2	1263	c.1216G>T	c.(1216-1218)Gat>Tat	p.D406Y	C9orf131_ENST00000354479.5_Missense_Mutation_p.D333Y|C9orf131_ENST00000421362.2_Missense_Mutation_p.D358Y|FLJ00273_ENST00000595331.1_5'Flank	NM_001040410.1|NM_203299.2	NP_001035500.1|NP_976044.2	Q5VYM1	CI131_HUMAN	chromosome 9 open reading frame 131	406										cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(23)|prostate(2)|skin(2)|stomach(1)	39	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			TTCCCTGGAAGATCCATCCAG	0.537																																					p.D406Y		.											C9orf131,NS,carcinoma,0,1	C9orf131	0	0			c.G1216T						.						74.0	83.0	80.0					9																	35043842		2203	4300	6503	SO:0001583	missense	138724	exon2			CTGGAAGATCCAT	BC045643	CCDS6572.2, CCDS47961.1, CCDS47962.1	9p13.3	2008-02-05			ENSG00000174038	ENSG00000174038			31418	protein-coding gene	gene with protein product							Standard	NM_001287391		Approved	MGC41945	uc003zvw.3	Q5VYM1	OTTHUMG00000019853	ENST00000312292.5:c.1216G>T	9.37:g.35043842G>T	ENSP00000308279:p.Asp406Tyr	49	0		35	2	NM_203299	A6NLE6|E9PB26|Q86XC6|Q9UF74	Missense_Mutation	SNP	ENST00000312292.5	37	CCDS6572.2	.	.	.	.	.	.	.	.	.	.	G	13.26	2.183346	0.38511	.	.	ENSG00000174038	ENST00000421362;ENST00000354479;ENST00000312292	T;T;T	0.19105	2.17;2.17;2.18	4.37	1.45	0.22620	.	0.433346	0.19683	N	0.108473	T	0.17365	0.0417	L	0.49778	1.585	0.09310	N	1	B;B;B	0.12013	0.005;0.005;0.005	B;B;B	0.17433	0.018;0.018;0.018	T	0.20672	-1.0268	10	0.66056	D	0.02	-0.2828	5.6382	0.17548	0.1883:0.0:0.653:0.1587	.	406;333;358	Q5VYM1;A6NLE6;E9PB26	CI131_HUMAN;.;.	Y	358;333;406	ENSP00000393683:D358Y;ENSP00000346472:D333Y;ENSP00000308279:D406Y	ENSP00000308279:D406Y	D	+	1	0	C9orf131	35033842	0.061000	0.20836	0.008000	0.14137	0.075000	0.17131	0.590000	0.23954	0.212000	0.20703	-2.067000	0.00394	GAT	.		0.537	C9orf131-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052283.5	NM_203299	
GPR133	283383	hgsc.bcm.edu;bcgsc.ca	37	12	131476787	131476787	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr12:131476787C>A	ENST00000261654.5	+	8	1375	c.816C>A	c.(814-816)ccC>ccA	p.P272P	GPR133_ENST00000535015.1_Silent_p.P304P|RP11-76C10.5_ENST00000542980.1_lincRNA	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	272					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		TTCAGATGCCCACAGATGCCT	0.398																																					p.P272P		.											.	.	.	0			c.C816A						.						178.0	196.0	190.0					12																	131476787		2203	4300	6503	SO:0001819	synonymous_variant	283383	exon8			GATGCCCACAGAT	AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.816C>A	12.37:g.131476787C>A		58	0		85	4	NM_198827	B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Silent	SNP	ENST00000261654.5	37	CCDS9272.1																																																																																			.		0.398	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	NM_198827	
XKR4	114786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	56015537	56015537	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr8:56015537C>A	ENST00000327381.6	+	1	589	c.489C>A	c.(487-489)agC>agA	p.S163R		NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	163						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			AAGTGTTCAGCTTCCGCTGGT	0.652																																					p.S163R		.											.	.	.	0			c.C489A						.						50.0	35.0	40.0					8																	56015537		2202	4299	6501	SO:0001583	missense	114786	exon1			GTTCAGCTTCCGC	AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.489C>A	8.37:g.56015537C>A	ENSP00000328326:p.Ser163Arg	24	0		20	6	NM_052898	Q96PZ8	Missense_Mutation	SNP	ENST00000327381.6	37	CCDS34893.1	.	.	.	.	.	.	.	.	.	.	C	15.49	2.848488	0.51164	.	.	ENSG00000206579	ENST00000327381;ENST00000543752	T	0.70516	-0.49	5.48	2.5	0.30297	.	0.218063	0.45867	D	0.000329	T	0.71143	0.3305	M	0.85630	2.765	0.42711	D	0.993646	B	0.15141	0.012	B	0.21917	0.037	T	0.70128	-0.4957	10	0.72032	D	0.01	-22.4931	8.7578	0.34656	0.2692:0.6603:0.0:0.0705	.	163	Q5GH76	XKR4_HUMAN	R	163	ENSP00000328326:S163R	ENSP00000328326:S163R	S	+	3	2	XKR4	56178091	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.705000	0.37867	0.659000	0.30945	0.585000	0.79938	AGC	.		0.652	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378129.2	NM_052898	
SCP2	6342	hgsc.bcm.edu;bcgsc.ca	37	1	53453786	53453786	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:53453786G>T	ENST00000528311.1	+	10	1112	c.816G>T	c.(814-816)aaG>aaT	p.K272N	SCP2_ENST00000371513.5_Missense_Mutation_p.K309N|SCP2_ENST00000371514.3_Missense_Mutation_p.K353N|SCP2_ENST00000371509.4_Missense_Mutation_p.K309N|SCP2_ENST00000407246.2_Missense_Mutation_p.K329N	NM_001193617.1	NP_001180546.1	Q9BX26	SYCP2_HUMAN	sterol carrier protein 2	0					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	15						TGATTTCAAAGGGACACCCAC	0.368																																					p.K353N		.											.	.	.	0			c.G1059T						.						77.0	84.0	81.0					1																	53453786		2203	4300	6503	SO:0001583	missense	6342	exon11			TTCAAAGGGACAC	M75884	CCDS572.1, CCDS30719.1, CCDS41338.1, CCDS44149.1, CCDS44150.1, CCDS53317.1, CCDS53318.1, CCDS53319.1	1p32	2010-08-20			ENSG00000116171	ENSG00000116171			10606	protein-coding gene	gene with protein product		184755				1703300, 1718316	Standard	NM_001007098		Approved		uc001cur.2	P22307	OTTHUMG00000008936	ENST00000528311.1:c.816G>T	1.37:g.53453786G>T	ENSP00000434132:p.Lys272Asn	90	0		67	4	NM_002979	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	ENST00000528311.1	37	CCDS53319.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.185757	0.78789	.	.	ENSG00000116171	ENST00000371514;ENST00000528311;ENST00000371509;ENST00000407246;ENST00000371513	D;D;D;D;D	0.92299	-3.01;-3.01;-3.01;-3.01;-3.01	5.8	3.86	0.44501	Thiolase-like, subgroup (1);Thiolase-like (1);Thiolase, conserved site (1);Thiolase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.95765	0.8622	M	0.88842	2.985	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;0.999	D	0.95298	0.8401	10	0.87932	D	0	-17.9719	7.9599	0.30066	0.2633:0.0:0.7367:0.0	.	329;309;353;309	C9JC79;A6NM69;P22307;Q6NXF4	.;.;NLTP_HUMAN;.	N	353;272;309;329;309	ENSP00000360569:K353N;ENSP00000434132:K272N;ENSP00000360564:K309N;ENSP00000384569:K329N;ENSP00000360568:K309N	ENSP00000360564:K309N	K	+	3	2	SCP2	53226374	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.885000	0.39678	1.358000	0.45922	0.650000	0.86243	AAG	.		0.368	SCP2-010	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387558.1	NM_002979	
PTPRJ	5795	hgsc.bcm.edu;bcgsc.ca	37	11	48168501	48168501	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr11:48168501C>A	ENST00000418331.2	+	15	3337	c.2985C>A	c.(2983-2985)ttC>ttA	p.F995L		NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	995					contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						GCTTCATCTTCTGGAGAAAGA	0.398																																					p.F995L		.											.	.	.	0			c.C2985A						.						270.0	252.0	258.0					11																	48168501		2201	4298	6499	SO:0001583	missense	5795	exon15			CATCTTCTGGAGA	U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.2985C>A	11.37:g.48168501C>A	ENSP00000400010:p.Phe995Leu	67	0		77	4	NM_002843	Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Missense_Mutation	SNP	ENST00000418331.2	37	CCDS7945.1	.	.	.	.	.	.	.	.	.	.	C	14.67	2.605677	0.46527	.	.	ENSG00000149177	ENST00000418331	T	0.12774	2.65	5.37	3.5	0.40072	.	.	.	.	.	T	0.14787	0.0357	M	0.70275	2.135	0.80722	D	1	B	0.21905	0.062	B	0.20767	0.031	T	0.04870	-1.0921	9	0.12103	T	0.63	.	10.0006	0.41927	0.0:0.8338:0.0:0.1662	.	995	Q12913	PTPRJ_HUMAN	L	995	ENSP00000400010:F995L	ENSP00000400010:F995L	F	+	3	2	PTPRJ	48125077	1.000000	0.71417	1.000000	0.80357	0.707000	0.40811	1.857000	0.39399	0.644000	0.30656	0.558000	0.71614	TTC	.		0.398	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390525.1		
NOX5	79400	hgsc.bcm.edu	37	15	69325389	69325389	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr15:69325389C>A	ENST00000388866.3	+	5	668	c.627C>A	c.(625-627)gcC>gcA	p.A209A	NOX5_ENST00000260364.5_Silent_p.A191A|NOX5_ENST00000530406.2_Silent_p.A181A|NOX5_ENST00000455873.3_Silent_p.A174A|NOX5_ENST00000448182.3_Silent_p.A163A	NM_001184779.1|NM_024505.3	NP_001171708.1|NP_078781.3	Q96PH1	NOX5_HUMAN	NADPH oxidase, EF-hand calcium binding domain 5	209					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cytokine secretion (GO:0050663)|cytokinesis (GO:0000910)|endothelial cell proliferation (GO:0001935)|oxidation-reduction process (GO:0055114)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|proton transport (GO:0015992)|regulation of fusion of sperm to egg plasma membrane (GO:0043012)|regulation of proton transport (GO:0010155)|superoxide anion generation (GO:0042554)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|hydrogen ion channel activity (GO:0015252)|NADP binding (GO:0050661)|superoxide-generating NADPH oxidase activity (GO:0016175)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35						GCAGCGCTGCCCACTGGCTGA	0.711																																					p.A209A		.											NOX5,NS,carcinoma,0,1	NOX5	0	0			c.C627A						.						17.0	21.0	20.0					15																	69325389		1304	3023	4327	SO:0001819	synonymous_variant	79400	exon5			CGCTGCCCACTGG	AF317889	CCDS32276.1, CCDS32276.2, CCDS53953.1, CCDS53954.1	15q22.31	2013-01-10			ENSG00000255346	ENSG00000255346		"""EF-hand domain containing"""	14874	protein-coding gene	gene with protein product		606572				11483596	Standard	NM_001184779		Approved	NOX5A, NOX5B	uc002ars.2	Q96PH1	OTTHUMG00000133320	ENST00000388866.3:c.627C>A	15.37:g.69325389C>A		28	0		33	2	NM_024505	B2RBJ4|Q08AN2|Q08AN3|Q8TEQ1|Q8TER4|Q96PH2|Q96PJ8|Q96PJ9|Q9H6E0|Q9HAM8	Silent	SNP	ENST00000388866.3	37	CCDS32276.2																																																																																			.		0.711	NOX5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257124.2	NM_024505	
ZNF208	7757	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	22157097	22157097	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr19:22157097G>T	ENST00000397126.4	-	4	887	c.739C>A	c.(739-741)Cat>Aat	p.H247N	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	247					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				ATTACCTTATGTTTAGTAAGG	0.353																																					p.H247N		.											.	.	.	0			c.C739A						.						36.0	40.0	39.0					19																	22157097		2107	4235	6342	SO:0001583	missense	7757	exon4			CCTTATGTTTAGT	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.739C>A	19.37:g.22157097G>T	ENSP00000380315:p.His247Asn	36	0		46	24	NM_007153		Missense_Mutation	SNP	ENST00000397126.4	37	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	G	13.06	2.124115	0.37533	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	D	0.86865	-2.18	2.93	1.85	0.25348	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.89339	0.6687	.	.	.	0.09310	N	1	P	0.51791	0.948	P	0.55615	0.78	T	0.79845	-0.1631	8	0.66056	D	0.02	.	8.6631	0.34103	0.1255:0.0:0.8745:0.0	.	247	O43345	ZN208_HUMAN	N	247	ENSP00000380315:H247N	ENSP00000380315:H247N	H	-	1	0	ZNF208	21948937	0.998000	0.40836	0.001000	0.08648	0.008000	0.06430	4.939000	0.63526	0.214000	0.20742	0.313000	0.20887	CAT	.		0.353	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
SDK2	54549	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	71334731	71334731	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr17:71334731C>A	ENST00000392650.3	-	45	6514	c.6514G>T	c.(6514-6516)Gtt>Ttt	p.V2172F	SDK2_ENST00000410094.1_5'UTR|SDK2_ENST00000388726.3_Missense_Mutation_p.V2153F	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	2172					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						TGATGTCAAACAAATGATGAA	0.542																																					p.V2172F		.											.	.	.	0			c.G6514T						.						17.0	18.0	18.0					17																	71334731		2193	4274	6467	SO:0001583	missense	54549	exon45			GTCAAACAAATGA	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.6514G>T	17.37:g.71334731C>A	ENSP00000376421:p.Val2172Phe	31	0		47	15	NM_001144952	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	37	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	C	17.03	3.284125	0.59867	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000410094	T;T;T	0.65732	-0.15;-0.17;0.98	4.62	4.62	0.57501	.	.	.	.	.	T	0.63570	0.2522	N	0.08118	0	0.58432	D	0.999998	D;D	0.89917	1.0;0.999	D;D	0.77004	0.989;0.988	T	0.73745	-0.3886	9	0.87932	D	0	.	17.4484	0.87585	0.0:1.0:0.0:0.0	.	2172;2153	Q58EX2;Q58EX2-3	SDK2_HUMAN;.	F	1796;2172;2153;1329;513	ENSP00000376421:V2172F;ENSP00000373378:V2153F;ENSP00000407098:V1329F	ENSP00000373378:V2153F	V	-	1	0	SDK2	68846326	1.000000	0.71417	0.924000	0.36721	0.229000	0.25112	7.046000	0.76592	2.273000	0.75805	0.557000	0.71058	GTT	.		0.542	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064	
FIGNL1	63979	hgsc.bcm.edu;bcgsc.ca	37	7	50513283	50513283	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr7:50513283G>T	ENST00000419119.1	-	2	3256	c.1703C>A	c.(1702-1704)cCa>cAa	p.P568Q	FIGNL1_ENST00000395556.2_Missense_Mutation_p.P568Q|FIGNL1_ENST00000356889.4_Missense_Mutation_p.P568Q|FIGNL1_ENST00000433017.1_Missense_Mutation_p.P568Q			Q6PIW4	FIGL1_HUMAN	fidgetin-like 1	568					ATP metabolic process (GO:0046034)|cellular response to ionizing radiation (GO:0071479)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|osteoblast differentiation (GO:0001649)|osteoblast proliferation (GO:0033687)|regulation of cell cycle (GO:0051726)|regulation of double-strand break repair via homologous recombination (GO:0010569)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|hydrolase activity (GO:0016787)|magnesium ion binding (GO:0000287)			endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	29	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;3.73e-08)|all_hematologic(4;7.51e-06)				TGAAGCTTCTGGGAGGGGAAT	0.438																																					p.P568Q		.											.	.	.	0			c.C1703A						.						89.0	93.0	92.0					7																	50513283		2203	4300	6503	SO:0001583	missense	63979	exon4			GCTTCTGGGAGGG	AK023142	CCDS5510.1	7p12.2	2010-04-21			ENSG00000132436	ENSG00000132436		"""ATPases / AAA-type"""	13286	protein-coding gene	gene with protein product		615383					Standard	XM_005271783		Approved		uc003tpc.3	Q6PIW4	OTTHUMG00000022866	ENST00000419119.1:c.1703C>A	7.37:g.50513283G>T	ENSP00000410811:p.Pro568Gln	34	0		52	4	NM_001042762	D3DVM6|Q86V18|Q8ND59|Q9H8P1|Q9H917	Missense_Mutation	SNP	ENST00000419119.1	37	CCDS5510.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.689275	0.88735	.	.	ENSG00000132436	ENST00000356889;ENST00000395556;ENST00000433017;ENST00000419119	D;D;D;D	0.99098	-5.42;-5.42;-5.42;-5.42	6.17	6.17	0.99709	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.99691	0.9883	H	0.99182	4.46	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97448	1.0026	10	0.87932	D	0	-11.8311	19.8676	0.96824	0.0:0.0:1.0:0.0	.	568	Q6PIW4	FIGL1_HUMAN	Q	568	ENSP00000349356:P568Q;ENSP00000378924:P568Q;ENSP00000399997:P568Q;ENSP00000410811:P568Q	ENSP00000349356:P568Q	P	-	2	0	FIGNL1	50480777	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.624000	0.98398	2.941000	0.99782	0.655000	0.94253	CCA	.		0.438	FIGNL1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342579.1	NM_001042762	
PTGER4	5734	hgsc.bcm.edu	37	5	40692076	40692076	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr5:40692076C>A	ENST00000302472.3	+	3	2087	c.1063C>A	c.(1063-1065)Cgc>Agc	p.R355S		NM_000958.2	NP_000949.1	P35408	PE2R4_HUMAN	prostaglandin E receptor 4 (subtype EP4)	355					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|bone development (GO:0060348)|cellular response to mechanical stimulus (GO:0071260)|ERK1 and ERK2 cascade (GO:0070371)|immune response (GO:0006955)|JNK cascade (GO:0007254)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of eosinophil extravasation (GO:2000420)|negative regulation of inflammatory response (GO:0050728)|negative regulation of integrin activation (GO:0033624)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of inflammatory response (GO:0050729)|regulation of ossification (GO:0030278)|regulation of stress fiber assembly (GO:0051492)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|T-helper cell differentiation (GO:0042093)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	prostaglandin E receptor activity (GO:0004957)	p.R355S(1)		breast(1)|endometrium(3)|liver(1)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23					Dinoprostone(DB00917)|Misoprostol(DB00929)	TGGCGGGTCCCGCAGGGAGCG	0.547																																					p.R355S		.											PTGER4,NS,neuroblastoma,0,1	PTGER4	0	1	Substitution - Missense(1)	lung(1)	c.C1063A						.						41.0	45.0	44.0					5																	40692076		2203	4300	6503	SO:0001583	missense	5734	exon3			GGGTCCCGCAGGG	L28175	CCDS3930.1	5p13.1	2012-08-08			ENSG00000171522	ENSG00000171522		"""GPCR / Class A : Prostanoid receptors"""	9596	protein-coding gene	gene with protein product		601586				7759114, 8661119	Standard	NM_000958		Approved	EP4	uc003jlz.3	P35408	OTTHUMG00000094769	ENST00000302472.3:c.1063C>A	5.37:g.40692076C>A	ENSP00000302846:p.Arg355Ser	21	0		20	2	NM_000958	Q3MJ87	Missense_Mutation	SNP	ENST00000302472.3	37	CCDS3930.1	.	.	.	.	.	.	.	.	.	.	C	11.40	1.628909	0.28978	.	.	ENSG00000171522	ENST00000302472	T	0.35236	1.32	5.03	3.19	0.36642	.	0.355344	0.30168	N	0.010259	T	0.29458	0.0734	L	0.47716	1.5	0.29072	N	0.883244	B	0.18166	0.026	B	0.16722	0.016	T	0.25187	-1.0139	10	0.07813	T	0.8	-12.0003	15.0255	0.71667	0.0:0.7201:0.2799:0.0	.	355	P35408	PE2R4_HUMAN	S	355	ENSP00000302846:R355S	ENSP00000302846:R355S	R	+	1	0	PTGER4	40727833	0.129000	0.22400	0.013000	0.15412	0.611000	0.37282	0.670000	0.25157	0.656000	0.30886	0.467000	0.42956	CGC	.		0.547	PTGER4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211578.2	NM_000958	
BAP1	8314	hgsc.bcm.edu;bcgsc.ca	37	3	52437805	52437805	+	Silent	SNP	G	G	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr3:52437805G>A	ENST00000460680.1	-	13	1827	c.1356C>T	c.(1354-1356)ctC>ctT	p.L452L	BAP1_ENST00000296288.5_Silent_p.L434L	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		GGGACTCTTTGAGCTTCTCAG	0.592			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.L452L	GBM(101;493 1458 7992 21037 25532)	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	.	.	0			c.C1356T						.						84.0	85.0	85.0					3																	52437805		2203	4300	6503	SO:0001819	synonymous_variant	8314	exon13			CTCTTTGAGCTTC	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1356C>T	3.37:g.52437805G>A		25	0		17	12	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Silent	SNP	ENST00000460680.1	37	CCDS2853.1																																																																																			.		0.592	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
CTPS1	1503	hgsc.bcm.edu	37	1	41450520	41450520	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:41450520G>T	ENST00000372621.4	+	3	702	c.194G>T	c.(193-195)gGg>gTg	p.G65V	CTPS1_ENST00000372616.1_Missense_Mutation_p.G65V|CTPS1_ENST00000543104.1_Missense_Mutation_p.G72V|CTPS1_ENST00000541520.1_Intron	NM_001905.2	NP_001896.2			CTP synthase 1											endometrium(3)|lung(10)	13						GATGATGGTGGGGAAGTAGAC	0.438																																					p.G65V		.											.	.	.	0			c.G194T						.						248.0	236.0	240.0					1																	41450520		2203	4300	6503	SO:0001583	missense	1503	exon3			ATGGTGGGGAAGT	BC009408	CCDS459.1	1p34.1	2012-05-02	2012-05-02	2012-05-02	ENSG00000171793	ENSG00000171793	6.3.4.2		2519	protein-coding gene	gene with protein product		123860	"""CTP synthase"""	CTPS		1783378	Standard	XM_005270536		Approved		uc001cgk.4	P17812	OTTHUMG00000005712	ENST00000372621.4:c.194G>T	1.37:g.41450520G>T	ENSP00000361704:p.Gly65Val	85	0		75	4	NM_001905		Missense_Mutation	SNP	ENST00000372621.4	37	CCDS459.1	.	.	.	.	.	.	.	.	.	.	G	18.09	3.545794	0.65198	.	.	ENSG00000171793	ENST00000372621;ENST00000543104;ENST00000372616	T;T	0.48201	0.82;0.82	5.45	5.45	0.79879	CTP synthase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.78091	0.4229	H	0.94462	3.54	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.79108	0.982;0.992	D	0.84565	0.0652	10	0.87932	D	0	.	17.8595	0.88777	0.0:0.0:1.0:0.0	.	72;65	B7Z9C4;P17812	.;PYRG1_HUMAN	V	65;72;65	ENSP00000361704:G65V;ENSP00000361699:G65V	ENSP00000361699:G65V	G	+	2	0	CTPS	41223107	1.000000	0.71417	0.999000	0.59377	0.123000	0.20343	9.391000	0.97249	2.545000	0.85829	0.650000	0.86243	GGG	.		0.438	CTPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015629.1	NM_001905	
C5orf58	133874	hgsc.bcm.edu;bcgsc.ca	37	5	169661164	169661164	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr5:169661164C>A	ENST00000521850.1	+	1	1714	c.25C>A	c.(25-27)Cct>Act	p.P9T	C5orf58_ENST00000517575.1_Intron|C5orf58_ENST00000593851.1_Missense_Mutation_p.P9T			C9J3I9	CE058_HUMAN	chromosome 5 open reading frame 58	9										large_intestine(1)|lung(4)|urinary_tract(1)	6						AGAAATTCTCCCTGCTCAGGA	0.403																																					p.P9T		.											.	.	.	0			c.C25A						.						122.0	117.0	119.0					5																	169661164		1864	4112	5976	SO:0001583	missense	133874	exon2			ATTCTCCCTGCTC	BC030767	CCDS47338.1	5q35.1	2009-09-30			ENSG00000234511	ENSG00000234511			37272	protein-coding gene	gene with protein product							Standard	NM_001102609		Approved		uc010jjn.3	C9J3I9	OTTHUMG00000163122	ENST00000521850.1:c.25C>A	5.37:g.169661164C>A	ENSP00000428956:p.Pro9Thr	60	0		69	4	NM_001102609		Missense_Mutation	SNP	ENST00000521850.1	37	CCDS47338.1	.	.	.	.	.	.	.	.	.	.	C	8.732	0.916801	0.17907	.	.	ENSG00000234511	ENST00000521850	.	.	.	3.76	-1.88	0.07713	.	.	.	.	.	T	0.17195	0.0413	N	0.14661	0.345	0.09310	N	1	B	0.32160	0.358	B	0.24701	0.055	T	0.14172	-1.0482	8	0.87932	D	0	.	5.7573	0.18180	0.0:0.2702:0.5011:0.2287	.	9	C9J3I9	CE058_HUMAN	T	9	.	ENSP00000428956:P9T	P	+	1	0	C5orf58	169593742	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.700000	0.01905	-0.412000	0.07519	-0.176000	0.13171	CCT	.		0.403	C5orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371739.1	NM_001102609	
ATAD3B	83858	hgsc.bcm.edu	37	1	1431002	1431002	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:1431002C>A	ENST00000308647.7	+	16	1868	c.1752C>A	c.(1750-1752)ccC>ccA	p.P584P		NM_031921.4	NP_114127.3	Q5T9A4	ATD3B_HUMAN	ATPase family, AAA domain containing 3B	584						mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)|urinary_tract(1)	10	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		TCGAGCACCCCCTATCCGGAG	0.647																																					p.P584P		.											ATAD3B,NS,carcinoma,0,1	ATAD3B	0	0			c.C1752A						.						43.0	44.0	44.0					1																	1431002		2203	4299	6502	SO:0001819	synonymous_variant	83858	exon16			GCACCCCCTATCC	AL834179	CCDS30.1	1p36.33	2010-04-21		2007-02-08	ENSG00000160072	ENSG00000160072		"""ATPases / AAA-type"""	24007	protein-coding gene	gene with protein product		612317				10574462	Standard	XM_005244806		Approved	TOB3, KIAA1273	uc001afv.3	Q5T9A4	OTTHUMG00000000577	ENST00000308647.7:c.1752C>A	1.37:g.1431002C>A		71	0		47	2	NM_031921	A8K3H1|Q6ZRB5|Q9BUK4|Q9ULE7	Silent	SNP	ENST00000308647.7	37	CCDS30.1																																																																																			.		0.647	ATAD3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001369.2	NM_031921	
CDH22	64405	hgsc.bcm.edu	37	20	44879706	44879706	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr20:44879706C>A	ENST00000372262.3	-	1	628	c.228G>T	c.(226-228)acG>acT	p.T76T	CDH22_ENST00000537909.1_Silent_p.T76T	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	76	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				GCTCCGTGCCCGTGTACTCCT	0.662																																					p.T76T		.											.	.	.	0			c.G228T						.						34.0	35.0	35.0					20																	44879706		2203	4300	6503	SO:0001819	synonymous_variant	64405	exon2			CGTGCCCGTGTAC	AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.228G>T	20.37:g.44879706C>A		68	0		54	4	NM_021248	B9EGK7|O43205	Silent	SNP	ENST00000372262.3	37	CCDS13395.1																																																																																			.		0.662	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080491.1	NM_021248	
VPS45	11311	hgsc.bcm.edu	37	1	150054917	150054917	+	Nonsense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:150054917G>T	ENST00000369130.3	+	10	1600	c.1054G>T	c.(1054-1056)Gag>Tag	p.E352*	VPS45_ENST00000369128.5_Nonsense_Mutation_p.E247*|VPS45_ENST00000535106.1_Nonsense_Mutation_p.E283*	NM_001279354.1|NM_007259.3	NP_001266283.1|NP_009190.2	Q9NRW7	VPS45_HUMAN	vacuolar protein sorting 45 homolog (S. cerevisiae)	352					blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|vesicle docking involved in exocytosis (GO:0006904)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	21	Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGAGGTTTCAGAGGTTGAGCA	0.478																																					p.E352X		.											.	.	.	0			c.G1054T						.						117.0	114.0	115.0					1																	150054917		2203	4300	6503	SO:0001587	stop_gained	11311	exon10			GTTTCAGAGGTTG	U35246	CCDS944.1, CCDS60244.1, CCDS72904.1	1q21.2	2008-02-05	2006-12-19	2006-12-19	ENSG00000136631	ENSG00000136631			14579	protein-coding gene	gene with protein product		610035	"""vacuolar protein sorting 45A (yeast homolog)"", ""vacuolar protein sorting 45A (yeast)"""	VPS45B, VPS45A		8996080	Standard	NM_007259		Approved	h-vps45, H1	uc001etp.3	Q9NRW7	OTTHUMG00000012511	ENST00000369130.3:c.1054G>T	1.37:g.150054917G>T	ENSP00000358126:p.Glu352*	44	0		87	4	NM_007259	D3DUZ9|F5H8K1|Q15715|Q53FR8|Q5T4P6|Q9Y4Z6	Nonsense_Mutation	SNP	ENST00000369130.3	37	CCDS944.1	.	.	.	.	.	.	.	.	.	.	G	42	9.695620	0.99241	.	.	ENSG00000136631	ENST00000369130;ENST00000369128;ENST00000543996;ENST00000535106;ENST00000419023	.	.	.	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.2671	0.93993	0.0:0.0:1.0:0.0	.	.	.	.	X	352;247;227;283;283	.	ENSP00000358124:E247X	E	+	1	0	VPS45	148321541	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	9.616000	0.98359	2.788000	0.95919	0.650000	0.86243	GAG	.		0.478	VPS45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034964.1	NM_007259	
TLN1	7094	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	35698454	35698454	+	Missense_Mutation	SNP	C	C	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr9:35698454C>T	ENST00000314888.9	-	55	7590	c.7237G>A	c.(7237-7239)Gca>Aca	p.A2413T	TLN1_ENST00000540444.1_Missense_Mutation_p.A2301T	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	2413	I/LWEQ. {ECO:0000255|PROSITE- ProRule:PRU00292}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TGTACAGCTGCATTGGCTGCC	0.582																																					p.A2413T		.											.	.	.	0			c.G7237A						.						42.0	38.0	39.0					9																	35698454		2203	4300	6503	SO:0001583	missense	7094	exon55			CAGCTGCATTGGC	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.7237G>A	9.37:g.35698454C>T	ENSP00000316029:p.Ala2413Thr	17	0		14	4	NM_006289	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	37	CCDS35009.1	.	.	.	.	.	.	.	.	.	.	C	16.30	3.083390	0.55861	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.42900	0.96;0.96	5.18	5.18	0.71444	I/LWEQ (4);	0.184523	0.48286	D	0.000183	T	0.39436	0.1078	L	0.40543	1.245	0.41683	D	0.989309	B	0.22541	0.071	B	0.30029	0.11	T	0.15065	-1.0450	10	0.21540	T	0.41	-5.6061	18.5465	0.91048	0.0:1.0:0.0:0.0	.	2413	Q9Y490	TLN1_HUMAN	T	2413;2301	ENSP00000316029:A2413T;ENSP00000442981:A2301T	ENSP00000316029:A2413T	A	-	1	0	TLN1	35688454	1.000000	0.71417	0.997000	0.53966	0.980000	0.70556	4.501000	0.60393	2.698000	0.92095	0.650000	0.86243	GCA	.		0.582	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	
ZAP70	7535	hgsc.bcm.edu	37	2	98341665	98341665	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr2:98341665G>T	ENST00000264972.5	+	4	728	c.513G>T	c.(511-513)gaG>gaT	p.E171D	ZAP70_ENST00000463643.1_3'UTR|ZAP70_ENST00000442208.1_Missense_Mutation_p.E45D	NM_001079.3	NP_001070.2	P43403	ZAP70_HUMAN	zeta-chain (TCR) associated protein kinase 70kDa	171	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|beta selection (GO:0043366)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative thymic T cell selection (GO:0045060)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell activation (GO:0042110)|T cell aggregation (GO:0070489)|T cell differentiation (GO:0030217)|T cell migration (GO:0072678)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	29						TGACGCGTGAGGAGGCCGAGC	0.642																																					p.E171D		.											.	.	.	0			c.G513T						.						54.0	49.0	51.0					2																	98341665		2203	4300	6503	SO:0001583	missense	7535	exon4			GCGTGAGGAGGCC	L05148	CCDS33254.1, CCDS33255.1	2q11-q13	2014-09-17	2002-08-29		ENSG00000115085	ENSG00000115085		"""SH2 domain containing"""	12858	protein-coding gene	gene with protein product		176947	"""zeta-chain (TCR) associated protein kinase (70 kD)"""	SRK		1423621	Standard	NM_001079		Approved	ZAP-70, STD	uc002syd.1	P43403	OTTHUMG00000153060	ENST00000264972.5:c.513G>T	2.37:g.98341665G>T	ENSP00000264972:p.Glu171Asp	44	0		45	3	NM_001079	A6NFP4|Q6PIA4|Q8IXD6|Q9UBS6	Missense_Mutation	SNP	ENST00000264972.5	37	CCDS33254.1	.	.	.	.	.	.	.	.	.	.	G	12.69	2.013461	0.35511	.	.	ENSG00000115085	ENST00000264972;ENST00000442208	D;D	0.89196	-2.48;-2.48	5.33	2.37	0.29283	SH2 motif (5);	0.131736	0.33875	N	0.004478	T	0.72104	0.3419	N	0.11000	0.08	0.34191	D	0.672014	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.06405	0.001;0.001;0.002	T	0.62558	-0.6829	10	0.22109	T	0.4	.	3.1931	0.06624	0.3209:0.0:0.4933:0.1857	.	171;45;171	B4E0E2;P43403-3;P43403	.;.;ZAP70_HUMAN	D	171;45	ENSP00000264972:E171D;ENSP00000411141:E45D	ENSP00000264972:E171D	E	+	3	2	ZAP70	97708097	0.887000	0.30362	0.981000	0.43875	0.971000	0.66376	-0.056000	0.11787	0.655000	0.30866	0.591000	0.81541	GAG	.		0.642	ZAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329278.1		
DNAAF3	352909	hgsc.bcm.edu	37	19	55670934	55670934	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr19:55670934G>T	ENST00000524407.2	-	11	1238	c.1205C>A	c.(1204-1206)gCa>gAa	p.A402E	DNAAF3_ENST00000391720.4_Missense_Mutation_p.A449E|DNAAF3_ENST00000527223.2_Missense_Mutation_p.A469E|DNAAF3_ENST00000455045.1_Missense_Mutation_p.A348E|TNNI3_ENST00000588882.1_5'Flank|TNNI3_ENST00000344887.5_5'Flank|TNNI3_ENST00000590463.1_5'Flank|CTD-2587H24.4_ENST00000587871.1_Silent_p.G63G|DNAAF3_ENST00000587789.2_5'UTR|CTD-2587H24.5_ENST00000591665.1_RNA			Q8N9W5	DAAF3_HUMAN	dynein, axonemal, assembly factor 3	402					axonemal dynein complex assembly (GO:0070286)|motile cilium assembly (GO:0044458)	cytoplasm (GO:0005737)		p.A449E(1)									CCCTCCGGGTGCCACACAGGC	0.592																																					p.A469E		.											C19orf51,NS,carcinoma,0,1	C19orf51	0	1	Substitution - Missense(1)	kidney(1)	c.C1406A						.						102.0	110.0	107.0					19																	55670934		2027	4187	6214	SO:0001583	missense	352909	exon11			CCGGGTGCCACAC	AK097388	CCDS12918.2, CCDS58679.1, CCDS58680.1, CCDS59422.1	19q13.42	2012-10-05	2012-03-09	2012-03-09	ENSG00000167646	ENSG00000167646			30492	protein-coding gene	gene with protein product		614566	"""chromosome 19 open reading frame 51"", ""ciliary dyskinesia, primary 2"""	C19orf51, CILD2		22387996	Standard	NM_001256714		Approved	FLJ40069, FLJ36139, PF22, PCD	uc002qjl.2	Q8N9W5	OTTHUMG00000128547	ENST00000524407.2:c.1205C>A	19.37:g.55670934G>T	ENSP00000432046:p.Ala402Glu	28	0		31	2	NM_001256714	A8MUY0|E3W9A1|E9PAX5|Q6P4F6|Q8N9W0|Q96AR2	Missense_Mutation	SNP	ENST00000524407.2	37	CCDS59422.1	.	.	.	.	.	.	.	.	.	.	G	19.46	3.831170	0.71258	.	.	ENSG00000167646	ENST00000301249;ENST00000455045;ENST00000391720;ENST00000530077	T;T	0.18016	2.24;2.24	4.21	3.15	0.36227	.	0.130082	0.49916	D	0.000124	T	0.34366	0.0895	M	0.64404	1.975	0.37253	D	0.906636	D;D;D;D	0.76494	0.989;0.996;0.965;0.999	P;D;P;D	0.70016	0.848;0.944;0.719;0.967	T	0.24154	-1.0168	10	0.36615	T	0.2	-19.6496	11.7241	0.51700	0.0:0.0:0.8213:0.1786	.	469;348;422;402	E9PAX5;E3W9A1;Q8N9W5-3;Q8N9W5	.;.;.;CS051_HUMAN	E	469;348;449;97	ENSP00000394343:A348E;ENSP00000375600:A449E	ENSP00000301249:A469E	A	-	2	0	C19orf51	60362746	1.000000	0.71417	0.997000	0.53966	0.670000	0.39368	0.769000	0.26604	1.073000	0.40885	0.485000	0.47835	GCA	.		0.592	DNAAF3-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250388.5	NM_178837	
PLEKHM3	389072	hgsc.bcm.edu	37	2	208866251	208866251	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr2:208866251C>A	ENST00000427836.2	-	2	602	c.113G>T	c.(112-114)gGg>gTg	p.G38V	PLEKHM3_ENST00000389247.4_Missense_Mutation_p.G38V|PLEKHM3_ENST00000457206.1_Missense_Mutation_p.G38V	NM_001080475.2	NP_001073944.1	Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M, member 3	38					intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TTCCTGGATCCCATAAACCTC	0.483																																					p.G38V		.											.,2	.	101	0			c.G113T						.						113.0	112.0	113.0					2																	208866251		1921	4130	6051	SO:0001583	missense	389072	exon2			TGGATCCCATAAA	AK057612	CCDS42808.1	2q33.3	2013-01-10	2008-04-03	2008-04-03	ENSG00000178385	ENSG00000178385		"""Pleckstrin homology (PH) domain containing"""	34006	protein-coding gene	gene with protein product	"""differentiation associated protein"""		"""pleckstrin homology domain containing, family M, member 1-like"""	PLEKHM1L		19028694	Standard	NM_001080475		Approved	DAPR	uc002vcl.2	Q6ZWE6	OTTHUMG00000154781	ENST00000427836.2:c.113G>T	2.37:g.208866251C>A	ENSP00000417003:p.Gly38Val	22	0		14	2	NM_001080475	B9EKV2|Q8WW68	Missense_Mutation	SNP	ENST00000427836.2	37	CCDS42808.1	.	.	.	.	.	.	.	.	.	.	C	14.68	2.608253	0.46527	.	.	ENSG00000178385	ENST00000427836;ENST00000389247;ENST00000457206	D;D;D	0.91180	-2.57;-2.63;-2.8	5.84	4.02	0.46733	.	0.467315	0.22279	N	0.062143	D	0.85331	0.5672	L	0.29908	0.895	0.80722	D	1	P;B	0.37500	0.597;0.29	B;B	0.37650	0.255;0.17	D	0.84581	0.0661	10	0.87932	D	0	.	12.2733	0.54719	0.0:0.8064:0.1283:0.0653	.	38;38	C9J119;Q6ZWE6	.;PKHM3_HUMAN	V	38	ENSP00000417003:G38V;ENSP00000373899:G38V;ENSP00000400150:G38V	ENSP00000373899:G38V	G	-	2	0	PLEKHM3	208574496	0.998000	0.40836	0.979000	0.43373	0.982000	0.71751	4.044000	0.57361	0.899000	0.36444	-0.145000	0.13849	GGG	.		0.483	PLEKHM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337036.1	NM_001080475	
METAP1	23173	hgsc.bcm.edu	37	4	99916973	99916973	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr4:99916973C>A	ENST00000296411.6	+	1	203	c.69C>A	c.(67-69)ccC>ccA	p.P23P	MIR3684_ENST00000579779.1_RNA|RP11-571L19.7_ENST00000583654.1_RNA	NM_015143.2	NP_055958.2	P53582	MAP11_HUMAN	methionyl aminopeptidase 1	23	Zinc finger-like; important for proper ribosome association. {ECO:0000255|HAMAP- Rule:MF_03174}.				N-terminal protein amino acid modification (GO:0031365)|peptidyl-methionine modification (GO:0018206)|phototransduction, visible light (GO:0007603)|platelet aggregation (GO:0070527)|protein initiator methionine removal (GO:0070084)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of translation (GO:0006417)|rhodopsin mediated signaling pathway (GO:0016056)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic ribosome (GO:0022626)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metalloaminopeptidase activity (GO:0070006)|metalloexopeptidase activity (GO:0008235)			endometrium(3)|kidney(2)|large_intestine(1)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	17				OV - Ovarian serous cystadenocarcinoma(123;3.12e-07)		TCCAGTGTCCCACTTGCATCA	0.687																																					p.P23P		.											.	.	.	0			c.C69A						.						31.0	49.0	44.0					4																	99916973		692	1591	2283	SO:0001819	synonymous_variant	23173	exon1			GTGTCCCACTTGC	D42084	CCDS47110.1	4q23	2010-08-20			ENSG00000164024	ENSG00000164024	3.4.11.18		15789	protein-coding gene	gene with protein product	"""Peptidase M"""	610151				7788527, 12144506	Standard	NM_015143		Approved	KIAA0094, MetAP1A, MAP1A	uc003huf.4	P53582	OTTHUMG00000161231	ENST00000296411.6:c.69C>A	4.37:g.99916973C>A		68	0		61	4	NM_015143	B4E2E6	Silent	SNP	ENST00000296411.6	37	CCDS47110.1																																																																																			.		0.687	METAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364237.1	NM_015143	
HTATIP2	10553	hgsc.bcm.edu	37	11	20385802	20385802	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr11:20385802C>A	ENST00000451739.2	+	1	460	c.19C>A	c.(19-21)Ctg>Atg	p.L7M	HTATIP2_ENST00000532081.1_Missense_Mutation_p.L7M|HTATIP2_ENST00000421577.2_Missense_Mutation_p.L7M|HTATIP2_ENST00000530266.1_Missense_Mutation_p.L7M|HTATIP2_ENST00000419348.2_Missense_Mutation_p.L41M|HTATIP2_ENST00000532505.1_Missense_Mutation_p.L7M|HTATIP2_ENST00000443524.2_Missense_Mutation_p.L7M|HTATIP2_ENST00000531058.1_Missense_Mutation_p.L7M	NM_001098522.1	NP_001091992.1			HIV-1 Tat interactive protein 2, 30kDa											large_intestine(2)|lung(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	8						AACAGAAGCCCTGTCGAAGCT	0.522																																					p.L41M		.											HTATIP2_ENST00000419348,NS,carcinoma,0,2	HTATIP2_ENST00000419348	0	0			c.C121A						.						92.0	97.0	95.0					11																	20385802		2203	4300	6503	SO:0001583	missense	10553	exon2			GAAGCCCTGTCGA	AF039103	CCDS7852.1, CCDS44553.1, CCDS53613.1	11p15.1	2011-09-14	2002-08-29		ENSG00000109854	ENSG00000109854	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	16637	protein-coding gene	gene with protein product	"""Tat-interacting protein (30kD)"", ""short chain dehydrogenase/reductase family 44U, member 1"""	605628	"""HIV-1 Tat interactive protein 2, 30 kDa"""			9482853, 9174052, 19027726	Standard	NM_006410		Approved	TIP30, CC3, FLJ26963, SDR44U1	uc001mpx.2	Q9BUP3	OTTHUMG00000166015	ENST00000451739.2:c.19C>A	11.37:g.20385802C>A	ENSP00000394259:p.Leu7Met	51	0		44	2	NM_001098520		Missense_Mutation	SNP	ENST00000451739.2	37	CCDS7852.1	.	.	.	.	.	.	.	.	.	.	C	14.79	2.641950	0.47153	.	.	ENSG00000109854	ENST00000530266;ENST00000421577;ENST00000443524;ENST00000419348;ENST00000451739;ENST00000532505;ENST00000532081;ENST00000531058	T;T;T;T;T	0.57107	0.71;0.71;0.42;0.71;0.7	6.02	4.05	0.47172	.	0.259478	0.42548	D	0.000684	T	0.34077	0.0885	N	0.22421	0.69	0.39078	D	0.960849	B;P;B	0.34462	0.032;0.454;0.024	B;B;B	0.30572	0.003;0.117;0.01	T	0.28202	-1.0051	10	0.39692	T	0.17	-17.6249	8.8082	0.34952	0.1502:0.7712:0.0:0.0787	.	7;7;41	Q9BUP3;Q9BUP3-2;Q9BUP3-3	HTAI2_HUMAN;.;.	M	7;7;7;41;7;7;7;7	ENSP00000397752:L7M;ENSP00000387876:L7M;ENSP00000392985:L41M;ENSP00000394259:L7M;ENSP00000436729:L7M	ENSP00000392985:L41M	L	+	1	2	HTATIP2	20342378	0.728000	0.28080	0.355000	0.25773	0.465000	0.32709	1.259000	0.32956	1.551000	0.49450	0.655000	0.94253	CTG	.		0.522	HTATIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387445.2	NM_001098521	
SYNE1	23345	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	152647206	152647206	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr6:152647206C>A	ENST00000367255.5	-	80	15926	c.15325G>T	c.(15325-15327)Gca>Tca	p.A5109S	SYNE1_ENST00000423061.1_Missense_Mutation_p.A5038S|SYNE1_ENST00000448038.1_Missense_Mutation_p.A5038S|SYNE1_ENST00000341594.5_Intron|SYNE1_ENST00000265368.4_Missense_Mutation_p.A5109S	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5109					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCTTCCCTTGCTTTCTGGTAA	0.388										HNSCC(10;0.0054)																											p.A5109S		.											.	.	.	0			c.G15325T						.						133.0	132.0	132.0					6																	152647206		2203	4300	6503	SO:0001583	missense	23345	exon80			CCCTTGCTTTCTG	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.15325G>T	6.37:g.152647206C>A	ENSP00000356224:p.Ala5109Ser	48	0		42	34	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	12.29	1.894650	0.33442	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038	T;T;T;T	0.34072	1.38;1.38;1.38;1.38	6.07	0.729	0.18266	.	0.094927	0.45867	D	0.000336	T	0.09379	0.0231	L	0.39020	1.185	0.80722	D	1	B;B;B;B	0.21147	0.052;0.017;0.017;0.029	B;B;B;B	0.18871	0.023;0.01;0.01;0.021	T	0.13282	-1.0515	10	0.14656	T	0.56	.	7.683	0.28524	0.2154:0.6037:0.0:0.1809	.	5109;5109;5109;5038	Q8NF91-7;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	S	5109;5038;5109;5038	ENSP00000356224:A5109S;ENSP00000396024:A5038S;ENSP00000265368:A5109S;ENSP00000390975:A5038S	ENSP00000265368:A5109S	A	-	1	0	SYNE1	152688899	0.000000	0.05858	0.788000	0.31933	0.928000	0.56348	-0.090000	0.11163	0.164000	0.19529	-0.152000	0.13540	GCA	.		0.388	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
CFP	5199	hgsc.bcm.edu	37	X	47487614	47487614	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chrX:47487614G>T	ENST00000396992.3	-	3	410	c.290C>A	c.(289-291)tCc>tAc	p.S97Y	CFP_ENST00000377005.2_Missense_Mutation_p.S97Y|CFP_ENST00000247153.3_Missense_Mutation_p.S97Y|CFP_ENST00000480317.1_5'UTR	NM_001145252.1	NP_001138724.1	P27918	PROP_HUMAN	complement factor properdin	97	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	18						CCGCAGCTGGGAGCCCTCAGA	0.647																																					p.S97Y		.											.	.	.	0			c.C290A						.						45.0	39.0	41.0					X																	47487614		2203	4300	6503	SO:0001583	missense	5199	exon3			AGCTGGGAGCCCT	M83652	CCDS14282.1	Xp11.4	2014-09-17	2006-03-02	2006-03-02	ENSG00000126759	ENSG00000126759		"""Complement system"""	8864	protein-coding gene	gene with protein product		300383	"""properdin P factor, complement"""	PFC		1783405	Standard	NM_001145252		Approved		uc004dih.3	P27918	OTTHUMG00000021451	ENST00000396992.3:c.290C>A	X.37:g.47487614G>T	ENSP00000380189:p.Ser97Tyr	74	0		48	4	NM_001145252	O15134|O15135|O15136|O75826	Missense_Mutation	SNP	ENST00000396992.3	37	CCDS14282.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.109120	0.77096	.	.	ENSG00000126759	ENST00000396992;ENST00000247153;ENST00000377005	T;T;T	0.56103	0.48;0.48;0.48	5.97	5.97	0.96955	.	0.127200	0.56097	D	0.000028	T	0.64382	0.2593	L	0.46670	1.46	0.40990	D	0.984841	D;D	0.89917	0.995;1.0	D;D	0.91635	0.97;0.999	T	0.59172	-0.7504	10	0.20046	T	0.44	.	14.562	0.68148	0.0:0.0:1.0:0.0	.	33;97	B3KVK6;P27918	.;PROP_HUMAN	Y	97	ENSP00000380189:S97Y;ENSP00000247153:S97Y;ENSP00000366204:S97Y	ENSP00000247153:S97Y	S	-	2	0	CFP	47372558	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	2.847000	0.48270	2.517000	0.84864	0.600000	0.82982	TCC	.		0.647	CFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056435.2	NM_002621	
FAIM2	23017	hgsc.bcm.edu	37	12	50294991	50294991	+	Nonsense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr12:50294991C>A	ENST00000320634.3	-	2	227	c.133G>T	c.(133-135)Gag>Tag	p.E45*	FAIM2_ENST00000550890.1_5'UTR	NM_012306.3	NP_036438.2	Q9BWQ8	LFG2_HUMAN	Fas apoptotic inhibitory molecule 2	45					apoptotic process (GO:0006915)|cerebellar granular layer development (GO:0021681)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum development (GO:0021549)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of neuron apoptotic process (GO:0043524)|regulation of neuron apoptotic process (GO:0043523)|response to ischemia (GO:0002931)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|postsynaptic membrane (GO:0045211)		p.E45Q(1)		endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|skin(2)	14						TTCATCCCCTCCCCAGAGGTG	0.662																																					p.E45X		.											FAIM2,NS,carcinoma,0,1	FAIM2	0	1	Substitution - Missense(1)	lung(1)	c.G133T						.						30.0	31.0	31.0					12																	50294991		2203	4299	6502	SO:0001587	stop_gained	23017	exon2			TCCCCTCCCCAGA	AB023167	CCDS8791.1	12q13	2010-03-18				ENSG00000135472			17067	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 2"""	604306				10231032, 10535980	Standard	NM_012306		Approved	KIAA0950, LFG, NMP35, LIFEGUARD, TMBIM2, LFG2	uc001rvj.2	Q9BWQ8	OTTHUMG00000169808	ENST00000320634.3:c.133G>T	12.37:g.50294991C>A	ENSP00000321951:p.Glu45*	47	0		49	2	NM_012306	A8K1W6|B3KR08|Q9UJY9|Q9Y2F7	Nonsense_Mutation	SNP	ENST00000320634.3	37	CCDS8791.1	.	.	.	.	.	.	.	.	.	.	C	38	6.833932	0.97873	.	.	ENSG00000135472	ENST00000320634;ENST00000550635	.	.	.	5.31	5.31	0.75309	.	0.076770	0.53938	D	0.000052	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-19.7636	14.4843	0.67606	0.0:1.0:0.0:0.0	.	.	.	.	X	45	.	ENSP00000321951:E45X	E	-	1	0	FAIM2	48581258	0.998000	0.40836	1.000000	0.80357	0.869000	0.49853	3.545000	0.53648	2.511000	0.84671	0.561000	0.74099	GAG	.		0.662	FAIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405984.1	NM_012306	
SSTR5-AS1	146336	hgsc.bcm.edu	37	16	1115551	1115551	+	RNA	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr16:1115551G>T	ENST00000569832.1	-	0	1405				RP11-161M6.5_ENST00000564390.1_lincRNA	NR_027242.1				SSTR5 antisense RNA 1																		CAGTGTTCTCGGGAGGGCCCG	0.652																																					.		.											.	.	.	0			.						.																																					146336	.			GTTCTCGGGAGGG	AK056814		16p13.3	2012-10-12	2012-08-15		ENSG00000261713	ENSG00000261713		"""Long non-coding RNAs"""	26502	non-coding RNA	RNA, long non-coding			"""SSTR5 antisense RNA 1 (non-protein coding)"""				Standard	NR_027242		Approved		uc002cko.3		OTTHUMG00000172831		16.37:g.1115551G>T		45	0		52	4	.		RNA	SNP	ENST00000569832.1	37																																																																																				.		0.652	SSTR5-AS1-001	KNOWN	basic	lincRNA	processed_transcript	OTTHUMT00000420783.1	NR_02724	
HSPA12A	259217	hgsc.bcm.edu	37	10	118460575	118460575	+	Missense_Mutation	SNP	G	G	T	rs372144587		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr10:118460575G>T	ENST00000369209.3	-	4	424	c.320C>A	c.(319-321)cCc>cAc	p.P107H		NM_025015.2	NP_079291.2	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A	107						extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32				all cancers(201;0.0158)		CTTCCTCTCGGGAGTCAGCAA	0.562																																					p.P107H		.											HSPA12A,colon,carcinoma,0,1	HSPA12A	0	0			c.C320A						.	G	HIS/PRO	0,4250		0,0,2125	79.0	85.0	83.0		320	4.7	0.1	10		83	1,8483		0,1,4241	no	missense	HSPA12A	NM_025015.2	77	0,1,6366	TT,TG,GG		0.0118,0.0,0.0079	probably-damaging	107/676	118460575	1,12733	2125	4242	6367	SO:0001583	missense	259217	exon4			CTCTCGGGAGTCA	AB007877	CCDS41569.1	10q25.3	2011-09-02	2002-08-29		ENSG00000165868	ENSG00000165868		"""Heat shock proteins / HSP70"""	19022	protein-coding gene	gene with protein product		610701	"""heat shock 70kD protein 12A"""			12552099	Standard	NM_025015		Approved	FLJ13874, KIAA0417	uc001lct.3	O43301	OTTHUMG00000019107	ENST00000369209.3:c.320C>A	10.37:g.118460575G>T	ENSP00000358211:p.Pro107His	37	0		35	2	NM_025015		Missense_Mutation	SNP	ENST00000369209.3	37	CCDS41569.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.424962	0.83667	0.0	1.18E-4	ENSG00000165868	ENST00000369209	T	0.49720	0.77	5.62	4.72	0.59763	.	0.048194	0.85682	D	0.000000	T	0.69477	0.3115	M	0.83603	2.65	0.80722	D	1	D	0.67145	0.996	D	0.69479	0.964	T	0.75051	-0.3454	10	0.72032	D	0.01	.	14.0819	0.64929	0.0719:0.0:0.9281:0.0	.	107	O43301	HS12A_HUMAN	H	107	ENSP00000358211:P107H	ENSP00000358211:P107H	P	-	2	0	HSPA12A	118450565	1.000000	0.71417	0.075000	0.20258	0.976000	0.68499	9.749000	0.98871	1.379000	0.46325	0.655000	0.94253	CCC	.		0.562	HSPA12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050530.1	NM_025015	
SETD1B	23067	hgsc.bcm.edu	37	12	122257702	122257702	+	Nonsense_Mutation	SNP	G	G	T	rs532792954		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr12:122257702G>T	ENST00000604567.1	+	11	3879	c.3811G>T	c.(3811-3813)Gaa>Taa	p.E1271*	SETD1B_ENST00000542440.1_Nonsense_Mutation_p.E1228*|SETD1B_ENST00000267197.5_Nonsense_Mutation_p.E1228*			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	1271	Glu-rich.|Pro-rich.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						GCCGCCTGAGGAACCAGGCCT	0.677																																					p.E1228X		.											.	.	.	0			c.G3682T						.						31.0	41.0	38.0					12																	122257702		692	1590	2282	SO:0001587	stop_gained	23067	exon11			CCTGAGGAACCAG	AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.3811G>T	12.37:g.122257702G>T	ENSP00000474253:p.Glu1271*	46	0		56	4	NM_015048	F6MFW1	Nonsense_Mutation	SNP	ENST00000604567.1	37		.	.	.	.	.	.	.	.	.	.	G	40	8.177503	0.98691	.	.	ENSG00000139718	ENST00000542440;ENST00000267197	.	.	.	5.29	4.35	0.52113	.	0.477105	0.19829	N	0.105121	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	.	13.1636	0.59558	0.0:0.2212:0.7788:0.0	.	.	.	.	X	1228	.	ENSP00000267197:E1228X	E	+	1	0	SETD1B	120742085	1.000000	0.71417	0.191000	0.23289	0.033000	0.12548	3.787000	0.55439	2.476000	0.83614	0.650000	0.86243	GAA	.		0.677	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000468264.1	XM_037523	
VCL	7414	hgsc.bcm.edu	37	10	75860838	75860838	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr10:75860838C>A	ENST00000211998.4	+	14	2099	c.2005C>A	c.(2005-2007)Cga>Aga	p.R669R	VCL_ENST00000372755.3_Silent_p.R669R|VCL_ENST00000478896.2_3'UTR|VCL_ENST00000417648.2_Intron	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	669	N-terminal globular head.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.R669G(1)	VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					GAAGACGGCCCGAGAACTCAC	0.458																																					p.R669R		.											VCL,NS,carcinoma,0,1	VCL	0	1	Substitution - Missense(1)	kidney(1)	c.C2005A						.						51.0	48.0	49.0					10																	75860838		2203	4300	6503	SO:0001819	synonymous_variant	7414	exon14			ACGGCCCGAGAAC	M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.2005C>A	10.37:g.75860838C>A		45	0		49	2	NM_003373	Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Silent	SNP	ENST00000211998.4	37	CCDS7341.1																																																																																			.		0.458	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_003373, NM_014000	
FER	2241	hgsc.bcm.edu	37	5	108382829	108382829	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr5:108382829C>A	ENST00000281092.4	+	16	2238	c.1854C>A	c.(1852-1854)ccC>ccA	p.P618P	FER_ENST00000438717.2_Silent_p.P443P	NM_005246.2	NP_005237.2	P16591	FER_HUMAN	fer (fps/fes related) tyrosine kinase	618	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|cell proliferation (GO:0008283)|cell-cell adhesion mediated by cadherin (GO:0044331)|cellular response to insulin stimulus (GO:0032869)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to reactive oxygen species (GO:0034614)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|diapedesis (GO:0050904)|extracellular matrix-cell signaling (GO:0035426)|Fc-epsilon receptor signaling pathway (GO:0038095)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular signal transduction (GO:0035556)|Kit signaling pathway (GO:0038109)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of mast cell activation involved in immune response (GO:0033007)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of fibroblast migration (GO:0010762)|regulation of lamellipodium assembly (GO:0010591)|regulation of protein phosphorylation (GO:0001932)|response to lipopolysaccharide (GO:0032496)|response to platelet-derived growth factor (GO:0036119)|substrate adhesion-dependent cell spreading (GO:0034446)|tyrosine phosphorylation of Stat3 protein (GO:0042503)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|nucleus (GO:0005634)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			NS(2)|biliary_tract(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	32		all_cancers(142;2.86e-06)|all_epithelial(76;9.81e-08)|Prostate(80;0.00972)|Lung NSC(167;0.039)|Ovarian(225;0.0448)|all_lung(232;0.0496)|Colorectal(57;0.0986)|Breast(839;0.152)		OV - Ovarian serous cystadenocarcinoma(64;6.77e-10)|Epithelial(69;4.13e-08)|COAD - Colon adenocarcinoma(37;0.0174)		ATGATCATCCCAATATTGTCA	0.318																																					p.P618P	Colon(146;1051 1799 9836 27344 47401)	.											FER,NS,carcinoma,0,1	FER	0	0			c.C1854A						.						110.0	104.0	106.0					5																	108382829		2202	4298	6500	SO:0001819	synonymous_variant	2241	exon16			TCATCCCAATATT	J03358	CCDS4098.1	5q21	2013-02-14	2008-02-07		ENSG00000151422	ENSG00000151422	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""SH2 domain containing"""	3655	protein-coding gene	gene with protein product	"""phosphoprotein NCP94"", ""protein phosphatase 1, regulatory subunit 74"""	176942					Standard	NM_005246		Approved	TYK3, PPP1R74	uc003kop.1	P16591	OTTHUMG00000128751	ENST00000281092.4:c.1854C>A	5.37:g.108382829C>A		48	0		50	2	NM_005246	B2RCR4|B4DSQ2|H2FLB8	Silent	SNP	ENST00000281092.4	37	CCDS4098.1																																																																																			.		0.318	FER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250664.1	NM_005246	
GPM6B	2824	hgsc.bcm.edu;bcgsc.ca	37	X	13801543	13801543	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chrX:13801543C>A	ENST00000356942.5	-	3	787	c.346G>T	c.(346-348)Gtg>Ttg	p.V116L	GPM6B_ENST00000398361.3_Missense_Mutation_p.V30L|GPM6B_ENST00000316715.4_Missense_Mutation_p.V156L|GPM6B_ENST00000493677.1_Missense_Mutation_p.V130L|GPM6B_ENST00000454189.2_Missense_Mutation_p.V97L|GPM6B_ENST00000355135.2_Missense_Mutation_p.V156L	NM_005278.3	NP_005269.1	Q13491	GPM6B_HUMAN	glycoprotein M6B	116					cell differentiation (GO:0030154)|extracellular matrix assembly (GO:0085029)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of serotonin uptake (GO:0051612)|nervous system development (GO:0007399)|ossification (GO:0001503)|positive regulation of bone mineralization (GO:0030501)|protein transport (GO:0015031)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of focal adhesion assembly (GO:0051893)	integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|ovary(1)|pancreas(1)	6						AGTTCTTTCACTGCACTTGTG	0.423																																					p.V156L		.											.	.	.	0			c.G466T						.						161.0	136.0	144.0					X																	13801543		2203	4300	6503	SO:0001583	missense	2824	exon4			CTTTCACTGCACT		CCDS14158.1, CCDS35206.1, CCDS35207.1, CCDS48084.1	Xp22.2	2010-08-03			ENSG00000046653	ENSG00000046653			4461	protein-coding gene	gene with protein product		300051				8661015	Standard	NM_001001995		Approved	M6B, MGC17150, MGC54284	uc004cvw.3	Q13491	OTTHUMG00000021162	ENST00000356942.5:c.346G>T	X.37:g.13801543C>A	ENSP00000349420:p.Val116Leu	71	0		66	4	NM_001001995	O76077|Q86X43|Q8N956	Missense_Mutation	SNP	ENST00000356942.5	37	CCDS14158.1	.	.	.	.	.	.	.	.	.	.	C	31	5.076491	0.94000	.	.	ENSG00000046653	ENST00000316715;ENST00000454189;ENST00000493677;ENST00000355135;ENST00000356942;ENST00000398361;ENST00000495211;ENST00000493085;ENST00000468080	D;D;D;D;D;D;D;D;D	0.99405	-5.84;-5.84;-5.84;-5.84;-5.84;-5.84;-5.84;-5.84;-5.84	5.16	5.16	0.70880	.	0.110151	0.64402	D	0.000009	D	0.99230	0.9732	M	0.77820	2.39	0.80722	D	1	P;P;P;P;P;P	0.52692	0.888;0.69;0.934;0.619;0.955;0.934	P;B;P;B;P;P	0.51701	0.583;0.316;0.544;0.381;0.658;0.677	D	0.99482	1.0948	10	0.62326	D	0.03	-5.9222	18.0423	0.89322	0.0:1.0:0.0:0.0	.	130;97;116;156;108;156	B7Z613;Q13491-2;Q13491;Q13491-3;Q59FD5;Q8N956	.;.;GPM6B_HUMAN;.;.;.	L	156;97;130;156;116;30;81;30;30	ENSP00000316861:V156L;ENSP00000389915:V97L;ENSP00000419904:V130L;ENSP00000347258:V156L;ENSP00000349420:V116L;ENSP00000381402:V30L;ENSP00000419409:V81L;ENSP00000418199:V30L;ENSP00000419779:V30L	ENSP00000316861:V156L	V	-	1	0	GPM6B	13711464	1.000000	0.71417	0.970000	0.41538	0.997000	0.91878	5.658000	0.68003	2.283000	0.76528	0.600000	0.82982	GTG	.		0.423	GPM6B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055822.1	NM_001001995	
ZFAND1	79752	hgsc.bcm.edu;bcgsc.ca	37	8	82626157	82626157	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr8:82626157G>T	ENST00000220669.5	-	6	494	c.476C>A	c.(475-477)cCa>cAa	p.P159Q	ZFAND1_ENST00000521287.1_Missense_Mutation_p.P52Q|ZFAND1_ENST00000523096.1_Missense_Mutation_p.P159Q|ZFAND1_ENST00000521895.1_Missense_Mutation_p.P52Q|ZFAND1_ENST00000519523.1_Missense_Mutation_p.P159Q|ZFAND1_ENST00000517588.1_Missense_Mutation_p.P52Q|ZFAND1_ENST00000522520.1_Missense_Mutation_p.P52Q	NM_024699.2	NP_078975.2	Q8TCF1	ZFAN1_HUMAN	zinc finger, AN1-type domain 1	159							zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13						ACCAACCTGTGGTAATGACTT	0.353																																					p.P159Q		.											.	.	.	0			c.C476A						.						152.0	136.0	142.0					8																	82626157		2203	4300	6503	SO:0001583	missense	79752	exon6			ACCTGTGGTAATG		CCDS6232.1, CCDS55250.1, CCDS55251.1	8q21.13	2006-07-07						"""Zinc fingers, AN1-type domain containing"""	25858	protein-coding gene	gene with protein product						12477932	Standard	NM_024699		Approved	FLJ14007	uc003ycj.2	Q8TCF1		ENST00000220669.5:c.476C>A	8.37:g.82626157G>T	ENSP00000220669:p.Pro159Gln	86	0		102	5	NM_001170796	E5RIG0|E5RJ99|Q658R7|Q6IA32|Q6PGQ6|Q9H810	Missense_Mutation	SNP	ENST00000220669.5	37	CCDS6232.1	.	.	.	.	.	.	.	.	.	.	G	32	5.127130	0.94429	.	.	ENSG00000104231	ENST00000523096;ENST00000220669;ENST00000522520;ENST00000521895;ENST00000521287;ENST00000520635;ENST00000517588;ENST00000519523;ENST00000520604;ENST00000523361;ENST00000517450;ENST00000521742	.	.	.	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.85767	0.5773	M	0.90814	3.15	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.71656	0.974;0.963	D	0.87902	0.2691	9	0.87932	D	0	.	20.0044	0.97430	0.0:0.0:1.0:0.0	.	159;159	E5RIG0;Q8TCF1	.;ZFAN1_HUMAN	Q	159;159;52;52;52;52;52;159;52;52;52;52	.	ENSP00000220669:P159Q	P	-	2	0	ZFAND1	82788712	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.510000	0.90532	2.714000	0.92807	0.650000	0.86243	CCA	.		0.353	ZFAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379739.1	NM_024699	
TRIM32	22954	hgsc.bcm.edu	37	9	119461766	119461766	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr9:119461766G>T	ENST00000450136.1	+	2	1906	c.1745G>T	c.(1744-1746)tGt>tTt	p.C582F	TRIM32_ENST00000373983.2_Missense_Mutation_p.C582F|ASTN2_ENST00000361209.2_Intron|ASTN2_ENST00000361477.3_Intron|ASTN2_ENST00000313400.4_Intron|ASTN2_ENST00000373996.3_Intron	NM_001099679.1|NM_012210.3	NP_001093149.1|NP_036342.2	Q13049	TRI32_HUMAN	tripartite motif containing 32	582					fat cell differentiation (GO:0045444)|innate immune response (GO:0045087)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of proteolysis (GO:0045862)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of type I interferon production (GO:0032479)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|striated muscle myosin thick filament (GO:0005863)	ligase activity (GO:0016874)|myosin binding (GO:0017022)|protein self-association (GO:0043621)|RNA binding (GO:0003723)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|translation initiation factor binding (GO:0031369)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	26						GCTGGCATGTGTGTGGATGCT	0.527																																					p.C582F	Esophageal Squamous(92;212 1916 19711 26951)	.											TRIM32,NS,carcinoma,0,1	TRIM32	0	0			c.G1745T						.						114.0	107.0	109.0					9																	119461766		2203	4300	6503	SO:0001583	missense	22954	exon2			GCATGTGTGTGGA	U18543	CCDS6817.1	9q33.1	2014-09-17	2011-01-25		ENSG00000119401	ENSG00000119401		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16380	protein-coding gene	gene with protein product		602290	"""limb girdle muscular dystrophy 2H (autosomal recessive)"", ""tripartite motif-containing 32"""	LGMD2H		11331580, 7778269, 16606853	Standard	NM_001099679		Approved	HT2A, TATIP, BBS11	uc004bjx.2	Q13049	OTTHUMG00000021026	ENST00000450136.1:c.1745G>T	9.37:g.119461766G>T	ENSP00000408292:p.Cys582Phe	20	0		13	2	NM_012210	Q9NQP8	Missense_Mutation	SNP	ENST00000450136.1	37	CCDS6817.1	.	.	.	.	.	.	.	.	.	.	G	17.85	3.491262	0.64074	.	.	ENSG00000119401	ENST00000450136;ENST00000373983	D;D	0.90197	-2.63;-2.63	5.59	5.59	0.84812	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.91375	0.7279	N	0.19112	0.55	0.80722	D	1	D	0.65815	0.995	D	0.69142	0.962	D	0.90234	0.4281	9	.	.	.	-9.6677	19.5873	0.95495	0.0:0.0:1.0:0.0	.	582	Q13049	TRI32_HUMAN	F	582	ENSP00000408292:C582F;ENSP00000363095:C582F	.	C	+	2	0	TRIM32	118501587	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.434000	0.97515	2.610000	0.88304	0.650000	0.86243	TGT	.		0.527	TRIM32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055466.2	NM_012210	
DBNDD2	55861	hgsc.bcm.edu	37	20	44035143	44035143	+	Missense_Mutation	SNP	G	G	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr20:44035143G>A	ENST00000372720.3	+	1	283	c.52G>A	c.(52-54)Gca>Aca	p.A18T	SYS1-DBNDD2_ENST00000475242.1_Intron|DBNDD2_ENST00000372722.3_Intron|TP53TG5_ENST00000494455.1_Intron|DBNDD2_ENST00000372717.1_5'Flank|DBNDD2_ENST00000372710.3_5'Flank|DBNDD2_ENST00000360981.4_5'Flank|DBNDD2_ENST00000372712.2_5'Flank|DBNDD2_ENST00000357275.2_Intron|DBNDD2_ENST00000372723.3_Intron|SYS1-DBNDD2_ENST00000452133.1_Intron	NM_018478.3	NP_060948.3	Q9BQY9	DBND2_HUMAN	dysbindin (dystrobrevin binding protein 1) domain containing 2	18					negative regulation of protein kinase activity (GO:0006469)	cytoplasm (GO:0005737)				breast(1)|lung(2)	3		Myeloproliferative disorder(115;0.0122)				AGCCGCGCTCGCAGGGGCTGC	0.711																																					p.A18T		.											DBNDD2_ENST00000372720,colon,carcinoma,0,1	DBNDD2_ENST00000372720	0	0			c.G52A						.																																			SO:0001583	missense	55861	exon1			GCGCTCGCAGGGG	AF220191	CCDS42880.1, CCDS42881.1, CCDS56193.1, CCDS56194.1	20q13.12	2007-07-23	2006-04-04	2006-04-04	ENSG00000244274	ENSG00000244274			15881	protein-coding gene	gene with protein product		611453	"""chromosome 20 open reading frame 35"""	C20orf35			Standard	NM_001048225		Approved	HSMNP1	uc002xof.3	Q9BQY9	OTTHUMG00000032576	ENST00000372720.3:c.52G>A	20.37:g.44035143G>A	ENSP00000361805:p.Ala18Thr	22	0		21	2	NM_018478	Q331S6|Q5QPV4|Q5QPV6|Q9BQZ0|Q9BVL1|Q9H1F6|Q9NWZ0|Q9NY07|Q9NZ31	Missense_Mutation	SNP	ENST00000372720.3	37	CCDS56193.1	.	.	.	.	.	.	.	.	.	.	G	14.78	2.638085	0.47153	.	.	ENSG00000244274	ENST00000372720	T	0.32515	1.45	3.23	-2.42	0.06542	.	.	.	.	.	T	0.18045	0.0433	N	0.14661	0.345	0.09310	N	0.999996	.	.	.	.	.	.	T	0.32745	-0.9895	7	0.87932	D	0	.	6.2752	0.20977	0.1398:0.549:0.3111:0.0	.	.	.	.	T	18	ENSP00000361805:A18T	ENSP00000361805:A18T	A	+	1	0	DBNDD2	43468557	0.000000	0.05858	0.000000	0.03702	0.154000	0.21943	-0.849000	0.04322	-0.408000	0.07565	-0.519000	0.04390	GCA	.		0.711	DBNDD2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079438.1	NM_018478	
NCOR1	9611	hgsc.bcm.edu	37	17	16040656	16040656	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr17:16040656C>A	ENST00000268712.3	-	14	1735	c.1478G>T	c.(1477-1479)aGg>aTg	p.R493M	NCOR1_ENST00000395851.1_Missense_Mutation_p.R493M|NCOR1_ENST00000395848.1_Missense_Mutation_p.R384M|RNU6-862P_ENST00000362804.1_RNA	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	493					CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		CCCATAATTCCTTCTGACGAG	0.343																																					p.R493M		.											.	.	.	0			c.G1478T						.						72.0	68.0	69.0					17																	16040656		2203	4300	6503	SO:0001583	missense	9611	exon13			TAATTCCTTCTGA	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.1478G>T	17.37:g.16040656C>A	ENSP00000268712:p.Arg493Met	48	0		46	4	NM_001190440	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	ENST00000268712.3	37	CCDS11175.1	.	.	.	.	.	.	.	.	.	.	C	12.91	2.078434	0.36662	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000458113;ENST00000395848;ENST00000411510;ENST00000436828	T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78	5.22	4.22	0.49857	.	0.000000	0.85682	D	0.000000	T	0.69620	0.3131	M	0.80332	2.49	0.80722	D	1	D;D;D;D;D;P	0.76494	0.999;0.999;0.999;0.979;0.997;0.874	D;D;D;D;D;P	0.80764	0.971;0.971;0.971;0.94;0.994;0.73	T	0.75491	-0.3299	10	0.87932	D	0	-10.0101	14.9712	0.71235	0.0:0.8565:0.1435:0.0	.	502;493;493;384;493;493	E7EU93;E7EV02;E7EW50;E9PGV6;O75376;O75376-2	.;.;.;.;NCOR1_HUMAN;.	M	493;493;384;502;384;493;502	ENSP00000268712:R493M;ENSP00000379192:R493M;ENSP00000379189:R384M;ENSP00000407998:R493M;ENSP00000387727:R502M	ENSP00000268712:R493M	R	-	2	0	NCOR1	15981381	1.000000	0.71417	0.963000	0.40424	0.978000	0.69477	7.403000	0.79983	1.284000	0.44531	0.655000	0.94253	AGG	.		0.343	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	
SEPT1	1731	hgsc.bcm.edu	37	16	30392754	30392754	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr16:30392754G>T	ENST00000571393.1	-	6	532	c.346C>A	c.(346-348)Cag>Aag	p.Q116K	SEPT1_ENST00000605106.1_Missense_Mutation_p.Q121K|SEPT1_ENST00000570039.1_5'Flank|SEPT1_ENST00000321367.3_Missense_Mutation_p.Q163K			Q8WYJ6	SEPT1_HUMAN	septin 1	116	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)			breast(2)|endometrium(1)|large_intestine(3)|lung(15)|ovary(1)|skin(1)|urinary_tract(1)	24			Colorectal(24;0.193)			CTAAGGTACTGCTCAAATTGC	0.587																																					p.Q163K		.											SEPT1,NS,carcinoma,0,1	SEPT1	0	0			c.C487A						.						107.0	100.0	102.0					16																	30392754		2197	4300	6497	SO:0001583	missense	1731	exon6			GGTACTGCTCAAA	AF308288	CCDS10678.1, CCDS10678.2, CCDS10678.3	16p11.2	2013-01-21		2001-09-10	ENSG00000180096	ENSG00000180096	3.1.5.1	"""Septins"""	2879	protein-coding gene	gene with protein product		612897		DIFF6		8697812	Standard	NM_052838		Approved	PNUTL3	uc002dxy.4	Q8WYJ6	OTTHUMG00000176984	ENST00000571393.1:c.346C>A	16.37:g.30392754G>T	ENSP00000460441:p.Gln116Lys	61	0		65	3	NM_052838	B4DVE6|Q658T1|Q8NEZ1|Q96EL4|Q9H285	Missense_Mutation	SNP	ENST00000571393.1	37		.	.	.	.	.	.	.	.	.	.	G	11.28	1.592662	0.28357	.	.	ENSG00000180096	ENST00000321367	.	.	.	5.53	5.53	0.82687	.	0.000000	0.56097	D	0.000030	T	0.49474	0.1559	N	0.16307	0.4	0.48395	D	0.999645	B;B	0.32467	0.226;0.372	B;B	0.37692	0.241;0.256	T	0.53394	-0.8445	9	0.62326	D	0.03	.	18.6084	0.91275	0.0:0.0:1.0:0.0	.	163;116	B4E0I4;Q8WYJ6	.;SEPT1_HUMAN	K	116	.	ENSP00000324511:Q116K	Q	-	1	0	SEPT1	30300255	1.000000	0.71417	1.000000	0.80357	0.068000	0.16541	8.004000	0.88535	2.772000	0.95346	0.591000	0.81541	CAG	.		0.587	SEPT1-201	KNOWN	basic	protein_coding	protein_coding		NM_052838	
COL11A1	1301	hgsc.bcm.edu	37	1	103540202	103540202	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:103540202G>T	ENST00000370096.3	-	4	935	c.623C>A	c.(622-624)aCa>aAa	p.T208K	COL11A1_ENST00000358392.2_Missense_Mutation_p.T208K|COL11A1_ENST00000512756.1_Missense_Mutation_p.T208K|COL11A1_ENST00000353414.4_Missense_Mutation_p.T208K	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	208	Laminin G-like.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.T208K(2)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CAAAATCCTTGTTCCAAAAAC	0.338																																					p.T208K		.											COL11A1_ENST00000370096,NS,carcinoma,0,2	COL11A1_ENST00000370096	0	2	Substitution - Missense(2)	endometrium(2)	c.C623A						.						140.0	128.0	132.0					1																	103540202		2202	4300	6502	SO:0001583	missense	1301	exon4			ATCCTTGTTCCAA	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.623C>A	1.37:g.103540202G>T	ENSP00000359114:p.Thr208Lys	35	0		37	2	NM_001854	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	G	16.28	3.079454	0.55753	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756;ENST00000427239;ENST00000447608	T;T;T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07;-1.07;-1.07	5.73	4.81	0.61882	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);Laminin G, thrombospondin-type, N-terminal (1);Laminin G, subdomain 2 (1);	0.000000	0.85682	D	0.000000	T	0.79179	0.4402	M	0.81802	2.56	0.58432	D	0.999998	P;P;P;P	0.46859	0.885;0.86;0.86;0.885	P;P;P;P	0.48770	0.589;0.453;0.453;0.589	T	0.83194	-0.0082	10	0.72032	D	0.01	.	16.0686	0.80907	0.0:0.0:0.8648:0.1352	.	208;208;208;208	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	K	208;208;208;208;208;135	ENSP00000359114:T208K;ENSP00000351163:T208K;ENSP00000302551:T208K;ENSP00000426533:T208K;ENSP00000408640:T208K;ENSP00000410177:T135K	ENSP00000302551:T208K	T	-	2	0	COL11A1	103312790	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.864000	0.99589	1.389000	0.46526	0.650000	0.86243	ACA	.		0.338	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
GRIN2D	2906	hgsc.bcm.edu;bcgsc.ca	37	19	48918188	48918188	+	Missense_Mutation	SNP	C	C	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr19:48918188C>T	ENST00000263269.3	+	6	1568	c.1480C>T	c.(1480-1482)Cgg>Tgg	p.R494W		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	494					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CATTCTGAAGCGGCTGGCGCA	0.612																																					p.R494W		.											.	.	.	0			c.C1480T						.						51.0	52.0	51.0					19																	48918188		2203	4300	6503	SO:0001583	missense	2906	exon6			CTGAAGCGGCTGG	U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.1480C>T	19.37:g.48918188C>T	ENSP00000263269:p.Arg494Trp	81	0		70	4	NM_000836		Missense_Mutation	SNP	ENST00000263269.3	37	CCDS12719.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.030424	0.75504	.	.	ENSG00000105464	ENST00000263269	T	0.27890	1.64	4.88	2.7	0.31948	Extracellular solute-binding protein, family 3 (1);Glutamate receptor, L-glutamate/glycine-binding (1);Ionotropic glutamate receptor (1);	0.000000	0.64402	D	0.000001	T	0.40247	0.1109	L	0.28274	0.84	0.43531	D	0.995815	D	0.89917	1.0	D	0.85130	0.997	T	0.25012	-1.0144	10	0.87932	D	0	.	12.1371	0.53977	0.3727:0.6272:0.0:0.0	.	494	O15399	NMDE4_HUMAN	W	494	ENSP00000263269:R494W	ENSP00000263269:R494W	R	+	1	2	GRIN2D	53610000	0.999000	0.42202	1.000000	0.80357	0.988000	0.76386	0.960000	0.29253	0.495000	0.27882	0.655000	0.94253	CGG	.		0.612	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466121.1		
CNOT2	4848	hgsc.bcm.edu	37	12	70735907	70735907	+	Missense_Mutation	SNP	C	C	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr12:70735907C>T	ENST00000418359.3	+	13	1650	c.1199C>T	c.(1198-1200)gCg>gTg	p.A400V	CNOT2_ENST00000229195.3_Missense_Mutation_p.A400V|CNOT2_ENST00000551483.1_Missense_Mutation_p.A51V	NM_001199302.1	NP_001186231.1	Q9NZN8	CNOT2_HUMAN	CCR4-NOT transcription complex, subunit 2	400					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription corepressor binding (GO:0001226)	p.A400V(1)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(2)|urinary_tract(1)	20	Renal(347;0.236)		GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			CCCAAATTTGCGTCACCCTGG	0.343																																					p.A400V		.											CNOT2,NS,carcinoma,0,1	CNOT2	0	1	Substitution - Missense(1)	endometrium(1)	c.C1199T						.						127.0	127.0	127.0					12																	70735907		2203	4300	6503	SO:0001583	missense	4848	exon13			AATTTGCGTCACC	AF180473	CCDS31857.1	12q15	2008-05-14				ENSG00000111596			7878	protein-coding gene	gene with protein product		604909		NOT2		10637334	Standard	NM_014515		Approved	CDC36, NOT2H	uc001svv.3	Q9NZN8		ENST00000418359.3:c.1199C>T	12.37:g.70735907C>T	ENSP00000412091:p.Ala400Val	40	0		49	3	NM_001199302	Q9H3E0|Q9NSX5|Q9NWR6|Q9P028	Missense_Mutation	SNP	ENST00000418359.3	37	CCDS31857.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.352785	0.82132	.	.	ENSG00000111596	ENST00000229195;ENST00000418359;ENST00000550160;ENST00000548159;ENST00000551043;ENST00000551483	T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92	5.79	5.79	0.91817	NOT2/NOT3/NOT5 (1);	0.000000	0.85682	D	0.000000	T	0.50240	0.1604	L	0.39397	1.21	0.80722	D	1	B;P	0.48407	0.416;0.91	B;P	0.51999	0.146;0.687	T	0.35176	-0.9799	10	0.41790	T	0.15	-1.1205	20.0221	0.97508	0.0:1.0:0.0:0.0	.	400;400	Q9NZN8-4;Q9NZN8	.;CNOT2_HUMAN	V	400;400;263;391;400;51	ENSP00000229195:A400V;ENSP00000412091:A400V;ENSP00000449659:A391V;ENSP00000449260:A400V;ENSP00000448883:A51V	ENSP00000229195:A400V	A	+	2	0	CNOT2	69022174	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.768000	0.85345	2.732000	0.93576	0.650000	0.86243	GCG	.		0.343	CNOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404260.1		
GON4L	54856	hgsc.bcm.edu;bcgsc.ca	37	1	155732107	155732107	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:155732107C>A	ENST00000368331.1	-	23	4833	c.4785G>T	c.(4783-4785)cgG>cgT	p.R1595R	GON4L_ENST00000271883.5_Silent_p.R1595R|GON4L_ENST00000437809.1_Silent_p.R1595R|GON4L_ENST00000471341.1_5'Flank	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1595					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					CCCGACTTCCCCGCTTGTTGC	0.542																																					p.R1595R		.											.	.	.	0			c.G4785T						.						69.0	68.0	68.0					1																	155732107		1992	4151	6143	SO:0001819	synonymous_variant	54856	exon23			ACTTCCCCGCTTG	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.4785G>T	1.37:g.155732107C>A		35	0		95	5	NM_001037533	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Silent	SNP	ENST00000368331.1	37																																																																																				.		0.542	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292	
EDRF1	26098	hgsc.bcm.edu	37	10	127429150	127429150	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr10:127429150C>A	ENST00000356792.4	+	16	2332	c.2100C>A	c.(2098-2100)tcC>tcA	p.S700S	C10orf137_ENST00000337623.3_Silent_p.S666S	NM_001202438.1	NP_001189367.1	Q3B7T1	EDRF1_HUMAN		700					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(20)|ovary(8)|pancreas(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	61		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				ATGTTTTGTCCGATGCTGCCA	0.373																																					p.S700S		.											C10orf137,caecum,carcinoma,0,1	C10orf137	0	0			c.C2100A						.						131.0	121.0	124.0					10																	127429150		2203	4300	6503	SO:0001819	synonymous_variant	26098	exon16			TTTGTCCGATGCT																												ENST00000356792.4:c.2100C>A	10.37:g.127429150C>A		84	0		44	2	NM_001202438	B2RC65|Q3KR40|Q4G190|Q5VZQ4|Q8IZ74|Q9Y3W4	Silent	SNP	ENST00000356792.4	37	CCDS55733.1																																																																																			.		0.373	C10orf137-007	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388539.1		
ZNF560	147741	hgsc.bcm.edu	37	19	9579006	9579006	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr19:9579006C>A	ENST00000301480.4	-	10	830	c.617G>T	c.(616-618)aGa>aTa	p.R206I		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	206					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						ATTTTGGTTTCTTGCCTGTTA	0.348																																					p.R206I		.											ZNF560,NS,carcinoma,0,1	ZNF560	0	0			c.G617T						.						64.0	50.0	55.0					19																	9579006		2203	4300	6503	SO:0001583	missense	147741	exon10			TGGTTTCTTGCCT	AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.617G>T	19.37:g.9579006C>A	ENSP00000301480:p.Arg206Ile	38	0		39	2	NM_152476	Q495S9|Q495T1	Missense_Mutation	SNP	ENST00000301480.4	37	CCDS12214.1	.	.	.	.	.	.	.	.	.	.	C	14.12	2.439542	0.43326	.	.	ENSG00000198028	ENST00000301480	T	0.29655	1.56	2.15	-0.0455	0.13851	.	.	.	.	.	T	0.46814	0.1412	M	0.75447	2.3	0.09310	N	0.999992	D	0.89917	1.0	D	0.68192	0.956	T	0.28106	-1.0054	9	0.36615	T	0.2	.	5.9629	0.19308	0.0:0.6972:0.0:0.3028	.	206	Q96MR9	ZN560_HUMAN	I	206	ENSP00000301480:R206I	ENSP00000301480:R206I	R	-	2	0	ZNF560	9440006	0.001000	0.12720	0.006000	0.13384	0.576000	0.36127	0.770000	0.26618	0.044000	0.15775	0.561000	0.74099	AGA	.		0.348	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449901.1	NM_152476	
ZNF586	54807	hgsc.bcm.edu;bcgsc.ca	37	19	58290630	58290630	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr19:58290630G>T	ENST00000396154.2	+	3	848	c.675G>T	c.(673-675)agG>agT	p.R225S	ZNF586_ENST00000599802.1_Intron|ZNF586_ENST00000598885.1_Intron|ZNF586_ENST00000391702.3_Missense_Mutation_p.R182S|ZNF586_ENST00000598183.1_Intron|ZNF586_ENST00000396150.4_Missense_Mutation_p.G183V	NM_017652.3	NP_060122.2	Q9NXT0	ZN586_HUMAN	zinc finger protein 586	225					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)	15		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TTAAACACAGGAGGATTCACA	0.428																																					p.R225S		.											.	.	.	0			c.G675T						.						111.0	117.0	115.0					19																	58290630		2198	4300	6498	SO:0001583	missense	54807	exon3			ACACAGGAGGATT	AK095993	CCDS42640.1, CCDS56107.1, CCDS56108.1	19q13.43	2013-01-08				ENSG00000083828		"""Zinc fingers, C2H2-type"", ""-"""	25949	protein-coding gene	gene with protein product						12477932	Standard	NM_017652		Approved	FLJ20070	uc002qqd.3	Q9NXT0		ENST00000396154.2:c.675G>T	19.37:g.58290630G>T	ENSP00000379458:p.Arg225Ser	38	0		56	4	NM_017652	A0JLV8|A8MY63|B3KTS9|E7ERT1|G3XAH3	Missense_Mutation	SNP	ENST00000396154.2	37	CCDS42640.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.20|12.20	1.865596|1.865596	0.32977|0.32977	.|.	.|.	ENSG00000083828|ENSG00000083828	ENST00000396150|ENST00000449441;ENST00000391702;ENST00000396154	T|T;T	0.05580|0.07216	3.42|3.21;3.21	1.56|1.56	1.56|1.56	0.23342|0.23342	.|Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.|.	.|.	.|.	.|.	T|T	0.15435|0.15435	0.0372|0.0372	L|L	0.35793|0.35793	1.09|1.09	0.09310|0.09310	N|N	1|1	B|P	0.24483|0.41569	0.104|0.755	B|P	0.25405|0.60012	0.06|0.867	T|T	0.15093|0.15093	-1.0449|-1.0449	9|9	0.51188|0.87932	T|D	0.08|0	.|.	6.3684|6.3684	0.21468|0.21468	0.0:0.0:0.7077:0.2923|0.0:0.0:0.7077:0.2923	.|.	183|225	A0JLV8|Q9NXT0	.|ZN586_HUMAN	V|S	183|225;182;225	ENSP00000379454:G183V|ENSP00000375583:R182S;ENSP00000379458:R225S	ENSP00000379454:G183V|ENSP00000375583:R182S	G|R	+|+	2|3	0|2	ZNF586|ZNF586	62982442|62982442	0.000000|0.000000	0.05858|0.05858	0.013000|0.013000	0.15412|0.15412	0.008000|0.008000	0.06430|0.06430	-0.077000|-0.077000	0.11394|0.11394	0.822000|0.822000	0.34565|0.34565	0.591000|0.591000	0.81541|0.81541	GGA|AGG	.		0.428	ZNF586-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466825.2	NM_017652	
MTUS2	23281	hgsc.bcm.edu	37	13	29933476	29933476	+	Missense_Mutation	SNP	C	C	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr13:29933476C>T	ENST00000431530.3	+	6	3071	c.3013C>T	c.(3013-3015)Cgg>Tgg	p.R1005W		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	995	Localization to the growing distal tip of microtubules.					cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						TGAGGCTGAGCGGCAGCTGGT	0.627																																					p.R1005W		.											MTUS2_ENST00000431530,colon,carcinoma,0,1	MTUS2_ENST00000431530	0	0			c.C3013T						.						13.0	16.0	15.0					13																	29933476		2007	4164	6171	SO:0001583	missense	23281	exon6			GCTGAGCGGCAGC	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.3013C>T	13.37:g.29933476C>T	ENSP00000392057:p.Arg1005Trp	43	0		32	2	NM_001033602	A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	ENST00000431530.3	37	CCDS45022.1	.	.	.	.	.	.	.	.	.	.	C	18.60	3.659107	0.67586	.	.	ENSG00000132938	ENST00000431530	T	0.14266	2.52	4.91	1.79	0.24919	.	0.613274	0.14315	N	0.327413	T	0.26810	0.0656	L	0.43152	1.355	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.01121	-1.1445	9	.	.	.	.	11.9536	0.52968	0.4836:0.5164:0.0:0.0	.	995	Q5JR59	MTUS2_HUMAN	W	1005	ENSP00000392057:R1005W	.	R	+	1	2	MTUS2	28831476	0.998000	0.40836	0.999000	0.59377	0.970000	0.65996	0.217000	0.17603	0.593000	0.29745	0.591000	0.81541	CGG	.		0.627	MTUS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044336.3	XM_166270	
GOT1	2805	hgsc.bcm.edu	37	10	101163490	101163490	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr10:101163490C>A	ENST00000370508.5	-	6	811	c.784G>T	c.(784-786)Ggg>Tgg	p.G262W	GOT1_ENST00000543866.1_Missense_Mutation_p.G241W	NM_002079.2	NP_002070.1	P17174	AATC_HUMAN	glutamic-oxaloacetic transaminase 1, soluble	262					2-oxoglutarate metabolic process (GO:0006103)|aspartate biosynthetic process (GO:0006532)|aspartate catabolic process (GO:0006533)|aspartate metabolic process (GO:0006531)|carbohydrate metabolic process (GO:0005975)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to insulin stimulus (GO:0032869)|fatty acid homeostasis (GO:0055089)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glutamate catabolic process to 2-oxoglutarate (GO:0019551)|glutamate catabolic process to aspartate (GO:0019550)|glutamate metabolic process (GO:0006536)|glycerol biosynthetic process (GO:0006114)|L-methionine biosynthetic process from methylthioadenosine (GO:0019509)|oxaloacetate metabolic process (GO:0006107)|polyamine metabolic process (GO:0006595)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	carboxylic acid binding (GO:0031406)|L-aspartate:2-oxoglutarate aminotransferase activity (GO:0004069)|L-cysteine:2-oxoglutarate aminotransferase activity (GO:0047801)|L-phenylalanine:2-oxoglutarate aminotransferase activity (GO:0080130)|phosphatidylserine decarboxylase activity (GO:0004609)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)	p.G262W(2)		endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|prostate(2)	16		Ovarian(717;0.028)|Colorectal(252;0.234)		Epithelial(162;4.76e-10)|all cancers(201;3.84e-08)	L-Aspartic Acid(DB00128)|L-Cysteine(DB00151)	CTGTAGAGCCCGAAGTTCTTG	0.537																																					p.G262W	Melanoma(173;770 3544 21601)	.											GOT1,NS,carcinoma,0,1	GOT1	0	2	Substitution - Missense(2)	prostate(1)|lung(1)	c.G784T						.						81.0	78.0	79.0					10																	101163490		2203	4300	6503	SO:0001583	missense	2805	exon6			AGAGCCCGAAGTT	M37400	CCDS7479.1	10q24.1-q25.1	2013-05-29	2013-05-29		ENSG00000120053	ENSG00000120053	2.6.1.1		4432	protein-coding gene	gene with protein product	"""aspartate aminotransferase 1"", ""aspartate transaminase 1"""	138180	"""glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1)"""			1974457	Standard	NM_002079		Approved		uc001kpr.3	P17174	OTTHUMG00000018882	ENST00000370508.5:c.784G>T	10.37:g.101163490C>A	ENSP00000359539:p.Gly262Trp	45	0		34	2	NM_002079	B2R6R7|B7Z7E9|Q5VW80	Missense_Mutation	SNP	ENST00000370508.5	37	CCDS7479.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.710865	0.89112	.	.	ENSG00000120053	ENST00000370508;ENST00000535447;ENST00000543866	D;D	0.95756	-3.8;-3.8	5.3	5.3	0.74995	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.096735	0.64402	D	0.000001	D	0.98720	0.9570	H	0.97587	4.035	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99497	1.0952	10	0.87932	D	0	-10.0104	19.3592	0.94428	0.0:1.0:0.0:0.0	.	262	P17174	AATC_HUMAN	W	262;215;241	ENSP00000359539:G262W;ENSP00000445578:G241W	ENSP00000359539:G262W	G	-	1	0	GOT1	101153480	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.647000	0.89833	0.558000	0.71614	GGG	.		0.537	GOT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049794.1	NM_002079	
SEL1L	6400	hgsc.bcm.edu;bcgsc.ca	37	14	81946075	81946075	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr14:81946075G>T	ENST00000336735.4	-	20	2172	c.2056C>A	c.(2056-2058)Ctt>Att	p.L686I		NM_005065.5	NP_005056.3	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like (C. elegans)	686	Interaction with ERLEC1, OS9 and SYVN1.				Notch signaling pathway (GO:0007219)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	28				BRCA - Breast invasive adenocarcinoma(234;0.0299)		CGTTTCGCAAGGTGAATATCC	0.368																																					p.L686I		.											.	.	.	0			c.C2056A						.						72.0	73.0	73.0					14																	81946075		2203	4300	6503	SO:0001583	missense	6400	exon20			TCGCAAGGTGAAT		CCDS9876.1, CCDS58333.1	14q31	2011-03-31	2001-11-28		ENSG00000071537	ENSG00000071537			10717	protein-coding gene	gene with protein product	"""sel-1 suppressor of lin-12-like 1 (C. elegans)"""	602329	"""sel-1 (suppressor of lin-12, C.elegans)-like"""			9417916, 10051412, 16331677	Standard	NM_005065		Approved	IBD2, SEL1L1	uc010tvv.2	Q9UBV2		ENST00000336735.4:c.2056C>A	14.37:g.81946075G>T	ENSP00000337053:p.Leu686Ile	71	0		55	5	NM_005065	Q6UWT6|Q9P1T9|Q9UHK7	Missense_Mutation	SNP	ENST00000336735.4	37	CCDS9876.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.662571	0.88251	.	.	ENSG00000071537	ENST00000336735;ENST00000261258	T	0.55588	0.51	6.04	6.04	0.98038	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.70465	0.3227	L	0.50993	1.605	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.69989	-0.4995	10	0.87932	D	0	.	20.5948	0.99439	0.0:0.0:1.0:0.0	.	686	Q9UBV2	SE1L1_HUMAN	I	686;47	ENSP00000337053:L686I	ENSP00000261258:L47I	L	-	1	0	SEL1L	81015828	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	6.115000	0.71566	2.873000	0.98535	0.563000	0.77884	CTT	.		0.368	SEL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413325.1	NM_005065	
GPLD1	2822	hgsc.bcm.edu	37	6	24448239	24448239	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr6:24448239C>A	ENST00000230036.1	-	17	1654	c.1544G>T	c.(1543-1545)tGg>tTg	p.W515L		NM_001503.3	NP_001494.2	P80108	PHLD_HUMAN	glycosylphosphatidylinositol specific phospholipase D1	515					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to calcium ion (GO:0071277)|cellular response to cholesterol (GO:0071397)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|cellular response to pH (GO:0071467)|cellular response to triglyceride (GO:0071401)|chondrocyte differentiation (GO:0002062)|complement receptor mediated signaling pathway (GO:0002430)|GPI anchor release (GO:0006507)|hematopoietic stem cell migration (GO:0035701)|hematopoietic stem cell migration to bone marrow (GO:0097241)|insulin receptor signaling pathway (GO:0008286)|negative regulation of cell proliferation (GO:0008285)|negative regulation of triglyceride catabolic process (GO:0010897)|ossification (GO:0001503)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of high-density lipoprotein particle clearance (GO:0010983)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of secretion (GO:0051047)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cellular response to insulin stimulus (GO:1900076)|response to glucose (GO:0009749)|transepithelial transport (GO:0070633)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|proteinaceous extracellular matrix (GO:0005578)	glycosylphosphatidylinositol phospholipase D activity (GO:0004621)|phospholipase D activity (GO:0004630)|sodium channel regulator activity (GO:0017080)			breast(3)|endometrium(5)|kidney(1)|large_intestine(11)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	32						CAAGAGAGTCCAGCCCAAGTT	0.512																																					p.W515L		.											.	.	.	0			c.G1544T						.						109.0	98.0	102.0					6																	24448239		2203	4300	6503	SO:0001583	missense	2822	exon17			AGAGTCCAGCCCA	L11701	CCDS4553.1	6p22.1	2008-02-05			ENSG00000112293	ENSG00000112293			4459	protein-coding gene	gene with protein product		602515				11072085	Standard	NM_001503		Approved		uc003ned.2	P80108	OTTHUMG00000016104	ENST00000230036.1:c.1544G>T	6.37:g.24448239C>A	ENSP00000230036:p.Trp515Leu	54	0		73	3	NM_001503	Q15127|Q15128|Q2M2F2|Q5T3Y0|Q7Z6T8|Q8TCV0|Q8WW82|Q96ID6|Q9H167|Q9H4M1|Q9UJC9	Missense_Mutation	SNP	ENST00000230036.1	37	CCDS4553.1	.	.	.	.	.	.	.	.	.	.	C	18.51	3.640687	0.67244	.	.	ENSG00000112293	ENST00000230036	T	0.68025	-0.3	4.92	4.92	0.64577	.	0.087857	0.50627	D	0.000103	T	0.75280	0.3828	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73004	-0.4119	10	0.35671	T	0.21	-11.8505	18.0885	0.89466	0.0:1.0:0.0:0.0	.	515	P80108	PHLD_HUMAN	L	515	ENSP00000230036:W515L	ENSP00000230036:W515L	W	-	2	0	GPLD1	24556218	1.000000	0.71417	0.997000	0.53966	0.740000	0.42216	4.945000	0.63568	2.435000	0.82474	0.655000	0.94253	TGG	.		0.512	GPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043315.1	NM_001503	
STAB2	55576	hgsc.bcm.edu	37	12	104100719	104100719	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr12:104100719C>A	ENST00000388887.2	+	38	4350	c.4146C>A	c.(4144-4146)gcC>gcA	p.A1382A		NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						GCGGCACAGCCTGCGAGACCT	0.567																																					p.A1382A		.											STAB2,right_upper_lobe,carcinoma,0,1	STAB2	0	0			c.C4146A						.						116.0	93.0	101.0					12																	104100719		2203	4300	6503	SO:0001819	synonymous_variant	55576	exon38			CACAGCCTGCGAG	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.4146C>A	12.37:g.104100719C>A		25	0		14	2	NM_017564		Silent	SNP	ENST00000388887.2	37	CCDS31888.1																																																																																			.		0.567	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
MED13	9969	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	60043913	60043913	+	Missense_Mutation	SNP	C	C	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr17:60043913C>T	ENST00000397786.2	-	19	4367	c.4291G>A	c.(4291-4293)Gta>Ata	p.V1431I		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	1431					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						CATTCTGCTACCAACTTTTCT	0.403																																					p.V1431I		.											.	.	.	0			c.G4291A						.						150.0	135.0	140.0					17																	60043913		1875	4110	5985	SO:0001583	missense	9969	exon19			CTGCTACCAACTT	AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.4291G>A	17.37:g.60043913C>T	ENSP00000380888:p.Val1431Ile	54	0		56	14	NM_005121	B2RU05|O60334	Missense_Mutation	SNP	ENST00000397786.2	37	CCDS42366.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.078979	0.76528	.	.	ENSG00000108510	ENST00000397786;ENST00000262436	T	0.63096	-0.02	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.62744	0.2453	M	0.69358	2.11	0.80722	D	1	P	0.39831	0.69	B	0.36666	0.23	T	0.64411	-0.6414	10	0.37606	T	0.19	-19.2005	19.363	0.94448	0.0:1.0:0.0:0.0	.	1431	Q9UHV7	MED13_HUMAN	I	1431;1430	ENSP00000380888:V1431I	ENSP00000262436:V1430I	V	-	1	0	MED13	57398695	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.727000	0.68523	2.584000	0.87258	0.563000	0.77884	GTA	.		0.403	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445461.1	NM_005121	
MAP3K8	1326	hgsc.bcm.edu	37	10	30747044	30747044	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr10:30747044G>T	ENST00000263056.1	+	7	1601	c.905G>T	c.(904-906)aGg>aTg	p.R302M	MAP3K8_ENST00000542547.1_Missense_Mutation_p.R302M|MAP3K8_ENST00000375321.1_Missense_Mutation_p.R302M	NM_001244134.1|NM_005204.3	NP_001231063.1|NP_005195.2	P41279	M3K8_HUMAN	mitogen-activated protein kinase kinase kinase 8	302	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|protein phosphorylation (GO:0006468)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		Prostate(175;0.151)				ATCCTGTGCAGGGGCCATTCA	0.547																																					p.R302M		.											MAP3K8,NS,carcinoma,0,1	MAP3K8	0	0			c.G905T						.						90.0	91.0	91.0					10																	30747044		2203	4300	6503	SO:0001583	missense	1326	exon6			TGTGCAGGGGCCA	D14497	CCDS7166.1	10p11.2	2011-06-09			ENSG00000107968	ENSG00000107968		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6860	protein-coding gene	gene with protein product		191195		COT, ESTF		2072910, 8479752	Standard	NM_005204		Approved	Tpl-2, EST, c-COT, MEKK8	uc009xlf.2	P41279	OTTHUMG00000017889	ENST00000263056.1:c.905G>T	10.37:g.30747044G>T	ENSP00000263056:p.Arg302Met	44	0		45	3	NM_001244134	A8K2Q5|D3DRX1|Q14275|Q5T855|Q9HC81	Missense_Mutation	SNP	ENST00000263056.1	37	CCDS7166.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.749977	0.89753	.	.	ENSG00000107968	ENST00000375328;ENST00000263056;ENST00000542547;ENST00000375321	T;T;T	0.67171	-0.25;-0.25;-0.25	5.05	5.05	0.67936	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.75917	0.3915	L	0.38838	1.175	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.76520	-0.2929	10	0.49607	T	0.09	.	18.8345	0.92155	0.0:0.0:1.0:0.0	.	302	P41279	M3K8_HUMAN	M	302	ENSP00000263056:R302M;ENSP00000443610:R302M;ENSP00000364470:R302M	ENSP00000263056:R302M	R	+	2	0	MAP3K8	30787050	1.000000	0.71417	0.966000	0.40874	0.925000	0.55904	9.203000	0.95033	2.537000	0.85549	0.644000	0.83932	AGG	.		0.547	MAP3K8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047416.2	NM_005204	
SSH1	54434	hgsc.bcm.edu	37	12	109182282	109182282	+	Missense_Mutation	SNP	C	C	A	rs367620838		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr12:109182282C>A	ENST00000326495.5	-	15	2725	c.2632G>T	c.(2632-2634)Ggg>Tgg	p.G878W	SSH1_ENST00000360239.3_Missense_Mutation_p.G566W	NM_018984.3	NP_061857.3	Q8WYL5	SSH1_HUMAN	slingshot protein phosphatase 1	878					actin cytoskeleton organization (GO:0030036)|cell morphogenesis (GO:0000902)|cellular response to ATP (GO:0071318)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of cellular protein metabolic process (GO:0032268)|regulation of lamellipodium assembly (GO:0010591)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TCATCACTCCCGGCCTGGCTG	0.652																																					p.G878W		.											SSH1,NS,carcinoma,0,1	SSH1	0	0			c.G2632T						.						23.0	28.0	26.0					12																	109182282		2199	4298	6497	SO:0001583	missense	54434	exon15			CACTCCCGGCCTG	BC062341	CCDS9121.1, CCDS53825.1, CCDS55882.1	12q24.12	2013-03-05	2013-03-05			ENSG00000084112		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30579	protein-coding gene	gene with protein product		606778	"""slingshot homolog 1 (Drosophila)"""			10718198, 11832213	Standard	NM_018984		Approved	KIAA1298	uc001tnm.3	Q8WYL5	OTTHUMG00000169371	ENST00000326495.5:c.2632G>T	12.37:g.109182282C>A	ENSP00000315713:p.Gly878Trp	42	0		39	2	NM_018984	Q6P6C0|Q8N9A7|Q8WYL3|Q8WYL4|Q9P2P8	Missense_Mutation	SNP	ENST00000326495.5	37	CCDS9121.1	.	.	.	.	.	.	.	.	.	.	C	10.33	1.321187	0.23994	.	.	ENSG00000084112	ENST00000360239;ENST00000326495	T;T	0.12465	2.84;2.68	4.11	1.23	0.21249	.	1.114910	0.07262	U	0.867665	T	0.22589	0.0545	L	0.36672	1.1	0.09310	N	1	D;D	0.76494	0.981;0.999	P;D	0.63381	0.755;0.914	T	0.20974	-1.0259	10	0.72032	D	0.01	-1.536	5.7082	0.17921	0.0:0.6514:0.1696:0.179	.	878;566	Q8WYL5;Q8WYL5-4	SSH1_HUMAN;.	W	566;878	ENSP00000353374:G566W;ENSP00000315713:G878W	ENSP00000315713:G878W	G	-	1	0	SSH1	107706411	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	0.557000	0.23454	0.150000	0.19136	0.655000	0.94253	GGG	.		0.652	SSH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403724.1	NM_018984	
SLC12A7	10723	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	1077985	1077985	+	Missense_Mutation	SNP	T	T	C			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr5:1077985T>C	ENST00000264930.5	-	12	1635	c.1592A>G	c.(1591-1593)cAg>cGg	p.Q531R		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	531					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	GGCAATGGCCTGCAGTAGGCG	0.701																																					p.Q531R		.											.	.	.	0			c.A1592G						.						20.0	20.0	20.0					5																	1077985		2183	4285	6468	SO:0001583	missense	10723	exon12			ATGGCCTGCAGTA	AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.1592A>G	5.37:g.1077985T>C	ENSP00000264930:p.Gln531Arg	55	0		44	18	NM_006598	A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Missense_Mutation	SNP	ENST00000264930.5	37	CCDS34129.1	.	.	.	.	.	.	.	.	.	.	t	20.1	3.936203	0.73442	.	.	ENSG00000113504	ENST00000264930	D	0.98807	-5.15	3.57	3.57	0.40892	Amino acid permease domain (1);	0.066707	0.64402	D	0.000010	D	0.99152	0.9707	M	0.94101	3.495	0.80722	D	1	D	0.71674	0.998	D	0.65323	0.934	D	0.99180	1.0867	10	0.87932	D	0	.	11.6533	0.51301	0.0:0.0:0.0:1.0	.	531	Q9Y666	S12A7_HUMAN	R	531	ENSP00000264930:Q531R	ENSP00000264930:Q531R	Q	-	2	0	SLC12A7	1130985	1.000000	0.71417	1.000000	0.80357	0.579000	0.36224	6.798000	0.75155	1.579000	0.49836	0.402000	0.26972	CAG	.		0.701	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366446.2	NM_006598	
CYTH3	9265	hgsc.bcm.edu;bcgsc.ca	37	7	6226714	6226714	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr7:6226714C>A	ENST00000350796.3	-	4	352	c.216G>T	c.(214-216)atG>atT	p.M72I		NM_004227.3	NP_004218.1	O43739	CYH3_HUMAN	cytohesin 3	72					establishment of epithelial cell polarity (GO:0090162)|Golgi vesicle transport (GO:0048193)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)	cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|urinary_tract(1)	19						TCTTTCTTCCCATGGCTATCT	0.433																																					p.M72I		.											.	.	.	0			c.G216T						.						313.0	286.0	296.0					7																	6226714		2203	4300	6503	SO:0001583	missense	9265	exon4			TCTTCCCATGGCT	AJ223957	CCDS5346.1	7p22.1	2014-05-02	2008-08-14	2008-08-14	ENSG00000008256	ENSG00000008256		"""Pleckstrin homology (PH) domain containing"""	9504	protein-coding gene	gene with protein product		605081	"""pleckstrin homology, Sec7 and coiled-coil domains 3"""	PSCD3		9072969	Standard	NM_004227		Approved	GRP1, ARNO3, cytohesin-3	uc003spt.3	O43739	OTTHUMG00000023440	ENST00000350796.3:c.216G>T	7.37:g.6226714C>A	ENSP00000297044:p.Met72Ile	45	0		58	4	NM_004227	A4D2N8	Missense_Mutation	SNP	ENST00000350796.3	37	CCDS5346.1	.	.	.	.	.	.	.	.	.	.	C	8.280	0.815233	0.16607	.	.	ENSG00000008256	ENST00000350796	T	0.53640	0.61	5.36	5.36	0.76844	.	0.071925	0.85682	D	0.000000	T	0.20047	0.0482	N	0.00569	-1.365	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16364	-1.0405	10	0.26408	T	0.33	.	18.2057	0.89853	0.0:1.0:0.0:0.0	.	72	O43739-2	.	I	72	ENSP00000297044:M72I	ENSP00000297044:M72I	M	-	3	0	CYTH3	6193239	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.373000	0.59537	2.651000	0.90000	0.655000	0.94253	ATG	.		0.433	CYTH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207396.2	NM_004227	
IMPG2	50939	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	100963395	100963395	+	Missense_Mutation	SNP	C	C	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr3:100963395C>T	ENST00000193391.7	-	13	1967	c.1780G>A	c.(1780-1782)Gag>Aag	p.E594K		NM_016247.3	NP_057331.2	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	594					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)|receptor complex (GO:0043235)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)			NS(1)|breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(14)|lung(32)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64					Hyaluronan(DB08818)	AATATTAACTCTTTTTCCATG	0.453																																					p.E594K		.											.	.	.	0			c.G1780A						.						136.0	129.0	132.0					3																	100963395		2203	4300	6503	SO:0001583	missense	50939	exon13			TTAACTCTTTTTC	AF173155	CCDS2940.1	3q12.2-q12.3	2014-01-28			ENSG00000081148	ENSG00000081148			18362	protein-coding gene	gene with protein product		607056				10542133	Standard	NM_016247		Approved	IPM200, RP56	uc003duq.2	Q9BZV3	OTTHUMG00000159091	ENST00000193391.7:c.1780G>A	3.37:g.100963395C>T	ENSP00000193391:p.Glu594Lys	58	0		57	28	NM_016247	A8MWT5|Q9UKD4|Q9UKK5	Missense_Mutation	SNP	ENST00000193391.7	37	CCDS2940.1	.	.	.	.	.	.	.	.	.	.	C	11.19	1.566507	0.27915	.	.	ENSG00000081148	ENST00000193391	T	0.24350	1.86	5.88	5.88	0.94601	.	0.408515	0.25500	N	0.030253	T	0.17534	0.0421	L	0.29908	0.895	0.25627	N	0.986349	P;P	0.39282	0.666;0.666	B;B	0.35039	0.194;0.194	T	0.19192	-1.0313	10	0.25106	T	0.35	-0.2158	12.0779	0.53655	0.0:0.9152:0.0:0.0848	.	594;594	F1T0J3;Q9BZV3	.;IMPG2_HUMAN	K	594	ENSP00000193391:E594K	ENSP00000193391:E594K	E	-	1	0	IMPG2	102446085	0.384000	0.25164	0.995000	0.50966	0.059000	0.15707	1.341000	0.33907	2.780000	0.95670	0.655000	0.94253	GAG	.		0.453	IMPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353256.3		
HRC	3270	hgsc.bcm.edu	37	19	49657713	49657713	+	Missense_Mutation	SNP	T	T	A	rs547456261|rs61355957|rs61198077|rs66501117|rs531655952|rs534731199|rs569932130	byFrequency	TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	T	T	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr19:49657713T>A	ENST00000252825.4	-	1	968	c.782A>T	c.(781-783)gAt>gTt	p.D261V	HRC_ENST00000595625.1_Missense_Mutation_p.D261V	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	261	4 X tandem repeats, acidic.|6 X approximate tandem repeats.|Asp-rich (acidic).				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		AATGGAGAcatcatcatcatc	0.498																																					p.D261V	Melanoma(37;75 1097 24567 25669 30645)	.											HRC,NS,carcinoma,0,1	HRC	0	0			c.A782T						.						143.0	105.0	118.0					19																	49657713		2203	4300	6503	SO:0001583	missense	3270	exon1			GAGACATCATCAT		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.782A>T	19.37:g.49657713T>A	ENSP00000252825:p.Asp261Val	11	0		12	2	NM_002152	Q504Y6	Missense_Mutation	SNP	ENST00000252825.4	37	CCDS12759.1	.	.	.	.	.	.	.	.	.	.	T	12.96	2.093755	0.36952	.	.	ENSG00000130528	ENST00000252825;ENST00000434964	T	0.33438	1.41	3.29	1.02	0.19986	.	.	.	.	.	T	0.26738	0.0654	M	0.69823	2.125	0.09310	N	0.999995	B	0.24618	0.107	B	0.19666	0.026	T	0.29671	-1.0004	9	0.36615	T	0.2	2.7396	2.2712	0.04091	0.249:0.1435:0.0:0.6075	.	261	P23327	SRCH_HUMAN	V	261;231	ENSP00000252825:D261V	ENSP00000252825:D261V	D	-	2	0	HRC	54349525	0.000000	0.05858	0.174000	0.22961	0.528000	0.34623	-1.362000	0.02595	0.283000	0.22279	0.374000	0.22700	GAT	.		0.498	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
CAPN9	10753	broad.mit.edu	37	1	230928600	230928600	+	Frame_Shift_Del	DEL	T	T	-			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:230928600delT	ENST00000271971.2	+	17	1909	c.1796delT	c.(1795-1797)cttfs	p.L599fs	RP11-99J16__A.2_ENST00000412344.1_RNA|CAPN9_ENST00000480004.1_3'UTR|CAPN9_ENST00000366666.2_Frame_Shift_Del_p.L536fs|RP11-99J16__A.2_ENST00000428480.1_RNA|RP11-99J16__A.2_ENST00000452640.1_RNA|CAPN9_ENST00000354537.1_Frame_Shift_Del_p.L573fs	NM_006615.2	NP_006606.1	O14815	CAN9_HUMAN	calpain 9	599	Domain IV.|EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	25	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)				CTTTAGAACCTTTTCCTTCGG	0.532																																					p.L599fs													.	CAPN9	116	0			c.1796delT						.						140.0	144.0	143.0					1																	230928600		2203	4300	6503	SO:0001589	frameshift_variant	10753	exon17			AGAACCTTTTCCT	AF022799	CCDS1586.1, CCDS31053.1	1q42.11-q42.3	2013-01-10	2004-11-11		ENSG00000135773	ENSG00000135773		"""EF-hand domain containing"""	1486	protein-coding gene	gene with protein product	"""novel calpain large subunit-4"""	606401	"""calpain 9 (nCL-4)"""			9524069, 10835488	Standard	XM_005273010		Approved	nCL-4, GC36	uc001htz.1	O14815	OTTHUMG00000037779	ENST00000271971.2:c.1796delT	1.37:g.230928600delT	ENSP00000271971:p.Leu599fs	19	0		6	2	NM_006615	B1APS1|B1AQI0|Q9NS74	Frame_Shift_Del	DEL	ENST00000271971.2	37	CCDS1586.1																																																																																			.		0.532	CAPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092179.1	NM_006615	
SPEN	23013	broad.mit.edu	37	1	16261510	16261510	+	Frame_Shift_Del	DEL	G	G	-			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:16261510delG	ENST00000375759.3	+	11	8979	c.8775delG	c.(8773-8775)cagfs	p.Q2925fs		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	2925					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CTGTCACCCAGGGAGGCACAG	0.562																																					p.Q2925fs													.	SPEN	374	0			c.8775delG						.						57.0	56.0	57.0					1																	16261510		2203	4300	6503	SO:0001589	frameshift_variant	23013	exon11			CACCCAGGGAGGC		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.8775delG	1.37:g.16261510delG	ENSP00000364912:p.Gln2925fs	6	0		6	2	NM_015001	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Frame_Shift_Del	DEL	ENST00000375759.3	37	CCDS164.1																																																																																			.		0.562	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
KRTAP5-4	387267	broad.mit.edu	37	11	1642976	1642976	+	Silent	SNP	A	A	C	rs569029116	byFrequency	TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr11:1642976A>C	ENST00000399682.1	-	1	392	c.348T>G	c.(346-348)ggT>ggG	p.G116G		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0	9 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.G116G(3)		NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCCCCTTGGAACCCCCACAGG	0.662													a|||	27	0.00539137	0.0068	0.0	5008	,	,		10207	0.001		0.005	False		,,,				2504	0.0123				p.G116G													KRTAP5-4,NS,carcinoma,0,5	KRTAP5-4	78	3	Substitution - coding silent(3)	endometrium(2)|prostate(1)	c.T348G						.						10.0	20.0	17.0					11																	1642976		677	1565	2242	SO:0001819	synonymous_variant	387267	exon1			CTTGGAACCCCCA	AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.348T>G	11.37:g.1642976A>C		63	1		69	12	NM_001012709		Silent	SNP	ENST00000399682.1	37																																																																																				.		0.662	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000127918.1	NM_001012709	
IL10RA	3587	broad.mit.edu	37	11	117869604	117869604	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr11:117869604C>A	ENST00000227752.3	+	7	1105	c.985C>A	c.(985-987)Cag>Aag	p.Q329K	IL10RA_ENST00000545409.1_Missense_Mutation_p.Q180K|IL10RA_ENST00000541785.1_Missense_Mutation_p.Q309K|IL10RA_ENST00000533700.1_3'UTR	NM_001558.3	NP_001549.2	Q13651	I10R1_HUMAN	interleukin 10 receptor, alpha	329					cytokine-mediated signaling pathway (GO:0019221)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-10 receptor activity (GO:0004920)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(2)|prostate(1)	19	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)|Epithelial(105;0.00108)		GCCATCCCTGCAGACTGAAGA	0.607																																					p.Q329K													.	IL10RA	46	0			c.C985A						.						83.0	71.0	75.0					11																	117869604		2200	4296	6496	SO:0001583	missense	3587	exon7			TCCCTGCAGACTG	U00672	CCDS8388.1	11q23	2014-09-17			ENSG00000110324	ENSG00000110324		"""Interleukins and interleukin receptors"", ""CD molecules"""	5964	protein-coding gene	gene with protein product		146933		IL10R		8120391	Standard	NR_026691		Approved	HIL-10R, CDW210A, CD210a, CD210	uc001prv.3	Q13651	OTTHUMG00000166523	ENST00000227752.3:c.985C>A	11.37:g.117869604C>A	ENSP00000227752:p.Gln329Lys	32	0		32	3	NM_001558	A8K6I0|B0YJ27	Missense_Mutation	SNP	ENST00000227752.3	37	CCDS8388.1	.	.	.	.	.	.	.	.	.	.	C	19.98	3.926862	0.73327	.	.	ENSG00000110324	ENST00000227752;ENST00000541785;ENST00000545409;ENST00000536858	T;T;T	0.25085	1.82;1.82;1.82	5.56	5.56	0.83823	.	0.786477	0.11748	N	0.533297	T	0.32346	0.0826	M	0.71581	2.175	0.33392	D	0.576225	P;P	0.45715	0.865;0.787	B;B	0.43478	0.421;0.241	T	0.35226	-0.9797	10	0.06625	T	0.88	-23.9982	16.2392	0.82399	0.0:1.0:0.0:0.0	.	309;329	F5GYV8;Q13651	.;I10R1_HUMAN	K	329;309;180;309	ENSP00000227752:Q329K;ENSP00000441397:Q309K;ENSP00000443019:Q180K	ENSP00000227752:Q329K	Q	+	1	0	IL10RA	117374814	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.524000	0.45589	2.607000	0.88179	0.563000	0.77884	CAG	.		0.607	IL10RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390167.1		
RP11-24M17.5	0	broad.mit.edu;ucsc.edu	37	15	76074431	76074431	+	RNA	SNP	C	C	T	rs371238897		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr15:76074431C>T	ENST00000395215.3	+	0	610																		p.S190L(2)									CTCCAGTCCTCGAGCTGCAGA	0.547																																					.													ENSG00000187812,NS,carcinoma,0,7	.	.	2	Substitution - Missense(2)	endometrium(2)	.						.																																					0	.			AGTCCTCGAGCTG																													15.37:g.76074431C>T		54	1		54	6	.		RNA	SNP	ENST00000395215.3	37		.	.	.	.	.	.	.	.	.	.	.	3.205	-0.162863	0.06502	.	.	ENSG00000187812	ENST00000395215	.	.	.	0.789	0.789	0.18607	.	.	.	.	.	T	0.29850	0.0746	.	.	.	.	.	.	B	0.20550	0.046	B	0.15870	0.014	T	0.30208	-0.9986	6	0.27082	T	0.32	.	7.4893	0.27452	0.0:0.9999:0.0:1.0E-4	.	190	B4DZE6	.	L	190	.	ENSP00000378641:S190L	S	+	2	0	AC019294.2	73861486	0.987000	0.35691	0.013000	0.15412	0.024000	0.10985	3.310000	0.51911	0.745000	0.32763	0.274000	0.19336	TCG	.		0.547	RP11-24M17.5-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000420501.1		
LYSMD4	145748	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	100272030	100272030	+	Missense_Mutation	SNP	C	C	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr15:100272030C>T	ENST00000409796.1	-	2	237	c.175G>A	c.(175-177)Ggt>Agt	p.G59S	LYSMD4_ENST00000344791.2_Silent_p.A29A|LYSMD4_ENST00000332728.4_Missense_Mutation_p.G59S|LYSMD4_ENST00000604213.1_Intron|LYSMD4_ENST00000545021.1_5'UTR	NM_001284417.1|NM_001284418.1|NM_001284420.1	NP_001271346.1|NP_001271347.1|NP_001271349.1	Q5XG99	LYSM4_HUMAN	LysM, putative peptidoglycan-binding, domain containing 4	59						integral component of membrane (GO:0016021)				breast(1)|cervix(1)|kidney(2)|large_intestine(2)|lung(3)|stomach(1)	10	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00162)|LUSC - Lung squamous cell carcinoma(107;0.17)|Lung(145;0.208)			TGGTGGACACCGCTCTTGTGG	0.627																																					p.A29A													.	LYSMD4	21	0			c.G87A						.						38.0	39.0	39.0					15																	100272030		2203	4300	6503	SO:0001583	missense	145748	exon3			GGACACCGCTCTT	BC041097	CCDS10381.1, CCDS66876.1, CCDS66877.1, CCDS73788.1	15q26.3	2005-10-24			ENSG00000183060	ENSG00000183060			26571	protein-coding gene	gene with protein product						12477932	Standard	NM_001284418		Approved	FLJ33008	uc002bvl.3	Q5XG99	OTTHUMG00000149853	ENST00000409796.1:c.175G>A	15.37:g.100272030C>T	ENSP00000386283:p.Gly59Ser	99	1		74	19	NM_152449	A6NII6|A8K2N1|Q96LY7	Missense_Mutation	SNP	ENST00000409796.1	37		.	.	.	.	.	.	.	.	.	.	C	0.012	-1.656109	0.00779	.	.	ENSG00000183060	ENST00000409796;ENST00000332728	T;T	0.17528	2.27;2.27	4.92	-0.608	0.11611	.	.	.	.	.	T	0.05273	0.0140	.	.	.	0.18873	N	0.999984	B	0.19706	0.038	B	0.12837	0.008	T	0.40979	-0.9534	8	0.02654	T	1	-5.4007	5.4922	0.16783	0.1449:0.3689:0.0:0.4862	.	59	Q5XG99	LYSM4_HUMAN	S	59	ENSP00000386283:G59S;ENSP00000333008:G59S	ENSP00000333008:G59S	G	-	1	0	LYSMD4	98089553	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	0.319000	0.19522	-0.161000	0.10983	0.655000	0.94253	GGT	.		0.627	LYSMD4-005	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000335634.1	NM_152449	
PPL	5493	broad.mit.edu	37	16	4945406	4945406	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr16:4945406G>T	ENST00000345988.2	-	11	1187	c.1098C>A	c.(1096-1098)gaC>gaA	p.D366E	PPL_ENST00000590782.2_Missense_Mutation_p.D364E	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	366					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						CCTTCTCCTGGTCCTGGAGAG	0.652																																					p.D366E													.	PPL	168	0			c.C1098A						.						38.0	37.0	38.0					16																	4945406		2197	4300	6497	SO:0001583	missense	5493	exon11			CTCCTGGTCCTGG	AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.1098C>A	16.37:g.4945406G>T	ENSP00000340510:p.Asp366Glu	51	0		44	3	NM_002705	O60314|O60454|Q14C98	Missense_Mutation	SNP	ENST00000345988.2	37	CCDS10526.1	.	.	.	.	.	.	.	.	.	.	G	15.79	2.938091	0.52972	.	.	ENSG00000118898	ENST00000345988	D	0.94576	-3.46	4.57	2.36	0.29203	.	0.000000	0.85682	D	0.000000	D	0.93517	0.7931	L	0.35542	1.07	0.36575	D	0.873205	D	0.76494	0.999	D	0.78314	0.991	D	0.90922	0.4784	10	0.13853	T	0.58	.	10.0759	0.42360	0.0841:0.2616:0.6543:0.0	.	366	O60437	PEPL_HUMAN	E	366	ENSP00000340510:D366E	ENSP00000340510:D366E	D	-	3	2	PPL	4885407	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	1.475000	0.35409	1.083000	0.41159	0.561000	0.74099	GAC	.		0.652	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251715.1	NM_002705	
COG7	91949	broad.mit.edu	37	16	23415150	23415150	+	Silent	SNP	T	T	C			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr16:23415150T>C	ENST00000307149.5	-	13	1853	c.1668A>G	c.(1666-1668)aaA>aaG	p.K556K		NM_153603.3	NP_705831.1	P83436	COG7_HUMAN	component of oligomeric golgi complex 7	556					intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to Golgi apparatus (GO:0034067)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(7)|large_intestine(9)|liver(1)|lung(7)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.0401)		TGCTTGACCCTTTTTCCTAAG	0.507																																					p.K556K													.	COG7	62	0			c.A1668G						.						69.0	59.0	63.0					16																	23415150		2197	4300	6497	SO:0001819	synonymous_variant	91949	exon13			TGACCCTTTTTCC	AF070568	CCDS10610.1	16p12.2	2008-02-05			ENSG00000168434	ENSG00000168434		"""Components of oligomeric golgi complex"""	18622	protein-coding gene	gene with protein product		606978				11980916	Standard	NM_153603		Approved		uc002dlo.3	P83436	OTTHUMG00000094807	ENST00000307149.5:c.1668A>G	16.37:g.23415150T>C		79	0		70	3	NM_153603	Q6UWU7	Silent	SNP	ENST00000307149.5	37	CCDS10610.1																																																																																			.		0.507	COG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211625.1		
RP11-429P3.3	0	broad.mit.edu	37	16	50091423	50091424	+	RNA	DEL	AC	AC	-	rs199708338|rs567632314	byFrequency	TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr16:50091423_50091424delAC	ENST00000568130.2	-	0	289																											AGAATTGcatacacacacacac	0.376																																					.													.	.	.	0			.						.																																					0	.			TTGCATACACACA																													16.37:g.50091433_50091434delAC		8	0		9	4	.		RNA	DEL	ENST00000568130.2	37																																																																																				.		0.376	RP11-429P3.3-001	KNOWN	basic	antisense	antisense	OTTHUMT00000423139.2		
GPR179	440435	broad.mit.edu;ucsc.edu	37	17	36489224	36489224	+	Silent	SNP	G	G	A	rs372049950		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr17:36489224G>A	ENST00000342292.4	-	10	1967	c.1947C>T	c.(1945-1947)gaC>gaT	p.D649D		NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	649					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				GGTCCAGCTCGTCCTCACACA	0.622																																					p.D649D													.	GPR179	170	0			c.C1947T						.	G		0,4372		0,0,2186	61.0	70.0	67.0		1947	-10.4	0.2	17		67	1,8573		0,1,4286	no	coding-synonymous	GPR179	NM_001004334.2		0,1,6472	AA,AG,GG		0.0117,0.0,0.0077		649/2368	36489224	1,12945	2186	4287	6473	SO:0001819	synonymous_variant	440435	exon10			CAGCTCGTCCTCA		CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.1947C>T	17.37:g.36489224G>A		13	0		18	6	NM_001004334		Silent	SNP	ENST00000342292.4	37	CCDS42308.1																																																																																			.		0.622	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255329.2		
EVPL	2125	broad.mit.edu	37	17	74003247	74003247	+	Silent	SNP	C	C	T	rs201429993		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr17:74003247C>T	ENST00000301607.3	-	22	6292	c.6039G>A	c.(6037-6039)gcG>gcA	p.A2013A	TEN1-CDK3_ENST00000567351.1_RNA|EVPL_ENST00000586740.1_Silent_p.A2035A	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	2013	Globular 2.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						CCTCCAGTGCCGCTGGCAGGA	0.672																																					p.A2013A													.	EVPL	155	0			c.G6039A						.						37.0	40.0	39.0					17																	74003247		2202	4298	6500	SO:0001819	synonymous_variant	2125	exon22			CAGTGCCGCTGGC	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.6039G>A	17.37:g.74003247C>T		53	0		51	3	NM_001988	A0AUV5	Silent	SNP	ENST00000301607.3	37	CCDS11737.1																																																																																			C|0.999;T|0.001		0.672	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449483.1	NM_001988	
KLHL14	57565	broad.mit.edu	37	18	30260289	30260289	+	Splice_Site	SNP	C	C	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr18:30260289C>T	ENST00000359358.4	-	7	1869	c.1431G>A	c.(1429-1431)ggG>ggA	p.G477G		NM_020805.1	NP_065856.1	Q9P2G3	KLH14_HUMAN	kelch-like family member 14	477						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(20)|ovary(2)	31						TGTGTACACCCCCTGTGAAAT	0.393																																					p.G477G													.	KLHL14	92	0			c.G1431A						.						150.0	139.0	143.0					18																	30260289		2203	4300	6503	SO:0001630	splice_region_variant	57565	exon7			TACACCCCCTGTG	AB037805	CCDS32813.1	18q12.1	2013-10-15	2013-01-30		ENSG00000197705	ENSG00000197705		"""Kelch-like"", ""BTB/POZ domain containing"""	29266	protein-coding gene	gene with protein product	"""printor"""	613772	"""kelch-like 14 (Drosophila)"""			10718198, 19535332	Standard	NM_020805		Approved	KIAA1384	uc002kxm.1	Q9P2G3	OTTHUMG00000179819	ENST00000359358.4:c.1430-1G>A	18.37:g.30260289C>T		54	0		51	4	NM_020805	A6NNW1|B4DHA0|Q8WU41	Splice_Site	SNP	ENST00000359358.4	37	CCDS32813.1																																																																																			.		0.393	KLHL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448376.1		Silent
CEACAM20	125931	broad.mit.edu	37	19	45017504	45017504	+	RNA	DEL	T	T	-	rs398034749		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr19:45017504delT	ENST00000454753.1	-	0	1588							Q6UY09	CEA20_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 20							integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)	15		Prostate(69;0.0352)				ttggttttgcttttttttttt	0.458																																					.													.	CEACAM20	31	0			.						.																																					125931	.			TTTTGCTTTTTTT	AY358129	CCDS74390.1, CCDS74391.1, CCDS74392.1, CCDS74393.1	19q13.31	2013-01-30			ENSG00000176395	ENSG00000273777		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	24879	protein-coding gene	gene with protein product						12975309	Standard	NM_001102600		Approved	UNQ9366	uc010ejo.1	Q6UY09	OTTHUMG00000151532		19.37:g.45017504delT		4	0		11	4	.		RNA	DEL	ENST00000454753.1	37																																																																																				.		0.458	CEACAM20-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000323032.1	NM_198444	
CTC-457E21.9	0	broad.mit.edu	37	19	22882603	22882603	+	RNA	DEL	T	T	-			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr19:22882603delT	ENST00000601860.1	-	0	340				CTC-457E21.9_ENST00000597533.1_RNA																							GTGCTGGCTCttttttttagt	0.343																																					.													.	.	.	0			.						.																																					0	.			TGGCTCTTTTTTT																													19.37:g.22882603delT		4	0		6	2	.		RNA	DEL	ENST00000601860.1	37																																																																																				.		0.343	CTC-457E21.9-001	KNOWN	basic	antisense	antisense	OTTHUMT00000464586.1		
GPR113	165082	broad.mit.edu;bcgsc.ca	37	2	26536340	26536340	+	Missense_Mutation	SNP	T	T	C			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr2:26536340T>C	ENST00000311519.1	-	9	1377	c.1378A>G	c.(1378-1380)Ata>Gta	p.I460V	GPR113_ENST00000541401.1_Missense_Mutation_p.I63V|GPR113_ENST00000459892.1_5'UTR|GPR113_ENST00000333478.6_Missense_Mutation_p.I261V|GPR113_ENST00000421160.2_Missense_Mutation_p.I391V	NM_001145168.1	NP_001138640.1	Q8IZF5	GP113_HUMAN	G protein-coupled receptor 113	460					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTCCTCACTATGCCCCTCTTG	0.622																																					p.I460V													.	GPR113	134	0			c.A1378G						.						41.0	37.0	38.0					2																	26536340		2203	4300	6503	SO:0001583	missense	165082	exon9			TCACTATGCCCCT	AB083619	CCDS33159.2, CCDS46238.1, CCDS46239.1	2p24.1	2014-08-08			ENSG00000173567	ENSG00000173567		"""-"", ""GPCR / Class B : Orphans"""	18989	protein-coding gene	gene with protein product						12435584	Standard	NM_153835		Approved	hGPCR37, PGR23	uc002rhe.4	Q8IZF5	OTTHUMG00000150225	ENST00000311519.1:c.1378A>G	2.37:g.26536340T>C	ENSP00000307831:p.Ile460Val	33	0		18	5	NM_001145168	B4DF15|E9PEV1|Q53TA5|Q6UXT7|Q6UXX3|Q86SL7|Q8IXD8|Q8TDT3	Missense_Mutation	SNP	ENST00000311519.1	37	CCDS46239.1	.	.	.	.	.	.	.	.	.	.	T	6.523	0.464792	0.12402	.	.	ENSG00000173567	ENST00000541401;ENST00000333478;ENST00000421160;ENST00000311519	T;T;T;T	0.51817	0.69;3.18;3.18;3.18	5.84	-7.17	0.01511	GPCR, family 2, extracellular hormone receptor domain (2);	.	.	.	.	T	0.11324	0.0276	N	0.00926	-1.1	0.09310	N	1	B;B;B;B	0.06786	0.001;0.001;0.0;0.0	B;B;B;B	0.11329	0.006;0.006;0.0;0.0	T	0.20107	-1.0285	9	0.05620	T	0.96	-0.6797	4.1879	0.10407	0.1011:0.4362:0.1025:0.3602	.	391;261;460;63	E9PEV1;Q8IZF5-2;Q8IZF5;F5H1E4	.;.;GP113_HUMAN;.	V	63;261;391;460	ENSP00000445729:I63V;ENSP00000327396:I261V;ENSP00000388537:I391V;ENSP00000307831:I460V	ENSP00000307831:I460V	I	-	1	0	GPR113	26389844	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.088000	0.01359	-1.611000	0.01581	-0.366000	0.07423	ATA	.		0.622	GPR113-004	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316892.1	NM_153835	
ANKRD36C	400986	broad.mit.edu	37	2	96521834	96521834	+	Missense_Mutation	SNP	T	T	C	rs199502470		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr2:96521834T>C	ENST00000456556.1	-	63	4259	c.4175A>G	c.(4174-4176)aAa>aGa	p.K1392R	ANKRD36C_ENST00000420871.2_Missense_Mutation_p.K643R|ANKRD36C_ENST00000419039.2_Missense_Mutation_p.K419R			Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C	1392							ion channel inhibitor activity (GO:0008200)	p.K643R(4)|p.K1392R(2)		breast(1)|endometrium(8)|kidney(5)|lung(4)	18						GTTTTGGTTTTTTATTGTGTC	0.363																																					.													ENSG00000174501,NS,carcinoma,0,6	.	.	6	Substitution - Missense(6)	endometrium(6)	.						.																																			SO:0001583	missense	400986	.			TGGTTTTTTATTG	AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.4175A>G	2.37:g.96521834T>C	ENSP00000403302:p.Lys1392Arg	99	1		87	4	.	C9JZ08|Q15694|Q53S06|Q658V2	Missense_Mutation	SNP	ENST00000456556.1	37		.	.	.	.	.	.	.	.	.	.	t	8.924	0.961900	0.18583	.	.	ENSG00000174501	ENST00000420871;ENST00000456556;ENST00000419039	T;T;T	0.18016	2.24;2.24;2.24	1.87	0.683	0.17998	.	.	.	.	.	T	0.12347	0.0300	L	0.48642	1.525	0.09310	N	1	B	0.27286	0.174	B	0.23716	0.048	T	0.31447	-0.9943	9	0.26408	T	0.33	.	4.1432	0.10203	0.0:0.3784:0.0:0.6216	.	1392	Q5JPF3	AN36C_HUMAN	R	643;1392;419	ENSP00000415231:K643R;ENSP00000403302:K1392R;ENSP00000407838:K419R	ENSP00000407838:K419R	K	-	2	0	AC073995.2	95885561	1.000000	0.71417	0.403000	0.26384	0.082000	0.17680	0.861000	0.27885	0.192000	0.20272	0.260000	0.18958	AAA	T|0.250;C|0.750		0.363	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000338799.2	NM_001010914	
COL6A1	1291	broad.mit.edu	37	21	47421295	47421295	+	Missense_Mutation	SNP	G	G	C			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr21:47421295G>C	ENST00000361866.3	+	30	2065	c.1951G>C	c.(1951-1953)Gtc>Ctc	p.V651L	COL6A1_ENST00000498614.1_3'UTR	NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1	651	C-terminal globular domain.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		GGACGAGCTGGTCAAGGTGAG	0.672																																					p.V651L													.	COL6A1	101	0			c.G1951C						.						90.0	95.0	93.0					21																	47421295		2203	4300	6503	SO:0001583	missense	1291	exon30			GAGCTGGTCAAGG	M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.1951G>C	21.37:g.47421295G>C	ENSP00000355180:p.Val651Leu	26	0		10	3	NM_001848	O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	Missense_Mutation	SNP	ENST00000361866.3	37	CCDS13727.1	.	.	.	.	.	.	.	.	.	.	G	12.31	1.899105	0.33535	.	.	ENSG00000142156	ENST00000361866	T	0.77489	-1.1	5.2	5.2	0.72013	von Willebrand factor, type A (3);	0.078334	0.50627	D	0.000116	T	0.71204	0.3312	L	0.45581	1.43	0.58432	D	0.999996	P	0.36199	0.543	B	0.34991	0.193	T	0.68577	-0.5372	10	0.11182	T	0.66	-30.3983	18.7225	0.91700	0.0:0.0:1.0:0.0	.	651	P12109	CO6A1_HUMAN	L	651	ENSP00000355180:V651L	ENSP00000355180:V651L	V	+	1	0	COL6A1	46245723	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	5.343000	0.65976	2.432000	0.82394	0.544000	0.68410	GTC	.		0.672	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206877.1	NM_001848	
MUC4	4585	broad.mit.edu	37	3	195505762	195505762	+	Missense_Mutation	SNP	A	A	G	rs566782506	byFrequency	TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr3:195505762A>G	ENST00000463781.3	-	2	13148	c.12689T>C	c.(12688-12690)cTt>cCt	p.L4230P	MUC4_ENST00000475231.1_Missense_Mutation_p.L4230P|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	987					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TACTGAGGAAAGGCTGGTGAC	0.577													.|||	339	0.0676917	0.034	0.0576	5008	,	,		15843	0.1062		0.0646	False		,,,				2504	0.0838				p.L4230P													MUC4_ENST00000463781,NS,carcinoma,-1,4	MUC4	1505	0			c.T12689C						.						42.0	42.0	42.0					3																	195505762		2092	4200	6292	SO:0001583	missense	4585	exon2			GAGGAAAGGCTGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12689T>C	3.37:g.195505762A>G	ENSP00000417498:p.Leu4230Pro	40	1		65	7	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	0.071	-1.202607	0.01581	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.31769	1.48;1.49	.	.	.	.	.	.	.	.	T	0.08044	0.0201	N	0.04959	-0.14	0.09310	N	0.999998	P	0.35139	0.486	B	0.19946	0.027	T	0.18524	-1.0334	6	.	.	.	.	.	.	.	.	4102	E7ESK3	.	P	4230	ENSP00000417498:L4230P;ENSP00000420243:L4230P	.	L	-	2	0	MUC4	196990541	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.148000	0.16224	-1.986000	0.00983	-1.973000	0.00462	CTT	.		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MXD3	83463	broad.mit.edu	37	5	176738408	176738408	+	Frame_Shift_Del	DEL	G	G	-			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr5:176738408delG	ENST00000439742.2	-	2	626	c.148delC	c.(148-150)cagfs	p.Q50fs	MXD3_ENST00000423571.2_Frame_Shift_Del_p.Q50fs|MXD3_ENST00000427908.2_Frame_Shift_Del_p.Q50fs|MXD3_ENST00000513063.1_Frame_Shift_Del_p.Q50fs	NM_031300.3	NP_112590.1	Q9BW11	MAD3_HUMAN	MAX dimerization protein 3	50					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)					all_cancers(89;2.49e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCAGGAGCCTGGGGGGGTCGC	0.746																																					p.Q50fs													.	MXD3	13	0			c.148delC						.		,	47,3785		20,7,1889	4.0	4.0	4.0		,	3.8	0.7	5		3	71,7395		26,19,3688	no	frameshift,frameshift	MXD3	NM_031300.3,NM_001142935.1	,	46,26,5577	A1A1,A1R,RR		0.951,1.2265,1.0444	,	,	176738408	118,11180	2054	4014	6068	SO:0001589	frameshift_variant	83463	exon2			GAGCCTGGGGGGG	BC000745	CCDS4416.1, CCDS47347.1	5q35.3	2013-03-20			ENSG00000213347	ENSG00000213347		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	14008	protein-coding gene	gene with protein product		609450					Standard	NM_031300		Approved	MAD3, bHLHc13	uc003mgb.2	Q9BW11	OTTHUMG00000130854	ENST00000439742.2:c.148delC	5.37:g.176738408delG	ENSP00000401867:p.Gln50fs	6	0		12	4	NM_001142935	B4E0J1|Q53HK1|Q7Z4Y0|Q8NDJ7|Q96ME3	Frame_Shift_Del	DEL	ENST00000439742.2	37	CCDS4416.1																																																																																			.		0.746	MXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253427.1		
RP11-155G15.2	0	broad.mit.edu	37	5	96706256	96706256	+	RNA	DEL	T	T	-			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr5:96706256delT	ENST00000504578.1	+	0	71																											TTTGTAGTTCTTTTTTTTTTT	0.393																																					.													.	.	.	0			.						.																																					0	.			TAGTTCTTTTTTT																													5.37:g.96706256delT		4	0		6	2	.		RNA	DEL	ENST00000504578.1	37																																																																																				.		0.393	RP11-155G15.2-001	PUTATIVE	basic|exp_conf	processed_transcript	processed_transcript	OTTHUMT00000370138.2		
EXTL3	2137	broad.mit.edu	37	8	28573668	28573668	+	Nonsense_Mutation	SNP	G	G	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr8:28573668G>A	ENST00000220562.4	+	3	994	c.92G>A	c.(91-93)tGg>tAg	p.W31*	EXTL3_ENST00000523149.1_Intron|EXTL3_ENST00000519886.1_Intron	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	31					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)			biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		CGCCTCACGTGGCTCAGCTTC	0.592																																					p.W31X													.	EXTL3	83	0			c.G92A						.						163.0	116.0	132.0					8																	28573668		2203	4300	6503	SO:0001587	stop_gained	2137	exon3			TCACGTGGCTCAG	U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	ENST00000220562.4:c.92G>A	8.37:g.28573668G>A	ENSP00000220562:p.Trp31*	23	0		17	3	NM_001440	D3DST8|O00225|Q53XT3	Nonsense_Mutation	SNP	ENST00000220562.4	37	CCDS6070.1	.	.	.	.	.	.	.	.	.	.	G	45	11.441247	0.99561	.	.	ENSG00000012232	ENST00000220562	.	.	.	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-9.0525	19.2363	0.93862	0.0:0.0:1.0:0.0	.	.	.	.	X	31	.	.	W	+	2	0	EXTL3	28629587	1.000000	0.71417	0.997000	0.53966	0.818000	0.46254	9.869000	0.99810	2.553000	0.86117	0.491000	0.48974	TGG	.		0.592	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219987.3	NM_001440	
MLLT3	4300	broad.mit.edu	37	9	20414343	20414343	+	Silent	SNP	A	A	G	rs372894655	byFrequency	TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr9:20414343A>G	ENST00000380338.4	-	5	787	c.501T>C	c.(499-501)agT>agC	p.S167S	MLLT3_ENST00000429426.2_Silent_p.S164S|MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000475957.1_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	167	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S167S(19)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctactgctgctgc	0.532			T	MLL	ALL								A|||	612	0.122204	0.1505	0.1066	5008	,	,		12422	0.0833		0.0716	False		,,,				2504	0.1871				p.S167S				Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	MLLT3,bladder,carcinoma,0,25	MLLT3	125	19	Substitution - coding silent(19)	lung(8)|kidney(5)|endometrium(3)|central_nervous_system(1)|urinary_tract(1)|prostate(1)	c.T501C						.						8.0	15.0	13.0					9																	20414343		1537	3257	4794	SO:0001819	synonymous_variant	4300	exon5			GCTGCTACTGCTG	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.501T>C	9.37:g.20414343A>G		61	2		52	7	NM_004529	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	ENST00000380338.4	37	CCDS6494.1																																																																																			.		0.532	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
PABPC5-AS1	102724167	broad.mit.edu	37	X	90678413	90678414	+	RNA	DEL	AC	AC	-	rs111834017		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chrX:90678413_90678414delAC	ENST00000456187.1	-	0	97									PABPC5 antisense RNA 1																		acacacacaaacacacacacac	0.406																																					.													.	.	.	0			.						.																																					0	.			ACACAAACACACA			Xq21.31	2014-05-20	2012-08-15	2011-04-28	ENSG00000234161	ENSG00000234161		"""Long non-coding RNAs"""	31845	non-coding RNA	RNA, long non-coding			"""chromosome X open reading frame 46"", ""PABPC5 antisense RNA 1 (non-protein coding)"""	CXorf46			Standard	XR_430528		Approved	OTTHUMG00000021960			OTTHUMG00000021960		X.37:g.90678423_90678424delAC		4	0		7	1	.		RNA	DEL	ENST00000456187.1	37																																																																																				CA|1.000;|0.000		0.406	PABPC5-AS1-001	KNOWN	basic	antisense	antisense	OTTHUMT00000057431.1		
CFAP74	85452	ucsc.edu;bcgsc.ca	37	1	1887067	1887067	+	IGR	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:1887067G>T								TMEM52 (36355 upstream) : C1orf222 (32495 downstream)																							TCAGCCCCCTGGAATGCTGCC	0.602																																					p.Q747K													KIAA1751,colon,carcinoma,+2,1	KIAA1751	92	0			c.C2239A						.						59.0	65.0	63.0					1																	1887067		1924	4104	6028	SO:0001628	intergenic_variant	339457	exon18			CCCCCTGGAATGC																													1.37:g.1887067G>T		50	0		42	4	NM_001080484		Missense_Mutation	SNP		37		.	.	.	.	.	.	.	.	.	.	G	9.362	1.068289	0.20067	.	.	ENSG00000142609	ENST00000270720	.	.	.	1.45	1.45	0.22620	.	1.015600	0.07994	U	0.987606	T	0.18087	0.0434	N	0.08118	0	0.09310	N	0.999995	B	0.28128	0.201	B	0.18263	0.021	T	0.19063	-1.0317	9	0.87932	D	0	.	6.2966	0.21089	0.0:0.0:1.0:0.0	.	747	Q9C0B2	K1751_HUMAN	K	747	.	ENSP00000270720:Q747K	Q	-	1	0	C1orf222	1876927	0.013000	0.17824	0.005000	0.12908	0.142000	0.21351	2.234000	0.43035	1.097000	0.41459	0.462000	0.41574	CAG	.	0	0.602								
CR2	1380	ucsc.edu;bcgsc.ca	37	1	207649657	207649657	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:207649657G>T	ENST00000367058.3	+	14	2807	c.2618G>T	c.(2617-2619)gGa>gTa	p.G873V	CR2_ENST00000367057.3_Missense_Mutation_p.G932V|CR2_ENST00000458541.2_Missense_Mutation_p.G846V|CR2_ENST00000367059.3_Intron	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	873	Sushi 14. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						TTTTCTCCTGGAATGTCAATC	0.527																																					p.G932V													.	CR2	164	0			c.G2795T						.						138.0	125.0	130.0					1																	207649657		2203	4300	6503	SO:0001583	missense	1380	exon15			CTCCTGGAATGTC	M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.2618G>T	1.37:g.207649657G>T	ENSP00000356025:p.Gly873Val	34	0		28	4	NM_001006658	C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Missense_Mutation	SNP	ENST00000367058.3	37	CCDS1478.1	.	.	.	.	.	.	.	.	.	.	G	18.60	3.658635	0.67586	.	.	ENSG00000117322	ENST00000367058;ENST00000367057;ENST00000458541	T;T;T	0.72725	-0.68;-0.68;-0.68	4.87	4.87	0.63330	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	D	0.88610	0.6483	H	0.95982	3.75	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91600	0.5294	9	0.87932	D	0	.	14.2451	0.65983	0.0:0.0:1.0:0.0	.	873;932	P20023;P20023-3	CR2_HUMAN;.	V	873;932;846	ENSP00000356025:G873V;ENSP00000356024:G932V;ENSP00000404222:G846V	ENSP00000356024:G932V	G	+	2	0	CR2	205716280	1.000000	0.71417	0.995000	0.50966	0.743000	0.42351	4.943000	0.63554	2.643000	0.89663	0.655000	0.94253	GGA	.		0.527	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	NM_001877	
ZNF292	23036	ucsc.edu;bcgsc.ca	37	6	87969651	87969651	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr6:87969651C>A	ENST00000369577.3	+	8	6347	c.6304C>A	c.(6304-6306)Ctt>Att	p.L2102I	ZNF292_ENST00000339907.4_Missense_Mutation_p.L2097I	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	2102						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		TTCCCAATCCCTTGAGTTTCC	0.408																																					p.L2102I													.	ZNF292	479	0			c.C6304A						.						83.0	85.0	85.0					6																	87969651		1883	4094	5977	SO:0001583	missense	23036	exon8			CAATCCCTTGAGT	AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.6304C>A	6.37:g.87969651C>A	ENSP00000358590:p.Leu2102Ile	71	0		41	4	NM_015021	Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	ENST00000369577.3	37	CCDS47457.1	.	.	.	.	.	.	.	.	.	.	C	6.199	0.404818	0.11754	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.07021	3.23;3.24	5.77	2.99	0.34606	.	0.667620	0.16522	N	0.210763	T	0.01695	0.0054	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.48293	-0.9048	10	0.20519	T	0.43	.	4.8713	0.13635	0.1495:0.6178:0.0:0.2327	.	2102	O60281	ZN292_HUMAN	I	2102;2097	ENSP00000358590:L2102I;ENSP00000342847:L2097I	ENSP00000342847:L2097I	L	+	1	0	ZNF292	88026370	0.000000	0.05858	0.112000	0.21494	0.984000	0.73092	-0.464000	0.06688	0.341000	0.23771	0.655000	0.94253	CTT	.		0.408	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376192.2	NM_015021	
CCL26	10344	ucsc.edu;bcgsc.ca	37	7	75401265	75401265	+	Missense_Mutation	SNP	A	A	G			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	A	A					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr7:75401265A>G	ENST00000394905.2	-	3	387	c.130T>C	c.(130-132)Tgg>Cgg	p.W44R	CCL26_ENST00000005180.4_Missense_Mutation_p.W44R	NM_006072.4	NP_006063.1	Q9Y258	CCL26_HUMAN	chemokine (C-C motif) ligand 26	44					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of Rac GTPase activity (GO:0032855)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	chemokine activity (GO:0008009)			lung(3)	3						ACCCAGGTCCAGGGAAGGGGC	0.517																																					p.W44R													.	CCL26	5	0			c.T130C						.						101.0	96.0	98.0					7																	75401265		2203	4300	6503	SO:0001583	missense	10344	exon3			AGGTCCAGGGAAG	AF124601	CCDS5578.1	7q11.2	2013-02-25	2002-08-22	2002-08-23	ENSG00000006606	ENSG00000006606		"""Chemokine ligands"", ""Endogenous ligands"""	10625	protein-coding gene	gene with protein product	"""macrophage inflammatory protein 4-alpha"", ""small inducible cytokine A26"", ""CC chemokine IMAC"", ""chemokine N1"", ""thymic stroma chemokine-1"", ""eotaxin-3"""	604697	"""small inducible cytokine subfamily A (Cys-Cys), member 26"""	SCYA26		10373330	Standard	NM_006072		Approved	MIP-4alpha, eotaxin-3, IMAC, MIP-4a, TSC-1	uc003udt.1	Q9Y258	OTTHUMG00000130403	ENST00000394905.2:c.130T>C	7.37:g.75401265A>G	ENSP00000378365:p.Trp44Arg	21	0		25	4	NM_006072	A0N0Q5|Q52LV8	Missense_Mutation	SNP	ENST00000394905.2	37	CCDS5578.1	.	.	.	.	.	.	.	.	.	.	A	0.690	-0.794834	0.02862	.	.	ENSG00000006606	ENST00000005180;ENST00000394905	T;T	0.04119	3.7;3.7	3.61	0.991	0.19813	CC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	1.177540	0.06214	N	0.685527	T	0.03178	0.0093	.	.	.	0.09310	N	1	B	0.15141	0.012	B	0.13407	0.009	T	0.47971	-0.9075	9	0.24483	T	0.36	.	2.8556	0.05571	0.6575:0.0:0.1249:0.2176	.	44	Q9Y258	CCL26_HUMAN	R	44	ENSP00000005180:W44R;ENSP00000378365:W44R	ENSP00000005180:W44R	W	-	1	0	CCL26	75239201	0.000000	0.05858	0.007000	0.13788	0.071000	0.16799	0.025000	0.13577	0.095000	0.17434	0.329000	0.21502	TGG	.		0.517	CCL26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344900.1	NM_006072	
SEC16A	9919	ucsc.edu;bcgsc.ca	37	9	139341749	139341749	+	Silent	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr9:139341749G>T	ENST00000371706.3	-	25	6126	c.6093C>A	c.(6091-6093)ctC>ctA	p.L2031L	SEC16A_ENST00000290037.6_Silent_p.L2031L|SEC16A_ENST00000398335.1_3'UTR|SEC16A_ENST00000431893.2_Silent_p.L2031L|SEC16A_ENST00000313084.5_Silent_p.L215L|SEC16A_ENST00000313050.7_Silent_p.L2209L			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	2031	Pro-rich.|Required for interaction with SEC23A.				COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		CCGCAGGAGCGAGAGCCGGCT	0.612																																					p.L2209L													.	SEC16A	249	0			c.C6627A						.						16.0	23.0	21.0					9																	139341749		2002	4152	6154	SO:0001819	synonymous_variant	9919	exon27			AGGAGCGAGAGCC	AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.6093C>A	9.37:g.139341749G>T		31	0		20	4	NM_014866	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Silent	SNP	ENST00000371706.3	37		.	.	.	.	.	.	.	.	.	.	G	5.436	0.265606	0.10294	.	.	ENSG00000148396	ENST00000433860	.	.	.	5.26	-10.5	0.00291	.	.	.	.	.	T	0.23611	0.0571	.	.	.	0.18873	N	0.999982	.	.	.	.	.	.	T	0.17684	-1.0361	4	.	.	.	-3.5671	7.6843	0.28532	0.304:0.4236:0.2724:0.0	.	.	.	.	S	339	.	.	R	-	1	0	SEC16A	138461570	0.005000	0.15991	0.000000	0.03702	0.010000	0.07245	-0.939000	0.03933	-2.011000	0.00952	-0.611000	0.04053	CGC	.		0.612	SEC16A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000055077.1	XM_088459	
UNC5B	219699	ucsc.edu;bcgsc.ca	37	10	73050759	73050759	+	Missense_Mutation	SNP	T	T	G	rs117156661		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	T	T					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr10:73050759T>G	ENST00000335350.6	+	9	1603	c.1187T>G	c.(1186-1188)gTg>gGg	p.V396G	UNC5B_ENST00000373192.4_Missense_Mutation_p.V385G	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	396					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						GCGGTGGGGGTGGTGGTGTAC	0.627																																					p.V396G													.	UNC5B	123	0			c.T1187G						.						176.0	172.0	173.0					10																	73050759		2203	4300	6503	SO:0001583	missense	219699	exon9			TGGGGGTGGTGGT	AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.1187T>G	10.37:g.73050759T>G	ENSP00000334329:p.Val396Gly	41	1		39	12	NM_170744	Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Missense_Mutation	SNP	ENST00000335350.6	37	CCDS7309.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.510623	0.85389	.	.	ENSG00000107731	ENST00000335350;ENST00000373192	T;T	0.55760	0.6;0.5	5.26	5.26	0.73747	.	0.062472	0.64402	D	0.000004	T	0.69557	0.3124	M	0.73217	2.22	0.80722	D	1	D;D	0.76494	0.999;0.998	D;P	0.66351	0.943;0.878	T	0.71364	-0.4615	10	0.46703	T	0.11	-20.6219	15.1633	0.72801	0.0:0.0:0.0:1.0	.	385;396	Q8IZJ1-2;Q8IZJ1	.;UNC5B_HUMAN	G	396;385	ENSP00000334329:V396G;ENSP00000362288:V385G	ENSP00000334329:V396G	V	+	2	0	UNC5B	72720765	1.000000	0.71417	0.929000	0.37066	0.557000	0.35523	4.283000	0.58977	1.996000	0.58369	0.460000	0.39030	GTG	T|0.999;G|0.001		0.627	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048541.1	NM_170744	
COX15	1355	ucsc.edu;bcgsc.ca	37	10	101489417	101489417	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr10:101489417C>A	ENST00000016171.5	-	2	215	c.165G>T	c.(163-165)agG>agT	p.R55S	CUTC_ENST00000370476.5_5'Flank|COX15_ENST00000370483.5_Missense_Mutation_p.R55S|CUTC_ENST00000493385.1_Intron			Q7KZN9	COX15_HUMAN	cytochrome c oxidase assembly homolog 15 (yeast)	55					cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)|oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13		Colorectal(252;0.234)		Epithelial(162;3.08e-10)|all cancers(201;2.43e-08)		ACACTGTACCCCTTCCAGATT	0.527																																					p.R55S													.	COX15	25	0			c.G165T						.						118.0	115.0	116.0					10																	101489417		2203	4300	6503	SO:0001583	missense	1355	exon2			TGTACCCCTTCCA	AF044323	CCDS7481.1, CCDS7482.1	10q24	2014-09-17	2012-10-15		ENSG00000014919	ENSG00000014919		"""Mitochondrial respiratory chain complex assembly factors"""	2263	protein-coding gene	gene with protein product		603646	"""COX15 (yeast) homolog, cytochrome c oxidase assembly protein"", ""COX15 homolog, cytochrome c oxidase assembly protein (yeast)"""			9878253	Standard	NM_078470		Approved		uc001kqb.4	Q7KZN9	OTTHUMG00000018893	ENST00000016171.5:c.165G>T	10.37:g.101489417C>A	ENSP00000016171:p.Arg55Ser	32	0		26	4	NM_078470	A8K6I9|O60556|O75878|Q5TD00|Q5TD01|Q7Z3Q3|Q9NTN0	Missense_Mutation	SNP	ENST00000016171.5	37	CCDS7482.1	.	.	.	.	.	.	.	.	.	.	C	9.108	1.005890	0.19199	.	.	ENSG00000014919	ENST00000370483;ENST00000016171	.	.	.	4.97	1.95	0.26073	Peptidase cysteine/serine, trypsin-like (1);	0.772227	0.12734	N	0.443638	T	0.23249	0.0562	N	0.24115	0.695	0.29823	N	0.830666	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.31779	-0.9931	9	0.09084	T	0.74	-5.2347	6.733	0.23393	0.4466:0.4691:0.0:0.0843	.	55;55	Q7KZN9-2;Q7KZN9	.;COX15_HUMAN	S	55	.	ENSP00000016171:R55S	R	-	3	2	COX15	101479407	0.425000	0.25498	0.981000	0.43875	0.908000	0.53690	0.643000	0.24750	0.230000	0.21059	0.555000	0.69702	AGG	.		0.527	COX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049818.1	NP_510870	
DAK	26007	ucsc.edu;bcgsc.ca	37	11	61109333	61109333	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr11:61109333G>T	ENST00000394900.3	+	7	833	c.604G>T	c.(604-606)Ggt>Tgt	p.G202C		NM_015533.3	NP_056348.2	Q3LXA3	DHAK_HUMAN	dihydroxyacetone kinase 2 homolog (S. cerevisiae)	202	DhaK. {ECO:0000255|PROSITE- ProRule:PRU00814}.				carbohydrate phosphorylation (GO:0046835)|cellular carbohydrate metabolic process (GO:0044262)|glycerol metabolic process (GO:0006071)|innate immune response (GO:0045087)|regulation of innate immune response (GO:0045088)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|FAD-AMP lyase (cyclizing) activity (GO:0034012)|glycerone kinase activity (GO:0004371)|metal ion binding (GO:0046872)|triokinase activity (GO:0050354)			NS(1)|breast(3)|endometrium(3)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	23						CAGCGTCCCTGGTTCCAAACC	0.597																																					p.G202C													.	DAK	52	0			c.G604T						.						150.0	137.0	141.0					11																	61109333		2203	4299	6502	SO:0001583	missense	26007	exon7			GTCCCTGGTTCCA		CCDS8003.1	11q12.2	2009-11-06	2006-04-04		ENSG00000149476	ENSG00000149476			24552	protein-coding gene	gene with protein product		615844	"""dihydroxyacetone kinase 2 homolog (yeast)"""				Standard	XM_005273898		Approved	DKFZP586B1621, NET45	uc001nre.3	Q3LXA3	OTTHUMG00000168076	ENST00000394900.3:c.604G>T	11.37:g.61109333G>T	ENSP00000378360:p.Gly202Cys	35	0		33	4	NM_015533	Q2L9C1|Q53EQ9|Q9BVA7|Q9H895	Missense_Mutation	SNP	ENST00000394900.3	37	CCDS8003.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.795011	0.90453	.	.	ENSG00000149476	ENST00000394900;ENST00000529479	T;T	0.41065	1.01;1.01	5.84	5.84	0.93424	Dak kinase (2);	0.045607	0.85682	D	0.000000	T	0.68961	0.3058	M	0.82517	2.595	0.80722	D	1	D;D	0.58970	0.984;0.964	P;D	0.67103	0.874;0.949	T	0.71994	-0.4424	10	0.87932	D	0	-18.7155	19.7385	0.96217	0.0:0.0:1.0:0.0	.	202;202	Q2L9C1;Q3LXA3	.;DHAK_HUMAN	C	202;201	ENSP00000378360:G202C;ENSP00000432539:G201C	ENSP00000378360:G202C	G	+	1	0	DAK	60865909	1.000000	0.71417	0.992000	0.48379	0.993000	0.82548	6.940000	0.75917	2.769000	0.95229	0.563000	0.77884	GGT	.		0.597	DAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394425.4	NM_015533	
PC	5091	ucsc.edu;bcgsc.ca	37	11	66639209	66639209	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr11:66639209C>A	ENST00000393958.2	-	4	363	c.270G>T	c.(268-270)ctG>ctT	p.L90L	PC_ENST00000524491.1_Silent_p.L50L|PC_ENST00000355677.3_Silent_p.L90L|PC_ENST00000393955.2_Silent_p.L90L|PC_ENST00000393960.1_Silent_p.L90L	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	90	Biotin carboxylation.				biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	GCACGGGGGCCAGGCCGCGGC	0.647																																					p.L90L													.	PC	116	0			c.G270T						.						26.0	29.0	28.0					11																	66639209		2187	4284	6471	SO:0001819	synonymous_variant	5091	exon4			GGGGGCCAGGCCG	U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.270G>T	11.37:g.66639209C>A		24	0		33	4	NM_000920	B4DN00|Q16705	Silent	SNP	ENST00000393958.2	37	CCDS8152.1																																																																																			.		0.647	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393115.1	NM_001040716	
KDM4B	23030	ucsc.edu;bcgsc.ca	37	19	5071058	5071058	+	Missense_Mutation	SNP	C	C	T	rs151146933		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr19:5071058C>T	ENST00000159111.4	+	7	882	c.664C>T	c.(664-666)Cgg>Tgg	p.R222W	KDM4B_ENST00000536461.1_Missense_Mutation_p.R222W|KDM4B_ENST00000592175.1_3'UTR|KDM4B_ENST00000381759.4_Missense_Mutation_p.R222W	NM_015015.2	NP_055830	O94953	KDM4B_HUMAN	lysine (K)-specific demethylase 4B	222	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(1)|liver(1)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						GCGCCTGGAGCGGCTGGCCAT	0.706																																					p.R222W													.	KDM4B	120	0			c.C664T						.						32.0	33.0	33.0					19																	5071058		2203	4300	6503	SO:0001583	missense	23030	exon7			CTGGAGCGGCTGG	AB020683	CCDS12138.1	19p13.3	2013-01-23	2009-04-06	2009-04-06		ENSG00000127663		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	29136	protein-coding gene	gene with protein product	"""tudor domain containing 14B"""	609765	"""jumonji domain containing 2B"""	JMJD2B		10048485, 15138608	Standard	NM_015015		Approved	KIAA0876, TDRD14B	uc002mbq.4	O94953		ENST00000159111.4:c.664C>T	19.37:g.5071058C>T	ENSP00000159111:p.Arg222Trp	50	0		46	5	NM_015015	B9EGN8|D6W631|O75274|Q6P3R5|Q9P1V1|Q9UF40	Missense_Mutation	SNP	ENST00000159111.4	37	CCDS12138.1	.	.	.	.	.	.	.	.	.	.	C	19.66	3.869940	0.72065	.	.	ENSG00000127663	ENST00000159111;ENST00000381759;ENST00000536461	T;T;T	0.72835	-0.69;-0.69;-0.69	4.62	3.49	0.39957	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.000000	0.85682	D	0.000000	D	0.85256	0.5655	M	0.91196	3.185	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.985;0.983;0.991	D	0.87606	0.2500	10	0.87932	D	0	-35.3527	11.0003	0.47602	0.296:0.704:0.0:0.0	.	222;222;222	F5GX28;O94953-2;O94953	.;.;KDM4B_HUMAN	W	222	ENSP00000159111:R222W;ENSP00000371178:R222W;ENSP00000440495:R222W	ENSP00000159111:R222W	R	+	1	2	KDM4B	5022058	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	1.034000	0.30204	2.292000	0.77174	0.650000	0.86243	CGG	C|1.000;A|0.000		0.706	KDM4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450558.1	NM_015015	
C19orf80	55908	ucsc.edu;bcgsc.ca	37	19	11352354	11352354	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr19:11352354C>A	ENST00000252453.8	+	4	607	c.588C>A	c.(586-588)ctC>ctA	p.L196L	DOCK6_ENST00000294618.7_Intron|C19orf80_ENST00000591200.1_Silent_p.L97L	NM_018687.6	NP_061157.3	Q6UXH0	BETAT_HUMAN	chromosome 19 open reading frame 80	196					cellular lipid metabolic process (GO:0044255)|glucose metabolic process (GO:0006006)|positive regulation of protein processing (GO:0010954)|regulation of lipoprotein metabolic process (GO:0050746)|triglyceride homeostasis (GO:0070328)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(1)|breast(1)|endometrium(2)	4						CAGCGGCGCTCCCAGCCTGAA	0.652																																					p.L196L													.	C19orf80	8	0			c.C588A						.						20.0	26.0	24.0					19																	11352354		2064	4197	6261	SO:0001819	synonymous_variant	55908	exon4			GGCGCTCCCAGCC		CCDS54220.1	19p13.2	2014-02-13			ENSG00000130173	ENSG00000130173			24933	protein-coding gene	gene with protein product	"""lipasin"", ""betatrophin"""					22809513, 23150577, 24262987	Standard	NM_018687		Approved	TD26, RIFL, ANGPTL8	uc021upg.1	Q6UXH0		ENST00000252453.8:c.588C>A	19.37:g.11352354C>A		39	0		40	4	NM_018687	Q9NQZ1	Silent	SNP	ENST00000252453.8	37	CCDS54220.1																																																																																			.		0.652	C19orf80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453175.1	NM_018687	
CYP4F3	4051	ucsc.edu	37	19	15760954	15760954	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr19:15760954C>A	ENST00000221307.8	+	7	926	c.879C>A	c.(877-879)tcC>tcA	p.S293S	CYP4F3_ENST00000591058.1_Silent_p.S293S|CYP4F3_ENST00000586182.2_Silent_p.S293S|CYP4F3_ENST00000585846.1_Silent_p.S293S	NM_000896.2	NP_000887.2	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 3	293					arachidonic acid metabolic process (GO:0019369)|icosanoid metabolic process (GO:0006690)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-tocopherol omega-hydroxylase activity (GO:0052871)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|monooxygenase activity (GO:0004497)			endometrium(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|stomach(1)	34						AGGCCAAATCCAAGACTTTGG	0.542																																					p.S293S													.	CYP4F3	69	0			c.C879A						.						61.0	57.0	58.0					19																	15760954		2203	4298	6501	SO:0001819	synonymous_variant	4051	exon7			CAAATCCAAGACT	AB002454	CCDS12332.1, CCDS59362.1	19p13.12	2013-02-21	2003-01-14		ENSG00000186529	ENSG00000186529		"""Cytochrome P450s"""	2646	protein-coding gene	gene with protein product		601270	"""cytochrome P450, subfamily IVF, polypeptide 3 (leukotriene B4 omega hydroxylase)"""	LTB4H		8486631, 9539102	Standard	NM_000896		Approved	CYP4F	uc010xol.2	Q08477	OTTHUMG00000182374	ENST00000221307.8:c.879C>A	19.37:g.15760954C>A		47	0		33	4	NM_001199209	B7Z8Z3|O60634|Q5U740	Silent	SNP	ENST00000221307.8	37	CCDS12332.1																																																																																			.		0.542	CYP4F3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460819.3	NM_000896	
KDELR3	11015	ucsc.edu;bcgsc.ca	37	22	38881994	38881994	+	IGR	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr22:38881994C>A	ENST00000216014.4	+	0	1728				DDX17_ENST00000381633.3_Missense_Mutation_p.Q635H|DDX17_ENST00000396821.3_Missense_Mutation_p.Q714H|DDX17_ENST00000444597.1_Missense_Mutation_p.Q164H	NM_006855.2	NP_006846.1	O43731	ERD23_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein retention in ER lumen (GO:0006621)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ER retention sequence binding (GO:0046923)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)	13	Melanoma(58;0.0286)					GGTAGGCAGTCTGCCCCATGT	0.512																																					p.Q714H	Ovarian(11;103 529 24120 28493 32980)												.	DDX17	73	0			c.G2142T						.						179.0	161.0	167.0					22																	38881994		2203	4300	6503	SO:0001628	intergenic_variant	10521	exon13			GGCAGTCTGCCCC	AL035081	CCDS13972.1, CCDS46705.1	22q13	2008-05-02			ENSG00000100196	ENSG00000100196			6306	protein-coding gene	gene with protein product							Standard	NM_006855		Approved		uc003avu.3	O43731	OTTHUMG00000153520		22.37:g.38881994C>A		26	0		27	4	NM_001098504	A8K7T7|B8ZZ26|O95557|Q4V750|Q4V767|Q53FP4|Q53GK1	Missense_Mutation	SNP	ENST00000216014.4	37	CCDS13972.1	.	.	.	.	.	.	.	.	.	.	C	10.79	1.450539	0.26074	.	.	ENSG00000100201	ENST00000396821;ENST00000381633;ENST00000415748;ENST00000444597;ENST00000403230	T;T;T	0.28454	1.61;1.63;1.61	5.42	5.42	0.78866	.	0.000000	0.45361	D	0.000363	T	0.42131	0.1189	N	0.19112	0.55	0.38886	D	0.957009	D;D	0.62365	0.987;0.991	P;D	0.71870	0.775;0.975	T	0.37314	-0.9711	10	0.38643	T	0.18	-9.0628	19.2201	0.93793	0.0:1.0:0.0:0.0	.	712;166	Q92841-4;Q9UQL5	.;.	H	714;635;166;164;712	ENSP00000380033:Q714H;ENSP00000371046:Q635H;ENSP00000385536:Q712H	ENSP00000371046:Q635H	Q	-	3	2	DDX17	37211940	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.929000	0.28844	2.524000	0.85096	0.655000	0.94253	CAG	.		0.512	KDELR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331474.1		
DMC1	11144	ucsc.edu;bcgsc.ca	37	22	38917699	38917699	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr22:38917699C>A	ENST00000216024.2	-	13	1143	c.867G>T	c.(865-867)ggG>ggT	p.G289G	DMC1_ENST00000428462.2_Silent_p.G234G	NM_007068.2	NP_008999.2	Q14565	DMC1_HUMAN	DNA meiotic recombinase 1	289					female gamete generation (GO:0007292)|male meiosis I (GO:0007141)|meiotic nuclear division (GO:0007126)|oocyte maturation (GO:0001556)|ovarian follicle development (GO:0001541)|reciprocal meiotic recombination (GO:0007131)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	chromosome (GO:0005694)|chromosome, telomeric region (GO:0000781)|condensed nuclear chromosome (GO:0000794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)			large_intestine(5)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	11	Melanoma(58;0.0286)					GAATGTGTCCCCCAATGGGTT	0.373								Homologous recombination																													p.G289G													.	DMC1	33	0			c.G867T						.						115.0	111.0	112.0					22																	38917699		2203	4300	6503	SO:0001819	synonymous_variant	11144	exon13			GTGTCCCCCAATG	D63882	CCDS13973.1, CCDS63477.1	22q13.1	2013-05-02	2013-05-02		ENSG00000100206	ENSG00000100206			2927	protein-coding gene	gene with protein product		602721	"""DMC1 (dosage suppressor of mck1, yeast homolog) meiosis-specific homologous recombination"", ""DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast)"""			8602360, 8590282, 17541404	Standard	NM_007068		Approved	LIM15	uc003avz.2	Q14565	OTTHUMG00000151088	ENST00000216024.2:c.867G>T	22.37:g.38917699C>A		31	0		31	4	NM_007068	A8K9A2|B4DMW6|Q08AI1|Q99498|Q9UH11	Silent	SNP	ENST00000216024.2	37	CCDS13973.1																																																																																			.		0.373	DMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321246.2	NM_007068	
DIAPH2	1730	ucsc.edu	37	X	96048621	96048621	+	Intron	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chrX:96048621C>A	ENST00000324765.8	+	4	794				DIAPH2_ENST00000373049.4_Intron|DIAPH2_ENST00000373061.3_Intron|DIAPH2_ENST00000355827.4_Intron|DIAPH2_ENST00000373054.4_Nonsense_Mutation_p.S142*			O60879	DIAP2_HUMAN	diaphanous-related formin 2						actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						actgtatcctcacatattagg	0.448																																					.													.	DIAPH2	148	0			.						.						39.0	38.0	38.0					X																	96048621		876	1991	2867	SO:0001627	intron_variant	1730	.			TATCCTCACATAT	Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.447+35364C>A	X.37:g.96048621C>A		31	0		35	4	.	A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Nonsense_Mutation	SNP	ENST00000324765.8	37	CCDS14467.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.905432	0.92107	.	.	ENSG00000147202	ENST00000373054	.	.	.	1.29	1.29	0.21616	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	.	5.4138	0.16361	0.0:1.0:0.0:0.0	.	.	.	.	X	142	.	ENSP00000362145:S142X	S	+	2	0	DIAPH2	95935277	0.054000	0.20591	0.010000	0.14722	0.026000	0.11368	0.915000	0.28638	0.896000	0.36366	0.415000	0.27848	TCA	.		0.448	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058871.2	NM_006729, NM_007309	
MROH7	374977	bcgsc.ca	37	1	55172120	55172120	+	Silent	SNP	C	C	A	rs368624796		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:55172120C>A	ENST00000421030.2	+	22	3862	c.3577C>A	c.(3577-3579)Cga>Aga	p.R1193R	MROH7-TTC4_ENST00000414150.2_Silent_p.R1193R|MROH7_ENST00000409996.1_Silent_p.R761R|MROH7_ENST00000454855.2_Silent_p.R711R	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	1193						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											GAACACCCACCGAGACAGCGC	0.542																																					p.R1193R													.	.	.	0			c.C3577A						.						119.0	123.0	122.0					1																	55172120		1929	4144	6073	SO:0001819	synonymous_variant	374977	exon22			ACCCACCGAGACA	AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.3577C>A	1.37:g.55172120C>A		25	0		18	3	NM_001039464	A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Silent	SNP	ENST00000421030.2	37	CCDS41342.2																																																																																			.		0.542	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346978.1	NM_198547	
Unknown	0	bcgsc.ca	37	1	79215094	79215094	+	IGR	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:79215094G>T								AC104837.1 (62249 upstream) : ELTD1 (140354 downstream)																							CACTGTCCTGGTTCCAAAGGA	0.388																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			GTCCTGGTTCCAA																													1.37:g.79215094G>T		18	0		24	8	.		RNA	SNP		37																																																																																				.	0	0.388								
C1orf74	148304	bcgsc.ca	37	1	209956321	209956321	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:209956321G>T	ENST00000294811.1	-	2	915	c.659C>A	c.(658-660)tCt>tAt	p.S220Y		NM_152485.2	NP_689698.1	Q96LT6	CA074_HUMAN	chromosome 1 open reading frame 74	220								p.S220Y(1)		endometrium(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)	15				OV - Ovarian serous cystadenocarcinoma(81;0.0328)		GACACTAAAAGAATAGAGCAG	0.498																																					p.S220Y													C1orf74,rectum,carcinoma,0,1	C1orf74	30	1	Substitution - Missense(1)	large_intestine(1)	c.C659A						.						79.0	88.0	85.0					1																	209956321		2203	4300	6503	SO:0001583	missense	148304	exon2			CTAAAAGAATAGA	AK057807	CCDS1491.1	1q32.2	2008-02-05			ENSG00000162757	ENSG00000162757			26319	protein-coding gene	gene with protein product						12477932	Standard	NM_152485		Approved	FLJ25078	uc001hhp.1	Q96LT6	OTTHUMG00000036483	ENST00000294811.1:c.659C>A	1.37:g.209956321G>T	ENSP00000294811:p.Ser220Tyr	48	0		42	4	NM_152485		Missense_Mutation	SNP	ENST00000294811.1	37	CCDS1491.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.683102	0.88542	.	.	ENSG00000162757	ENST00000294811	T	0.62788	0.0	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.80380	0.4612	M	0.76328	2.33	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82092	-0.0628	10	0.87932	D	0	-22.676	19.4121	0.94679	0.0:0.0:1.0:0.0	.	220	Q96LT6	CA074_HUMAN	Y	220	ENSP00000294811:S220Y	ENSP00000294811:S220Y	S	-	2	0	C1orf74	208022944	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.059000	0.93902	2.595000	0.87683	0.655000	0.94253	TCT	.		0.498	C1orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088745.1	NM_152485	
CENPF	1063	bcgsc.ca	37	1	214820276	214820276	+	Missense_Mutation	SNP	G	G	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr1:214820276G>A	ENST00000366955.3	+	13	7531	c.7363G>A	c.(7363-7365)Gca>Aca	p.A2455T		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	2551	2 X 177 AA tandem repeats.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		TGAGAGAGTGGCAGCCCTGCA	0.418																																					p.A2455T	Colon(80;575 1284 11000 14801 43496)												.	CENPF	321	0			c.G7363A						.						73.0	85.0	81.0					1																	214820276		2203	4300	6503	SO:0001583	missense	1063	exon13			AGAGTGGCAGCCC	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.7363G>A	1.37:g.214820276G>A	ENSP00000355922:p.Ala2455Thr	99	0		53	4	NM_016343	Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	37	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	G	5.487	0.274791	0.10403	.	.	ENSG00000117724	ENST00000366955	T	0.03124	4.04	5.31	-2.65	0.06095	.	1.183190	0.06528	N	0.740998	T	0.04137	0.0115	L	0.51422	1.61	0.09310	N	1	B	0.14805	0.011	B	0.10450	0.005	T	0.48592	-0.9022	10	0.15499	T	0.54	.	8.2846	0.31922	0.4272:0.0:0.4766:0.0963	.	2551	P49454	CENPF_HUMAN	T	2455	ENSP00000355922:A2455T	ENSP00000355922:A2455T	A	+	1	0	CENPF	212886899	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.269000	0.08596	-0.735000	0.04837	-1.821000	0.00599	GCA	.		0.418	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
GALNT14	79623	bcgsc.ca	37	2	31168651	31168651	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr2:31168651C>A	ENST00000349752.5	-	7	1379	c.740G>T	c.(739-741)gGg>gTg	p.G247V	GALNT14_ENST00000486564.1_5'UTR|GALNT14_ENST00000406653.1_Missense_Mutation_p.G227V|GALNT14_ENST00000324589.5_Missense_Mutation_p.G252V|GALNT14_ENST00000356174.3_Missense_Mutation_p.G214V|GALNT14_ENST00000420311.2_Missense_Mutation_p.G212V	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	247					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					CAACTCACCCCCTCTGAGCTC	0.502																																					p.G252V													.	GALNT14	103	0			c.G755T						.						88.0	69.0	75.0					2																	31168651		2203	4300	6503	SO:0001583	missense	79623	exon8			TCACCCCCTCTGA	AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.740G>T	2.37:g.31168651C>A	ENSP00000288988:p.Gly247Val	68	0		56	4	NM_001253826	B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Missense_Mutation	SNP	ENST00000349752.5	37	CCDS1773.2	.	.	.	.	.	.	.	.	.	.	C	22.4	4.281089	0.80692	.	.	ENSG00000158089	ENST00000349752;ENST00000324589;ENST00000406653;ENST00000356174;ENST00000420311;ENST00000430167	T;T;T;T;T;T	0.59906	0.23;0.23;0.23;0.23;0.23;0.23	4.85	4.85	0.62838	Glycosyl transferase, family 2 (1);	0.000000	0.85682	D	0.000000	D	0.85805	0.5782	H	0.98276	4.19	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.91760	0.5419	10	0.87932	D	0	.	17.9284	0.88990	0.0:1.0:0.0:0.0	.	212;214;252;247;227	F5H263;Q96FL9-2;Q96FL9-3;Q96FL9;B3KV89	.;.;.;GLT14_HUMAN;.	V	247;252;227;214;212;214	ENSP00000288988:G247V;ENSP00000314500:G252V;ENSP00000385435:G227V;ENSP00000348497:G214V;ENSP00000415514:G212V;ENSP00000406399:G214V	ENSP00000314500:G252V	G	-	2	0	GALNT14	31022155	1.000000	0.71417	0.998000	0.56505	0.746000	0.42486	7.215000	0.77966	2.407000	0.81776	0.455000	0.32223	GGG	.		0.502	GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157264.1	NM_024572	
CKAP2L	150468	bcgsc.ca	37	2	113513554	113513554	+	Splice_Site	SNP	C	C	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr2:113513554C>T	ENST00000302450.6	-	4	1472	c.1394G>A	c.(1393-1395)aGg>aAg	p.R465K	CKAP2L_ENST00000481732.1_5'Flank|CKAP2L_ENST00000541405.1_Splice_Site_p.R300K	NM_152515.3	NP_689728.3	Q8IYA6	CKP2L_HUMAN	cytoskeleton associated protein 2-like	465						centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	28						AGCAAAGTACCTTCGATCCTC	0.398																																					p.R465K													.	CKAP2L	54	0			c.G1394A						.						159.0	167.0	165.0					2																	113513554		2203	4300	6503	SO:0001630	splice_region_variant	150468	exon4			AAGTACCTTCGAT	AL832036	CCDS2100.1	2q13	2008-02-05			ENSG00000169607	ENSG00000169607			26877	protein-coding gene	gene with protein product						12477932	Standard	NM_152515		Approved	FLJ40629	uc002tie.2	Q8IYA6	OTTHUMG00000131313	ENST00000302450.6:c.1394+1G>A	2.37:g.113513554C>T		56	0		52	4	NM_152515	A8K915|B4DZE3|B7ZAC6|F5H0M5|Q53QF8|Q53RS8|Q8N1J8	Missense_Mutation	SNP	ENST00000302450.6	37	CCDS2100.1	.	.	.	.	.	.	.	.	.	.	C	17.19	3.326034	0.60743	.	.	ENSG00000169607	ENST00000541405;ENST00000302450	T;T	0.22945	1.93;1.93	5.25	5.25	0.73442	.	0.095420	0.64402	N	0.000002	T	0.40815	0.1132	L	0.39467	1.215	0.35381	D	0.789927	B;D	0.76494	0.015;0.999	B;D	0.80764	0.016;0.994	T	0.35051	-0.9804	9	.	.	.	-19.9722	14.5237	0.67873	0.0:1.0:0.0:0.0	.	54;465	Q8IYA6-2;Q8IYA6	.;CKP2L_HUMAN	K	300;465	ENSP00000438763:R300K;ENSP00000305204:R465K	.	R	-	2	0	CKAP2L	113230025	1.000000	0.71417	1.000000	0.80357	0.501000	0.33797	3.266000	0.51569	2.890000	0.99128	0.585000	0.79938	AGG	.		0.398	CKAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254082.2	NM_152515	Missense_Mutation
NEB	4703	bcgsc.ca	37	2	152354773	152354773	+	Intron	SNP	C	C	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr2:152354773C>T	ENST00000172853.10	-	140	18973				NEB_ENST00000498015.2_Intron|NEB_ENST00000509223.2_Intron|NEB_ENST00000397345.3_Splice_Site|NEB_ENST00000397336.2_Splice_Site|NEB_ENST00000604864.1_Splice_Site|NEB_ENST00000427231.2_Splice_Site|NEB_ENST00000603639.1_Splice_Site|NEB_ENST00000409198.1_Intron			P20929	NEBU_HUMAN	nebulin						muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTCCAAAATACCGAGCTAAGG	0.378																																					.													.	NEB	1697	0			c.24207+1G>A						.						227.0	171.0	188.0					2																	152354773		692	1591	2283	SO:0001627	intron_variant	4703	exon171			AAAATACCGAGCT	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.18826-1891G>A	2.37:g.152354773C>T		83	0		66	4	NM_001164507	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Splice_Site	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	C	23.4	4.413641	0.83449	.	.	ENSG00000183091	ENST00000397337;ENST00000397345;ENST00000427231;ENST00000397336;ENST00000421461	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5173	0.90939	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NEB	152063019	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	6.015000	0.70791	2.805000	0.96524	0.655000	0.94253	.	.		0.378	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
ARL6IP6	151188	bcgsc.ca	37	2	153573781	153573781	+	5'Flank	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr2:153573781C>A	ENST00000326446.5	+	0	0				PRPF40A_ENST00000486100.1_Intron|PRPF40A_ENST00000410080.1_Intron	NM_152522.5	NP_689735.1	Q8N6S5	AR6P6_HUMAN	ADP-ribosylation factor-like 6 interacting protein 6							integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|lung(2)|pancreas(1)	5						AGCAGAGACCCAAGAGCCGGA	0.622																																					.													.	PRPF40A	149	0			.						.																																			SO:0001631	upstream_gene_variant	55660	.			GAGACCCAAGAGC	AK023109	CCDS2197.1	2q23	2014-05-12	2014-05-12		ENSG00000177917	ENSG00000177917			24048	protein-coding gene	gene with protein product							Standard	NM_152522		Approved	MGC33864	uc002tyn.3	Q8N6S5	OTTHUMG00000131901		2.37:g.153573781C>A	Exception_encountered	61	0		49	4	.	B2RDS6|Q7Z4G7	Missense_Mutation	SNP	ENST00000326446.5	37	CCDS2197.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.511751	0.85389	.	.	ENSG00000196504	ENST00000356402;ENST00000545856;ENST00000493468	.	.	.	5.3	5.3	0.74995	.	0.426837	0.20708	N	0.087144	T	0.52948	0.1766	.	.	.	0.80722	D	1	B	0.21905	0.062	B	0.19391	0.025	T	0.48103	-0.9064	8	0.33940	T	0.23	.	14.4952	0.67683	0.0:1.0:0.0:0.0	.	43	O75400-3	.	L	43;43;36	.	ENSP00000348770:W43L	W	-	2	0	PRPF40A	153282027	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.617000	0.36943	2.462000	0.83206	0.655000	0.94253	TGG	.		0.622	ARL6IP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254852.3	NM_152522	
Unknown	0	bcgsc.ca	37	2	228513200	228513200	+	IGR	SNP	G	G	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr2:228513200G>A								C2orf83 (15164 upstream) : SLC19A3 (37370 downstream)																							GTCAGGTAATGATGAAACTAA	0.517																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			GGTAATGATGAAA																													2.37:g.228513200G>A		57	0		38	8	.		RNA	SNP		37																																																																																				.	0	0.517								
SUMF1	285362	bcgsc.ca	37	3	4452606	4452606	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr3:4452606C>A	ENST00000272902.5	-	7	932	c.897G>T	c.(895-897)tgG>tgT	p.W299C	SUMF1_ENST00000534863.1_Missense_Mutation_p.W299C|SUMF1_ENST00000383843.5_Missense_Mutation_p.W274C|SUMF1_ENST00000405420.2_Missense_Mutation_p.W299C|SUMF1_ENST00000458465.2_Missense_Mutation_p.W167C	NM_182760.3	NP_877437.2	Q8NBK3	SUMF1_HUMAN	sulfatase modifying factor 1	299					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)	metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(3)	13		Melanoma(143;0.068)|Colorectal(144;0.233)		Epithelial(13;0.0147)|OV - Ovarian serous cystadenocarcinoma(96;0.0444)|all cancers(10;0.0549)		AAGTCCATTCCCATGCGTTCC	0.438																																					p.W299C													.	SUMF1	23	0			c.G897T						.						202.0	181.0	188.0					3																	4452606		2203	4300	6503	SO:0001583	missense	285362	exon7			CCATTCCCATGCG	BC017005	CCDS2564.1, CCDS54548.1, CCDS54549.1	3p26.1	2009-07-23			ENSG00000144455	ENSG00000144455			20376	protein-coding gene	gene with protein product		607939				12757705, 12757706	Standard	NM_182760		Approved	FGE, UNQ3037	uc003bpz.2	Q8NBK3	OTTHUMG00000090269	ENST00000272902.5:c.897G>T	3.37:g.4452606C>A	ENSP00000272902:p.Trp299Cys	66	0		21	3	NM_001164675	B4DXK5|B7XD05|E9PGL0|G5E9B0|Q0VAC6|Q0VAC7|Q2NL78|Q53ZE4|Q6UY39|Q96AK5|Q96DK8	Missense_Mutation	SNP	ENST00000272902.5	37	CCDS2564.1	.	.	.	.	.	.	.	.	.	.	C	16.62	3.172618	0.57584	.	.	ENSG00000144455	ENST00000534982;ENST00000534863;ENST00000272902;ENST00000383843;ENST00000458465;ENST00000405420	D;D;D;D;D	0.98512	-4.97;-4.97;-4.97;-3.74;-4.97	5.42	5.42	0.78866	C-type lectin fold (1);Formylglycine-generating sulphatase enzyme domain (2);	0.105878	0.64402	D	0.000001	D	0.99396	0.9787	H	0.97516	4.02	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98470	1.0600	10	0.87932	D	0	-26.0734	17.9951	0.89181	0.0:1.0:0.0:0.0	.	167;274;299;299	E9PF05;G5E9B0;E9PGL0;Q8NBK3	.;.;.;SUMF1_HUMAN	C	299;299;299;274;167;299	ENSP00000440421:W299C;ENSP00000272902:W299C;ENSP00000373355:W274C;ENSP00000410060:W167C;ENSP00000384977:W299C	ENSP00000272902:W299C	W	-	3	0	SUMF1	4427606	1.000000	0.71417	1.000000	0.80357	0.380000	0.30137	6.955000	0.76007	2.544000	0.85801	0.561000	0.74099	TGG	.		0.438	SUMF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206591.2	NM_182760	
GLB1	2720	bcgsc.ca	37	3	33110405	33110405	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr3:33110405G>T	ENST00000399402.3	-	3	344	c.213C>A	c.(211-213)gaC>gaA	p.D71E	GLB1_ENST00000307377.8_Intron|GLB1_ENST00000445488.2_Missense_Mutation_p.D149E|GLB1_ENST00000307363.5_Missense_Mutation_p.D101E	NM_001079811.1	NP_001073279	P16278	BGAL_HUMAN	galactosidase, beta 1	101					carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)	beta-galactosidase activity (GO:0004565)|galactoside binding (GO:0016936)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	21		Melanoma(143;0.104)				CCACATCATGGTCCTCAGAAA	0.542																																					p.D101E													GLB1,NS,carcinoma,-1,1	GLB1	51	0			c.C303A						.						115.0	115.0	115.0					3																	33110405		1953	4153	6106	SO:0001583	missense	2720	exon3			ATCATGGTCCTCA	M22590	CCDS43061.1, CCDS43062.1, CCDS46785.1	3p22.3	2012-10-02			ENSG00000170266	ENSG00000170266	3.2.1.23		4298	protein-coding gene	gene with protein product		611458	"""elastin receptor 1, 67kDa"", ""elastin receptor 1 (67kD)"""	ELNR1		110522, 3143362	Standard	NM_000404		Approved	EBP	uc003cfi.1	P16278	OTTHUMG00000155781	ENST00000399402.3:c.213C>A	3.37:g.33110405G>T	ENSP00000382333:p.Asp71Glu	38	0		22	3	NM_000404	B2R7H8|B7Z6B0|P16279	Missense_Mutation	SNP	ENST00000399402.3	37	CCDS43062.1	.	.	.	.	.	.	.	.	.	.	G	4.532	0.098842	0.08681	.	.	ENSG00000170266	ENST00000399402;ENST00000307363;ENST00000445488;ENST00000450835	D;D;D;D	0.97906	-4.6;-4.6;-4.6;-4.6	4.29	-5.73	0.02398	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.197843	0.51477	N	0.000098	D	0.90645	0.7066	L	0.35723	1.085	0.29181	N	0.876488	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.11329	0.004;0.004;0.006	T	0.82822	-0.0267	10	0.12103	T	0.63	-19.1245	0.7558	0.00998	0.2744:0.2921:0.2358:0.1976	.	101;101;149	Q53G40;P16278;B7Z6Q5	.;BGAL_HUMAN;.	E	71;101;149;71	ENSP00000382333:D71E;ENSP00000306920:D101E;ENSP00000393377:D149E;ENSP00000403264:D71E	ENSP00000306920:D101E	D	-	3	2	GLB1	33085409	0.968000	0.33430	0.050000	0.19076	0.926000	0.56050	0.483000	0.22292	-0.865000	0.04073	-0.150000	0.13652	GAC	.		0.542	GLB1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000341570.2	NM_000404	
BMP2K	55589	bcgsc.ca	37	4	79832212	79832212	+	Silent	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr4:79832212C>A	ENST00000335016.5	+	16	2677	c.2511C>A	c.(2509-2511)ctC>ctA	p.L837L	PAQR3_ENST00000295462.3_Intron	NM_198892.1	NP_942595.1	Q9NSY1	BMP2K_HUMAN	BMP2 inducible kinase	837					regulation of bone mineralization (GO:0030500)	nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatase regulator activity (GO:0019208)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	13						CAATACTCCTCACCTCAGCCC	0.478																																					p.L837L													.	BMP2K	169	0			c.C2511A						.						80.0	79.0	79.0					4																	79832212		2025	4207	6232	SO:0001819	synonymous_variant	55589	exon16			ACTCCTCACCTCA	AB015331	CCDS34019.1, CCDS47083.1	4q21.21	2008-05-15			ENSG00000138756	ENSG00000138756			18041	protein-coding gene	gene with protein product							Standard	NM_017593		Approved	DKFZp434K0614, BIKe	uc003hlk.3	Q9NSY1	OTTHUMG00000160900	ENST00000335016.5:c.2511C>A	4.37:g.79832212C>A		55	0		26	3	NM_198892	O94791|Q4W5H2|Q8IYF2|Q8N2G7|Q8NHG9|Q9NTG8	Silent	SNP	ENST00000335016.5	37	CCDS47083.1	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.664419	0.00765	.	.	ENSG00000138756	ENST00000502613	.	.	.	4.4	3.52	0.40303	.	.	.	.	.	T	0.27900	0.0687	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.17837	-1.0356	4	.	.	.	-4.8384	5.3564	0.16063	0.0:0.615:0.171:0.214	.	.	.	.	N	530	.	.	H	+	1	0	BMP2K	80051236	0.001000	0.12720	0.730000	0.30809	0.302000	0.27658	0.665000	0.25083	1.143000	0.42306	0.484000	0.47621	CAC	.		0.478	BMP2K-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_017593	
Unknown	0	bcgsc.ca	37	5	54154080	54154080	+	IGR	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr5:54154080C>A								AC112198.2 (5304 upstream) : RP11-45H22.3 (97982 downstream)																							TACTTCTTCCCGTCATAGTAA	0.383																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			TCTTCCCGTCATA																													5.37:g.54154080C>A		55	0		49	4	.		RNA	SNP		37																																																																																				.	0	0.383								
BCLAF1P1	728366	bcgsc.ca	37	5	110283910	110283910	+	IGR	SNP	T	T	C	rs386691066|rs80293008		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr5:110283910T>C								SLC25A46 (183053 upstream) : CTC-551A13.1 (22739 downstream)																							CCTCTTTTGGTCTAATAATCC	0.413																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			TTTTGGTCTAATA																													5.37:g.110283910T>C		25	0		41	7	.		RNA	SNP		37																																																																																				.	0	0.413								
BCLAF1P1	728366	bcgsc.ca	37	5	110283912	110283912	+	IGR	SNP	T	T	C	rs386691066|rs74826826		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr5:110283912T>C								SLC25A46 (183055 upstream) : CTC-551A13.1 (22737 downstream)																							TCTTTTGGTCTAATAATCCAC	0.408																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			TTGGTCTAATAAT																													5.37:g.110283912T>C		24	0		43	7	.		RNA	SNP		37																																																																																				.	0	0.408								
BCLAF1P1	728366	bcgsc.ca	37	5	110283938	110283938	+	IGR	SNP	A	A	G			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr5:110283938A>G								SLC25A46 (183081 upstream) : CTC-551A13.1 (22711 downstream)																							CATCTCTGTCATGATGCAAGA	0.403																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			TCTGTCATGATGC																													5.37:g.110283938A>G		23	0		37	6	.		RNA	SNP		37																																																																																				.	0	0.403								
BCLAF1P1	728366	bcgsc.ca	37	5	110283940	110283940	+	IGR	SNP	G	G	C			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr5:110283940G>C								SLC25A46 (183083 upstream) : CTC-551A13.1 (22709 downstream)																							TCTCTGTCATGATGCAAGAAA	0.403																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			TGTCATGATGCAA																													5.37:g.110283940G>C		24	0		34	6	.		RNA	SNP		37																																																																																				.	0	0.403								
BCLAF1P1	728366	bcgsc.ca	37	5	110283944	110283944	+	IGR	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr5:110283944C>A								SLC25A46 (183087 upstream) : CTC-551A13.1 (22705 downstream)																							TGTCATGATGCAAGAAATACT	0.398																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			ATGATGCAAGAAA																													5.37:g.110283944C>A		23	0		35	6	.		RNA	SNP		37																																																																																				.	0	0.398								
RREB1	6239	bcgsc.ca	37	6	7187719	7187719	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr6:7187719G>T	ENST00000349384.6	+	5	538	c.224G>T	c.(223-225)tGc>tTc	p.C75F	RREB1_ENST00000379933.3_Missense_Mutation_p.C75F|RREB1_ENST00000334984.6_Missense_Mutation_p.C75F|RREB1_ENST00000379938.2_Missense_Mutation_p.C75F|RP11-405O10.2_ENST00000451355.2_RNA|Y_RNA_ENST00000364613.1_RNA	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	75					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				GAGAAGATTTGCACTACCCAG	0.338																																					p.C75F													.	RREB1	242	0			c.G224T						.						73.0	70.0	71.0					6																	7187719		2203	4300	6503	SO:0001583	missense	6239	exon5			AGATTTGCACTAC	U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.224G>T	6.37:g.7187719G>T	ENSP00000305560:p.Cys75Phe	93	0		71	4	NM_001003700	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Missense_Mutation	SNP	ENST00000349384.6	37	CCDS34336.1	.	.	.	.	.	.	.	.	.	.	G	16.51	3.144308	0.57044	.	.	ENSG00000124782	ENST00000379933;ENST00000491191;ENST00000379938;ENST00000471433;ENST00000349384;ENST00000334984;ENST00000483150	T;T;T;T;T;T;T	0.61627	1.22;0.09;1.22;0.09;1.22;1.22;1.22	5.37	5.37	0.77165	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.000000	0.64402	D	0.000002	T	0.27559	0.0677	N	0.00465	-1.465	0.80722	D	1	P;P;D	0.89917	0.797;0.831;1.0	P;P;D	0.91635	0.573;0.777;0.999	T	0.50294	-0.8845	10	0.02654	T	1	-31.3066	19.1188	0.93353	0.0:0.0:1.0:0.0	.	75;75;75	Q92766-3;Q92766;Q92766-2	.;RREB1_HUMAN;.	F	75	ENSP00000369265:C75F;ENSP00000420519:C75F;ENSP00000369270:C75F;ENSP00000420299:C75F;ENSP00000305560:C75F;ENSP00000335574:C75F;ENSP00000419511:C75F	ENSP00000335574:C75F	C	+	2	0	RREB1	7132718	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.921000	0.92784	2.517000	0.84864	0.655000	0.94253	TGC	.		0.338	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1		
RCN1P1	442234	bcgsc.ca	37	6	87832078	87832078	+	IGR	SNP	G	G	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr6:87832078G>A								CGA (27254 upstream) : RP11-393I2.4 (28798 downstream)																							GTTTGATCCAGGTTTTCAGCT	0.468																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	442234	.			GATCCAGGTTTTC																													6.37:g.87832078G>A		49	0		31	26	.		RNA	SNP		37																																																																																				.	0	0.468								
LAMA2	3908	bcgsc.ca	37	6	129588265	129588265	+	Silent	SNP	G	G	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr6:129588265G>A	ENST00000421865.2	+	16	2272	c.2223G>A	c.(2221-2223)agG>agA	p.R741R		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	741	Laminin EGF-like 5; second part. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		GTTGGCCTAGGCACAGGCGAG	0.443																																					p.R741R													.	LAMA2	481	0			c.G2223A						.						287.0	250.0	263.0					6																	129588265		2203	4300	6503	SO:0001819	synonymous_variant	3908	exon16			GCCTAGGCACAGG	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.2223G>A	6.37:g.129588265G>A		35	0		12	3	NM_001079823	Q14736|Q5VUM2|Q93022	Silent	SNP	ENST00000421865.2	37	CCDS5138.1																																																																																			.		0.443	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1		
SERAC1	84947	bcgsc.ca	37	6	158569934	158569934	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr6:158569934C>A	ENST00000367104.3	-	5	449	c.318G>T	c.(316-318)ttG>ttT	p.L106F	SERAC1_ENST00000367102.2_Missense_Mutation_p.L106F|SERAC1_ENST00000607000.1_Missense_Mutation_p.L106F|SERAC1_ENST00000367101.1_Missense_Mutation_p.L106F	NM_032861.3	NP_116250.3	Q96JX3	SRAC1_HUMAN	serine active site containing 1	106					extracellular matrix organization (GO:0030198)|GPI anchor metabolic process (GO:0006505)|intracellular protein transport (GO:0006886)|phospholipid biosynthetic process (GO:0008654)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)			endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	15		Breast(66;0.00519)|Ovarian(120;0.123)|Prostate(117;0.178)		OV - Ovarian serous cystadenocarcinoma(65;1.37e-18)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)		CTGATGTTGCCAATACTTTTC	0.328																																					p.L106F													.	SERAC1	31	0			c.G318T						.						172.0	136.0	148.0					6																	158569934		2203	4300	6503	SO:0001583	missense	84947	exon5			TGTTGCCAATACT	BC001705	CCDS5255.1	6q25.3	2003-05-12			ENSG00000122335	ENSG00000122335			21061	protein-coding gene	gene with protein product		614725					Standard	NM_032861		Approved	FLJ14917	uc003qrc.2	Q96JX3	OTTHUMG00000015905	ENST00000367104.3:c.318G>T	6.37:g.158569934C>A	ENSP00000356071:p.Leu106Phe	60	0		44	4	NM_032861	Q49AT1|Q5VTX3|Q6PKF3	Missense_Mutation	SNP	ENST00000367104.3	37	CCDS5255.1	.	.	.	.	.	.	.	.	.	.	C	10.33	1.320108	0.23994	.	.	ENSG00000122335	ENST00000367102;ENST00000367104;ENST00000367101	T;T;T	0.68624	-0.34;-0.34;-0.34	5.61	1.47	0.22746	.	0.211858	0.39475	N	0.001352	T	0.38134	0.1029	L	0.49455	1.56	0.48696	D	0.999693	B	0.09022	0.002	B	0.08055	0.003	T	0.46442	-0.9191	10	0.39692	T	0.17	-14.0598	4.7211	0.12918	0.1422:0.4188:0.0:0.439	.	106	Q96JX3	SRAC1_HUMAN	F	106	ENSP00000356069:L106F;ENSP00000356071:L106F;ENSP00000356068:L106F	ENSP00000356068:L106F	L	-	3	2	SERAC1	158489922	0.991000	0.36638	0.036000	0.18154	0.732000	0.41865	0.176000	0.16782	2.139000	0.66308	0.477000	0.44152	TTG	.		0.328	SERAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042862.1	NM_032861	
Unknown	0	bcgsc.ca	37	7	56356156	56356156	+	IGR	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr7:56356156C>A								AC073136.1 (18612 upstream) : RNU6-1335P (51767 downstream)																							TCAACAACAACTAATTAGGGA	0.413																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			CAACAACTAATTA																													7.37:g.56356156C>A		36	0		35	16	.		RNA	SNP		37																																																																																				.	0	0.413								
DNAJC2	27000	bcgsc.ca	37	7	102982346	102982346	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr7:102982346C>A	ENST00000379263.3	-	2	370	c.120G>T	c.(118-120)aaG>aaT	p.K40N	DNAJC2_ENST00000412522.1_Missense_Mutation_p.K40N|DNAJC2_ENST00000249270.7_Missense_Mutation_p.K40N	NM_014377.1	NP_055192.1	Q99543	DNJC2_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 2	40					'de novo' cotranslational protein folding (GO:0051083)|chromatin modification (GO:0016568)|DNA replication (GO:0006260)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|Hsp70 protein binding (GO:0030544)|poly(A) RNA binding (GO:0044822)|ubiquitin binding (GO:0043130)			endometrium(1)|kidney(9)|large_intestine(6)|lung(4)|ovary(1)	21						TGTTTCTCCTCTTAACAAAAG	0.418																																					p.K40N													.	DNAJC2	46	0			c.G120T						.						102.0	93.0	96.0					7																	102982346		1853	4103	5956	SO:0001583	missense	27000	exon2			TCTCCTCTTAACA	X98260	CCDS43628.1, CCDS47679.1	7q22-q32	2011-09-02	2008-07-01	2008-07-01	ENSG00000105821	ENSG00000105821		"""Heat shock proteins / DNAJ (HSP40)"""	13192	protein-coding gene	gene with protein product		605502	"""zuotin related factor 1"""	ZRF1		8885239	Standard	NM_001129887		Approved	MPP11, MPHOSPH11, ZUO1, zuotin	uc003vbo.3	Q99543	OTTHUMG00000157202	ENST00000379263.3:c.120G>T	7.37:g.102982346C>A	ENSP00000368565:p.Lys40Asn	40	0		49	4	NM_001129887	A4VCI0|Q9BVX1	Missense_Mutation	SNP	ENST00000379263.3	37	CCDS43628.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.95|15.95	2.982890|2.982890	0.53827|0.53827	.|.	.|.	ENSG00000105821|ENSG00000105821	ENST00000249270;ENST00000379263;ENST00000537811;ENST00000412522|ENST00000426036	T;T;T|.	0.21543|.	2.0;2.0;2.0|.	5.25|5.25	5.25|5.25	0.73442|0.73442	Heat shock protein DnaJ, N-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.70133|0.70133	0.3189|0.3189	L|L	0.50919|0.50919	1.6|1.6	0.58432|0.58432	D|D	0.999999|0.999999	B;D;P|.	0.76494|.	0.074;0.999;0.608|.	B;D;B|.	0.65233|.	0.043;0.933;0.261|.	T|T	0.67074|0.67074	-0.5762|-0.5762	10|5	0.26408|.	T|.	0.33|.	-6.3823|-6.3823	18.8548|18.8548	0.92247|0.92247	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	40;40;40|.	Q99543-2;F2Z3H0;Q99543|.	.;.;DNJC2_HUMAN|.	N|I	40|29	ENSP00000249270:K40N;ENSP00000368565:K40N;ENSP00000406275:K40N|.	ENSP00000249270:K40N|.	K|R	-|-	3|2	2|0	DNAJC2|DNAJC2	102769582|102769582	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	5.451000|5.451000	0.66632|0.66632	2.460000|2.460000	0.83146|0.83146	0.460000|0.460000	0.39030|0.39030	AAG|AGA	.		0.418	DNAJC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347891.1		
OR2A13P	392140	bcgsc.ca	37	7	143839528	143839528	+	IGR	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr7:143839528C>A								OR2A14 (12366 upstream) : CTAGE4 (41030 downstream)																							GTGCACGATCCTGGCTCTCAC	0.522																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	392140	.			ACGATCCTGGCTC																													7.37:g.143839528C>A		22	0		14	3	.		RNA	SNP		37																																																																																				.	0	0.522								
CA8	767	bcgsc.ca	37	8	61144922	61144922	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr8:61144922C>A	ENST00000317995.4	-	4	698	c.434G>T	c.(433-435)tGg>tTg	p.W145L	CA8_ENST00000528666.1_5'UTR	NM_004056.4	NP_004047.3	P35219	CAH8_HUMAN	carbonic anhydrase VIII	145					one-carbon metabolic process (GO:0006730)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasm (GO:0005737)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(5)|lung(6)|prostate(2)|skin(1)	16		all_cancers(86;0.172)|all_epithelial(80;0.0383)|all_lung(136;0.0413)|Lung NSC(129;0.0474)			Zonisamide(DB00909)	AGTGGAGTTCCAGTGGATCAG	0.448																																					p.W145L													.	CA8	31	0			c.G434T						.						174.0	162.0	166.0					8																	61144922		2203	4300	6503	SO:0001583	missense	767	exon4			GAGTTCCAGTGGA	L04656	CCDS6174.1	8q12.1	2012-08-21			ENSG00000178538	ENSG00000178538		"""Carbonic anhydrases"""	1382	protein-coding gene	gene with protein product		114815		CALS		17219437	Standard	NM_004056		Approved	CARP	uc003xtz.1	P35219	OTTHUMG00000165325	ENST00000317995.4:c.434G>T	8.37:g.61144922C>A	ENSP00000314407:p.Trp145Leu	38	0		28	3	NM_004056	A8K0A5|B3KQZ7|Q32MY2	Missense_Mutation	SNP	ENST00000317995.4	37	CCDS6174.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.854099	0.91355	.	.	ENSG00000178538	ENST00000317995	T	0.69306	-0.39	4.79	4.79	0.61399	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.134153	0.64402	D	0.000019	T	0.76111	0.3942	L	0.56340	1.77	0.80722	D	1	D	0.69078	0.997	P	0.59546	0.859	T	0.77595	-0.2529	10	0.51188	T	0.08	.	18.1848	0.89789	0.0:1.0:0.0:0.0	.	145	P35219	CAH8_HUMAN	L	145	ENSP00000314407:W145L	ENSP00000314407:W145L	W	-	2	0	CA8	61307476	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.152000	0.77419	2.377000	0.81083	0.650000	0.86243	TGG	.		0.448	CA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383445.1		
ASAP1	50807	bcgsc.ca	37	8	131070296	131070296	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr8:131070296C>A	ENST00000518721.1	-	29	3446	c.3219G>T	c.(3217-3219)aaG>aaT	p.K1073N	ASAP1_ENST00000357668.1_Missense_Mutation_p.K1073N	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	1073	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						CATAAATGGTCTTCACTCGCC	0.438																																					p.K1073N													.	ASAP1	133	0			c.G3219T						.						226.0	192.0	204.0					8																	131070296		2203	4300	6503	SO:0001583	missense	50807	exon29			AATGGTCTTCACT	AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.3219G>T	8.37:g.131070296C>A	ENSP00000429900:p.Lys1073Asn	69	0		68	4	NM_018482	B2RNV3	Missense_Mutation	SNP	ENST00000518721.1	37	CCDS6362.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.5|21.5	4.152876|4.152876	0.78001|0.78001	.|.	.|.	ENSG00000153317|ENSG00000153317	ENST00000524124;ENST00000519483|ENST00000343135;ENST00000357668;ENST00000518721	.|T;T	.|0.32272	.|1.46;1.46	5.37|5.37	5.37|5.37	0.77165|0.77165	.|Src homology-3 domain (3);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.61060|0.61060	0.2317|0.2317	M|M	0.90019|0.90019	3.08|3.08	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.76494	.|0.999;0.999;0.999	.|D;D;D	.|0.83275	.|0.996;0.996;0.996	T|T	0.68330|0.68330	-0.5437|-0.5437	5|10	.|0.87932	.|D	.|0	.|.	11.5603|11.5603	0.50772|0.50772	0.0:0.919:0.0:0.081|0.0:0.919:0.0:0.081	.|.	.|1073;1073;1076	.|B2RNV3;Q9ULH1;Q9ULH1-2	.|.;ASAP1_HUMAN;.	Y|N	894;430|1076;1073;1073	.|ENSP00000350297:K1073N;ENSP00000429900:K1073N	.|ENSP00000344591:K1076N	D|K	-|-	1|3	0|2	ASAP1|ASAP1	131139478|131139478	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	2.663000|2.663000	0.46774|0.46774	2.493000|2.493000	0.84123|0.84123	0.655000|0.655000	0.94253|0.94253	GAC|AAG	.		0.438	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380170.1	NM_018482	
GRINA	2907	bcgsc.ca	37	8	145065564	145065564	+	Missense_Mutation	SNP	C	C	A	rs377024859		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr8:145065564C>A	ENST00000313269.5	+	2	451	c.173C>A	c.(172-174)cCc>cAc	p.P58H	GRINA_ENST00000395068.4_Missense_Mutation_p.P58H	NM_000837.1	NP_000828.1	Q7Z429	LFG1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)	58	Pro-rich.					integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	9	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCAGGGTACCCCCATGGCCCC	0.701																																					p.P58H													.	GRINA	25	0			c.C173A						.						6.0	8.0	7.0					8																	145065564		2083	4128	6211	SO:0001583	missense	2907	exon2			GGTACCCCCATGG	NM_001009184	CCDS34961.1	8q24.3	2010-03-18	2008-04-01						4589	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 3"""	138251		NMDARA1		1719427, 8406459	Standard	XM_005250899		Approved	HNRGW, TMBIM3, LFG1	uc003zao.1	Q7Z429		ENST00000313269.5:c.173C>A	8.37:g.145065564C>A	ENSP00000314380:p.Pro58His	39	0		39	4	NM_001009184	B3KXM7|O43836|Q8IVW7	Missense_Mutation	SNP	ENST00000313269.5	37	CCDS34961.1	.	.	.	.	.	.	.	.	.	.	C	16.41	3.115698	0.56505	.	.	ENSG00000178719	ENST00000313269;ENST00000529301;ENST00000395068;ENST00000530898;ENST00000537637	T;T;T	0.24538	1.87;1.85;1.87	4.86	4.86	0.63082	.	0.141102	0.46758	D	0.000263	T	0.42607	0.1210	L	0.47190	1.495	0.43118	D	0.994833	D	0.89917	1.0	D	0.85130	0.997	T	0.09862	-1.0655	10	0.21540	T	0.41	-22.0463	15.8798	0.79195	0.0:1.0:0.0:0.0	.	58	Q7Z429	GRINA_HUMAN	H	58;58;58;58;39	ENSP00000314380:P58H;ENSP00000432706:P58H;ENSP00000378507:P58H	ENSP00000314380:P58H	P	+	2	0	GRINA	145137552	1.000000	0.71417	1.000000	0.80357	0.719000	0.41307	3.323000	0.52014	2.422000	0.82143	0.567000	0.79289	CCC	.		0.701	GRINA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384048.1	NM_001009184	
CDC37L1	55664	bcgsc.ca	37	9	4684988	4684988	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr9:4684988G>T	ENST00000381854.3	+	2	446	c.244G>T	c.(244-246)Gca>Tca	p.A82S	CDC37L1_ENST00000479095.1_3'UTR|CDC37L1_ENST00000381858.1_Missense_Mutation_p.A82S	NM_017913.2	NP_060383.2	Q7L3B6	CD37L_HUMAN	cell division cycle 37-like 1	82	Self-association.					cytoplasm (GO:0005737)				breast(1)|kidney(1)|lung(2)	4	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.0318)		TGGTAGCTTAGCACTGCATAA	0.458																																					p.A82S													.	CDC37L1	19	0			c.G244T						.						138.0	130.0	133.0					9																	4684988		2203	4300	6503	SO:0001583	missense	55664	exon2			AGCTTAGCACTGC	AK000497	CCDS6454.1	9p24.1	2013-01-17	2013-01-17		ENSG00000106993	ENSG00000106993			17179	protein-coding gene	gene with protein product		610346	"""CDC37 cell division cycle 37 homolog (S. cerevisiae)-like 1"", ""cell division cycle 37 homolog (S. cerevisiae)-like 1"""				Standard	NM_017913		Approved	HARC, FLJ20639, CDC37B	uc003zio.3	Q7L3B6	OTTHUMG00000019465	ENST00000381854.3:c.244G>T	9.37:g.4684988G>T	ENSP00000371278:p.Ala82Ser	44	0		29	3	NM_017913	B1AL70|Q9NWS3|Q9NX16	Missense_Mutation	SNP	ENST00000381854.3	37	CCDS6454.1	.	.	.	.	.	.	.	.	.	.	G	18.20	3.571364	0.65765	.	.	ENSG00000106993	ENST00000381858;ENST00000381854	T;T	0.45276	0.91;0.9	5.73	5.73	0.89815	.	0.150288	0.64402	D	0.000013	T	0.33527	0.0866	N	0.24115	0.695	0.49130	D	0.999755	B	0.14805	0.011	B	0.19946	0.027	T	0.08806	-1.0704	10	0.19147	T	0.46	-2.9593	19.9134	0.97033	0.0:0.0:1.0:0.0	.	82	Q7L3B6	CD37L_HUMAN	S	82	ENSP00000371282:A82S;ENSP00000371278:A82S	ENSP00000371278:A82S	A	+	1	0	CDC37L1	4674988	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.778000	0.75043	2.708000	0.92522	0.467000	0.42956	GCA	.		0.458	CDC37L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051564.1	NM_017913	
RP13-60M5.2	0	bcgsc.ca	37	9	91266948	91266948	+	lincRNA	SNP	C	C	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr9:91266948C>T	ENST00000418343.2	-	0	103																											AGCATTAGGACAGATGTATAA	0.443																																					.													.	.	.	0			.						.						144.0	137.0	139.0					9																	91266948		1951	4145	6096			0	.			TTAGGACAGATGT																													9.37:g.91266948C>T		86	0		34	3	.		RNA	SNP	ENST00000418343.2	37																																																																																				.		0.443	RP13-60M5.2-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000052976.2		
CACUL1	143384	bcgsc.ca	37	10	120450823	120450823	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr10:120450823G>T	ENST00000369151.3	-	7	1462	c.979C>A	c.(979-981)Caa>Aaa	p.Q327K	CACUL1_ENST00000544392.1_5'UTR	NM_153810.4	NP_722517.3	Q86Y37	CACL1_HUMAN	CDK2-associated, cullin domain 1	327					G1/S transition of mitotic cell cycle (GO:0000082)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein kinase activity (GO:0045860)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)	protein kinase binding (GO:0019901)										TTCTGATCTTGAGCAGCATAT	0.393																																					p.Q327K													.	.	.	0			c.C979A						.						143.0	147.0	146.0					10																	120450823		1813	4078	5891	SO:0001583	missense	143384	exon7			GATCTTGAGCAGC	AK097728	CCDS41570.1	10q26.13	2012-06-12	2012-06-12	2012-06-12	ENSG00000151893	ENSG00000151893			23727	protein-coding gene	gene with protein product	"""Cdk-Associated Cullin1"""		"""chromosome 10 open reading frame 46"""	C10orf46		19829063	Standard	NM_153810		Approved	FLJ40409, MGC33215, CAC1	uc001lds.1	Q86Y37	OTTHUMG00000019138	ENST00000369151.3:c.979C>A	10.37:g.120450823G>T	ENSP00000358147:p.Gln327Lys	126	0		136	5	NM_153810	Q5XPL7|Q8IY11|Q8N7S4	Missense_Mutation	SNP	ENST00000369151.3	37	CCDS41570.1	.	.	.	.	.	.	.	.	.	.	G	19.78	3.890658	0.72524	.	.	ENSG00000151893	ENST00000544392;ENST00000369156;ENST00000369151	T	0.75477	-0.94	5.97	5.06	0.68205	.	0.112936	0.64402	D	0.000007	T	0.63698	0.2533	L	0.32530	0.975	0.80722	D	1	P	0.35844	0.524	B	0.24974	0.057	T	0.67055	-0.5767	10	0.72032	D	0.01	-5.1767	17.1882	0.86872	0.0:0.1263:0.8737:0.0	.	327	Q86Y37	CJ046_HUMAN	K	138;204;327	ENSP00000358147:Q327K	ENSP00000358147:Q327K	Q	-	1	0	C10orf46	120440813	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.925000	0.75829	1.508000	0.48769	0.585000	0.79938	CAA	.		0.393	CACUL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050612.2	NM_153810	
CAPRIN1	4076	bcgsc.ca	37	11	34074142	34074142	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr11:34074142G>T	ENST00000341394.4	+	2	364	c.175G>T	c.(175-177)Ggg>Tgg	p.G59W	CAPRIN1_ENST00000389645.3_Missense_Mutation_p.G59W|CAPRIN1_ENST00000529307.1_5'Flank|CAPRIN1_ENST00000530820.1_Missense_Mutation_p.G59W|CAPRIN1_ENST00000532820.1_Missense_Mutation_p.G59W	NM_005898.4	NP_005889.3	Q14444	CAPR1_HUMAN	cell cycle associated protein 1	59					negative regulation of translation (GO:0017148)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	18		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				GCAGATTCTCGGGGTGATCGA	0.697																																					p.G59W													.	CAPRIN1	110	0			c.G175T						.						17.0	17.0	17.0					11																	34074142		2189	4281	6470	SO:0001583	missense	4076	exon2			ATTCTCGGGGTGA	BC001731	CCDS31453.1, CCDS31454.1	11p13	2010-08-03	2007-03-27	2007-03-27	ENSG00000135387	ENSG00000135387			6743	protein-coding gene	gene with protein product	"""cytoplasmic activation/proliferation-associated protein-1"""	601178	"""membrane component, chromosome 11, surface marker 1"", ""GPI-anchored membrane protein 1"""	M11S1, GPIAP1		7657653, 16177067, 17210633, 14764709, 15471883	Standard	NM_005898		Approved	caprin-1, RNG105	uc001mvh.1	Q14444	OTTHUMG00000166248	ENST00000341394.4:c.175G>T	11.37:g.34074142G>T	ENSP00000340329:p.Gly59Trp	51	0		56	4	NM_203364	A6NMY7|D3DR06|Q15074|Q6IMN4|Q6IMN7|Q9BV09	Missense_Mutation	SNP	ENST00000341394.4	37	CCDS31453.1	.	.	.	.	.	.	.	.	.	.	G	16.95	3.262371	0.59431	.	.	ENSG00000135387	ENST00000341394;ENST00000389645;ENST00000534825;ENST00000532820;ENST00000530820	T;T;T;T;T	0.21734	1.99;1.99;1.99;1.99;1.99	4.21	3.29	0.37713	.	0.255473	0.36893	U	0.002345	T	0.36608	0.0973	L	0.59436	1.845	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.67900	0.954;0.936	T	0.03993	-1.0986	10	0.37606	T	0.19	-3.7741	10.2214	0.43198	0.0962:0.0:0.9038:0.0	.	59;59	Q14444;Q14444-2	CAPR1_HUMAN;.	W	59	ENSP00000340329:G59W;ENSP00000374296:G59W;ENSP00000431373:G59W;ENSP00000434150:G59W;ENSP00000434204:G59W	ENSP00000340329:G59W	G	+	1	0	CAPRIN1	34030718	1.000000	0.71417	0.999000	0.59377	0.819000	0.46315	5.405000	0.66351	0.896000	0.36366	-0.268000	0.10319	GGG	.		0.697	CAPRIN1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000388680.2	NM_005898	
RP11-167J8.3	0	bcgsc.ca	37	11	71417571	71417571	+	lincRNA	SNP	C	C	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr11:71417571C>T	ENST00000532530.1	-	0	0				AP003498.2_ENST00000411303.1_RNA																							ttctctaactcgctcaagtac	0.537																																					.													.	.	.	0			.						.																																					0	.			CTAACTCGCTCAA																													11.37:g.71417571C>T		123	0		138	7	.		RNA	SNP	ENST00000532530.1	37																																																																																				.		0.537	RP11-167J8.3-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000394696.1		
KMT2D	8085	bcgsc.ca	37	12	49421075	49421075	+	Missense_Mutation	SNP	G	G	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr12:49421075G>A	ENST00000301067.7	-	48	14673	c.14674C>T	c.(14674-14676)Cac>Tac	p.H4892Y		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	4892					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GTATAGCTGTGCTGAGTGGGT	0.607																																					p.H4892Y													.	MLL2	1173	0			c.C14674T						.						98.0	104.0	102.0					12																	49421075		1830	3925	5755	SO:0001583	missense	9757	exon48			AGCTGTGCTGAGT	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.14674C>T	12.37:g.49421075G>A	ENSP00000301067:p.His4892Tyr	47	0		50	4	NM_003482	O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	G	12.31	1.899962	0.33535	.	.	ENSG00000167548	ENST00000301067	D	0.81579	-1.51	4.03	4.03	0.46877	.	0.000000	0.38272	N	0.001753	D	0.88738	0.6518	M	0.73962	2.25	0.58432	D	0.999995	D	0.71674	0.998	D	0.78314	0.991	D	0.90421	0.4417	10	0.87932	D	0	.	15.4834	0.75545	0.0:0.0:1.0:0.0	.	4892	O14686	MLL2_HUMAN	Y	4892	ENSP00000301067:H4892Y	ENSP00000301067:H4892Y	H	-	1	0	MLL2	47707342	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.300000	0.78841	2.255000	0.74692	0.655000	0.94253	CAC	.		0.607	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
CIT	11113	bcgsc.ca	37	12	120135559	120135559	+	Silent	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr12:120135559G>T	ENST00000261833.7	-	45	5713	c.5661C>A	c.(5659-5661)tcC>tcA	p.S1887S	RP1-127H14.3_ENST00000535109.1_5'Flank|CIT_ENST00000537607.1_5'UTR|CIT_ENST00000392521.2_Silent_p.S1929S	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	1887					cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		CCTGGTATGAGGACGCCAAGT	0.602																																					p.S1929S													.	CIT	535	0			c.C5787A						.						100.0	104.0	102.0					12																	120135559		2203	4300	6503	SO:0001819	synonymous_variant	11113	exon46			GTATGAGGACGCC	AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.5661C>A	12.37:g.120135559G>T		43	0		29	4	NM_001206999	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Silent	SNP	ENST00000261833.7	37	CCDS9192.1	.	.	.	.	.	.	.	.	.	.	G	9.546	1.114775	0.20795	.	.	ENSG00000122966	ENST00000392520	.	.	.	5.07	1.06	0.20224	.	.	.	.	.	T	0.52025	0.1709	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38845	-0.9642	4	.	.	.	.	6.0161	0.19603	0.35:0.1291:0.5209:0.0	.	.	.	.	H	1500	.	.	P	-	2	0	CIT	118619942	0.999000	0.42202	0.962000	0.40283	0.891000	0.51852	0.550000	0.23345	0.242000	0.21303	0.655000	0.94253	CCT	.		0.602	CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259410.4	NM_007174	
RPL22P19	644022	bcgsc.ca	37	12	125420235	125420235	+	RNA	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr12:125420235C>A	ENST00000480427.1	-	0	206									ribosomal protein L22 pseudogene 19																		GTCACTACCCCTCCACCAAAG	0.458																																					.													.	.	.	0			.						.																																					644022	.			CTACCCCTCCACC			12q24.31	2009-03-11				ENSG00000241129			36567	pseudogene	pseudogene						19123937	Standard	NG_010946		Approved						12.37:g.125420235C>A		40	0		75	5	.		RNA	SNP	ENST00000480427.1	37																																																																																				.		0.458	RPL22P19-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000351190.1	NG_010946	
EP400	57634	bcgsc.ca	37	12	132547093	132547093	+	Silent	SNP	A	A	G	rs10902490|rs528214697	byFrequency	TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr12:132547093A>G	ENST00000333577.4	+	48	8398	c.8289A>G	c.(8287-8289)caA>caG	p.Q2763Q	EP400_ENST00000389562.2_Silent_p.Q2726Q|EP400_ENST00000332482.4_Silent_p.Q2690Q|EP400_ENST00000330386.6_Silent_p.Q2646Q|EP400_ENST00000389561.2_Silent_p.Q2727Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2763	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q2726Q(9)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcaacaacagcagcagc	0.567																																					p.Q2727Q													EP400,NS,carcinoma,0,15	EP400	370	9	Substitution - coding silent(9)	lung(3)|kidney(2)|endometrium(2)|central_nervous_system(2)	c.A8181G						.						25.0	29.0	28.0					12																	132547093		2173	4217	6390	SO:0001819	synonymous_variant	57634	exon47			GCAACAACAGCAG	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8289A>G	12.37:g.132547093A>G		30	1		31	5	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																				A|0.500;G|0.500		0.567	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
FAR1P1	100128011	bcgsc.ca	37	13	90823573	90823573	+	IGR	SNP	A	A	C			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr13:90823573A>C								RNA5SP34 (35478 upstream) : MIR622 (59862 downstream)																							GTGAAGTTTAATACCATGTAA	0.388																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	100128011	.			AGTTTAATACCAT																													13.37:g.90823573A>C		25	0		32	16	.		RNA	SNP		37																																																																																				.	0	0.388								
POLE2	5427	bcgsc.ca	37	14	50120901	50120901	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr14:50120901C>A	ENST00000216367.5	-	14	1204	c.1105G>T	c.(1105-1107)Gat>Tat	p.D369Y	POLE2_ENST00000539565.2_Missense_Mutation_p.D343Y|POLE2_ENST00000554396.1_Missense_Mutation_p.D369Y|POLE2_ENST00000556584.1_5'UTR	NM_002692.3	NP_002683.2	P56282	DPOE2_HUMAN	polymerase (DNA directed), epsilon 2, accessory subunit	369					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	epsilon DNA polymerase complex (GO:0008622)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	10	all_epithelial(31;0.0021)|Breast(41;0.0124)				Cladribine(DB00242)	AATCCAGGATCCTCTGGACCA	0.308																																					p.D369Y													.	POLE2	36	0			c.G1105T						.						47.0	48.0	48.0					14																	50120901		2203	4300	6503	SO:0001583	missense	5427	exon14			CAGGATCCTCTGG	AF025840	CCDS32073.1, CCDS55914.1, CCDS55915.1	14q21-q22	2012-05-18	2012-05-18		ENSG00000100479	ENSG00000100479		"""DNA polymerases"""	9178	protein-coding gene	gene with protein product	"""DNA polymerase epsilon subunit B"""	602670	"""polymerase (DNA directed), epsilon 2 (p59 subunit)"""			9405441, 9443964	Standard	NM_002692		Approved	DPE2	uc001wwu.3	P56282	OTTHUMG00000170813	ENST00000216367.5:c.1105G>T	14.37:g.50120901C>A	ENSP00000216367:p.Asp369Tyr	108	0		76	4	NM_001197331	A0AV55|A4FU92|A4LBB7|A6NH58|B4DDE6|O43560	Missense_Mutation	SNP	ENST00000216367.5	37	CCDS32073.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.514034	0.85389	.	.	ENSG00000100479	ENST00000216367;ENST00000539565;ENST00000554396	T;T;T	0.73681	-0.77;-0.77;-0.77	5.62	5.62	0.85841	DNA polymerase alpha/epsilon, subunit B (1);	0.000000	0.85682	D	0.000000	D	0.90321	0.6972	H	0.94964	3.605	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.92600	0.6090	10	0.87932	D	0	-26.6391	17.8508	0.88747	0.0:1.0:0.0:0.0	.	369;343;369	A4FU92;B4DDE6;P56282	.;.;DPOE2_HUMAN	Y	369;343;369	ENSP00000216367:D369Y;ENSP00000446313:D343Y;ENSP00000451621:D369Y	ENSP00000216367:D369Y	D	-	1	0	POLE2	49190651	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.886000	0.69743	2.665000	0.90641	0.650000	0.86243	GAT	.		0.308	POLE2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410512.1	NM_002692	
Unknown	0	bcgsc.ca	37	14	106444624	106444624	+	IGR	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr14:106444624C>A								ADAM6 (6266 upstream) : IGHV1-2 (8046 downstream)																							CCTTTCTGGGCCTTGATTTTC	0.418																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			TCTGGGCCTTGAT																													14.37:g.106444624C>A		77	0		62	4	.		RNA	SNP		37																																																																																				.	0	0.418								
HERC2	8924	bcgsc.ca	37	15	28375649	28375649	+	Splice_Site	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr15:28375649C>A	ENST00000261609.7	-	82	12770	c.12662G>T	c.(12661-12663)tGg>tTg	p.W4221L		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TCTTGCGTACCAGGTATAAAC	0.438																																					p.W4221L													.	HERC2	501	0			c.G12662T						.						182.0	196.0	192.0					15																	28375649		2203	4300	6503	SO:0001630	splice_region_variant	8924	exon82			GCGTACCAGGTAT	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.12662+1G>T	15.37:g.28375649C>A		36	0		44	4	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.448036	0.84101	.	.	ENSG00000128731	ENST00000261609	D	0.92199	-2.99	5.03	5.03	0.67393	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.97514	0.9186	H	0.96460	3.825	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98994	1.0809	9	.	.	.	.	18.3543	0.90352	0.0:1.0:0.0:0.0	.	4221	O95714	HERC2_HUMAN	L	4221	ENSP00000261609:W4221L	.	W	-	2	0	HERC2	26049244	1.000000	0.71417	0.999000	0.59377	0.564000	0.35744	7.788000	0.85771	2.310000	0.77875	0.561000	0.74099	TGG	.		0.438	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	Missense_Mutation
TMOD2	29767	bcgsc.ca	37	15	52060462	52060462	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr15:52060462G>T	ENST00000249700.4	+	3	351	c.130G>T	c.(130-132)Gcc>Tcc	p.A44S	TMOD2_ENST00000539962.2_5'UTR|TMOD2_ENST00000435126.2_Missense_Mutation_p.A44S	NM_001142885.1|NM_014548.3	NP_001136357.1|NP_055363.1	Q9NZR1	TMOD2_HUMAN	tropomodulin 2 (neuronal)	44					learning or memory (GO:0007611)|nervous system development (GO:0007399)|neuron-neuron synaptic transmission (GO:0007270)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)	tropomyosin binding (GO:0005523)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	16				all cancers(107;0.00435)		TTGTCAGAGTGCCATGCTGCC	0.567																																					p.A44S													.	TMOD2	36	0			c.G130T						.						50.0	47.0	48.0					15																	52060462		2195	4293	6488	SO:0001583	missense	29767	exon3			CAGAGTGCCATGC	AF177169	CCDS10144.1, CCDS45260.1	15q21.2	2008-05-14			ENSG00000128872	ENSG00000128872			11872	protein-coding gene	gene with protein product		602928				10662549	Standard	NM_014548		Approved	NTMOD	uc002abk.3	Q9NZR1	OTTHUMG00000131805	ENST00000249700.4:c.130G>T	15.37:g.52060462G>T	ENSP00000249700:p.Ala44Ser	42	0		48	4	NM_014548	B4DEW6	Missense_Mutation	SNP	ENST00000249700.4	37	CCDS10144.1	.	.	.	.	.	.	.	.	.	.	G	17.88	3.497613	0.64186	.	.	ENSG00000128872	ENST00000435126;ENST00000249700	T;T	0.30714	1.52;1.52	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.43809	0.1264	L	0.35542	1.07	0.58432	D	0.999992	D;D	0.89917	0.984;1.0	D;D	0.91635	0.916;0.999	T	0.06698	-1.0812	10	0.06757	T	0.87	-18.4717	20.3931	0.98965	0.0:0.0:1.0:0.0	.	44;44	Q9NZR1-2;Q9NZR1	.;TMOD2_HUMAN	S	44	ENSP00000404590:A44S;ENSP00000249700:A44S	ENSP00000249700:A44S	A	+	1	0	TMOD2	49847754	1.000000	0.71417	0.922000	0.36590	0.532000	0.34746	7.986000	0.88173	2.824000	0.97209	0.655000	0.94253	GCC	.		0.567	TMOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254742.2		
CIITA	4261	bcgsc.ca	37	16	11001930	11001930	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr16:11001930C>A	ENST00000324288.8	+	11	2714	c.2581C>A	c.(2581-2583)Ctg>Atg	p.L861M	CIITA_ENST00000381835.5_Intron|CIITA_ENST00000537380.1_Intron	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	861					aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						AGACTTCTCCCTGGACCTCCG	0.652			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """																																p.L861M				Dom	yes		16	16p13	4261	"""class II, major histocompatibility complex, transactivator"""		L	.	CIITA	92	0			c.C2581A						.						14.0	16.0	15.0					16																	11001930		2197	4292	6489	SO:0001583	missense	4261	exon11			TTCTCCCTGGACC	U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.2581C>A	16.37:g.11001930C>A	ENSP00000316328:p.Leu861Met	36	0		34	4	NM_000246	A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Missense_Mutation	SNP	ENST00000324288.8	37	CCDS10544.1	.	.	.	.	.	.	.	.	.	.	C	14.99	2.699118	0.48307	.	.	ENSG00000179583	ENST00000324288;ENST00000388910	T	0.79033	-1.23	4.86	3.89	0.44902	.	0.000000	0.51477	D	0.000093	D	0.84302	0.5442	M	0.71581	2.175	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.87578	0.996;0.991;0.998;0.998	T	0.83221	-0.0068	10	0.59425	D	0.04	.	6.4223	0.21750	0.0:0.7032:0.0:0.2968	.	861;861;813;861	A0N0N9;P33076;F2Z2G8;Q96KL4	.;C2TA_HUMAN;.;.	M	861;813	ENSP00000316328:L861M	ENSP00000316328:L861M	L	+	1	2	CIITA	10909431	1.000000	0.71417	0.999000	0.59377	0.693000	0.40251	1.560000	0.36331	0.989000	0.38761	0.655000	0.94253	CTG	.		0.652	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251966.2	NM_000246	
USP6	9098	bcgsc.ca	37	17	5040990	5040990	+	Silent	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr17:5040990G>T	ENST00000574788.1	+	20	3100	c.870G>T	c.(868-870)gtG>gtT	p.V290V	USP6_ENST00000250066.6_Silent_p.V290V|USP6_ENST00000332776.4_Silent_p.V290V|USP6_ENST00000304328.5_5'UTR			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	290	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						TGTATTTGGTGGAAGGAGAAC	0.582			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																p.V290V				Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	.	USP6	213	0			c.G870T						.						246.0	225.0	232.0					17																	5040990		2203	4300	6503	SO:0001819	synonymous_variant	9098	exon12			TTTGGTGGAAGGA	X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.870G>T	17.37:g.5040990G>T		75	0		54	4	NM_004505	Q15634|Q86WP6|Q8IWT4	Silent	SNP	ENST00000574788.1	37	CCDS11069.2																																																																																			.		0.582	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438990.1	NM_004505	
JUP	3728	bcgsc.ca	37	17	39912069	39912069	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr17:39912069C>A	ENST00000393931.3	-	14	2283	c.2165G>T	c.(2164-2166)gGa>gTa	p.G722V	JUP_ENST00000310706.5_Missense_Mutation_p.G722V|JUP_ENST00000540235.1_Intron|JUP_ENST00000393930.1_Missense_Mutation_p.G722V	NM_002230.2	NP_002221.1	P14923	PLAK_HUMAN	junction plakoglobin	722					adherens junction organization (GO:0034332)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell-cell junction organization (GO:0045216)|cellular response to indole-3-methanol (GO:0071681)|cytoskeletal anchoring at plasma membrane (GO:0007016)|desmosome assembly (GO:0002159)|detection of mechanical stimulus (GO:0050982)|ectoderm development (GO:0007398)|endothelial cell-cell adhesion (GO:0071603)|establishment of protein localization to plasma membrane (GO:0090002)|gastrulation (GO:0007369)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|nervous system development (GO:0007399)|oocyte development (GO:0048599)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein heterooligomerization (GO:0051291)|regulation of cell proliferation (GO:0042127)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)|ventricular cardiac muscle cell action potential (GO:0086005)	actin cytoskeleton (GO:0015629)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gamma-catenin-TCF7L2 complex (GO:0071665)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|cadherin binding (GO:0045296)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|structural constituent of cell wall (GO:0005199)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	23		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		GGGGTAGTCTCCATCCATGTC	0.642																																					p.G722V	Colon(16;42 520 6044 17852 28530)												.	JUP	64	0			c.G2165T						.						95.0	85.0	89.0					17																	39912069		2203	4300	6503	SO:0001583	missense	3728	exon14			TAGTCTCCATCCA	AF233882	CCDS11407.1	17q21	2014-09-17	2004-08-09		ENSG00000173801	ENSG00000173801		"""Armadillo repeat containing"""	6207	protein-coding gene	gene with protein product		173325	"""catenin (cadherin-associated protein), gamma 80kDa"""	CTNNG		1889810, 7604000	Standard	NM_021991		Approved	DP3, PDGB, PKGB, DPIII	uc002hxs.2	P14923	OTTHUMG00000133494	ENST00000393931.3:c.2165G>T	17.37:g.39912069C>A	ENSP00000377508:p.Gly722Val	22	0		19	4	NM_021991	Q15093|Q15151|Q7L3S5|Q86W21|Q9BWC4|Q9HCX9	Missense_Mutation	SNP	ENST00000393931.3	37	CCDS11407.1	.	.	.	.	.	.	.	.	.	.	C	12.26	1.884216	0.33255	.	.	ENSG00000173801	ENST00000393930;ENST00000310706;ENST00000393931	T;T;T	0.61392	0.11;0.11;0.11	4.84	3.85	0.44370	.	0.499734	0.21105	N	0.080097	T	0.49287	0.1548	L	0.50333	1.59	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.48340	-0.9044	10	0.51188	T	0.08	-28.8205	9.1582	0.37005	0.166:0.6736:0.1604:0.0	.	722	P14923	PLAK_HUMAN	V	722	ENSP00000377507:G722V;ENSP00000311113:G722V;ENSP00000377508:G722V	ENSP00000311113:G722V	G	-	2	0	JUP	37165595	0.093000	0.21703	0.435000	0.26784	0.965000	0.64279	1.655000	0.37345	1.221000	0.43506	0.655000	0.94253	GGA	.		0.642	JUP-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257406.1		
SCRN2	90507	bcgsc.ca	37	17	45918185	45918185	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr17:45918185G>T	ENST00000290216.9	-	2	150	c.25C>A	c.(25-27)Cca>Aca	p.P9T	SCRN2_ENST00000584123.1_Missense_Mutation_p.P17T|SCRN2_ENST00000407215.3_Missense_Mutation_p.P9T	NM_001145023.1|NM_138355.3	NP_001138495.1|NP_612364.2	Q96FV2	SCRN2_HUMAN	secernin 2	9						extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)			cervix(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	14						CAGGAACATGGGGAGTCAGGG	0.657																																					p.P9T													.	SCRN2	35	0			c.C25A						.						27.0	33.0	31.0					17																	45918185		2203	4300	6503	SO:0001583	missense	90507	exon2			AACATGGGGAGTC	BC002980	CCDS11519.1, CCDS45723.1	17q21	2008-02-05							30381	protein-coding gene	gene with protein product		614966				12221138	Standard	NM_001145023		Approved		uc002imd.3	Q96FV2		ENST00000290216.9:c.25C>A	17.37:g.45918185G>T	ENSP00000290216:p.Pro9Thr	80	0		68	5	NM_138355	A8K3N1|B7Z8S7|E9PBV5|Q96AC3|Q9BU04	Missense_Mutation	SNP	ENST00000290216.9	37	CCDS11519.1	.	.	.	.	.	.	.	.	.	.	g	21.2	4.120151	0.77323	.	.	ENSG00000141295	ENST00000290216;ENST00000407215	T;T	0.11385	2.83;2.78	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.38983	0.1061	M	0.83223	2.63	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.997;0.997	T	0.23868	-1.0176	10	0.72032	D	0.01	-14.3584	18.2917	0.90133	0.0:0.0:1.0:0.0	.	9;9;9	E9PBV5;Q96FV2;B7Z8S7	.;SCRN2_HUMAN;.	T	9	ENSP00000290216:P9T;ENSP00000383935:P9T	ENSP00000290216:P9T	P	-	1	0	SCRN2	43273184	1.000000	0.71417	0.983000	0.44433	0.448000	0.32197	7.765000	0.85310	2.636000	0.89361	0.651000	0.88453	CCA	.		0.657	SCRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441383.1	NM_138355	
SDAD1P2	400836	bcgsc.ca	37	20	10366879	10366879	+	IGR	SNP	T	T	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr20:10366879T>A								SNAP25-AS1 (17455 upstream) : MKKS (14777 downstream)																							AACTTCTACGTTGCCATGATA	0.348																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	400836	.			TCTACGTTGCCAT																													20.37:g.10366879T>A		24	0		25	5	.		RNA	SNP		37																																																																																				.	0	0.348								
FRG1B	284802	bcgsc.ca	37	20	29632707	29632707	+	Silent	SNP	G	G	A	rs6057187		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr20:29632707G>A	ENST00000278882.3	+	8	902	c.522G>A	c.(520-522)gaG>gaA	p.E174E	FRG1B_ENST00000358464.4_Silent_p.E174E			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	174								p.E174E(10)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TTTTGCATGAGACGCTTCTGG	0.313																																					.													FRG1B,NS,malignant_melanoma,0,4	FRG1B	181	10	Substitution - coding silent(10)	endometrium(6)|kidney(4)	.						.																																			SO:0001819	synonymous_variant	284802	.			GCATGAGACGCTT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.522G>A	20.37:g.29632707G>A		249	11		256	17	.	C4AME5	Silent	SNP	ENST00000278882.3	37																																																																																				G|0.500;A|0.500		0.313	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
ACSS2	55902	bcgsc.ca	37	20	33470783	33470783	+	Missense_Mutation	SNP	C	C	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr20:33470783C>A	ENST00000360596.2	+	2	576	c.365C>A	c.(364-366)gCt>gAt	p.A122D	ACSS2_ENST00000253382.5_Missense_Mutation_p.A122D|ACSS2_ENST00000476922.1_3'UTR|ACSS2_ENST00000336325.4_Missense_Mutation_p.A72D	NM_018677.3	NP_061147.1	Q9NR19	ACSA_HUMAN	acyl-CoA synthetase short-chain family member 2	122					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|lipid biosynthetic process (GO:0008610)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)			cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(9)	21					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GATAAAGTTGCTTTTTACTGG	0.363																																					p.A122D													.	ACSS2	75	0			c.C365A						.						72.0	67.0	69.0					20																	33470783		2203	4300	6503	SO:0001583	missense	55902	exon2			AAGTTGCTTTTTA	AF263614	CCDS13243.1, CCDS42868.1, CCDS42868.2	20q11.22	2012-07-13	2005-09-08	2005-09-08	ENSG00000131069	ENSG00000131069	6.2.1.1	"""Acyl-CoA synthetase family"""	15814	protein-coding gene	gene with protein product		605832	"""acetyl-Coenzyme A synthetase 2 (ADP forming)"""	ACAS2		10843999	Standard	NM_018677		Approved	ACS, ACSA, AceCS, dJ1161H23.1	uc010gey.2	Q9NR19	OTTHUMG00000032317	ENST00000360596.2:c.365C>A	20.37:g.33470783C>A	ENSP00000353804:p.Ala122Asp	48	0		28	3	NM_001076552	A6NE90|Q5QPH2|Q5QPH3|Q8N238|Q96EL0|Q9NQP7|Q9UJ15	Missense_Mutation	SNP	ENST00000360596.2	37	CCDS13243.1	.	.	.	.	.	.	.	.	.	.	C	30	5.049691	0.93740	.	.	ENSG00000131069	ENST00000488172;ENST00000336325;ENST00000360596;ENST00000374693;ENST00000484354;ENST00000493805;ENST00000473172;ENST00000253382	T;T;T;T;T;T;T	0.60797	0.16;0.16;0.16;1.99;1.99;0.16;0.16	5.97	5.97	0.96955	Acyl-CoA synthase, domain of unknown function DUF3448 (1);	0.047902	0.85682	D	0.000000	D	0.86447	0.5935	H	0.98295	4.195	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.994;1.0;0.996	D	0.91006	0.4846	10	0.87932	D	0	-17.2035	19.1953	0.93686	0.0:1.0:0.0:0.0	.	122;122;122	Q5QPH3;B4DEH9;Q9NR19	.;.;ACSA_HUMAN	D	72;72;122;122;114;122;122;122	ENSP00000417783:A72D;ENSP00000337190:A72D;ENSP00000353804:A122D;ENSP00000419167:A114D;ENSP00000418812:A122D;ENSP00000419925:A122D;ENSP00000253382:A122D	ENSP00000253382:A122D	A	+	2	0	ACSS2	32934444	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.439000	0.80444	2.834000	0.97654	0.650000	0.86243	GCT	.		0.363	ACSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078823.3	NM_018677	
SYNJ1	8867	bcgsc.ca	37	21	34072179	34072179	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr21:34072179G>T	ENST00000322229.7	-	3	447	c.448C>A	c.(448-450)Caa>Aaa	p.Q150K	SYNJ1_ENST00000433931.2_Missense_Mutation_p.Q189K|SYNJ1_ENST00000382491.3_Missense_Mutation_p.Q150K|SYNJ1_ENST00000357345.3_Missense_Mutation_p.Q150K|SYNJ1_ENST00000382499.2_Missense_Mutation_p.Q189K			O43426	SYNJ1_HUMAN	synaptojanin 1	150	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						GTCTGTTCTTGCATGCTACGA	0.363																																					p.Q189K													.	SYNJ1	253	0			c.C565A						.						58.0	58.0	58.0					21																	34072179		2203	4300	6503	SO:0001583	missense	8867	exon4			GTTCTTGCATGCT	AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926	ENST00000322229.7:c.448C>A	21.37:g.34072179G>T	ENSP00000322234:p.Gln150Lys	33	0		27	3	NM_203446	O43425|O94984|Q4KMR1	Missense_Mutation	SNP	ENST00000322229.7	37	CCDS54484.1	.	.	.	.	.	.	.	.	.	.	G	11.73	1.726951	0.30593	.	.	ENSG00000159082	ENST00000382491;ENST00000357345;ENST00000382499;ENST00000433931;ENST00000322229;ENST00000429236;ENST00000456084	T;T;T;T;T;T;T	0.56611	0.45;0.45;0.45;0.45;0.45;0.45;0.45	5.6	5.6	0.85130	Synaptojanin, N-terminal (2);	0.059685	0.64402	D	0.000002	T	0.45256	0.1333	L	0.51422	1.61	0.51233	D	0.999917	B;B;B;B;P	0.39022	0.014;0.027;0.035;0.073;0.655	B;B;B;B;B	0.30855	0.029;0.038;0.027;0.065;0.121	T	0.40308	-0.9570	10	0.15952	T	0.53	.	19.6209	0.95654	0.0:0.0:1.0:0.0	.	150;189;150;150;150	B9EGN3;C9JFZ1;O43426-2;O43426;O43426-4	.;.;.;SYNJ1_HUMAN;.	K	150;150;189;189;150;150;150	ENSP00000371931:Q150K;ENSP00000349903:Q150K;ENSP00000371939:Q189K;ENSP00000409667:Q189K;ENSP00000322234:Q150K;ENSP00000413649:Q150K;ENSP00000412707:Q150K	ENSP00000322234:Q150K	Q	-	1	0	SYNJ1	32994050	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.000000	0.57039	2.646000	0.89796	0.585000	0.79938	CAA	.		0.363	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	protein_coding			
NF1P6	644637	bcgsc.ca	37	22	16349406	16349406	+	IGR	SNP	G	G	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr22:16349406G>A								POTEH (61469 upstream) : LA16c-2F2.8 (23674 downstream)																							AGGATGCAGCGGAACCCCCCT	0.483																																					.													.	.	.	0			.						.																																			SO:0001628	intergenic_variant	644637	.			TGCAGCGGAACCC																													22.37:g.16349406G>A		44	0		21	4	.		RNA	SNP		37																																																																																				.	0	0.483								
CLTCL1	8218	bcgsc.ca	37	22	19226799	19226799	+	Splice_Site	SNP	T	T	A			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr22:19226799T>A	ENST00000263200.10	-	5	866	c.794A>T	c.(793-795)cAg>cTg	p.Q265L	CLTCL1_ENST00000427926.1_Splice_Site_p.Q265L|CLTCL1_ENST00000353891.5_Splice_Site_p.Q265L	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	265	Globular terminal domain.|WD40-like repeat 6.				anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					CATTCGTACCTGCATAGCCAC	0.453			T	?	ALCL																																p.Q265L				Dom	yes		22	22q11.21	8218	"""clathrin, heavy polypeptide-like 1"""		L	.	CLTCL1	115	0			c.A794T						.						159.0	161.0	160.0					22																	19226799		1956	4150	6106	SO:0001630	splice_region_variant	8218	exon5			CGTACCTGCATAG		CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.795+1A>T	22.37:g.19226799T>A		54	0		55	4	NM_001835	B7Z7U5|Q14017|Q15808|Q15809	Missense_Mutation	SNP	ENST00000263200.10	37	CCDS46662.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.427494	0.83667	.	.	ENSG00000070371	ENST00000353891;ENST00000263200;ENST00000427926	T;T;T	0.23348	1.91;1.91;1.91	3.91	3.91	0.45181	Clathrin, heavy chain, propeller, N-terminal (1);Clathrin, heavy chain, linker/propeller domain (1);	0.000000	0.64402	D	0.000002	T	0.52533	0.1740	M	0.86268	2.805	0.80722	D	1	D;P	0.71674	0.998;0.715	D;P	0.71870	0.975;0.707	T	0.60722	-0.7207	10	0.62326	D	0.03	-14.1056	12.9043	0.58143	0.0:0.0:0.0:1.0	.	265;265	P53675-2;P53675	.;CLH2_HUMAN	L	265	ENSP00000439662:Q265L;ENSP00000445677:Q265L;ENSP00000441158:Q265L	ENSP00000445677:Q265L	Q	-	2	0	CLTCL1	17606799	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	6.915000	0.75770	1.626000	0.50381	0.482000	0.46254	CAG	.		0.453	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316397.5	NM_007098	Missense_Mutation
DMD	1756	bcgsc.ca	37	X	32519901	32519901	+	Missense_Mutation	SNP	G	G	T	rs1800260		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chrX:32519901G>T	ENST00000357033.4	-	19	2557	c.2351C>A	c.(2350-2352)gCt>gAt	p.A784D	DMD_ENST00000378677.2_Missense_Mutation_p.A780D	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	784			A -> G (in dbSNP:rs1800260). {ECO:0000269|PubMed:2668885}.		cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CAGGGCCTGAGCTGATCTGCT	0.408																																					p.A784D													.	DMD	2127	0			c.C2351A						.						101.0	82.0	88.0					X																	32519901		2202	4300	6502	SO:0001583	missense	1756	exon19			GCCTGAGCTGATC	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.2351C>A	X.37:g.32519901G>T	ENSP00000354923:p.Ala784Asp	26	0		24	3	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.367915	0.82463	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.57907	0.37;0.37	5.35	5.35	0.76521	.	0.000000	0.34725	U	0.003721	T	0.66934	0.2840	M	0.63428	1.95	0.80722	D	1	D;B;D	0.56746	0.971;0.285;0.977	P;B;P	0.57057	0.714;0.171;0.812	T	0.70730	-0.4792	10	0.72032	D	0.01	.	18.2209	0.89901	0.0:0.0:1.0:0.0	.	776;784;780	P11532-4;P11532;E9PDN5	.;DMD_HUMAN;.	D	776;780;784;784;661	ENSP00000367948:A780D;ENSP00000354923:A784D	ENSP00000354923:A784D	A	-	2	0	DMD	32429822	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.830000	0.69324	2.241000	0.73720	0.544000	0.68410	GCT	G|1.000;|0.000		0.408	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
TRPC5	7224	bcgsc.ca	37	X	111155896	111155896	+	Missense_Mutation	SNP	G	G	T			TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chrX:111155896G>T	ENST00000262839.2	-	3	1441	c.523C>A	c.(523-525)Cgc>Agc	p.R175S		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	175					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						CAGTTGCAGCGGATCTGGTGG	0.542																																					p.R175S													.	TRPC5	142	0			c.C523A						.						111.0	98.0	102.0					X																	111155896		2203	4300	6503	SO:0001583	missense	7224	exon3			TGCAGCGGATCTG	AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.523C>A	X.37:g.111155896G>T	ENSP00000262839:p.Arg175Ser	22	0		14	3	NM_012471	B2RP53|O75233|Q5JXY8|Q9Y514	Missense_Mutation	SNP	ENST00000262839.2	37	CCDS14561.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.073284	0.76415	.	.	ENSG00000072315	ENST00000262839	T	0.69561	-0.41	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.72653	0.3487	L	0.35723	1.085	0.80722	D	1	D;D	0.76494	0.966;0.999	P;D	0.68765	0.838;0.96	T	0.71800	-0.4483	10	0.38643	T	0.18	-16.5029	14.0073	0.64473	0.0:0.0:0.8391:0.1609	.	176;175	Q59G51;Q9UL62	.;TRPC5_HUMAN	S	175	ENSP00000262839:R175S	ENSP00000262839:R175S	R	-	1	0	TRPC5	111042552	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.664000	0.83830	2.260000	0.74910	0.529000	0.55759	CGC	.		0.542	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057945.1	NM_012471	
ERBB2	2064	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	37880219	37880220	+	Missense_Mutation	DNP	TT	TT	CC	rs121913470|rs121913469		TCGA-4G-AAZO-01A-12D-A417-09	TCGA-4G-AAZO-11A-11D-A41A-09	TT	TT	.	.	.	.	Unknown	Untested	Somatic	.	WXS	none	.		Illumina HiSeq	9aa164bc-bd5d-43fc-b0df-49a1eb05c6ab	48de3d5a-35d8-456d-a23e-e2dc25a840ac	g.chr17:37880219_37880220TT>CC	ENST00000269571.5	+	19	2422_2423	c.2263_2264TT>CC	c.(2263-2265)TTg>CCg	p.L755P	ERBB2_ENST00000584601.1_Missense_Mutation_p.L725P|ERBB2_ENST00000540147.1_Missense_Mutation_p.L725P|ERBB2_ENST00000541774.1_Missense_Mutation_p.L740P|ERBB2_ENST00000584450.1_Missense_Mutation_p.L755P|ERBB2_ENST00000406381.2_Missense_Mutation_p.L725P|MIR4728_ENST00000580969.1_RNA|ERBB2_ENST00000445658.2_Missense_Mutation_p.L479P			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	755	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		L -> P (in a lung adenocarcinoma sample; somatic mutation). {ECO:0000269|PubMed:15457249}.		axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)	p.L755S(10)|p.L755P(2)|p.L755_S760>A(1)		NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	CATCAAAGTGTTGAGGGAAAAC	0.53	L755S(LN229_CENTRAL_NERVOUS_SYSTEM)	1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																											p.L755P		.		Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	ERBB2,NS,carcinoma,0,20	ERBB2	0	13	Substitution - Missense(12)|Complex - insertion inframe(1)	breast(7)|lung(3)|stomach(2)|large_intestine(1)	c.T2264C						.																																			SO:0001583	missense	2064	exon19			AAGTGTTGAGGGA	X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		Exception_encountered	17.37:g.37880219_37880220delinsCC	ENSP00000269571:p.Leu755Pro	26	0		24	10	NM_004448	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	DNP	ENST00000269571.5	37	CCDS32642.1																																																																																			.		0.530	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2		
